8,088 Matching Annotations
  1. Mar 2023
    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      We thank the reviewers for their enthusiasm for our work and constructive feedback.

      Below please find our point-by-point response to the comments:

      Reviewer #1 -Key conclusions that were less convincing: -RhoA and NMII are in the title as mechanistic downstream regulators of CaM, but the results in Fig 8 call into question the role of RhoA. Why does RhoA activation not influence cell size and circularity? Can you overexpress MRLC-GFP and inhibit Rho and restore the wt phenotype? The role of NMII is also not clear - why does overexpressing MLCK-CA not have a phenotype but overexpressing MLCK downstream target MRLC show the phenotype? Are there any alternative pathways to regulate MRLC? It's not being discussed or described in 6D's schematic.

      Response: Rho activation usually leads to the formation of more stress fibers and therefore does not lead to decreased cell size and increased circularity observed in MFN2 KO. The phenotype is restored by either ROCK or MLCK knockdown. We have discussed in the main text that the formation of PAB requires both RhoA and NMII activation under restricted spatiotemporal control.

      MRLC has three major regulators (Ikebe & Hartshorne, 1985; Isotani et al., 2004). As we discussed, MLCK and ROCK phosphorylate MRLC at either Ser19 or Ser19 and Thr18. MRLC is dephosphorylated and inactivated by its phosphatase MLCP. We tried to knock down MLCP in wt MEF cells but failed to see any cell morphology changes (data not shown).

      We were also surprised to see MRLC-GFP overexpression with Rho Activator can phenocopy PAB, but “MLCK-CA + Rho Activator” failed to. We believe it is because MLCK-CA constitutively over-activates a broad range of downstream effectors while overexpressing MRLC mimics endogenous activation or NMII alone. Also, only a proportion of cells acquired PAB structure under Rho Activator and MRLC overexpression, which indicates PAB formation also requires specific spatiotemporal controls.

      *Rewrite for clarity -The role of ER/mito contacts in the system was unclear (since ER/mito contacts were not observed nor evaluated directly). *

      __Response: __We have included additional data to measure ER/mito contacts in MEFs. Our result is consistent with numerous previous reports that MFN2 regulates ER/mito contacts. The data is now included in Fig. S3.

      * -What role does focal adhesions have on PAB formation or any part of the model - There were results showing larger focal adhesions in the MFN2-/- cells, but not sure how this fits in with the bigger picture of contractility and PABs, and focal adhesions were not in the model in Figure 5.*

      __Response: __Focal adhesion and actomyosin are tightly coupled, and our work focuses on the actin network. Our model did not include FAs since FA is not a significant focus in this study.

      * -Whether regulating calcium impacts PAB formation*

      __Response: __Calcium likely regulates PAB formation. We have shown PAB cell percentage decreases in mfn2-/- with ER-mito tethering contrast in Fig. S3.

      -The role of PABs in migration is also unclear - can you affect PAB formation or get rid of PABs and quantify cell migration?

      __Response: __Our data suggest that PAB formation and cell migration are inversely correlated. Since PAB results from a contractile actin band on the cell periphery, its role in defective cell spreading and migration is expected. We demonstrated that MLCK and ROCK knockdown reduced PABs and rescued cell spreading.

      -It was hard to understand the correlation between the membrane tension of MFN2-/- cells and their ability to spread on softer substrates. How does this result fit in with the overarching model?

      __Response: __Reduced membrane tension is presumably associated with decreased cell spreading. Softer substrates attenuate the mechanical force on focal adhesion proteins and the actin cytoskeleton (Burridge & Chrzanowska-Wodnicka, 2003; Pelham & Wang, 1997; Wong et al., 2015), which is required for focal adhesion maturation. As a result, softer substrates can reduce the over-contraction in the MFN2 KO cells. The results support the model that MFN2 KO cells have enhanced cell contraction on the substrates dependent on substrate interaction and force transduction on focal adhesions. Should the authors qualify some of their claims as preliminary or speculative, or remove them altogether?

      __Response: __We have removed the MFN2-related disease from the introduction to focus the paper more on cell biology in vitro.

      *-There were a number of findings that did not seem to fit in with the paper, or they were included, but were not robustly described nor quantified. As an example, Paxillin-positive focal adhesions were evaluated in MFN2-/- and with various pharmacological approaches, but there is no quantification with respect to size, number, or distribution of focal adhesions, despite language in the main text that there are differences between conditions. *

      __Response: __We have quantified the focal adhesions in the KO cells, and the data is now included in Fig. 5. We used the actin distribution to quantify the “PAB”; therefore, FAs are not a significant focus of this study.

      *Also, the model was presented in figure 5, and then there were several pieces of data presented afterward, some that are included in the model (myosin regulation), and some that are not in the model (membrane tension, TFM, substrate stiffness, etc). * __Response: __Membrane tension and substrate stiffness dependence are physical properties of the cell. The model focuses on the molecular mechanism that leads to PAB formation.

      The stiffness/tension figure was not clear to me, and it was difficult to make sense of the data since one would predict that an increase in actomyosin contractility at the cortex would lead to higher membrane tension, not lower, and then how membrane tension relates to spreading on soft matrices is also unclear.

      __Response: __The result was surprising to us initially. However, the MFN2 KO cells have increased actomyosin contractility only at the cell-substrate interface but not throughout the entire cell cortex. A less spread cell would have a more relaxed membrane and display a lower membrane tension, consistent with our observation. Softer matrices reduce cell contractility at the cell-substrate interface, which allows MFN2 KO cells to relax and spread better. We have emphasized in the discussion of our manuscript that MFN2 KO cells have an increase in actomyosin contractility only at the cell-substrate interface.

      The manuscript seems like an amalgamation of different pieces of data that do not necessarily fit together into a cohesive story, so the authors are encouraged to either remove these data, or shore them up and weave them into the narrative.

      __Response: __We respectfully disagree with the reviewer since the cell morphology, actin structure, substrate interaction, and cell mechanics are tightly correlative and provide a complete picture of the role of MFN2 in regulating cell behavior.

      * Request additional experiments 1. -The imaging used for a lot of the quantification (migration, circularity) is difficult to resolve. The cells often look like they are not imaged in the correct imaging plane. It would be helpful to have better representative images such that it is clear how the cells were tracked and how cell periphery regions of interest were manually drawn. Focal adhesions should also be shown without thresholding.*

      __Response: __We used a TIRF microscope and imaged a Z stack. Imaris was used to combine the Z-stack images. The images in the manuscripts are now of the lowest stack with background subtraction.

      2. -For most of the quantification, it appears that the experiment was only performed once and that a handful of cells were quantified. The figure legend indicates the number of cells (often reported as >12 cells or >25 cells), but the methods indicate that high content imaging was performed, and so the interpretation is that these experiments were only performed once. Biological replicates are required. If the data do represent at least 3 biological replicates, then more cell quantification is required (12 or 25 cells in total would mean quantifying a small number of cells per replicate).

      Response: __We quantified more cells and indicated the number of cells quantified in the figure legends. The experiments are with three biological replicates.__

      * 3. -Mitochondrial morphology and quantification should be performed in the MFN2 knockdown and rescue lines.*

      __Response: __Mitochondrial morphology is well characterized in the Mfn2 KO and rescue MEF cells (Chen et al., 2003; Naon et al., 2016; Samanas et al., 2020). We observed a similar phenotype using mito-RFP to label mitochondrial structure (Fig. S1).

      4.-Many of the comparisons throughout the figures is between MFN2 knockdown and MFN2 knockdown plus rescue or genetic/pharmacological approaches, but a comparison that is rarely made is between wildtype and experimental. These comparisons could be useful in comparing partial rescues and potential redundancies with the other mitofusin.

      Response: We have included the WT in our assays (Fig. 2-6). We also confirmed that MFN1 could not rescue the MFN2 defects (Fig. 2). We observed partial and complete rescue in different assays. It would be difficult to conclude whether the phenotype is due to the redundancies with the other mitofusin because not all cells are rescued at the endogenous level.

      * 5. -For the mito/ER tethering experiments, it is important to show that ER/mito contacts are formed and not formed in the various conditions with imaging approaches.*

      __Response: __We adopted a previously established method to quantify ER-mitochondria contacts with the probe SPLICSL (Cieri et al., 2017; Vallese et al., 2020). Our results align with previous reports that Mfn2-null MEFs displayed significantly decreased ER-mitochondria contacts. MFN2 re-expression or ER-mitochondria tethering structure restored the contacts. (Fig. S3).

      * 6. -For some of the pharmacological perturbations, it would be helpful to show that the perturbation actually led to the expected phenotype - as an example, in cells treated with different concentrations of A23187, what are the intracellular calcium levels and how do these treatments influence PAB formation? This aspect should be generally applied across the study - when a modification is made, that particular phenotype should first be evaluated, before dissecting how the perturbation affects downstream phenotypes.*

      __Response: __We selected a collection of well-characterized inhibitors broadly used in the literature for pharmacological perturbations. For example, numerous studies used A23187 treatment to raise intracellular calcium to examine related actin cytoskeleton changes (Carson et al., 1994; Goldfine et al., 1981; Shao et al., 2015). We titrated the drugs in WT in preliminary experiments and observed similar phenotypes. (data not shown). We then use the same concentration to treat the MFN2 KO cells. Overall, we use pharmacological perturbations as supporting evidence. We use genetics (knockdown or overexpression) to validate our results.

      7. -In Figures 4 and 5, the thresholding approaches in the images make the focal adhesions difficult to resolve, and therefore it is difficult to determine the size. As described above, these metrics should be defined and quantified.

      __Response: __We used a TIRF microscope and imaged a Z stack. Imaris was used to combine the Z-stack images. The images in the manuscripts are now of the lowest stack with background subtraction.

      8. -What is a PAB? How is it defined? What metrics make a structure a PAB versus regular cortical actin - are there quantifiable metrics? In figure 8, there are some structures that are labelled as a PAB, but some aren't (as an example, the left panel in 8b is a PAB, but the right panel in 8A is not, but they look the same), so a PAB should be defined with quantifiable measures, and then applied to the entire study.

      __Response: __We developed an algorism to quantify PAB cells. We first used the ImageJ plugin FiloQuant (Jacquemet et al., 2019) to identify the cell border and cytoskeleton, then used our custom algorism to quantify the percentage of actin in the cell border area. The cellular circularity is also calculated at the same time. If the cell contains more than 50% actin in the cell border area, and the circularity is higher than 0.6, we then count it as a “PAB” cell (Fig. S2).

      -As described above, why does RhoA activation not influence cell size and circularity? Can you overexpress MRLC-GFP and inhibit Rho and restore the wildtype phenotype?

      __Response: __Rho activation usually leads to the formation of more stress fibers and therefore does not lead to decreased cell size and increased circularity observed in MFN2 KO.

      We are sorry that we don’t understand the rationale of this experiment proposed by the reviewer. ROCK inhibition restored the wildtype phenotype in MFN2 KO cells (Fig.7). Figure 8 is to create the MFN2 KO phenotype in WT cells, which requires both Rho and MRLC overactivation.

      * 10 Are the data and the methods presented in such a way that they can be reproduced? -We appreciate that the authors quantified many parameters, although some quantifications were missing. There are some missing methods - how was directionality quantified, was migration quantified by selecting the approximate center of cells using MTrackJ or were centroids quantified by outlining cells, for instance. Also, given that some of the phenotypes were somewhat arbitrarily assigned (ie. what constitutes a PAB?), it may be difficult to reproduce these approaches and interpret data appropriately.*

      __Response: __We have clarified directionality quantification methods and other details. We used MTrackJ to track cell migration. And as we mentioned above, we came up with a customized algorithm to quantify PAB cells, which shows the critical effectors in a more quantifiable way.

      * 11. Are the experiments adequately replicated and statistical analysis adequate? -Unfortunately, while the approximate number of cells was reported, the number of biological replicates were not reported, and therefore, the experimental information and statistical analyses are not adequate.*

      __Response: __We have quantified more cells and indicated the number of repeats and cells quantified in the figure legend. Minor comments: Specific experimental issues that are easily addressable.

      * 12. - for some of the graphs - mostly about calcium levels - fold change is shown, but raw values should also be included to determine whether the basal levels of calcium are different across the conditions.*

      __Response: __Delta F/F0 is the standard method to normalize dye loading in cells for calcium concentration measurements (Kijlstra et al., 2015; Zhou et al., 2021).

      13. - scale bars in every panel should also help make the points clearer.

      __Response: __We have added scale bars in all panels.

      * Reviewer #2 (Evidence, reproducibility and clarity (Required)): 1. Fig. 1A: The Mfn1 Western Blot is not of publication quality. Moreover, quantitation is necessary.*

      __Response: __We performed additional western blots, changed the representative images, and quantified the level of knockdown and overexpression (Fig.2 and 7). We did not quantify the WB in Fig.1A since it was to confirm that the Mfn1-/- or Mfn2-/- were knock-out cell lines.

      2. Fig. 1B (as well as Fig. 2G and others): the date do not reflect cellular size but instead spread cellular area.

      __Response: __We thank the reviewer for this suggestion. We have changed all similar descriptions to “Spread Area” in the main text and figures.

      3. Fig. 1C, D: Mfn1-null MEFs appear to be more spindle-shaped than wt cells, yet their circularity tends to be elevated. Do the authors have an explanation?

      __Response: __The circularity of Mfn1-/- MEFs has a slight increase but is not significant compared to the wt cells. As we observed, Mfn1-/- MEFs have fewer protrusions than wt, which may contribute to the slight increase in its circularity (Fig. 5C). However, this is not the focus of this study.

      * 4. Fig. 2A: The Mfn1 levels in Mfn2-/- + Mfn2 are lower than Mfn2-/-? Does this imply a crosstalk between Mfn1 and Mfn2 expression.*

      __Response: __We agree with the reviewer that a compensatory change in MFN1 expression might happen in Mfn2-/- + MFN2 MEFs. Previous research also indicated crosstalk between MFN1 and MFN2 expression (Sidarala et al., 2022).

      * 5. Fig. 2H: The authors should provide co-staining of mitochondria and Mfn2 as well.*

      __Response: __Co-staining of mitochondria and MFN2 in Mfn2-/- MEFs or rescue lines has been done in numerous previous studies (Chen et al., 2003; Naon et al., 2016; Samanas et al., 2020). In this work, we transfected our cells with mito-RFP and showed mitochondria changes in Mfn2-/- and rescue MEF cells (Fig. S1G).

      6. Fig. 4D-E: Western blots are not of publication quality. Looking at the blots provided in Fig. 4D, the reviewer is not convinced with the quantitative data shown in Fig. 4E. For instance, the intensity of pCaMKII band for "vec" does not look 3x higher than that of "+MFN2", whereas that of "+MFN2" looks much higher than that of WT.

      __Response: __We have performed additional western blots and changed the representative images.

      * 7. Fig. 5C: The authors should stain for vinculin, which are present in mature FAs only, rather than paxillin which are present in all FAs. This would strengthen the authors' conclusions. Also, FA size should be quantified.*

      __Response: __We have quantified FA size in Figure 5. The maturity of FAs is not a major focus of this study. It is likely that most FAs here are mature since they are connected with stress fibers.

      * 8. Fig. 6C - Why does the background have a grid and appear grey in color? Also, the cell interior appears in different colors in the different images. The authors should take a z-stack of images and provide the raw image files.*

      __Response: __We used a TIRF microscope and imaged a Z stack. Imaris was used to combine the Z-stack images. The images in the manuscripts are now of the lowest stack with background subtraction.

      9. Fig 7C: The MLCII Western blot is not of publication quality, and may affect the quantification provided in Fig. 7D.

      __Response: __We have performed additional western blots and changed the representative images.

      * 10. Fig 8: Do cell treatments with Rho Activator and MLCK-CA also impair migration velocity similar to Mfn2-null cells?*

      __Response: __Our data indicated that Rho Activator and MRLC induced the “PAB” structure seen in MFN2 KO cells. It is likely that cell migration is impaired here. Spatiotemporal regulation of Rho Activation is important to cell migration, it is known that Rho overactivation can significantly inhibit cell migration (Nobes & Hall, 1999). Showing Rho Activator and MLCK-CA will reduce cell migration will not add new knowledge to the cell migration field. However not all cell migration defects are associated with the PAB. We, therefore, focused on PAB quantification in this figure.

      11. Fig. 9A: The authors claim that wt cells have actin bundles that protrude against the membrane while Mfn2-null cells do not. This does not look convincing as the Mfn2-null actin bundle seem to be pushing against the membrane at the bottom of the image. No quantification is provided. It is unclear what conclusion can be drawn from the super-resolution images.

      __Response: __We used super-resolution imaging to demonstrate the details of the peripheral actin band (PAB) structure. We have used two boxes to enlarge the regions where membrane parallel actin structures are predominant. The quantification of PAB is provided in other figures.

      12. Suppl. Fig. 5C: The authors should take images using a confocal microscope for cells with Flipper-TR construct, eliminate the background and the cell center to only consider the cell periphery. Nikon TE2000 does not seem to be a confocal microscope.

      Response: __The amount of Flipper-TR that MEF cells can take in was limited. With the current signal-to-noise ratio, complete background elimination is not feasible. A confocal microscope is not necessary for Flipper-TR FLIM imaging (García-Calvo et al., 2022). __* Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      General Comments (Major) 1. Data Presentation and analysis: The data analysis would benefit from using a method such as Super-Plots to show the data from separate biological repeats and to use N numbers that represent the number of biological repeats rather than the number of cells analysed. Please see the following reference for a suggestion on how to analyse the data: Lord SJ, Velle KB, Mullins RD, Fritz-Laylin LK. SuperPlots: Communicating reproducibility and variability in cell biology. J Cell Biol. 2020 Jun 1;219(6):e202001064. doi: 10.1083/jcb.202001064. PMID: 32346721; PMCID: PMC7265319.*

      __Response: __We have changed the dot colors to show data from separate biological repeats.

      • Another general comment is that many of the experiments show analysis of very few numbers of cells or maybe only one field of view in a microscopy quantification experiment. This seems unusually low - for example, in Figure 1E only 6 cells have been analysed. It seems like more could have been done and if statistical analysis like we suggest in 1 above is used, this might reveal that some of the differences are less significant than the authors think/report. This is important, as cells are noisy and it is unusual to have such high significance for experiments like cell migration and other parameters unless a lot of measurements are made. In Figure 1G, it appears that only one field of view has been used to quantify the data. We routinely use 3-5 fields of view to get a representative sample of what the cells are doing.*

      __Response: __We have quantified more cells and indicated the number of repeats and cells quantified in the figure legend.

      • Some of the micrographs appear to be missing scale bars- e.g. Fig. 2H, Fig. 8*

      __Response: __We have included scale bars in the lower right corner of all panels.

      * 4. In the cell tracking experiments, only some of the cells in the images appear to have been tracked. How were the tracked cells chosen? Normally, we would track every cell to avoid bias in selection.*

      __Response: __We tracked all the cells in the view at the beginning of the experiments.

      5. The western blot images do not show the molecular size of the bands. Show ladder position

      __Response: __We have added bands to show molecular weights.

      6. Mostly the graphs show individual data points, which is good, but in some cases only a bar is shown- it would be nice to have individual points overlaid on the bars- e.g. Figure 1I, 4E, 5B, 5E, 7B, 7D

      __Response: __We have updated the graph to show individual points.

      7. Many of the confocal images look very processed- they have no background and have a hazy black halo around the cell. I am not familiar with the type of processing that was done and I worry that the images are only showing a masked and processed version of the actual data. The authors need to explain what processing they have done and probably also to provide the unprocessed images in a supplementary figure or dataset for readers to see. The methods description is inadequate as it only says Image J was used to process the data.

      __Response: __We used a TIRF microscope and imaged a Z stack. Imaris was used to combine the Z-stack images. The images in the manuscripts are now of the lowest stack with background subtraction.

      * Individual comments on Figures: Figure 1: See general comments above- consider to use Superplots, more cells and more fields of view in quantifications. Show experimental points in bar graph.*

      __Response: __We have quantified more cells and used super plots to display the data. The number of repeats and cells quantified are indicated in the figure legend.

      Figure 2: In 2E, the colours are very similar for two of the experiments so it is difficult to distinguish them- e.g. the MFN1 vs MFN2 rescue data both appear dark blue. Response: We have changed the color for MFN1 rescue to distinguish the two samples better.

      In 2H are the magnifications really the same for the WT as the +DOX and -DOX? The cell in the WT looks huge. Is this representative? Also, the phalloidin stain looks very spotty on the WT. This seems unusual.

      __Response: __The images are of the same scale. The Mfn2-/- MEFs are smaller, and DOX-induced MFN2 expression can only partially rescue the cell size.

      * Figure 3: Not many cells were analysed in 3B, especially the zero time point.*

      __Response: __We have quantified more cells.

      * Please define +T, we assume it is the tether construct, but it is not defined*

      __Response: __We defined T as a tether in the main text and the figure legend. In 3F, how were the tracked cells chosen?

      __Response: __We tracked all the cells in the view at the beginning of the experiments.

      * Figure 4:* 4B: Why have they not tested FK506 and STO609 on the WT cells?

      __Response: __We focused on understanding the MFN2 KO phenotype. Since neither FK506 nor STO609 altered the MFN2 KO phenotype, we did not include them in the WT group.

      4C: How were the tracked cells chosen?

      __Response: __We tracked all the cells in the view at the start of the experiments.

      4D-E: The blot doesn't look representative of the quantification- were the numbers normalised to vinculin? The difference between WT and vector looks too large to be real if the amounts were normalised to the vinculin, as vinculin is increased in vector. Likewise, the pCAMKII looks to be substantially decreased from the +MFN2, but this is not what the quantification shows.

      __Response: __We have performed additional western blots and changed the representative images.

      Figure 5: 5B- please clarify which ratio is shown here. I assume it is the ratio of RhoA-GTP vs RhoA between the zero and 4 minute time points.

      __Response: __Yes, we have clarified this point in the figure legend.

      5C- These images appear to have a mask around the cell. It is hard to tell where the edge of the cell really is- what sort of processing was used? Especially for the paxillin staining, why is there no cytoplasm shown? Is this because the image is in TIRF?

      __Response: __We used a TIRF microscope and imaged a Z stack. Imaris was used to combine the Z-stack images. The images in the manuscripts are now of the lowest stack with background subtraction.

      Figure 6: Figure 6C- the blebbistatin treated cell looks very large- is this representative?

      __Response: __Yes, Blebbistatin-treated cells are larger (Fig. 6A).

      Figure 7: Fig 7C- The lanes for MLCII are all run together- is this from a different gel? Is this quantification accurate?

      __Response: __We have performed additional western blots and changed the representative images.

      Fig. 7F- What is the % level of knockdown achieved?

      __Response: __The level of knockdown is labeled on the figure.

      Figure 8: Fig 8A,B- does the scale bar represent all of the images in these two panels?

      __Response: __Yes, the figure legend is updated to clarify this point.

      Fig 8C,D- Superplots would be helpful here.

      __Response: __We have used super plots to display the data.

      Supplementary Data: The OCR data do not add much and are not discussed much in the manuscript. Perhaps they could be omitted.

      __Response: __Our OCR data ruled out the possibility of metabolic regulation. Since MFN2 is a mitochondria protein with its typical functions in metabolic pathways, we cannot omit its influence on metabolism here. As we observed, shMLCK enhanced OCR, shROCK reduced OCR, and both knock-down rescued cell morphology and motility. We believe that PAB formation is independent of MFN2’s function in metabolic regulation.

      Figure S3- The figure label doesn't match the manuscript test- was fibrinogen or collagen used?

      __Response: __We tried cover glass alone, collagen, and fibronectin-coated glass. The PAB formation is independent of these extracellular substrates. We did not try fibrinogen because MEF cell is reported to prefer fibronectin (Lehtimäki et al., 2021).

      Reference

      Burridge, K., & Chrzanowska-Wodnicka, M. (2003). FOCAL ADHESIONS, CONTRACTILITY, AND SIGNALING. Http://Dx.Doi.Org/10.1146/Annurev.Cellbio.12.1.463, 12, 463–519. https://doi.org/10.1146/ANNUREV.CELLBIO.12.1.463

      Carson, S. D., Perry, G. A., & Pirruccello, S. J. (1994). Fibroblast Tissue Factor: Calcium and Ionophore Induce Shape Changes, Release of Membrane Vesicles, and Redistribution of Tissue Factor Antigen in Addition to Increased Procoagulant Activity. Blood, 84(2), 526–534. https://doi.org/10.1182/BLOOD.V84.2.526.526

      Chen, H., Detmer, S. A., Ewald, A. J., Griffin, E. E., Fraser, S. E., & Chan, D. C. (2003). Mitofusins Mfn1 and Mfn2 coordinately regulate mitochondrial fusion and are essential for embryonic development. The Journal of Cell Biology, 160(2), 189. https://doi.org/10.1083/JCB.200211046

      Cieri, D., Vicario, M., Giacomello, M., Vallese, F., Filadi, R., Wagner, T., Pozzan, T., Pizzo, P., Scorrano, L., Brini, M., & Calì, T. (2017). SPLICS: a split green fluorescent protein-based contact site sensor for narrow and wide heterotypic organelle juxtaposition. Cell Death & Differentiation 2018 25:6, 25(6), 1131–1145. https://doi.org/10.1038/s41418-017-0033-z

      García-Calvo, J., López-Andarias, J., Maillard, J., Mercier, V., Roffay, C., Roux, A., Fürstenberg, A., Sakai, N., & Matile, S. (2022). HydroFlipper membrane tension probes: imaging membrane hydration and mechanical compression simultaneously in living cells. Chemical Science, 13(7), 2086–2093. https://doi.org/10.1039/D1SC05208J

      Goldfine, S. M., Schroter, E. H., & Izzard, C. S. (1981). Calcium-dependent shortening of fibroblasts induced by the ionophore, A23187. Journal of Cell Science, 50(1), 391–405. https://doi.org/10.1242/JCS.50.1.391

      Ikebe, M., & Hartshorne, D. J. (1985). Phosphorylation of Smooth Muscle Myosin at Two Distinct Sites by Myosin Light Chain Kinase*. Journal of Biological Chemistry, 260, 10027–10031. https://doi.org/10.1016/S0021-9258(17)39206-2

      Isotani, E., Zhi, G., Lau, K. S., Huang, J., Mizuno, Y., Persechini, A., Geguchadze, R., Kamm, K. E., & Stull, J. T. (2004). Real-time evaluation of myosin light chain kinase activation in smooth muscle tissues from a transgenic calmodulin-biosensor mouse. Proceedings of the National Academy of Sciences of the United States of America, 101(16), 6279–6284. https://doi.org/10.1073/PNAS.0308742101

      Kijlstra, J. D., Hu, D., Mittal, N., Kausel, E., van der Meer, P., Garakani, A., & Domian, I. J. (2015). Integrated Analysis of Contractile Kinetics, Force Generation, and Electrical Activity in Single Human Stem Cell-Derived Cardiomyocytes. Stem Cell Reports, 5(6), 1226. https://doi.org/10.1016/J.STEMCR.2015.10.017

      Lehtimäki, J. I., Rajakylä, E. K., Tojkander, S., & Lappalainen, P. (2021). Generation of stress fibers through myosin-driven reorganization of the actin cortex. ELife, 10, 1–43. https://doi.org/10.7554/ELIFE.60710

      Naon, D., Zaninello, M., Giacomello, M., Varanita, T., Grespi, F., Lakshminaranayan, S., Serafini, A., Semenzato, M., Herkenne, S., Hernández-Alvarez, M. I., Zorzano, A., De Stefani, D., Dorn, G. W., & Scorrano, L. (2016). Critical reappraisal confirms that Mitofusin 2 is an endoplasmic reticulum-mitochondria tether. Proceedings of the National Academy of Sciences of the United States of America, 113(40), 11249–11254. https://doi.org/10.1073/PNAS.1606786113/SUPPL_FILE/PNAS.201606786SI.PDF

      Nobes, C. D., & Hall, A. (1999). Rho GTPases Control Polarity, Protrusion, and Adhesion during Cell Movement. The Journal of Cell Biology, 144(6), 1235. https://doi.org/10.1083/JCB.144.6.1235

      Pelham, R. J., & Wang, Y. L. (1997). Cell locomotion and focal adhesions are regulated by substrate flexibility. Proceedings of the National Academy of Sciences of the United States of America, 94(25), 13661. https://doi.org/10.1073/PNAS.94.25.13661

      Samanas, N. B., Engelhart, E. A., & Hoppins, S. (2020). Defective nucleotide-dependent assembly and membrane fusion in Mfn2 CMT2A variants improved by Bax. Life Science Alliance, 3(5). https://doi.org/10.26508/LSA.201900527

      Shao, X., Li, Q., Mogilner, A., Bershadsky, A. D., & Shivashankar, G. V. (2015). Mechanical stimulation induces formin-dependent assembly of a perinuclear actin rim. Proceedings of the National Academy of Sciences of the United States of America, 112(20), E2595–E2601. https://doi.org/10.1073/PNAS.1504837112/SUPPL_FILE/PNAS.1504837112.SM03.AVI

      Sidarala, V., Zhu, J., Levi-D’Ancona, E., Pearson, G. L., Reck, E. C., Walker, E. M., Kaufman, B. A., & Soleimanpour, S. A. (2022). Mitofusin 1 and 2 regulation of mitochondrial DNA content is a critical determinant of glucose homeostasis. Nature Communications 2022 13:1, 13(1), 1–16. https://doi.org/10.1038/s41467-022-29945-7

      Vallese, F., Catoni, C., Cieri, D., Barazzuol, L., Ramirez, O., Calore, V., Bonora, M., Giamogante, F., Pinton, P., Brini, M., & Calì, T. (2020). An expanded palette of improved SPLICS reporters detects multiple organelle contacts in vitro and in vivo. Nature Communications, 11(1). https://doi.org/10.1038/S41467-020-19892-6

      Wong, S. Y., Ulrich, T. A., Deleyrolle, L. P., MacKay, J. L., Lin, J. M. G., Martuscello, R. T., Jundi, M. A., Reynolds, B. A., & Kumar, S. (2015). Constitutive activation of myosin-dependent contractility sensitizes glioma tumor-initiating cells to mechanical inputs and reduces tissue invasion. Cancer Research, 75(6), 1113–1122. https://doi.org/10.1158/0008-5472.CAN-13-3426

      Zhou, W., Hsu, A. Y., Wang, Y., Syahirah, R., Wang, T., Jeffries, J., Wang, X., Mohammad, H., Seleem, M. N., Umulis, D., & Deng, Q. (2021). Mitofusin 2 regulates neutrophil adhesive migration and the actin cytoskeleton. Journal of Cell Science, 133(17). https://doi.org/10.1242/JCS.248880/VIDEO-11

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      This study explores the importance of MFN2, a known endoplasmic reticulum-mitochondria linker protein, in cell motility and actin-myosin organization. It is known that the mitofusin proteins MFN1 and MFN2 can tether the mitochondria to the ER and are connected with calcium regulation in muscle and non-muscle cell types. Calcium flux mediated by mitofusins has previously been implicated in apoptosis and ER stress. In this study, the authors show that loss or depletion of MFN2 (but not MFN1) can lead to aberrant calcium increase in the cytoplasm and trigger actin-myosin reorganisation. They show that the actin and myosin changes are linked with activation of RhoA and also that they can be suppressed by inhibiting myosin light chain phosphorylation/ activation. They also show that cells with reduced MFN2 are softer (using atomic force microscopy), which agrees with activation of RhoA and contractility. If cells are plated on softer substrata, it partially compensates for the over-activation of RhoA.

      In many places, the data support the claims made, but in several places the experiments could be made more convincing or be more clearly presented. Some of the experiments appear to have been repeated only 1-2 times and very few cells or fields of view have been analysed.

      General Comments (Major)

      1. Data Presentation and analysis: The data analysis would benefit from using a method such as Super-Plots to show the data from separate biological repeats and to use N numbers that represent the number of biological repeats rather than the number of cells analysed. Please see the following reference for a suggestion on how to analyse the data: Lord SJ, Velle KB, Mullins RD, Fritz-Laylin LK. SuperPlots: Communicating reproducibility and variability in cell biology. J Cell Biol. 2020 Jun 1;219(6):e202001064. doi: 10.1083/jcb.202001064. PMID: 32346721; PMCID: PMC7265319.
      2. Another general comment is that many of the experiments show analysis of very few numbers of cells or maybe only one field of view in a microscopy quantification experiment. This seems unusually low - for example, in Figure 1E only 6 cells have been analysed. It seems like more could have been done and if statistical analysis like we suggest in 1 above is used, this might reveal that some of the differences are less significant than the authors think/report. This is important, as cells are noisy and it is unusual to have such high significance for experiments like cell migration and other parameters unless a lot of measurements are made. In Figure 1G, it appears that only one field of view has been used to quantify the data. We routinely use 3-5 fields of view to get a representative sample of what the cells are doing.
      3. Some of the micrographs appear to be missing scale bars- e.g. Fig. 2H, Fig. 8
      4. In the cell tracking experiments, only some of the cells in the images appear to have been tracked. How were the tracked cells chosen? Normally, we would track every cell to avoid bias in selection.
      5. The western blot images do not show the molecular size of the bands.
      6. Mostly the graphs show individual data points, which is good, but in some cases only a bar is shown- it would be nice to have individual points overlaid on the bars- e.g. Figure 1I, 4E, 5B, 5E, 7B, 7D
      7. Many of the confocal images look very processed- they have no background and have a hazy black halo around the cell. I am not familiar with the type of processing that was done and I worry that the images are only showing a masked and processed version of the actual data. The authors need to explain what processing they have done and probably also to provide the unprocessed images in a supplementary figure or dataset for readers to see. The methods description is inadequate as it only says Image J was used to process the data.

      Individual comments on Figures:

      Figure 1: See general comments above- consider to use Superplots, more cells and more fields of view in quantifications. Show experimental points in bar graph.

      Figure 2: In 2E, the colours are very similar for two of the experiments so it is difficult to distinguish them- e.g. the MFN1 vs MFN2 rescue data both appear dark blue. In 2H are the magnifications really the same for the WT as the +DOX and -DOX? The cell in the WT looks huge. Is this representative? Also, the phalloidin stain looks very spotty on the WT. This seems unusual.

      Figure 3: Not many cells were analysed in 3B, especially the zero time point. Please define +T, we assume it is the tether construct, but it is not defined In 3F, how were the tracked cells chosen?

      Figure 4: 4B: Why have they not tested FK506 and STO609 on the WT cells? 4C: How were the tracked cells chosen? 4D-E: The blot doesn't look representative of the quantification- were the numbers normalised to vinculin? The difference between WT and vector looks too large to be real if the amounts were normalised to the vinculin, as vinculin is increased in vector. Likewise, the pCAMKII looks to be substantially decreased from the +MFN2, but this is not what the quantification shows.

      Figure 5: 5B- please clarify which ratio is shown here. I assume it is the ratio of RhoA-GTP vs RhoA between the zero and 4 minute time points. 5C- These images appear to have a mask around the cell. It is hard to tell where the edge of the cell really is- what sort of processing was used? Especially for the paxillin staining, why is there no cytoplasm shown? Is this because the image is in TIRF?

      Figure 6: Figure 6C- the blebbistatin treated cell looks very large- is this representative?

      Figure 7: Fig 7C- The lanes for MLCII are all run together- is this from a different gel? Is this quantification accurate? Fig. 7F- What is the % level of knockdown achieved?

      Figure 8: Fig 8A,B- does the scale bar represent all of the images in these two panels? Fig 8C,D- Superplots would be helpful here.

      Supplementary Data:

      The OCR data do not add much and are not discussed much in the manuscript. Perhaps they could be omitted. Figure S3- The figure label doesn't match the manuscript test- was fibrinogen or collagen used?

      Significance

      The main novelty here appears to be the connection between excess cytoplasmic calcium, MFN2 loss and RhoA/myosin activation. This is interesting and a useful addition to the literature. It is unclear what the significance is perhaps, as increased cytoplasmic calcium is likely to cause multiple effects in addition to these. So, this effect may be a side-effect of uncoupling the ER and the mitochondria. Nonetheless, it is important to know about this and it will likely inform future studies on the mitofusins.

      This will be of interest to basic researchers studying mitochondria function and the connections between signaling and mitochondria function.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      In this manuscript, Wang et al. investigate the role of Mitofusin 2 (Mfn2) in MEF morphology and migration. MEFs lacking Mfn2 exhibit a rather circular shape and reduced migratory potential due to increased cytosolic Ca2+, which activates Ca2+/calmodulin-dependent protein kinase II, RhoA and myosin light-chain kinase (MLCK), triggering non-muscle myosin II overactivation and formation of an F-actin ring at the cell periphery. Overall, this is an interesting study. However, additional work is needed for this manuscript to reach publication quality.

      Major Concerns:

      • Several of the Western blots are not of publication quality. This may affect their quantification, and the authors' conclusions.
      • The authors should examine how treatment of wt MEFs with Rho Activator and MLCK-CA affect cell motility (point #10).
      • The reviewer is not convinced that the membrane tension measurements were performed correctly (see point #12 below). The reviewer would expect that the presence of an F-actin ring at the cell periphery would increase the membrane tension, which is opposite to the authors' findings.

      Specific Comments:

      1. Fig. 1A: The Mfn1 Western Blot is not of publication quality. Moreover, quantitation is necessary.
      2. Fig. 1B (as well as Fig. 2G and others): the date do not reflect cellular size but instead spread cellular area.
      3. Fig. 1C, D: Mfn1-null MEFs appear to be more spindle-shaped than wt cells, yet their circularity tends to be elevated. Do the authors have an explanation?
      4. Fig. 2A: The Mfn1 levels in Mfn2-/- + Mfn2 are lower than Mfn2-/-? Does this imply a crosstalk between Mfn1 and Mfn2 expression.
      5. Fig. 2H: The authors should provide co-staining of mitochondria and Mfn2 as well.
      6. Fig. 4D-E: Western blots are not of publication quality. Looking at the blots provided in Fig. 4D, the reviewer is not convinced with the quantitative data shown in Fig. 4E. For instance, the intensity of pCaMKII band for "vec" does not look 3x higher than that of "+MFN2", whereas that of "+MFN2" looks much higher than that of WT.
      7. Fig. 5C: The authors should stain for vinculin, which are present in mature FAs only, rather than paxillin which are present in all FAs. This would strengthen the authors' conclusions. Also, FA size should be quantified.
      8. Fig. 6C - Why does the background have a grid and appear grey in color? Also, the cell interior appears in different colors in the different images. The authors should take a z-stack of images and provide the raw image files.
      9. Fig 7C: The MLCII Western blot is not of publication quality, and may affect the quantification provided in Fig. 7D.
      10. Fig 8: Do cell treatments with Rho Activator and MLCK-CA also impair migration velocity similar to Mfn2-null cells?
      11. Fig. 9A: The authors claim that wt cells have actin bundles that protrude against the membrane while Mfn2-null cells do not. This does not look convincing as the Mfn2-null actin bundle seem to be pushing against the membrane at the bottom of the image. No quantification is provided. It is unclear what conclusion can be drawn from the super-resolution images.
      12. Suppl. Fig. 5C: The authors should take images using a confocal microscope for cells with Flipper-TR construct, eliminate the background and the cell center to only consider the cell periphery. Nikon TE2000 does not seem to be a confocal microscope.

      Significance

      Delineating the role of Mfn2 in cell migration will represent a good, fundamental contribution to the field of cell migration. The reviewer finds this manuscript to be conceptually interesting. Unfortunately, there are technical issues, which need to be fixed so that the readers feel confident about the conclusion of this study.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary:

      Wang et al use a combination of cell biological and biochemical approaches to show that Mitofusin2 (MFN2) - a protein typically known to regulate mitochondrial morphology - regulates cell morphology by regulating calcium levels and downstream cell contractility players. They show that cells deficient in MFN2 exhibit increased intracellular calcium levels, and overactivation of myosin II, leading to increased cell contractility. Furthermore, MFN2-deficient cells exhibit an F-actin ring around the cell periphery (which they call PABs). The study takes advantage of both pharmacological and genetic perturbations, as well a variety of assays to support many of their findings; however, it is unclear how these findings are related to each other. Furthermore, MFN2-related disease was raised a few times in the abstract and throughout the manuscript, but it's unclear how the findings in the paper relate to disease states, both in terms of the cell biology, as well as the model that was used (MEFs). This reviewer applauds the authors for exploring MFN2 function outside of its conventional role in mitochondria; but it was difficult to parse through the findings to resolve a mechanistic explanation for how MFN2 affect cell behavior, and what role, if any, PABs have on biological function. While it is important to dissect mitochondrial-independent functions for MFN2, given the whole scale changes in cells in MFN2-deficient cells, and the fact that there is a metabolic phenotype, it is difficult to know how many of the observed phenotypes are downstream of perturbed mitochondrial function versus on cytoskeletal dynamics directly.

      Major comments:

      Are the key conclusions convincing?

      • Key conclusions that were convincing:
        • MFN2-/- cells exhibit decreased cell velocity, decreased cell size, increased cell circularity, and increased intracellular calcium
        • modifying the levels of calcium has an effect on cell circulariy.
        • MFN2-/- cells exhibit increased activation of contractility players
      • Key conclusions that were less convincing:
        • RhoA and NMII are in the title as mechanistic downstream regulators of CaM, but the results in Fig 8 call into question the role of RhoA. Why does RhoA activation not influence cell size and circularity? Can you overexpress MRLC-GFP and inhibit Rho and restore the wt phenotype? The role of NMII is also not clear - why does overexpressing MLCK-CA not have a phenotype but overexpressing MLCK downstream target MRLC show the phenotype? Are there any alternative pathways to regulate MRLC? It's not being discussed or described in 6D's schematic.
        • The role of ER/mito contacts in the system was unclear (since ER/mito contacts were not observed nor evaluated directly).
        • What role does focal adhesions have on PAB formation or any part of the model - There were results showing larger focal adhesions in the MFN2-/- cells, but not sure how this fits in with the bigger picture of contractility and PABs, and focal adhesions were not in the model in Figure 5.
        • Whether regulating calcium impacts PAB formation
        • The role of PABs in migration is also unclear - can you affect PAB formation or get rid of PABs and quantify cell migration?
        • It was hard to understand the correlation between the membrane tension of MFN2-/- cells and its ability to spread on softer substrates. How does this result fit in with the overarching model?

      Should the authors qualify some of their claims as preliminary or speculative, or remove them altogether?

      • There were a number of findings that did not seem to fit in with the paper, or they were included, but were not robustly described nor quantified. As an example, Paxillin-positive focal adhesions were evaluated in MFN2-/- and with various pharmacological approaches, but there is no quantification with respect to size, number, or distribution of focal adhesions, despite language in the main text that there are differences between conditions. Also, the model was presented in figure 5, and then there were several pieces of data presented afterward, some that are included in the model (myosin regulation), and some that are not in the model (membrane tension, TFM, substrate stiffness, etc). The stiffness/tension figure was not clear to me, and it was difficult to make sense of the data since one would predict that an increase in actomyosin contractility at the cortex would lead to higher membrane tension, not lower, and then how membrane tension relates to spreading on soft matrices is also unclear. The manuscript seems like an amalgamation of different pieces of data that do not necessarily fit together into a cohesive story, so the authors are encouraged to either remove these data, or shore them up and weave them into the narrative.

      Would additional experiments be essential to support the claims of the paper? Request additional experiments only where necessary for the paper as it is, and do not ask authors to open new lines of experimentation.

      • The imaging used for a lot of the quantification (migration, circularity) is difficult to resolve. The cells often look like they are not imaged in the correct imaging plane. It would be helpful to have better representative images such that it is clear how the cells were tracked and how cell periphery regions of interest were manually drawn. Focal adhesions should also be shown without thresholding.
      • For most of the quantification, it appears that the experiment was only performed once and that a handful of cells were quantified. The figure legend indicates the number of cells (often reported as >12 cells or >25 cells), but the methods indicate that high content imaging was performed, and so the interpretation is that these experiments were only performed once. Biological replicates are required. If the data do represent at least 3 biological replicates, then more cell quantification is required (12 or 25 cells in total would mean quantifying a small number of cells per replicate).
      • Mitochondrial morphology and quantification should be performed in the MFN2 knockdown and rescue lines.
      • Many of the comparisons throughout the figures is between MFN2 knockdown and MFN2 knockdown plus rescue or genetic/pharmacological approaches, but a comparison that is rarely made is between wildtype and experimental. These comparisons could be useful in comparing partial rescues and potential redundancies with the other mitofusin.
      • For the mito/ER tethering experiments, it is important to show that ER/mito contacts are formed and not formed in the various conditions with imaging approaches
      • For some of the pharmacological perturbations, it would be helpful to show that the perturbation actually led to the expected phenotype - as an example, in cells treated with different concentrations of A23187, what are the intracellular calcium levels and how do these treatments influence PAB formation? This aspect should be generally applied across the study - when a modification is made, that particular phenotype should first be evaluated, before dissecting how the perturbation affects downstream phenotypes.
      • In Figures 4 and 5, the thresholding approaches in the images make the focal adhesions difficult to resolve, and therefore it is difficult to determine the size. As described above, these metrics should be defined and quantified.
      • What is a PAB? How is it defined? What metrics make a structure a PAB versus regular cortical actin - are there quantifiable metrics? In figure 8, there are some structures that are labelled as a PAB, but some aren't (as an example, the left panel in 8b is a PAB, but the right panel in 8A is not, but they look the same), so a PAB should be defined with quantifiable measures, and then applied to the entire study.
      • As described above, why does RhoA activation not influence cell size and circularity? Can you overexpress MRLC-GFP and inhibit Rho and restore the wildtype phenotype?

      Are the suggested experiments realistic in terms of time and resources? It would help if you could add an estimated cost and time investment for substantial experiments.

      • These suggested experiments described above will take a substantial amount of time and money, as it appears that some experiments were only performed once, and therefore many of these experiments might need to be performed 2-3 more times. Also, experiments showing that addition of drugs lead to expected outcomes prior to analyzing downstream phenotypes will also require a significant amount of time. It is hard to predict how long it will take, but we would guess, 6-8 months?

      Are the data and the methods presented in such a way that they can be reproduced?

      • We appreciate that the authors quantified many parameters, although some quantifications were missing. There are some missing methods - how was directionality quantified, was migration quantified by selecting the approximate center of cells using MTrackJ or were centroids quantified by outlining cells, for instance. Also, given that some of the phenotypes were somewhat arbitrarily assigned (ie. what constitutes a PAB?), it may be difficult to reproduce these approaches and interpret data appropriately.

      Are the experiments adequately replicated and statistical analysis adequate?

      • Unfortunately, while the approximate number of cells was reported, the number of biological replicates were not reported, and therefore, the experimental information and statistical analyses are not adequate.

      Minor comments:

      Specific experimental issues that are easily addressable. - for some of the graphs - mostly about calcium levels - fold change is shown, but raw values should also be included to determine whether the basal levels of calcium are different across the conditions. - scale bars in every panel should also help make the points clearer.

      Are prior studies referenced appropriately?

      • Yes

      Are the text and figures clear and accurate?

      • Some of the data in the figures were unclear - see above for more info.

      Do you have suggestions that would help the authors improve the presentation of their data and conclusions?

      • See above for more info.

      Significance

      Describe the nature and significance of the advance (e.g. conceptual, technical, clinical) for the field.

      • There is a growing field of mitochondrial biology and how it relates to cell migration. This paper examines the function of a key mitochondrial morphology regulator, MFN2, and dissects a role for MFN2 in migration at the level of cytoskeletal regulation. We think that this is interesting, and that it's clear that MFN2 has multiple functions in the cell, but the phenotypes are so pleiotropic that it's difficult to parse out mechanistic understanding. The authors also describe a new actin architecture - a structure that they refer to as PABs - but there is no indication that PABs form in other cell types or tissues, or in other contexts, so it is unclear whether PABs are an important structure or an artifact of the system. Furthermore, part of the motivation of the work seems to be to understand MFN-related pathologies, but using a MEF system does not necessarily allow for that. One way to strengthen this part of the manuscript is to potentially use disease-relevant MFN2 mutations and determine downstream effects on cell morphology and migration.

      State what audience might be interested in and influenced by the reported findings.

      • This work would appeal to card-carrying cell biologists.

      Define your field of expertise with a few keywords to help the authors contextualize your point of view. Indicate if there are any parts of the paper that you do not have sufficient expertise to evaluate.

      • cell migration; actin; mitochondria
    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      We would like to thank all the reviewers for their positive evaluations of our work and constructive comments, in particular for highlighting that our work “provides new insight into cancer metabolism knowledge”, is “conceptually interesting and experimentally well performed” and “the findings presented here will be very interesting to a broad range of researchers, including the cancer, metabolism and wider cell biology communities”.

      Reviewer #1 (Evidence, reproducibility and clarity (Required)): Nazemi et al. show that the extracellular matrix (ECM) has a crucial role in sustaining the growth of invasive breast and pancreatic cells during nutrient deprivation. In particular, under amino acid starvation, cancer cells internalize ECM by macropinocytosis and activate phenylalanine and tyrosine catabolism, which in turn support cell growth in nutrient stress conditions. The paper is well written and the results shown are very interesting. The experimental plan is well designed to assess the hypothesis and the description of the methods is sufficiently detailed to reproduce the analyses, which are also characterized by appropriate internal controls. Finally, the data provided sustain the conclusions proposed by the authors.

      * Major comment:*

      Since the authors performed their experiments on invasive breast and pancreatic cancers and it has been noted that stress conditions could promote the escape of cancer cells from the site of origin (e.g., Jimenez and Goding, Cell Metabolism 2018; Manzano et al, EMBO Reports 2020), it would be interesting to evaluate how ECM internalization could have a role in sustaining the invasive abilities of cancer cells under amino acid starvation. Which is the impact of the inhibition of macropinocytosis and tyrosine catabolism on cell invasion? The authors could evaluate this aspect by in vitro 2D and 3D analysis.

      This is a very important point, and we are planning to investigate this by using:

      • 2D single cell migration assays on cell-derived matrices (we have extensively used this system to characterise invasive cell migration; Rainero et al., 2015; Rainero et al., 2012)
      • 3D spheroids assays, to assess collective/3D cell invasion through collagen I and matrigel mixtures. Both experiments will be performed under amino acid starvation, in the presence of pharmacological inhibitors and siRNAs targeting macropinocytosis (FRAX597, PAK1) and tyrosine catabolism (Nitisinone, HPDL). Preliminary data suggest that both FRAX597 and Nitisinone reduce cell invasiveness.

      In addition, to strengthen the paper and give a stronger significance in terms of clinical translatability, it could be useful to implement the analysis of breast and pancreatic patients by publicly dataset evaluating for example free survival, disease free survival, overall survival and metastasis free survival.

      We have now included in the manuscript new data in figure 6 O-R showing that high HPDL expression correlates with reduces overall survival, distant metastasis-free survival, relapse-free survival and palliative performance scale in breast cancer patients. In response to other reviewers’ comments, we have removed the pancreatic cancer data from our manuscript.

      Minor Comment:

      The text and the figures are clear and accurate. The references cited support the hypothesis, rightly introduce the results and are appropriate for the discussion. However, the paragraph relative to figure 4 is a little confusing. Changing the order of the description of the results could be useful.

      We apologise for the lack of clarity in this section. We have now re-organised the data both in the figure and in the result section, to describe the findings in a more logical way.

      Reviewer #1 (Significance (Required)): Based on my metabolic background in tumour aetiology and progression, I think that this study provides new insights into cancer metabolism knowledge, in particular on how the stroma may drive metabolic reprogramming of cancer cells sustaining cell growth in nutrient stress conditions. Together with other similar studies on the stromal non-cellular components, the data here shown can contribute to expand the knowledge on the factors that promote cancer metabolic plasticity, which is exploited from cancer cells to obtain advantages in terms of growth, survival and progression. In conclusion, I think that the results shown are new and the manuscript is well presented. Following the short revision process suggested, it will be eligible for a final publication in a medium-high impact factor journal.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      • Please find enclosed my reviewing comments on the manuscript entitled "The extracellular matrix supports cancer cell growth under amino acid starvation by promoting tyrosine catabolism" by Nazemi et al.*

      In this manuscript the group of Elena Romero and colleagues provides evidence that breast cancer cells, and pancreatic cancer cell, use matrix proteins degradation to feed their proliferative metabolic needs under amino acid starvation. Under this drastic condition, cancer cells use micropinocytosis to uptake matrix proteins, a process that requires mTORC1 activation and PAK1. Furthermore, a metabolomic study demonstrates that ECM-dependent cancer cell growth relies on tyrosine catabolism. Altogether, I found this study conceptually interesting and experimentally well performed. Experiments are well controlled and state-of-the-art technologies used in this manuscript make it a good candidate for publication. However, some aspects of the work need to be strengthen to reinforce the overall good quality of the manuscript, therefore, please find below some experimental propositions. 1. Despite the reviewer proposition, I believe that the additional experiments using the PDAC cancer cell does not improve the quality of the manuscript. Instead, it brings confusion to me, since the relative addition is minor compare to what is demonstrated using breast cancer cells.

      We have decided to remove the pancreatic cancer cell data from the manuscript.

      To importantly improve the potential impact of this manuscript, I suggest to add in vivo data using either syngenic mice model of breast cancer or xenografted human breast cancer cells in nude mice. What would be the impact of micropinocytosis and tyrosine catabolism inhibition on cancer growth, in vivo, should be demonstrated? If possible, it may be interesting to demonstrate that this micropinocytosis may interfere with cancer evolution toward a metastatic phenotype using, for example, the PyMT-MMTV mice model of breast cancer development?

      We will perform orthotopic mammary fat pad injections in immunocompetent mice, to monitor primary tumour growth and localised invasion in the presence of Nitisinone or vehicle control. PyMT-driven breast cancer cells have been generated in the Blyth lab, from FVB-pure MMTV-PyMT mice and we have preliminary data indicating that these cells are able to internalise ECM and grow under starvation in an ECM-dependent manner. Prior to performing any in vivo work, we will perform further in vitro experiment to confirm the role of tyrosine catabolism in these cells. Nitisinone is an FDA-approved drug that has already been used in mouse models. Blood tyrosine levels can be measured to assess tyrosine catabolism inhibition by Nitisinone. These experiments will be conducted in collaboration with the Blyth lab at the CRUK Beatson Institute in Glasgow.

      Data obtained using cancer cells with different metastatic property suggest that the ability to use ECM to compensate for soluble nutrient starvation is acquired during cancer progression. To further demonstrate that it is the case, would it be possible that non metastatic breast cancer cells are not able to perform micropinocytosis? Is PAK1 overexpressed with increase cancer cells metastatic ability, without affecting invasive capacity in 3D spheroids?

      To address these points, we have started to measure PAK1 expression across the MCF10 series of cell lines, where MCF10A are non-transformed mammary epithelial cells, MCF10A-DCIS are ductal carcinoma in situ cells and MCF10CA1 are metastatic breast cancer cells. Our preliminary data show that there is no upregulation of PAK1 expression in the metastatic cells compared to non-transformed or non-invasive cancer cells. This suggest that the over-expression of PAK1 might not be a valuable strategy to address this point.

      In addition, we found that collagen I uptake was upregulated in MCF10CA1 compared to MCF10A and MCF10A-DCIS. We will corroborate our preliminary data by quantifying collagen I and cell-derived matrices internalisation across the 3 cell lines.

      What would be the efficacy to promote the ECM-dependent growth under starvation following a mTORC1 in non-invasive cancer cells?

      We will measure the growth of MCF10A and MCF10A-DCIS on ECM under starvation in the presence of the mTOR activator MHY1485. Western blot analysis of downstream targets of mTORC1 (p-S6 and p-4EBP1) will confirm the extent of mTOR activation.

      The discrepancy of cancer cells proliferation under starvation condition between plastic and ECM-based supports could be explained by the massive difference of support rigidity. This is also probably the case between CDM made by normal fibroblast and CAF. It brings the question of studying the role of matrix stiffness in regard to micropinocytosis-dependent cancer cells growth. It would also explain why this process is link to aggressive cancer cell behaviour, as ECM goes stiffer with time in cancer development. It may not be the case, but the demonstration that mechanical cues from the ECM could regulate the micropinocytosis-dependent cancer cells growth under amino acid starvation could bring additional value to the manuscript.

      We will use 2 experimental approaches to address the effect of different stiffness in ECM-dependent cell growth:

      1. Polyacrylamide hydrogels coated with different ECM components.
      2. Collagen I gels in which the stiffness is modified by Ribose treatment (this approach has been published by the Parson’s lab). Our preliminary data confirmed that ribose cross-linking increased YAP nuclear localisation and collagen I can still be internalised under these conditions. We will assess ECM endocytosis and cell growth under starvation conditions (using EdU incorporation in conjunction with A and high throughput imaging with B)

      Along with this, it has been demonstrated that matrix rigidity regulates glutaminolysis in breast cancer, resulting in aspartate production and cancer cells proliferation. Is asparate production increase by micropinocytosis? Could you rescue cancer cells growth by aspartate supplementation?

      Our metabolomics experiments were performed under amino acid starvation; therefore glutamine was not present in the media. Nor glutaminolysis intermediates nor aspartate were upregulated on ECM compared to plastic in our datasets, suggesting that aspartate might not be involved in this system. We added this point in the discussion. However, glutamine, glutamate and aspartate were found to be upregulated on collagen I compared to plastic in complete media, where the most enriched pathway was alanine, aspartate and glutamate metabolism. Future work will address the role of the ECM in supporting cancer cell metabolism in the absence of nutrient starvation.

      Data presented in Fig 1 and SF1 show that breast cancer cell lines growth in a comparable manner either they are cultured on plastic or on 3D ECM substrates in complete media. Again, on thick 3D substrates, in which the stiffness is lower compared to plastic, I would have thought that cancer cells would have grown slower. Could you please discuss this finding in regard to the literature?

      Our experiments in full media were performed in the presence of dialysed serum, to represent a better control for the starvation conditions, which were in the presence of dialysed serum. This is consistent with a vast body of literature assessing nutrient starvation conditions in the presence of dialysed serum. This could explain the discrepancy between ours and published results. We have addressed this point in the discussion.

      If you have the capacity to do so in your lab or in collaboration, would it be possible to measure the exact stiffness of the different matrix you use in this manuscript? Or using hydrogel, would it be possible to study the role of matrix stiffness in the ECM-dependent cancer cells growth under AA starvation? I would understand that this may be out of the scope of the present manuscript, but I again believe that such finding would reinforce the manuscript.

      We don’t have the capacity to measure the stiffness in our lab, however NF-CDM and CAF-CDM, generated by the same cells and using the same protocol, have been previously measured at ~0.4kPa and ~0.8 kPa, respectively (Hernandez-Fernaud et al., 2017). We have now included this in the paper. As mentioned in response to point 4, we will use hydrogels to directly test the effect of matrix stiffness on ECM-dependent cell growth under nutrient starvation.

      In SF 3A-C, it is shown that ECM does not affect caspase-dependent cell death under AA starvation. Did you considered a non-caspase dependent cell death that may be triggered by AA starvation?

      We will complement the caspase 3/7 data by performing PI staining, to detect all forms of cell death. Preliminary data indicate that, consistent with our cas3/7 data, amino acid starvation promotes cell death, but the presence of the ECM doesn’t affect the percentage of PI positive cells, corroborating our conclusions that the ECM modulates cell proliferation and not cell death. We will complete these experiments in both MDA-MB-231 and MCF10CA1 cells and will include them in figure S3.In fig 5, it is shown that inhibition of Focal Adhesion Kinase (FAK) does not impair the ECM-dependent rescue of cancer cell growth under starvation. To further decipher the concept of adhesion dependent signalling, maybe the authors could also inhibit the Src kinase or ITG-beta1 activation?

      Integrin b1 is also required for ECM internalisation (our unpublished data), therefore interfering with integrin function would make the interpretation of the data quite complex. As suggested by the reviewer, we will use the Src inhibitor PP2, which has been extensively used in the literature in MDA-MB-231 cells. Preliminary data indicate that, despite significantly reducing cell proliferation in complete media, Src inhibition does not affect cell growth on collagen I under amino acid starvation, consistent with our FAK inhibitor data. We will complete these experiments on both collagen I and cell-derived matrices and will include them in figure 5.

      Minor comment, in F1B, it is written "AA free starvation" while in every others legend, it is written "AA starvation". I believe the "free" should be removed.

      We apologise for this mistake; we have now removed “free” from the legend.

      Reviewer #2 (Significance (Required)): Altogether, I found this study conceptually interesting and experimentally well performed. Experiments are well controlled and state-of-the-art technologies used in this manuscript make it a good candidate for publication. However, some aspects of the work need to be strengthen to reinforce the overall good quality of the manuscript.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)): In this manuscript the authors explore the mechanisms that metastatic cancer cells use to adapt their metabolism. The authors show that the growth of cancer cell lines is supported by uptake of ECM components in nutrient-starved conditions. The authors propose a very interesting mechanism in which the cells adapt their metabolism to ECM uptake as nutrient source via a PAK1-dependent macropinocytosis pathway which in turn increases tyrosine catabolism. Several key aspects of the authors complex hypothesis require further controls to fully support the authors ideas. As a disclaimer we do not feel qualified enough to comment on the metabolite experiments. Please find our detailed comments below.

      * Major -The ECM mediated increase of cell growth under amino acid (AA) starvation is nicely shown In Fig.1 but the authors should include the full medium data from figure S1 in the graphs of Fig. 1 to enable the reader to evaluate the magnitude of rescue effect of the ECM components. The values should also be included in the results text*.

      We have now moved all the complete media data into the main figure and highlighted the extent of the rescue in the result section.

      Also the authors only glutamine starve in Fig1&2 and then don't mention it again can the authors please include a sentence to explain why this experiment was dropped.

      As now highlighted in the result section, we focused on the amino acid starvation as it resulted in the strongest difference between normal and cancer. On the one hand, also non-invasive breast cancer cells can use ECM (namely matrigel) to grow under glutamine starvation, while this is not the case under amino acid starvation. On the other hand, only CAF-CDM, but not normal-CDM, could rescue cell growth under amino acid starvation. We reasoned that this condition was more likely to identify cancer-specific phenotypes.

      - The evaluation of uptake pathways is very interesting. The focus on macropinocytosis is not entirely justified in our opinion looking at FigS4A. Caveolin1/2 and DNM1/3 seem to have strongest effect on uptake of Matrigel and not PAK1? Statements like "Since our data indicate that macropinocytosis is the main pathway controlling ECM endocytosis..." are not justified nor are they really needed in our opinion. Several pathways can be implicated in passive uptake.

      We have now removed the statement, as suggested by the reviewer. In addition, we will assess CDM uptake upon caveolin 1/2 and DNM 2/3 knock-down, to test whether the effects are matrigel specific.

      - The authors use FAK inhibition to evaluate the effect of focal adhesion signalling on their phenotypes and conclude that there is no connection between the observed increase of cell proliferation in presence of ECM and adhesion signalling. To make this assessment the authors need at the very least to show that their FAK inhibitor treatment at the used concentration results in changes in focal adhesions and the associated force transduction.

      In the result section, we are including a western blot analysis showing that the concentration of FAK inhibitor used in sufficient so significantly reduced FAK auto-phosphorylation. Based on published evidence (Horton et al., 2016), FAK inhibition does not affect focal adhesion formation, but only the phosphorylation events. Therefore, we don’t think that we will be able to detected changes in focal adhesions regardless of the concentration of the inhibitor we use. To strengthen the observation that ECM-dependent cell growth in independent from adhesion signalling, as suggested by reviewer #2, we will use the Src inhibitor PP2, which has been extensively used in the literature in MDA-MB-231 cells. Preliminary data indicate that, despite significantly reducing cell proliferation in complete media, Src inhibition does not affect cell growth on collagen I under amino acid starvation, consistent with our FAK inhibitor data. We will complete these experiments on both collagen I and cell-derived matrices and will include them in figure 5.

      -The pancreatic cancer data currently feels a bit like an afterthought. We suggest to remove this data from the manuscript. If this data is included we suggest the authors should expand this section and repeat key experiments of earlier figures.

      We have now removed these data from the manuscript, as this was also the suggestion of reviewer #2.

      -Was the fetal bovine serum (FBS) and Horse Serum (HS) the authors use in their experiments tested for ECM components? The authors mention that the FBS for MDA231 cells was dialysed but not the HS.

      HS was used at a much lower concentration that FBS in our cell proliferation experiments (2.5% compared to 10%). We will characterise both sera components by mass spectrometry analysis, in collaboration with Dr Collins, biOMICS Facility, University of Sheffield.

      Minor comments:

      -Please can the authors provide experimental data directly comparing NF-CAM versus CAF-CDM on the same graph (Figure 1D-E).

      In the experiments included in the manuscript, the two matrices were generated independently, and we don’t feel it is appropriate to combine the results in the same graph. We are now repeating these experiments by generating both matrices in the same plates, so that we can present the data in the same graph. -Please can the authors give more insight to the use of 25% Plasmax to mimic starved tumor microenvironment. Is there previous research that suggests the nutrient values are representative of TME?

      Apologies for not clarifying this in the initial submission, the rationale behind this choice is based on the observation that, in pancreatic cancers, nutrients were shown to be depleted between 50-75% (Kamphorst et al., 2015). We have now stated this in the result section.

      -Fig3E Can the authors please include example images of the pS6 staining in the supplementary figures and explain "mTOR endosomal index" in figure legend.

      We have now included the representative images (new figure 3E) and we have described how the mTOR endosomal index was calculated both in the figure legend and in the method section. -Can the authors include a negative control for the mTORC1 localisation in Fig.3 (such as use of rapamycin/Torin)?

      Amino acid starvation is the gold-standard control for mTORC1 lysosomal targeting, as described in a variety of publications, including Manifava et al., 2016; Meng et al., 2021; Averous et al., 2014. In addition, Torin 1 treatment has been shown to result in a significant accumulation of mTOR on lysosomes compared with untreated cells (Settembre et al., 2012). Consistent with this, we looked at mTOR localisation in the presence of Rapamycin and we did not detect any reduction in lysosomal targeting.

      - The PAK1 expression level blots in the knockdown experiments should be quantified from N=3.

      We have not included the quantification of the western blots in the new supplementary figure 5.

      -What is the FA index in Fig.5, explain how it is calculated. Why not use FA size alone?

      We have now defined this is the method section. We haven’t used FA size alone, as this measure can be affected by cell size. If a cell is bigger, the overall FA size will be bigger, but this doesn’t necessarily reflect a change in adhesions.

      -Can the authors please use paragraphs on page 9 to improve readability. We apologise for overlooking this, we have now used paragraph in this section.

      Reviewer #3 (Significance (Required)): The findings presented here will be very interesting to a broad range of researchers including the cancer, metabolism and wider cell biology communities. The Rainero lab has progressed the idea that ECM uptake supports cancer progression and the data presented here has the potential to significantly advance our understanding of the underlying cellular mechanisms.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      In this manuscript the authors explore the mechanisms that metastatic cancer cells use to adapt their metabolism. The authors show that the growth of cancer cell lines is supported by uptake of ECM components in nutrient-starved conditions. The authors propose a very interesting mechanism in which the cells adapt their metabolism to ECM uptake as nutrient source via a PAK1-dependent macropinocytosis pathway which in turn increases tyrosine catabolism. Several key aspects of the authors complex hypothesis require further controls to fully support the authors ideas. As a disclaimer we do not feel qualified enough to comment on the metabolite experiments. Please find our detailed comments below.

      Major

      • The ECM mediated increase of cell growth under amino acid (AA) starvation is nicely shown In Fig.1 but the authors should include the full medium data from figure S1 in the graphs of Fig. 1 to enable the reader to evaluate the magnitude of rescue effect of the ECM components. The values should also be included in the results text. Also the authors only glutamine starve in Fig1&2 and then don't mention it again can the authors please include a sentence to explain why this experiment was dropped.
      • The evaluation of uptake pathways is very interesting. The focus on macropinocytosis is not entirely justified in our opinion looking at FigS4A. Caveolin1/2 and DNM1/3 seem to have strongest effect on uptake of Matrigel and not PAK1? Statements like "Since our data indicate that macropinocytosis is the main pathway controlling ECM endocytosis..." are not justified nor are they really needed in our opinion. Several pathways can be implicated in passive uptake.
      • The authors use FAK inhibition to evaluate the effect of focal adhesion signalling on their phenotypes and conclude that there is no connection between the observed increase of cell proliferation in presence of ECM and adhesion signalling. To make this assessment the authors need at the very least to show that their FAK inhibitor treatment at the used concentration results in changes in focal adhesions and the associated force transduction.
      • The pancreatic cancer data currently feels a bit like an afterthought. We suggest to remove this data from the manuscript. If this data is included we suggest the authors should expand this section and repeat key experiments of earlier figures.
      • Was the fetal bovine serum (FBS) and Horse Serum (HS) the authors use in their experiments tested for ECM components? The authors mention that the FBS for MDA231 cells was dialysed but not the HS.

      Minor comments:

      • Please can the authors provide experimental data directly comparing NF-CAM versus CAF-CDM on the same graph (Figure 1D-E)
      • Please can the authors give more insight to the use of 25% Plasmax to mimic starved tumor microenvironment. Is there previous research that suggests the nutrient values are representative of TME?
      • Fig3E Can the authors please include example images of the pS6 staining in the supplementary figures and explain "mTOR endosomal index" in figure legend.
      • Can the authors include a negative control for the mTORC1 localisation in Fig.3 (such as use of rapamycin/Torin)?
      • The PAK1 expression level blots in the knockdown experiments should be quantified from N=3
      • What is the FA index in Fig.5, explain how it is calculated. Why not use FA size alone?
      • Can the authors please use paragraphs on page 9 to improve readability.

      Significance

      The findings presented here will be very interesting to a broad range of researchers including the cancer, metabolism and wider cell biology communities. The Rainero lab has progressed the idea that ECM uptake supports cancer progression and the data presented here has the potential to significantly advance our understanding of the underlying cellular mechanisms.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Please find enclosed my reviewing comments on the manuscript entitled "The extracellular matrix supports cancer cell growth under amino acid starvation by promoting tyrosine catabolism" by Nazemi et al.

      In this manuscript the group of Elena Romero and colleagues provides evidence that breast cancer cells, and pancreatic cancer cell, use matrix proteins degradation to feed their proliferative metabolic needs under amino acid starvation. Under this drastic condition, cancer cells use micropinocytosis to uptake matrix proteins, a process that requires mTORC1 activation and PAK1. Furthermore, a metabolomic study demonstrates that ECM-dependent cancer cell growth relies on tyrosine catabolism.

      Altogether, I found this study conceptually interesting and experimentally well performed. Experiments are well controlled and state-of-the-art technologies used in this manuscript make it a good candidate for publication. However, some aspects of the work need to be strengthen to reinforce the overall good quality of the manuscript, therefore, please find below some experimental propositions.

      1. Despite the reviewer proposition, I believe that the additional experiments using the PDAC cancer cell does not improve the quality of the manuscript. Instead, it brings confusion to me, since the relative addition is minor compare to what is demonstrated using breast cancer cells.
      2. To importantly improve the potential impact of this manuscript, I suggest to add in vivo data using either syngenic mice model of breast cancer or xenografted human breast cancer cells in nude mice. What would be the impact of micropinocytosis and tyrosine catabolism inhibition on cancer growth, in vivo, should be demonstrated? If possible, it may be interesting to demonstrate that this micropinocytosis may interfere with cancer evolution toward a metastatic phenotype using, for example, the PyMT-MMTV mice model of breast cancer development?
      3. Data obtained using cancer cells with different metastatic property suggest that the ability to use ECM to compensate for soluble nutrient starvation is acquired during cancer progression. To further demonstrate that it is the case, would it be possible that non metastatic breast cancer cells are not able to perform micropinocytosis? Is PAK1 overexpressed with increase cancer cells metastatic ability, without affecting invasive capacity in 3D spheroids? What would be the efficacy to promote the ECM-dependent growth under starvation following a mTORC1 activation or PAK1 activation in non-invasive cancer cells?
      4. The discrepancy of cancer cells proliferation under starvation condition between plastic and ECM-based supports could be explained by the massive difference of support rigidity. This is also probably the case between CDM made by normal fibroblast and CAF. It brings the question of studying the role of matrix stiffness in regard to micropinocytosis-dependent cancer cells growth. It would also explain why this process is link to aggressive cancer cell behaviour, as ECM goes stiffer with time in cancer development. It may not be the case, but the demonstration that mechanical cues from the ECM could regulate the micropinocytosis-dependent cancer cells growth under amino acid starvation could bring additional value to the manuscript.
      5. Along with this, it has been demonstrated that matrix rigidity regulates glutaminolysis in breast cancer, resulting in aspartate production and cancer cells proliferation. Is asparate production increase by micropinocytosis? Could you rescue cancer cells growth by aspartate supplementation?
      6. Data presented in Fig 1 and SF1 show that breast cancer cell lines growth in a comparable manner either they are cultured on plastic or on 3D ECM substrates in complete media. Again, on thick 3D substrates, in which the stiffness is lower compared to plastic, I would have thought that cancer cells would have grown slower. Could you please discuss this finding in regard to the literature? If you have the capacity to do so in your lab or in collaboration, would it be possible to measure the exact stiffness of the different matrix you use in this manuscript? Or using hydrogel, would it be possible to study the role of matrix stiffness in the ECM-dependent cancer cells growth under AA starvation? I would understand that this may be out of the scope of the present manuscript, but I again believe that such finding would reinforce the manuscript.
      7. In SF 3A-C, it is shown that ECM does not affect caspase-dependent cell death under AA starvation. Did you considered a non-caspase dependent cell death that may be triggered by AA starvation?
      8. In fig 5, it is shown that inhibition of Focal Adhesion Kinase (FAK) does not impair the ECM-dependent rescue of cancer cell growth under starvation. To further decipher the concept of adhesion dependent signalling, maybe the authors could also inhibit the Src kinase or ITG-beta1 activation?
      9. Minor comment, in F1B, it is written "AA free starvation" while in every others legend, it is written "AA starvation". I believe the "free" should be removed.

      Significance

      Altogether, I found this study conceptually interesting and experimentally well performed. Experiments are well controlled and state-of-the-art technologies used in this manuscript make it a good candidate for publication. However, some aspects of the work need to be strengthen to reinforce the overall good quality of the manuscript.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Nazemi et al. show that the extracellular matrix (ECM) has a crucial role in sustaining the growth of invasive breast and pancreatic cells during nutrient deprivation. In particular, under amino acid starvation, cancer cells internalize ECM by macropinocytosis and activate phenylalanine and tyrosine catabolism, which in turn support cell growth in nutrient stress conditions.

      The paper is well written and the results shown are very interesting. The experimental plan is well designed to assess the hypothesis and the description of the methods is sufficiently detailed to reproduce the analyses, which are also characterized by appropriate internal controls. Finally, the data provided sustain the conclusions proposed by the authors.

      Major comment:

      Since the authors performed their experiments on invasive breast and pancreatic cancers and it has been noted that stress conditions could promote the escape of cancer cells from the site of origin (e.g., Jimenez and Goding, Cell Metabolism 2018; Manzano et al, EMBO Reports 2020), it would be interesting to evaluate how ECM internalization could have a role in sustaining the invasive abilities of cancer cells under amino acid starvation. Which is the impact of the inhibition of macropinocytosis and tyrosine catabolism on cell invasion? The authors could evaluate this aspect by in vitro 2D and 3D analysis. In addition, to strengthen the paper and give a stronger significance in terms of clinical translatability, it could be useful to implement the analysis of breast and pancreatic patients by publicly dataset evaluating for example free survival, disease free survival, overall survival and metastasis free survival.

      Minor Comment:

      The text and the figures are clear and accurate. The references cited support the hypothesis, rightly introduce the results and are appropriate for the discussion. However, the paragraph relative to figure 4 is a little confusing. Changing the order of the description of the results could be useful.

      Significance

      Based on my metabolic background in tumour aetiology and progression, I think that this study provides new insights into cancer metabolism knowledge, in particular on how the stroma may drive metabolic reprogramming of cancer cells sustaining cell growth in nutrient stress conditions. Together with other similar studies on the stromal non-cellular components, the data here shown can contribute to expand the knowledge on the factors that promote cancer metabolic plasticity, which is exploited from cancer cells to obtain advantages in terms of growth, survival and progression.

      In conclusion, I think that the results shown are new and the manuscript is well presented. Following the short revision process suggested, it will be eligible for a final publication in a medium-high impact factor journal.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      This study by Viedor et al. examines the role of TIS7 (IFRD1) and its ortholog SKMc15 (IFRD2) in the regulation of adipogenesis via their ability to modulate the levels of DLK1 (Pref-1), a well-known inhibitor of adipogenesis. They generate SKMc15 KO mice and cross them to previously published TIS7 KO mice. All 3 mutant strains show decreased fat mass, with the effect being most pronounced in double KO mice (dKO). Using mouse embryonic fibroblasts (MEFs) from mutant mice, they authors ascribe a defect in adipogenic differentiation of mutant cells to an upregulation of DLK-1. In the case of TIS7, they propose that this is due to its known inhibition of Wnt signaling, which regulates DLK-1 expression. In the case of SKMc15, they suggest a new mechanism linked to its ability to suppress translation. Overall, the work is of interest, with the finding, that SKMc15 regulates adipocyte differentiation being its novelty, and generally well done, though multiple aspects need to be improved to bolster the conclusions put forth.

      **Major concerns:**

      1)The main mechanism put forth by the authors to explain the inability of dKO cells to differentiate into adipocytes is the upregulation of DLK-1 levels. However, this notion is never directly tested. Authors should test if knockdown of DLK-1 in dKO cells is sufficient to correct the defect in differentiation, or if additional factors are involved.

      Response: In response to the reviewer’s concerns, we have generated two stable cell lines expressing short hairpin RNAs directed against DLK1 in the TIS7 SKMc15 dKO MEFs. With these two and the parental dKO MEF cell line, we have performed adipogenesis differentiation experiments as explained in the manuscript before. Figure EV2C (left and right panels) shows that knockdown of DLK1 with two different DLK1 shRNA constructs (targeting DLK1 with or without the extracellular cleavage site) significantly (P2)There are multiple instances were the authors refer to "data not shown", such as when discussing the body length of dKO mice. Please show the data in all cases (Supplementary Info is fine) or remove any discussion of data that is not shown and cannot be evaluated.

      Response: Following three results were in the initial version of our manuscript mentioned as “data not shown”:

      • line 137: “body length, including the tail did not significantly differ between WT and dKO mice”
      • line 307: “higher concentrations of free fatty acids in the feces of dKO mice”
      • line 331: “effects of ectopic expression of TIS7, SKMc15 and their co-expression on DLK-1 levels” In the current version of the manuscript, we provide these results as:

      • Figure EV1A shows no significant difference in body length.

      • The significantly elevated levels of free fatty acids and energy determined by bomb calorimetry in the feces of dKO animals fed HFD are shown in Figures 6A and B, respectively.
      • The significant inhibitory effect of ectopic expression of TIS7 and SKMc15 on DLK1 levels was identified by both qPCR and WB analyses, which are shown in Figure 3B. 3)Indirect calorimetry data shown in Fig. S1 should include an entire 24 hr cycle and plots of VO2, activity and other measured parameters shown (only RER and food intake are shown), not just alluded to in the legend.

      Response: Based on the reviewer’s suggestion, we present here a table containing all parameters measured in the indirect calorimetry experiment.

      Metabolic phenotyping presented in Figure EV1B containing 21 hours measurement was performed exactly according to the standardized protocol previously published by Rozman J. et al. [1]. All phenotyping tests were performed following the International Mouse Phenotyping Resource of Standardized Screens (IMPReSS) pipeline routines.

      4)It is surprising that the dKO mice weight so much less than WT even though their food consumption and activity levels are similar, and their RER does not indicate a switch in fuel preference. An explanation could be altered lipid absorption. The authors indicate that feces were collected. An analysis of fat content in feces (NEFAs, TG) needs to be performed to examine this possibility. The discussion alludes to it, but no data is shown.

      __Response: __We thank the reviewer for bringing up this important point that prompted us to present data clarifying this aspect of the metabolic phenotype of dKO mice. As shown in Figures 6A,B, while fed with HFD, dKO mice had higher concentrations of free fatty acids in the feces (109 ± 10.4 µmol/g) when compared to the WT animals (78 ± 6.5 µmol/g) and a consequent increase in feces energy content (WT: 14.442 ± 0.433 kJ/g dry mass compared to dKO: 15.497 ± 0.482 kJ/g dry mass). Thus, lack of TIS7 and SKMc15 reduced efficient free fatty acid uptake in the intestines of mice.

      5)It would be important to know if increased MEK/ERK signaling and SOX9 expression are seen in fat pads of mutant mice, not just on the MEF system. Similarly, what are the expression levels of PPARg and C/EBPa in WAT depots of mutant mice?

      Response: To address this point, we have now performed the MEK/ERK activity measurement for the revised version of the manuscript in gonadal WAT tissue (GWAT). As noted in samples from several mice, there was an increase in p42 and p44 MAPK phosphorylation in G WAT isolated from dKO mice compared with the G WAT from WT control mice (Figure 4G).).

      The mRNA expression levels of PPARg and C/EBPa were significantly downregulated in GWAT samples isolated from dKO mice compared with levels from WT control animals (Figure 4H). However, we did not find any significant difference in SOX9 expression in fat pads. Total amounts of Sox9 mRNA in terminally differentiated adipocytes were very low and not within the reliable detection range, and the variation between animals within the same group was too great. Therefore, we provide these data only for the reviewer’s information here and do not present them in the manuscript.

      6)Analysis of Wnt signaling in Fig. 3c should also include a FOPflash control reporter vector, to demonstrate specificity. Also, data from transfection studies should be shown as mean plus/minus STD and not SEM. This also applies to all other cell-based studies (e.g., Fig. 6b,c).

      Response: To address the reviewer’s concerns, we performed FOPflash control reporter measurements in MEFs of all four genotypes. As expected, in every tested cell line the luciferase activity of the FOPflash reporter was substantially lower than that of TOPflash, confirming the specificity of this reporter system.

      We also thank the reviewer for this important reference to our statistical analyses. We have revised the original data and found that the abbreviation SEM was inadvertently used in the legends instead of STD. STD was always used in the original analyses and therefore we have corrected all legends accordingly in the new version of the manuscript.

      7)It is unclear why the authors used the MEF model rather than adipocyte precursors derived from the stromal vascular fraction (SVF) of fat pads from mutant mice. If they did generate data from SVF progenitors, they should include it.

      __Response: __We agree with this comment, although performing the experiments was challenging enough for us. Therefore, we isolated inguinal fat pads and obtained SVF cells from mice of all four genotypes (WT, TIS7, SKMc15 single and double KOs) and have repeated crucial experiments, i.e. adipocyte differentiation, DLK1, PPARg and C/EBPa mRNA and protein analyses in these cells. Novel data gained in this cell system fully confirmed our previous observations in MEFs. Therefore, in the current version of the manuscript we have replaced figures describing the effects of lacking TIS7 and SKMc15 in MEFs by adipose tissues samples (Figures 2D,E, 4G,H,I and 6C) or SVF cells from inguinal WAT (Figures 2A,B,F,G,H, 3C,D,E and F). In addition to the results obtained from SVF cells of inguinal WAT, we also obtained comparable data from SVF cells isolated from fat pads of gonadal WAT. We provide the results from gonadal WAT hereafter for the reviewers' information only.

      amido black

      • 60 kDa

      • 50 kDa

      __G WAT __tissues

      dKO

      WT

      GAPDH

      DLK-1

      • 60 kDa

      • 50 kDa

      • 35 kDa

      WT

      dKO

      DLK-1

      • 60 kDa

      • 50 kDa

      __G WAT __undifferentiated cells

      undifferentiated G WAT cells

      The only experiments where we have still used data obtained in MEFs are those where the ectopic expression or effects of shRNA were necessary (e.g. Figures 2C, 3B,H,I, 5F,G EV2B,C and EV3 A-F).

      8)Given that the authors' proposed mechanism involves both, transcriptional and post-transcriptional regulation of DLK-1 by TIS7 and SKMc15, Fig. 4d should be a Western blot capturing both of these events, and not just quantitation of mRNA levels.

      Response: As requested by the reviewer, we have added in Figure 3B the Western blot analysis of DLK1 expression. Secondly, this experiment was entirely redone and we now show the effects of ectopic expression of SKMc15, TIS7 alone and their combination side by side with the control GFP. We present here the effects of stable expression of ectopic TIS7 and SKMc15 in dKO MEFs following the viral delivery of expression constructs, antibiotic selection and 8 days of adipocyte differentiation.

      9)There is no mention of the impact on brown adipose tissue (BAT) differentiation of KO of TIS7, SKMc15, or the combination. Given the role of BAT in systemic metabolism beyond energy expenditure, the authors need to comment on this issue.

      Response: We thank the reviewer for bringing up this important point that prompted us to better describe the phenotype of TIS7, SKMc15 and double knockout mice. We measured DLK1 protein levels in BAT isolated from WT, TIS7, and SKMc15 mice with single and double knockout and detected a significant increase in DLK1 protein levels in all three knockout genotypes. Five mice per genotype were analyzed, and the statistical analysis in Figure 4I represents the mean ± STD. The p-values are based on the results of the Student's t-test and one-way Anova analysis (p-value = 0.0241).

      **Minor comments:**

      10)The y axis in Fig. 2c is labeled as gain of body weight (g). Is it really the case that WT mice gained 30 g of body weight after just 3 weeks of HFD? This rate of increase seems extraordinary, and somewhat unlikely. Please re-check the accuracy of this panel.

      Response: We thank the reviewer for drawing our attention to the apparent mislabeling of the y-axis. The correct labeling is: "Increase in body weight in %" and Figure 1F has been corrected accordingly.

      11)The Methods indicates all statistical analysis was performed using t tests, but this is at odds with some figure legends that indicate additional tests (e.g., ANCOVA).

      Response: This inaccurate information in the manuscript was corrected.

      12)Please specify in all cases the WAT depot used for the analysis shown (e.g., Fig. 3d is just labeled as WAT, as are Fig. 4a,e, etc.).

      Response: This information was added at all appropriate places of the manuscript.

      13)Fig. 5d is missing error bars, giving the impression that this experiment was performed only once (Fig. 5c). The legend has no details. Please amend.

      __Response: __We thank the reviewer for this important point regarding the statistical analyses. In the new version of the manuscript, we have included a graph (now Figure 4D) depicting results of three independent experiments including the results of the statistical analysis performed. Statistical analysis was performed using One-Way ANOVA (P=0.0016).

      Reviewer #1 (Significance (Required)):

      The role of TIS7 in adipocyte differentiation is well established. The only truly novel finding in this work is the observation that SKMc15 also plays a role in adipogenesis. The molecular mechanisms proposed (modulation of DLK-1 levels) are not novel, but make sense. However, they need to be bolstered by additional data.

      **Referees cross-commenting**

      I think we are all in agreement that the findings in this work are of interest, but that significant additional work is required to discern the mechanisms involved. In my view, a direct and specific link between SKMc15 and translation of DLK-1 needs to be established and its significance for adipogenesis in cells derived from the SVF of fat pads determined. Reviewer 2 has suggested some concrete ways to provide evidence of a direct link.

      __Response: __We agree with the reviewer's comment and have also noted that this point will be crucial in assessing the novelty value of our manuscript, as was also expressed in the referees cross-commenting. Therefore, we have now additionally performed a polysomal RNA analysis, which has of course been included in the current version of the manuscript.

      We analyzed the differences in DLK-1 translation between wild-type control cells and SKMc15 knockout cells in the gradient-purified ribosomal fractions by DLK-1 qPCR. Our analysis identified significantly (pSimilarly, as proposed by the reviewer, we have established stromal vascular fraction cell cultures from inguinal fat pads. In SVF cells of TIS7 and SKMc15 single and double knockout mice, we found increased DLK1 mRNA and protein levels (Figures 2F,G and H) as well as decreased PPARg and C/EBPa levels (Figures 3C,D,E and F). Specifically, we found that the ability of knockout SVF cells to differentiate into adipocytes was significantly downregulated (Figures 2A and B), fully confirming our original findings in TIS7 and SKMc15 knockout MEFs.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      **Summary:**

      In the current study, Vietor et al. aimed to explore the regulation of Delta-like homolog 1 (DLK-1), an inhibitor of adipogenesis, and demonstrated a role for TIS7 and its orthologue SKMc15 in the regulation of adipogenesis by controlling the level of DLK-1. Using mouse models with whole body deficiency of TIS7 (TIS7 KO) or SKMc15 (SKMc15KO) and double KO (TIS7 and SKMc15 dKO) mice, the authors used a combination of in-vivo experiments and cell culture experiments with mouse embryonic fibroblasts derived from the KO animals, to show that the concurrent depletion of TIS7 and SKMc15 dramatically reduced the amount of adipose tissues and protected against diet-induced obesity in mice, which was associated with defective adipogenesis in vitro.

      **Major Comments:**

      Overall, this study presents convincing evidence that TIOS7 and SKMc15 are necessary for optimal adipogenesis, and proposes a novel mechanism for the control of DLK1 abundance via coordinated regulation of DLK-1 transcription and translation. However, a number of questions remain largely unanswered. In particular, the direct ability of SKMc15 to regulate the translation of DLK-1 is lacking, and this claim remains speculative. SKMc15 being a general inhibitor of translation, SKMc15 may have an effect on adipogenesis independently of its regulation of DLK-1. Thus, addressing the following comments would further improve the quality of the manuscript:

      Response:

      We have been very attentive to these comments to improve the novelty and quality of our manuscript and have tried to address them experimentally. Therefore, this thorough revision of our manuscript took a longer time. First, we identified polysomal enrichment of DLK-1 RNA in SKMc15 KO MEFs, demonstrating that SKMc15 translationally affects DLK-1 levels (Figure 3I). Second, treatment with a recombinant DLK-1 protein as well as its ectopic expression quite clearly blocked adipocyte differentiation of WT MEFs (Figures EV3B,C). In addition, two different shRNA constructs targeting DLK-1 significantly induced adipocyte differentiation of TIS7 SKMc15 dKO MEFs (Figure EV2C, left and right panels). We believe that these results, taken together, sufficiently support our proposed mechanism, namely that TIS7 and SKMc15 control adipocyte differentiation through DLK-1 regulation.

      • The experimental evidence supporting that SKMc15 controls DLK-1 protein levels comes primarily from the observations that DLK-1 abundance is further increased in SKMc15 KO and dKO WAT than in TIS7KO WAT (Fig 3d), and that translation is generally increased in SKMc15 KO and dKO cells (Fig 5a). However, since the rescue experiment is performed in dKO cells, by restoring both TIS7 and SKMc15 together, it is impossible to disentangle the effects on DLK-1 transcription, DLK-1 translation and on adipogenesis. A more detailed description of the TIS7 and SKM15c single KO cells, with or without re-expression of TIS7 and SKMc15 individually, at the level of DLK-1 mRNA expression and DLK-1 protein abundance would be necessary. In addition, polyribosome fractioning followed by qPCR for DLK-1 in each fraction, and by comparison with DLK-1 global expression in control and SKMc15 KO cells, would reveal the efficiency of translation for DLK-1 specifically, and directly prove a translational control of DLK-1 by SKMc15. Alternatively, showing that DLK-1 is among the proteins newly translated in SKMc15 KO cells (Fig. 5a) would be helpful. Response: As suggested by the reviewer we used single TIS7 and SKMc15 knockout cells and demonstrated that both, TIS7 and SKMc15, affect Dlk-1 mRNA levels. We identified a highly significant effect on total DLK-1 mRNA levels in SKMc15 knockout MEFs as presented in Figure 3H. We also show that DLK-1 mRNA is specifically enriched in polysomal fractions obtained from proliferating SKMc15 knockout MEFs when compared to WT MEFs. However, the strong accumulation of DLK-1 mRNA in polysomes cannot be explained by transcriptional upregulation of DLK-1 alone, suggesting that regulation also occurs at the translational level. We took up this suggestion and ectopically expressed TIS7 and SKMc15 separately or together. For this purpose, we used not only MEF cell lines with double knockout but also with single knockout. Our recent data showed that stable ectopic expression of SKMc15 significantly increased adipocyte differentiation in both, single and double TIS7 and SKMc15 knockout MEF cell lines (Figures EV1C,D and EV2A). Ectopic expression of TIS7 significantly induced the adipocyte differentiation in TIS7 single knockout MEFs (Figure EV1C). In addition, both genes down regulated DLK-1 mRNA expression in dKO MEFs (Figure EV2A, bar chart on the right). We fully agree with the opinion of both reviewers and as already explained above we identified by qPCR in the polysomes that SKMc15 directly regulates DLK-1 translation (Figure 3I).

      • While the scope of the study focuses on the molecular control of adipogenesis by TIS7 and SKMc15 via the regulation of DLK-1, basic elements of the metabolic characterization of the KO animals providing the basis for this study would be useful. Since the difference in body weight between WT and dKO animals is already apparent 1 week after birth (Fig 1a), it would be interesting to determine whether the fat mass is decreased at an earlier age than 6 months (Fig 1b). The dKO mice are leaner despite identical food intake, activity and RER (Sup Fig 1). It remains unclear whether defective fat mass expansion is a result or consequence of this phenotype. Is the excess energy stored ectopically? The authors mention defective lipid absorption, however, these data are not presented in the manuscript. It would be interesting to investigate the relative contribution of calorie intake and adipose lipid storage capacity in the resistance to diet-induced obesity. In addition, data reported in Fig 1c seem to indicate a preferential defect in visceral fat development, as compared to subcutaneous fat. It would be relevant if the authors could quantify it and comment on it. Are TIS7 and SKMc15 differentially expressed in various adipose depots? The authors used embryonic fibroblasts as a paradigm to study adipogenesis. It would be important to investigate, especially in light of the former comment, whether pre-adipocytes from subcutaneous and visceral stroma-vascular fractions present similar defects in adipogenesis. Response: We addressed the issue of lipid storage capacity raised by the reviewer using two experimental methods. First, we have analyzed feces of mice fed with high fat diet. The free fatty acids content in dKO mice feces was significantly (PConcerning the question of younger animals, we have repeated microCT fat measurements on a group of 1-2 months old WT and dKO male mice (n=4 per group). The total amount of abdominal fat was in WT mice significantly higher than in dKO mice (P=0.019; Student’s T-test). We provide these data only for the reviewer’s information here and do not present them in the manuscript.

      We have also followed the reviewer’s advice and revisited our microCT measurements of abdominal fat and anylyzed the possible differences between subcutaneous and visceral fat. In all three types of abdominal fat mass measurement (total, subcutaneous and visceral) there was always significantly (ANOVA P=0.034 subcutaneous, P=0.002 total and P=0.002 visceral fat) less fat in the dKO group (n=8) of mice when compared to WT (n=12) mice. However, the difference was more prominent in visceral (P=0.001; Student’s T-test) than in subcutaneous fat (P=0.027; Student’s T-test). We provide these data only for the reviewer’s information here and do not present them in the manuscript.

      In addition, we have analyzed the expression of TIS7 and SKMc15 mRNA expression in both, inguinal and gonadal WAT. Our qPCR result showed that both genes are expressed in different types of WAT. The qPCR analysis was performed on RNA isolated from undifferentiated SVF cells isolated from several animals. The expression of TIS7 and SKMc15 was normalized on GAPDH. Data represent mean and standard deviation of technical replicates from several mice as labeled in the graph. We provide these data only for the reviewer’s information here and do not present them in the manuscript.

      Topics of a) stromal vascular fraction as a source of pre-adipocytes and b) comparison of TIS7 and SKMc15 roles in gonadal vs. inguinal fat pads we answered in response to the Reviewer #1, point 7. The results are presented in Figures 2, 3 and 4 and in this document.

      Both data and methods are explained clearly. The experiments are, for the most part, adequately replicated. However, whenever multiple groups are compared, ANOVA should be employed instead of t-test for statistical analysis.

      Response: Thank you for pointing this out. Wherever it was applicable, we used ANOVA for the statistical analysis of data.

      **Minor comments:**

      • Figure 4 d. The appropriate control would be WT with empty vector Response: this experiment was entirely replaced by the new Figure 3B where stably transfected MEF cells expressing TIS7 or SKMc15 were used.

      • Figure 7c/d. The appropriate control would be WT with empty vector Response: We have now generated new, confirmatory data in MEF cells stably expressing TIS7 or SKMc15 following lentiviral expression.

      • Figure 5C. An additional control would be WT with WT medium __Response: __We agree with your suggestion and therefore we have incorporated this control in all experimental repeats presented in the new Figure 4C.

      • Figure 2: In the legends, the "x" is missing for the dKO regression formula __Response: __Thank you, we have corrected this mistake. In the current version of the manuscript it is Figure 1D.

      • Since the role of SKMc15 in adipogenesis has never been described, the authors could consider describing the single SKMc15 KO in addition to the dKO, or explain the rationale for focusing the study on dKO. __Response: __The original reason for focusing on dKO mice and cells was the obvious and dominant phenotype in this animal model. However, we have sought to address the reviewer's concerns and have now also examined DLK-1 mRNA levels in proliferating SKMc15 knockout MEFs (Figure 3H). In addition to this experiment, we measured DLK-1 mRNA levels also during the process of adipocyte differentiation of single knockout cells. In WT MEFs we observed a transient increase of DLK-1 mRNA only on day 1. In contrast, significantly elevated DLK-1 mRNA levels were found in TIS7 single-knockout MEFs throughout the differentiation process, with the highest level reached at day 8. Interestingly, in SKMc15 single knockout MEFs we found an upregulation of DLK-1 mRNA level in proliferating cells but not a further increase during the differentiation. This supported our idea that SKMc15 acts mainly via translational regulation of DLK-1. We provide these data only for the reviewer’s information here and do not present them in the manuscript.

      To emphasize this point, we revised the entire manuscript accordingly and added data on SKMc15 knockout mice. In particular, experiments presenting data characterizing SKMc15 single knockout mice are presented in: Figures 1C,D,E and F, Figures 2A,B,C and D, Figures 3E,F,H and I, Figures 4A and I and in Figure EV1D.

      Reviewer #2 (Significance (Required)):

      While the effects of DLK-1 on adipogenesis have been widely documented, the factors controlling DLK-1 expression and function remain poorly understood. Here the authors propose a novel mechanism for the regulation of DLK-1, and how it affects adipocyte differentiation. This study should therefore be of interest for researchers interested in the molecular control of adipogenesis and cell differentiation in general. Furthermore, the characterization of the function of SKMc15 in the control of translation may be of interest to a broader readership.

      **Referees cross-commenting**

      I agree with all the comments raised by the other reviewers. Addressing the often overlapping but also complementary questions would help to clarify the molecular mechanisms by which TIS7 and SKMc15 control adipogenesis, and support the conclusions raised by the authors.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      In the article, "The negative regulator DLK1 is transcriptionally regulated by TIS7 (IFRD1) and translationally by its orthologue SKMc15 (IFRD2)", the authors performed a double knockout (dKO) of TIS7 and its orthologue SKMc15 in mice and could show that those dKO mice had less adipose tissue compared to wild-type (WT) mice and were resistant to a high fat-diet induced obesity. The study takes advantage of number of different methods and approaches and combines both in vivo and in vitro work. However, some more detailed analysis and clarifications would be needed to fully justify some of the statements. Including the role of TIS7 as a transcriptional regulator of DLK1, SKMc15 as translational regulator of DLK1 and overall contribution of DLK1 in the observed differentiation defects. The observed results could still be explained by many indirect effects caused by the knock-outs and more direct functional connections between the studied molecules would be needed. Moreover, some assays appear to be missing biological replicates and statistical analysis. Please see below for more detailed comments:

      **Major comments:**

      -Are the key conclusions convincing? Yes.

      -Should the authors qualify some of their claims as preliminary or speculative, or remove them altogether? No.

      -Would additional experiments be essential to support the claims of the paper? Yes. Please see my comments.

      -Are the suggested experiments realistic in terms of time and resources? Recombinant DLK1 10 μg - Tetu-bio - 112€ ; 8 days of adipocyte differentiation in 3 biological replicate ~ 1 month.

      __Response: __We followed the advice of the individual reviewers as expressed in “Referees cross-commenting” and tested this idea experimentally. Since the manufacturer couldn’t suppy information on biological activities of recombinant DLK-1 proteins, we analyzed in vivo the effects of two different ones, namely RPL437Mu01 and RPL437Mu02. The 8-day adipocyte differentiation protocol showed that the RPL437Mu02 protein was cytotoxic to WT MEF cells and therefore could not be used for analysis. On the other hand, treatment with the Mu01 recombinant DLK-1 protein did not result in a substantial cell death. According to oil red O staining, incubation with 3.3 mg/ml (final concentration) RPL437Mu01 led to 75% inhibition of adipocyte differentiation when compared to not treated WT MEFs (Figure EV3B and C).

      -Are the data and the methods presented in such a way that they can be reproduced? Yes.

      -Are the experiments adequately replicated and statistical analysis adequate?

      Adequately reproduced yes. Please see my comments concerning the statistical analysis.

      1)Fig1a: In the method section it is written that an unpaired 2-tailed Student's t test was used for all statistical comparisons. However, here something like Multivariate analysis of variance (MANOVA) should rather be used to assess statistical significance between the mice. Moreover, the details of this should be clearly stated in the corresponding Figure legend.

      __Response: __Based on this suggestion, we have revised all of our statistical analyses. In several cases, (Figures 1F, 2B and C) we have replaced the statistical analysis using Student’s T test with Anova. However, based on the definition “the difference between ANOVA and MANOVA is merely the number of dependent variables fit. If there is one dependent variable then the procedure ANOVA is used”, in case of Figure 1A we used ANOVA.

      2)Fig2a: please use an appropriate title for Fig2a instead of "Abdominal fat vs. body mass".

      Response: Title of the Figure 1D (formerly Figure 2a) we changed to “Effect of TIS7 and SKMc15 on the abdominal fat mass”.

      3)Fig2c: in the method section it is written that an unpaired 2-tailed Student's t test was used for all statistical comparisons. However, in Fig2c 4 groups are compared (WT, TIS7 KO, SKMc15 KO and dKO) and thus something like Multivariate analysis of variance (MANOVA) should rather be used to assess statistical significance.

      Response: For Figure 1F (formerly Figure 2c), in the revised version of the manuscript, we applied the ordinary one-way ANOVA with Holm-Šidák's multiple comparison test. This analysis gave us statistically even more significant results concerning the difference between WT and dKO mice than previously found by Student's T test. The results in detail were as follows:

      Holm-Šidák's multiple comparisons test Summary Adjusted P Value

      WT vs. TIS7 KO ** 0,0096

      WT vs. SKMc15 KO * 0,0308

      WT vs. dKO **** 4)Fig2 conclusion: Additive or just showing stronger effect?

      Response: We have re-phrased the concluding summary for Figure 1F (formerly Figure 2c). We agree that the precise description of differences found between the weight of single and double knockout animals should be described as “stronger” and not additive effect of knockout of both genes.

      5)Fig3a: the microscope picture for SKMc15 KO shows that cells might have died. Please state the percentage of cell death.

      Response: We would like to comment on these concerns of the reviewer as follows: In the image in Figure 3 of the original manuscript, the density of SKMc15 KO MEF cells after the adipocyte differentiation protocol was lower than in the WT control. Regarding the possible cell death, the cells stained with Oil Red O were adherent and alive. The adipocyte differentiation protocol consists of 3 days proliferation and further 5 days of differentiation including three changes of media during which dead cells are washed away and their vitality cannot be checked. However, in the meantime, we have repeated this protocol and the density of SKMc15 knockout MEFs was now not substantially lower than those of controls. Despite the comparable cell density, we have seen a substantial negative effect of the SKMc15 knockout on the adipogenic differentiation ability of these cells. Several examples are shown here:

      TIS7 +/+ SKMc15 +/+ MEFs

      TIS7 +/+ SKMc15 -/- MEFs

      oil red O staining; 8d differentiated cells

      Importantly, in the current version of our manuscript we replaced MEFs (shown in the former Figure 3a) by SVF cells (Figure 2A in the current manuscript). In these cells we did not see any significant difference in their density after 8 days of the adipocyte differentiation protocol.

      6)Fig3b: It would be informative to additionally observe some of marker genes for adipogenesis and whether all of them are affected.

      Response: In our newly established SVF cell lines, derived from inguinal WAT we have confirmed data previously identified in MEFs. As shown in the new Figure 3, PPARg and C/EBPa mRNA levels were downregulated in all knockout SVF cell lines, both undifferentiated (Figures 3C and D) and adipocyte differentiated (Figures 3E and F). On the other hand, DLK-1 mRNA and protein levels, both in undifferentiated (Figures 2F and G) and adipocyte differentiated (Figure 2H) SVF cells were significantly upregulated in dKO cells when compared to WT cells.

      7)Fig3b: instead of using an unpaired 2-tailed Student's t test with proportion, an one-way ANOVA would be more appropriate.

      __Response: __On the recommendation of the reviewer, we applied a simple ANOVA to our new data from SVF cells using the Holm-Šidák test for multiple comparisons. The Anova summary using GraphPad Prism Ver. 9.2 identified statistically highly significant (P value 8)Fig3c: Same comment as for Fig3b.

      __Response: __Also, in this experiment (now Figure 2C) we used ordinary one-way ANOVA with Holm-Šidák's multiple comparisons test. The ANOVA summary identified statistically highly significant (P value 9)Fig3d: A representative Western blot for 3 independent experiments is shown. Please add the other two as supplementary materials.

      __Response: __Here we provide examples of the requested two additional, independent experiments. These refer now to the Figure 2D in the revised version of the manuscript:

      31 07 2020

      = manuscript

      b____-catenin

      22 07 2020

      WT

      TIS7 KO

      dKO

      SKMc15 KO

      WT

      TIS7 KO

      dKO

      SKMc15 KO

      actin

      b____-catenin

      30 07 2020

      actin

      b____-catenin

      WT

      TIS7 KO

      dKO

      SKMc15 KO

      WT

      TIS7 KO

      dKO

      SKMc15 KO

      actin

      10)Fig3d:Is this distinguishing between the active and inactive catenin?

      __Response: __No, the b-catenin antibody, that we used is not discriminating between active and inactive b-catenin forms.

      11)Fig4a: Please perform qPCR for measuring DLK-1 mRNA levels in TIS7 KO and SKMc15 KO samples to check whether there is a correlation between mRNA and protein level as the statement of the authors is that "DLK1 is transcriptionally regulated by TIS7 (IFRD1) and translationally by its orthologue SKMc15".

      Response: Similar questions were raised by Reviewer 2 on p. 11 “Since the role of SKMc15 in adipogenesis has never been described, the authors could consider describing the single SKMc15 KO in addition to the dKO, or explain the rationale for focusing the study on dKO.” Please see our reply to his comment.

      12)Fig4c: please add the other two western blots as supplementary materials.

      __Response: __Here we provide data from two additional, independent experiments.

      13)Fig4d: The effects in MEFs appear quite modest. What about a rescue with TIS7 or SKMc15 alone?

      __Response: __As mentioned already in response to the question 2 of Reviewer #1, in our newly performed experiments we found significant inhibitory effects of ectopic TIS7 and SKMc15 expression on DLK1 levels, identified both by qPCR and WB analyses (Figure 3B).

      14)Page 12, row 207: I would not call histones transcription factors.

      __Response: __We re-phrased this sentence accordingly.

      15)Fig4e: Would be good to see a schematic overview of the locations of the ChIP primers in relation to the known binding sites and the gene (TSS, gene body). Moreover, the results include an enrichment for only one region while in the text two different regions are discussed. Importantly, to confirm the specificity of the observed enrichment, a primer pair targeting an unspecific control region not bound by the proteins should be included.

      __Response: __The selection of oligonucleotide sequences used for ChIP analyses of the binding of b-catenin, TIS7 and SKMc15 to the Dlk-1 promoter was, based on the following reference, as mentioned in Methods section of our original manuscript on p.21, line 494: Paul C, Sardet C, Fabbrizio E. “The Wnt-target gene Dlk-1 is regulated by the Prmt5-associated factor Copr5 during adipogenic conversion”. Biol Open. 2015 Feb 13;4(3):312-6. doi: 10.1242/bio.201411247.

      We used two regions of the Dlk-1 promoter: a proximal one, encompassing the TCF binding site 2 (TCFbs2) and a more distal one, annotated as “A”:

      Oligonucleotide sequences used for ChIP PCR:

      Dlk-1 TCFbs2 5'f CATTTGACGGTGAACATATTGG

      5'r GCCCAGACCCCAAATCTGTC

      Dlk-1 region A (-2263/-2143) 5'f TTGTCTAACCACCCTACCTCAAA

      5’r CTCTGAGAAAAGATGTTGGGATTT

      We observed specific binding at the proximal site.

      16)Fig5a: Has this experiment been replicated? That is no mention about the reproducibility or quantification of this result. This is the main experiment regarding the role of SKMc15 as a translational regulator of DLK1, also mentioned in the title of the manuscript.

      __Response: __This relates to the Figure 4A in the revised manuscript. Yes, we repeated this experiment several times. Here we provide images and quantifications of three independent experiments.

      17)Fig5b: Showing another unaffected secreted protein would be an appropriate control here.

      Response: As recommended by the reviewer, we have performed an additional WB with a recombinant anti-Collagen I antibody [Abcam, [EPR22209-75] ab255809]. Medium from 8 days adipocyte differentiated WT and dKO MEFs was concentrated using Centriprep 30K and resolved on 10% SDS-PAGE gel. Western blot presented in the new Fig 4 B shows even slightly higher amounts of Collagen-1 protein in medium from WT than in dKO MEFs. Mw of the detected band was approximately 35 kDa, which corresponded to the manufacturer’s information.

      18)Fig5c: I would recommend to perform additional experiments to prove that DLK-1 secreted in the medium can contribute and is responsible for the inhibition of the differentiation. Indeed, a time course of adipocyte differentiation followed by the addition of soluble DLK-1 would confirm that DLK-1 can inhibit adipocyte differentiation in this experimental setup. Moreover, silencing (for example RNAi) of DLK1 in the dKO cells before harvesting the conditioned media would allow to estimate the contribution of DLK1 to the observed inhibition of differentiation by the media. This is important because many other molecules could also be mediating this inhibition.

      __Response: __We agree with this reviewer’s concern, which are shared by other reviewers. Similarly, as in response to Reviewer #2 and as already mentioned above, in response to “major comments” of Reviewer #3, in our novel experiments we found that treatment with recombinant DLK-1 protein as well as ectopic expression of DLK-1 blocked adipocyte differentiation of WT MEFs (Figures EV3B,C,D and E) as well as medium from dKO shDLK-1 391 cells (Figure EV3F).

      19)Fig5c: The details and the timeline of the experiment with conditioned media are not provided in the figure or in the methods. At what time point was conditioned media changed? How long were the cells kept in conditioned media? How does this compare to the regular media change intervals? Could the lower differentiation capacity relate to turnover of the differentiation inducing compounds in the media due to longer period between media change? Moreover, is the result statistically significant after replication?

      __Response: __Based on the reviewer`s comment we have added technical information concerning the experimental protocol of the treatment with conditioned media. In general, the treatment for adipocyte differentiation was identical with the previous experiments. The only difference was that after three days in proliferation medium, we used either fresh differentiation medium or 2-day-old differentiation medium from dKO control or dKO-shDLK-1 391 cell cultures then for wild-type cells, as shown in the figure (Figure EV3F). Cells were incubated additional five days with the differentiation medium with two changes of media, every second day. The adipocyte differentiation of medium “donor” cells and the DLK-1 protein levels in these cells were monitored by oil red O staining and Western blot analysis, respectively.

      Additionally, we show now in Figure 4C representative images from three independent biological repeats and in Figure 4D the statistical analysis confirming a significant decrease in adipocyte differentiation ability of WT MEFs following their incubation with a conditioned differentiation medium from dKO MEFs.

      20)Fig5d: please add a statistical analysis of the oil-red-o quantification.

      __Response: __As requested, we included statistical analysis of at least three independent experiments. In Figure 4D we present the statistical analysis confirming a significant decrease in adipocyte differentiation of WT MEFs following their incubation with the differentiation medium from dKO cells. Additionally, Figure 4C shows representative images of oil red O staining from several independent experiments.

      21)Fig7c-d: Does overexpression also rescue the PPARg and CEBPa induction during differentiation. The importance of their induction in undifferentiated MEFs is a little difficult to judge.

      __Response: __We have focused our attention primarily on the ability of TIS7 and SKMc15 to “rescue” the adipocyte differentiation phenotype of dKO MEFs. dKO MEFs stably expressing SKMc15, TIS7 or both genes were differentiated into adipocytes for 8 days and afterwards stained with oil red O. There was a statistically significant increase in oil red O staining following the individual ectopic expression of SKMc15 (p=5.7E-03), a negative effect of TIS7 ectopic expression and a significant (p=9.3E-03), positive effect of co-expression of both genes (Figure EV2A). We found a significant decrease in Dlk-1 mRNA expression following the ectopic expression of TIS7 and/or SKMc15 (Figure EV2A, very right panel). However, C/EBPa mRNA levels were only partially rescued in 8 days differentiated MEFs by TIS7 and/or SKMc15 ectopic expression, and PPARg mRNA levels were not significantly altered.

      22)Fig8: it is not surprising that PPARg targets are not induced in the absence of PPARg. What is the upstream event explaining this defect? Is DLK1 alone enough to explain the results? Could there be additional mediators of the differences? How big are transcriptome-wide differences between WT MEFs and dKO MEFs?

      __Response: __We agree with the reviewer that the lean phenotype of dKO mice most likely cannot be explained by simple transcriptional regulation of PPARg. Although we showed that in undifferentiated MEFs, the levels of PPARg and C/EBPa are controlled (or upregulated) by both TIS7 and SKMc15, we also expected differences in the expression of genes regulating fat uptake. To determine changes in expression of lipid processing and transporting molecules, we performed transcriptome analyses of total RNA samples isolated from the small intestines of HFD-fed WT type and dKO animals. Cluster analyses of lipid transport-related gene transcripts revealed differences between WT type and dKO animals in the expression of adipogenesis regulators. Those included among other genes the following, mentioned as examples:

      • peroxisome proliferator-activated receptors γ (PPARγ) and d [2], fatty acid binding proteins 1 and 2 (FABP1, 2) [3],
      • cytoplasmic fatty acid chaperones expressed in adipocytes,
      • acyl-coenzyme A synthetases 1 and 4 (ACSL1,4) found to be associated with histone acetylation in adipocytes, lipid loading and insulin sensitivity [4],
      • SLC27a1, a2 fatty acid transport proteins, critical mediators of fatty acid metabolism [5],
      • angiotensin-converting enzyme (ACE) playing a regulatory role in adipogenesis and insulin resistance [6],
      • CROT, a carnitine acyltransferase important for the oxidation of fatty acids, a critical step in their metabolism [7],
      • phospholipase PLA2G5 robustly induced in adipocytes of obese mice [8]; [9]. Parts of the following text are embedded in the manuscript.

      We decided to study in more detail the regulation of CD36 that encodes a very long chain fatty acids (VLCFA) transporter because CD36 is an important fatty acid transporter that facilitates fatty acids (FA) uptake by heart, skeletal muscle, and also adipose tissues [10]. PPARγ induces CD36 expression in adipose tissue, where it functions as a fatty acid transporter, and therefore, its regulation by PPARγ contributes to the control of blood lipids. Diacylglycerol acyltransferase 1 (DGAT1), a protein associated with the enterocytic triglyceride absorption and intracellular lipid processing is besides CD36 another target gene of adipogenesis master regulator PPARγ [11]. DGAT1 mRNA levels are strongly up regulated during adipocyte differentiation [12], its promoter region contains a PPARγ binding site and DGAT1 is also negatively regulated by the MEK/ERK pathway. DGAT1 expression was shown to be increased in TIS7 transgenic mice [13] and its expression was decreased in the gut of high fat diet-fed TIS7 KO mice [14]. Importantly, DGAT1 expression in adipocytes and WAT is up regulated by PPARγ activation [11].

      Heatmap of hierarchical cluster analysis of intestinal gene expression involved in lipid transport altered in TIS7 SKMc15 dKO mice fed a high-fat diet for 3 weeks.

      What is the upstream event explaining this defect?

      Wnt pathway causes epigenetic repression of the master adipogenic gene PPARγ. There are three epigenetic signatures implicated in repression of PPARγ: increased recruitment of MeCP2 (methyl CpG binding protein 2) and HP-1α co-repressor to PPARγ promoter and enhanced H3K27 dimethylation at the exon 5 locus in a manner dependent on suppressed canonical Wnt. These epigenetic effects are reproduced by antagonism of canonical Wnt signaling with Dikkopf-1.

      Zhu et al. showed that Dlk1 knockdown causes suppression of Wnt and thereby epigenetic de-repression of PPARγ [15]. Dlk1 levels positively correlate with Wnt signaling activity and negatively with epigenetic repression of PPARγ [16]. Activation of the Wnt pathway caused by DLK1 reprograms lipid metabolism via MeCP2-mediated epigenetic repression of PPARγ [17]. Blocking the Wnt signaling pathway abrogates epigenetic repressions and restores the PPARγ gene expression and differentiation [18].

      **Minor comments:**

      1)Please use the same font in the main text for the references.

      Response: We thank the reviewer for the remark. This issue was corrected.

      Reviewer #3 (Significance (Required)):

      The study provides interesting insights into the role of these factors in adipocyte differentiation that would be relevant especially to researchers working on adipogenesis and cellular differentiation in general. The authors find the studied factors to have additive contribution to the differentiation efficiency. However, the exact nature of the roles and whether they are strictly speaking additive or synergistic is not clear. More detailed analysis of their contribution and molecular interplay would add to the broader interest of the study on molecular networks controlling cellular differentiation.

      **Referees cross-commenting**

      I very much agree on the different points raised by the other reviewers, some of which are also matching my own already raised concerns. And therefore it makes sense to request these modifications from the authors.

      References

      1. Rozman, J., M. Klingenspor, and M. Hrabe de Angelis, A review of standardized metabolic phenotyping of animal models. Mamm Genome, 2014. 25(9-10): p. 497-507.
      2. Lefterova, M.I., et al., PPARgamma and the global map of adipogenesis and beyond. Trends Endocrinol Metab, 2014. 25(6): p. 293-302.
      3. Garin-Shkolnik, T., et al., FABP4 attenuates PPARgamma and adipogenesis and is inversely correlated with PPARgamma in adipose tissues. Diabetes, 2014. 63(3): p. 900-11.
      4. Joseph, R., et al., ACSL1 Is Associated With Fetal Programming of Insulin Sensitivity and Cellular Lipid Content. Mol Endocrinol, 2015. 29(6): p. 909-20.
      5. Anderson, C.M. and A. Stahl, SLC27 fatty acid transport proteins. Mol Aspects Med, 2013. 34(2-3): p. 516-28.
      6. Riedel, J., et al., Characterization of key genes of the renin-angiotensin system in mature feline adipocytes and during in vitro adipogenesis. J Anim Physiol Anim Nutr (Berl), 2016. 100(6): p. 1139-1148.
      7. Zhou, S., et al., Increased missense mutation burden of Fatty Acid metabolism related genes in nunavik inuit population. PLoS One, 2015. 10(5): p. e0128255.
      8. Wootton, P.T., et al., Tagging SNP haplotype analysis of the secretory PLA2-V gene, PLA2G5, shows strong association with LDL and oxLDL levels, suggesting functional distinction from sPLA2-IIA: results from the UDACS study. Hum Mol Genet, 2007. 16(12): p. 1437-44.
      9. Sergouniotis, P.I., et al., Biallelic mutations in PLA2G5, encoding group V phospholipase A2, cause benign fleck retina. Am J Hum Genet, 2011. 89(6): p. 782-91.
      10. Coburn, C.T., et al., Defective uptake and utilization of long chain fatty acids in muscle and adipose tissues of CD36 knockout mice. J Biol Chem, 2000. 275(42): p. 32523-9.
      11. Koliwad, S.K., et al., DGAT1-dependent triacylglycerol storage by macrophages protects mice from diet-induced insulin resistance and inflammation. J Clin Invest, 2010. 120(3): p. 756-67.
      12. Cases, S., et al., Identification of a gene encoding an acyl CoA:diacylglycerol acyltransferase, a key enzyme in triacylglycerol synthesis. Proc Natl Acad Sci U S A, 1998. 95(22): p. 13018-23.
      13. Wang, Y., et al., Targeted intestinal overexpression of the immediate early gene tis7 in transgenic mice increases triglyceride absorption and adiposity. J Biol Chem, 2005. 280(41): p. 34764-75.
      14. Yu, C., et al., Deletion of Tis7 protects mice from high-fat diet-induced weight gain and blunts the intestinal adaptive response postresection. J Nutr, 2010. 140(11): p. 1907-14.
      15. Zhu, N.L., et al., Hepatic stellate cell-derived delta-like homolog 1 (DLK1) protein in liver regeneration. J Biol Chem, 2012. 287(13): p. 10355-10367.
      16. Zhu, N.L., J. Wang, and H. Tsukamoto, The Necdin-Wnt pathway causes epigenetic peroxisome proliferator-activated receptor gamma repression in hepatic stellate cells. J Biol Chem, 2010. 285(40): p. 30463-71.
      17. Tsukamoto, H., Metabolic reprogramming and cell fate regulation in alcoholic liver disease. Pancreatology, 2015. 15(4 Suppl): p. S61-5.
      18. Miao, C.G., et al., Wnt signaling in liver fibrosis: progress, challenges and potential directions. Biochimie, 2013. 95(12): p. 2326-35.
    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      In the article, "The negative regulator DLK1 is transcriptionally regulated by TIS7 (IFRD1) and translationally by its orthologue SKMc15 (IFRD2)", the authors performed a double knockout (dKO) of TIS7 and its orthologue SKMc15 in mice and could show that those dKO mice had less adipose tissue compared to wild-type (WT) mice and were resistant to a high fat-diet induced obesity. The study takes advantage of number of different methods and approaches and combines both in vivo and in vitro work. However, some more detailed analysis and clarifications would be needed to fully justify some of the statements. Including the role of TIS7 as a transcriptional regulator of DLK1, SKMc15 as translational regulator of DLK1 and overall contribution of DLK1 in the observed differentiation defects. The observed results could still be explained by many indirect effects caused by the knock-outs and more direct functional connections between the studied molecules would be needed. Moreover, some assays appear to be missing biological replicates and statistical analysis. Please see below for more detailed comments:

      Major comments:

      -Are the key conclusions convincing? Yes.

      -Should the authors qualify some of their claims as preliminary or speculative, or remove them altogether? No.

      -Would additional experiments be essential to support the claims of the paper? Yes. Please see my comments.

      -Are the suggested experiments realistic in terms of time and resources? Recombinant DLK1 10 μg - Tetu-bio - 112€ ; 8 days of adipocyte differentiation in 3 biological replicate ~ 1 month.

      -Are the data and the methods presented in such a way that they can be reproduced? Yes.

      -Are the experiments adequately replicated and statistical analysis adequate? Adequately reproduced yes. Please see my comments concerning the statistical analysis.

      1)Fig1a: In the method section it is written that an unpaired 2-tailed Student's t test was used for all statistical comparisons. However, here something like Multivariate analysis of variance (MANOVA) should rather be used to assess statistical significance between the mice. Moreover, the details of this should be clearly stated in the corresponding Figure legend.

      2)Fig2a: please use an appropriate title for Fig2a instead of "Abdominal fat vs. body mass".

      3)Fig2c: in the method section it is written that an unpaired 2-tailed Student's t test was used for all statistical comparisons. However, in Fig2c 4 groups are compared (WT, TIS7 KO, SKMc15 KO and dKO) and thus something like Multivariate analysis of variance (MANOVA) should rather be used to assess statistical significance.

      4)Fig2 conclusion: Additive or just showing stronger effect?

      5)Fig3a: the microscope picture for SKMc15 KO shows that cells might have died. Please state the percentage of cell death.

      6)Fig3b: It would be informative to additionally observe some of marker genes for adipogenesis and whether all of them are affected.

      7)Fig3b: instead of using an unpaired 2-tailed Student's t test with proportion, an one-way ANOVA would be more appropriate.

      8)Fig3c: Same comment as for Fig3b.

      9)Fig3d: A representative Western blot for 3 independent experiments is shown. Please add the other two as supplementary materials.

      10)Fig3d:Is this distinguishing between the active and inactive catenin?

      11)Fig4a: Please perform qPCR for measuring DLK-1 mRNA levels in TIS7 KO and SKMc15 KO samples to check whether there is a correlation between mRNA and protein level as the statement of the authors is that "DLK1 is transcriptionally regulated by TIS7 (IFRD1) and translationally by its orthologue SKMc15".

      12)Fig4c: please add the other two western blots as supplementary materials.

      13)Fig4d: The effects in MEFs appear quite modest. What about a rescue with TIS7 or SKMc15 alone?

      14)Page 12, row 207: I would not call histones transcription factors.

      15)Fig4e: Would be good to see a schematic overview of the locations of the ChIP primers in relation to the known binding sites and the gene (TSS, gene body). Moreover, the results include an enrichment for only one region while in the text two different regions are discussed. Importantly, to confirm the specificity of the observed enrichment, a primer pair targeting an unspecific control region not bound by the proteins should be included.

      16)Fig5a: Has this experiment been replicated? That is no mention about the reproducibility or quantification of this result. This is the main experiment regarding the role of SKMc15 as a translational regulator of DLK1, also mentioned in the title of the manuscript.

      17)Fig5b: Showing another unaffected secreted protein would be an appropriate control here.

      18)Fig5c: I would recommend to perform additional experiments to prove that DLK-1 secreted in the medium can contribute and is responsible for the inhibition of the differentiation. Indeed, a time course of adipocyte differentiation followed by the addition of soluble DLK-1 would confirm that DLK-1 can inhibit adipocyte differentiation in this experimental setup. Moreover, silencing (for example RNAi) of DLK1 in the dKO cells before harvesting the conditioned media would allow to estimate the contribution of DLK1 to the observed inhibition of differentiation by the media. This is important because many other molecules could also be mediating this inhibition.

      19)Fig5c: The details and the timeline of the experiment with conditioned media are not provided in the figure or in the methods. At what time point was conditioned media changed? How long were the cells kept in conditioned media? How does this compare to the regular media change intervals? Could the lower differentiation capacity relate to turnover of the differentiation inducing compounds in the media due to longer period between media change? Moreover, is the result statistically significant after replication?

      20)Fig5d: please add a statistical analysis of the oil-re3d-o quantification.

      21)Fig7c-d: Does overexpression also rescue the PPARg and CEBPa induction during differentiation. The importance of their induction in undifferentiated MEFs is a little difficult to judge.

      22)Fig8: it is not surprising that PPARg targets are not induced in the absence of PPARg. What is the upstream event explaining this defect? Is DLK1 alone enough to explain the results? Could there be additional mediators of the differences? How big are transcriptome-wide differences between WT MEFs and dKO MEFs?

      Minor comments:

      1)Please use the same font in the main text for the references.

      Significance

      The study provides interesting insights into the role of these factors in adipocyte differentiation that would be relevant especially to researchers working on adipogenesis and cellular differentiation in general. The authors find the studied factors to have additive contribution to the differentiation efficiency. However, the exact nature of the roles and whether they are strictly speaking additive or synergistic is not clear. More detailed analysis of their contribution and molecular interplay would add to the broader interest of the study on molecular networks controlling cellular differentiation.

      Referees cross-commenting

      I very much agree on the different points raised by the other reviewers, some of which are also matching my own already raised concerns. And therefore it makes sense to request these modifications from the authors.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Summary:

      In the current study, Vietor et al. aimed to explore the regulation of Delta-like homolog 1 (DLK-1), an inhibitor of adipogenesis, and demonstrated a role for TIS7 and its orthologue SKMc15 in the regulation of adipogenesis by controlling the level of DLK-1. Using mouse models with whole body deficiency of TIS7 (TIS7 KO) or SKMc15 (SKMc15KO) and double KO (TIS7 and SKMc15 dKO) mice, the authors used a combination of in-vivo experiments and cell culture experiments with mouse embryonic fibroblasts derived from the KO animals, to show that the concurrent depletion of TIS7 and SKMc15 dramatically reduced the amount of adipose tissues and protected against diet-induced obesity in mice, which was associated with defective adipogenesis in vitro.

      Major Comments:

      Overall, this study presents convincing evidence that TIOS7 and SKMc15 are necessary for optimal adipogenesis, and proposes a novel mechanism for the control of DLK1 abundance via coordinated regulation of DLK-1 transcription and translation. However, a number of questions remain largely unanswered. In particular, the direct ability of SKMc15 to regulate the translation of DLK-1 is lacking, and this claim remains speculative. SKMc15 being a general inhibitor of translation, SKMc15 may have an effect on adipogenesis independently of its regulation of DLK-1. Thus, addressing the following comments would further improve the quality of the manuscript:

      •The experimental evidence supporting that SKMc15 controls DLK-1 protein levels comes primarily from the observations that DLK-1 abundance is further increased in SKMc15 KO and dKO WAT than in TIS7KO WAT (Fig 3d), and that translation is generally increased in SKMc15 KO and dKO cells (Fig 5a). However, since the rescue experiment is performed in dKO cells, by restoring both TIS7 and SKMc15 together, it is impossible to disentangle the effects on DLK-1 transcription, DLK-1 translation and on adipogenesis. A more detailed description of the TIS7 and SKM15c single KO cells, with or without re-expression of TIS7 and SKMc15 individually, at the level of DLK-1 mRNA expression and DLK-1 protein abundance would be necessary. In addition, polyribosome fractioning followed by qPCR for DLK-1 in each fraction, and by comparison with DLK-1 global expression in control and SKMc15 KO cells, would reveal the efficiency of translation for DLK-1 specifically, and directly prove a translational control of DLK-1 by SKMc15. Alternatively, showing that DLK-1 is among the proteins newly translated in SKMc15 KO cells (Fig. 5a) would be helpful.

      •While the scope of the study focuses on the molecular control of adipogenesis by TIS7 and SKMc15 via the regulation of DLK-1, basic elements of the metabolic characterization of the KO animals providing the basis for this study would be useful. Since the difference in body weight between WT and dKO animals is already apparent 1 week after birth (Fig 1a), it would be interesting to determine whether the fat mass is decreased at an earlier age than 6 months (Fig 1b). The dKO mice are leaner despite identical food intake, activity and RER (Sup Fig 1). It remains unclear whether defective fat mass expansion is a result or consequence of this phenotype. Is the excess energy stored ectopically? The authors mention defective lipid absorption, however, these data are not presented in the manuscript. It would be interesting to investigate the relative contribution of calorie intake and adipose lipid storage capacity in the resistance to diet-induced obesity. In addition, data reported in Fig 1c seem to indicate a preferential defect in visceral fat development, as compared to subcutaneous fat. It would be relevant if the authors could quantify it and comment on it. Are TIS7 and SKMc15 differentially expressed in various adipose depots? The authors used embryonic fibroblasts as a paradigm to study adipogenesis. It would be important to investigate, especially in light of the former comment, whether pre-adipocytes from subcutaneous and visceral stroma-vascular fractions present similar defects in adipogenesis.

      We estimate the suggested experiments above realistic in terms of time and resources and important to support the major conclusions of the study. Both data and methods are explained clearly. The experiments are, for the most part, adequately replicated. However, whenever multiple groups are compared, ANOVA should be employed instead of t-test for statistical analysis.

      Minor comments:

      •Figure 4 d. The appropriate control would be WT with empty vector

      •Figure 7c/d. The appropriate control would be WT with empty vector

      •Figure 5C. An additional control would be WT with WT medium

      •Figure 2: In the legends, the "x" is missing for the dKO regression formula

      •Since the role of SKMc15 in adipogenesis has never been described, the authors could consider describing the single SKMc15 KO in addition to the dKO, or explain the rationale for focusing the study on dKO.

      Significance

      While the effects of DLK-1 on adipogenesis have been widely documented, the factors controlling DLK-1 expression and function remain poorly understood. Here the authors propose a novel mechanism for the regulation of DLK-1, and how it affects adipocyte differentiation. This study should therefore be of interest for researchers interested in the molecular control of adipogenesis and cell differentiation in general. Furthermore, the characterization of the function of SKMc15 in the control of translation may be of interest to a broader readership.

      Referees cross-commenting

      I agree with all the comments raised by the other reviewers. Addressing the often overlapping but also complementary questions would help to clarify the molecular mechanisms by which TIS7 and SKMc15 control adipogenesis, and support the conclusions raised by the authors.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      This study by Viedor et al. examines the role of TIS7 (IFRD1) and its ortholog SKMc15 (IFRD2) in the regulation of adipogenesis via their ability to modulate the levels of DLK1 (Pref-1), a well-known inhibitor of adipogenesis. They generate SKMc15 KO mice and cross them to previously published TIS7 KO mice. All 3 mutant strains show decreased fat mass, with the effect being most pronounced in double KO mice (dKO). Using mouse embryonic fibroblasts (MEFs) from mutant mice, they authors ascribe a defect in adipogenic differentiation of mutant cells to an upregulation of DLK-1. In the case of TIS7, they propose that this is due to its known inhibition of Wnt signaling, which regulates DLK-1 expression. In the case of SKMc15, they suggest a new mechanism linked to its ability to suppress translation. Overall, the work is of interest, with the finding that SKMc15 regulates adipocyte differentiation being its novelty, and generally well done, though multiple aspects need to be improved to bolster the conclusions put forth.

      Major concerns:

      1)The main mechanism put forth by the authors to explain the inability of dKO cells to differentiate into adipocytes is the upregulation of DLK-1 levels. However, this notion is never directly tested. Authors should test if knockdown of DLK-1 in dKO cells is sufficient to correct the defect in differentiation, or if additional factors are involved.

      2)There are multiple instances were the authors refer to "data not shown", such as when discussing the body length of dKO mice. Please show the data in all cases (Supplementary Info is fine) or remove any discussion of data that is not shown and cannot be evaluated.

      3)Indirect calorimetry data shown in Fig. S1 should include an entire 24 hr cycle and plots of VO2, activity and other measured parameters shown (only RER and food intake are shown), not just alluded to in the legend.

      4)It is surprising that the dKO mice weight so much less than WT even though their food consumption and activity levels are similar, and their RER does not indicate a switch in fuel preference. An explanation could be altered lipid absorption. The authors indicate that feces were collected. An analysis of fat content in feces (NEFAs, TG) needs to be performed to examine this possibility. The discussion alludes to it, but no data is shown.

      5)It would be important to know if increased MEK/ERK signaling and SOX9 expression are seen in fat pads of mutant mice, not just on the MEF system. Similarly, what are the expression levels of PPARg and C/EBPa in WAT depots of mutant mice?

      6)Analysis of Wnt signaling in Fig. 3c should also include a FOPflash control reporter vector, to demonstrate specificity. Also, data from transfection studies should be shown as mean plus/minus STD and not SEM. This also applies to all other cell-based studies (e.g., Fig. 6b,c).

      7)It is unclear why the authors used the MEF model rather than adipocyte precursors derived from the stromal vascular fraction (SVF) of fat pads from mutant mice. If they did generate data from SVF progenitors, they should include it.

      8)Given that the authors' proposed mechanism involves both, transcriptional and post-transcriptional regulation of DLK-1 by TIS7 and SKMc15, Fig. 4d should be a Western blot capturing both of these events, and not just quantitation of mRNA levels.

      9)There is no mention of the impact on brown adipose tissue (BAT) differentiation of KO of TIS7, SKMc15, or the combination. Given the role of BAT in systemic metabolism beyond energy expenditure, the authors need to comment on this issue.

      Minor comments:

      10)The y axis in Fig. 2c is labeled as gain of body weight (g). Is it really the case that WT mice gained 30 g of body weight after just 3 weeks of HFD? This rate of increase seems extraordinary, and somewhat unlikely. Please re-check the accuracy of this panel.

      11)The Methods indicates all statistical analysis was performed using t tests, but this is at odds with some figure legends that indicate additional tests (e.g., ANCOVA).

      12)Please specify in all cases the WAT depot used for the analysis shown (e.g., Fig. 3d is just labeled as WAT, as are Fig. 4a,e, etc.).

      13)Fig. 5d is missing error bars, giving the impression that this experiment was performed only once (Fig. 5c). The legend has no details. Please amend.

      Significance

      The role of TIS7 in adipocyte differentiation is well established. The only truly novel finding in this work is the observation that SKMc15 also plays a role in adipogenesis. The molecular mechanisms proposed (modulation of DLK-1 levels) are not novel, but make sense. However, they need to be bolstered by additional data.

      Referees cross-commenting

      I think we are all in agreement that the findings in this work are of interest, but that significant additional work is required to discern the mechanisms involved. In my view, a direct and specific link between SKMc15 and translation of DLK-1 needs to be established and its significance for adipogenesis in cells derived from the SVF of fat pads determined. Reviewer 2 has suggested some concrete ways to provide evidence of a direct link.

    1. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      Summary: The manuscript analyzes how the constriction of a tissue by an enveloping basement membrane alters the migration of cells migrating through that tissue. The tissue analyzed is the Drosophila egg chamber, an important model for basement membrane studies in vivo, and the cells migrating through it are the border cells. The border cells migrate through the center of the egg chamber, moving as a cluster between the nurse cells, which are in turn surrounded by follicle cells, which secrete the basement membrane on the outside of the egg chamber. The authors decrease and increase the basement membrane stiffness with various genetic perturbations, and they find that the border cells move more rapidly when the stiffness is reduced. They then investigate how basement membrane stiffness is communicated to the border cells several cell layers inside, by measuring cortical tension with laser-recoil. They found that external basement membrane stiffness alters the cortical tension of the nurse cells and the follicle cells, such that reduced matrix stiffness causes reduced cortical tension; further, reducing cortical tension directly within the cells also results in increased border cell migration rates. They conclude that basement membrane stiffness can alter cell migration in a new way, by altering constriction and cortical tension, with an inverse relationship between stiffness and migration rate. This is a strong manuscript and I would request very few changes.

      The authors are commended on the rigor and completeness of their study. Several independent methods are used to alter basement membrane stiffness (loss of laminin, knock-down of laminin, knock-down of collagen IV, over-production of collagen IV - all of which end up changing collagen IV levels) and all show the same result. Further, they are extremely rigorous about testing and excluding an attractive alternative hypothesis, that the basement membrane of the border cell cluster itself controls its migration rate. The use of mirror-Gal4 is very elegant and convincing, as it expressed only in the central part of the egg chamber, and they found border cells responded differently only in that region. Moreover, the authors were exceptionally thorough in reproducing the basement membrane mechanical data in their own hands using the bursting assay. Overall, the experimental data support the claims of the paper. There is only one more control I would like to see, for the knockdown of laminin in the border cell cluster with a triple-Gal4 combination. Presumably using all three Gal4 lines was necessary to get complete knockdown, and it would be nice to see anti-laminin for the border cell cluster under these knockdown conditions.

      Despite the rigor, because all of the manipulations to the basement membrane alter the levels of collagen IV, the authors cannot formally exclude the possibility that collagen IV in the basement membrane has another function besides stiffness, perhaps sequestering a signaling ligand, and that this other function somehow alters the cortical tension of the egg chamber. In the paper by Crest et al, externally applied collagenase served as a control for this possibility, but collagenase will not work for the authors because this study is in vivo. I suggest the authors bring up this caveat in the discussion. If they wanted to extend the study (optional), they could knock down the crosslinking enzyme peroxidasin in the egg chamber, which ought to reduce basement membrane stiffness without changing the collagen content. The problem here is that it hasn't already been shown to work that way in the egg chamber, and so both stiffness and collagen levels would need to be measured. Testing the stiffness directly would be difficult, since the bursting assay is not actually a measurement of stiffness (more on that below). Rather than go this route, I suggest just acknowledging the formal possibility, which seems to me unlikely anyway.

      In terms of clarity, the manuscript absolutely needs a schematic at the beginning to introduce the egg chamber and border cell migration, labeling the cell types, showing the route and direction of border cell migration, and labeling the A/P axis. Without this the non-expert reader cannot readily understand the study.

      Finally, in terms of clarity, the authors repeatedly use statements such as "stiffness influences migration rate". Influences how? These results are not intuitive to me, and it would help enormously if the authors would make statements like, decreasing stiffness increases migration (as I tried to in my summary). Here are two examples of statements to refine: • Line 189 - "We found that reducing laminin levels affected the migration speed of both phases (Fig.1F, G)." Please say increased, not affected. • Line 245 -"Altogether, these results demonstrate that the stiffness of the follicle BM influences dynamics and mode of BC migration." Again, be specific about how. There are many such statements, from the abstract to the results to the discussion, where it would help the clarity to be more precise about what kind of influence.

      Minor comments: • The movies are beautiful! • All the quantitative data are shown in bar charts with means and errors. It is much better to show the individual data points, superimposing the means and distributions on top of the individual points. • The bursting assay does not actually measure basement membrane stiffness; rather, it measures failure after elastic expansion. These are related, as was found by Crest et al and the authors say that at one point, but stiffness and failure are not the same thing. Please change the language discussing this assay to "mechanical properties" rather than stiffness. • The laser-recoil assays are done well and are convincing. Throughout the results section, the authors describe these as measuring "cortical tension", which is correct. However, in the figure legends the language changes to "membrane tension" which is only one component of cortical tension. Change them all to cortical tension. • In the Discussion, it would be nice to include something on the two different modes of migration (tumbling and not tumbling). • I suggest changing the title to remove the word "forces", because forces are never directly measured from basement membrane. • Although Dai et al (Science 2020) is discussed near the end, I suggest bringing this reference up to the introduction, so the reader can have the background on the mechanical aspects of border cell migration at the start of this study. • Two typos (there may be more): At the bottom of Fig. 2, text turns strangely white that should probably be black; and in line 260, you mean Fig. S5 not S4 (laser ablation).

      Significance

      Mechanobiology, and mechanobiology of the basement membrane, is a vibrant area of study now, arising from the intersection of biophysics/engineering and genetics. There is general interest in how the basement membrane alters forces within the tissue, and this study is the first to my knowledge to relate basement membrane mechanics to migration via constriction and cortical tension. The authors do a great job of discussing the broader significance of their work in the Discussion. To greatly broaden the scope of this work in the future, the authors could collaborate with a mouse team to look for similar responses in a mammalian tissue, as they discuss. It is worth noting that there is a lot of work on matrix stiffness and migration showing that stiffness promotes migration speed; in these cases, matrix is a substrate, not a compression mechanism. But the opposite nature of the result in interesting and makes this work non-intutive and perhaps hard for some readers to grasp.<br /> As the paper is written now, I think the audience for this work would mostly be oogenesis, border cell migration, and/or basement membrane researchers in the Drosophila community, of which there are many (I am in this camp). With some rewriting to make it more accessible to other audiences, I think it would be interesting to a larger developmental biology audience. The content is not like any other paper I know, but it may be similar in scope and subject matter to the papers detailing how follicle cells and basement membrane interact during follicle rotation.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Ester and her colleagues described a force model that controls border cell migration by varying the stiffness of the basement membrane. It's based on the modification of laminin and Coll IV which are components of the basement membrane. To reduce BMs stiffness, they introduced LanB1RNAi or the LanB1 mutant to inhibit laminin production or vkgRNAi to reduce Coll IV. They also applied EHBP1mCh to enhance BM stiffness. Furthermore, they applied laser ablition to confirm that the BM stiffness affects the tension of nurse cells and follicle cells, thus regulating border cell behavour by changing environmental properties. It is a nice work revealing how the environment controls border cell migration; however, there are several points that concern me: 1. It's reported that actin polymerization at the front of the cell generates protrusions, as well as that myosin contractility helps to suppress lateral random protrusions, thus leading to a directed and efficient cell migration. So why do more lateral protrusions (tj>LanB1RNAi) produce a faster migration speed? 2. We know some labs also did experiments with those Kel/Dic mutant flies. And the Kel mutant is very sick, which sometimes leads to NC degeneration. As a result, we have serious doubts that this mutant's border cell migration will remain normal. 3. From figure4, we noticed that with mirrGal4, the vertex distance increase is much lower than tjGal4 (control of D, H and K), and even with expressing the EHPB1mCh, the distance is still lower than the tjGal4 control. These indicate the NC cortical tension is lower with mirrGal4 expression, which is patially against the paper's main point. (Similar issue in figure5 D and E). 4. Sfigure1 A and B seem not to have the right contrast (the blue and the red should have the same brightness), so the comparison of the intensities might be inaccurate and needs to be requantified after adjustment of the images. 5. Sfigure2 A-E showed that the vkgRNAi has the highest bursting frequency, whereas F and G do not. And the majority of the data from F does not fit with A-E, and it is unclear what timepoint sF.G. is at. 6. SFigure 6 only displayed a representative image of the control condition; the lack of representative images for the other conditions resulted in unconvincing results. 7. Some figures and movies have prominent variation of migrating stages, such as not-detached border cells compared with detached border cells. This might strongly cause the results inconsistent with each other. 8. There are numerous typos in both the manuscript and the figures. Based on all these concerns, I recommend authors to do some improvement before this manuscript is accepted by some reputed journals.

      Significance

      Strengths: the manuscript is well written and organised; limitation: figures and results are not supportive enough, and thus conclusion is not completely convincing, statistical quantification is not clear and somehow confusing.

      Advice: If the conclusion is solid, this story will fill the unclear importance of surrounding environment on cell-rich tissue for collective cell migration. Concept is very novel while needing more supporting data. It is a fundamental study for development biology.

      Audience: The story will fit well for developmental and cell biology, as well as people with biomechanical background.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      The manuscript by Lopez et al have employed the ex vivo model of Border cell migration in Drosophila ovaries to examine the constriction forces imposed by basement membrane on migrating border cells. The authors have extensively employed live cell imaging coupled with genetics to demonstrate that basement membrane encasing fly eggs modulates the dynamics of migrating border cells. Through laser ablation experiments they show that basement influences the tension of the underlying follicle cell and nurse cells which in turn affects the migration efficiency of collectively moving border cells. Over all the experiments are well quantified with good degree of statistics that drive the claim of the authors.

      Major comments: Over in all the images, it is very hard to appreciate the overall contour of the egg chamber. This is important to get an insight regarding the stage of the egg chamber being evaluated.

      1. By depleting the constituents of basement membrane, the authors show that the speed of the migrating border cells increases. However in Supplementary Figure 1A and B where that authors have depleted LanB1, the migrating border cell cluster seems to lag while the control has reached the oocyte boundary. Is this a single off phenomena?

      2. This is regarding the osmotic swelling experiments. The frequency and speed of bursting of egg chambers in deionized water was used to evaluate the stiffness of basement membrane in different genetic background. As egg chambers of different stages have variable sizes, it would be fair to evaluate egg chambers of only a particular stage for this analysis as the tonocity of the egg chambers may depend on their size.

      3. Line 211, "Live time lapse imaging, showed that the overexpression of EHBP1mCh in all FCs delayed BC migration (tslGFP; tj> EHBP1mCh, Figure S4A-B', Movie S4, n=6)." Though the border cell cluster hasn't moved significantly in Fig S4B', the egg chamber development seems to be stalled as the movement of main body follicle cells is affected. My concern if over expression of EHBP1mCh in the follicle cells is stalling the oogenesis itself could that indirectly affect the border cell movement. Secondly though EHBP1 has been shown to affect secretion of the basement membrane constituents, it could also modulate asymmetric secretion of other components. Can the authors evaluate if over expression of EHBP1mCh rescues the delay in migrating border cells in Lanb1 heterozygous background to render stronger support to their claim.

      4. In Supplementary Fig 7 B and B' the nurse cell morphology seems to be affected. Could the distorted nurse cell morphology in the abi-depleted germline cell affecting the migration efficiency of border cells.

      5. Line 313-314 The authors state that "The radius of curvature of a spherical interface is inversely proportional to the difference in pressure between the two sides of the interface." This may be applicable to a smooth surface but may be not directly applicable to the cell membrane as there are local regional variations and thus any inference on the cytoplasmic pressure of nurse cells may be misleading.

      Minor comment:

      1. In supplementary figure 6D, the square boxes are obscuring the border cell membrane and it will be better if the authors can modify the figure to render more clarity.
      2. There are couple of places where sentence structure needs to be corrected.

      Referees cross-commenting

      I agree with all the comments of other reviewers. Overall I also feel that results do not strongly support the main conclusions. The authors draw major conclusions based on experiments that are merely suggestive rather than being conclusive. Some of the concerns are listed. Like Reviewer 3 raising the concern that Collagen IV may have other functions in the basement membrane other than providing stiffness. A similar concern I too have raised regarding over-expression of EHBP1. I agree with Reviewer 3 that there are several other factors that can affect the outcome of bursting assay besides the stiffness of the basement membrane itself. So the authors need to be careful in linking the bursting frequency of the egg chamber with the stiffness of the basement membrane itself.

      I agree with other reviewers that the quality of the images need to be better. In addition, the image presented should be representative of the population and should fit with the over claim made by the authors (Point No 3 of Reviewer 2 and Point No 1 of Reviewer1). I also agree that authors need to explain Reviewer 2's concern (Point No-1) as to why the lateral protrusion in tj>LanB1RNAi doesn't inhibit the movement of border cell clusters but rather produce faster migration speeds?

      Lastly it is important for the authors to verify that like Kel/Dic mutants are indeed effective or any genetic perturbation like overexpression of EHBP1mCh is not the stalling the oogenesis progression perse, thus giving a false impression of altered migratory speed of border cell clusters.

      Significance

      The role basement membrane is well documented in affecting the shape of neighbouring cells Here the authors claim that the stiffness of basement membrane is regulating the migration efficiency of the border cells. I believe that basement membrane encasing the follicle and underlying germline cells provides a very narrow passage for the border cells to migrate. Any mechanical perturbation that releases or increases the pressure or make the nurse cells membranes less or more taut will affect the dynamics of migrating border cells. Though the authors have demonstrated this with very elegant experiments, I am afraid that their findings are standard outcomes in any physically constrained system and somehow doesn't significantly advance the field.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Manuscript number: RC-2022-01776

      Corresponding author(s): David Bryant

      1. General Statements [optional]

      We describe an ARF6 GTPase module that controls integrin recycling to drive invasion in PTEN-null Ovarian Cancer (OC). We used high-throughput, time-lapse imaging and machine learning to characterise spheroid behaviours from a series of cell lines modelling common genetic lesions in OC patients. We identified that PTEN loss was associated with increased invasion, the formation of invasive protrusions enriched for the PTEN substrate PI(3,4,5)P3, and enhanced recycling of integrins in an ARF6-dependent matter. We utilised Mass Spectrometry proteomics and unbiased labelling to investigate the interactome of ARF6, identifying a single ARF GAP (AGAP1) and a single ARF GEF (CYTH2). Importantly, this ARF6-AGAP1-CYTH2 modality was associated with poor clinical outcome in patients.

      We thank all Reviewers for their highly complementary assessment of our manuscript, describing our paper as a "very impressive study, very well done and controlled with rigorous statistical analyses that uses sophisticated methods", a study that is "stunning in its thoroughness and depth and breadth of its molecular analysis", with "experiments are properly designed, and the data are well presented. The conclusions are appropriate and supported by the data". Finally, we would like to thank the reviewers for appreciating that our results are "of significance for both scientific discovery and clinical application, which will interest the broad audience in both basic and clinical research".

      2. Description of the planned revisions

      Insert here a point-by-point reply that explains what revisions, additional experimentations and analyses are planned to address the points raised by the referees.

      Reviewer comments in bold. Our response in non-bold.

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      This paper by Konstantinou et al aims at deciphering the mechanisms by which PTEN loss could be driving poorer prognosis in patients. The authors use their great high-throughput 3D screening method coupled to an unbiased proteomic method and a CRISPR screen to uncover a new pro-invasive axis driving collective invasion of high-grade serous ovarian carcinoma (HGSOC) cells. Overall, this is a very impressive study, very well done and controlled with rigorous statistical analyses that uses sophisticated methods to convincingly show that the CYTH2-ARF6-AGAP1-ITGA6/ITGB1 module is required for the pro-invasive effect of PTEN depletion and discriminates patients with poorest prognosis.

      __

      MAJOR COMMENTS __

      Below are listed all the claims that, in my opinion, are not adequately supported by the data.

      1) Choice of the cell line: More justification on the use of the ID8 cell line and on the p53 deletion is needed. The authors need to clearly state that most p53 mutations in ovarian cancer are missense mutations that lead to a strong accumulation of a p53 protein devoid of transcriptional activity. Nevertheless, it seems that p53 mutations are not associated to differences in patient survival. Hence the choice of studying PTEN loss in the complete absence of p53, a situation that does not mirror the clinical situation, needs to be explained. Moreover, the in vivo experiments already performed in the literature mentioned in the discussion should be mentioned in the introduction to provide more context and physiological relevance to this study (especially regarding the special focus on the p53 null/ dKO cells throughout the study).

      We will update the manuscript with a detailed explanation of the cell line of choice. Briefly, while indeed Tp53 is found mutated in HGSOC, approximately 30-35 % of these are classified as null mutations (PMID: 21552211), making models with null Trp53 representative of the clinical situation. Further, there is no difference in patient outcome in HGSOC by Tp53 mutation type (PMID: 20229506), while gene expression data from TCGA suggest that HGSC is marked by loss of wild-type P53 signalling regardless of Tp53 mutation type (PMID 25109877). Thus, we believe our choice of model can faithfully mirror the clinical situation.

      2) "Therefore, PTEN loss in ovarian cancer, particularly at the protein level, occurs in the tumour epithelium and is associated with upregulated AKT signalling and poor overall survival". This claim is an over-interpretation and over-generalisation of the data presented. I appreciate the honesty of the authors in showing all the ovarian datasets that are available and highlight the discrepancies in expression of the proteins they study in stroma and epithelium. I think the way to present these data in the text without over-interpreting and generalizing would be to show that there is a clear epithelial-specific downregulation of PTEN at the mRNA level. Most likely due to the contribution to other cell types in the stroma, only 3 out of 5 bulk tumour mRNA datasets show a tumour specific downregulation of PTEN and no association with survival based on a median split of PTEN mRNA expression. Nevertheless, although there is no direct correlation between PTEN mRNA and protein levels, patients with low PTEN protein levels have poorer survival that is associated to an upregulation of Akt signalling. This allows to have a clearer conclusion, based solely on the protein data presented and no over-generalisation using the mRNA data. This, to me, makes a stronger case for studying PTEN loss in ovarian cancer and is fully supported by the data presented.

      We will incorporate this reviewer suggestion into the modified manuscript.

      3) PTEN loss induces modest effects in 2D culture. The authors make claims regarding the fact that some of the phenotypes they look at happen after PTEN depletion alone or in combination with p53 loss and are more prominent in 3D vs 2D. Many of these are insufficiently backed up by data. A few key experiments are also only performed in 2D and should be done in 3D. Finally, some clarifications if the role of PTEN is most prominent on either collective, ECM-induced or 3D-dependent invasion.

      some clarifications if the role of PTEN is most prominent on either collective, ECM-induced or 3D-dependent invasion

      We believe that the reviewer may be confused. Both of our models, either spheroids or invading monolayers, are events occurring inside gels of ECM. Therefore, these are all are 3D, ECM-induced, collective invasion. We have not performed 2D migration assays. We apologise that the this was not clearer in the first submission. We will correct this in the updated manuscript.

      First, the authors claim that PTEN loss alone (i.e. without p53 deletion) leads to changes in Akt signalling. Supp fig 1H clearly shows that there is no significant increase in Akt activation, although there seems to be one in the Western Blot (WB) presented in supp fig 1G. There is a clear, significant increase in the Akt activation in all the PTEN KO clones when in association with p53 loss though. This claim is hence not backed up by data and the conclusion seems to be that the effect on Akt signalling requires both deletion of p53 and PTEN.

      The reviewer is correct: that the increase to pAKT levels upon PTEN KO is more robust with co-KO of TP53, thereby indicating synergy with p53. We will update the manuscript to note this, accordingly.

      It will be interesting to see a quantification of the pS473-Akt staining (supp fig S1J), as it seems from these images that pAkt is preferentially found on rounded cells. It should also be performed in 3D conditions to see if there is an enrichment at invasive tips and back-up the invasion data.

      This observation made us realise that the images we had included were giving the wrong impression (that pAkt levels would be highest in round cells). Based on the quantitation in Fig. S1M, PTEN KO cells (which have elevated pAkt levels), show a marked depletion of rounded cells. Therefore, pAkt elevated is not associated with being enriched in rounded cells. We will replace this image with cells mirroring the phenotypes quantified in Fig S1M.

      We used 2D for quantitation of pAKT staining, as we perform a like for like comparison. We cannot compare pAkt in 3D protrusions accurately between genotypes because of the frequency of protrusions: in p53 KO protrusion are rare. In 3D, therefore, it is not a situation where protrusions are present in both genotypes and we compare enrichment or depletion in a stable structure. Rather, what we can provide is whether when protrusions form, there is clear pAkt labelling in a protrusion. We will include for the revision a representative image of each phenotype in 3D, including a 3D Trp53-/-;Pten-/- spheroid stained for pAKT S473.

      Arf6 is recruited to the invasive tips of cells invading a 2D wound (fig4D). How do the authors reconcile the fact that all the machinery required for 3D invasion is present but that PTEN loss has a modest effect on cells in 2D? If the wound assay was done on glass, it should be done again on ECM coated glass to see if it recapitulates the effects seen in 3D. This experiment will help deconvolute if the effect of PTEN loss is more linked to collective behaviour than 3D organization or presence of ECM.

      We again apologise for not being clearer in our description. Both the wound assays and the IF of invading monolayer were performed with cell monolayers invading into Matrigel. Monolayers are grown on top of Matrigel, wounded, and then overlayed with Matrigel. Therefore, this is orthogonal to our spheroid assay, and completely 3D. We will address this comment by changing the text in the results section to highlight the 3D nature of the method.

      The recycling assays are all done in 2D, condition under which the authors claim that the PTEN phenotype is weakest. Although I understand that it is not possible to do this assay in 3D, its contribution to elucidating the mechanism by which integrins participate in the PTEN loss invasive phenotype is not clear. The requirement of integrins relies on the data showing that ITGB1 KO results in no collagen4-positive basement membrane of the cysts and greatly impaired invasion. Experiments looking at the integrin localisation would be helpful: can an enrichment at the invasive tips can be seen? Are ITGA6 and/or ITGB1 repartitions homogeneous between the cysts membranes and the invasive tips? In my opinion the Src/FAK data is not enough to draw the conclusions of fig7I schematic.

      We will endeavour to include images of 3D spheroids of Trp53-/-;Pten-/- cells and stained for β1 integrin (total and active) and α5 integrin to interrogate localisation at the tips.

      4) Expression of AGAP1 isoforms do not alter ARF6 levels. Data in fig 6C, D show a significant downregulation of Arf6 and Akt signalling after expression of AGAP1S. Can the authors clarify what they mean?

      We thank the reviewer for picking up that discrepancy between the results and the text. We will change the relevant text to highlight that expression of AGAP1S is associated with a statistically significant reduction of roughly 30% in ARF6 levels and 10% in p:t AKT. We do not know why AGAP1s may enact such an effect.

      5) Arf6 is not modulated in the different cell lines: data in fig4B (far right graph) and supp fig 4B, J seem to indicate otherwise. Can the authors clarify what they mean?

      It is not clear exactly what the reviewer is referring to here. If the reviewer is referring to Supplementary Figure 4B, this is an experiment examining the levels of ARF5 or ARF6 upon knockdown, so levels would be expected to vary. Fig S4B does not correspond to the experiment performed in S4J. Our interpretation is that loss of p53 alone or in combination with Pten does not seem to be consistently be accompanied with an increase in either the levels of total or bulk GTP-bound ARF6 that could explain the dependency of Trp53-/-;Pten-/- on the GTPase for the invasive phenotype. We will make our interpretation clearer in the text

      6) Immunofluorescence panels without quantifications: Quantifications for the different stainings shown in fig3A; 4D, E; 5H; 7B and supp fig S1L, J; S3 need to be included to fully back the conclusions of the authors. Indeed, these images are used to draw conclusions and not only as illustrations.

      It is not possible to do a direct comparison between protrusion vs no protrusion (see our response above). We will include a line scan to show clear enrichment at the end of the tip for image shown. Quantitation for Figure S1L is already included (S1K and M), quantitation for Figure S1J is presented in Fig S1I and for Fig 5H quantitation of the phenotype is present in Fig 5I.

      7) Quantifications of invasion show that WT cysts become hyper-protrusive at around the half experiment mark (around 30-40hrs). Nevertheless, all movies or galleries show spherical cysts, which does not seem representative. Can the authors change this or explain why these images/movies were chosen?

      We present the fold change at each time point because that is intuitively easier to understand rather than the raw number. The quantitation does not show that the cysts necessarily become hyper-protrusive at the specific timepoint, but rather that the proportion of hyper-protrusive cysts observed in this genotype peaks at the specific timepoint. This phenotype may still be in the minority of behaviours. As an example, something that occurs 5% of the time in the control, with a two-fold increase in behaviours, might still only be 10% of the population. Therefore, adding in a picture that may be representative of a small proportion of the population may not be a realistic depiction of what is happening across the entire population. We will provide the reviewer with the exact percentage of spheroids that are classified as hyper-protrusive at the specific cell line across timepoints, to make this clearer.

      8) Since it seems that the main effect of PTEN is to drive the localisation and intensity of recycling of Arf6 cargoes, it will be helpful to confirm that all the proteins involved in the Arf6 module be shown to be accumulated/present at the pro-invasive tips. Immunofluorescence stainings showing the presence of AGAP1 (could be done with the AGAP1S isoform that is mNeon-tagged), pS473-Akt, ITGB1 (active integrin if possible, otherwise total integrin), ITGA5, PI3K should be included if possible. A quantification comparing signal in the cysts and in the invasive tips should also be included to see if there is an accumulation to PIP3-enriched areas.

      We will endeavour to include the requested images.

      9) Data in fig5I convincingly show that PTEN loss induces a fragmented collagen4-positive basement membrane. The authors use this data to claim that this is one of the ways that PTEN could be driving invasion but no correlation between these structures and the hyper-protrusive phenotype is made. This experiment needs to be done to support this claim.

      This comment made us realise that in an attempt to make images simpler (displayed nuclei and COL4 only), we omitted a staining for where protrusions were moving through gaps in the ECM. We will update these times to demonstrate such events.

      __

      MINOR COMMENTS __

      1) Data visualization: I think that the heatmap representation is overkill when only 2 or 3 conditions are presented. A graph showing the evolution of area or spherical/Hyper-protrusive phenotype proportions across time would be easier to read and more impactful: each genotype could be presented with a colour and the spherical/hyper-protrusive phenotypes as either plain or dashed lanes across time. I understand that this representation allows for the stats to be done at each time points but they are generally pretty clear (especially for the PTEN KO or dKO phenotypes) and do not need to be done for each time point in my opinion. These heatmaps could be put in supplementary figures if the authors feel strongly about putting stats for each time points.

      We thank their reviewer for their suggestion. We believe that our approach, while complex, is the best visualisation to reflect both the changes across time but also between conditions while allowing appreciation of the statistical significance. This visualisation has been optimised by our lab over years of working with this type of data and we would prefer that they remain consistent with the accepted standard of our other publications. We are, however, happy to expand the explanation in the text on how to interpret the bubble heatmaps.

      Fig supp S1M, fig 5I should be presented as a stacked histogram to improve readability and merged with fig supp S1K.

      We will merge Figures S1M and S1K. We believe that Figure 5I is easier to read as is.

      Displaying fold change as antilog rather than log values would be easier for the reader to realise the magnitude of the differences.

      We disagree with the reviewer.

      A bar graph would be easier to read than the matrix representation for fig 6B.

      We disagree with the reviewer as we feel it makes it easier to directly compare each lipid between the two cell lines.

      The way Area data is presented throughout to me makes it very difficult to understand what is going on. Could the authors at least give some explanations in figure legends. A curve graph displaying the evolution of the area across time would be easier to read and see the differences between conditions.

      Please see our response to Minor point 1

      2) It is confusing that, in fig supp S1M, there is a significant decrease of the rounded phenotype after PTEN loss that is not associated to a significant change in another of the categories. Could the authors explain how?

      This can be simply explained from our data: while the rounded phenotype was reduced in a consistent way across replicate experiments (therefore resulting in significance), the effect on the other two phenotypes was not consistent (not set in magnitude and directionality). This therefore does not lead to a significant (i.e. consistent) effect on the latter two phenotypes. PTEN loss therefore seems to allow cells to undergo – at the expense of being round - a range of shape changes, rather than a set phenotype.

      3) One of the big differences of the PTEN KO cells seems their ability to invade through the matrigel bed and migration on the glass below (supp movie S2). From what I gather, these cysts would be considered out of focus and excluded from the analysis. Would it be possible that this would minimize some of the results? Would it be possible to include a quantification of this particular phenotype to confirm it is specific to PTEN KO cells?

      In the same spirit, could the authors provide the percentage of non-classified cysts, to make sure that the same proportion of cysts is quantified across all different genotypes.

      Indeed, we cannot exclude that we under-estimate the magnitude of the effect on the PTEN null. We will include this point in the discussion. We can include a reviewer-only figure showing the proportion of cysts and levels of the ‘OutOfFocus’ objects across cell lines.

      __

      4) Can the authors clarify how a 0 fold change (in log value) in fig 2D can be highly significant? __

      We believe that the reviewer is equating statistical significance with something being biologically meaningful. Statistical analysis does not indicate a priori whether something is biologically meaningful. Rather, it assesses the likelihood that an observed result is occurring by chance (or not). For instance, if a small change (e.g 0.04 in a log2 fold change) occurred repeatedly across experimental replicates this is unlikely to be a result of chance, and therefore could be statistically significant. Yet, such a small magnitude of effect is probably biologically minor. This is why our heatmaps provide both statistical significance, fold change, and consistency in magnitude of effect.

      5) Delta isoform of PI3K seems to have an effect on area in the middle of the experiment, but has no effect at all on invasion. Could the authors comment? Are these smaller cysts still as invasive? There might be an interesting uncoupling between proliferation and invasion there.

      The cysts are actually slightly larger with PI3Kδ inhibition and there is no change in invasion. We will expand our comments in text as well to account for this observation.

      6) ITGB1 depletion seems to induce a downregulation of Akt protein. Is that right? Does it change Akt localisation? Is there a dose effect whereby there is not enough Akt protein to mediate invasion?

      The p:t AKT ratio does not change consistently across all gRNAs (Figure 5C) but we can look at Akt (total) protein levels and include this information if needed.

      __

      7) Stats should be added directly on the graphs for the recycling assays, doing a pairwise comparison of the different genotypes for each time points. Can the authors clarify what the t-32min quantification graphs adds (fig7E, supp fig S8G-I)? I would advise to remove them, as this data is already presented in the recycling assay graphs. __

      We don't include these because although they are technical replicates, they are demonstrative of a single experiment. What we include instead is the quantitation across independent biological experiments (which each have their own internal multiple technical replicates), where it is appropriate to include statistical analysis.

      8) There is a substantial amount of typos and erroneous references to figures. I listed below the ones that I spotted and I encourage the authors to carefully check.

      1. there are some mistakes in referencing the number of cysts in supp table 1. There is for example no cysts experiments in Figure 1 but yet there are some references to figure 1 in supp table 1. Please correct it. I think it will be easier for the reader if the number of cysts quantified for each conditions was also indicated in the figure legends. Supp table 1 can still be included for readers that want additional details.
      2. comma missing page 3
      3. page 3 and 4: PI(3,4)2 means PI(3,4)P2? Can be shorten to PIP2 for ease of read and specify if it is another PIP2 specie otherwise
      4. define CYTH abbreviation: I suppose this is for cytohesin?
      5. fig1F-I: don't understand why TCGA.OV is specified on some but not all the graphs. It seems to me that all the data are from TCGA.OV? Makes it seems it is nit the case
      6. legend of fig1H, I: y axis is -Log10 values in 1I, not Log10 values
      7. page 6: dKO abbreviation is already specified above and should be used to avoid repetition and for ease of read
      8. supp fig S1D: missing legend for the second bar (after Wild Type)
      9. supp fig S1N: legend of the X-axis should be below the axis
      10. supp fig S1O: the numerotation of the X-axis needs to be below the line of the axis for ease of read, not above it
      11. legend of S2A: clones 1.12 and 1.15 are p53-/-;PTEN-/- and not PTEN-/-
      12. supp figS2C can the authors specify the different stages of matrigel (liquid or gel) that are used for the invasion assay, to make it easier for the non-specialist to understand what is going on. Please confirm that the 50% GFR matrigel makes a gel on top of the cells and fill in the wound to produce the 3D invasion assay setup.
      13. page 7: no parental cells are used in S3A, B only p53 null and p53 null and dKO. Please also specify what cells are being compared in the text
      14. description of arrow heads and colours need to be moved to figure legends and not in main text (page 7)
      15. fig 2D: the signification of the dot in the circles needs to be in the legends (since it is its first apparition in the manuscript). It only appears later on, in supp2A legend. Additional description of the matrices is necessary, as they contain a lot of information to digest to understand fully what is going on
      16. legend of fig3: error in figure reference: area data is D and not E, protrusive phenotypes are E and not F
      17. arrow missing in fig3B
      18. fig 3D,E, G, H: please indicate the cell line studied
      19. fig 3I: the different genotypes need to be stated on the galleries for clarity
      20. page 8: define Arf6-mNG in the text
      21. __ page 9: "We thank the reviewer for their careful examination of the manuscript. We will go through all above points and make the corresponding careful adjustments to the manuscript.

      OPTIONAL SUGGESTIONS

      1) Choice of cell line: There is a high number of patients (around 9% according to (Cole et al. 2016)) that present the R248Q gain-of-function mutation. A recent study has shown that this mutant p53 protein is associated to an activation of Akt signalling and an increase of the intercellular trafficking of EGFR (Lai et al. 2021). Given that EGFR was also a hit in this screen, that is seems to have a central role in Arf6 cargoes (fig 4G), I think it would be a great addition to this study. It could hence cooperate with PTEN loss to drive strong, robust invasion.

      This is an excellent observation and one we will likely follow-up in an independent study.

      2) Are MAPK involved in the PTEN KO pro-invasive phenotype? In particular Erk1/2, since EGFR is one of the PTEN loss induced Arf6 cargoes.

      This is an excellent observation and one we will likely follow-up in an independent study.

      __

      REFERENCE Cole, Alexander J., Trisha Dwight, Anthony J. Gill, Kristie-Ann Dickson, Ying Zhu, Adele Clarkson, Gregory B. Gard, et al. 2016. « Assessing Mutant P53 in Primary High-Grade Serous Ovarian Cancer Using Immunohistochemistry and Massively Parallel Sequencing ». Scientific Reports 6 (1): 26191. _https://doi.org/10.1038/srep26191_.

      Lai, Zih-Yin, Kai-Yun Tsai, Shing-Jyh Chang, et Yung-Jen Chuang. 2021. « Gain-of-Function Mutant TP53 R248Q Overexpressed in Epithelial Ovarian Carcinoma Alters AKT-Dependent Regulation of Intercellular Trafficking in Responses to EGFR/MDM2 Inhibitor ». International Journal of Molecular Sciences 22 (16): 8784. _https://doi.org/10.3390/ijms22168784_. __

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      The authors have conducted a study of the molecular requirements for cancer invasion that is stunning in its thoroughness and depth and breadth of its molecular analysis. The writing is exceptionally precise though also very dense (see below). The molecular model proposed is that PTEN loss (in a p53 null background) leads to reliance upon ARF6 for invasion, with regulation through interactions with AGAP1 and beta1-integrin and it is convincingly demonstrated. They focus on interpreting the consequences of genetic and pharmacologic manipulations in a cell line, using a series of 2D and 3D assays. The phenotypes are more prominent in 3D assays.

      Concerns and Suggestions:

      • There is a disconnect between the essentially complete loss of protrusions and invasion in 3D (e.g. 4A) and the reduction in magnitude of protrusive invasion but the continued presence of elongated cells with protrusions in 2D (e.g. S4C). This discrepancy is present in a couple of comparisons and is glossed over in quick callouts to many figure panels.

        We thank the reviewer for mentioning this as this comment was very helpful in determining that we needed to clarify our description of the role of ARF6 to protrusion formation vs maturation. In the Trp53-/- genotype, protrusions can form, but they rapidly retract, failing to mature into structures that drive invasion through ECM (e.g. Figure S2E). This protrusion maturation occurs upon PTEN KO. When ARF6 depleted, PTEN-null cells can form protrusions, but now again lack the ability to mature into invasion-inducing structures.

      This concept of needing ARF6 for protrusion maturation and maintenance is underpinned by our model of ARF6 regulating recycling of active integrin back to the protrusion front. Indeed, we have observed ARF6 being required not for protrusion initiation, but rather ensuring protrusions are not retracted in other contexts (i.e. upon loss of the ARF6 GEF protein IQSEC1 in invading 3D culture of PC3 cells; PMID: 33712589).

      We also note that, as responded to Reviewer 1, the assay is a 3D invasion rather than 2D migration assay, with cells sandwiched between Matrigel.

      We will update the relevant sections of the results and discussion with the point above.

      Once a journal has been identified, it would be wise for the editor to allow some flexibility in word limit to enable some very dense sections to be expanded slightly to guide the reader through the experiments and results more clearly. For example, in the section "ARF6 regulates active integrin pools...", there are callouts like (Fig. 7C,E; S8A-C; G-I) and then (Fig. 7D,E; Fig. S8E-F, H-I). It takes a lot of time to unpack these different experimental claims based on a single sentence.

      We greatly appreciate the refreshing comments of this reviewer to advocate for actions to improve clarity in our reporting. We would take glad advantage of such a possibility.

      The patient data on CYTH2 and its relationship to survival is modestly convincing.

      In Ovarian Cancer, effects on survival are often minor. This is not a disease where one often sees large shifts in survival, which is why we are so excited about the large shifts that we do see with the ARF GTPase module we identified. However, we concede that the effects on CYTH2, although significant, are not vast changes. We will point this out and tone down our language.

      Very minor- search on %- there are a few inconsistencies in terms of spaces and commas vs. periods. The Methods also have some inconsistencies in terms of spaces between numbers and units or numbers and degrees Celsius. References are also in a different font. Overall it was extremely carefully written though (just dense).

      We thank the reviewer for their careful inspection of our manuscript. We will carefully go over the sections flagged before resubmission

      Reviewer #2 (Significance (Required)):

      One limitation of the experimental design is that the depth of molecular analysis in vitro comes at the expense of any in vivo validation, which the authors acknowledge in the Discussion. They attempt to make similar points using analysis of patient survival data from public databases but these analyses generally yielded small magnitude differences. The main audience for this study is likely to be cell biologists interested in cell migration, cell-ECM adhesion, cancer invasion, and GTPases. I don't see any need for new experiments- what can be done has been done and then some. I do think that it would benefit readers if the text could be made less dense.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      Summary: Using a murine HGSOC 3D cell model, in combination with analysis of human ovarian cancer datasets, the authors uncover a CYTH2-ARF6-AGAP1 signaling module regulated by PTEN and identify a biomarker for tumor invasion and targeted therapy.

      Major comments:

      __The findings of this study are significant as they reveal a critical signaling module that controls tumor invasion by mediating tumor cell interaction with the extracellular matrix. The experiments are properly designed, and the data are well presented. The conclusions are appropriate and supported by the data. The limitation of the study has also been discussed properly.

      One suggestion regarding the survival analysis in Fig. 6 and 7. __

      The authors noted that the CYTH2-ARF6-AGAP1 module is not specifically or only induced in Pten-null contexts, but rather that Pten-null cells become more dependent on the module for enacting the invasive phenotype. Based on this, it would be interesting to evaluate how the PTEN status impacts the survival difference by integrating the PTEN genomic status (WT versus mutation) or its expression level (protein or mRNA) into the survival analysis of patient cohorts in Fig. 6 and Fig. 7.

      We thank the reviewer for this excellent point. We will include such analysis, where possible. One consideration will be that extensive division of patients based on these molecular characteristics may results in patient numbers too low to draw conclusions of significance.

      **Referees cross-commenting**

      Gene deletion and mutation may elicit different functional outcomes. I therefore agree with Reviewer #1 that "the choice of studying PTEN loss in the complete absence of p53, a situation that does not mirror the clinical situation, needs to be explained".

      We will make our reasons for this choice clear in the text before submission. Please refer to response to Reviewer 1, Major comment 1.

      Reviewer #3 (Significance (Required)):

      The model used and data presented in this study are of significance for both scientific discovery and clinical application, which will interest the broad audience in both basic and clinical research.

      3. Description of the revisions that have already been incorporated in the transferred manuscript

      4. Description of analyses that authors prefer not to carry out

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      Summary:

      Using a murine HGSOC 3D cell model, in combination with analysis of human ovarian cancer datasets, the authors uncover a CYTH2-ARF6-AGAP1 signaling module regulated by PTEN and identify a biomarker for tumor invasion and targeted therapy.

      Major comments:

      The findings of this study are significant as they reveal a critical signaling module that controls tumor invasion by mediating tumor cell interaction with the extracellular matrix. The experiments are properly designed, and the data are well presented. The conclusions are appropriate and supported by the data. The limitation of the study has also been discussed properly.

      One suggestion regarding the survival analysis in Fig. 6 and 7. The authors noted that the CYTH2-ARF6-AGAP1 module is not specifically or only induced in Pten-null contexts, but rather that Pten-null cells become more dependent on the module for enacting the invasive phenotype. Based on this, it would be interesting to evaluate how the PTEN status impacts the survival difference by integrating the PTEN genomic status (WT versus mutation) or its expression level (protein or mRNA) into the survival analysis of patient cohorts in Fig. 6 and Fig. 7.

      Referees cross-commenting

      Gene deletion and mutation may elicit different functional outcomes. I therefore agree with Reviewer #1 that "the choice of studying PTEN loss in the complete absence of p53, a situation that does not mirror the clinical situation, needs to be explained".

      Significance

      The model used and data presented in this study are of significance for both scientific discovery and clinical application, which will interest the broad audience in both basic and clinical research.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      The authors have conducted a study of the molecular requirements for cancer invasion that is stunning in its thoroughness and depth and breadth of its molecular analysis. The writing is exceptionally precise though also very dense (see below). The molecular model proposed is that PTEN loss (in a p53 null background) leads to reliance upon ARF6 for invasion, with regulation through interactions with AGAP1 and beta1-integrin and it is convincingly demonstrated. They focus on interpreting the consequences of genetic and pharmacologic manipulations in a cell line, using a series of 2D and 3D assays. The phenotypes are more prominent in 3D assays.

      Concerns and Suggestions:

      1. There is a disconnect between the essentially complete loss of protrusions and invasion in 3D (e.g. 4A) and the reduction in magnitude of protrusive invasion but the continued presence of elongated cells with protrusions in 2D (e.g. S4C). This discrepancy is present in a couple of comparisons and is glossed over in quick callouts to many figure panels.
      2. Once a journal has been identified, it would be wise for the editor to allow some flexibility in word limit to enable some very dense sections to be expanded slightly to guide the reader through the experiments and results more clearly. For example, in the section "ARF6 regulates active integrin pools...", there are callouts like (Fig. 7C,E; S8A-C; G-I) and then (Fig. 7D,E; Fig. S8E-F, H-I). It takes a lot of time to unpack these different experimental claims based on a single sentence.
      3. The patient data on CYTH2 and its relationship to survival is modestly convincing.
      4. Very minor- search on %- there are a few inconsistencies in terms of spaces and commas vs. periods. The Methods also have some inconsistencies in terms of spaces between numbers and units or numbers and degrees Celsius. References are also in a different font. Overall it was extremely carefully written though (just dense).

      Significance

      One limitation of the experimental design is that the depth of molecular analysis in vitro comes at the expense of any in vivo validation, which the authors acknowledge in the Discussion. They attempt to make similar points using analysis of patient survival data from public databases but these analyses generally yielded small magnitude differences. The main audience for this study is likely to be cell biologists interested in cell migration, cell-ECM adhesion, cancer invasion, and GTPases. I don't see any need for new experiments- what can be done has been done and then some. I do think that it would benefit readers if the text could be made less dense.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      This paper by Konstantinou et al aims at deciphering the mechanisms by which PTEN loss could be driving poorer prognosis in patients. The authors use their great high-throughput 3D screening method coupled to an unbiased proteomic method and a CRISPR screen to uncover a new pro-invasive axis driving collective invasion of high-grade serous ovarian carcinoma (HGSOC) cells. Overall, this is a very impressive study, very well done and controlled with rigorous statistical analyses that uses sophisticated methods to convincingly show that the CYTH2-ARF6-AGAP1-ITGA6/ITGB1 module is required for the pro-invasive effect of PTEN depletion and discriminates patients with poorest prognosis.

      Major comments

      Below are listed all the claims that, in my opinion, are not adequately supported by the data.

      1. Choice of the cell line: More justification on the use of the ID8 cell line and on the p53 deletion is needed. The authors need to clearly state that most p53 mutations in ovarian cancer are missense mutations that lead to a strong accumulation of a p53 protein devoid of transcriptional activity. Nevertheless, it seems that p53 mutations are not associated to differences in patient survival. Hence the choice of studying PTEN loss in the complete absence of p53, a situation that does not mirror the clinical situation, needs to be explained. Moreover, the in vivo experiments already performed in the literature mentioned in the discussion should be mentioned in the introduction to provide more context and physiological relevance to this study (especially regarding the special focus on the p53 null/ dKO cells throughout the study).
      2. "Therefore, PTEN loss in ovarian cancer, particularly at the protein level, occurs in the tumour epithelium and is associated with upregulated AKT signalling and poor overall survival". This claim is an over-interpretation and over-generalisation of the data presented. I appreciate the honesty of the authors in showing all the ovarian datasets that are available and highlight the discrepancies in expression of the proteins they study in stroma and epithelium. I think the way to present these data in the text without over-interpreting and generalizing would be to show that there is a clear epithelial-specific downregulation of PTEN at the mRNA level. Most likely due to the contribution to other cell types in the stroma, only 3 out of 5 bulk tumour mRNA datasets show a tumour specific downregulation of PTEN and no association with survival based on a median split of PTEN mRNA expression. Nevertheless, although there is no direct correlation between PTEN mRNA and protein levels, patients with low PTEN protein levels have poorer survival that is associated to an upregulation of Akt signalling. This allows to have a clearer conclusion, based solely on the protein data presented and no over-generalisation using the mRNA data. This, to me, makes a stronger case for studying PTEN loss in ovarian cancer and is fully supported by the data presented.
      3. PTEN loss induces modest effects in 2D culture. The authors make claims regarding the fact that some of the phenotypes they look at happen after PTEN depletion alone or in combination with p53 loss and are more prominent in 3D vs 2D. Many of these are insufficiently backed up by data. A few key experiments are also only performed in 2D and should be done in 3D. Finally, some clarifications if the role of PTEN is most prominent on either collective, ECM-induced or 3D-dependent invasion.

      First, the authors claim that PTEN loss alone (i.e. without p53 deletion) leads to changes in Akt signalling. Supp fig 1H clearly shows that there is no significant increase in Akt activation, although there seems to be one in the Western Blot (WB) presented in supp fig 1G. There is a clear, significant increase in the Akt activation in all the PTEN KO clones when in association with p53 loss though. This claim is hence not backed up by data and the conclusion seems to be that the effect on Akt signalling requires both deletion of p53 and PTEN.

      It will be interesting to see a quantification of the pS473-Akt staining (supp fig S1J), as it seems from these images that pAkt is preferentially found on rounded cells. It should also be performed in 3D conditions to see if there is an enrichment at invasive tips and back-up the invasion data.

      Arf6 is recruited to the invasive tips of cells invading a 2D wound (fig4D). How do the authors reconcile the fact that all the machinery required for 3D invasion is present but that PTEN loss has a modest effect on cells in 2D? If the wound assay was done on glass, it should be done again on ECM coated glass to see if it recapitulates the effects seen in 3D. This experiment will help deconvolute if the effect of PTEN loss is more linked to collective behaviour than 3D organization or presence of ECM.

      The recycling assays are all done in 2D, condition under which the authors claim that the PTEN phenotype is weakest. Although I understand that it is not possible to do this assay in 3D, its contribution to elucidating the mechanism by which integrins participate in the PTEN loss invasive phenotype is not clear. The requirement of integrins relies on the data showing that ITGB1 KO results in no collagen4-positive basement membrane of the cysts and greatly impaired invasion. Experiments looking at the integrin localisation would be helpful: can an enrichment at the invasive tips can be seen? Are ITGA6 and/or ITGB1 repartitions homogeneous between the cysts membranes and the invasive tips? In my opinion the Src/FAK data is not enough to draw the conclusions of fig7I schematic. 4. Expression of AGAP1 isoforms do not alter ARF6 levels. Data in fig 6C, D show a significant downregulation of Arf6 and Akt signalling after expression of AGAP1S. Can the authors clarify what they mean? 5. Arf6 is not modulated in the different cell lines: data in fig4B (far right graph) and supp fig 4B, J seem to indicate otherwise. Can the authors clarify what they mean? 6. Immunofluorescence panels without quantifications: Quantifications for the different stainings shown in fig3A; 4D, E; 5H; 7B and supp fig S1L, J; S3 need to be included to fully back the conclusions of the authors. Indeed, these images are used to draw conclusions and not only as illustrations. 7. Quantifications of invasion show that WT cysts become hyper-protrusive at around the half experiment mark (around 30-40hrs). Nevertheless, all movies or galleries show spherical cysts, which does not seem representative. Can the authors change this or explain why these images/movies were chosen? 8. Since it seems that the main effect of PTEN is to drive the localisation and intensity of recycling of Arf6 cargoes, it will be helpful to confirm that all the proteins involved in the Arf6 module be shown to be accumulated/present at the pro-invasive tips. Immunofluorescence stainings showing the presence of AGAP1 (could be done with the AGAP1S isoform that is mNeon-tagged), pS473-Akt, ITGB1 (active integrin if possible, otherwise total integrin), ITGA5, PI3K should be included if possible. A quantification comparing signal in the cysts and in the invasive tips should also be included to see if there is an accumulation to PIP3-enriched areas. 9. Data in fig5I convincingly show that PTEN loss induces a fragmented collagen4-positive basement membrane. The authors use this data to claim that this is one of the ways that PTEN could be driving invasion but no correlation between these structures and the hyper-protrusive phenotype is made. This experiment needs to be done to support this claim.

      Minor comments

      1. Data visualization: I think that the heatmap representation is overkill when only 2 or 3 conditions are presented. A graph showing the evolution of area or spherical/Hyper-protrusive phenotype proportions across time would be easier to read and more impactful: each genotype could be presented with a colour and the spherical/hyper-protrusive phenotypes as either plain or dashed lanes across time. I understand that this representation allows for the stats to be done at each time points but they are generally pretty clear (especially for the PTEN KO or dKO phenotypes) and do not need to be done for each time point in my opinion. These heatmaps could be put in supplementary figures if the authors feel strongly about putting stats for each time points.

      Fig supp S1M, fig 5I should be presented as a stacked histogram to improve readability and merged with fig supp S1K.

      Displaying fold change as antilog rather than log values would be easier for the reader to realise the magnitude of the differences.

      A bar graph would be easier to read than the matrix representation for fig 6B.

      The way Area data is presented throughout to me makes it very difficult to understand what is going on. Could the authors at least give some explanations in figure legends. A curve graph displaying the evolution of the area across time would be easier to read and see the differences between conditions. 2. It is confusing that, in fig supp S1M, there is a significant decrease of the rounded phenotype after PTEN loss that is not associated to a significant change in another of the categories. Could the authors explain how? 3. One of the big differences of the PTEN KO cells seems their ability to invade through the matrigel bed and migration on the glass below (supp movie S2). From what I gather, these cysts would be considered out of focus and excluded from the analysis. Would it be possible that this would minimize some of the results? Would it be possible to include a quantification of this particular phenotype to confirm it is specific to PTEN KO cells?

      In the same spirit, could the authors provide the percentage of non-classified cysts, to make sure that the same proportion of cysts is quantified across all different genotypes. 4. Can the authors clarify how a 0 fold change (in log value) in fig 2D can be highly significant? 5. Delta isoform of PI3K seems to have an effect on area in the middle of the experiment, but has no effect at all on invasion. Could the authors comment? Are these smaller cysts still as invasive? There might be an interesting uncoupling between proliferation and invasion there. 6. ITGB1 depletion seems to induce a downregulation of Akt protein. Is that right? Does it change Akt localisation? Is there a dose effect whereby there is not enough Akt protein to mediate invasion? 7. Stats should be added directly on the graphs for the recycling assays, doing a pairwise comparison of the different genotypes for each time points. Can the authors clarify what the t-32min quantification graphs adds (fig7E, supp fig S8G-I)? I would advise to remove them, as this data is already presented in the recycling assay graphs. 8. There is a substantial amount of typos and erroneous references to figures. I listed below the ones that I spotted and I encourage the authors to carefully check.

      • a. there are some mistakes in referencing the number of cysts in supp table 1. There is for example no cysts experiments in Figure 1 but yet there are some references to figure 1 in supp table 1. Please correct it. I think it will be easier for the reader if the number of cysts quantified for each conditions was also indicated in the figure legends. Supp table 1 can still be included for readers that want additional details.
      • b. comma missing page 3
      • c. page 3 and 4: PI(3,4)2 means PI(3,4)P2? Can be shorten to PIP2 for ease of read and specify if it is another PIP2 specie otherwise
      • d. define CYTH abbreviation: I suppose this is for cytohesin?
      • e. fig1F-I: don't understand why TCGA.OV is specified on some but not all the graphs. It seems to me that all the data are from TCGA.OV? Makes it seems it is nit the case
      • f. legend of fig1H, I: y axis is -Log10 values in 1I, not Log10 values
      • g. page 6: dKO abbreviation is already specified above and should be used to avoid repetition and for ease of read
      • h. supp fig S1D: missing legend for the second bar (after Wild Type)
      • i. supp fig S1N: legend of the X-axis should be below the axis
      • j. supp fig S1O: the numerotation of the X-axis needs to be below the line of the axis for ease of read, not above it
      • k. legend of S2A: clones 1.12 and 1.15 are p53-/-;PTEN-/- and not PTEN-/-
      • l. supp figS2C can the authors specify the different stages of matrigel (liquid or gel) that are used for the invasion assay, to make it easier for the non-specialist to understand what is going on. Please confirm that the 50% GFR matrigel makes a gel on top of the cells and fill in the wound to produce the 3D invasion assay setup.
      • m. page 7: no parental cells are used in S3A, B only p53 null and p53 null and dKO. Please also specify what cells are being compared in the text
      • n. description of arrow heads and colours need to be moved to figure legends and not in main text (page 7)
      • o. fig 2D: the signification of the dot in the circles needs to be in the legends (since it is its first apparition in the manuscript). It only appears later on, in supp2A legend. Additional description of the matrices is necessary, as they contain a lot of information to digest to understand fully what is going on
      • p. legend of fig3: error in figure reference: area data is D and not E, protrusive phenotypes are E and not F
      • q. arrow missing in fig3B
      • r. fig 3D,E, G, H: please indicate the cell line studied
      • s. fig 3I: the different genotypes need to be stated on the galleries for clarity
      • t. page 8: define Arf6-mNG in the text
      • u. page 9: "<" symbol should be an alpha symbol
      • v. fig 4A: indicate the cell line used on the figure
      • w. supp fig S4E: why is it specified mouse-specific for the shArf6?
      • x. 4H, I, J: indicate on the figure if these interactors are mostly unchanged, strong interactors or weak interactors for clarity
      • y. legend of fig4H: "coloured spots underneath denote the protein complex that each interactor belongs (in J)" should indicate panel G and not J
      • z. fig4I, J: are you sure of the legend for the fold change coloring? Log2 of 1 is a 0 fold change, i don't see how these could show any significant difference (i.e. some of the pale red circles are significant)
      • aa. page 11: description of the assay (starting with "Machine learning classification of...") is very confusing, please clarify
      • bb. page16: figure 4H should be 4I (PTEN-null specific association of Arf6 with ITGA5)
      • cc. supp fig S5H-P: choose Tumour or cancer to homogeneise naming across the graphs
      • dd. fig 5H: box are difficultly visible in green, change color to yellow or something more visible
      • ee. page 13: Fig6E, F should also refer to 6G
      • ff. LCM abbreviation on page 10 and 12 refers to LCMD? Otherwise please define it.

      Optional suggestions

      1. Choice of cell line: There is a high number of patients (around 9% according to (Cole et al. 2016)) that present the R248Q gain-of-function mutation. A recent study has shown that this mutant p53 protein is associated to an activation of Akt signalling and an increase of the intercellular trafficking of EGFR (Lai et al. 2021). Given that EGFR was also a hit in this screen, that is seems to have a central role in Arf6 cargoes (fig 4G), I think it would be a great addition to this study. It could hence cooperate with PTEN loss to drive strong, robust invasion.
      2. Are MAPK involved in the PTEN KO pro-invasive phenotype? In particular Erk1/2, since EGFR is one of the PTEN loss induced Arf6 cargoes.

      Reference

      Cole, Alexander J., Trisha Dwight, Anthony J. Gill, Kristie-Ann Dickson, Ying Zhu, Adele Clarkson, Gregory B. Gard, et al. 2016. « Assessing Mutant P53 in Primary High-Grade Serous Ovarian Cancer Using Immunohistochemistry and Massively Parallel Sequencing ». Scientific Reports 6 (1): 26191. https://doi.org/10.1038/srep26191.

      Lai, Zih-Yin, Kai-Yun Tsai, Shing-Jyh Chang, et Yung-Jen Chuang. 2021. « Gain-of-Function Mutant TP53 R248Q Overexpressed in Epithelial Ovarian Carcinoma Alters AKT-Dependent Regulation of Intercellular Trafficking in Responses to EGFR/MDM2 Inhibitor ». International Journal of Molecular Sciences 22 (16): 8784. https://doi.org/10.3390/ijms22168784.

      Significance

      It has only been recently appreciated that PTEN loss is a driver in ovarian cancer (Martins et al. 2020) but no studies to data have aimed at understanding the mechanisms. This study is hence the first to propose one and as such provides a very valuable advance for researchers interested in ovarian cancer. The authors also propose that the CYTH2-ARF6-AGAP1 high mRNA be used as a signature of worsen prognosis. This hence paves the way to better understanding and stratify patients with ovarian cancers.

      One of the main difference after PTEN loss is the accumulation of PIP3 in pro-invasive tips that correlates with the recruitment of Arf6 to these tips. The authors have developed a very powerful automated quantification pipeline to follow the behaviour of cysts grown in 3D that they have coupled to an unbiased proteomic method to identify interactors and a CRISPR screen to test their functional relevance. This is clearly the strongest aspect of the paper that allows them to gather very robust data and identify the machinery driving invasion in PTEN KO cells. The authors' model claims that this in turns recruit the Arf6 machinery, composed of CYTH2 2G (the only CYTH2 isoform correlated to a poorer prognosis, preferentially binding PIP3) and AGAP1 that leads to a local increase in active integrin recycling that mediates the more invasive phenotype of PTEN depleted cells. It is rightfully mentioned in the discussion that PTEN depletion only leads to a modest change in Arf6 interactors, and that most likely PTEN loss acts by locally directing the Arf6 machinery to the invasive tips. Indeed, the authors convincingly show that Arf6, AGAP1 and ITGB1 are required for the formation of these invasive protrusions.

      The limitation of this study is the combination of 2D and 3D experiments to drive general conclusions on the mechanism. These are listed in the previous section. Another big limitation, in my opinion, is the choice of the cell model: indeed, nearly all patients present a vast increase in the amount of the p53 protein present due to a very large number of mutations that in most cases prevent its binding to DNA. Throughout this paper the authors have used a p53 null cell line that expresses no p53 protein. This is not compatible with the clinical situation. Moreover, since p53 also present frequent gain-of-function mutations that have been shown to be associated to an increase of Akt signalling and intercellular trafficking of EGFR. Studying the implication of the Arf6 module identified here in a context of p53 WT or mutant protein overexpression would be of great interest.

      Reference

      Martins, Filipe Correia, Dominique-Laurent Couturier, Anna Paterson, Anthony N. Karnezis, Christine Chow, Tayyebeh M. Nazeran, Adekunle Odunsi, et al. 2020. « Clinical and Pathological Associations of PTEN Expression in Ovarian Cancer: A Multicentre Study from the Ovarian Tumour Tissue Analysis Consortium ». British Journal of Cancer 123 (5): 793‑802. https://doi.org/10.1038/s41416-020-0900-0.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      1. General Statements [optional]

      We are grateful to the reviewers for highlighting the value and power of our 3D chimeric dataset to explore cancer/stellate interactions in pancreatic cancer invasion. We also appreciate their support of our findings identifying divergent roles for the two related enzymes ADAMTS2 and ADAMTS14. We thank the reviewers for their detailed comments, which have allowed us to prepare a significantly stronger and clearer manuscript.

      Following the reviewers comments we have made three major changes to the manuscript, which we will outline here in addition to the point-by-point rebuttal.

      1. i) Revised manuscript structure. We have modified the structure of the manuscript, which we hope improves the clarity and accessibility of the work.

      Figure 1 remains the description of our 3D invasion model and our approach to identify stellate cell and cancer cell transcriptomic information from this context.

      Figure 2 describes our focus on proteases and now includes concordance of our data with clinical data sets. This is also now where we describe the strikingly opposing roles for ADAMTS2 and ADAMTS14 in regulating invasion.

      Figure 3 is now the figure demonstrating that ADAMTS2 and ADAMTS14 have an equal contribution to collagen processing from stellate cells. This is an important experiment given that the main physiological roles for these enzymes are in the processing of collagen, and the importance of collagen for cancer progression. It was therefore reasonable to hypothesise that the effect of these enzymes on invasion could be due to differences in their collagen processing in this context. The finding that both have an equal effect on collagen processing points towards a wider, and more diverse, role for these enzymes in regulating biology.

      Figure 4 describes the divergent roles of these two enzymes on myofibroblast differentiation, and by extension TGFβ bioavailability. In this figure we now include experiments with TGFβ reporter constructs, which demonstrate an increase in active TGFβ following loss of ADAMTS14 and a reduction in TGFβ activity following loss of ADAMTS2.

      Figure 5 is our matrisomic experiment to identify enriched enzyme-specific substrates following knockdown of either ADAMTS2 or ADAMTS14.

      Figure 6 details our investigation into the substrate responsible for the reduction in invasion following loss of ADAMTS2. As the previous matrisomic experiment identified only two enriched ADAMTS2 substrates, we investigated both in our 3D assays, identifying SERPINE2 as the responsible substrate. Further analysis identified a reduction in plasmin activity in ADAMTS2 deficient cells. This was rescued with co-knockdown of SERPINE2, implicating this pathway as being crucial for mediating the effect of ADAMTS2. Additionally, we now include experiments demonstrating that concomitant knockdown of SERPINE2 alongside ADAMTS2 rescues the reduction in TGFβ activity observed with ADAMTS2 loss alone.

      Figure 7 describes our analysis of ADAMTS14 substrates. As the matrisomics identified a large change in proteins following ADAMTS14 knockdown, we performed an siRNA screen of candidates to identify those responsible for ADAMTS14 phenotype. This, followed by further validation in our 3D invasive assay, revealed Fibulin2 as the responsible substrate. Fibulin2 has a well-established role in regulating TGFβ release from the matrix. In accordance with this we present new data using TGFβ reporter constructs, which demonstrate that the increase in active TGFβ following ADAMTS14 knockdown can be reversed with co-knockdown of Fibulin2.

      1. ii) Improvement of the clinical significance of our chimeric data set and ADAMTS proteins. Ideally, we would like to present IHC images of ADAMTS2 and ADAMTS14 expression in PDAC tissue samples to corroborate our in vitro findings. However as these enzymes are secreted, this precludes antibody based imaging, as it would not provide cell type specific information. RNA scope presents an alternative, however we have experienced technical issues with this technique due to RNA degradation in PDAC tissue and unavailability of ADAMTS2/14 specific probes. In place of this we have used a range of publically available resources.

      We have compared our chimeric data set with human clinical data using the resource published by Maurer and colleagues (PMID: 30658994). This paper presents transcriptomic data from PDAC tumour and stromal compartments using laser microdissection of clinical tissue. In accordance with our data set, the majority of metzincins, including ADAMTS2 and ADAMTS14, are expressed in the stromal compartment. These data are presented in updated figure 2.

      We have also examined ADAMTS2 and ADAMTS14 expression in PDAC and CAF subtypes using publically available data sets. Using the TCGA dataset, we identified that ADAMTS2 and ADAMTS14 are highly expressed in PDAC tumours compared to normal counterparts. As the majority of PDAC is comprised of stroma, the bulk transcriptomic data from TCGA, combined with the results from the Maurer publication, lead us to conclude that this expression reflects the stromal origin of these proteases. In addition, using publically available single cell RNA sequencing data published by Luo and colleagues (PMID: 36333338), we identified ADAMTS2 and ADAMTS14 expression in the prominent PDAC CAF subtypes, inflammatory and myofibroblastic CAFs. Together these data demonstrate that these enzymes are enriched in clinical disease, which when combined with our mechanistic 3D studies implies a greater role for these enzymes in disease progression than previously appreciated.

      iii) Improved mechanistic link between ADAMTS2 and ADAMTS14 with TGFβ bioavailability

      To strengthen the association between ADAMTS2 and ADAMTS14 function, their substrates SERPINE2 and Fibulin2, and TGFβ bioavailability, we have performed the following experiments using TGFβ reporter constructs:

      We have taken conditioned media from stellate cells lacking either ADAMTS2 or ADAMTS14, along with co-knockdown of their substrate, and stimulated a recipient cell line expressing a SMAD Luciferase reporter. These cells express luciferase in response to TGFβ stimulation. In accordance with a role for ADAMTS14 and Fibulin2 in regulating TGFβ, we demonstrate that following ADAMTS14 knockdown there is a strong increase in active TGFβ in the media (Figure 4I), which is abrogated with co-knockdown of Fibulin2 (Figure 7F).

      We have also obtained a fluorescent reporter, CAGA-eGFP, which expresses GFP in response to TGFβ stimulation in order to examine TGFβ activity in 3D cultures. Stellate cells expressing this construct were embedded in collagen: Matrigel hydrogels following knockdown of either ADAMTS2 or ADAMTS14 and CAGA fluorescence recorded after 72 hours of culture. In accordance with our data, stellate cells deficient in ADAMTS14 showed increased fluorescence in 3D, indicative of increased TGFβ activity, which was abrogated with co-knockdown of Fibulin2 (Figure 4J, K and 7G, H). Equally, loss of ADAMTS2 reduced TGFβ activity in 3D culture, which was rescued with co-knockdown of SERPINE2 (Figure 4J, K and 6 D, E).

      These experiments confirm a link between the ADAMTS enzyme, its relevant substrate, and TGFβ bioavailability. Together with extensive published work linking SERPINE2 and Fibulin2 with TGFβ release we are confident in our proposed mechanism for the dichotomic relationship of ADAMTS2 and ADAMTS14 in regulating TGFβ and thus myofibroblast action.

      2. Point-by-point description of the revisions

      This section is mandatory. *Please insert a point-by-point reply describing the revisions that were already carried out and included in the transferred manuscript. *

      • *

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      • *

      This study aims to explain the opposing contributions of stromal stellate cells/CAFs to PDAC. By first identifying stroma-specific proteases, followed by a process of candidate selection and elimination, the authors find that two specific metalloproteases that share enzymatic activity against collagen in fact have differential activity on TGFb availability. This could be interpreted as a way of shaping the CAF population and tumor-promotin or -restricting properties of the stroma.

      There are several flaws that the authors could address to improve the manuscript:

      1. In the flow of experiments and analyses, there is a strange mix of fully unbiased discovery phases followed by functional experiments that do not consider all possible candidates to test, and vice versa. For instance, from the mixed-species transcript analysis, ADAMTS2 and -14 are chosen based on their shared collagenase activity based on literature. However, the authors then perform again a proteomics analysis to identify things from the entire matrisome that are cleaved by these enzymes? Then, for ADAMTS2 a co-silencing approach is done on one selected candidate (Serpine2), but for ADAMTS14 an siRNA screen is performed? The problem of this approach is that the rationale for some studied enzymes is very strong, where as for others it is not.

      We thank the reviewer for their comment and trust the revised manuscript provides more clarity for the rationale of our approach. We performed the chimera sequencing as a discovery experiment to reveal the communication between cancer and stellate cells in a 3D, invasive context. We present the chimera experiment and data here as a resource for the community, with our analysis of ADAMTS2 and ADAMTS14 function serving as a first example of the biological insight this data set can reveal. Other insights revealed from this dataset are active avenues of research in our group.

      Our finding that ADAMTS2 and ADAMTS14 have dramatically opposing roles in regulating invasion was especially striking given their equal contribution to collagen processing in this context. This led us to conclude that the divergent nature of these enzymes must be due to enzyme-specific substrates. A substrate repertoire for these enzymes has been previously published (PMID: 26740262) and we reasoned that the responsible substrate would be enriched following knockdown of the relevant enzyme. Thus we preformed matrisomics on cells lacking either of these enzymes, which did indeed reveal enrichment of known, enzyme-specific substrates that we could use for further analysis.

      The matrisome following ADAMTS2 knockdown was minimally changed and only presented enrichment of two ADAMTS2 substrates. As there was only a minimal cellular phenotype in 2D following loss of ADAMTS2, we decided to concentrate our studies on the two identified substrates in our 3D assay. Conversely as the matrisome following ADAMTS14 knockdown was dramatically different from control cells, and ADAMTS14 knockdown presented a clear phenotype in αSMA expression, we decided to perform a screen of all matrisome hits. This highlighted the role of IL-1β in mediating myofibroblast differentiation, which has been reported elsewhere and validated our approach. Further, this refined the number of enriched ADAMTS14 substrates to two, MMP1 and Fibulin2, with Fibulin2 being identified as the responsible candidate in our 3D assays.

      The ECM is more than just collagen. Choosing these two metalloproteases based on their shared collagen substrate is an approach that perhaps oversimplifies the ECM a bit, and again, does not provide the strongest rationale that these metalloproteases are most likely to explain counteracting stromal activities on tumor growth and progression.

      We fully agree with the reviewers comment and feel our work acutely demonstrates this point. Loss of either ADAMTS2 or ADAMTS14 had similar effects on collagen processing; implicating their divergent roles on invasion was independent of their effects on collagen regulation. This work therefore showcases the incredible complexity of ECM regulation in tumour progression. As discussed in the manuscript, collagen along with other elements of the ECM can regulate tumour progression and we believe our work adds an additional facet to this.

      Related to the above: How were the stellate cells used for the matrisome analysis grown? In the suspension setup or adherent? This will have a large impact on the outcome. Is there for instance hyaluronic acid in this matrix?

      The matrisome analysis was conducted on cells cultured in 2D. Vitamin C was added to the media to promote matrix production. We agree that this is not truly reflective of the in vivo situation but as a discovery tool this led us to identify the ADAMTS2 and ADAMTS14 substrates responsible for the function observed in 3D.

      1. Performing the species-specific transcript analysis both ways is a neat approach, but why did the authors ignore the opportunity to formally overlay/compare the two stromal gene sets to define likely candidates based on statistics?

      We primarily used this approach as a discovery tool to identify key differences between cancer and stellate cell compartments. Comparing the two species data sets is problematic as the murine cancer cells express many elements found in the stellate cells, while the human data set presents a cleaner comparison. This is evident from comparing metzincin expression in the two data sets. The human data set (Figure 2A) shows clear separation between cancer and stellate compartments, which is less evident in the murine data set (Supp figure 2A). As noted in supplementary figure 1A, unlike the human cancer cells used in this study, the murine cancer cells are capable of invading without stellate support (although when cultured with stellate cells invasive projections are always stellate led). Nevertheless the murine data set matches the human, although with less clarity.

      Minor comments: The bioinformatics Methods need more details on how reads were mapped to the different genomes. How many mismatches were allowed and was the mapping done separately or using for instance Xenofilter?

      We have improved the methodology section to include more detail for this separation. Using STAR aligner, reads were mapped to host species using a combined human and mouse genome. Ambiguous reads were subsequently discarded from the analysis. While there are bioinformatic packages that seek to match ambiguous reads to parent species we did not use these for our analysis.

      The authors use the knowledge on the activities of both ADAMTS2 and -14 on collagen as a rationale to choose these two. Is there really a need for the paragraph (and associated figures) from line 102 on?

      Given the prominent role collagen has been shown to have in regulating PDAC progression and the primary role for ADAMTS2 and ADAMTS14 being collagen processing, we initially hypothesised that the divergent role for these enzymes on invasion could be due to differences in collagen processing in this context. The fact that both equally contribute to collagen processing is surprising and adds to the novelty of our findings that these enzymes have a more complex role in regulating stromal biology.

      We have altered the structure of the manuscript to emphasise this point. The divergent roles of ADAMTS2 and ADAMTS14 on invasion are now presented in Figure 2, with their equal role in collagen processing now presented after in Figure 3. Figure 4 onwards now details the opposing roles of these enzymes in myofibroblast differentiation and our investigation into the enzyme-specific substrates responsible for this.

      Abstract, line 21; some words are missing?

      We thank the reviewer for bringing this to our attention and have now amended the abstract.

      Were the siRNA screen hits validated?


      Yes, hits relevant for our further investigations, MMP1 and Fibulin2, are presented in the manuscript.

      What is the genotype of the mouse cancer cells? KPC-derived?

      DT6066 are KPC derived while R254 are derived from KPF mice. This has been added to the methods with relevant reference.

      Reviewer #1 (Significance (Required)):

      The trick of dissecting tumor from stromal signals in spheroid cocultures by RNA-Seq is a cool trick, but not new and the authors should probably cite some prior work.

      We have included reference to other work where researchers have used species deconvolution to explore heterocellular interactions (Lines 68-72). However, we believe our work is one of the first to use this approach to explore cellular interactions in an in vitro, 3D, invasive context.

      What this all means for patients (or in vivo tumors even) remains unclear. There is some debate on whether highly activated CAFs (ACTA2/aSMA+ cells, some call them myCAFs) are indeed tumor-restrictive or whether they promote invasion. The authors appear to argue the latter (which I can agree with) but without any translational work to show what the net outcome of this mechanism is, the study remains descriptive and perhaps of limited interest.

      We contend that our 3D invasion model is a powerful tool to understand the role of stellate cells in leading invasion. We have shown the utility of this model in several studies to dissect the biology of this cell type, revealing the importance of the nuclear translocation of FGFR1 in stellate invasion (PMID: 36357571), the role of the kinase PKN2 in regulating stellate heterogeneity (PMID: 35081338) and the influence of cancer cell-derived exosomes on stellate invasion (PMID: 33592190).

      CAFs within PDAC stroma are highly plastic and can adopt multiple functions depending on distinct environmental cues. Thus, identifying how they are regulated is of paramount importance if they are to be therapeutically targeted. We contend that our mechanistic studies using heterocellular 3D models can aid in the dissection of the biology of these cells with more granularity than offered by clinical or in vivo studies, particularly in the context of secreted proteases. To add clinical relevance for our findings we have compared our chimera data set with previously published laser microdissected tumour and stroma PDAC tissue (Figure 2B), and identified ADAMTS2 and ADAMTS14 expression in prominent CAF subtypes (inflammatory and myofibroblastic) from published single cell RNA seq data taken from tumours (Supp figure 2C). As these enzymes are produced in multiple CAF subtypes, genetically targeting them in vivo appears prohibitive. The generation of ADAMTS2 and ADAMTS14 specific inhibitors would be required to assess their roles in vivo.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      The manuscript by Carter and colleagues examines that role of cancer-associated fibroblasts (CAFs) in regulation of invasion in a 3D co-culture assay with epithelial cells. The authors propose that invasive chains of cancer cells are led by fibroblasts. The authors utilise a system of co-culture to create chimeric human-mouse fibroblast-cancer cell spheroids (both directions utilised, to eliminate species bias) to allow for in situ sequencing of the co-operating transcriptional programmes of each cell type during 3D invasion. From this powerful approach, this allowed the authors to identify two key two collagen-processing enzymes, ADAMTS2 and ADAMTS14, as contributing to CAF function in their system. The authors identify that these two enzymes have opposing roles in invasion, and map some of their key substrates in invasion, which extend beyond collagen-processing. The authors propose that one key function is to control the processing of TGFbeta, the latter of which is a regulator of the myofibroblast subpopulation of CAF. Overall, the findings of the manuscript are interesting, but need some further proof-of-principal demonstrations to extend their findings to support the claims within.

      • The authors demonstrate a clear role of ADAMTS2 and ADAMTS14 in stellate function during differentiation and invasion. Is there any evidence of such changes in patient materials? Could the authors query publicly available databases of micro-dissected stroma vs epithelium to validate the translational relevance of their findings?

      We thank the reviewer for their suggestion; we have now explored clinical relevance of ADAMTS2 and ADAMTS14 expression in two ways. We have used previously published work by Maurer and colleagues (PMID: 30658994), which descibes transcriptomic analysis of laser microdissected tumour and stroma from pancreatic cancer tissue. In accordance with our chimeric data set the majority of metzincins, including ADAMTS2 and ADAMTS14, are expressed in the sromal compartment (Figure 2B). We have also used publically available scRNA seq data to examine ADAMTS2 and ADAMTS14 expression in distinct CAF subtypes (Supp Figure 2C). Both ADAMTS2 and ADAMTS14 are expressed in inflammatory and myofibroblastic CAFs, with ADAMTS14 expression lower than that of ADAMTS2. Given the complexity of CAF heterogeneity it is possible that ADAMTS2/14 secretion by one population regulates the resulting phenotype of surrounding CAFs, however this hypothesis if beyond the scope of our current work.

      Major comments: - Page no. 4, Line 71, The authors conclude that the invasion in the chimeric spheroids is "led by" stellate cells. This is a key concept in the manuscript. How do the authors define the "led by" phenomena? What is the frequency that this occurs?

      In our experience all invasive projections are stellate led, defined as a stellate-labelled nucleus present at the tip of invasive projections. Indeed the human cancer cells used in this study are incapable of invading in the absence of stellate cells (Supp figure 1 A). We have previously reported this model where we demonstrated FGFR1 activity in the stellate cells is crucial for invasion (PMID: 36357571). Others have demonstrated the general importance for fibroblasts in leading invasion (PMID: 18037882, 28218910). Interestingly in our study, mouse cancer cells were capable of invading in the absence of stellate cells. However, when cultured with stellate cells, projections were predominantly stellate led.

      • For Figure 2A and S2A, the text suggests that the heatmap represents the stellate vs cancer cell expression (as shown in Figure 1B and S1B) in the respective species but the labelling below the heatmap suggests they are all cancer cells (Mia, Pan, R2 and DT). Is this a typo? Could the authors clarify this?

      We use Mia, Pan, R2 and DT to define the sphere combination from which the data originated. We have improved the clarity of the heatmaps by colour coding the different cell types within each sphere, and matching it with the cell type data presented in the heat map. We hope this improved labelling makes the heatmaps more accessible.

      • The text and the figures are lacking information about the cell line names used in the experiment, e.g, Figure 2C, 2D, 2SB, 2SC and 2SD does not indicate what cell line was used in the study. This is the same with other figures as well. Please indicate in all instances exactly which samples are queried.

      We have now included reference to the cell type and stellate cell species used in each experiment in relevant figure legends. Key 3D invasive experiments were conducted with both human and mouse stellate cells.

      • It's mentioned in the text that the authors have used the cancer and stellate cells in a 1:2 ratio but the numbers of stellate cells look different between different spheroids confocal images. e.g. The numbers look very different between the Miapaca2:PS1 vs Miapaca2:mPSC spheroids. Is this simply the representative images, or are their bona fide differences. This, in turn, would impact on claims of cells being 'led' by stellate cells. Can the authors clarify?

      This is a consequence of the method by which the stellate cells were immortalised. Human PS1 stellate cells were immortalised with hTERT, while mouse stellate cells were immortalised with SV40. A consequence of this is that the mouse stellate cells proliferate faster in 3D than the human stellate cells, with both proliferating slower than the cancer cell compartment. So while spheroids start at 1000 cells (666 stellate, 333 cancer) with stellate cells as the prominent component they are quickly overtaken by the cancer cells. Despite this difference in proliferation we find no difference in the invasive capacity of the stellate cells, with invasive projections always stellate led irrespective of whether they are human or mouse.

      • While for most of the experiments the authors generated the chimeric spheroids first and then performed the respective experiments, it appears that for the invasion assay simply co-culture of Cancer cells and stellate cells was done. Is this correct? Have the authors tried performing the assay with the chimeric spheroids to see if the stellate cells still invade?

      The Boyden chamber migration assay was conducted by seeding a co-culture of stellate and cancer cells in the apical compartment then imaging their migration to the basolateral side. This provided a second method to predominantly showcase the enhanced migration of cells lacking ADAMTS14 in a manner that could be quantified over time. We have not tried placing spheroids in the apical compartment and imaging invasion through the pores.

      • The authors claim that ADAMTS2 and ADAMTS14 regulate the bioavailability of TGFB, and this is a key reason that these regulate CAF differentiation. However, there is no direct demonstration of this concept, which is conspicuous by absence. Could the authors either directly demonstrate this, or remove such notions from the results, and explicitly state that this is an untested speculation in discussion? Examples of this are:

      o Line 173, authors state "ADAMTS2 facilitates TGFβ release through degradation of the plasmin inhibitor, SERPINE2 (Figure 5D)"

      o Line 196 authors conclude "Together these data implicate 197 ADAMTS14 as a key regulator of TGFβ bioavailability (Figure 6F)."

      o Line 240 states "This reduces the activation of Plasmin, preventing the release of TGFβ (Figure 5C)." Since this is just a model without detailed experiments, It will be better to propose rather than conclude.

      We appreciate the reviewer’s concern and have now added additional experiments to strengthen the association of ADAMTS enzymes and TGFβ bioavailability.

      Using a TGFβ-responsive luciferase reporter we demonstrate that the media from stellate cells lacking ADAMTS14 has greatly increased amounts of active TGFβ (Figure 4), which is abrogated when Fibulin2 is knocked down alongside (Figure 7). This links ADAMTS14 and Fibulin2 to TGFβ activity. Given the extensive literature detailing a role for Fibulin2 in regulating matrix TGFβ release through interactions with fibrillin (e.g, PMID: 19349279, 12598898, 12429738) we believe this is how ADAMTS14 is regulating myofibroblast differentiation. As we do not directly examine the association of Fibulin2 with fibrillin in this manuscript we have amended the associated statements to reflect this.

      We have also used a TGFβ-responsive fluorescent reporter to examine TGFβ activity of stellate cells in 3D. Consistent with our results, loss of ADAMTS2 reduces, while loss of ADAMTS14 enhances, TGFβ activity (Figure 4), which can be reversed with concomitant knockdown of their respective substrates SERPINE2 (Figure 6) and Fibulin2 (Figure 7).

      • Figure S5C shows a less invasive phenotype in the NTCsi + ADAMTS14si spheroids compared to the NTCsi + NTCsi control. However, there appears no appreciable difference between NTCsi + ADAMTS14si and NTCsi + NTCsi spheroids' brightfield images in Figure 5SD.

      Could the authors comment on this?

      We thank the reviewer for bringing this to our attention and apologise for our mistake. The images were positioned erroneously. This has now been corrected and the images reflect the quantification that demonstrates a clear increase in invasion following loss of ADAMTS14, which is abrogated with co-knockdown of Fibulin2.

      Minor Comments: - Page no. 2, Line 20 has an incomplete sentence "Crosstalk between cancer and stellate cells is pivotal in pancreatic cancer, resulting in differentiation 21 of stellate cells into myofibroblasts that drive."

      Apologies for the error. This has been rectified.

      • Figure 2C; Figure S2C and Figure S5E lack quantification for the western blots.

      We have now included densitometry for all western blots, presenting values relative to the respective loading control and normalised to the experimental control. Values are averages taken from all biological repeats with significance indicated where relevant.

      • Why did the authors choose to investigate the Metzincin family? Could the authors provide their reasoning to investigate these proteins, to the exclusion of other candidates?

      We focused on the metzincin family, as they are best known for their involvement in cancer invasion. A goal for this manuscript is to present our chimera data set as a discovery tool for the community. While this initial manuscript focuses on protease activity, we have further projects on-going that have used this data set to identify important elements of cancer/stellate communication.

      • Info about the number of fields imaged per sample for the microscopy data is missing in the figure legends (e.g. Figure 2F and 2I, Figure 5SF).

      We have now included a statement in each relevant figure legend to indicate that quantification was performed on at least five fields of view per biological repeat.

      • Any particular reason why the ADAMTS2 expression was not checked through Western blotting like ADAMTS14 in Figure S2B.

      We attempted to examine ADAMTS2 by western blotting but were unable to find an antibody that produced consistent results with our samples, and corroborated consistent knockdown by PCR.

      • The legends for Figure 3SC and 5SF mention that "Images are representative of at least two biological replicates". How many technical replicates were used? It would be useful if the relative intensity of the images is measured and plotted in a graph.

      We have now moved these images to the main figure alongside quantification of αSMA intensity. Images are collected from two biological repeats with quantification obtained from at least five fields of view per image. Together these data strongly demonstrate that loss of ADAMTS14 increases αSMA fibre intensity, which is blocked by either an inhibitor of TGFβ signalling (Figure 4), or co-knockdown of Fibulin2 (Figure 7).

      Reviewer #2 (Significance (Required)):

      This work provides an examination of the cross talk between fibroblasts and cancer cells in a 3-Dimensional culture model of pancreatic tumour cell invasion. By using chimeric human-mouse spheroids, the authors are able to identify cell-type specific transcripts by bulk RNA sequencing in situ. This advance is not to be underestimated as a number of existing approaches for cell type-specific profiling (eg. single-cell sequencing) relies upon dissociation of cell communities prior to sequencing. It is very likely that transcriptional programmes change during this isolation process. This approach allows the authors to identify transcriptional co-operating programmes in situ. This data provides a resource to understand this key co-operation of these two cell types during tumourigenesis, and will be of interest to the pancreatic cancer field. In addition, the mapping of the key substrate of these enzymes provides further insights that may be useful in understanding the expanded target repertoire of these enzymes beyond collagen processing.

      We thank the reviewer for their strong support of our chimeric spheroid approach and resulting investigation into the dichotomic roles of ADAMTS2 and ADAMTS14.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      AMADTS2 and ADAMTS14 belong to the disintegrin and metalloproteinase with thrombospondin motif protein family, mainly produced by pancreatic stellate cells (PSC) and are related to cancer cell invasion. This study reveals that ADAMTS2 and ADAMTS14 have opposite roles in myofibroblast differentiation based on experiments testing HSC driven cancer cell invasion, variant expression of HSC activation makers and the related downstream targets analysed upon RNA sequencing analyses. The authors (TA) established PSC/cancer cell chimeric spheroids for investigating the crosstalk between these cell types in 3D in vitro. Based on their findings, they claim that ADAMTS2 and ADAMTS14 have different functions regarding PSC and TGF-β activation. However, their conclusions mainly rely on quantitatve data of invasion and mechanistic details are completely lacking.

      Comments: Typos, even in the abstract, e.g. first sentence incomplete

      We apologise for the error in the abstract and have rectified this in the revised manuscript.

      Introduction is rather sparce with one third of the text repeating the results of the study

      Our manuscript details a discovery experiment using chimeric spheroids to identify cancer cell and stellate cell transcriptomes in a 3D invasive context. We then showcase the power of this data set by using it to identify and then describe divergent roles for ADAMTS2 and ADAMTS14 in shaping stellate cell biology. Given this two-tiered approach we incorporated text that would normally be placed in the introduction into the results section (e.g. our description of the importance of collagen processing in PDAC, presented as a prelude to the results from figure 3). We feel this improves the flow of the manuscript, rather than having information that isn’t necessarily relevant to the reader at the outset.

      Some citations do not at all fit with the position where they are placed; needs approval

      We have examined this in detail and are confident in our use of appropriate references throughout.

      In this study, it is said that TS2 (AMADTS2) and TS14 (ADAMTS14) have opposite functions on myofibroblast differentiation, with individual depletion leading to distinct matrisomal phenotypes in PSC. However, both similarly contribute to collagen processing. As we know, collagen is increased in response to TGFβ signaling, since TS2 depletion (knock down, kd) inhibits and TS14 kd is suggested to promote TGFβ activation, it is expected that this has impact on the available collagen levels. How do the authors explain that nevertheless the kd effect on collagen is very similar?

      The primary effects of these enzymes are on the processing of pro-collagen to its mature form, rather than on the production of collagen. This is evidenced in figure 3B where collagen expression in the whole cell lysate is the same following ADAMTS2 knockdown, and slightly reduced with loss of ADAMTS14, but the mature form is lost in the cell culture supernatant.

      While myofibroblast differentiation is associated with increased collagen production, it is possible that this is perturbed in a situation where the cell is surrounded by collagen that is incompletely processed (e.g. through biomechanical feedback). Given that our results clearly indicated that the effect of ADAMTS2 and ADAMTS14 on invasion is independent of their roles in collagen processing, this avenue is beyond the scope of the current manuscript.

      The authors claim that TS2 facilitates TGFβ release and TS14 is a key regulator of TGFβ bioavailability. However, throughout the whole data, there is no experimental evidence for this conclusion. TGFβ activation, LAP concentration and downstream effects should be provided.

      Most of the conclusions in the manuscript are based on effects to invasion and the estimated quantification histograms. "Black boxes in between the treatment, e.g. knockdown and readout, that relate to the signals and mechanisms remain black boxes throughout. For example, the impact of the treatments on stellate cell activation markers, the cancer cells invasion signaling, the SERPINE2- and Fibulin2-dependent myofibroblast differentiation pathways should be mechanistically investigated.

      We disagree with this comment. Our invasive model shows a clear role for ADAMTS2 and ADAMTS14 in regulating invasion, which is mitigated by disrupting their substrates SERPINE2 and Fibulin2.

      ADAMTS2 loss is associated with a reduction in plasmin activity, which again is mitigated with concurrent loss of SERPINE2. Equally, inhibition of plasmin activity with Aprotinin matches the loss of invasion observed with loss of ADAMTS2. Plasmin has a well-established role in mediating TGFβ release from the matrix. We have now included additional experiments using a TGFβ fluorescent reporter in 3D culture. This demonstrates that loss of ADAMTS2 reduces TGFβ activity, which can be rescued with co-knockdown of SERPINE2 (Figure 6). Our data therefore support a mechanism where ADAMTS2 blocks TGFβ release from the matrix, and therefore myofibroblast differentiation, through its regulation of SERPINE2 activity.

      We have strengthened our proposed mechanism for ADAMTS14 regulation of TGFβ through Fibulin2 with the use of both luciferase and fluorescent TGFβ reporter constructs. Using these reporters, we demonstrate that stellate cells lacking ADAMTS14 exhibit increased TGFβ activity (Figure 4), which is mitigated with co-knockdown of Fibulin2 (Figure 7). Combined with the effects on αSMA expression and 3D invasion, our data fit with a model where ADAMTS14 regulates TGFβ bioavailability through Fibulin2.

      The authors investigate one cell line each for their conclusions; we know that different cell lines behave differently; can they confirm that the finding they present is of general validity or a finding that is specific for the tested cancer/PSC cell lines. Can the principle findings also be proven in primary cells. More importantly, the authors should proof their findings in PaCa tissue of patients as follows: Expression of the proteases in the tissue, related variation of matrisome signatures, e.g. by snRNASeq, to confirm relevance of the finding.

      All our key 3D invasive experiments are repeated with both human and mouse stellate cells, adding strength to our proposed association with ADAMTS2 and SERPINE2, and ADAMTS14 and Fibulin2, on the invasive capacity of stellate cells. As detailed above we have explored the clinical relevance of our findings by examining laser dissected tumour and stromal data from PDAC tissue, and scRNA fibroblast data. These data confirm that ADAMTS2 and ADAMTS14 are predominantly expressed in the stromal compartment of the tumour and are associated with key CAF subtypes present in the PDAC environment, inflammatory and myofibroblastic CAFs.

      Details related to the figures: Figure 1: Are the numbers of PSC and PaCa cells integrated in the spheres related to the numbers found in patients?

      The 2:1 ratio of stellate to cancer cells used to produce spheres is a technical requirement and reflects the numbers in patients (PMID: 23359139). Cancer cells will proliferate substantially faster than the stellate cells so at the end of the experiment (day 3) the spheres are predominantly cancer cells. Nevertheless the stellate cells are able to drive invasion of the cancer cells, which can be quantitatively assessed in this model.

      B, it seems that the PSC in the spheroid are not equally distributed but instead are all located in close vicinity to eachother in a cloud; is that the representative situation for the spheres and is this similar in the PaCa cancer tissue? Does this have influence on the results?

      We have replaced this image with a more representative image that shows mouse stellate cells dispersed throughout the sphere.

      Figure 2: It is interesting to hear that BMP1, which is actually a ligand for BMP signaling is a protease for Collagen. How does this work?

      While the BMP family generally belong to the TGFβ superfamily, BMP1 is the exception in that it is a C-terminal collagenase. Please refer to reference 21 in the manuscript (PMID: 33879793), which details the role of BMP1 on collagen processing and the resulting effect on PDAC progression.

      C, Quantification of all blots should be presented.

      We have now included densitometry for all western blots, presenting values relative to the loading control and normalised to the experimental control. Values are averages taken from all biological repeats with significance indicated by stars.

      Figure S2: TS2 kd and TS14 kd should be confirmed and provided by both qrt PCR and WB data.

      We were unable to assess ADAMTS2 knockdown by western blot due to the quality of available antibodies. We are confident that either western or PCR confirmation of knockdown is sufficient, especially given the strong phenotype observed with the resulting knockdown.

      Figure 3: F; this result is arguing against the conclusion that TGFb bioavailability is a function of the ADAMs, since the kd impacts on the treatment result with exogenous TGFb. This suggests an effect downstream of ligand activation by proteasomal cleavage, e.g. receptor activation or signal transduction; this needs clarification. H, I: TGFβR inhibitor reduces TS14kd enhanced αSMA expression. How is unclear and needs clarification, since from F we know that already activated TGFβ needs TS2 to fully induce αSMA expression.

      SupplFig.3: B, C, as above!

      αSMA expression in stellate cells requires continuous exposure to TGFβ over 48 hours. Active TGFβ has an incredibly short half-life (minutes) and so requires positive feedback to maintain signalling. We propose that following ADAMTS2 knockdown the cells are incapable of releasing further TGFβ to maintain the phenotype. Equally following ADAMTS14 knockdown the cells are able to release more TGFβ, which is incapable of initiating signalling when the receptor is blocked.

      Figure 4: TIMP1 is a canonical TGFb signaling target gene in fibrosis. How the authors explain that TIMP1 is upregulated in both knockdowns, when they claim that TS2 and 14 have opposing functions on TGFb activation. This result as well puts their conclusions as regards TGFb and also the myofibroblast phenotype into question. Especially, since TIMP1 signifies stellate cell activation not only in the pancreas, but also in the liver and kidney. C, D, E should be explained in more detail and all details of the results should be presented.

      TIMP1 is a substrate for both ADAMTS2 and ADAMTS14, so its enrichment following knockdown of either is unsurprising, reflective of reduced cleavage of TIMP1. Both our 3D invasive assessment in Figure 6 and αSMA imaging in supplementary figure 5 demonstrate that TIMP1 is not responsible for the effect observed as a consequence from loss of either ADAMTS2 or ADAMTS14.

      This holds also for the different myofibroblast phenotypes. All data should be included. From recent scRNASeq investigations, several myofibroblast populations were described and compared, e.g my-stellate cells vs i-stellate cells. To which of these phenotypes the identified populations belong?

      As mentioned above, we have interrogated publically available data sets and identified ADAMTS2 and ADAMTS14 expression in multiple CAF subtypes. As these proteases are secreted it is probable that one CAF subtype can control the phenotype of surrounding CAFs through ADAMTS2 and ADAMTS14 production. While intriguing, this hypotheses is beyond the scope of the current work.

      Figure 5: C, Only brightfield images are provided, confocal images are suggested for comparison of +/- Aprotinin treatment.

      We do not think the addition of confocal images will add to the comparison. Aprotinin clearly reduces invasion, which coupled with the action of stellate-derived SERPINE2 on invasion, and reduced plasmin activity following ADAMTS2 knockdown, suggests that plasmin is important for regulating the effects of ADAMTS2 on invasion.

      The efficiency of TS2 and Serpine2 kd should be provided by qrt PCR and WB.

      TS2 kd promoted SERPINE2 expression should also be presented by qrt PCR and WB.

      We are confident that either western or PCR confirmation of knockdown is sufficient. Of note is that following ADAMTS2 knockdown, SERPINE2 expression is unchanged (sup figure 4C). This would indicate that the enrichment of SERPINE2 observed in the matrisome following loss of ADAMTS2 is reflective of reduced cleavage, rather than a change in expression.

      Figure 6: A, why ta use aSMA and not invasive activity as a readout here?

      Increased αSMA expression following ADAMTS14 knockdown provides a strong, clear, 2D phenotype to act as a readout for an siRNA screen with high-content imaging. Performing such a screen with our 3D invasive model is currently impractical.

      There are many parameters leading to decreased aSMA expression upon kd; (1) why only MMP1 and Fibulin were selected as candidates?

      From our αSMA screen, MMP1 and Fibulin2 knockdown were the only candidates that were able to both prevent an increase in αSMA seen with ADAMTS14 loss alone, and are known ADAMTS14 substrates. Further validation in our 3D invasive model demonstrated that Fibulin2 and not MMP1 was responsible for the effect of ADAMTS14 loss on invasion.

      (2) the single kd control of the screen candidates is missing!

      We feel this control is not needed, as the goal of the experiment was to establish which candidate was responsible for mediating the effects brought about by ADAMTS14 knockdown. Increased αSMA expression with IL-1β loss validates our approach, as this is a known negative regulator of TGFβ signalling.

      (3) Can it be expected that all these matrisomal proteins are involved in aSMA expression regulation? I have doubts.

      We agree with the reviewers comment, from the siRNA screen (sup figure 5B) it is clear that the majority of the identified matrisome proteins have a minimal effect on αSMA expression following loss of ADAMTS14.

      C, D, E, why MMP1 was not also tested in these assays?

      Our spheroid assay clearly demonstrated that invasion was enhanced following ADAMTS14 knockdown even with co-knockdown of MMP1. Given the strong rescue observed with co-knockdown of Fibulin2 we proceeded to further analyse this candidate over MMP1.

      F, Fibrillin is shown in the figure but not described in the text. It would be quite interesting to see whether Fibrillin kd has the same effect as TS14 kd on LTGF-β activation (which of course need to be shown experimentally).

      The association of fibrillin with TGFβ release is well established as it underpins the biology behind Marfan syndrome. Loss of fibrillin, or mutations to its TGFβ binding sites results in a phenotype consistent with super active TGFβ signalling.

      E, what is the meaning of αSMA intensity quantification? By IF staining of αSMA? PSC αSMA expression should be quantified by qrt PCR and WB.

      We have now incorporated the confocal images analysing αSMA expression into the main figure and labelled the quantification accordingly. We feel this improves the clarity of the figures. Every western blot is now presented with quantification.

      Also here, kd efficiency of TS14 and Fibulin2 should be provided by qrt PCR and WB.

      Figure S5E should be part of figure 6, qrt PCR of Fibulin2 should be added.

      We have moved this western blot to the main figure (Fig 7C). We feel additional PCR validation of Fibulin 2 knockdown is not necessary.

      Figure 5/6 and throughout: It is claimed that ADAMTS2 and ADAMTS14 regulate TGFβ bioavailability through SREPINE2-Plasmin and Fibulin2. As mentioned above, TGFβ activation is only mentioned in the schemes, but no experimental evidence is given. In addition, according to previous studies, ADAMTSs can activate latent TGFβ directly by interaction with the LAP of latent TGFβ. .

      We have now included extra experimental evidence to support an association of ADAMTS proteins with TGFβ bioavailability. Using a TGFβ luciferase reporter construct, we demonstrate that active TGFβ is increased following loss of ADAMTS14, which is abrogated with concomitant loss of Fibulin2. This provides further evidence that ADAMTS14 is mediating its effects on myofibroblast differentiation / invasion through TGFβ release.

      Figure 3B, C, and 6D: We are confused from the migration/invasion assays. Invasion should be based on migration of tumor cells, whereas in the migration assays only stellate cells seem to be active? Can you explain this to us? According to Figure 3B, stellate and cancer cells are cocultured in the chamber. Is this the same condition as for the experiment presented as figure 6D?

      In our migration assay, stellate and cancer cells are co-cultured in the apical chamber and cell migration imaged over time. We pooled data of both cancer and stellate cell migration following stellate specific knockdown of either ADAMTS2 or ADAMTS14, which showed an increase in cell migration following loss of ADAMTS14. In figure 7, we again use this assay to demonstrate that Fibulin2 expression accounts for the phenotype observed from loss of ADAMTS14.

      In summary, this study for the first time found that ADAMTS2 and ADAMTS14 have opposite roles on myofibroblast differentiation, which is shown by using chimeric spheroids of stellate and pancreatic cancer cells. The authors claim a therapeutic potential for pancreatic cancer by regulating ADAMTS2/14-mediated stellate cell activation, which should avoid cancer cell invasion. The approach is interesting and there is preliminary evidence, however the study has many gaps and requires substantive workload.

      We thank the reviewer for their support of our findings. We hope the additional data, combined with the known role for these substrates in the regulation of TGFβ, strengthens the clarity of our manuscript.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      AMADTS2 and ADAMTS14 belong to the disintegrin and metalloproteinase with thrombospondin motif protein family, mainly produced by pancreatic stellate cells (PSC) and are related to cancer cell invasion. This study reveals that ADAMTS2 and ADAMTS14 have opposite roles in myofibroblast differentiation based on experiments testing HSC driven cancer cell invasion, variant expression of HSC activation makers and the related downstream targets analysed upon RNA sequencing analyses. The authors (TA) established PSC/cancer cell chimeric spheroids for investigating the crosstalk between these cell types in 3D in vitro. Based on their findings, they claim that ADAMTS2 and ADAMTS14 have different functions regarding PSC and TGF-β activation. However, their conclusions mainly rely on quantitatve data of invasion and mechanistic details are completely lacking.

      Comments:

      Typos, even in the abstract, e.g. first sentence incomplete Introduction is rather sparce with one third of the text repeating the results of the study Some citations do not at all fit with the position where they are placed; needs approval

      In this study, it is said that TS2 (AMADTS2) and TS14 (ADAMTS14) have opposite functions on myofibroblast differentiation, with individual depletion leading to distinct matrisomal phenotypes in PSC. However, both similarly contribute to collagen processing. As we know, collagen is increased in response to TGFβ signaling, since TS2 depletion (knock down, kd) inhibits and TS14 kd is suggested to promote TGFβ activation, it is expected that this has impact on the available collagen levels. How do the authors explain that nevertheless the kd effect on collagen is very similar?

      The authors claim that TS2 facilitates TGFβ release and TS14 is a key regulator of TGFβ bioavailability. However, throughout the whole data, there is no experimental evidence for this conclusion. TGFβ activation, LAP concentration and downstream effects should be provided.

      Most of the conclusions in the manuscript are based on effects to invasion and the estimated quantification histograms. "Black boxes in between the treatment, e.g. knockdown and readout, that relate to the signals and mechanisms remain black boxes throughout. For example, the impact of the treatments on stellate cell activation markers, the cancer cells invasion signaling, the SERPINE2- and Fibulin2-dependent myofibroblast differentiation pathways should be mechanistically investigated.

      The authors investigate one cell line each for their conclusions; we know that different cell lines behave differently; can they confirm that the finding they present is of general validity or a finding that is specific for the tested cancer/PSC cell lines. Can the principle findings also be proven in primary cells. More importantly, the authors should proof their findings in PaCa tissue of patients as follows: Expression of the proteases in the tissue, related variation of matrisome signatures, e.g. by snRNASeq, to confirm relevance of the finding.

      Details related to the figures:

      Figure 1: Are the numbers of PSC and PaCa cells integrated in the spheres related to the numbers found in patients? B, it seems that the PSC in the spheroid are not equally distributed but instead are all located in close vicinity to eachother in a cloud; is that the representative situation for the spheres and is this similar in the PaCa cancer tissue? Does this have influence on the results?

      Figure 2: It is interesting to hear that BMP1, which is actually a ligand for BMP signaling is a protease for Collagen. How does this work? C, Quantification of all blots should be presented.

      Figure S2: TS2 kd and TS14 kd should be confirmed and provided by both qrt PCR and WB data.

      Figure 3: F; this result is arguing against the conclusion that TGFb bioavailability is a function of the ADAMs, since the kd impacts on the treatment result with exogenous TGFb. This suggests an effect downstream of ligand activation by proteasomal cleavage, e.g. receptor activation or signal transduction; this needs clarification. H, I: TGFβR inhibitor reduces TS14kd enhanced αSMA expression. How is unclear and needs clarification, since from F we know that already activated TGFβ needs TS2 to fully induce αSMA expression.

      SupplFig.3: B, C, as above!

      Figure 4: TIMP1 is a canonical TGFb signaling target gene in fibrosis. How the authors explain that TIMP1 is upregulated in both knockdowns, when they claim that TS2 and 14 have opposing functions on TGFb activation. This result as well puts their conclusions as regards TGFb and also the myofibroblast phenotype into question. Especially, since TIMP1 signifies stellate cell activation not only in the pancreas, but also in the liver and kidney. C, D, E should be explained in more detail and all details of the results should be presented. This holds also for the different myofibroblast phenotypes. All data should be included. From recent scRNASeq investigations, several myofibroblast populations were described and compared, e.g my-stellate cells vs i-stellate cells. To which of these phenotypes the identified populations belong?

      Figure 5: C, Only brightfield images are provided, confocal images are suggested for comparison of +/- Aprotinin treatment. The efficiency of TS2 and Serpine2 kd should be provided by qrt PCR and WB. TS2 kd promoted SERPINE2 expression should also be presented by qrt PCR and WB.

      Figure 6: A, why ta use aSMA and not invasive activity as a readout here? There are many parameters leading to decreased aSMA expression upon kd; (1) why only MMP1 and Fibulin were selected as candidates? (2) the single kd control of the screen candidates is missing! (3) Can it be expected that all these matrisomal proteins are involved in aSMA expression regulation? I have doubts. C, D, E, why MMP1 was not also tested in these assays? F, Fibrillin is shown in the figure but not described in the text. It would be quite interesting to see whether Fibrillin kd has the same effect as TS14 kd on LTGF-β activation (which of course need to be shown experimentally). E, what is the meaning of αSMA intensity quantification? By IF staining of αSMA? PSC αSMA expression should be quantified by qrt PCR and WB. Also here, kd efficiency of TS14 and Fibulin2 should be provided by qrt PCR and WB.

      Figure S5E should be part of figure 6, qrt PCR of Fibulin2 should be added.

      Figure 5/6 and throughout: It is claimed that ADAMTS2 and ADAMTS14 regulate TGFβ bioavailability through SREPINE2-Plasmin and Fibulin2. As mentioned above, TGFβ activation is only mentioned in the schemes, but no experimental evidence is given. In addition, according to previous studies, ADAMTSs can activate latent TGFβ directly by interaction with the LAP of latent TGFβ. . Figure 3B, C, and 6D: We are confused from the migration/invasion assays. Invasion should be based on migration of tumor cells, whereas in the migration assays only stellate cells seem to be active? Can you explain this to us? According to Figure 3B, stellate and cancer cells are cocultured in the chamber. Is this the same condition as for the experiment presented as figure 6D?

      In summary, this study for the first time found that ADAMTS2 and ADAMTS14 have opposite roles on myofibroblast differentiation, which is shown by using chimeric spheroids of stellate and pancreatic cancer cells. The authors claim a therapeutic potential for pancreatic cancer by regulating ADAMTS2/14-mediated stellate cell activation, which should avoid cancer cell invasion. The approach is interesting and there is preliminary evidence, however the study has many gaps and requires substantive workload.

      Significance

      AMADTS2 and ADAMTS14 belong to the disintegrin and metalloproteinase with thrombospondin motif protein family, mainly produced by pancreatic stellate cells (PSC) and are related to cancer cell invasion. This study reveals that ADAMTS2 and ADAMTS14 have opposite roles in myofibroblast differentiation based on experiments testing HSC driven cancer cell invasion, variant expression of HSC activation makers and the related downstream targets analysed upon RNA sequencing analyses.

      The authors (TA) established PSC/cancer cell chimeric spheroids for investigating the crosstalk between these cell types in 3D in vitro. Based on their findings, they claim that ADAMTS2 and ADAMTS14 have different functions regarding PSC and TGF-β activation. However, their conclusions mainly rely on quantitatve data of invasion and mechanistic details are completely lacking.

      Comments:

      Typos, even in the abstract, e.g. first sentence incomplete Introduction is rather sparce with one third of the text repeating the results of the study Some citations do not at all fit with the position where they are placed; needs approval

      In this study, it is said that TS2 (AMADTS2) and TS14 (ADAMTS14) have opposite functions on myofibroblast differentiation, with individual depletion leading to distinct matrisomal phenotypes in PSC. However, both similarly contribute to collagen processing. As we know, collagen is increased in response to TGFβ signaling, since TS2 depletion (knock down, kd) inhibits and TS14 kd is suggested to promote TGFβ activation, it is expected that this has impact on the available collagen levels. How do the authors explain that nevertheless the kd effect on collagen is very similar?

      The authors claim that TS2 facilitates TGFβ release and TS14 is a key regulator of TGFβ bioavailability. However, throughout the whole data, there is no experimental evidence for this conclusion. TGFβ activation, LAP concentration and downstream effects should be provided.

      Most of the conclusions in the manuscript are based on effects to invasion and the estimated quantification histograms. "Black boxes in between the treatment, e.g. knockdown and readout, that relate to the signals and mechanisms remain black boxes throughout. For example, the impact of the treatments on stellate cell activation markers, the cancer cells invasion signaling, the SERPINE2- and Fibulin2-dependent myofibroblast differentiation pathways should be mechanistically investigated.

      The authors investigate one cell line each for their conclusions; we know that different cell lines behave differently; can they confirm that the finding they present is of general validity or a finding that is specific for the tested cancer/PSC cell lines. Can the principle findings also be proven in primary cells. More importantly, the authors should proof their findings in PaCa tissue of patients as follows: Expression of the proteases in the tissue, related variation of matrisome signatures, e.g. by snRNASeq, to confirm relevance of the finding.

      Details related to the figures:

      Figure 1: Are the numbers of PSC and PaCa cells integrated in the spheres related to the numbers found in patients? B, it seems that the PSC in the spheroid are not equally distributed but instead are all located in close vicinity to eachother in a cloud; is that the representative situation for the spheres and is this similar in the PaCa cancer tissue? Does this have influence on the results?

      Figure 2: It is interesting to hear that BMP1, which is actually a ligand for BMP signaling is a protease for Collagen. How does this work? C, Quantification of all blots should be presented.

      Figure S2: TS2 kd and TS14 kd should be confirmed and provided by both qrt PCR and WB data.

      Figure 3: F; this result is arguing against the conclusion that TGFb bioavailability is a function of the ADAMs, since the kd impacts on the treatment result with exogenous TGFb. This suggests an effect downstream of ligand activation by proteasomal cleavage, e.g. receptor activation or signal transduction; this needs clarification. H, I: TGFβR inhibitor reduces TS14kd enhanced αSMA expression. How is unclear and needs clarification, since from F we know that already activated TGFβ needs TS2 to fully induce αSMA expression.

      SupplFig.3: B, C, as above!

      Figure 4: TIMP1 is a canonical TGFb signaling target gene in fibrosis. How the authors explain that TIMP1 is upregulated in both knockdowns, when they claim that TS2 and 14 have opposing functions on TGFb activation. This result as well puts their conclusions as regards TGFb and also the myofibroblast phenotype into question. Especially, since TIMP1 signifies stellate cell activation not only in the pancreas, but also in the liver and kidney. C, D, E should be explained in more detail and all details of the results should be presented. This holds also for the different myofibroblast phenotypes. All data should be included. From recent scRNASeq investigations, several myofibroblast populations were described and compared, e.g my-stellate cells vs i-stellate cells. To which of these phenotypes the identified populations belong?

      Figure 5: C, Only brightfield images are provided, confocal images are suggested for comparison of +/- Aprotinin treatment. The efficiency of TS2 and Serpine2 kd should be provided by qrt PCR and WB. TS2 kd promoted SERPINE2 expression should also be presented by qrt PCR and WB.

      Figure 6: A, why ta use aSMA and not invasive activity as a readout here? There are many parameters leading to decreased aSMA expression upon kd; (1) why only MMP1 and Fibulin were selected as candidates? (2) the single kd control of the screen candidates is missing! (3) Can it be expected that all these matrisomal proteins are involved in aSMA expression regulation? I have doubts. C, D, E, why MMP1 was not also tested in these assays? F, Fibrillin is shown in the figure but not described in the text. It would be quite interesting to see whether Fibrillin kd has the same effect as TS14 kd on LTGF-β activation (which of course need to be shown experimentally). E, what is the meaning of αSMA intensity quantification? By IF staining of αSMA? PSC αSMA expression should be quantified by qrt PCR and WB. Also here, kd efficiency of TS14 and Fibulin2 should be provided by qrt PCR and WB.

      Figure S5E should be part of figure 6, qrt PCR of Fibulin2 should be added.

      Figure 5/6 and throughout: It is claimed that ADAMTS2 and ADAMTS14 regulate TGFβ bioavailability through SREPINE2-Plasmin and Fibulin2. As mentioned above, TGFβ activation is only mentioned in the schemes, but no experimental evidence is given. In addition, according to previous studies, ADAMTSs can activate latent TGFβ directly by interaction with the LAP of latent TGFβ. .

      Figure 3B, C, and 6D: We are confused from the migration/invasion assays. Invasion should be based on migration of tumor cells, whereas in the migration assays only stellate cells seem to be active? Can you explain this to us? According to Figure 3B, stellate and cancer cells are cocultured in the chamber. Is this the same condition as for the experiment presented as figure 6D?

      In summary, this study for the first time found that ADAMTS2 and ADAMTS14 have opposite roles on myofibroblast differentiation, which is shown by using chimeric spheroids of stellate and pancreatic cancer cells. The authors claim a therapeutic potential for pancreatic cancer by regulating ADAMTS2/14-mediated stellate cell activation, which should avoid cancer cell invasion. The approach is interesting and there is preliminary evidence, however the study has many gaps and requires substantive workload.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      The manuscript by Carter and colleagues examines that role of cancer-associated fibroblasts (CAFs) in regulation of invasion in a 3D co-culture assay with epithelial cells. The authors propose that invasive chains of cancer cells are led by fibroblasts. The authors utilise a system of co-culture to create chimeric human-mouse fibroblast-cancer cell spheroids (both directions utilised, to eliminate species bias) to allow for in situ sequencing of the co-operating transcriptional programmes of each cell type during 3D invasion. From this powerful approach, this allowed the authors to identify two key two collagen-processing enzymes, ADAMTS2 and ADAMTS14, as contributing to CAF function in their system. The authors identify that these two enzymes have opposing roles in invasion, and map some of their key substrates in invasion, which extend beyond collagen-processing. The authors propose that one key function is to control the processing of TGFbeta, the latter of which is a regulator of the myofibroblast subpopulation of CAF. Overall, the findings of the manuscript are interesting, but need some further proof-of-principal demonstrations to extend their findings to support the claims within.

      • The authors demonstrate a clear role of ADAMTS2 and ADAMTS14 in stellate function during differentiation and invasion. Is there any evidence of such changes in patient materials? Could the authors query publicly available databases of micro-dissected stroma vs epithelium to validate the translational relevance of their findings?

      Major comments:

      • Page no. 4, Line 71, The authors conclude that the invasion in the chimeric spheroids is "led by" stellate cells. This is a key concept in the manuscript. How do the authors define the "led by" phenomena? What is the frequency that this occurs?
      • For Figure 2A and S2A, the text suggests that the heatmap represents the stellate vs cancer cell expression (as shown in Figure 1B and S1B) in the respective species but the labelling below the heatmap suggests they are all cancer cells (Mia, Pan, R2 and DT). Is this a typo? Could the authors clarify this?
      • The text and the figures are lacking information about the cell line names used in the experiment, e.g, Figure 2C, 2D, 2SB, 2SC and 2SD does not indicate what cell line was used in the study. This is the same with other figures as well. Please indicate in all instances exactly which samples are queried.
      • It's mentioned in the text that the authors have used the cancer and stellate cells in a 1:2 ratio but the numbers of stellate cells look different between different spheroids confocal images. e.g. The numbers look very different between the Miapaca2:PS1 vs Miapaca2:mPSC spheroids. Is this simply the representative images, or are their bona fide differences. This, in turn, would impact on claims of cells being 'led' by stellate cells. Can the authors clarify?
      • While for most of the experiments the authors generated the chimeric spheroids first and then performed the respective experiments, it appears that for the invasion assay simply co-culture of Cancer cells and stellate cells was done. Is this correct? Have the authors tried performing the assay with the chimeric spheroids to see if the stellate cells still invade?
      • The authors claim that ADAMTS2 and ADAMTS14 regulate the bioavailability of TGFB, and this is a key reason that these regulate CAF differentiation. However, there is no direct demonstration of this concept, which is conspicuous by absence. Could the authors either directly demonstrate this, or remove such notions from the results, and explicitly state that this is an untested speculation in discussion? Examples of this are:

        • Line 173, authors state "ADAMTS2 facilitates TGFβ release through degradation of the plasmin inhibitor, SERPINE2 (Figure 5D)"
        • Line 196 authors conclude "Together these data implicate 197 ADAMTS14 as a key regulator of TGFβ bioavailability (Figure 6F)."
        • Line 240 states "This reduces the activation of Plasmin, preventing the release of TGFβ (Figure 5C)." Since this is just a model without detailed experiments, It will be better to propose rather than conclude.
      • Figure S5C shows a less invasive phenotype in the NTCsi + ADAMTS14si spheroids compared to the NTCsi + NTCsi control. However, there appears no appreciable difference between NTCsi + ADAMTS14si and NTCsi + NTCsi spheroids' brightfield images in Figure 5SD. Could the authors comment on this?

      Minor Comments:

      • Page no. 2, Line 20 has an incomplete sentence "Crosstalk between cancer and stellate cells is pivotal in pancreatic cancer, resulting in differentiation 21 of stellate cells into myofibroblasts that drive."
      • Figure 2C; Figure S2C and Figure S5E lack quantification for the western blots.
      • Why did the authors choose to investigate the Metzincin family? Could the authors provide their reasoning to investigate these proteins, to the exclusion of other candidates?
      • Info about the number of fields imaged per sample for the microscopy data is missing in the figure legends (e.g. Figure 2F and 2I, Figure 5SF).
      • Any particular reason why the ADAMTS2 expression was not checked through Western blotting like ADAMTS14 in Figure S2B.
      • The legends for Figure 3SC and 5SF mention that "Images are representative of at least two biological replicates". How many technical replicates were used? It would be useful if the relative intensity of the images is measured and plotted in a graph.

      Significance

      This work provides an examination of the cross talk between fibroblasts and cancer cells in a 3-Dimensional culture model of pancreatic tumour cell invasion. By using chimeric human-mouse spheroids, the authors are able to identify cell-type specific transcripts by bulk RNA sequencing in situ. This advance is not to be underestimated as a number of existing approaches for cell type-specific profiling (eg. single-cell sequencing) relies upon dissociation of cell communities prior to sequencing. It is very likely that transcriptional programmes change during this isolation process. This approach allows the authors to identify transcriptional co-operating programmes in situ. This data provides a resource to understand this key co-operation of these two cell types during tumourigenesis, and will be of interest to the pancreatic cancer field. In addition, the mapping of the key substrate of these enzymes provides further insights that may be useful in understanding the expanded target repertoire of these enzymes beyond collagen processing.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      This study aims to explain the opposing contributions of stromal stellate cells/CAFs to PDAC. By first identifying stroma-specific proteases, followed by a process of candidate selection and elimination, the authors find that two specific metalloproteases that share enzymatic activity against collagen in fact have differential activity on TGFb availability. This could be interpreted as a way of shaping the CAF population and tumor-promotin or -restricting properties of the stroma.

      There are several flaws that the authors could address to improve the manuscript:

      1. In the flow of experiments and analyses, there is a strange mix of fully unbiased discovery phases followed by functional experiments that do not consider all possible candidates to test, and vice versa. For instance, from the mixed-species transcript analysis, ADAMTS2 and -14 are chosen based on their shared collagenase activity based on literature. However, the authors then perform again a proteomics analysis to identify things from the entire matrisome that are cleaved by these enzymes? Then, for ADAMTS2 a co-silencing approach is done on one selected candidate (Serpine2), but for ADAMTS14 an siRNA screen is performed? The problem of this approach is that the rationale for some studied enzymes is very strong, where as for others it is not.
      2. The ECM is more than just collagen. Choosing these two metalloproteases based on their shared collagen substrate is an approach that perhaps oversimplifies the ECM a bit, and again, does not provide the strongest rationale that these metalloproteases are most likely to explain counteracting stromal activities on tumor growth and progression.
      3. Related to the above: How were the stellate cells used for the matrisome analysis grown? In the suspension setup or adherent? This will have a large impact on the outcome. Is there for instance hyaluronic acid in this matrix?
      4. Performing the species-specific transcript analysis both ways is a neat approach, but why did the authors ignore the opportunity to formally overlay/compare the two stromal gene sets to define likely candidates based on statistics?

      Minor comments:

      The bioinformatics Methods need more details on how reads were mapped to the different genomes. How many mismatches were allowed and was the mapping done separately or using for instance Xenofilter?

      The authors use the knowledge on the activities of both ADAMTS2 and -14 on collagen as a rationale to choose these two. Is there really a need for the paragraph (and associated figures) from line 102 on?

      Abstract, line 21; some words are missing?

      Were the siRNA screen hits validated?

      What is the genotype of the mouse cancer cells? KPC-derived?

      Significance

      The trick of dissecting tumor from stromal signals in spheroid cocultures by RNA-Seq is a cool trick, but not new and the authors should probably cite some prior work.

      What this all means for patients (or in vivo tumors even) remains unclear. There is some debate on whether highly activated CAFs (ACTA2/aSMA+ cells, some call them myCAFs) are indeed tumor-restrictive or whether they promote invasion. The authors appear to argue the latter (which I can agree with) but without any translational work to show what the net outcome of this mechanism is, the study remains descriptive and perhaps of limited interest.

    1. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      This study by Kordala et al reports the identification of new therapeutics to further improve the clinical outcomes of spinal muscular atrophy (SMA) patients. SMA is childhood neurological disease that is caused by insufficient levels of the survival motor neuron (SMN) protein. There are currently three approved therapies for SMA, yet the disease is not cured and many patients remain severely disabled. The authors conducted a screen of known epigenetic regulators to identify molecules that increase SMN protein. They identified MS023, which is a selectively PRMT inhibitor, that promotes SMN exon 7 inclusion and thus full length SMN protein. Importantly, MS023 improves the SMA phenotype alone or in combination with the SMN2 antisense oligonucleotide suggesting it can potentially be used by itself or in combinatorial approaches. While this is a generally well written paper with relatively straight forward experimental design there remains some concerns that should be addressed.

      Major Concerns:

      1. The mechanism of action needs further clarification. Does MS023 work similarly to Risdaplam? Also, if Nusinersen is already interfering with hnRNPA1 how does MS023 augment the splicing.
      2. MS023 alone did not increase improve exon 7 inclusion in the spinal cord of treated SMA mice yet the protein levels were increased (Fig. 3D,F). Are there alternative mechanisms through which MS023 is acting?
      3. Further explanation of why MS023 did not improve exon 7 inclusion in the spinal cord but enhanced the effect of the ASO (Fig. 4B) is needed.
      4. Nusinersen has been shown to almost completely rescue the SMA phenotype in mice. Was the dose used here chosen to be suboptimal?

      Minor Concern:

      Many neurological diseases are now moving to a multimodal approach. The manuscript could be improved with further discussion of why MS023 would be an attractive option compared to other synergistic strategies being employed for SMA, including the most obvious of combining some of the already approved therapies.

      Significance

      This is a generally well done study that works through a screening methodology to identify a molecule that increase the levels of SMN. Mechanistic studies suggest that the compound works through inhibiting the recruitment of hnRNPA1 to the SMN2 gene, thus promoting inclusion of exon 7 and the production of full-length SMN protein.

      The study does not provide definitive data that methyl transferase activity of PRMT promotes exon 7 exclusion or that the inhibitor changes the methylation state of any of the proteins involved. However, knockdown experiments does not exclude this possibility.

      This study would be of general interest to wider audience if more detail was included regarding the current SMA landscape and how MS023 fits in with what is currently available. The transcriptome data was potentially very interesting since it provided clues on how MS023 is exerting its synergistic effect(neuroinflammation angle is relatively unique), but that data was only briefly discussed.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary

      SMA is a severe, monogenetic, progressive neuromuscular disease that mostly affects young children. SMA is cause by homozygous loss of function of SMN1. The main modifier of disease severity - that ranges widely, from neonatal to adult onset - is the presence of a varying number of SMN2 copies in the human genome. Recently, several gene-targeting therapies for SMA have been approved. This has changed the outcome of SMA drastically for many patients, but, surprisingly, the effect of these treatments varies strongly between patients. This leads to significant uncertainty for patients, families and clinicians and poses a challenge to reliable prognosis.

      One of the drugs that has been approved for treating SMA is the antisense oligonucleotide nusinersen (Spinraza). Nusinersen improves SMA outcomes by enhancing the splicing of SMN2 -transcribed pre-mRNA, leading to an increase in the inclusion of exon 7 leading to an increase in the availability of full-length, functional SMN protein. In the current manuscript, Kordala and colleagues investigate the effect of a library of 54 compounds (focused on modulating epigenetic regulators) on SMN2 splicing and SMN protein in an SMA type II patient fibroblast cell line. They found the Type I PMRT inhibitor, MS023 to dose-dependently increase full length SMN2 splicing SMN protein levels, by decreasing hnRNPA1 binding to SMN2 pre-mRNA. Next, they show that MS023 monotreatment of the severe 'Taiwanese' (+/- SMA type I) mouse model of SMA leads to improved survival and weight gain. Moreover, they show that combinatorial treatment of the same mouse model with MS023 and nusinersen, significantly further improves survival compared to both nusinersen and MS023 monotreatment. Finally, transcriptome analysis suggests that the majority of misregulated transcripts in SMA is rescued by both nusinersen an combinatorial treatment but, importantly, the rescue observed in the combinatorial group seems more complete.

      Suggestions

      The authors state in the abstract that "transcriptomic analysis revealed that MS023 treatment has very minimal off-target effects". However, their transcriptomic analyses do not contain a condition that investigates the effects of MS023 on the transcriptome in WT and SMA animals on its own. I belief this would have been an essential addition to support the conclusion on off-target effects of MS023, especially considering the benefits that the authors list in the discussion when compared to e.g. VPA. I agree with their comments about the unspecificity of such drugs; however, I don't belief their current transcriptomics analysis on MS023 fully support this conclusion either. It may not be feasible to include such an experiment in a revised version of the manuscript, but in this case the authors should reflect on the wording of their conclusions.

      I agree with the authors that the effect of MS023 on SMN-FL RNA appears to be dose-dependent but I don't think the data fully supports that conclusion for SMN protein levels (compare e.g. 250 nM and 2.5 µM quantification). In fact, there are many inconsistencies between SMN RNA and SMN protein levels: in figure 3 (MS023 monotreatment), the authors observe in spinal cord no change in SMN RNA but a significant increase in SMN protein. In contrast, in the same figure, in muscle, both SMN RNA and protein increase significantly. This is a bit confusing and to me mostly means that the regulation of SMN RNA and protein expression in complex and likely depends on many more factors than PMRT activity and hnRNPA1 arginine methylation status. Indeed, the authors pick hnRNPA1 as a promising target from a list of proteins that contains 72 in total. Are there no other promising candidates in this list that would be able to explain the unclear and inconsistent correlation between SMN RNA splicing and SMN protein levels?

      The in vitro work was based on the use of one primary fibroblast cell line. It would be relatively straightforward to characterized the effect of MS023 on e.g. type 1 and type 3 patient-derived lines, thus providing a clearer overview of the use of this type of drug in SMA patients of different types. Both through the Corriell repository (as used in the current paper) and surely also through biobanks at Oxford it should be relatively straightforward to obtain such cell lines and for the authors to extend their analyses to include patients of different types (and with varying SMN2 copy number).

      The mechanism that the authors suggest in e.g. Fig. 2D about the interaction of hnRNPA1 with the SMN2-ISSN1 in relation to PMRT inhibition is very similar to how nusinersen prevents SMN2-ISSN1 binding of hnRNPA1 (as the authors mention in the discussion). How do the authors suggest this would work? Do they have suggestions for further experiments to investigate this interaction (e.g. using hnRNPA1 and nusinersen molecules with point mutations?)

      Minor comments

      Do I understand correctly that none of the screened molecules in figure 1 lead to significantly unregulated SMN protein levels (including MS023)? What causes the difference between figure 1 (no signficicant upregulation of SMN protein) vs figure 2 (a dose dependent increase of SMN protein)? Do the authors have an explanation for this difference? In relation to this point, I am somewhat surprised at the variability in protein quantifications in especially figures 1 and 2. In these figures, biological replicates are obtained from one cell line. Although I understand that there is not necessarily much benefit to including all western blots used for quantification in for example the supplementary files with the paper, it would be useful to see some examples for e.g. the western blots for the quantifications in fig. 1C. Similarly, I appreciate the complexity of the IPs and arginine-methylation specific blotting in fig 2E, but the current tightly cropped blots are not super convincing and the uncropped blots are not included in the supplementary data. Also how was this quantified; fig 2F lacks some indication of standard deviation or other indicator of reproducibility between measurements.

      There are some what appear to be reference formatting errors (e.g. lines 17 and 20 on page 15 of the manuscript PDF amongst others).

      The PDF version of Supplementary table 2 in its current format is not really usable or readable; an Excel version would be preferable.

      Significance

      The paper addresses an interesting question: it aims to improve the efficacy of existing drugs for SMA by identifying novel molecules that may improve the working mechanism of, in this case, nusinersen. Others have tried this before by using VPA, but the current molecule appears to be more specific. However, it would have been interesting to get more details on the effect of this novel compound: a wider range of cell lines, further mouse experiments (a control group in figs. 3 and 5) and analysis (e.g. pathological analysis of the neuromuscular system). It would in fact have been interesting to combine some of the analyses in the current work also with the other available SMN2 splicing modifier risdiplam: as risdiplam also modulates SMN2 splicing, MS023 might also have been suitable to improve risdiplam efficacy. Especially in the cell line the authors have used this would have been a relatively straightforward addition. I believe the paper may provide an interesting start, but without further analysis remains at that stage.

      The audience to likely be most interest are mostly colleagues from the SMA field, as the mechanisms in the current manuscript focus very much on ISS-N1-regulated SMN2 splicing which is highly specific for SMA.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Manuscript number: RC-2022-01785

      Corresponding author(s): Amélie, Fradet-Turcotte, and Louis, Flamand

      Title: The immediate early protein 1 of human herpesvirus 6B counteracts ATM activation in an NBS1-dependent manner

      Our manuscript received positive and constructive comments from all three Reviewers. First, they unanimously agreed that the biology uncovered in our study is novel and of broad scientific interest, including researchers studying host-pathogen, DNA damage response and repair processes. They highlighted that the manuscript is well-written and presents clear, rigorous, and convincing data. Second, they provided constructive comments to strengthen our model and the biological relevance of our findings. Here, we provide an overview of our findings and a point-by-point reply explaining the revisions, additional experimentations and analyses planned to address the points raised by the referees.

      1 - Description of the planned revisions

      1.1 *The three Reviewers agreed that we convincingly show that HHV-6B IE1 binds to NBS1 and inhibits ATM activation; however, they all raised concerns about whether the IE1-dependent inhibition of ATM is required for HHV-6B replication and integration. *

      We agree with the Reviewers that the biological data validating the impact of ATM on viral replication and integration could be solidified. Problematically, IE1 is essential to promote HHV-6B replication in infected cells, and thus any IE1 knockdown (KD) or knockout (KO) approach will generate data that are hard to interpret. As mentioned by Reviewers 1 and 3, the ideal experiment to address this concern would be to infect cells with an HHV-6B virus in which IE1 contains a small truncation or a mutation that specifically suppresses its ability to inhibit ATM. Creating IE1 deletion and single mutants in the HHV-6 genome is technically challenging and can only be achieved using herpesvirus bacterial artificial chromosome (BAC)(Warden et al., 2011). Although HHV-6A BAC was previously described (Borenstein & Frenkel, 2009; Tang et al., 2010), our multiple attempts at generating HHV-6B BAC remained unsuccessful. As an alternative, we will investigate if the inhibition of ATM by using the ATM inhibitor (KU-55933) or its depletion by an shRNA, impact HHV-6B replication and integration as proposed by Reviewers 1 and 3. Specifically, MOLT-3 cells will be either treated with 10 µM KU-55933 or depleted for ATM with shATM(Rodier et al., 2009) prior to infection. DMSO and shLUC will be used as controls, respectively. These experiments will allow us to determine if ATM inhibition enhances HHV-6B replication and/or integration.

      1.2 Reviewer 2: "Although they have nicely mapped the interaction (between IE1 and NBS1), the authors have not yet defined the mechanism of ATM inhibition. They propose a number of possibilities in the discussion, but none are yet tested experimentally. The manuscript would be strengthened by further exploration of these possibilities. Does the sequence or proposed structure give any insights into interactions that could be relevant? Is IE1 phosphorylated by ATM, and could this affect the binding of other proteins?"

      We thank the Reviewer for pinpointing that a deeper characterization of the mechanism of ATM inhibition would allow us to support our model. In the manuscript, we discuss the possibility that IE1 inhibits ATM activation by preventing the interaction between the FxF/Y motif of NBS1 and ATM. Although we do not detect a strong interaction between IE1 and ATM (Fig. 5A), we have not yet investigated if the ATM-inhibitory domain (ATMiD) is required for IE1 to prevent the recruitment of ATM by NBS1 at the LacO array (Fig. 5E). Thus, we will determine if an ∆ATMiD IE1 inhibits the interaction between NBS1 and ATM in this assay. If the ATMiD domain interferes with the interaction of NBS1 with ATM, we expect to see no inhibition of NBS1 activation of ATM in cells that express 3xFlag-HHV-6B IE1 ∆ATMiD.

      Another possibility is that IE1 inhibits ATM activation indirectly by interacting with the nucleosome. The latter possibility is based on the finding that the C-terminal domain of HHV-5 IE1 contains an arginine-serine (RS) motif that interacts with the acidic patch of the nucleosome(Fang et al., 2016). Interestingly, HHV-6B IE1 sequence analysis reveals two RS motifs at positions 852-53 and 1033-34. Thus, the conserved RS residues (R852A/S853A and R1033A/S1034A) will be mutated in the ATMiD domain of HHV-6B IE1 (810-1078), and their ability to inhibit ATM activation will be quantified by immunofluorescence approach as described in Fig 6 D-E. In parallel, GST-tagged recombinant ATMiD of HHV-6B IE1 will be produced, and pulldown experiments will investigate their ability to bind to nucleosomes. We already have purified nucleosomes in the lab and have the expertise for this type of analysis(Galloy et al., 2021; Sitz et al., 2019).

      Thanks to the Reviewer's comment, we performed sequence analyses for putative ATM phosphorylation sites (SQ/TQ) and found that the protein contains 6 of them, two of which are in the ATMiD of the protein. To determine if the viral protein is a substrate of ATM, we will immunoprecipitate IE1 from MOLT-3 infected cells and use the well-characterized pSQ/pTQ antibody in western blotting analyses. The immunoprecipitation will be done in denaturing conditions to avoid interference with other endogenous interactors of IE1. If the protein is phosphorylated in an ATM-dependent manner, we will test the impact of these mutants on ATM inhibition as done in Fig. 6 D-E.

      Altogether, these experiments will allow us to refine our understanding of the mechanism by which HHV-6B IE1 inhibits ATM activation in host cells.

      1.3* Reviewer 2: "Could the effects of IE1 be linked to other post-translational modifications? The literature suggests this protein to be SUMOylated. Is SUMOylation relevant to the effects on ATM activation?" *

      The Reviewer is right. Our group showed that IE1 is sumoylated on K802R in a SUMO interacting motif (SIM)-dependent manner (V775, I776, V777)(Collin et al., 2020). In the LacO/LacR assays, we already showed that the K802R and SIM mutant (775AAA777) do not impact the interaction of IE1 with NBS1. Although the sumoylated site and the SIM lie outside of the ATMiD, we cannot rule out the possibility that this post-tranlationnal modification impacts ATM inhibition by IE1 throughout a conformational interference. To address this possibility, we will characterize the ability of the single and double K802R/SIM mutant proteins to inhibit the activation of ATM, as described in Fig 6 D-E.

      2 - ____Description of the revisions already incorporated in the transferred manuscript

      The following comments and all minor comments raised by the Reviewers have been incorporated into the transferred manuscript:

      2.1 Reviewer 2: "In Figure 1, they look at micronuclei formation but MNi is not defined the main text."

      We thank the Reviewer for noticing this mistake. MNi is now defined as micronuclei in line 138.

      2.2 Reviewer 3: "As discussed by the authors, HHV-6B IE1 inhibits DSB signaling through NSB1, but we cannot know how this inhibition (might be increase genome instability of both host and virus) enhances viral replication and integration. The readers are easy to understand if the authors described it in the discussion or analyzed by KD or KO of IE1 in infected cells."

      The Reviewer is right. We cannot rule out that increased genomic instability enhances viral replication. Thus, we add the following sentences to clarify this point in the discussion.

      Line 371-374: "Finally, the model presented here assumes that NBS1 and ATM activity must be inhibited to prevent their detrimental effect on viral replication. However, it is impossible to rule out that enhanced viral replication and integration result from the increased level of genomic instability induced in host cells upon viral infection. Further studies will be required to address this question."

      2.3 Reviewer 3: "Described in lines 354-356 are the case of lytic cycle only. In the lytic cycle, the infected cells will die soon after viral replication. and there is no chance to become tumor. However, the state of ciHHV-6 or latently infected cells can be affected by genome instability during IE1 expression. Please add discussion."

      We thank the Reviewer for raising this important point. We agree that the real threat for the host cells regarding tumor development is genomic instability promoted by the expression of IE1 during latent infection or from an integrated form of the virus. Consistent with this possibility, our original manuscript contains this sentence in the abstract:

      Line 60-62: "Interestingly, as IE1 expression has been detected in cells of subjects with the inherited chromosomally-integrated form of HHV-6B (iciHHV-6B), a condition associated with several health conditions, our results raise the possibility of a link between genomic instability and the development of iciHHV-6-associated diseases."

      To further emphasize this point, the following sentence has now been added to the discussion:

      Line 349-356: During the lytic cycle, the accumulation of genomic instability in the host cell genome is not a problem as these cells will die upon the lysis provoked by the virus to release new virus particles. However, more selective inhibition of ATM by IE1 during the latent cycle of HHV-6B or from iciHHV-6B would avoid a detrimental accumulation of genomic alterations in host cells. This model would be consistent with the fact that HHV-6B is not associated with a higher frequency of cancer development, as would be expected if global DSB signaling was inhibited in these cells. Alternatively, expression of IE1 upon the exit of latency may inhibit global DSB signaling, but this phenomenon is restricted to the early stages of the process, thereby minimizing the impact on the host cell's genomic stability.

      2.4 Reviewer 3: Line 114, Miura et al (J Infect Dis 223:1717-1723 [2021]) should be cited.

      This reference has been added in line 113. In the discussion, we also introduce the citation where we mention the link between HHV-6B integration and abortion, line 362 of the revised manuscript.

      3 - ____Description of the revisions that will not be carried out

      3.1 Reviewer 2: "Does it (HHV-6B IE1) also share other activities with herpesvirus proteins e.g. ubiquitinylation?"

      IE1 shares very little sequence homology with proteins from other herpesviruses (except HHV-6A and HHV-7), meaning that deductions based on primary sequence analysis are very limited. Any attempt at understanding the function of HHV-6B IE1 by structure analysis prediction software did not predict any known function or domain. Thus, most of our knowledge of IE1 relies on experiments that used IE1 truncation (this study and (Jaworska et al., 2007)) and point mutants(Collin et al., 2020). The protein contains no conserved RING or HECT domain that would hint at an E3-ligase activity and does not share homology with other herpes proteins that promote ubiquitylation events, such as ICPO from HSV-1(Rodríguez et al., 2020). We believe that, at this point, there is not enough evidence to investigate further if HHV-6B IE1 has an E3-ligase activity.

      3.2 Reviewer 3: Lines 52, "Expression of immediate early protein 1 (IE1) was sufficient to recapitulate this phenotype" is not right. The authors showed that IE1 blocked ATM signaling in transient experiments but they did not show any evidence in infected cells. Kock down or Kock out of IE1 is important to conclude it."

      We agree with the Reviewer HHV-6B IE1 knockdown, or knockout, would allow us to conclude that IE1 is the only protein to target DSB signaling in the infected cells. As mentioned by the Reviewer (see point 3.3 and 1.1), IE1 is essential to promote HHV-6B replication in infected cells. Thus, any knockdown or knockout approach will generate data that are hard to interpret. In contrast, the generation of an HHV-6 genome containing truncation or point mutation that abolishes its ability to inhibit ATM signaling should allow us to bypass this issue. While we believe this question is important, human resource shortages prevent us from addressing this point in an acceptable time frame. Instead, we propose investigating the role of ATM activity in HHV-6B replication and integration. We also rephrased the sentence highlighted by Reviewer 3:

      Line 51-52: "Expression of immediate early protein 1 (IE1) phenocopies this phenotype and blocks further homology-directed double-strand break (DSB) repair."

      3.3 Reviewer 3: The authors did not analyze the effect of viral manipulation as they did not analyze KO or KD of IE1. Even if HHV-6B IE1 is essential for viral replication, they can use dominant negative mutant of IE1 or NSB1 determined in this manuscript.

      Reviewer is right. As discussed in points 3.2 and 1.1, we haven’t tried to rescue IE1 knockdown, or knockout in infected cells. Rescue experiments of IE1 by transient transfection of dominant negative IE1 mutant would require a high level of transfection in MOLT-3 cells and small truncation or mutations of IE1 that revert the ATM inhibitory function of IE1. Screening additional sets of truncations/mutants of IE1 that abolish its ability to inhibit ATM and optimizing the poor transfection efficiency of the lymphoid cell line MOLT-3 will take time and resources that we don’t have at this moment. Thus, we believe that this point should be addressed in follow-up studies.

      REFERENCES

      Borenstein, R., & Frenkel, N. (2009). Cloning human herpes virus 6A genome into bacterial artificial chromosomes and study of DNA replication intermediates. Proceedings of the National Academy of Sciences of the United States of America, 106(45). https://doi.org/10.1073/pnas.0908504106

      Collin, V., Gravel, A., Kaufer, B. B., & Flamand, L. (2020). The promyelocytic leukemia protein facilitates human herpesvirus 6B chromosomal integration, immediate-early 1 protein multiSUMOylation and its localization at telomeres. PLoS Pathogens, 16(7). https://doi.org/10.1371/journal.ppat.1008683

      Fang, Q., Chen, P., Wang, M., Fang, J., Yang, N., Li, G., & Xu, R.-M. (2016). Human cytomegalovirus IE1 protein alters the higher-order chromatin structure by targeting the acidic patch of the nucleosome. ELife, 5. https://doi.org/10.7554/elife.11911

      Galloy, M., Lachance, C., Cheng, X., Distéfano-Gagné, F., Côté, J., & Fradet-Turcotte. (2021). Approaches to study native chromatin-modifying activities and function. Frontiers in Cell and Developmental Biology, Section Epigenomics and Epigenetics, In Press.

      Jaworska, J., Gravel, A., Fink, K., Grandvaux, N., & Flamand, L. (2007). Inhibition of Transcription of the Beta Interferon Gene by the Human Herpesvirus 6 Immediate-Early 1 Protein. Journal of Virology, 81(11), 5737–5748. https://doi.org/10.1128/jvi.02443-06

      Rodier, F., Coppé, J. P., Patil, C. K., Hoeijmakers, W. A. M., Muñoz, D. P., Raza, S. R., Freund, A., Campeau, E., Davalos, A. R., & Campisi, J. (2009). Persistent DNA damage signalling triggers senescence-associated inflammatory cytokine secretion. Nature Cell Biology, 11(8). https://doi.org/10.1038/ncb1909

      Rodríguez, M. C., Dybas, J. M., Hughes, J., Weitzman, M. D., & Boutell, C. (2020). The HSV-1 ubiquitin ligase ICP0: Modifying the cellular proteome to promote infection. In Virus Research (Vol. 285). https://doi.org/10.1016/j.virusres.2020.198015

      Sitz, J., Blanchet, S. A. S. A., Gameiro, S. F. S. F., Biquand, E., Morgan, T. M. T. M., Galloy, M., Dessapt, J., Lavoie, E. G. E. G., Blondeau, A., Smith, B. C. B. C., Mymryk, J. S. J. S., Moody, C. A. C. A., & Fradet-Turcotte, A. (2019). Human papillomavirus E7 oncoprotein targets RNF168 to hijack the host DNA damage response. Proceedings of the National Academy of Sciences of the United States of America, 116(39), 19552–19562. https://doi.org/10.1073/pnas.1906102116

      Tang, H., Kawabata, A., Yoshida, M., Oyaizu, H., Maeki, T., Yamanishi, K., & Mori, Y. (2010). Human herpesvirus 6 encoded glycoprotein Q1 gene is essential for virus growth. Virology, 407(2). https://doi.org/10.1016/j.virol.2010.08.018

      Warden, C., Tang, Q., & Zhu, H. (2011). Herpesvirus BACs: Past, present, and future. In Journal of Biomedicine and Biotechnology (Vol. 2011). https://doi.org/10.1155/2011/124595

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      In this manuscript, the authors report that human herpesvirus 6B (HHV-6B) infection suppresses the host cell's ability to induce ATM-dependent signaling pathways. At least one of the viral proteins named IE1 block ATM signaling and further homology-directed double-strand break (DSB) repair in these cells. The ATM-dependent DNA damage response (DDR) is activated by infection of many viruses and suppresses their replications. Some of them induce the degradation of the MRE11/RAD50/NBS1 (MRN) complex and prevent subsequent DDR signaling. In the case of HHV-6B IE1, the N-terminal domain of it interacts with the MRN complex protein NBS1, the interaction of which might recruit IE1 to DSB and the C-terminal domain of IE1 inhibits ATM. The authors also showed that depletion of NBS1 enhanced HHV-6B replication. Viral integration of HHV-6B into the cellular chromosomes was enhanced by the NSB1 depletion in ATL-negative HeLa cells, supporting the models that the viral integration occurs via telomere elongation rather than through DNA repair.

      Major comments

      This manuscript is well written and will be of interest to the readers. The data seems convincing and statistical analysis is adequate. However, the role and significance of HHV-6B IE1 in infected cells was not analyzed well. If there are not analyzed, the data only show the role of the MRN complex or the only a single protein NSB1 for HHV-6B replication and they cannot conclude that HHV-6B IE1 hampers the ATM signaling for proper viral replication. I have a few comments listed below to improve this manuscript. All of them might be required for a couple of months.

      • (i) Lines 52, "Expression of immediate early protein 1 (IE1) was sufficient to recapitulate this phenotype" is not right. The authors showed that IE1 blocked ATM signaling in transient experiment but they did not show any evidence in infected cells. Kock down or Kock out of IE1 is important to conclude it.
      • (ii) In Fig7, the role of the other factors in the ATM-dependent DDR (such as ATM) should be analyzed by knock down or inhibitors.
      • (iii) The authors did not analyze the effect of viral manipulation as thy did not analyze KO or KD of IE1. Even if HHV-6B IE1 is essential for viral replication, they can use dominant negative mutant of IE1 or NSB1 determined in this manuscript.
      • (iv) As discussed by the authors, HHV-6B IE1 inhibit DSB signaling through NSB1, but we cannot know how this inhibition (might be increase genome instability of both host and virus) enhances viral replication and integration. The readers are easy to understand if the authors described it in the discussion or analyzed by KD or KO of IE1 in infected cells.

      Minor comments

      • (i) Described in lines 354-356 are the case of lytic cycle only. In the lytic cycle, the infected cells will die soon after viral replication. and there is no chance to become tumor. However, the state of ciHHV-6 or latently infected cells can be affected by genome instability during IE1 expression. Please add discussion.
      • (ii) Line114, Miura et al (J Infect Dis 223:1717-1723 [2021]) should be cited.

      Significance

      HHV-6B is ubiquitous herpesvirus which cause exanthem subitem and encephalitis, although effective antiviral is not established yet. Characteristically, HHV-6B has ability to integrate its genome into host. How HHV-6B replicate and integrate its genome in host cells is one of the most important question in this field. I am basic virologist mainly focusing on this virus and believe this manuscript includes important notion for our field.

      To counteract ATM-mediated signaling, many viruses induce the degradation of the MRN complex and prevent subsequent DDR signaling. The mechanism of HHV-6B IE1 described in this manuscript is unique and might be interested by the readers from many fields.

      Furthermore, around 1% of human populations harbor chromosomally integrated HHV-6B in their genome. The pathogenesis of it is not completely understand but must be important not only for virologist but also all of us.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Viruses have evolved different strategies by which they manipulate the host DNA damage response (DDR) in order to propagate in infected cells. This study shows how the human herpesvirus 6B (HHV-6B) blocks homology-directed double-stranded DNA break repair by the immediate early protein 1 (IE1) which they demonstrate inhibits the host ATM kinase. They employ microscopy and cytometry approaches to probe genomic instability, signaling, and interactions between virus and host. They use infection of MOLT-3 cells and induction of IE1 in U2OS cells to examine these mechanisms and the effects on genome stability. They show inhibition of H2AX phosphorylation, and inhibition of homology-directed repair with reporter assays. They discovered that IE1 interacts with the cellular NBS1 protein, localizes to DNA breaks, and inhibits activation of ATM kinase. They map two distinct domains that promote NBS1 interaction and the inhibition of ATM activation. They show that depletion of NBS1 promotes lytic replication in MOLT-3 cells, and also decreases the frequency of integration, at least in some semi-permissive cells.

      Major:

      1. Although they have nicely mapped the interactions, the authors have not yet defined the mechanism of ATM inhibition. They propose a number of possibilities in the Discussion but none are yet tested experimentally. The manuscript would be strengthened by further exploration of these possibilities. Does the sequence or proposed structure give any insights into interactions that could be relevant? Is IE1 phosphorylated by ATM and could this affect binding of other proteins?
      2. Could the effects of IE1 be linked to other post-translational modifications? The literature suggests this protein to be SUMOylated. Is SUMOylation relevant to the effects on ATM activation? Does it also share other activities with herpesvirus proteins e.g. ubiquitinylation?
      3. Are the effects on the lifecycle (lytic replication and integration) affected by ATM kinase in the same way as NBS1?

      Minor:

      1. In Figure 1 they look at micronuclei formation but MNi is not defined the main text.

      Significance

      Overall, the manuscript is well written the experiments are performed in a rigorous manner, and the biology uncovered is of broad scientific interest. It is now known that a number of DNA viruses inhibit aspects of the cellular DNA sensing and repair machinery to overcome antiviral responses and promote infection. Understanding how this achieved by different viral systems provides insights into cellular DNA damage signaling and repair. It also informs about how viruses can trigger genomic instability. In this case, the authors have uncovered a novel way that the ATM kinase is inhibited during HHV-6B infection by the IE1 protein. They show that HHV-6B infection induces genomic instability. Integration of the HHV-6 genome results in inherited chromosomally-integrated (ici)HHV-6A/B. They have some data to show that virus replication is inhibited by NBS1 and that viral integration may be partially impacted. These results have implications for understanding viral integration and genomic instability with this human pathogen. They advance the field and expand our understanding of how viruses manipulate repair pathways and lead to genomic instability. Strengths include the rigorous analysis of interactions with IE1 and impacts on cellular pathways. Limitations include the lack of mechanism for inhibition and the weaker links to viral biology. The results will be on interest to those studying virus-host interactions as well as those studying repair pathways beyond virus infection.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      In this manuscript Collin and colleagues found that the human herpesvirus 6B (HHV-6B) causes genomic instability in host cells by suppressing the host cell's ability to induce ATM-dependent signaling pathways. The authors show that the immediate early protein 1 (IE1) of HHV-6B is sufficient to block homology-directed double-strand break (DSB) repair and ATM-mediated DNA damage signaling. Interestingly, the authors show that IE1 does not affect the stability of the MRN complex, but instead uses two distinct domains to inhibit ATM activation. Finally, the authors show that suppression of NBS1 is critical for the ability of HHV-6B to replicate in permissive cells. In contrast, suppression of NBS1 increases the rate of integration in semi permissive cells. Overall, this study provides a mechanistic insight into HHV-6B infection and viral integration into telomeres may promote genomic instability and the development of certain diseases associated with inherited chromosomally integrated form of HHV-6B.

      Significance

      Overall, this is a superb manuscript, the data are clear, well controlled, and well presented. This reviewer has only a minor suggestion/ comment.

      The authors show convincingly that E1a can bind NBS1 and suppress ATM activation. However, it is not clear whether suppression of ATM is critical for HHV-6 replication. The ideal experiment would be an infection with a virus depleted of E1A (or expressing a defective E1A mutant). I realize that this would be a challenging experiment. An alternative experiment would be to test whether suppression of ATM has the same effect on HHV-6 replication and integration as NBS1 depletion.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Manuscript number: RC-2022-01803

      Corresponding author(s): Brittany A., Ahlstedt, Rakesh, Ganji, Sirisha Mukkavalli, Joao A., Paulo, Steve P., Gygi, Malavika, Raman

      If you wish to submit a full revision, please use our "Full Revision" template. It is important to use the appropriate template to clearly inform the editors of your intentions.]

      1. General Statements [optional]

      This section is optional. Insert here any general statements you wish to make about the goal of the study or about the reviews.

      We thank the reviewers for their insightful comments and agree that the many of these revision experiments will improve the strength of our manuscript. Some of these we have already completed or are in the process of completing which will be outlined below. In particular, the reviewers asked that we investigate the mechanistic link between increased translation and UPR induction. We have detailed the studies that we will perform to establish this connection in detail below.

      Description of the planned revisions

      Response to Reviewer 1:

      1. The authors need to express UBXN1 and mutants lacking either the UBX or UBA domain in UBXN1 knockout cells to test whether the ER stress phenotype (Figure 1) and the protein upregulation phenotype (Figure 5A-F) can be rescued. This would eliminate the possibility that the reported phenotypes are the off-target effects of CRISPR.
      2. We will express the Myc-tagged wildtype UBXN1 and UBX or UBA point mutants (used in translation rescue studies in Figure 6) into UBXN1 knockout (KO) cells to determine whether the ER stress phenotype can be rescued. We will determine the level of xbp1s by real-time PCR and BiP by immunoblot.
      3. The studies in Figure 5 A-F were completed in cells depleted of UBXN1 with siRNA, not the CRISPR knockout cells. Thus, it is unlikely an off-target effect of CRISPR. We will attempt rescue of this phenotype with the wildtype and mutant constructs.

      For Figure 2, please indicate whether the repeat is a biological replicate or a technical replicate from RT-PCR.

      • We apologize for the omission. The data from the RT PCR studies in Figure 2 are biological replicates – the figure legend and main text of the manuscript will be edited to clarify this.

      In Figure 1A, the authors show that the knockout of UBXN1 causes an upregulation of phosphorylated eIF2alpha, which is known to suppress protein translation globally. In this regard, it is surprising to see the authors also concluded from Figure 7 that there is an upregulation of protein translation in UBXN1 knockout cells. The authors do not provide any explanation on how these seemingly contradictory phenotypes could be seen in the same cells.

      • We will provide a detailed discussion of the apparent paradox between upregulation of phosphorylated eIF2a and increased protein translation. Several prior studies have demonstrated that elevated expression of ATF4 (as we observe in UBXN1 KO cells) activates a transcriptional program that restarts translation. This occurs through the upregulation of the phosphatase PPP1R15a that dephosphorylates eiF2a, as well as aminoacyl tRNA synthetases and ribosomal subunits. We propose that elevated ATF4 levels leads to premature translational restart in UBXN1 KO cells. In addition, our data suggests that UBXN1 represses translation upstream of UPR activation and thus and increase in protein translation dysregulates ER-proteostasis which hyperactivates the UPR.

      Any evidence that UBXN1 is associated with translating ribosomes?

      • We now have new data that UBXN1 is associated with 40S, 60S, and 80S ribosomal fractions as well as actively translating polysome fractions that we isolated by polysome purification. In agreement with our finding that the role of UBXN1 in repressing translation is independent of p97, p97 appears to associate largely with the 40S, 60S, and 80S ribosomal fractions but not with the actively translating polysomes. This data will be included in the revised manuscript. Response to Reviewer 2:

      • Authors found that significant enrichment of the ER proteins in UBXN1 KO cells, while there is no change in the abundance of proteins in the cytosol or nucleus. Mitochondrial proteins are even down-regulated in UBXN1 KO cells. I found these observations very interesting. However, I was frustrated that authors did not investigated the reason why such differences are associated in UBXN1-suppressed cells. Authors demonstrate that depletion of UBXN1 resulted in suppression of protein synthesis, but did not address whether ER proteins are specifically repressed by UBXN1 or it represses translation globally, as noted in their Discussion section. Do the mRNAs encoding signal sequence at the N-terminus of their products are specifically translated in UBXN1-suppressed cells? Do the translations of mRNAs encoding mitochondria translocation signals are suppressed in UBXN1 KO cells? It should be possible to investigate these issues by using appropriate model ER- or mitochondrial proteins with or without specific signal sequences. Such kind of analysis should be necessary to support the claim of this manuscript.

      • Previous studies by Luke Wiseman’s group showed that PERK activation resulted in hyperfusion of the mitochondria and loss of Tim17 leading to decreased mitochondrial import. We already show that mitochondrial proteins are downregulated (by TMT proteomics and by immunoblotting). We now have preliminary data that mitochondria are more fused in UBXN1 KO cells consistent with data from the Wiseman group. We will include this in the resubmission.
      • In addition, we have re-analyzed our TMT proteomics data to parse out proteins with ER-signal sequences and define the topology of ER proteins (Type 1, 2, multimembrane spanning and luminal proteins) and those with mitochondrial targeting sequences. This data will be included in the revised manuscript.

      Related to my previous comments, ER-targeted mRNAs are known to be degraded by a process termed RIDD in the case of ER stressed condition. Since the rapid degradation of mRNAs through RIDD functions to alleviate ER stress by preventing the continued influx of new polypeptides into the ER, I wondered why UBXN1 depletion greatly stimulates ER protein synthesis, escaping IRE1-dependent mRNA degradations. Does UBXN1 depletion suppress RIDD?

      • In the revised manuscript, we will determine the relative mRNA abundance of the bona fide RIDD targets BLOC1S1 and CD59 by quantitative PCR in cells stressed with dithiothreitol (DTT). We will utilize previously published and validated primers for each target to quantify RIDD activity in wildtype and UBXN1 KO cells. These studies will address whether loss of UBXN1 impacts IRE1-dependent RIDD.

      Authors mentioned that the elevated levels of ER proteins are not due to increased transcription of target genes. However, they only provided the quantification of prp transcript levels, which was unchanged between wildtype and UBXN1 KO cells. To support this important conclusion, it is necessary to provide whole transcriptome data to compare the expression levels of corresponding ER proteins (quantified by their proteomics data) and transcripts (quantified by, for an example, RNA-seq analysis).

      • We thank the reviewer for this comment. Currently, we show that mRNA levels of Prp do not significantly change between control and siUBXN1 cells (Supplementary Figure 4). For a more comprehensive analysis, we will additionally assess the mRNA levels of the proteins we determinized to be significantly enriched in Figure 5 (AGAL, ALPP2 and TRAPa). RNA sequencing is currently beyond the scope of this study.

      Authors claimed that UBXN1 loss is detrimental to cell viability and have elevated levels of the apoptosis in the face of ER stress. However, authors did not examine apoptotic cell death in UBXN1 KO cells. They only provided evidence for defective proliferation of cells and transient induction of CHOP expression, but these are not enough to support the ER-stress induced apoptosis.

      • We will address the levels of apoptotic cell death in wildtype and UBXN1 KO cells by assessing PARP, caspase-3, or caspase-8 cleavage in these cells by immunoblot.

      Authors showed that UBA domain of UBXN1 is critical for suppressing protein synthesis. Could you provide a bit more detailed discussion how UBA domain modulates protein translational events and promote expressions of ER-related proteins. Have you ever checked whether UBA domain of UBXN1 is necessary for suppressing UPR-specific target gene expressions?

      • We will express the Myc-tagged wildtype UBXN1 and UBX or UBA point mutants (used in translation rescue studies in Figure 6) into UBXN1 knockout (KO) cells to determine whether the ER stress phenotype can be rescued.
      • We will also include a discussion on how the UBA domain in UBXN1 may recognize distinct ubiquitylation events on ribosomes that modulate their abundance and function. Response to Reviewer 3:

      (Major comments)

      1. My main reservation about the current manuscript is whether the UPR activation can be directly ascribed to the loss of UBXN1. The authors do not differentiate between acute depletion (through siRNA in Fig. 5) versus permanent UBXN1 knockout in most of the experiments. The latter may lead to extensive adaptation of the cellular proteome due to chronic stress. Prior studies from the authors have shown that UBXN1 knockout leads to loss of aggreasomes. This raises a major question whether the observed UPR activation can be directly attributed to UBXN1 loss or be an indirect result of adaptation in the knockout cells, for instance due to accumulation of BAG6 substrates in insoluble aggregates as the authors have shown previously (ref. 40). Along those lines, the authors already showed in the same study that UBXN1 knockout cells are more sensitive to proteotoxic stress.
      2. We agree with the reviewer that cells can adapt to CRISPR knockout. However, the IRE1a clustering studies found in Figure 1 were completed in the context of acute depletion of UBXN1 by siRNA and demonstrate a significant increase in IRE1a clustering when UBXN1 is depleted.
      3. We now have new data that that acute depletion of UBXN1 with siRNA results in a significant increase in BiP and ATF4 expression as well as ATF6 N-terminal processing.
      4. Furthermore, we have new data that acute depletion of UBXN1 with siRNA phenocopies UBXN1 KO in terms of increased puromycin incorporation into newly synthesized proteins.
      5. Thus, we will have both genetic knockout as well as siRNA acute depletion for all major studies. We will include these new studies in the revised manuscript.

      The later results in the study nicely show that the repressed protein translation phenotype is dependent on the ubiquitin binding domain of UBXN1. These segregation-of-function mutants and complementation experiments could be easily used to more clearly distinguish whether the UPR activation can be directly attributed to UBXN1 and the increase in protein translation. For instance, can overexpression of UBXN1 in the knockout background suppress the UPR activation? Is the UBX-domain mutant capable of suppressing the UPR phenotype? These results would provide critical support as to whether the UPR activation is a direct result of the loss of UBXN1.

      • We will express the Myc-tagged wildtype UBXN1 and UBX or UBA point mutants (used in translation rescue studies in Figure 6) into UBXN1 knockout (KO) cells to determine whether the ER stress phenotype can be rescued. We will determine the level of xbp1s by real-time PCR and BiP by immunoblot.
      • To delineate the relationship between UPR activation and protein translation, we will halt protein synthesis with the translational elongation inhibitor cycloheximide and assess UPR activation in wildtype and UBXN1 KO cells. If increased protein translation in UBXN1 KO cells is what causes UPR activation, we anticipate that cycloheximide will rescue UPR activation in UBXN1 KO cells back to wildtype levels.

      Similarly, the authors use transient siRNA knockdown of UBXN1 in Fig. 5 and Supp. Fig. 4, but do not reassess the UPR activation under these conditions. It would be important to validate that the acute UBXN1 knockdown can recapitulate the UPR activation phenotype.

      • Please see comment 1 above.

      I am puzzled by the interpretation of the AGAL degradation experiments in Supplemental Figure 4F. Clearly, the rate of AGAL degradation is much faster in WT cells than in UBXN1 knockout cells as indicated by the slope of the curves between 2-4 hours. I disagree with the interpretation that UBXN1 knockout does not impact AGAL turnover. It is not valid to make the comparison at 9 hours because hardly any AGAL substrate is remaining. Importantly, this experiment raises a larger question: Are other ER client degradation rates affected by the UBXN1 knockout? And is the UPR activation more generally due to accumulation of misfolded ER proteins? Their prior publication (ref. 40) evaluated several ERAD clients where UBXN1 was dispensable, but it could be possible that UBXN1 has a more specialized client pool. Showing quantification of the PrP CHX chase would also be helpful - from the single replicate it looks like more PrP remaining in the UBXN1 knockout at 8 hours (Supp. Figure 4G).

      • Our previous ERAD reporter study using three distinct ERAD clients that are routinely used to assess ERAD found no role for UBXN1 in ERAD (Ganji et al MCB 2018). We do agree with the reviewer that UBXN1 may have discrete roles in regulating the degradation of select p97 ER clients. Determining this in an unbiased and comprehensive manner would require pulse chase SILAC proteomics or similar methodologies which are beyond the scope of the current study. We will therefore evaluate whether loss of UBXN1 affects the rate of degradation of additional ER-client proteins that we identified via TMT. Additionally, we will include a quantification of PrP cycloheximide chase.

      It would be helpful for the manuscript to clearly distinguish between 1) upregulation of ER proteostasis factors because of ER stress/UPR, and 2) upregulation of secreted clients (AGAL, PrP) which may be partly due to increased translation rates but could also be due to reduced degradation. Many of the hits from the proteomics experiments are ER proteostasis factors that are part of the adaptive stress response (SEC61B, SEC63, CANX, SSR1/2/3, STT3B, RPN1, RPN2, SEC61A1 - compare to ref 12: most are direct IRE1/XBP1s targets). Their increased expression does not lead to increased ER stress as they are involved in the resolution of ER stress. It appears to be circular logic that increased expression of UPR targets would lead to more UPR activation. Currently, the authors do not clearly disentangle the increased expression of endogenous ER proteins from the proteomics experiment versus overexpression of exogenous secreted clients.

      • We identify many ER proteins with increased abundance in UBXN1 KO cells that are not transcriptional targets of the IRE1-UPR pathway. We will re-format the TMT data to more comprehensively characterize the proteins that we identify (known UPR transcriptional targets, membrane embedded, soluble clients etc.).
      • We will change the language in the current manuscript to clearly demarcate the difference between an increase of ER proteostasis factors in response to ER stress, and the upregulation of secreted proteins. Additionally, we will emphasize the secretory proteins that are significantly enriched in UBXN1 KO cells in our proteomics figures to demonstrate the increase of non-ER stress responsive clients.

      The authors should tone down on broad generalizations, for instance in lines 306-309: ER aggregation was only observed for a single client protein (AGAL). Further, only a single mitochondrial protein was observed to be downregulated (TOMM20).

      • We have included the quantifications of the relative expression levels of three mitochondrial proteins, two of which are significantly reduced (TOMM20 and CYC1).
      • Additionally, we have new data where we immunoblotted for additional mitochondrial import factors and observed significant reduction of the mitochondrial proteins TIMM23 and TOMM70A which will be included in the revised manuscript.
      • We also plan to examine the levels of the TIMM17A subunit of the TIMM23 complex in UBXN1-depleted cells. TIMM17A is degraded in response to ER stress to prevent protein import into the mitochondria. (Rainbolt, T. et al. Cell Metab 2013)
      • The language of the manuscript will be changed to tone down on broad generalizations. (Minor comments)

      Does UBXN1 localization to the ER/microsomes fraction depend on p97? What happens in UBX-domain mutant?

      • We will isolate ER-microsomes from UBXN1 KO cells where we have expressed wildtype and UBX/UBA domain mutants to address if localization is dependent on ubiquitin or p97 interaction.

      In Fig. 1A it is surprising that no BiP is detected at 0 hours as BiP is highly expressed even in the absence of ER stress. Can the authors comment on this discrepancy.

      • We provide low exposures of the immunoblots as the UBXN1 KO cells have very high levels of BiP compared to control. We will provide alternative blots where the BiP levels at t=0 in control cells is more obvious.

      The authors use different ER stressors interchangeably: DTT, Tunicamycin, Thapsigargin. While all results in UPR activation, they do so through different mechanisms and with slight nuances that may be worth considering for the experiments and interpretations.

      • We thank the reviewer for this comment and agree that these stressors can impact the ER and UPR activation in distinct ways. Our rationale for using these agents interchangeably was to demonstrate the UPR induction in UBXN1 null cells occurs irrespective of the type of stress.
      • DTT is a severe stressor and we used tunicamycin and thapsigargin in some assays (imaging etc.) as they are less toxic and more amenable to downstream analysis. We will include text that explains our rationale better.

      Line 198: "Hierarchical clustering analysis demonstrates that the gene expression pattern observed in UBXN1 KO cells more closely resembles wildtype cells stressed with DTT than untreated wildtype cells based on similar log2 fold change values (Figure 2)." Where is this clustering shown?

      • We apologize that this was not clear in the figure. We will edit the figure to make the clustering more obvious.

      What are the downregulated UPR genes in Fig. 2, and may this hold significance?

      • The reviewer points out an interesting observation. Many of the downregulated transcripts are ERAD components. The significance of this is presently unclear and we would require RNA-seq analysis to make a more educated conclusion. However, this finding may point to an environment that has a greater need to induce folding than degradative components. We will include a discussion of this in the revision.

      3. Description of the revisions that have already been incorporated in the transferred manuscript.

      Please insert a point-by-point reply describing the revisions that were already carried out and included in the transferred manuscript. If no revisions have been carried out yet, please leave this section empty.

      4. Description of analyses that authors prefer not to carry out

      Please include a point-by-point response explaining why some of the requested data or additional analyses might not be necessary or cannot be provided within the scope of a revision. This can be due to time or resource limitations or in case of disagreement about the necessity of such additional data given the scope of the study. Please leave empty if not applicable.

      Response to Reviewer 1:

      1. Taking the increased protein translation phenotype as an example, does this indicate UBXN1 is a translation suppressor for those ER-associated proteins?
      2. We thank the reviewer for this comment. We are indeed very interested in determining whether UBXN1 represses the translation of ER proteins. We are in the process of identifying proteins that are translated in UBXN1 null cells using O-propargyl-puromycin (OPP) labelling and mass spectrometry. However, given the timeframe for these studies, this cannot be accomplished in this revision.

      How can UBXN1 selectively inhibit the translation of a subset of proteins?

      • Recent studies suggest that ribosome populations are quite heterogeneous, and ribosome associated proteins can help tune translation of select proteins. For example, pyruvate kinase muscle (PKM) associates with ER docked ribosomes to regulate the translation of ER proteins in particular. We find that UBXN1 is present on ER membranes and localizes to polysomes and thus may regulate the translation of specific proteins. Studies are underway to test this hypothesis but are beyond the scope for this present study. Response to Reviewer 2:

      • Authors found that significant enrichment of the ER proteins in UBXN1 KO cells, while there is no change in the abundance of proteins in the cytosol or nucleus. Mitochondrial proteins are even down-regulated in UBXN1 KO cells. I found these observations very interesting. However, I was frustrated that authors did not investigated the reason why such differences are associated in UBXN1-suppressed cells. Authors demonstrate that depletion of UBXN1 resulted in suppression of protein synthesis, but did not address whether ER proteins are specifically repressed by UBXN1 or it represses translation globally, as noted in their Discussion section. Do the mRNAs encoding signal sequence at the N-terminus of their products are specifically translated in UBXN1-suppressed cells? Do the translations of mRNAs encoding mitochondria translocation signals are suppressed in UBXN1 KO cells? It should be possible to investigate these issues by using appropriate model ER- or mitochondrial proteins with or without specific signal sequences. Such kind of analysis should be necessary to support the claim of this manuscript.

      • Please see comment 1 above.
    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      Summary:

      Ahlstedt et al. investigate a new role for the p97 adapter protein UBXN1 in negatively regulating the ER unfolded protein response. The study starts from the observations that knockdown of UBXN1 in a previously generated HeLa cell line leads to induction of unfolded protein response markers, and the knockout cells display more pronounced UPR activation upon ER stress. This elevated UPR signaling renders the UBXN1 cells more prone to cell death. Global proteomics experiments similarly show an increased abundance of ER localized proteins, although it is not clearly delineated which of those are the result of UPR activation. The authors then probe the expression of two secretory client proteins, alpha-galactosidase (AGAL) and prion protein (PrP) and find that UBXN1 transient knockdown leads to ER accumulation of the two proteins and increased aggregation upon ER stress. The authors claim that degradation of these ER client proteins in unaffected by the UBXN1 knockdown, but accumulation may instead be due to increased protein translation. Indeed, they surprisingly find that UBXN1 knockout leads to constitutively elevated protein translation. This result points to a previously unknown role of UBXN1 in repressing protein synthesis. Complementation with UBXN1 mutants demonstrate that the translation repression is dependent on the ubiquitin binding activity of UBXN1 but that p97 is dispensable. Further investigation into the molecular mechanism for the translation repression remains reserved for a future manuscript.

      Major comments:

      1. My main reservation about the current manuscript is whether the UPR activation can be directly ascribed to the loss of UBXN1. The authors do not differentiate between acute depletion (through siRNA in Fig. 5) versus permanent UBXN1 knockout in most of the experiments. The latter may lead to extensive adaptation of the cellular proteome due to chronic stress. Prior studies from the authors have shown that UBXN1 knockout leads to loss of aggreasomes. This raises a major question whether the observed UPR activation can be directly attributed to UBXN1 loss or be an indirect result of adaptation in the knockout cells, for instance due to accumulation of BAG6 substrates in insoluble aggregates as the authors have shown previously (ref. 40). Along those lines, the authors already showed in the same study that UBXN1 knockout cells are more sensitive to proteotoxic stress.
      2. The later results in the study nicely show that the repressed protein translation phenotype is dependent on the ubiquitin binding domain of UBXN1. These segregation-of-function mutants and complementation experiments could be easily used to more clearly distinguish whether the UPR activation can be directly attributed to UBXN1 and the increase in protein translation. For instance, can overexpression of UBXN1 in the knockout background suppress the UPR activation? Is the UBX-domain mutant capable of suppressing the UPR phenotype? These results would provide critical support as to whether the UPR activation is a direct result of the loss of UBXN1.
      3. Similarly, the authors use transient siRNA knockdown of UBXN1 in Fig. 5 and Supp. Fig. 4, but do not reassess the UPR activation under these conditions. It would be important to validate that the acute UBXN1 knockdown can recapitulate the UPR activation phenotype.
      4. I am puzzled by the interpretation of the AGAL degradation experiments in Supplemental Figure 4F. Clearly, the rate of AGAL degradation is much faster in WT cells than in UBXN1 knockout cells as indicated by the slope of the curves between 2-4 hours. I disagree with the interpretation that UBXN1 knockout does not impact AGAL turnover. It is not valid to make the comparison at 9 hours because hardly any AGAL substrate is remaining. Importantly, this experiment raises a larger question: Are other ER client degradation rates affected by the UBXN1 knockout? And is the UPR activation more generally due to accumulation of misfolded ER proteins? Their prior publication (ref. 40) evaluated several ERAD clients where UBXN1 was dispensable, but it could be possible that UBXN1 has a more specialized client pool. Showing quantification of the PrP CHX chase would also be helpful - from the single replicate it looks like more PrP remaining in the UBXN1 knockout at 8 hours (Supp. Figure 4G).
      5. It would be helpful for the manuscript to clearly distinguish between 1) upregulation of ER proteostasis factors because of ER stress/UPR, and 2) upregulation of secreted clients (AGAL, PrP) which may be partly due to increased translation rates but could also be due to reduced degradation. Many of the hits from the proteomics experiments are ER proteostasis factors that are part of the adaptive stress response (SEC61B, SEC63, CANX, SSR1/2/3, STT3B, RPN1, RPN2, SEC61A1 - compare to ref 12: most are direct IRE1/XBP1s targets). Their increased expression does not lead to increased ER stress as they are involved in the resolution of ER stress. It appears to be circular logic that increased expression of UPR targets would lead to more UPR activation. Currently, the authors do not clearly disentangle the increased expression of endogenous ER proteins from the proteomics experiment versus overexpression of exogenous secreted clients.
      6. The authors should tone down on broad generalizations, for instance in lines 306-309: ER aggregation was only observed for a single client protein (AGAL). Further, only a single mitochondrial protein was observed to be downregulated (TOMM20).

      Minor comments

      • Does UBXN1 localization to the ER/microsomes fraction depend on p97? What happens in UBX-domain mutant?
      • In Fig. 1A it is surprising that no BiP is detected at 0 hours as BiP is highly expressed even in the absence of ER stress. Can the authors comment on this discrepancy.
      • The authors use different ER stressors interchangeably: DTT, Tunicamycin, Thapsigargin. While all results in UPR activation, they do so through different mechanisms and with slight nuances that may be worth considering for the experiments and interpretations.
      • Line 198: "Hierarchical clustering analysis demonstrates that the gene expression pattern observed in UBXN1 KO cells more closely resembles wildtype cells stressed with DTT than untreated wildtype cells based on similar log2 fold change values (Figure 2)." Where is this clustering shown?
      • What are the downregulated UPR genes in Fig. 2, and may this hold significance?

      Significance

      General assessment: The authors broadly characterize the UPR activation in the UBXN1 knockout cells, looking both at gene targets by Western blot and qPCR, and characterize the activation of individual sensors (ATF6 cleavage and IRE1alpha clustering). Proteomics results further corroborate the upregulation of ER-localized proteins, although the robustness of the findings is surprising considering that only 2 replicates were included in the mass spectrometry experiment. Most other experiments are technically sound, for instance the puromycilation translation assays. One of the key limitations of the is that the authors fail to make use of their extensive prior toolset on UBXN1, particularly the segregation-of-function mutations for p97 and ubiquitin binding, as well as the knockdown cell lines with inducible overexpression of UBXN1 to rescue the phenotypes. These tools could probe a direct involvement of UBXN1 in the UPR repression, and whether this activity is truly independent of p97. A related limitation is that results are often over-interpreted and too far generalized (see examples above), or wrongly interpreted (see AGAL degradation rates).

      Advance: The AAA+ ATPase VCP/p97 has many divergent cellular roles that are in part mediated by a variety of different adaptor proteins. The authors have previously discovered the important role for UBXN1 in recruiting p97 to mislocalized cytosolic proteins targeted to the BAG6 complex. The current study now aims to establish a new role for UBXN1 in regulating the unfolded protein response. As it stands, the findings that UBXN1 knockdown results in UPR activation and impacts translation rates are solid but largely descriptive in nature. These findings merit reporting but require that the authors tone down their conclusions about a direct role for UBXN1 as a regulator of the UPR. Alternatively, if the authors choose to stick with their current model for a direct involvement of UBXN1, they need to establish the mechanistic link more clearly.

      Audience: In the current form, the manuscript should appeal to a broad biochemistry and cell biology readership interested in topics related to proteostasis, protein quality control, and stress signaling.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      RC-2022-01803 "UBXN1 maintains ER proteostasis and represses UPR activation by modulating translation independently of the p97 ATPase" By Ahlstedt et al.

      Comments to the Author

      UBXN1 is a VCP adaptor UBX domain protein which is known to be involved in elimination of ubiquitylated cytosolic proteins bound to the BAG6 complex. In this study, authors demonstrated that cells depleted of UBXN1 have elevated UPR activation, even without external ER stresses. Cells devoid of UBXN1 have significant and global up-regulation of UPR-specific target genes, and these cells are more sensitive to ER stress than their wildtype counterparts. Using quantitative tandem mass tag proteomics of UBXN1 deleted cells, authors found that significant enrichment of the abundance of ER proteins involved in protein translocation, protein folding, quality control, and the ER stress response in an ERAD-independent manner. Notably, they observed no change in the abundance of proteins in the cytosol or nucleus, and significant decrease in the expression of several mitochondrial proteins when UBXN1 was depleted. Authors further demonstrate that UBXN1 is a translation repressor, and its UBA domain is critical for suppressing protein synthesis. Thus, increased influx of proteins into the ER in UBXN1 KO cells causes UPR activation. Authors concluded that they have identified a new regulator of protein translation and ER proteostasis.

      My specific comments were provided as follows.

      Comments

      1. Authors found that significant enrichment of the ER proteins in UBXN1 KO cells, while there is no change in the abundance of proteins in the cytosol or nucleus. Mitochondrial proteins are even down-regulated in UBXN1 KO cells. I found these observations very interesting. However, I was frustrated that authors did not investigated the reason why such differences are associated in UBXN1-suppressed cells. Authors demonstrate that depletion of UBXN1 resulted in suppression of protein synthesis, but did not address whether ER proteins are specifically repressed by UBXN1 or it represses translation globally, as noted in their Discussion section. Do the mRNAs encoding signal sequence at the N-terminus of their products are specifically translated in UBXN1-suppressed cells? Do the translations of mRNAs encoding mitochondria translocation signals are suppressed in UBXN1 KO cells? It should be possible to investigate these issues by using appropriate model ER- or mitochondrial proteins with or without specific signal sequences. Such kind of analysis should be necessary to support the claim of this manuscript.
      2. Related to my previous comments, ER-targeted mRNAs are known to be degraded by a process termed RIDD in the case of ER stressed condition. Since the rapid degradation of mRNAs through RIDD functions to alleviate ER stress by preventing the continued influx of new polypeptides into the ER, I wondered why UBXN1 depletion greatly stimulates ER protein synthesis, escaping IRE1-dependent mRNA degradations. Does UBXN1 depletion suppress RIDD?
      3. Authors mentioned that the elevated levels of ER proteins are not due to increased transcription of target genes. However, they only provided the quantification of prp transcript levels, which was unchanged between wildtype and UBXN1 KO cells. To support this important conclusion, it is necessary to provide whole transcriptome data to compare the expression levels of corresponding ER proteins (quantified by their proteomics data) and transcripts (quantified by, for an example, RNA-seq analysis).
      4. Authors claimed that UBXN1 loss is detrimental to cell viability and have elevated levels of the apoptosis in the face of ER stress. However, authors did not examine apoptotic cell death in UBXN1 KO cells. They only provided evidence for defective proliferation of cells and transient induction of CHOP expression, but these are not enough to support the ER-stress induced apoptosis.
      5. Authors showed that UBA domain of UBXN1 is critical for suppressing protein synthesis. Could you provide a bit more detailed discussion how UBA domain modulates protein translational events and promote expressions of ER-related proteins. Have you ever checked whether UBA domain of UBXN1 is necessary for suppressing UPR-specific target gene expressions?

      Significance

      Although the discovery in this manuscript might be potentially interesting for broad audience, the presented study did not provide enough mechanistic insights and their data lacks vital evidences to support their conclusion. I found that the data are preliminary to discuss the validity of this finding. The inadequacy of these points makes this manuscript unsuitable for publication at this stage.

      My expertise is cell biology and biochemistry for protein quality control.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      In this manuscript, Ahlstedt et al. study UBXN1, an adaptor of the p97/VCP AAA ATPase, using a cell line deficient for UBXN1. They found that the knockout of UBXN1 activates ER stress and sensitizes cells to ER stress-induced cell death. They used a proteomic approach to analyze the change in the global proteome in UBXN1 knockout cells. Interestingly, they found many proteins are upregulated in UBXN1 knockout cells, which appears to be regulated at a post-transcriptional level. Using puromycin labeling, they found that protein translation appears to be upregulated in UBXN1 knockout cells.

      Major comments:

      The conclusions of the manuscript are generally well supported by experimental data, which are of high quality. The presentation is clear. In my opinion, a few issues need to be addressed to further strengthen their conclusions. 1. The authors need to express UBXN1 and mutants lacking either the UBX or UBA domain in UBXN1 knockout cells to test whether the ER stress phenotype (Figure 1) and the protein upregulation phenotype (Figure 5A-F) can be rescued. This would eliminate the possibility that the reported phenotypes are the off-target effects of CRISPR. 2. For Figure 2, please indicate whether the repeat is a biological replicate or a technical replicate from RT-PCR. 3. In Figure 1A, the authors show that the knockout of UBXN1 causes an upregulation of phosphorylated eIF2alpha, which is known to suppress protein translation globally. In this regard, it is surprising to see the authors also concluded from Figure 7 that there is an upregulation of protein translation in UBXN1 knockout cells. The authors do not provide any explanation on how these seemingly contradictory phenotypes could be seen in the same cells.

      Significance

      p97/VCP is an important member of the AAA ATPase family that has a variety of functions. It interacts with a collection of adaptor proteins that all contain a UBX domain. These adaptors help to link the ATPase to the correct substrate in cells. The best-established function of p97/VCP is its role in ERAD, in which it acts together with its adaptors Ufd1-Npl4 and UBXD8 to extract retrotranslocated proteins from the ER for proteasomal degradation. UBXN1 is not required for ERAD. Instead, it appears to be a negative regulator of ERAD. Previous studies have also implicated it in mitophagy (Mengus C., Autophagy, 2022) and aggresome formation (from this group). Overall, the published studies did not pinpoint the precise cellular function of UBXN1.

      This work characterizes the cellular phenotypes associated with UBXN1 loss of function. The information reported here is important, but the biological significance is limited. This is mainly because the authors entirely rely on a genetic approach. While the reported phenotypes associated with UBXN1 deficiency is solid, it is unclear what the underlying mechanisms are. It is not clear whether or not these phenotypes are interconnected, nor is it clear whether UBXN1 is a direct regulator of these processes. Taking the increased protein translation phenotype as an example, does this indicate UBXN1 is a translation suppressor for those ER-associated proteins? How can UBXN1 selectively inhibit the translation of a subset of proteins? Any evidence that UBXN1 is associated with translating ribosomes?

      In summary, because of the limited mechanistic insights on UBXN1 function, the study may only be interesting to a specialized audience.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      • Reviewer #1 (Evidence, reproducibility and clarity (Required))*

      Summary: ER+ breast cancer is the most common form of cancer. Targeting ER-alpha transcriptional cofactors present one potential method to target the disease. The authors demonstrate that MYSM1 is a histone deubiquitinase and a novel ER cofactor, functioning by up-regulating ER action via histone deubiquitination. Loss of MYSM1 attenuated cell growth and increase breast cancer cell lines' sensitivity to anti-estrogens. The authors, therefore, propose MYSM1 as a potential therapeutic target for endocrine resistance in Breast cancer. *

      *Major Comments: *

      The data as presented is convincing, and the evidence for the role of MYSM1 as a co-activator of ER-alpha is extensive. Given the amount of data, I do not believe any additional experiments are needed. I could not find any description of ethics for the patient samples used.

      Response: Appreciate for the positive response from the reviewer. According to the important suggestions, the ethics approval for the patient specimens have been included in the “Materials and methods” part.

      Minor Comments:

      The data as presented is convincing, and the evidence for the role of MYSM1 as a co-activator of ER-alpha is extensive. Given the amount of data, I do not believe any additional experiments are needed. I could not find any description of ethics for the patient samples used.

      • Response: Appreciate for the positive response from the reviewer. According to the important suggestions, the ethics approval for the patient specimens have been included in the “Materials and methods” part.

        (1)- Figure 4C - is the increase of binding in response to Estrogen significant? It is an important control to show for MCF7 as Fig 4B is in T47D.

      Response: According to the comments from reviewers, we conducted statistical difference analysis in Figure 4C, our results have shown that the recruitment of MYSM1 or ERa on c-Myc ERE region is significantly increased upon E2 treatment in MCF-7 cells.

      *(2)- Figure 6 - Can we clarify that B = Before, A = After *

      Response: Apologize for the unclear description in Figure 6. As clarified by the reviewer, “B” represents before AI treatment, “A” represents after AI treatment. We have included the description in the “Figure legends” section.

      (3)- The use of Fig EV was confusing to me, I assume it means supplementary?

      Response: Thank you for your question. Since our priority affiliate journal is belong to EMBO Press, this manuscript was written according to the relevant requirements and “EV” is the abbreviation of “Expanded View”, which is the same as that of the supplementary figures.

      Reviewer #1 (Significance (Required)): - Discovery science to understand the regulation of the ER is critical in discovering new opportunities to target breast cancer. As far as I can tell this is the first study where MYSM1 is a co-regulator of the ER. - The significance would be greatly increased if the manuscript identified opportuinities to target the ER via this pathway using existing compounds. However, it is reasonable to consider this is beyond the scope of this study.

      Response: According to your valuable suggestion, we thus turned to screen the commercially-available compound in ZINC database to find the compounds that could spatially interact with MYSM1 protein, thereby inhibiting the activity of MYSM1. We plan to perform the additional biological function experiments to explore the effect of MYSM1-targeting compounds on the sensitivity of breast cell lines to anti-estrogen treatment.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      *Below I outline a few suggestions that can help clarify specific aspects of the study. *

      Fig. 2: Ideally a rescue study with a wild-type and catalytically mutant MYSM1 should be performed.

      Response: Thank you for your suggestion. To address this point, we will perform a rescue study with a wild-type and catalytically mutant MYSM1 in the breast cancer cells with stable knocked down of MYSM1 to examine the corresponding protein expression of ERa target genes.

      What is the ERa interactome in the presence and absence of MYSM1? Proteomics studies upon shMYSM1 should be performed. Alternatively, a better characterization of ERa-containing complexes upon shMYSM1 should be performed.

      Response: We agree with the reviewer’s suggestion to functionally address the influence of MYSM1 on ERa interactome. In breast cancer cells with the presence or absence of MYSM1, Co-IP experiments will be conducted to examine the influence of MYSM1 on the interaction between ERa and KAT2B, EP300 and CREBBP complex, which are predicted from String database.

      *Fig. 3: Does MYSM1 control its own protein via deubiquitination? *

      Response: We thank the reviewer for this suggestion and it provides us with a novel perspective upon MYSM1 investigation of whether MYSM1 is the deubiqutination substrate of itself. We would first transfect MYSM1-FL or MYSM1-ΔMPN plasmids and detect whether the endogenous MYSM1 expression changes. Next step, ubiquitination assays will be performed to determine whether MYSM1 control its own protein via deubiquitination.

      *Fig. 4: I propose that the authors perform MYSM1 ChIP-Seq to better show the MYSM1 distribution and overlap with ERa distribution. *

      Response: Appreciate for the reviewer for the valuable and important comments. ChIP-seq will be additionally performed in MCF-7 cells with MYSM1 antibody to examine the MYSM1 occupation on global chromatin in response to E2 and to show its overlap with ERa distribution.

      Fig. 7. Is there a correlation between MYSM1 mRNA and protein levels in cancer and physiological samples? How is the MYSM1 transcriptionally regulated in physiological and cancer cells?

      Response: We thank the reviewer for raising this issue. We will detect MYSM1 mRNA and protein levels in breast cancer and physiological samples, along with physiological and breast cancer cells. Statistics for MYSM1 transcriptional level will be further displayed.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      *Luan et al performed a detailed analysis on the potential coactivator MYSM1 and its role in regulating the expression of ER and ER-dependent genes by being a deubiquitinase of ER as well the repressive mark, H2Aub1. This study has demonstrated an excellent work on the biochemistry aspect of the story with meticulous work on the role of specific domains of MYSM1 and ER and how they interact and how the deubiquitination process is regulated. This was identified initially in Drosophila models, but eventually and promptly explored in multiple breast cancer cell lines and patient samples. *

      *Major Comments: *

        • It is really exciting to see how MYSM1 regulates ER activity and it looks like expression of ER is the first event of regulation by MYSM1's. However, H3Ac would be the very intermediate event of ER activity. This brings a question of whether ER complex itself is affected by MYSM1 - for example, does MYSM1 affect p300, SWI/SNF and other ER-associated coactivator binding? Does it affect chromatin accessibility? Which exact histone mark of H3Ac is affected, as different proteins are involved in the acetylation of histones. *

      Response: Appreciate the reviewer for the valuable questions. The Co-IP and ChIP experiments will be conducted respectively to assess the influence of MYSM1 on the binding of ERa with its associated co-activators and their recruitments on EREs upon MYSM1 knockdown. In addition, ChIP assays will also be performed to determine the effect of MYSM1 on histone modification levels (H3K9ac, H3K27ac, et al). MNase assay will be further performed to examine the function of MYSM1 on chromatin accessibility.

      • The regulation of MYSM1 is mainly shown on promoters of ER regulated genes. However, ER primarily bind to enhancers. Is there any general effect on enhancers? *

      Response: Thank you for your comments. We will perform ChIP assays to detect the regulation of MYSM1 on ERa binding to enhancers of ERa regulated genes in breast cancer cells.

      3. MYSM1 is not the complex usually cells prefer to deubiquitinate H2Aub, but BAP1. What is the role of BAP1 here? Are they redundant or any cross-talk?

      Response: Concerning this interesting question, it has been reported that BAP1 co-activator function correlated with increased H3K4me3 and concomitant deubiquitination of H2Aub at target genes. However, BAP1 has not been reported as an ERa co-regulator so far. Moreover, the interaction between ERa and BAP1 cannot be predicted using the STRING database. Whether BAP1 plays a similar role as MYSM1 in breast cancer and how MYSM1 cooperates with the other DUBs to regulate the genome-wide landscape of histone H2A ubiquitination and the gene expression profiles of different mammalian cell types remains to be elusive. It would be necessary to further study in the future.

      • Effect of MYSM1 on histone marks on the EREs - only one ERE is shown. Multiple EREs should be validated by qPCR. Enhancers should also be focused. Does it affect H3K27ac or H3K4me1?*

      Response: Thank you for your suggestions. ChIP experiments will be conducted to examine the effect of MYSM1 on histone marks on multiple EREs of ERa target genes. Furthermore, we will focus on the effect on MYSM1 on hitone marks (H3K27ac and H3K4me1 levels, et al) on enhancers of ERa target genes.

      • It is clear that MYSM1 is required for the response to antiestrogen therapies. However, the link to resistance is not completely clear. This should be investigated with multiple Tamoxifen resistant cell lines. There is one cell line used, but it is responding to tamoxifen even at lower concentrations in Crystal violet assays. MYSM1 overexpression in nonresponders doesn't mean that their activity is also more. Binding analyses should be analysed in proper Tamoxifen-resistant cell lines. Usually, Tamoxifen is used or works at concentrations from 100 nM - 1 uM in vitro to see the transcriptional effects. However, the authors claim that these are very high concentrations, but actually they aren't the concentrations which promote toxicity.*

      Response: We thank reviewer for the valuable comments. According to your suggestion, we will construct Tamoxifen-resistant MCF-7 or T47D cell lines carrying stable knockdown of MYSM1 to perform the biological function experiments with appropriate Tamoxifen concentrations to further confirm the effect of MYSM1 on the sensitivity of cells to anti-estrogen. In addition, we will examine the expression of MYSM1 and ERa target genes or histone H2Aub levels in nonresponders samples to preliminarily determine the activity of MYSM1 in AI-resistant samples.

      • Discussion about DUB inhibitors - how specific are these? Would they be useful to target MYSM1 activity and thus ER regulation in nonresponders or resistant cell lines? This would add up strongly on the clinical potential of the study. *

      Response: The DUB inhibitors mentioned in discussion are specific to USP14 and UCHL5, but not MYSM1. We thus turned to screen the commercially-available compound in ZINC database to find the compounds that could spatially interact with MYSM1 protein, thereby inhibiting the activity of MYSM1. We plan to perform the additional biological function experiments to explore the effect of MYSM1-targeting compounds on the sensitivity of breast cell lines to anti-estrogen treatment.

      • OPTIONAL: ChIP-seq analyses on the factors would be more informative to look at the unbiased mechanisms including enhancers. *

      Response: We appreciate your important comments. We plan to perform ChIP-seq in MCF-7 cells with MYSM1 antibody to examine the MYSM1 occupation on global chromatin in response to E2 and to show its overlap with ERa distribution.

      • Number of replicates aren't clear in figure legends. Are they biological or technical replicates?*

      Response: We thank for your comments. We have included the number of replicates in the “materials and methods” and “Figure legends” sections.

      *Minor comments: *

      • Please give page numbers and line numbers in the manuscript.*

      Response: We have given page numbers and line numbers in the revised manuscript.

      • Title - "MYSM1 co-activates ER action". "Action" is not needed to be mentioned here.*

      Response: We have modified the title according to the reviewer’s suggestion. The title has been modified as below: “MYSM1 acts as a novel co-activator of ERα via histone and non-histone deubiquitination to confer antiestrogen resistance in breast cancer”.

      • Abstract talks about the work on Drosophila mainly, but apart from the first experiment, everything else is done on mammalian cell culture and also clinically relevant patient samples. *

      Response: Thank you for your important comments. We have modified the abstract contents with breast cancer-derived cell lines instead of Drosophila experimental system.

      • Abstract Line 13 - the work is done many ER regulated genes and not gene.*

      Response: We've modified the text into “ERa-regulated genes” in Abstract section.

      • Pg 6 first paragraph - What/how many mutants were screened here? *

      Response: Thank you for your suggestion. In this study, about 300 fly lines carrying loss of function mutants obtained from Bloomington Stock Center were used for screening.

      • CoIP protocol is not clear. It says followed with manufacturer instructions but no kit information is provided.*

      Response: Apologize for the misrepresentation. Co-IP experiments were performed as that in the previous study. We have corrected the description for CoIP protocol and cited our previous study in the Materials and Methods section.

      • Fig. 1H, etc - can you show a zoomed in or DAPI removed (from merge) picture to show the interactions clearly? It's hard to follow the yellow co-interaction spots as they are hidden behind the blue colour. Any kind of quantification analyses would be wonderful.*

      Response: Thank you for your suggestion, we have merged the red and green colours to precisely show the co-location of MYSM1 and ERa.

      • Fig. EV1H - can you link this with the results from Fig. 1F to discuss if the delta SANT-MYSM1 lost the interaction with ER also in the IF studies? *

      Response: Thank you for your question. Commonly, the fluorescence intensity of confocal results mainly represents the amount of ectopic expression of MYSM1 or ERa, Co-IP experiments more exactly represent the association between proteins. It would be better to pick up the similar cell number in confocal experiments to assess the intensity of protein interaction. We will repeat the confocal again to show the exact fluorescence intensity.

      • Pg 7 - 3-4th line from last - These lines should move above where AF1 and AF2 are introduced. According to Fig. 1G, the interaction of AF2 and MYSM1 is important. Why do we see an effect on AF1 as well in Fig. 2B?*

      Response: Thank you for your comments. The GST ERa-AF1 and GST ERa-AF1 fusion proteins contain 29-180aa and 282-595aa of ERa truncated mutants respectively, while the ERa-AF1 and ERa-AF2 expression plasmids used in luciferase assay in Fig 2B encode 1-282aa and 178-595aa fragments. We can see the ERa-AF1 mutant in Fig 2B contains more amino acid segments than that in GST ERa-AF1 in Fig. 1G. We speculate that MYSM1 may interact with the extra segment (180aa-282aa) to upregulate ERa-AF1 induced transcription. To make it clear, we have included relevant description in the text along with a schematic representation of ERa, ERa-AF1, and ERa-AF2 plasmids used in luciferase reporter assays in Fig EV2B and in materials and methods section.

      • It's confusing to have HEK and breast cancer cell line datasets swapped inconsistently between main figures and Supplementary figures. It would be nice to keep them consistent. *

      Response: We have reverse the order of Fig 2B and Fig EV2C to maintain the consistency of the cell line datasets.

      • RPMI is spelled wrong in Pg. 19. *

      Response: We have corrected the spelling error of RPMI.

      • How long is the estrogen treatment done in each experiment? What is the concentration? This should be mentioned in the figure legends. 12 or 24 hrs time point is a later stage of estrogen receptor induction. Even 1-3 hrs would be sufficient to promote a stronger effect on RNA transcription than that of these later time points. What you are looking at is all effect on later time points and the effect should be observed on earlier time points to observe dynamic and immediate effects. p-values are required for the comparison on no E2 vs E2 here.*

      Response: We appreciate your valuable comment. We have rephrased the description on estrogen treatment in “Material and methods” and “Discussion” parts to more clearly state that E2 (100nM) was given for 4-6h in the experiments detecting transcriptional levels, while 16-18h in the experiments detecting translation levels. In addition, p-values have included to display the change of MYSM1 and ERa recruitment on ERE region upon E2 treatment.

      • Fig. 2G - effect on c-Myc after MYSM1 knockdown is not clear comparing to the previous WB in 2E.*

      Response: We will replace a clear image in Fig 2G to show the change of c-Myc protein expression after MYSM1 knockdown.

      • Pg. 8 - start of the last paragraph - "Unexpectedly, in Co-IP experiment as shown in Figure 2E and F" - These are not Co-IP experiments. *

      Response: Apologize for the writing error. We have re-written the sentence “Unexpectedly, in western blot experiments as shown in Figure 2E and F” in line 229.

      • Fig. 3C and E - Quantification with comparison needed.*

      Response: Relative ERa levels were semi-quantified by densitometry and normalized by the relative expression of 0 hour to compare the ERa degradation rate in Fig 3C and E.

      • Pg 10 - subtitle - multiple gene promoters have been looked, but the subtitle says "gene". Only ERE for c-MYC is looked at, but it says EREs.*

      Response: We have modified the word “genes” and “ERE” in correct forms in the text.

      • MYSM1 is in the nucleus in IF even before E2 treatment, however it is recruited after estrogen treatment in ChIP assays. Explain why there is a difference seen here. What other targets they might bind to in the nucleus?*

      Response: The aim of ChIP experiments is to examine the recruitment of MYSM1 protein on the DNA in the presence of E2, while IF results represent the MYSM1 subcellular distribution in the nucleus even in the absence of E2. MYSM1 has been reported to bind to promoters of numerous target genes, including Ebf1 in B cell progenitors, Pax5 in naïve B cells, miR150 in B1a cells, Id2 in NK cell progenitors, Flt3 in dendritic cell precursors, and Gfi1 in hematopoietic stem and progenitor cells. In our study, we plan to perform ChIP-seq to further show its potential binding elements on the global genome in ER-positive breast cancer.

      • Pg. 10 last line - the sentence should be combined with comma.*

      Response: Thank you for pointing this out, we have combined a comma in the sentence.

      • Fig. 5H - What about Ki67 which is a proliferative marker for cancer cell growth?*

      Response: We will further perform IHC experiments to compare Ki67 expression in the shCtrl and shMYSM1 group of xenograft tumors from nude mice.

      • Pg 12 - Samples were used from patients treated with AI adjuvant treatment. A small summary of details are needed here including n, arm, details of administration, etc even though mentioned in Methods.*

      Response: We have restated the patients’ condition and administration details in lines 342-250.

      • MYSM1 is upregulated in nonresponders, but it is also downregulated in responders which is ignored. What would this mean mechanistically? Don't patients need MYSM1 for the response or after treatment? Does estrogen inhibition regulate MYSM1 upstream? *

      Response: Appreciate for your important questions. The changes of intracellular environment caused by AI treatment are complicated and varied. The mechanism underlying such a phenomenon is largely unclear. We plan to perform western blot and ubiquitination assays to compare the expression and activity of MYSM1 in endocrine-resistant breast cancer cells treated or untreated with endocrine drugs to identify the effects of estrogen inhibition on MYSM1 expression. Moreover, we will detect whether MYSM1 expression is correlated with cell cycle and cell proliferation states.

      • Pg 13 - Is this data associated with any trial? More details are needed. *

      Response: We appreciate for your helpful comment. We have rearranged the logic of the article in order to clarify our reasoning for presenting this data. The modified contents included in lines 367-371 in the modified version are followed below: The regulation of MYSM1 on ERa action indicates that MYSM1 acts as a novel ERa co-activator, suggesting that MYSM1 may play an important role in breast cancer. We then conducted western blot and IHC experiments to estimate MYSM1 expression and the correlation between MYSM1 expression and clinicopathologic factors of the patients.

      • Last lines of Pg 15 - These were already introduced in the results. *

      Response: We thank reviewer for their highlighting this redundancy in our text. We have simplified the text in lines 442-444.

      • Pg 16 - third last line of the first paragraph - makes typo.*

      Response: Thanks for pointing out this typo. We have corrected the word “make” in line 456.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      Luan et al performed a detailed analysis on the potential coactivator MYSM1 and its role in regulating the expression of ER and ER-dependent genes by being a deubiquitinase of ER as well the repressive mark, H2Aub1. This study has demonstrated an excellent work on the biochemistry aspect of the story with meticulous work on the role of specific domains of MYSM1 and ER and how they interact and how the deubiquitination process is regulated. This was identified initially in Drosophila models, but eventually and promptly explored in multiple breast cancer cell lines and patient samples.

      Major Comments:

      1. It is really exciting to see how MYSM1 regulates ER activity and it looks like expression of ER is the first event of regulation by MYSM1's. However, H3Ac would be the very intermediate event of ER activity. This brings a question of whether ER complex itself is affected by MYSM1 - for example, does MYSM1 affect p300, SWI/SNF and other ER-associated coactivator binding? Does it affect chromatin accessibility? Which exact histone mark of H3Ac is affected, as different proteins are involved in the acetylation of histones.
      2. The regulation of MYSM1 is mainly shown on promoters of ER regulated genes. However, ER primarily bind to enhancers. Is there any general effect on enhancers?
      3. MYSM1 is not the complex usually cells prefer to deubiquitinate H2Aub, but BAP1. What is the role of BAP1 here? Are they redundant or any cross-talk?
      4. Effect of MYSM1 on histone marks on the EREs - only one ERE is shown. Multiple EREs should be validated by qPCR. Enhancers should also be focused. Does it affect H3K27ac or H3K4me1?
      5. It is clear that MYSM1 is required for the response to antiestrogen therapies. However, the link to resistance is not completely clear. This should be investigated with multiple Tamoxifen resistant cell lines. There is one cell line used, but it is responding to tamoxifen even at lower concentrations in Crystal violet assays. MYSM1 overexpression in nonresponders doesn't mean that their activity is also more. Binding analyses should be analysed in proper Tamoxifen-resistant cell lines. Usually, Tamoxifen is used or works at concentrations from 100 nM - 1 uM in vitro to see the transcriptional effects. However, the authors claim that these are very high concentrations, but actually they aren't the concentrations which promote toxicity.
      6. Discussion about DUB inhibitors - how specific are these? Would they be useful to target MYSM1 activity and thus ER regulation in nonresponders or resistant cell lines? This would add up strongly on the clinical potential of the study.
      7. OPTIONAL: ChIP-seq analyses on the factors would be more informative to look at the unbiased mechanisms including enhancers.
      8. Number of replicates aren't clear in figure legends. Are they biological or technical replicates?

      Minor comments:

      1. Please give page numbers and line numbers in the manuscript.
      2. Title - "MYSM1 co-activates ER action". "Action" is not needed to be mentioned here.
      3. Abstract talks about the work on Drosophila mainly, but apart from the first experiment, everything else is done on mammalian cell culture and also clinically relevant patient samples.
      4. Abstract Line 13 - the work is done many ER regulated genes and not gene.
      5. Pg 6 first paragraph - What/how many mutants were screened here?
      6. CoIP protocol is not clear. It says followed with manufacturer instructions but no kit information is provided.
      7. Fig. 1H, etc - can you show a zoomed in or DAPI removed (from merge) picture to show the interactions clearly? It's hard to follow the yellow co-interaction spots as they are hidden behind the blue colour. Any kind of quantification analyses would be wonderful.
      8. Fig. EV1H - can you link this with the results from Fig. 1F to discuss if the delta SANT-MYSM1 lost the interaction with ER also in the IF studies?
      9. Pg 7 - 3-4th line from last - These lines should move above where AF1 and AF2 are introduced. According to Fig. 1G, the interaction of AF2 and MYSM1 is important. Why do we see an effect on AF1 as well in Fig. 2B?
      10. It's confusing to have HEK and breast cancer cell line datasets swapped inconsistently between main figures and Supplementary figures. It would be nice to keep them consistent.
      11. RPMI is spelled wrong in Pg. 19.
      12. How long is the estrogen treatment done in each experiment? What is the concentration? This should be mentioned in the figure legends. 12 or 24 hrs time point is a later stage of estrogen receptor induction. Even 1-3 hrs would be sufficient to promote a stronger effect on RNA transcription than that of these later time points. What you are looking at is all effect on later time points and the effect should be observed on earlier time points to observe dynamic and immediate effects. p-values are required for the comparison on no E2 vs E2 here.
      13. Fig. 2G - effect on c-Myc after MYSM1 knockdown is not clear comparing to the previous WB in 2E.
      14. Pg. 8 - start of the last paragraph - "Unexpectedly, in Co-IP experiment as shown in Figure 2E and F" - These are not Co-IP experiments.
      15. Fig. 3C and E - Quantification with comparison needed.
      16. Pg 10 - subtitle - multiple gene promoters have been looked, but the subtitle says "gene". Only ERE for c-MYC is looked at, but it says EREs.
      17. MYSM1 is in the nucleus in IF even before E2 treatment, however it is recruited after estrogen treatment in ChIP assays. Explain why there is a difference seen here. What other targets they might bind to in the nucleus?
      18. Pg. 10 last line - the sentence should be combined with comma.
      19. Fig. 5H - What about Ki67 which is a proliferative marker for cancer cell growth?
      20. Pg 12 - Samples were used from patients treated with AI adjuvant treatment. A small summary of details are needed here including n, arm, details of administration, etc even though mentioned in Methods.
      21. MYSM1 is upregulated in nonresponders, but it is also downregulated in responders which is ignored. What would this mean mechanistically? Don't patients need MYSM1 for the response or after treatment? Does estrogen inhibition regulate MYSM1 upstream?
      22. Pg 13 - Is this data associated with any trial? More details are needed.
      23. Last lines of Pg 15 - These were already introduced in the results.
      24. Pg 16 - third last line of the first paragraph - makes typo.

      Significance

      • The study seems to be novel as MYSM1 is never studied before as a coactivator for ER. This expands the wealth of knowledge we have on coactivators which can be explored for its potential targeting to treat advanced breast cancers. The study seems to be support the biochemical aspects of ER interaction, but vaguely uncovers the functional or epigenetic mechanisms.
      • Studies on coactivators/coregulators of ER is very important, as modulating ER alone is not efficient enough to solve the puzzle of antiestrogen resistance. The expression/activity levels of the coregulators are very important as these can be modulated in cancers due to epigenetic reprogramming during resistance and mutations on these genes dominate. They can also serve as potential targets especially when cells don't respond to classical ER targeting therapies.
      • Strength - Biochemical analyses of the interactions and detailed mechanistic information
      • Limitation - Studies are very much limited to the biochemical regulation on ER and not on the molecular or epigenetic mechanisms. Association of MYSM1 in resistance mechanisms isn't clear.
      • Audience - this can be interesting for both basic research and clinical audience. Biochemical knowledge would help people to understand how a nonclassical deubiquitinase can promote nuclear receptor associated transcription by targeting genomic and nongenomic targets simultaneously. Clinically this study would be relevant if the MYSM1-ER interaction can be targeted using DUB inhibitors, as requested.
      • Area of expertise of the reviewer - breast cancer, nuclear receptors, estrogen receptor biology, epigenetics, bioinformatics
    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Below I outline a few suggestions that can help clarify specific aspects of the study.

      Fig. 2: Ideally a rescue study with a wild-type and catalytically mutant MYSM1 should be performed. What is the ERa interactome in the presence and absence of MYSM1? Proteomics studies upon shMYSM1 should be performed. Alternatively, a better characterization of ERa-containing complexes upon shMYSM1 should be performed.

      Fig. 3: Does MYSM1 control its own protein via deubiquitination?

      Fig. 4: I propose that the authors perform MYSM1 ChIP-Seq to better show the MYSM1 distribution and overlap with ERa distribution.

      Fig. 7. Is there a correlation between MYSM1 mRNA and protein levels in cancer and physiological samples? How is the MYSM1 transcriptionally regulated in physiological and cancer cells?

      Significance

      This is a very comprehensive study characterizing the role of MYSM1 deubiquitinase in ERa transcriptional programs in breast cancer systems. Breast cancer therapy is an unmet need and the role of deubiquitinases warrants further investigation. This accounts for the high significance of the story.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary:

      ER+ breast cancer is the most common form of cancer. Targeting ER-alpha transcriptional cofactors present one potential method to target the disease. The authors demonstrate that MYSM1 is a histone deubiquitinase and a novel ER cofactor, functioning by up-regulating ER action via histone deubiquitination.

      Loss of MYSM1 attenuated cell growth and increase breast cancer cell lines' sensitivity to anti-estrogens. The authors, therefore, propose MYSM1 as a potential therapeutic target for endocrine resistance in Breast cancer.

      Major Comments:

      • The data as presented is convincing, and the evidence for the role of MYSM1 as a co-activator of ER-alpha is extensive.
      • Given the amount of data, I do not believe any additional experiments are needed.
      • I could not find any description of ethics for the patient samples used.

      Minor

      • Figure 4C - is the increase of binding in response to Estrogen significant? It is an important control to show for MCF7 as Fig 4B is in T47D.
      • Figure 6 - Can we clarify that B = Before, A = After
      • The use of Fig EV was confusing to me, I assume it means supplementary?

      Significance

      • Discovery science to understand the regulation of the ER is critical in discovering new opportunities to target breast cancer. As far as I can tell this is the first study where MYSM1 is a co-regulator of the ER.
      • The significance would be greatly increased if the manuscript identified opportuinities to target the ER via this pathway using existing compounds. However, it is reasonable to consider this is beyond the scope of this study.
  2. Feb 2023
    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      We apologize for the delay in resubmitting this revised manuscript. We faced a number of challenges over the previous year unrelated to this project that slowed progress on completing the necessary revisions. However, we are happy to report we have addressed all of the reviewer’s valuable comments in this revised submission through the including of 27 new or improved figure panels and significant adaptations to the text. We highlight these changes below.

      REVIEWER #1.

      Reviewer #1 General Comments. “This study investigates changes in mitochondrial morphology in response to ER stress due to pharmacological inhibition or genetic dysfunction in vitro via two different cell models (MEFs and HeLa cells). The authors specifically implicate the PERK branch of the ER-stress induced pathway in this process based on the observation that mitochondria elongate in response to thapsigargin (Tg) treatment which is blocked by the pathway inhibitors GSK and ISRIB or by genetic ablation of Perk/PERK. Homozygous knockout cells lacking PERK exhibit a fragmented mitochondrial phenotype even in the absence of Tg, which is rescued by expression of the wildtype but not a hypomorphic allele (PERKPSP). One of the more interesting suppositions of this manuscript is that mitochondrial elongation is dependent on the abundance of phosphatidic acid (PA); treatment with Tg provokes an increase in mitochondrial PA, but PA does not accumulate in mitochondria from cells co-treated with GSK, an inhibitor of PERK. This correlation suggests that increased mitochondrial PA accumulation is PERK-dependent. In addition, predicted manipulation of PA levels achieved by a gain of function expression of the lipase Lipin diminished mitochondrial elongation in response to ER stress. Similar results were obtained by PA-PLA1 overexpression, a cytosolic lipase that converts PA into lysophosphatidic acid (LPA). To further describe the mechanistic link between ER stress and mitochondrial morphology, the authors found that PRELID1, which transports PA from the OMM to the intermembrane space, and TIM17A, a component of the protein translocation machinery, were stabilized by loss of PERK or YME1L [and possibly an effect of ATF4], regardless of ER stress via Tg treatment. The authors also report that Tg treatment prevents OPA1 cleavage in cells treated with CCCP, an uncoupler of the proton gradient, suggesting that the effect due to Tg treatment is not through ER stress but decreased mitochondrial fusion via mito-stress induced OPA1 cleavage. To address this, cells were treated with ionomycin which induces mitochondrial fragmentation independent of DRP1. The authors observed an increase in mitochondrial fragmentation in the presence of ionomycin. However, co-treatment with Tg prevented fragmentation, as did overexpression of mitoPLDGFP, which converts cardiolipin to PA on the OMM. These results support a model in which, under ER stress conditions, PERK activation leads to translational attenuation, which leads to a decrease in the steady state levels of PRELID1 via YME1L-dependent degradation and to the accumulation of PA on the OMM. Based on published work this PA accumulation is expected to inhibit the mitochondrial division dynamin, DRP1. The authors tested this by examining the dependence of mitochondrial elongation on PRELID1.”

      “Perturbances in PERK signaling evoke an alteration in mitochondrial morphology and have been extensively reported on, due to their clinical implications on neurodegenerative disorders such as Alzheimer's disease. The present work provides insight into the molecular basis for Stress Induced Mitochondrial Hyperfusion (SIMH) which can be triggered by ER stress. The authors find that this process occurs downstream of PERK and proceeds through accumulation of PA in the OMM by stabilization of Prelid, a mitochondrial resident protein that transports PA from the OMM to IMM for cardiolipin synthesis. The evidence of this work represents a substantial addition to the field of mitochondrial dynamics/SIMH and the Unfolded Protein Response”

      “The novelty of this work is in the inclusion of PRELID1 downstream of PERK signaling pathway for transmission of ER stress to the mitochondria, a process that involves phosphatidic acid (PA). Some studies have addressed how phosphatidic acid is a modulator and a signal in mitochondrial physiology. The role of the lipids in mitochondrial dynamics represent an important and emerging field that needs to be explored in order to understand how metabolites control mitochondrial fusion/fission.”

      __Our Response to Reviewer #1 General Comments. __We thank the reviewer for the positive comments related to our manuscript. We address specific comments brought up by the reviewer in our revised manuscript as highlighted below. We combined specific comments related to the same point in this response to best manage the various points brought up by the reviewer.

      Reviewer #1 Comment #1. __The Reviewer__ brought up the quality of our images numerous times in their review. A few examples are included below.

      Image quality of mitochondria is sub par and the images do not always appear representative of/match the accompanying histograms. When using a single fluorescent marker (mito-GFP), the images should be in grey scale.

      In several images there is substantial background GFP signal resulting in images that are fuzzy on the high quality PDF (printout is unintelligible). Example: Figure 2, Mock+veh. Example: Figure S2I, Mock+veh, +PA-PLA Tg. Example: Figure 3C mock+veh

      Images from prior paper (Lebeau J, et al. 2018) are of much higher quality and is much easier to discern mitochondrial”

      Mitochondrial morphology doesn't appear uniform even within the same cell so how is this accounted for in scoring of mitochondrial morphology? Also, how are authors scoring mitochondrial morphology? Due to the inconsistencies in the chosen images, we feel this manuscript would benefit from addition of a supplementary figure showing examples for each cell model expressing mtGFP (i.e. HeLa and MEFs) depicting the fragmented, tubular and elongated mitochondria. This should be able to be constructed from images already collected for these analyses that weren't already used in the paper.”

      __Our Response to Reviewer #1 Comment #1. __In the revised manuscript, we improved the quality of the images and converted all images to greyscale, as suggested by the reviewer.

      As described in Materials and Methods, we quantified mitochondrial morphology by cell, scoring whether a cell has primarily fragmented, tubular, or elongated mitochondria morphology. This scoring was performed by at least two blinded researchers for at least 3 independent experiments with a total of >60 cells/condition counted across all experiments. Scores for individual experiments were then combined and averaged. Statistics were calculated from these averaged scores. In the revised manuscript, the images presented are representative of each individual condition. In addition, we now include new panels showing the quantification of total cells counted/condition across all individual replicates by a representative researcher for the main text figures (e.g., see Fig. S1C). This provides an alternative representation of the observed phenotype across the individual experiments for these key figures.

      As suggested by the reviewer, in the revised submission we also now provide representative images of cells with primarily fragmented, tubular, and elongated mitochondria for both MEF and HeLa cells (Fig. S1A,B). We appreciate this suggestion as we feel it improves the clarity of our manuscript.

      Reviewer #1 Comment #2. ____“Mitochondria in Perk-/- MEFs are highly fragmented, which is potentially inconsistent with previous work (Lebeau J, et al. 2018) performed by the same research group. Can the authors comments on this discrepancy? Also, do the authors interpret this fragmentation to mean that Perk is required to maintain mitochondrial elongation in the absence of exogenous ER stress (Tg)? If so, the authors should test whether expression of a dominant negative version of DRP1 rescues this fragmented morphology. This would be an additional critical test of the authors' model.”

      “Vehicle treated Perk-/- cells have fragmented morphology which is different from Figure 2F in above publication by same group. Can the authors explain this discrepancy?”

      Our Response to Reviewer #1 Comment #2. In our previous publication, we did not quantify mitochondrial morphology in Perk-deficient cells. However, as reported in this current manuscript, we find that Perk-deficient cells display higher amounts of fragmented mitochondria, as compared to Perk+/+ MEFs (Fig. 1B,C). We quantified this result across 5 independent experiments. Moreover, we found that reconstitution with PERKWT restored tubular mitochondrial morphology in Perk-deficient cells, demonstrating that this effect can be attributed to loss of PERK.

      With respect to the increase in mitochondrial fragmentation observed in Perk-deficient MEFs, we attribute this to reduced mitochondrial membrane potential observed in these cells. We now show that Perk-deficient MEFs show 50% reductions in TMRE staining, as compared to controls. We include this data in the revised manuscript as __Fig. S1D __and the accompanying text below.

      Line 91. “*Perk-/- MEFs showed increases in fragmented mitochondria in the absence of treatment (Fig. 1B,C and Fig. S1C). This corresponds with reductions in the mitochondrial membrane potential in Perk-deficient cells, as measured by tetramethylrhodamine ethyl ester (TMRE) staining (Fig. S1D). This suggests that the increase of fragmentation in these cells can be attributed to mitochondrial depolarization. Tg-induced mitochondrial elongation was also impaired in Perk-deficient cells (Fig. 1B,C and Fig. S1C).”. *

      Reviewer #1 Comment #3. The authors postulate that mitochondrial elongation in response to Perk activation is specifically outer membrane PA-dependent negative regulation of DRP1. However, PA is readily convertible to other phospholipids, notably CL and LPA, both of which positively regulate mitochondrial fusion. The authors do not measure abundance of other phospholipids, particularly LPA or CL in their targeted lipidomics experiments, only PC. The authors need to consider this alternate possibility.”

      Reviewer #1 Comment #3. __Overexpression of PA-PLA1 (which converts PA to LPA) blocks ER stress induced mitochondrial elongation (__Fig. S2L-O). This indicates that the observed Tg-dependent increase in mitochondrial elongation are unlikely to be attributed to increases in LPA. mitoPLD converts CL to PA at the outer mitochondrial membrane. Since mitoPLD overexpression increases mitochondrial elongation (Fig. 3A,B), this again suggests that CL is not a major driver of mitochondrial elongation. These results combined with the sensitivity of ER stress induced mitochondrial elongation to two different PA lipases strongly support a model whereby increases in PA contribute to ER stress induced mitochondrial elongation.

      In the revised manuscript, we include measurements of CL in mitochondria isolated from MEFmtGFP cells treated with Tg and/or depleted of Prelid1. As expected, reductions of PRELID1 decrease CL in isolated mitochondria (Fig. S5C). Treatment with Tg reduced CL to similar extents in mitochondria isolated from MEFmtGFP cells expressing non-silencing shRNA. However, we did not observe further reductions of CL in Prelid1-depleted cells. This is consistent with a model whereby ER stress-dependent reductions in PRELID1 decrease PA trafficking across the IMS and lead to reductions in CL synthesis. These results are discussed in the revised manuscript as below:

      Line 214. “PRELID1 traffics PA from the outer to inner mitochondrial membrane, where it serves as a precursor to the formation of cardiolipin.56,66,67 Thus, reductions in PRELID1 should decrease cardiolipin. To test this, we shRNA-depleted Prelid1 from MEFmGFP cells and monitored cardiolipin in isolated mitochondria in the presence or absence of ER stress. We confirmed efficient PRELID1 knockdown by immunoblotting (Fig. S5A). Importantly, Prelid1 depletion did not alter Tg-induced reductions of TIM17A or increases of ATF4. Further, Tg-dependent increases in PA were observed in Prelid1-depleted MEFmtGFP cells (Fig. S5B). These results indicate that loss of PRELID1 does not impair PERK signaling in these cells. Prelid1 depletion reduced cardiolipin in mitochondria isolated from MEFmtGFP cells (Fig. S5B). Treatment of MEFmtGFP cells expressing non-silencing shRNA with Tg for 3 h also reduced cardiolipin to levels similar to those observed in Prelid1-deficient cells. However, Tg did not further reduce cardiolipin in Prelid-depleted cells. These results are consistent with a model whereby ER stress-dependent reductions in PRELID1 limit PA trafficking across the inner mitochondrial membrane and contribute to reductions in cardiolipin during acute ER stress”

      Reviewer #1 Comment #4. In Figure 5, the authors found very little difference in mitochondrial elongation following knockdown of Prelid1 (comparison between vehicle only conditions), which is potentially inconsistent with their model as decreased PRELID1 should lead to increased OMM PA [and subsequently mitochondrial fusion/elongation]. Therefore, these findings do not adequately support the authors' main model.”

      Our Response to Reviewer #1 Comment #4. __Our model predicts that ER stress induced mitochondrial elongation is mediated through a process involving both PERK kinase-dependent increases in total PA and YME1L-dependent PRELID1 degradation induced downstream of PERK-dependent translation attenuation (see __Fig. 6). Thus, we predict that PRELID1 degradation is required, but not sufficient, to promote mitochondrial elongation. Our results showing that PRELID1 depletion does not basally disrupt mitochondrial morphology or inhibit Tg-induced mitochondrial elongation are consistent with this model. Moreover, we show that genetic Prelid1 depletion rescues Tg-induced mitochondrial elongation in cells co-treated with the PERK signaling inhibitor ISRIB – a compound that blocks PERK-dependent PRELID1 degradation (Fig. 4D), but not increases in PA (Fig. 2B, S2E,F) – in both MEFmtGFP and HeLa cells (Fig. 5A-D). This is consistent with our proposed model whereby PRELID1 degradation is required but not sufficient for promoting mitochondrial elongation. We make this point clearer in the revised manuscript.

      Line 259: “Interestingly, Prelid1 depletion did not basally influence mitochondrial morphology or inhibit Tg-induced mitochondrial elongation (Fig. 5A,B and Fig. S5E). This indicates that reduction of PRELID1, on its own, is not sufficient to increase mitochondrial elongation, likely reflecting the importance of PERK kinase-dependent increases in PA in this process.53”

      Reviewer #1 Comment #5. The manuscript requires more careful editing - there were grammatical and punctuation errors.

      “… the text needs considerable editing to make the language clearer and formal whereas the figures are not always presented in a manner that is easily absorbed by the reader. Representative microscopy images chosen do not always match the corresponding graphical summary and are not clear even on PDF version compared to (Lebeau J, et al. 2018 - full citation above).”

      __Our Response to Reviewer #1 Comment #5. __We carefully edited the revised manuscript.We also confirmed that representative images match the observed quantifications.

      Reviewer #1 Comment #6. In order to further investigate the contribution PRELID1-dependent accumulation of PA in the OMM and its role in mitochondrial elongation, the authors should investigate the abundance of PA (and other lipids) in Perk, Prelid, Yme1l KO mutants. These experiments should quantitatively complement the results in Figure 5. KD of Prelid would be expected to increase mitochondrial elongation but there is no difference compared to WT in Figure 5.”

      Our Response to Reviewer #1 Comment #6. __We thank the reviewer for this comment and now include new data to further demonstrate that co-treatment with the PERK kinase inhibitor GSK2656157 inhibits Tg-dependent increases in PA, while the PERK signaling inhibitor ISRIB does not (__Fig. 2B __and __Fig. S2A-E). Further, it is published that Perk-deletion inhibits ER stress-induced increases in PA, while knockin cells expressing the non-phosphorylatable eIF2a S51A mutant do not (Bobrovnikova-Marjon et al (2012) Mol Cell Biol). This is consistent with a model whereby PERK-dependent increases in PA are attributed to a PERK kinase-dependent, yet eIF2a phosphorylation-independent, mechanism. In the revised manuscript, we include additional quantification of PA across other genetic manipulations, as requested. Notably, we confirm that Lipin1 overexpression reduced basal PA and prevents Tg-dependent increases in PA (Fig. 2C, Fig. S2F,G). Further, we show that PRELID1 depletion does not significantly impact Tg-dependent increases of PA (Fig. S5B).

      However, it is important to highlight that our work is specifically monitoring how acute ER stress-dependent PERK activation impacts mitochondria. Genetic manipulations that target many of the core components of these pathways are well established to globally disrupt many aspects of mitochondrial biology. Thus, these types of genetic manipulations often confound our ability to accurately monitor the contribution of specific stress-responsive signaling pathways in adapting mitochondria in response to acute insults. For example, a recent publication demonstrates that deletion of Perk impairs ER-mitochondrial phospholipid transport through mechanism independent of PERK kinase activity (Sassano et al (2023) J Cell Biol). While this problem can be limited if specific perturbations do not basally disrupt the phenotype being monitored (e.g., PRELID1 depletion does not significantly impact basal mitochondrial morphology; Fig. 5), our ability to evaluate how stress-responsive signaling regulates mitochondria in response to acute insults (e.g., ER stress) still requires temporal control to properly evaluate how these pathways impact aspects of mitochondrial biology. It is for this reason that we paired PRELID1 depletion with pharmacologic interventions that can be used to temporally inhibit PERK signaling (e.g., ISRIB, GSK), allowing us to best define the specific role for PERK-dependent reductions PRELID1 in promoting mitochondrial elongation in response to ER stress.

      Reviewer #1 Comment #7. “Title of the subsection: "hypomorphic PERK variants inhibit ER..." is inappropriate since authors only investigated a single hypomorphic variant (PSP). KO mutant is a null not hypomorphic mutant”

      __Our Response to Reviewer #1 Comment #7. __We agree and have made the suggested change in the revised manuscript.

      Reviewer #1 Comment #8. Can the authors elaborate on the possible biological relevance for the inhibition of OPA1 cleavage via Tg treatment?

      Our Response to Reviewer #1 Comment #8. __We show that Tg pretreatment inhibits mitochondrial depolarization induced by CCCP (__Fig. S3G). Thus, the impaired CCCP-induced, OMA1-dependent OPA1 processing observed in response to pretreatment with Tg likely reflects disruptions in mitochondrial uncoupling afforded by this treatment. We make this point clearer in the revised manuscript.

      Line 170: “However, Tg pretreatment inhibited CCCP-induced proteolytic cleavage of the inner membrane GTPase OPA1 (Fig. 3C) – a biological process upstream of DRP1 in mitochondrial fragmentation induced by membrane uncoupling.43-47,64 This appears to result from Tg-dependent increases in mitochondrial membrane polarity (Fig. S3G), preventing efficient uncoupling in CCCP-treated cells and precluding our ability to determine whether Tg pretreatment directly impairs DRP1 activity under these conditions..”

      Reviewer #1 Comment #9. PRELID is a known short-lived protein; can the authors elaborate on possible additional impact due to 3-6 hr Tg treatment which is sufficient to induce expression of ATF4 target genes (Figure S2G).

      Our Response to Reviewer #1 Comment #9. PRELID1 is a short-lived mitochondrial protein that is rapidly degraded in response to acute ER insults. As demonstrated in Fig. 4 of our manuscript, this reduction is mediated by the IMM protease YME1L downstream of PERK-regulated translation attenuation. This 3-6 h timecourse corresponds with the translational attenuation induced downstream of PERK-dependent eIF2a phosphorylation following treatment with Tg and corresponds with the loss of PRELID1 observed in Tg-treated cells.

      Note that the increase in ATF4 noted by the reviewer reflects the fact that ATF4 (and related proteins) are preferentially translated following eIF2a phosphorylation due to the presence of uORFs in their promoter. Thus, while global protein translation (including PRELID1 translation) is reduced by eIF2a phosphorylation, proteins like ATF4 are selectively translated.

      Reviewer #1 Comment #10. Thapsigargin induced ER stress does not only activate PERK arm of the ISR, correct? Could the authors comment on this?”

      __Our Response to Reviewer #1 Comment #10. __I believe the reviewer is asking whether Tg treatment activates other arms of the integrated stress response (ISR). At the short timepoints used in this work (3-6 h), Tg-dependent increases in ISR signaling can be fully attributed to PERK signaling. This is evident as Perk deletion or inhibition blocks markers of ISR signaling in cells treated with Tg for these shorter timepoints (e.g., __Fig. 4E __of this paper; Harding et al (2002) Mol Cell and Lebeau et al (2018) Cell Reports). While other ISR kinases can be activated in response to more prolonged ER stress, the ISR activation observed in these shorter treatments with Tg are well established to be attributed to PERK activity.

      Tg does induce all three arms of the unfolded protein response (i.e., ATF6, IRE1, and PERK) in the 3-6 h timeframe used in this manuscript. We previously showed that pharmacologic inhibition of ATF6 and IRE1 activity does not influence Tg-induced mitochondrial elongation (Lebeau et al (2018) Cell Reports). However, as reproduced in this manuscript, inhibition of PERK signaling blocks ER stress induced mitochondrial elongation. We make this point clearer in the revised manuscript.

      Line 86. “Pharmacologic inhibition of PERK signaling, but not other arms of the UPR, blocks mitochondrial elongation induced by ER stress.39

      Reviewer #1 Comment #11. “*Addition of drugs and duration (3-6 hrs) likely very toxic to cells; how does this treatment affect viability? Unhealthy cells will have unhealthy mitochondria so it's hard to be confident that subtle morphological differences are specific. Why do authors use 3 hrs Tg-treatment after initially using 6 hrs in Figure 1? Would be helpful to assay toxicity and mitochondrial morphology of thapsigargin and other drugs in WT vs. Perk KO MEFs over time.” *

      __Our Response to Reviewer #1 Comment #11. __Thapsigargin (Tg) is toxic to cells, but apoptosis is observed in cell culture models only after much longer treatments 24-72 h. We are using Tg to monitor how cells respond to acute ER stress. We chose the short 3-6 h timecourse because this is sufficient to induce PERK-dependent translation attenuation independent of cell death. Consistent with this, we observe no reductions in cellular viability or death in the short 3-6 h treatments used in this study. This timecourse is standard in the field when monitoring cellular changes induced by acute ER stress.

      Reviewer #1 Comment #12. Previously, an increase in fragmentation was observed at 0.5 hours but this subsided by 6 hours in WT (Lebeau J, et al. 2018) but is this the same for Perk KO MEFs?

      Our Response to Reviewer #1 Comment #12. __The increase in mitochondrial fragmentation observed following Tg treatment results from the rapid increase of mitochondrial Ca2+ induced by this treatment (Hom et al (2007) J Cell Phy). Consistent with this, we have found that pharmacologic inhibition of PERK signaling using the compound ISRIB, does not inhibit mitochondrial fragmentation in MEFmtGFP cells treated for 30 min with Tg. Since Perk-deficient MEFs already show increased fragmentation (__Fig. 1B,C), monitoring mitochondrial morphology in Perk-deficient cells treated with Tg for 30 min is unlikely to reveal additional insights into the mechanism outlined in this manuscript.

      Reviewer #1 Comment #13. “How much protein was loaded per lane and what was the percentage of polyacrylamide gel? Please clarify details in methodology.”

      Our Response to Reviewer #1 Comment #13. We loaded 100 µg of protein for our immunoblotting experiments. We used 10% or 12% SDS-PAGE gels. We included this information in the revised Materials and Methods.

      Reviewer #1 Comment #14. Figure 1A is virtually identical to Figure 2A (with exception of "MEF A/A") from previous publication: Lebeau J, Saunders JM, Moraes VWR, Madhavan A, Madrazo N, Anthony MC, Wiseman RL. The PERK Arm of the Unfolded Protein Response Regulates Mitochondrial Morphology during Acute Endoplasmic Reticulum Stress. Cell Rep. 2018 Mar 13;22(11):2827-2836. doi: 10.1016/j.celrep.2018.02.055. PMID: 29539413; PMCID: PMC5870888.”

      Our Response to Reviewer #1 Comment #14. __Yes. __Fig. 1A is a cartoon showing PERK-dependent regulation of mitochondria and the specific pharmacologic and genetic manipulations used in this paper to alter this pathway. This is adapted from our previous manuscript (Lebeau et al (2018) Cell Reports). We properly reference this adaptation in the revised manuscript. We feel it is important to show this figure to specifically highlight how different manipulations influence this signaling pathway.

      Reviewer #1 Comment #15. “If the authors' hypothesis is correct, overexpression of PRELID1 should have same effect as overexpression of Lipin”

      Our Response to Reviewer #1 Comment #15. Overexpressed PRELID1 will be sensitive to the same rapid YME1L-dependent degradation observed for the endogenous protein. Thus, overexpressing PRELID1 would be expected to have no effect (or a very minor effect) on mitochondrial morphology in Tg-treated cells. We show that Lipin1 overexpression basally increases mitochondrial fragmentation and blocks Tg-induced mitochondrial elongation (Fig. 2). Identical results were observed in cells overexpressing the alternative PA lipase PA-PLA1 (Fig. S2). We feel that these data, in combination with others shown in our manuscript, strongly support the dependence of this process on PA levels and localization.

      Reviewer #1 Comment #16. What is the selective marker used for HeLa cells expressing mitoPLDGFP since the HeLa parental cell background already expressed a mitochondrial targeted GFP, we assume it was puromycin but this was not clear in the Figure legend or methods? If so, it would be helpful to clarify this. If not, how can the authors observe a difference in morphology if the selectable marker is the same? Indeed, mitoPLDGFP is expressed, detectable by immunoblot, but this is on a cell population level so no way of knowing whether the specific cells scored expressed mitoPLDGFP unless another selectable marker was used (i.e. should have used CFP, RFP, etc.).”

      The authors state "Note the expression of mitoPLDGFP did not impair our ability to accurately monitor mitochondrial morphology in these cells." in Figure 3 legend and again basically the same in S3: "Note that the expression of the mitoPLDGFP did not impair our ability to monitor mitochondrial morphology in these cells." Could the authors explain their reasoning here?

      __Our Response to Reviewer #1 Comment #16. __We co-transfected the mitochondrial localized mitoPLD-GFP with mtGFP in HeLa cells using calcium phosphate transfection. In using this approach, we (and others) have consistently found that this method leads to the efficient transfection of cells with both plasmids. Thus, cells will express both mitoPLD-GFP and mtGFP. We used mitoPLD-GFP because we were reproducing published experiments (Adachi et al (2016) Mol Cell) and we wanted to use the same overexpression plasmid used in these previous studies. It is clear from our images that the presence of GFP-tagged mitoPLD did not influence our ability to accurately monitor mitochondrial elongation in these cells. Further, the robust increase in mitochondrial elongation observed in cells overexpressing mitoPLD-GFP and the further increase in elongation observed upon co-treatment with Tg demonstrate the effectiveness of this assay. This is consistent with published results (Adachi et al (2016) Mol Cell).

      Reviewer #1 Comment #17. ____“Figure S4C: the authors show that Tg treatment on MEF mtGFP cells for distinct hours to determine PRELID levels. However, in the Results section states that this treatment was with CHX, could the authors please check this and correct?”

      Our Response to Reviewer #1 Comment #17. __The data shown in __Fig. S4C from the previous version is in Tg-treated cells. We corrected this in the revised manuscript.

      Reviewer #1 Comment #18. Figure 6: A schematic representation should be a graphic summary of all findings reported in the text with no text except where absolutely essential. A good model should be easily understood without reading any description since all concepts were supported in the main text and by experimentation.”

      *“The model also contains some inaccuracies. The suggestion is that the authors re-do the model and clarify some aspects such as: *

      *The model suggests that ISRIB inhibits PRELID1 directly but there is no evidence for this whereas PRELID is directly regulated by YME1L (also typo here in figure: "Yme1" no "l"). *

      *This model incorrectly uses inhibition symbols; for example, mutation of Perk does not inhibit its activity as GSK does. The KO does not have Perk so cannot perform its function. These are not the same. *

      Similarly, the lipases (Lipin and PA-PLA1) should be depicted instead as altering flux of PA away from OMM not as inhibition.

      The authors should connect PA accumulation in the OMM graphically to mitochondrial elongation [instead of through text]. If the authors consider the numbered labels convenient, please use just the number and place the description in the figure legend instead.”

      Our Response to Reviewer #1 Comment #18. __We have adapted our model shown in __Fig. 6 and the accompanying legend to address points brought up by the reviewer. In particular, because the reviewer found it difficult to follow how specific manipulations impacted specific steps, we removed those parts from the revised figure for clarity.

      __Reviewer #1 Comment #19. __The reviewer made many suggestions to improve the Materials and Methods section of this manuscript in their review, which we do not include here for space considerations.

      __Our Response to Reviewer #1 Comment #19. __We have addressed all of the reviewer’s comments regarding the Materials and Methods section in our revised manuscript.

      Reviewer #1 Comment #20. The reviewer made many suggestions about the presentation of our figures that we do not include here for space considerations.

      Our Response to Reviewer #1 Comment #20. __We have addressed all of the reviewer’s comments regarding the Figures__ in our revised manuscript.

      REVIEWER #2.

      Reviewer #2 General Comments. Previous studies have shown that ER stress increases amounts of phosphatidic acid (PA) (PMID: 22493067) and induces elongation of mitochondria through the protein and lipid kinase PERK (PMID: 29539413, work by Wiseman's lab). The current work reports that ER stress by thapsigargin promotes the degradation of a mitochondrial protein PRELID1, which transfers PA from the outer membrane to the inner membrane. An inner membrane protease, YME1L, was identified as responsible for this degradation of PRELID1. Consistent with the notion that PA is required for the morphological change, overexpression of a PA phosphatase (Lipin) or a PA phospholipase (PA-PLA1) decreased ER-stress-induced mitochondrial elongation.”

      Overall, this manuscript is a nice extension of the authors' previous work and investigates the molecular mechanism underlying the regulation of mitochondrial elongation induced by ER stress. However, the current data do not strongly support the role of PRELID1 in either ER-stress-mediated PA level elevation or mitochondrial elongation, as described in Specific comments. The authors should address these points.”

      __Our Response to Reviewer #2 General Comments. __We thank the reviewer for the thorough and careful read of our manuscript. We address the specific points brought up by the reviewer in our revised manuscript, as described below.

      Reviewer #2 Comment #1. The authors report that PRELID1 knockdown did not promote mitochondrial elongation under either normal or ER-stress conditions (Fig. 5). If PRELID1 plays a vital role in mitochondrial elongation, PRELID1 depletion will restore elongation. Therefore, the presented data argue against the authors' conclusion. Since PRELID1 has multiple homologs, including PRELID3B, which is also a short-lived protein like PRELID1, these homologs might redundantly function in PA transport, especially when PRELID1 is absent. Therefore, the authors need to knock them down simultaneously. This possibility is consistent with the previous authors' data that YME1L depletion decreases ER-stress-induced mitochondrial elongation (PMID: 29539413). YME1L knockdown may rescue multiple short-lived PRELID1 homologs.”

      Our Response to Reviewer #2 Comment #1. __Our model indicates that ER stress-dependent increases in mitochondrial elongation require two steps: 1) PERK kinase-dependent increases in total PA and 2) YME1L-dependent degradation of PRELID1 downstream of PERK-dependent translation attenuation. Thus, it is not surprising that PRELID1 depletion did not induce mitochondrial elongation on its own. However, we do demonstrate that depletion of PRELID1 rescues Tg-induced mitochondrial elongation in cells co-treated with the PERK signaling inhibitor ISRIB – a compound that specifically blocks Tg-dependent PRELID1 degradation, but not PERK kinase dependent increases in total PA (__Fig. 6). This demonstrates that PRELID1 reductions are required, but not sufficient for promoting mitochondrial elongation. We make this point more clear in the revised manuscript.

      Line 259: “Interestingly, Prelid1 depletion did not basally influence mitochondrial morphology or inhibit Tg-induced mitochondrial elongation (Fig. 5A,B and Fig. S5E). This indicates that reduction of PRELID1, on its own, is not sufficient to increase mitochondrial elongation, likely reflecting the importance of PERK kinase-dependent increases in PA in this process.53”

      With respect to PRELID3B/SLMO2. This lipid transporter is primarily associated with trafficking phosphatidylserine (PS) from the outer to the inner mitochondrial membrane, where it is then converted to phosphatidylethanolamine (PE). As alluded to by the reviewer, we found that SLMO2, like PRELID1, is also a short-lived mitochondrial protein that is rapidly degraded by YME1L downstream of PERK-dependent translation attenuation. We have also found that Tg treatment disrupts mitochondrial PE levels through a PERK-dependent mechanism on a similar timescale to that observed for PA changes. However, shRNA depletion of SLMO2 in HeLa cells – a condition that mimics the reductions in SLMO2 observed during ER stress – increases basal mitochondrial fragmentation and inhibits Tg-induced mitochondrial elongation. Since chronic, genetic reductions in SLMO2 (which mirror the acute reduction in SLMO2 observed during ER stress) show opposite impacts on mitochondrial morphology to that observed upon Tg treatment, we interpreted this result to indicate that SLMO2 reductions are likely not involved in PERK-dependent regulation of mitochondrial elongation during acute ER stress. In contrast, depletion of PRELID1 is sufficient to rescue Tg-induced mitochondrial elongation in cells co-treated with ISRIB (Fig. 5A-D) – a compound that selectively blocks ER stress-dependent reductions in PRELID1. This implicates reductions in PRELID1 in this process. We are continuing to define the specific impact of PERK-dependent regulation of SLMO2 on mitochondrial morphology, ultrastructure, and/or function in work outside the scope of this current manuscript, but we felt it most appropriate to focus this manuscript on PA-dependent morphology remodeling based on the presented data.

      Reviewer #2 Comment #2. “Another possibility is that since a previous study has shown that PERK-produced PA activates the mTOR-AKT pathway (PMID: 22493067), this signaling pathway may contribute to mitochondrial morphology in addition to PRELID1. The authors should test the combined effects of mTOR-AKT inhibition in ER-stress-induced mitochondrial elongation.”

      Our Response to Reviewer #2 Comment #2. __As highlighted by the reviewer, PERK-dependent increases in PA can influence mTOR and AKT activity. To test this, we monitored mTOR-dependent S6K phosphorylation and AKT phosphorylation in MEFmtGFP and HeLa cells treated with Tg for 3 h. While we did observe increases in S6K phosphorylation in Tg-treated MEFmtGFP cells, mTOR activity was not changed in Tg-treated HeLa cells. AKT phosphorylation was not affected in MEFmtGFP or HeLa cells (not shown). We include these mTOR data in the revised manuscript (see __Fig. S3C,D). Since we observe PERK-dependent mitochondrial elongation in both MEFmtGFP and HeLa cells, we interpret these results to indicate that PA-dependent increases in mTOR activity is not primarily responsible for ER stress dependent increases in mitochondrial elongation across cell types. We describe these results in the revised manuscript.

      Line 156: “In contrast, PERK-dependent increases in PA can activate mTOR during ER stress.53 Consistent with this, we observe Tg-dependent increases in mTOR-dependent S6K phosphorylation in MEFmtGFP cells (Fig. S3C). However, despite increasing PA and promoting mitochondrial elongation, Tg did not increase S6K phosphorylation in HeLa cells (Fig. S3D). These results suggest that PERK-dependent alterations in mTOR activity are unlikely to be primary contributors to ER stress induced mitochondrial elongation across cell types.”

      Reviewer #2 Comment #3. “The authors' model suggests the loss of PRELID1 increases PA levels in the mitochondrial outer membrane (Fig. 6). The authors should test PA levels in mitochondria isolated from cells depleted for PRELID1 and its homologs (simultaneously). Since PA that is transported to the inner membrane is actively converted to other phospholipids, such as CDP-DAG, elevated levels of PA are likely seen if the outer membrane to inner membrane transport is blocked.

      Our Response to Reviewer #2 Comment #3. __We agree with the reviewer it is important to evaluate how PERK-dependent degradation of PRELID1 impacts other phospholipids dependent on PA trafficking to the IM where it can be converted to other lipids, most notably cardiolipin (CL). In the revised manuscript, we now show measurements of CL in MEFmtGFP cells treated with Tg and/or depleted of Prelid1. As expected, reductions in PRELID1 decrease CL in isolated mitochondria (__Fig. S5C). Treatment with Tg reduced CL to similar extents in MEFmtGFP-treated cells expressing non-silencing shRNA. However, we did not observe further reductions of CL in Prelid1-depleted cells. This is consistent with a model whereby ER stress-dependent reductions in PRELID1 decrease PA trafficking across the IMS and lead to reductions in CL synthesis. These results are discussed in the revised manuscript as below:

      Line 214. “PRELID1 traffics PA from the outer to inner mitochondrial membrane, where it serves as a precursor to the formation of cardiolipin.56,66,67* Thus, reductions in PRELID1 should decrease cardiolipin. To test this, we shRNA-depleted Prelid1 from MEFmGFP cells and monitored cardiolipin in isolated mitochondria in the presence or absence of ER stress. We confirmed efficient PRELID1 knockdown by immunoblotting (Fig. S5A). Importantly, Prelid1 depletion did not alter Tg-induced reductions of TIM17A or increases of ATF4. Further, Tg-dependent increases in PA were observed in Prelid1-depleted MEFmtGFP cells (Fig. S5B). These results indicate that loss of PRELID1 does not impair PERK signaling in these cells. Prelid1 depletion reduced cardiolipin in mitochondria isolated from MEFmtGFP cells (Fig. S5C). Treatment of MEFmtGFP cells expressing non-silencing shRNA with Tg for 3 h also reduced cardiolipin to levels similar to those observed in Prelid1-deficient cells. However, Tg did not further reduce cardiolipin in Prelid-depleted cells. These results are consistent with a model whereby ER stress-dependent reductions in PRELID1 limit PA trafficking across the inner mitochondrial membrane and contribute to reductions in cardiolipin during acute ER stress.” *

      We are continuing to define how PERK signaling influences other mitochondrial phospholipids during conditions of ER stress in work outside the scope of this manuscript. Notably, we are continuing to evaluate how ER stress and PERK signaling influences aspects of cardiolipin synthesis in response to both acute and chronic ER stress. Further, as discussed above, we are determining how PERK-dependent reductions in PRELID3B/SLMO2 influence PS trafficking and subsequent PE synthesis at the IM and the implications of these changes on mitochondrial biology. Initial experiments indicate that PERK signaling reduces PE during ER stress, indicating that other phospholipids can be influenced by this pathway. However, we view this work as being outside the scope of the current manuscript focused specifically on defining the impact of PA remodeling on mitochondrial morphology.

      Reviewer #2 Comment #4. “The authors need to test whether Lipin and PA-PLA1 overexpression decreased PA levels in mitochondria treated with thapsigargin. The current manuscript only shows the effect of Lipin and PA-PLA1 on PA levels in whole-cell lysate without ER stress (Fig. S2F).”

      Our Response to Reviewer #2 Comment #4. __We agree. In the revised manuscript, we now show that Lipin overexpression blocks Tg-dependent increases in PA (__Fig. 2C). Identical experiments are also shown for Prelid1-depleted cells (Fig. S5B).

      Reviewer #2 Comment #5. “The authors propose that PA inhibits DRP1 in mitochondrial division under ER stress. It has been shown that PA blocks DRP1 after recruitment to mitochondria (PMID: 27635761). Does thapsigargin induce mitochondrial accumulation of DRP1?”

      Our Response to Reviewer #2 Comment #5. __The reviewer is correct that our results suggest that ER stress promotes mitochondrial elongation through a model involving PA-dependent inhibition of mitochondrial fission at the outer membrane. In the revised manuscript, we now show that Tg treatment does not significantly influence the recovery of DRP1 in mitochondrial fractions (__Fig. S3A). Further, we recapitulate results from previous publications showing that Tg does not significantly influence DRP1 phosphorylation at either S637 or S616 (Fig. S3B). This indicates that DRP1 localization and posttranslational modification does not appear affected by Tg treatment. However, we do show that Tg pretreatment inhibits DRP1-dependent mitochondrial fission induced by ionomycin (Fig. 3D,E). Combined with other results, our data are consistent with a model whereby PERK-dependent increases in PA and PRELID1 degradation leads to the accumulation of PA on the OM where it can inhibit DRP1 activity (Fig. 6). We make this point clearer in the revised manuscript.

      Line 154: “However, as reported previously39, Tg did not influence DRP1 phosphorylation at either S637 or S616 (Fig. S3A) or alter the amount of DRP1 enriched in mitochondrial fractions from MEFmtGFP cells (Fig. S3B).”

      REVIEWER #3.

      Reviewer #3 General Comments. The authors investigated signaling pathways and molecular mechanisms leading to mitochondrial dysfunction after ER stress. This study extends their previous publication (Lebeau et al., 2018) by providing evidence on how PERK regulates mitochondrial structure and function in response to ER stress. Some key findings are that PERK induces mitochondrial elongation by increasing and retaining phosphatidic acid (PA) in the outer mitochondrial membrane which is important for cell adaptation and survival. This process requires PERK-dependent translational attenuation through YME1L-PRELID dependent mechanism. This is a very strong study with compelling evidence.”

      This study adds to our current knowledge on how ER stress affects mitochondria adaptation and proteostasis, which may contribute to the pathogenesis and progression of numerous neurodegenerative diseases. Specifically, this study establishes a new role for PERK in mitochondrial adaptive remodeling focused on trafficking and accumulation of phospholipids. Identifying molecular markers like PERK and its involvement with PRELID, YME1L, and PA to regulate mitochondrial remodeling during ER stress is important to understand the effects of drug-targeting this ER stress-responsive factor.”

      __Our Response to Reviewer #3 General Comments. __We thank the reviewer for the enthusiastic comments about our manuscript. We address the reviewers remaining concerns as outlined below.

      Reviewer #3 Comment #1. “Only one minor point should be addressed: In Fig S2G & H, the authors indicate that "Lipin1 overexpression did not significantly influence increases of ATF4 protein". The blots show a decrease in ATF4 in Tg-treated HeLa cells. The same effect is observed in Fig. S3F showing reduction in ATF4, but the authors described it as the "overexpression of mitoPLD did not significantly impact other aspects of PERK signaling in Tg-treated cells". The quantification of the blots or indication that the blots were quantified should be clarified and noted (at least in the legend).”

      Our Response to Reviewer #3 Comment #1. __We agree. We now include quantification of ATF4 in immunoblots from HeLA cells overexpressing lipin1 and treated with Tg (__Fig. S2J). As we suggested, these results confirm that Tg treatment does not significantly influence ATF4 expression in these cells. In addition, we now include additional data showing that lipin overexpression does not significantly reduce Tg-dependent expression of ISR target genes including Asns or Chop (Fig. S2I). This further supports other findings in the manuscript showing that different manipulations do not significantly impact ISR signaling (evident by ATF4 expression or TIM17A or PRELID1 degradation).

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      The authors investigated signaling pathways and molecular mechanisms leading to mitochondrial dysfunction after ER stress. This study extends their previous publication (Lebeau et al., 2018) by providing evidence on how PERK regulates mitochondrial structure and function in response to ER stress. Some key findings are that PERK induces mitochondrial elongation by increasing and retaining phosphatidic acid (PA) in the outer mitochondrial membrane which is important for cell adaptation and survival. This process requires PERK-dependent translational attenuation through YME1L-PRELID dependent mechanism.

      This is a very strong study with compelling evidence. Only one minor point should be addressed: In Fig S2G & H, the authors indicate that "Lipin1 overexpression did not significantly influence increases of ATF4 protein". The blots show a decrease in ATF4 in Tg-treated HeLa cells. The same effect is observed in Fig. S3F showing reduction in ATF4, but the authors described it as the "overexpression of mitoPLD did not significantly impact other aspects of PERK signaling in Tg-treated cells". The quantification of the blots or indication that the blots were quantified should be clarified and noted (at least in the legend).

      Significance

      This study adds to our current knowledge on how ER stress affects mitochondria adaptation and proteostasis, which may contribute to the pathogenesis and progression of numerous neurodegenerative diseases. Specifically, this study establishes a new role for PERK in mitochondrial adaptive remodeling focused on trafficking and accumulation of phospholipids. Identifying molecular markers like PERK and its involvement with PRELID, YME1L, and PA to regulate mitochondrial remodeling during ER stress is important to understand the effects of drug-targeting this ER stress-responsive factor.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Summary

      Previous studies have shown that ER stress increases amounts of phosphatidic acid (PA) (PMID: 22493067) and induces elongation of mitochondria through the protein and lipid kinase PERK (PMID: 29539413, work by Wiseman's lab). The current work reports that ER stress by thapsigargin promotes the degradation of a mitochondrial protein PRELID1, which transfers PA from the outer membrane to the inner membrane. An inner membrane protease, YME1L, was identified as responsible for this degradation of PRELID1. Consistent with the notion that PA is required for the morphological change, overexpression of a PA phosphatase (Lipin) or a PA phospholipase (PA-PLA1) decreased ER-stress-induced mitochondrial elongation.

      Specific comments

      1. The authors report that PRELID1 knockdown did not promote mitochondrial elongation under either normal or ER-stress conditions (Fig. 5). If PRELID1 plays a vital role in mitochondrial elongation, PRELID1 depletion will restore elongation. Therefore, the presented data argue against the authors' conclusion. Since PRELID1 has multiple homologs, including PRELID3B, which is also a short-lived protein like PRELID1, these homologs might redundantly function in PA transport, especially when PRELID1 is absent. Therefore, the authors need to knock them down simultaneously. This possibility is consistent with the previous authors' data that YME1L depletion decreases ER-stress-induced mitochondrial elongation (PMID: 29539413). YME1L knockdown may rescue multiple short-lived PRELID1 homologs.
      2. Another possibility is that since a previous study has shown that PERK-produced PA activates the mTOR-AKT pathway (PMID: 22493067), this signaling pathway may contribute to mitochondrial morphology in addition to PRELID1. The authors should test the combined effects of mTOR-AKT inhibition in ER-stress-induced mitochondrial elongation.
      3. The authors' model suggests the loss of PRELID1 increases PA levels in the mitochondrial outer membrane (Fig. 6). The authors should test PA levels in mitochondria isolated from cells depleted for PRELID1 and its homologs (simultaneously). Since PA that is transported to the inner membrane is actively converted to other phospholipids, such as CDP-DAG, elevated levels of PA are likely seen if the outer membrane to inner membrane transport is blocked.
      4. The authors need to test whether Lipin and PA-PLA1 overexpression decreased PA levels in mitochondria treated with thapsigargin. The current manuscript only shows the effect of Lipin and PA-PLA1 on PA levels in whole-cell lysate without ER stress (Fig. S2F).
      5. The authors propose that PA inhibits DRP1 in mitochondrial division under ER stress. It has been shown that PA blocks DRP1 after recruitment to mitochondria (PMID: 27635761). Does thapsigargin induce mitochondrial accumulation of DRP1?

      Significance

      Overall, this manuscript is a nice extension of the authors' previous work and investigates the molecular mechanism underlying the regulation of mitochondrial elongation induced by ER stress. However, the current data do not strongly support the role of PRELID1 in either ER-stress-mediated PA level elevation or mitochondrial elongation, as described in Specific comments. The authors should address these points.

      Audience ER stress, mitochondrial dynamics, membrane lipids, proteases

      My Expertise mitochondrial dynamics, lipid biology

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary:

      This study investigates changes in mitochondrial morphology in response to ER stress due to pharmacological inhibition or genetic dysfunction in vitro via two different cell models (MEFs and HeLa cells). The authors specifically implicate the PERK branch of the ER-stress induced pathway in this process based on the observation that mitochondria elongate in response to thapsigargin (Tg) treatment which is blocked by the pathway inhibitors GSK and ISRIB or by genetic ablation of Perk/PERK. Homozygous knockout cells lacking PERK exhibit a fragmented mitochondrial phenotype even in the absence of Tg, which is rescued by expression of the wildtype but not a hypomorphic allele (PERKPSP). One of the more interesting suppositions of this manuscript is that mitochondrial elongation is dependent on the abundance of phosphatidic acid (PA); treatment with Tg provokes an increase in mitochondrial PA, but PA does not accumulate in mitochondria from cells co-treated with GSK, an inhibitor of PERK. This correlation suggests that increased mitochondrial PA accumulation is PERK-dependent. In addition, predicted manipulation of PA levels achieved by a gain of function expression of the lipase Lipin diminished mitochondrial elongation in response to ER stress. Similar results were obtained by PA-PLA1 overexpression, a cytosolic lipase that converts PA into lysophosphatidic acid (LPA). To further describe the mechanistic link between ER stress and mitochondrial morphology, the authors found that PRELID1, which transports PA from the OMM to the intermembrane space, and TIM17A, a component of the protein translocation machinery, were stabilized by loss of PERK or YME1L [and possibly an effect of ATF4], regardless of ER stress via Tg treatment. The authors also report that Tg treatment prevents OPA1 cleavage in cells treated with CCCP, an uncoupler of the proton gradient, suggesting that the effect due to Tg treatment is not through ER stress but decreased mitochondrial fusion via mito-stress induced OPA1 cleavage. To address this, cells were treated with ionomycin which induces mitochondrial fragmentation independent of DRP1. The authors observed an increase in mitochondrial fragmentation in the presence of ionomycin. However, co-treatment with Tg prevented fragmentation, as did overexpression of mitoPLDGFP, which converts cardiolipin to PA on the OMM. These results support a model in which, under ER stress conditions, PERK activation leads to translational attenuation, which leads to a decrease in the steady state levels of PRELID1 via YME1L-dependent degradation and to the accumulation of PA on the OMM. Based on published work this PA accumulation is expected to inhibit the mitochondrial division dynamin, DRP1. The authors tested this by examining the dependence of mitochondrial elongation on PRELID1.

      Major comments:

      1. Are the key conclusions convincing? A considerable amount of work was performed by the authors in preparation of this manuscript and while we find the model exciting, there are several issues that need to be addressed in order for the model to be sufficiently supported.
        1. Image quality of mitochondria is sub par and the images do not always appear representative of/match the accompanying histograms. When using a single fluorescent marker (mito-GFP), the images should be in grey scale.
        2. Mitochondria in Perk-/- MEFs are highly fragmented, which is potentially inconsistent with previous work (Lebeau J, et al. 2018) performed by the same research group. Can the authors comments on this discrepancy? Also, do the authors interpret this fragmentation to mean that Perk is required to maintain mitochondrial elongation in the absence of exogenous ER stress (Tg)? If so, the authors should test whether expression of a dominant negative version of DRP1 rescues this fragmented morphology. This would be an additional critical test of the authors' model.
        3. The authors postulate that mitochondrial elongation in response to Perk activation is specifically outer membrane PA-dependent negative regulation of DRP1. However, PA is readily convertible to other phospholipids, notably CL and LPA, both of which positively regulate mitochondrial fusion. The authors do not measure abundance of other phospholipids, particularly LPA or CL in their targeted lipidomics experiments, only PC. The authors need to consider this alternate possibility.
        4. In Figure 5, the authors found very little difference in mitochondrial elongation following knockdown of Prelid1 (comparison between vehicle only conditions), which is potentially inconsistent with their model as decreased PRELID1 should lead to increased OMM PA [and subsequently mitochondrial fusion/elongation].
        5. The manuscript requires more careful editing - there were grammatical and punctuation errors.
      2. Should the authors qualify some of their claims as preliminary or speculative, or remove them altogether? In Figure 5, the authors found very little difference in mitochondrial elongation following knockdown of Prelid1 (comparison between vehicle only conditions), which is potentially inconsistent with their model as decreased PRELID1 should lead to increased OMM PA [and subsequently mitochondrial fusion/elongation]. Therefore, these findings do not adequately support the authors' main model.
      3. Would additional experiments be essential to support the claims of the paper? Request additional experiments only where necessary for the paper as it is, and do not ask authors to open new lines of experimentation.
        • a. In order to further investigate the contribution PRELID1-dependent accumulation of PA in the OMM and its role in mitochondrial elongation, the authors should investigate the abundance of PA (and other lipids) in Perk, Prelid, Yme1l KO mutants. These experiments should quantitatively complement the results in Figure 5. KD of Prelid would be expected to increase mitochondrial elongation but there is no difference compared to WT in Figure 5.
        • b. The main premise is that ER-stress activates PERK which in turn leads to increased abundance of PA at the OMM in a PRELID1-dependent manner. PA has been shown to inactivate DRP1, resulting in decreased fission (and mitochondrial elongation). The authors should test their model by expressing a dominant negative allele of DRP1 to see if it rescues the fragmented morphology of Perk KO mutant.
      4. Are the suggested experiments realistic in terms of time and resources? It would help if you could add an estimated cost and time investment for substantial experiments.
        • a. The authors have all the necessary cell line and methods in hand, so we consider these experiments to be doable.
      5. Are the data and the methods presented in such a way that they can be reproduced?
        • a. Not all are described in a way that could be easily reproduced (see specific comments below).
      6. Are the experiments adequately replicated and statistical analysis adequate?
        • a. The foundation of this paper is based on qualitative analysis of confocal fluorescence microscopy images, but the chosen images are often not of high quality so performing statistical analysis in these cases is misleading. Also, each imaging-based experiment was performed three times, but with only 20 cells for each replicate. Does this represent sufficient statistical power?

      Specific major comments by section

      Introduction - No additional major comments.

      Results - Title of the subsection: "hypomorphic PERK variants inhibit ER..." is inappropriate since authors only investigated a single hypomorphic variant (PSP). KO mutant is a null not hypomorphic mutant.

      Discussion - Can the authors elaborate on the possible biological relevance for the inhibition of OPA1 cleavage via Tg treatment? - PRELID is a known short-lived protein; can the authors elaborate on possible additional impact due to 3-6 hr Tg treatment which is sufficient to induce expression of ATF4 target genes (Figure S2G). - Thapsigargin induced ER stress does not only activate PERK arm of the ISR, correct? Could the authors comment on this?

      Methods - Addition of drugs and duration (3-6 hrs) likely very toxic to cells; how does this treatment affect viability? Unhealthy cells will have unhealthy mitochondria so it's hard to be confident that subtle morphological differences are specific. Why do authors use 3 hrs Tg-treatment after initially using 6 hrs in Figure 1? Would be helpful to assay toxicity and mitochondrial morphology of thapsigargin and other drugs in WT vs. Perk KO MEFs over time. Previously, an increase in fragmentation was observed at 0.5 hours but this subsided by 6 hours in WT (Lebeau J, et al. 2018) but is this the same for Perk KO MEFs? Figures/supplementary figures - General: - In several images there is substantial background GFP signal resulting in images that are fuzzy on the high quality PDF (printout is unintelligible). - Example: Figure 2, Mock+veh. - Example: Figure S2I, Mock+veh, +PA-PLA Tg. - Example: Figure 3C mock+veh. - Mitochondrial morphology doesn't appear uniform even within the same cell so how is this accounted for in scoring of mitochondrial morphology? Also, how are authors scoring mitochondrial morphology? Due to the inconsistencies in the chosen images, we feel this manuscript would benefit from addition of a supplementary figure showing examples for each cell model expressing mtGFP (i.e. HeLa and MEFs) depicting the fragmented, tubular and elongated mitochondria. This should be able to be constructed from images already collected for these analyses that weren't already used in the paper. - Images from prior paper (Lebeau J, et al. 2018) are of much higher quality and is much easier to discern mitochondrial phenotype. - How much protein was loaded per lane and what was the percentage of polyacrylamide gel? Please clarify details in methodology. - Figure 1: - See general comments. - Figure 1A is virtually identical to Figure 2A (with exception of "MEF A/A") from previous publication: Lebeau J, Saunders JM, Moraes VWR, Madhavan A, Madrazo N, Anthony MC, Wiseman RL. The PERK Arm of the Unfolded Protein Response Regulates Mitochondrial Morphology during Acute Endoplasmic Reticulum Stress. Cell Rep. 2018 Mar 13;22(11):2827-2836. doi: 10.1016/j.celrep.2018.02.055. PMID: 29539413; PMCID: PMC5870888. - Figure 1B: the complemented Perk KO + vehicle should be similar to WT vehicle, but those images look quite different, even so, the respective bars are equal. - Vehicle treated Perk-/- cells have fragmented morphology which is different from Figure 2F in above publication by same group. Can the authors explain this discrepancy? - Figure S1: - No additional major comments. - Figure 2: - See general comments. - If the authors' hypothesis is correct, overexpression of PRELID1 should have same effect as overexpression of Lipin. ● Figure S2: - Images in Figure S2I are not representative of corresponding bars in Figure S2J (specifically vehicle treated panels). The "+PA-PLA1+Tg" panel instead appears fragmented (in comparison with other images). - Do authors have clearer images to substitute for CHX-treated panels? ● Figure 3: - What is the selective marker used for HeLa cells expressing mitoPLDGFP since the HeLa parental cell background already expressed a mitochondrial targeted GFP, we assume it was puromycin but this was not clear in the Figure legend or methods? If so, it would be helpful to clarify this. If not, how can the authors observe a difference in morphology if the selectable marker is the same? Indeed, mitoPLDGFP is expressed, detectable by immunoblot, but this is on a cell population level so no way of knowing whether the specific cells scored expressed mitoPLDGFP unless another selectable marker was used (i.e. should have used CFP, RFP, etc.). - The authors state "Note the expression of mitoPLDGFP did not impair our ability to accurately monitor mitochondrial morphology in these cells." in Figure 3 legend and again basically the same in S3: "Note that the expression of the mitoPLDGFP did not impair our ability to monitor mitochondrial morphology in these cells." Could the authors explain their reasoning here? - Figure S3: - Same as in Figure 3; "mock+Veh" appears more fragmented than tubular so is there a more representative image that the authors can show? - Figure 4: - No major comments. - Figure S4: - Figure S4C: the authors show that Tg treatment on MEF mtGFP cells for distinct hours to determine PRELID levels. However, in the Results section states that this treatment was with CHX, could the authors please check this and correct? - Figure 5: - 5C: PLKO NS shRNA +Tg appears more fragmented than tubular; do the authors have a more representative image? - Figure S5: - No major comments. - Figure 6: - A schematic representation should be a graphic summary of all findings reported in the text with no text except where absolutely essential. A good model should be easily understood without reading any description since all concepts were supported in the main text and by experimentation. - The model also contains some inaccuracies. The suggestion is that the authors re-do the model and clarify some aspects such as: - The model suggests that ISRIB inhibits PRELID1 directly but there is no evidence for this whereas PRELID is directly regulated by YME1L (also typo here in figure: "Yme1" no "l"). - This model incorrectly uses inhibition symbols; for example, mutation of Perk does not inhibit its activity as GSK does. The KO does not have Perk so cannot perform its function. These are not the same. Similarly, the lipases (Lipin and PA-PLA1) should be depicted instead as altering flux of PA away from OMM not as inhibition. - The authors should connect PA accumulation in the OMM graphically to mitochondrial elongation [instead of through text]. If the authors consider the numbered labels convenient, please use just the number and place the description in the figure legend instead.

      Minor comments:

      1. Specific experimental issues that are easily addressable.
        • a. Yes, please see specific examples below.
      2. Are prior studies referenced appropriately?
        • a. References appeared adequate except in the Materials and Methods section (see specific examples below).
      3. Are the text and figures clear and accurate?
        • a. No, the text needs considerable editing to make the language clearer and formal whereas the figures are not always presented in a manner that is easily absorbed by the reader. Representative microscopy images chosen do not always match the corresponding graphical summary and are not clear even on PDF version compared to (Lebeau J, et al. 2018 - full citation above).
      4. Do you have suggestions that would help the authors improve the presentation of their data and conclusions?
        • a. Yes, please see specific examples below.

      Specific minor comments by section

      Introduction - This section contains minor grammatical errors and awkward writing which should be rephrased to be more concise. For example: - Incorrect use of commas (ex: absence of commas on page 3, bottom of paragraph 3).

      Results - Overall, this section contains many grammatical errors and awkward language but these are unevenly distributed as some subsections are well written and thoroughly edited whereas others need closer inspection. For example: - No period at end of first subsection title; this should be consistent throughout. - Text not consistently written in past tense/passive voice. - Post-translational should be hyphenated (page 5, 2x on bottom of page). - The use of dashes to conjoin thoughts is too casual and sentences should be restructured with the aid of parentheses or semicolons only when necessary (ex: page 6, paragraph 2 through page 7). - Homogenize the use of hyphens in all sentences such as: ER stress-induced, ER stress-dependent.

      Discussion

      • Minor grammatical errors and awkward wording throughout; description of ideas should be more concisely written. For example:
        • Page 13, paragraph 1: "Thus, an improved understanding of how different PERK-dependent alterations to mitochondrial morphology and function integrate will provide additional insight to the critical importance of this pathway in regulating mitochondria during conditions of ER stress."
        • Page 13, paragraph 2: "Further investigations will be required to determine the specific impact of altered PERK signaling on mitochondria morphology and function in the context of these diseases to reveal both the pathologic and potentially therapeutic implications of PERK activity on the mitochondrial dysfunction observed in the pathogenesis of these disorders."
      • Awkward/oxymoronic word choices. For example:
        • Page 11, paragraph 2: "...GSK2606414 reduces Tg-dependent increases of PA..." could be written as "... blocks/limits Tg-dependent increase of PA..." instead.
      • What is evidence that ionomycin is completely independent of DRP1?

      Methods

      • Please provide more description or a reference for the method used for CRISPR/Cas9 gene editing (page 15, paragraph 1).
      • Since different versions of chemicals are often available from the same company (for example in solution vs. powder, as a salt, different purities, etc.) it would be helpful for the authors to also include the catalog number for the purchased drugs and analytical standards (page 16, paragraph 1).
      • The authors did an excellent job of blinding these images and utilizing several researchers to score each. However, we feel that 20 cells per biological replicate (~60 total per condition) is insufficient when mitochondrial morphology in chosen representative images is unclear. We think it is reasonable to request the authors to score additional images they collected as part of this investigation.
      • The below two sentences contain some redundancies and should be combined/rephrased (page 16, paragraph 2).
        • "Three different researchers scored each set of images and these scores were averaged for each individual experiment. All quantifications shown were performed for at least 3 independent experiments, where averages in morphology quantified from each individual experiment were then combined."
      • Incorrect units, for example: "500g" should be "500 x g" on page 16, paragraph 3 and "g" should be italicized. Same for "200g" on page 17, paragraph 1.
      • Inconsistent abbreviation of chemicals, for example:
        • Chloroform and hydrochloric acid but not methanol in methods on page 17, paragraph 1. Also, the "l" in "HCL" should be lowercase.
      • "Solvents" (2x) on page 17, paragraph 2 should be singular not plural.
      • What does RT stand for on page 17, paragraph 2?
      • Tris buffered saline is abbreviated incorrectly as "TB" then correctly later in the same paragraph as "TBS" on page 18, paragraph 3.
      • Paragraph 4 on page 18 should be indented to be consistent with formatting of previous methods sections.
      • To remove any ambiguity, catalog numbers should be included for antibodies (also consider including the lot number as there can be lot to lot variability).
      • What percentage of tween v/v was supplemented in TBS buffer? Different concentrations of tween can impact antibody binding and would beneficial to include for reproducibility.
      • Please indicate the incubation time and conditions for the secondary antibodies.
      • The abbreviation for phosphate buffered saline is "PBS" not "PBD" (page 19, paragraph 1).
      • Could the authors state clearly the reference transcript used for RT-qPCR (assumed is RIBOP)?
      • Sometimes GIBCO is capitalized, sometimes not (Gibco), which should also be consistent.
      • Who is the supplier for CCCP and what is the catalog number? Similarly, what is the catalog number for TMRE (both on page 19, paragraph 3)?
      • Student's t-test is capitalized and possessive (similar to Tukey's) on page 19, paragraph 4.

      Figures/supplementary figures

      • General:
        • With respect to the lines overlaying histograms scoring mitochondrial morphology for designating statistical significance [with color-coded asterisks]:
          • It is assumed that the bars of the histogram being compared are those at the ends of each line but these aren't aligned perfectly. Please tidy up the figure by shifting these and consider capping lines to make more clear.
          • It appears that the authors provide these lines at all instances of statistically significant differences whether the comparison is important to their conclusions or not; including only the necessary comparisons will reduce the noise of these figures and make them easier to absorb and interpret. For example:
          • Figure 1C: why is comparison being made only for KO vs. complemented (+veh) - difference between KO and WT not statistically significant? Also, wouldn't the difference between WT and KO +Tg percent fragmented be statistically significant? The comparisons being made appear arbitrary or if not, was not clearly stated (same criticism for 2D, 3B, 3D, etc.).
        • The authors appear to use "transfection" and "transduction" interchangeably such that it is unclear whether expression of transgenes or shRNA is stably vs. transiently expressed. It would help if the authors could clarify their language here as well.
      • Figure 1:
        • Figure 1A - PERK is membrane bound not soluble; should this not be represented in the model? Model colors are not easily distinguishable from each other on printout and should be upgraded.
        • Figure 1C - phenotypic scoring is not easy to interpret; perhaps authors could rearrange the figure such that each treatment is adjacent since that is the more interesting comparison? All cells in figure 1 are MEFs so delete "MEFs" below Perk+/+ and Perk -/-.
      • Figure S1:
        • How much protein was loaded per lane and what percentage of polyacrylamide gel was used?
      • Figure 2:
        • See general comments.
        • Figure 2A - extra letter/typo in "Fold Change."
        • Why do authors switch to HeLa cells after measuring PA content in MEFs?
      • Figure S2:
        • Authors are now including ns for "not significant" and the p value where before they were not before. The intent for including the p-value in S2B appears to be because it suggests a trend towards statistical significance (actually a bit surprised it is not based on SEM error bars; authors should recheck their calculations) which is inappropriate. Either provide all the p-values, possibly as a separate table or none at all.
        • Now including double headed error bars for S2D-E which is inconsistent with rest of manuscript.
        • What is standard error for vehicle treated cells in 3B, 3D, and 3E? Given the above mistake it's reasonable to suspect that the error bars were omitted by accident.
      • Figure 3:
        • Title should have hyphen for "stress-induced" and ionomycin shouldn't be capitalized.
        • Now using double headed error bars for 3B which is inconsistent with majority of other figures.
      • Figure S3:
        • Title should have hyphen for "stress-induced" and ionomycin shouldn't be capitalized.
      • Figure 4:
        • What is the purpose of including 4A? This depicts a concept which is not particularly difficult to grasp, was not experimentally shown in this manuscript, and is somewhat redundant with Figure 6. We recommend removing from Figure 4 and combining with Figure 6.
        • Since all cells used in Figure 4 were MEFs, the authors can remove "MEFs" from figure and just include genotype.
        • Figure 4C: typo in Yme1l - has two 1's.
      • Figure S4:
        • See general comments.
      • Figure 5:
        • Figure 5C: What does PLKO abbreviation stand for in the control line? pLKO.1 vector (see methods but not explained further).
      • Figure S5:
        • Figure S5A-B: KD clearly worked but how efficient is unclear (quantitatively, i.e. 50, 90%, etc.?). The authors could perform serial dilutions of protein (i.e. 5, 10, 20 ug of the same samples for SDS-PAGE/immunoblot) or RT-qPCR. If knockdown is incomplete, this could explain the discrepancy in Figure 5 where depletion of Prelid should result in elongation [via OMM depletion of PA].
      • Figure 6:
        • This is a more appropriate location for panel 4A.

      Significance

      1. Describe the nature and significance of the advance (e.g. conceptual, technical, clinical) for the field.
        • a. Perturbances in PERK signaling evoke an alteration in mitochondrial morphology and have been extensively reported on, due to their clinical implications on neurodegenerative disorders such as Alzheimer's disease. The present work provides insight into the molecular basis for Stress Induced Mitochondrial Hyperfusion (SIMH) which can be triggered by ER stress. The authors find that this process occurs downstream of PERK and proceeds through accumulation of PA in the OMM by stabilization of Prelid, a mitochondrial resident protein that transports PA from the OMM to IMM for cardiolipin synthesis. The evidence of this work represents a substantial addition to the field of mitochondrial dynamics/SIMH and the Unfolded Protein Response.
      2. Place the work in the context of the existing literature (provide references, where appropriate).
        • a. The novelty of this work is in the inclusion of PRELID1 downstream of PERK signaling pathway for transmission of ER stress to the mitochondria, a process that involves phosphatidic acid (PA). Some studies have addressed how phosphatidic acid is a modulator and a signal in mitochondrial physiology. The role of the lipids in mitochondrial dynamics represent an important and emerging field that needs to be explored in order to understand how metabolites control mitochondrial fusion/fission.

      References

      Yoshihiro Adachi, Kie Itoh, Tatsuya Yamada, Kara L. Cerveny, Takamichi L. Suzuki, Patrick Macdonald, Michael A. Frohman, Rajesh Ramachandran, Miho Iijima, Hiromi Sesaki. Coincident Phosphatidic Acid Interaction Restrains Drp1 in Mitochondrial Division. Molecular Cell. Volume 63, Issue 6. 2016. Pages 1034-1043. https://doi.org/10.1016/j.molcel.2016.08.013

      Huang H, Gao Q, Peng X, Choi SY, Sarma K, Ren H, Morris AJ, Frohman MA. piRNA-associated germline nuage formation and spermatogenesis require MitoPLD profusogenic mitochondrial-surface lipid signaling. Dev Cell. 2011 Mar 15;20(3):376-87. https://doi.org/10.1016/j.devcel.2011.01.004 3. State what audience might be interested in and influenced by the reported findings. - a. Audiences of the fields such as Mitochondrial dynamics, UPR, lipid metabolism, neurodegenerative diseases, ER-stress response, Integrated Stress Response. 4. Define your field of expertise with a few keywords to help the authors contextualize your point of view. Indicate if there are any parts of the paper that you do not have sufficient expertise to evaluate. - a. Mitochondrial morphology, mtDNA inheritance, mitochondrial metabolism, fluorescence/indirect immunofluorescence microscopy

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      We thank all the reviewers for having raised constructive criticism to fortify the main message and improve the clarity of the manuscript. We appreciate that all reviewers found that our work addresses an important topic and is of interest to a broad audience. We believe that we have thoroughly addressed the concerns of the reviewers, especially with regard to 1) performing another SMC3 chromatin immunoprecipitation and sequencing (ChIP-seq) replicate and control, 2) including a later time point for the transcriptional data, and 3) performing additional characterization of the growth phenotype of the SMC3 conditional knockdown.

      Reviewer #1

      (Evidence, reproducibility and clarity (Required)):*

      Summary The present work by Rosa et al., provides convincing data about the presence and functional relevance of the cohesin complex in Plasmodium falciparum blood stages. In accordance with other organisms, the composition of the cohesin complex containing SMC1, SMC3 RAD21 and putatively STAG could be confirmed via pulldown and mass spectrometry. Basic characterization of endogenous tagged SMC3 demonstrated the expression and nuclear localization during IDC, as well as the relatively stable accumulation at centromeric regions, consistent with the known cohesin function in chromatid separation. Furthermore, dynamic and stage-dependent binding to intergenic regions observed in ChIPseq and major transcriptome aberrations upon knockdown of SMC3 (__Response: __As we regularly perform ChIP-seq experiments in the lab, we have generated multiple negative control datasets. In our opinion, the most stringent negative control for an HA-tagged protein is performing ChIP with an HA antibody in a WT strain. We have recently published an in-depth analysis of this (and other) negative ChIP-seq controls (Baumgarten & Bryant, 2022, https://doi.org/10.12688/openreseurope.14836.2). We show in this publication that non-specific ChIP-seq experiments (such as negative controls) result in an over-representation of HP1-heterochromatinized regions due to differences in sonication efficiency of heterochromatin and technical challenges with mapping regions with high levels of homology. In the anti-HA in WT ChIP negative control (performed at 12hpi), we do not see any enrichment at centromeric regions, but rather at heterochromatinized regions where clonally variant gene families are located. We performed peak calling analysis and found no significant overlap between the negative control ChIP-seq and the SMC3-3HA ChIP-seq data at 12hpi.

      In addition, we have now performed a second biological replicate of the SMC3-3HA ChIP-seq with a different clone at all time points. We compared this data to that from the original clone and found significant overlap of the peaks called (see what is now Table 4 and Supp. Fig. 3A). We generated a stringent list of peaks that were shared between both clones at each time point and repeated all downstream analyses (see what are now Tables 5-8). We found that our conclusions were largely unchanged. Text describing these experiments and analyses have been added throughout the results section.

      • Proposed mechanism of repressive effect of SMC3 early in IDC on genes, that get de-repressed in late stages: To claim this mode of function, it would be necessary to include a KD on late stage parasites. If there is an early repressive role of SMC3, upregulated genes should not be affected by late SMC3-KD. __Response: __To be clear, we are most interested in the transcriptional role of SMC3 during interphase, where results are not confounded by its potential role in mitosis. However, we did collect a 36hpi time point in the SMC3-3HA-glmS and WT strain, with and without glucosamine. We have added this last time point and the WT data from the other two time points to the manuscript (see Tables 11-13). Unfortunately, and for reasons unknown, the WT replicates treated with glucosamine showed a significantly advanced “transcriptional age” compared to the other replicates at 36hpi (see what is now Supp. Fig. 5B). Thus, we did not feel comfortable performing the RNA-seq analysis as we did with the other two time points (i.e. subtracting up- and down-regulated genes from the WT control from the SMC3-3HA-glmS data sets). We have added this information to the results section (Lines 256 and 261). As the WT parasites treated with glucosamine were approximately 8 hours in advance of the untreated WT parasites for the 36hpi time point, any up- and down-regulated genes might have been due to differences in the cell cycle rather than due to glucosamine treatment. The glmS system of inducible knockdown is widely used in P. falciparum; however, to our knowledge, no lab has investigated whether glucosamine treatment affects transcription in wildtype cells over the course of the IDC. Thus, for accurate phenotypic characterization of any protein with this system with regard to transcriptomics, we thought it was important to provide an RNA-seq dataset to define the cohort of genes affected by glucosamine treatment in WT parasites. We hope that our study will demonstrate the importance of using stringent controls when using inducible knockdown systems.

      To address the question of whether genes that are upregulated upon depletion of SMC3 at early stages are affected at the 36hpi time point, we performed differential expression analysis of the SMC3-3HA-glmS parasites with and without glucosamine at 36hpi (we have added this data in Table 11). Again, significantly up- and down-regulated genes were not filtered using the WT dataset. With this analysis, we see only three genes from the list of invasion-related genes (Hu et al., 2010) that are up-regulated, but none of them have a significant q-value (Tab 5 of Table 18). Thus, depletion of SMC3 in late stage parasites does not lead to up-regulation of the same genes that are upregulated at 12 and 24hpi. We have added this information to the text (Line 273).

      Furthermore, the hypothesized repressive effect of SMC3 does not explain the numerous genes downregulated in KD.

      __Response: __As we state on line 350, we do not observe enrichment of SMC3 at downregulated genes, suggesting an indirect or secondary effect of SMC3 KD on these genes.

      • Due to the fact, that the KD was induced at the exact same timepoint and analysed 12h and 24h after induction it is possible that identified, differentially expressed genes at 24h are not directly regulated by SMC3, but rather due to a general deregulation of gene expression. Did the authors attempt to analyse gene expression upon induction at ring, trophozoite and schizont stage? Response: __As we state on line 230, in order to achieve SMC3 KD at the protein level, we had to treat the parasite with glucosamine for two cell cycles (approximately 96 hours). After two cell cycles of glucosamine treatment, the parasites were tightly synchronized and sampled 12 and 24 hours later. Thus, SMC3 KD takes place over the course of multiple days, but parasites are collected after stringent synchronization. Giemsa staining and bioinformatic analysis (line 250) of the RNA-seq data from parasites (with or without glucosamine) harvested at 12 and 24 hpi show that these parasites were synchronous and that there were no gross differences in genome-wide transcript levels. It is certainly possible that differentially expressed genes at 12 or 24hpi are not directly regulated by SMC3, and this is precisely why we perform ChIP-seq of SMC3: to provide evidence of direct involvement via binding, as stated on line 281. __

      • *Based on rapid parasite growth, the authors hypothesize a higher invasion rate due to upregulation of invasion genes. This hypothesis is not supported by quantitative invasion assays or quantification of invasion factors on the protein level. An alternative explanation could be a shorter cell cycle (__Response: __We have repeated the growth curve analysis with additional clones and no longer observe a growth phenotype in the SMC3 knockdown condition. We have added images of Giemsa-stained parasites from the knockdown time course we performed to what is now Supp. Fig. 5A. We see no obvious differences in cell morphology caused by glucosamine treatment in the WT or SMC3-3HA-glmS parasites.

      • Correlation of SMC3-occupancy/ATAC/expression profile of the exemplary genes rap2 and gap45 (Figure 4C,D,E): is this representative for all upregulated genes? __Response: __SMC3 occupancy shown at rap2 and gap45 is representative for all upregulated genes (see Fig. 4A and B). It is difficult to provide a general representation of the average expression profiles of all up-regulated genes over the course of the IDC, but Fig. 3E shows that the vast majority of up-regulated genes normally reach their peak expression in late stage parasites. With regard to ATAC-seq profiles, we have performed a metagene analysis of chromatin accessibility (data taken from (Toenhake et al., 2018)) at all up-regulated genes at time points that closely correspond to the time points used in our study: 15, 25, and 35, and 40 hpi (new Fig. 4C). This metagene analysis confirms what we observe at individual genes: increasing chromatin accessibility over the course of the IDC at these genes’ promoters. While metagene analyses offer important information, we always try to show the raw data (as in new Figs. 4D-F) from individual examples as proof of principle.

      • Given that SMC3 appears to be not essential for parasite growth, the authors could generate a null mutant for SMC3, which might allow for easier analysis of differences in gene regulation, cell cycle progression and/or invasion efficiency. __Response: __As we explain on line 327, very little cohesin is required for normal growth and/or mitosis in our study and two studies in S. cerevisiae and D. melanogaster. However, SMC3 is essential in S. cerevisiae. We were unable to knock out SMC3, and a recent mutagenesis study suggests that SMC3 and SMC1 are essential to the parasite during the intraerythrocytic developmental cycle (Zhang et al. Science, 2018). This is why we chose an inducible knockdown system.

      *Reviewer #1 (Significance (Required)):

      Own opinion The authors provide a basic characterization of the cohesin component SMC3 using NGS methods to investigate chromatin binding sites and its potential influence on gene expression. *

      __Response: __We respectfully disagree that our study offers only a basic characterization of SMC3. We combine IFA, mass spectrometry, and both ChIP-seq and RNA-seq of SMC3 across the entire intraerythrocytic developmental cycle to provide the most detailed and comprehensive functional analysis of SMC3 in P. falciparum to date.

      The localisation of SMC3 at centromers as described previously (Batugedara 2020) was confirmed. However, the dynamic binding to other regions in the genome, potentially mediated by other proteins, could not be resolved unequivocal with only one replicate of ChIPseq per time point.

      __Response: __With regard to the replicates for ChIP-seq, please see our response to this same point above.

      Similarly, the RNAseq data demonstrate the relevance of SMC3 for gene expression, but no clear picture of a regulatory mechanism can be drawn at his point. Lacking information about the mode of binding as well as the setup of transcriptome analysis (only two time-shifted sampling points after simultaneous glmS treatment for 96h resulting in incomplete knockdown) cannot definitely elucidate, if SMC3/cohesin is a chromatin factor that affects transcription of genes in general or a specific repressor of stage-specific genes. __Response: __We agree that we have not established a regulatory mechanism for how SMC3 achieves binding specificity. However, the combination of inducible knockdown (as SMC3 is essential to the cell cycle) and differential expression analysis with ChIP-seq from the same time points across the intraerythrocytic developmental cycle is the most stringent and standard approach in the field of epigenetics for determining the direct role of a chromatin-associated protein in gene expression. We provide a detailed explanation of how the transcriptome analysis was set up in the Results (lines 229-234) and Materials and Methods (lines 715-719) section. With regard to our sampling points being “time-shifted,” we provide bioinformatic analysis (line 246-251, what is now Supp. Fig. 5B) of the RNA-seq data from untreated and glucosamine-treated parasites showing highly similar “ages” with regard to progression through the intraerythrocytic developmental cycle. While we of course also monitor progression through the cell cycle with Giemsa staining (Supp. Fig. 5A), this bioinformatic analysis is the most stringent method of determining specific times in the cell cycle.

      *The work will be interesting to a general audience, interested in gene regulation and chromatin remodelling

      The reviewers are experts in Plasmodium cell biology and epigenetic regulation.*

      Reviewer #2

      (Evidence, reproducibility and clarity (Required)):

      Rosa et al, Review Commons The manuscript by Rosa et al. addresses the function of the cohesion subunit Smc3 in gene regulation during the asexual life cycle of P. falciparum. Cohesin is a conserved protein complex involved in sister chromatin cohesion during mitosis and meiosis in eukaryotic cells. Cohesin also modulates transcription and DNA repair by mediating long range DNA interactions and regulating higher order chromatin structure in mammals and yeast. In P. falciparum, the Cohesin complex remains largely uncharacterized. In this manuscript, the authors present mass spectrometry data from co-IPs showing that Smc3 interacts with Smc1 and a putative Rad21 orthologue (Pf3D7_1440100, consistent with published data from Batugedara et al and Hilliers et al), as well as a putative STAG domain protein orthologue (PF3D7_1456500). Smc3 protein appears to be most abundant in schizonts, but ChIPseq indicates predominant enrichment of Smc3 in centromers in ring and trophozoite stages. In addition, Smc3 dynamically binds with low abundance to other loci across the genome; however, the enrichment is rather marginal and only a single replicate was conducted for each time point making the data interpretation difficult. Conditional knock-down using a GlmS ribozyme approach indicates that parasites with reduced levels of Smc3 have a mild growth advantage, which is only evident after five asexual replication cycles and which the authors attribute to the transcriptional upregulation of invasion-linked genes following Smc3 KD. Indeed, Smc3 seems to be more enriched upstream of genes that are upregulated after Smc3 KD in rings than in downregulated genes, indicating that Smc3/cohesin may have a function in supressing transcription of these schizont specific genes until they are needed. The manuscript is concise and very well written, however it suffers from the lack of experimental replicates for ChIP experiments and a better characterization of the phenotype of conditional KD parasites. * Major comments • In the mass spectrometry analysis, many seemingly irrelevant proteins are identified at similar abundance to the putative rad21 and ssc3 orthologues, and therefore the association with the cohesion complex seems to be based mostly on analogy to other species rather than statistical significance. Hence, it would be really nice to see a validation of the novel STAG domain and Rad21 proteins, for example by Co-IP using double transgenic parasites.*

      __Response: __While our IP-MS data did not yield high numbers of peptides, the top most enriched proteins were SMC3 and SMC1. As we state on line 157, two previous studies have already shown a robust interaction between SMC1, SMC3, and RAD21 in Plasmodium, supporting the existence of a conserved cohesin complex. While the identification of the STAG domain-containing protein is interesting, the purpose of our IP-MS was less about redefining the cohesin complex in P. falciparum and more about confirming that the epitope-tagged SMC3 we generated was incorporated correctly into the cohesin complex and was specifically immunoprecipitated by the antibody we later use for western blot, immunofluorescence, and ChIP-seq analyses. However, to validate the results of ours and others’ mass spectrometry results, we generated two new parasite strains – SMC1-3HA-dd and STAG-3HA-dd – and an antibody against SMC3 (see what is now Supp. Fig. 1). We performed co-IP and western blot analysis with these strains and show an interaction between SMC1 and SMC3 and STAG and SMC3 (see what is now Supp. Fig. 2). This information has been added to the manuscript on lines 162-167.

      • *The ChIPseq analysis presented here is based on single replicates for each of the three time points. The significance cutoffs for the peaks are rather high (q __Response: __In our experience, a significance cutoff of FDR As we regularly perform ChIP-seq experiments in the lab, we have generated multiple negative control datasets. In our opinion, the most stringent negative control for an HA-tagged protein is performing ChIP with an HA antibody in a WT strain. We have recently published an in-depth analysis of this (and other) negative ChIP-seq controls (Baumgarten & Bryant, 2022, https://doi.org/10.12688/openreseurope.14836.2). We show in this publication that non-specific ChIP-seq experiments (such as negative controls) result in an over-representation of HP1-heterochromatinized regions due to differences in sonication efficiency of heterochromatin and technical challenges with mapping regions with high levels of homology. In the anti-HA in WT ChIP negative control (performed at 12hpi), we do not see any enrichment at centromeric regions, but rather at heterochromatinized regions where clonally variant gene families are located. We performed peak calling analysis and found no significant overlap between the negative control ChIP-seq and the SMC3-3HA ChIP-seq data at 12hpi.

      In addition, we have now performed a second biological replicate of the SMC3-3HA ChIP-seq with a different clone at all time points. We compared this data to that from the original clone and found significant overlap of the peaks called (see what is now Table 4 and Supp. Fig. 3A). We generated a stringent list of peaks that were shared between both clones at each time point and repeated all downstream analyses (see what are now Tables 5-8). We found that our conclusions were largely unchanged. Text describing these experiments and analyses have been added throughout the results section.

      The SMC3 ChIP from Batugedara et al., 2020 was performed with an in-house generated antibody (not a commercially available, widely validated antibody as we use) at a single time point in the IDC: trophozoites. Batugedara et al. performed one replicate and did not have an input sample for normalization. Rather, it seems that they incubated beads, which were not bound by antibody or IgG, with their chromatin and used any sequenced reads from this beads sample to subtract from their SMC3 ChIP signal as means of normalization. According to ENCODE ChIP-seq standards, this is not a standard nor stringent way of performing ChIP-seq and the subsequent analysis. Because they did not generate a dataset for their ChIP input, it is not possible to call peaks as we do in our study and compare those peaks with ours.

      • The authors argue that during schizogony, cohesin may no longer be required at centromers, explaining the low ChIPsignal at this stage (Line 301). However, during schizogony parasites undergo repeated rounds of DNA replication (S-phase) and mitosis (M-phase) to generate multinucleated parasites; and concentrated spots of Smc3 are observed in each nucleus in schizonts by IFA. In turn, the strong presence of Smc3 at centromers in ring stage parasites is surprising, particularly since the Western Blot in Figure 1D shows most expression of Smc3 in schizonts and least in rings; and Smc3 is undetectable in rings by IFA. Yet, the ChIP signal shows very strong enrichment at centromers, long before S phase produces sister chromatids. What could be the reason for this discrepancy? Again, ChIP replicates and controls would be helpful in distinguishing technical problems with the ChIP from biologically relevant differences. __Response: __We discuss in lines 337-342 not that cohesin is no longer required at centromeres during schizogony, but that its removal from centromeres may be required specifically for separation of sister chromatids, as is seen in other eukaryotes. We also discuss that the unique asynchronous mitosis in Plasmodium may lead to a mixed population of parasites at the time point sampled where there may be some centromeres with SMC3 present and some where it is absent to promote sister chromatid separation. Even though SMC3 may be evicted from centromeres to promote sister chromatid separation, it is likely re-loaded onto centromeres once this process is complete. This is most likely why we see foci of SMC3 in each nucleus of mature schizonts by IFA. With regard to the discrepancy between SMC3 levels in rings seen in total nuclear extracts (by western blot) and at centromeres (by ChIP-seq): the total level of a protein in the nucleus does not necessarily dictate the genome-wide binding pattern or the level of enrichment of that protein at specific loci in the genome. Moreover, if one molecule of SMC3 binds to each centromere, 14 molecules would be needed in a ring stage parasite while over 500 would be needed in a schizont (assuming that there are ~36 merozoites present). SMC3 binds to centromeres in interphase cells in other eukaryotes as well, and we speculate that this binding may play a role in the nuclear organization of centromeres, as we discuss starting on line 333.

      • It is surprising that a conserved protein like Smc3 shows such a subtle phenotype, given that it is predicted to be essential and its orthologues have a function in mitosis. Generally, only limited data are presented to characterize the Smc3 KD parasites, and more detail should be included. For example validation of the parasite line using a PCR screen for integration and absence of wt, parasite morphology after KD, and/or analysis of the KD parasites for cell cycle status. __Response: __First, we have repeated our growth curve analysis several times and with more clones and have concluded that there is not a significant growth phenotype in SMC3 KD parasites (see what is now Supp. Fig. 4B). As we discuss on line 342, very little intact cohesin complex seems to be required for normal growth and mitosis in S. cerevisiae and D. melanogaster, which is probably why we do not see an obvious growth or morphological phenotype. Because we could not generate SMC3 knockout parasites, there may be just enough SMC3 left to perform its vital function in our KD strain. We have added PCR data to demonstrate integration of the 3HA tag- and glmS ribozyme-encoding sequence in the clonal strains we are using for all experiments (see what is now Supp. Fig. 1A). Sanger sequencing was performed on these PCR products to confirm correct sequences. We also added images of Giemsa-stained parasites in untreated and glucosamine-treated parasites at all time points to demonstrate a lack of an obvious morphological phenotype in SMC3 KD parasites (see what is now Supp. Fig. 5A).

      • Synchronization was performed at the beginning of the growth time course, which would be expected to result in a stepwise increase in parasitemia every 48 hours; however, the parasitemia according to Fig. 4F rises steadily, which would indicate that the parasites are actually not very synchronous. __Response: __We did indeed tightly synchronize these parasites and hope that the stepwise increase in parasitemia is seen better in our new growth curve analysis (see what is now Supp. Fig. 4B).

      • The question of whether Smc3 causes a shorter parasite life cycle (quicker progression) or more invasion is important and could be experimentally addressed by purifying synchronous schizont stage parasites and determining their invasion rates as well as morphological examination of the Giemsa smears over the time course. __Response: __We have repeated our growth curve analysis several times and with more clones and have concluded that there is not a significant growth phenotype in SMC3 KD parasites (see what is now Supp. Fig. 4B).

      • Please also compare Smc3 transcriptional levels in transgenic parasites to those in wt parasites to rule out that the genetic modification has lead to artificial upregulation of Smc3 transcription. __Response: __We have added this data to what is now Supp. Fig. 4C, showing that there is no significant difference in SMC3 transcript levels between WT and SMC3-3HA-glmS strains. We have added this information to the text of the manuscript (Line 243). As we also generated an SMC3 antibody, we could demonstrate that there is no appreciable difference in SMC3 protein levels between WT and SMC3-3HA-glmS strains (see what is now Supp. Fig. 1D).

      • According to Figure S2, even more genes were deregulated at the 12 hpi time point in the WT parasites than in Smc3 parasites, and even to a much higher extent. What "transcriptional age" did the WT control parasites have at each time point? __Response: __We have now included the transcriptional age of all strains, replicates, and treatments in what is now Supp. Fig. 5B. At the 12 hpi time point in particular, regardless of glucosamine treatment, the SMC3-3HA-glmS and WT parasites were highly synchronous. The only large discrepancy we see in transcriptional age is between untreated and glucosamine-treated WT parasites at 36 hpi, which is why we did not include this time point in our transcriptional analysis. We were also surprised by the number of genes that were de-regulated with simple glucosamine treatment. The glmS system of inducible knockdown is widely used in P. falciparum; however, to our knowledge, no lab has investigated whether glucosamine treatment affects transcription in wildtype cells over the course of the IDC. Thus, for accurate phenotypic characterization of any protein with this system with regard to transcriptomics, we thought it was important to provide an RNA-seq dataset to define the cohort of genes affected by glucosamine treatment in WT parasites. We hope that our study will demonstrate the importance of using stringent controls when using inducible knockdown systems.

      • A negative correlation with transcription is well established in S. cerevisiae, particularly at inducible genes. How does Smc3 enrichment generally look like for genes that show maximal expression at each of the time point? __Response: __We have performed a metagene analysis of SMC3 enrichment at all genes at each respective time point, which we divided into quartiles of expression based on their FPKM values in the RNA-seq data from the corresponding time point in untreated SMC3-3HA-glmS parasites. This quartile analysis considers all genes, including genes that are not transcribed at all and regardless of whether a gene has a significant SMC3 peak or is differentially expressed upon SMC3 knockdown. At the 12 hpi time point, we do see an inverse correlation between SMC3 enrichment and gene transcription level, but this enrichment is most pronounced across genes bodies. We see the highest SMC3 enrichment at genes in the 4th (lowest) quartile category. For the other two time points, we do not see any obvious pattern of SMC3 enrichment with regard to transcriptional status.

      • Line 590: according to the methods, a 36 hpi KD time point was also harvested. Why are the data not shown/analysed? __Response: __To be clear, we are most interested in the transcriptional role of SMC3 during interphase, where results are not confounded by its potential role in mitosis. However, we did collect a 36hpi time point in the SMC3-3HA-glmS and WT strain, with and without glucosamine. We have added this last time point and the WT data from the other two time points to the manuscript (see Tables 11-13). Unfortunately, and for reasons unknown, the WT replicates treated with glucosamine showed a significantly advanced “transcriptional age” compared to the other replicates at 36hpi (see what is now Supp. Fig. 5B). Thus, we did not feel comfortable performing the RNA-seq analysis as we did with the other two time points (i.e. subtracting up- and down-regulated genes from the WT control from the SMC3-3HA-glmS data sets). We have added this information to the results section (Lines 256 and 261). As the WT parasites treated with glucosamine were approximately 8 hours in advance of the untreated WT parasites for the 36hpi time point, any up- and down-regulated genes might have been due to differences in the cell cycle rather than due to glucosamine treatment. The glmS system of inducible knockdown is widely used in P. falciparum; however, to our knowledge, no lab has investigated whether glucosamine treatment affects transcription in wildtype cells over the course of the IDC. Thus, for accurate phenotypic characterization of any protein with this system with regard to transcriptomics, we thought it was important to provide an RNA-seq dataset to define the cohort of genes affected by glucosamine treatment in WT parasites. We hope that our study will demonstrate the importance of using stringent controls when using inducible knockdown systems.

      Minor Comments • Line 103/104: the hinge domain and ATPase head domain are mentioned, please annotate these in Figure 1A.

      __Response: __We have annotated the hinge and ATPase domains.

      • Figure 1D: the kDa scale is missing from the H3 WB. __Response: __We have added a kDa scale.

      • What is the scale indicated by different colors in Fig. 2A? __Response: __The different colors (blue, coral, and green) only represent the 12, 24, and 36hpi time points, respectively. This color scheme is used throughout the manuscript. If the reviewer is referring to the color gradation within each circos plot, this does not indicate a specific scale. The maximum y-axis value for all circos plots is 24, as indicated in the figure legend.

      • Line 189: it would also be interesting how many peaks are "conserved" between the different time points studied, so not only to compare the gene lists of closest genes but also the intersecting peaks and then the closest genes to the intersecting peaks. __Response: __We have added this information in Table 7 and in the manuscript starting on Line 203. Using the new dataset of consensus peaks between two replicates, there were 88 genes associated with an SMC3 peak across all three time points, most of which were close to a centromeric region.

      • What is the distribution of the peaks over diverse genetic elements, such as gene bodies, introns, convergent/ divergent/ tandem intergenic regions? In yeast, cohesion is particularly enriched in convergent intergenic regions, so it would be interesting to see how this behaves in P. falciparum. __Response: __We would have liked to define how many peaks were in intergenic versus genic regions of the genome, but the dataset of “genes” from PlasmoDB includes UTRs. Thus, we would need a better annotation of the genome to perform this analysis. Regardless, we calculated the average SMC3 peak enrichment (shared between both replicates) in intergenic regions between convergent and divergent genes (see what is now Supp. Fig. 3B and Table 6). As we now state in the manuscript on line 198, we see a slight enrichment in regions between convergent genes at all time points, but the differences were not significant.

      • Line 130 intra-chromosomal interactions (word missing) __Response: __Thank you for pointing this out. We have corrected this.

      • Contrary to Figure 1D, the WB in Figure 3A indicates strong expression of Smc3 in rings. Please comment on this discrepancy. __Response: __While extracts from all time points were run on the same western blot in Fig. 1D and thus developed for the same amount of time, this was not the case for Fig. 3A. In Fig. 3A, the samples were run on different blots and exposed for different times, so while we can compare SMC3-HA levels between – and + glucosamine for each time point, the levels at 12 hpi cannot be quantitatively compared to those at 24 or 36hpi.

      • What time point after glucosamine addition represents the WB in Fig. 3A? __Response: __The “12hpi” parasites were sampled approximately 108 hours post glucosamine addition and the “24hpi” parasites sampled approximately 120 hours post glucosamine addition. Basically, the parasites were treated with glucosamine for 96 hours, synchronized, and then harvested 12 and 24 hours later.

      • Line 233 / Suppl Figure 3: Isn't it a bit concerning that the untreated control parasites at 24 hpi statistically corresponded to 18-19 hpi? And to what timepoint did the wt parasites correspond? __Response: __We are not concerned by this, and we have included the WT parasites in what is now Supp. Fig. 5B for better comparison. In the analysis presented in Supp. Fig. 5B, regardless of glucosamine presence or absence, the differences among replicates and strains at 12 and 24hpi are, in our opinion, minimal, amounting to one or two hours of the 48-hour IDC. In our extensive experience with RNA-seq across the P. falciparum lDC, this synchronization is extremely tight. As we describe on line 430 of the Materials and Methods, there is a ±3 hour window in our synchronization method, meaning that parasites harvested at 24hpi could be anywhere from 21-27hpi. In addition, the dataset that was used for comparison (from Bozdech et al., 2003) was generated in 2003 in a different laboratory using different strains with microarray. While comparing more recent RNA-seq data to this classic study has become well-established practice and is useful for comparing transcriptional age between replicates and strains, it is inevitable that the calculated “hpi” from (Bozdech et al., 2003) will differ somewhat from our experimental “hpi”. We have indeed seen this small discrepancy in predicted transcriptional age in several of our RNA-seq datasets (unrelated to this study) from trophozoites harvested at 24hpi.

      • Line 264: "whether naturally or via knockdown" - the meaning of this sentence is not entirely clear __Response: __We are referring to depletion of SMC3 at promoters, either naturally (i.e. lack of binding at the promoter at 36hpi that is not the result of SMC3 knockdown, as we show in Fig. 4B) or via SMC3 knockdown, which is not natural but artificial.

      • Figure 4 Legend: A, B, C etc. are mixed up. Response: Thank you for pointing this out. We have corrected this.

      • Figure 4D: the differences seem to be marginally significant, even not significant at all (q=0.8) for gap45 at 12hpi. __Response: __If one defines a significance cutoff of q = 0.05 (as is common practice in differential expression analyses), then the differences are significant. For a small minority of invasion genes (such as gap45), we do observe significance at either 12 hpi or 24 hpi, but not both. Thus, we have removed the word “significant” from the descriptions of each dataset in Tab 1 of what is now Table 18. however, we do not believe that this rules out a role for SMC3 at such a gene during interphase. What is now Table 18 offers a longer list of invasion-related genes, most of which are more “significantly” affected than rap2 and gap45.

      • Figure 4F shows FACS data using SYBR green as a DNA stain. The authors could exploit this data to look at the relative DNA content per cell as a measure of parasite stage, since more mature parasites will have more DNA (mean fluorescence intensity). How did the corresponding parasite cultures look in Giemsa smears? Response: We have repeated our growth curve analysis several times and with more clones and have concluded that there is not a significant growth phenotype in SMC3 KD parasites (see what is now Supp. Fig. 4B). We have added images of Giemsa-stained parasites in untreated and glucosamine-treated parasites at all time points to demonstrate a lack of an obvious morphological phenotype in SMC3 KD parasites (see what is now Supp. Fig. 5A).

      • Are RNAseq replicates biological replicates from independent experiments or technical replicates? __Response: __RNA-seq replicates are technical replicates from the same parasite clone.

      • Why does the number of genes analysed for differential gene expression differ between the comparisons? __Response: __If the reviewer is referring to the discrepancy between the total number of genes for different time points [for example, between what is now Table 9 (12hpi) and Table 10 (24hpi)], this is because in the RNA-seq/differential expression analysis, there have to be reads mapping back to a gene in order for that gene to be included in the analysis. Thus, if a gene is not transcribed at a given time point in the treated or untreated samples, it will not be included in the analysis. Gene transcription fluctuates significantly over the course of the IDC, so different time points will have different total numbers of transcribed genes.

      • Line 372: Do you mean the proteins or the genes? AP2-I has a peak at 24 hpi and 36 hpi, and its interacting AP2 factor Pf3D7_0613800 at all time points. __Response: __We are referring to the genes. With the new ChIP-seq analysis including the second replicate, there are no consensus SMC3 peaks associated with ap2-I, bdp1, or Pf3D7_0613800 (see what is now Table 7).

      • Line 480: no aldolase was shown. __Response: __We have removed this sentence.

      • Line 838: include GO analysis in methods __Response: __We have added this.

      Reviewer #2 (Significance (Required)): The paper addresses the function of the cohesin complex in gene regulation of malaria parasites for the first time. Due to the conserved nature of the complex, the data may be interesting for a broad audience of scientists interested in nuclear biology and cell division/ gene regulation.

      Reviewer #3

      (Evidence, reproducibility and clarity (Required)):

      *Summary:

      In the presented manuscript by Rosa et al. the authors investigate the longstanding question of how P. falciparum achieves the tight transcriptional regulation of its genome despite the apparent absence of many canonical sequence specific transcription factor families found in other eukaryotes. To do this the authors investigate the role of the spatial organization of the genome in this context, by performing a functional characterization of the conserved cohesion subunit SMC3 and its putative role in transcriptional regulation in P. falciparum. Using Cas9 mediated genome editing the authors generated a SMC3-3xHA-glmS parasite line, which they subsequently used to show expression of the protein over the asexual replication cycle by western blot and IFA analysis. In addition, using co-IP experiments coupled with mass spectrometry they identified the additional components of the cohesion complex also found in other eukaryotes as interaction partners of SMC3 in the parasite, thereby confirming the presence of the conserved cohesin complex in P. falciparum. By using a combination of ChIP-seq and RNA-seq experiments in SMC3 knockdown parasites the authors furthermore show that a reduction of SMC3 resulted in the up-regulation of a specific set of genes involved in invasion and egress in the early stages of the asexual replication cycle and that this up-regulation in transcription is correlated with a loss of SMC3 enrichment at these genes. From these observations the authors conclude, that SMC3 binds dynamically to a subset of genes and works as a transcriptional repressor, ensuring the timely expression of the bound genes. Overall, the presented data is intriguing, of high quality and very well presented. However, there are some points, which should be addressed to bolster the conclusions drawn by the authors.

      Major points: I was not able to find the deposited datasets in the BioProject database under the given accession number. This should obviously be addressed and would have been nice to be able to have a look at these datasets also for the review process. *__Response: __We apologize for not giving the reviewers access. As the manuscript has been made available as a pre-print (which includes data accession numbers), but has not yet been published, we have not activated access to the data on the database.

      *SMC3-ChIP-seq experiments:

      "168 were bound by SMC3 across all three time points (Fig. 2D). However, most SMC3-bound genes showed a dynamic binding pattern, with a peak present at only one or two time points (Fig. 2B,D)."

      Here it would be interesting to actually have more than one replicate of each of these ChIP-seq time points. This could provide a better idea of how "dynamic" these binding patterns actually are. Furthermore, I was missing a list of these 168 genes, which are constantly bound by SMC3. Anything special about those? What actually happens to this subset of genes in the SMC3 knockdown parasites? Do they show similar transcriptional changes?*

      __Response: __We have now performed a second biological replicate of the SMC3-3HA ChIP-seq with a different clone at all time points. We compared this data to that from the original clone and found significant overlap of the peaks called (see what is now Table 4 and Supp. Fig. 3A). We generated a stringent list of peaks that were shared between both clones at each time point and repeated all downstream analyses (see what are now Tables 5-8). We found that our conclusions were largely unchanged. Text describing these experiments and analyses have been added throughout the results section. Using the new dataset of consensus peaks between two replicates, there were 88 genes associated with an SMC3 peak across all three time points (see what is now Table 7). The genes that are associated with an SMC3 peak at all time points are, in general, those closest to centromeric/pericentromeric regions and show no obvious functional relationship to each other. Out of these 88 genes, four are significantly up- or downregulated at 12 hpi and 26 are significantly up- or downregulated at 24 hpi. The most significantly downregulated of these genes in both datasets is smc3 itself.

      *SMC3-knockdown experiments:

      In Sup. Fig. 1 there is a double band in the HA-western blot in the 2nd cycle -GlcN. sample. This second band is absent in all other HA-western shown. Have the authors any idea where that second band comes from?*

      __Response: __As the reviewer says, we do not see this second band in most of our western blots. It is possible that it is just a small amount of degradation in the lysate.

      In Figure 3A, the WB data shown is slightly contrasting the RNA-seq quantification (3B). The knock-down on protein level seems to be stronger in the 12 hpi samples here than in the 24 hpi samples. Although the band for HA-SMC3 is stronger at the 12 hpi TP there's no band visible in the + GlcN. sample. There's however in the 24 hpi samples. Could the authors comment on this?

      Response: __With regard to the discrepancy of the knockdown and protein versus RNA level, it is quite common for transcript levels to not agree with protein levels. This is why we always confirm a transcriptional knockdown with western blot analysis using appropriate loading controls. We are not sure why there is a more dramatic knockdown of SMC3 at 12hpi than at 24hpi, as these samples came from the same culture, but were simply harvested 12 hours apart. __

      *"Comparison of our RNA-seq data to the time course transcriptomics data from (Painter et al., 2018) revealed that SMC3 depletion at 12 hpi caused downregulation of genes that normally reach their peak expression in the trophozoite stage (18-30 hpi), with the majority of upregulated genes normally reaching their peak expression in the schizont and very early ring stages (40-2 hpi) (Fig. 3E). At 24 hpi, a similar trend is observed, with most downregulated genes normally peaking in expression in trophozoite stage (24-32 hpi) and the majority of upregulated genes peaking in expression at very early ring stage (2 hpi) (Fig. 3F)."

      I'm not fully convinced by these presented results/conclusions. This dataset would greatly benefit from the inclusion of additional later time points.*

      __Response: __To be clear, we are most interested in the transcriptional role of SMC3 during interphase, where results are not confounded by its potential role in mitosis. However, we did collect a 36hpi time point in the SMC3-3HA-glmS and WT strain, with and without glucosamine. We have added this last time point and the WT data from the other two time points to the manuscript (see Tables 11-13). Unfortunately, and for reasons unknown, the WT replicates treated with glucosamine showed a significantly advanced “transcriptional age” compared to the other replicates at 36hpi (see what is now Supp. Fig. 5B). Thus, we did not feel comfortable performing the RNA-seq analysis as we did with the other two time points (i.e. subtracting up- and down-regulated genes from the WT control from the SMC3-3HA-glmS data sets). We have added this information to the results section (Lines 256 and 261). As the WT parasites treated with glucosamine were approximately 8 hours in advance of the untreated WT parasites for the 36hpi time point, any up- and down-regulated genes might have been due to differences in the cell cycle rather than due to glucosamine treatment. The glmS system of inducible knockdown is widely used in P. falciparum; however, to our knowledge, no lab has investigated whether glucosamine treatment affects transcription in wildtype cells over the course of the IDC. Thus, for accurate phenotypic characterization of any protein with this system with regard to transcriptomics, we thought it was important to provide an RNA-seq dataset to define the cohort of genes affected by glucosamine treatment in WT parasites. We hope that our study will demonstrate the importance of using stringent controls when using inducible knockdown systems.

      We performed differential expression analysis of the SMC3-3HA-glmS parasites with and without glucosamine at 36hpi (we have added this data in Table 11). Again, significantly up- and down-regulated genes were not filtered using the WT dataset. With this analysis, we see only three genes from the list of invasion-related genes (Hu et al., 2010) that are up-regulated, but none of them have a significant q-value (Tab 5 of Table 18). Thus, depletion of SMC3 in late stage parasites does not lead to up-regulation of the same genes that are upregulated at 12 and 24hpi. We have added this information to the text (Line 277).

      *The presented upregulation of the egress and invasion related genes is hard to pinpoint to be a direct effect of transcriptional changes due to the SMC3 knockdown. While there's a slight upregulation of these genes they still seem to be regulated in their normal overall transcriptional program as shown in Figure 4D/E. *

      __Response: __We provide evidence of a direct effect of SMC3 binding by combining differential expression analysis performed upon SMC3 knockdown with SMC3 ChIP-seq at corresponding time points. As we show in what is now Fig. 4C and D, promoter accessibility of these egress/invasion genes correlates with their transcriptional activity. However, SMC3 binding to the promoters of these same genes shows inverse correlation with their transcriptional activity (what is now Fig. 4B and D). While we believe that SMC3 does contribute to the repression of these genes at specific time points during the cell cycle, it is highly likely that SMC3 is just one protein of many that regulates these genes. Moreover, and especially since we do not see a growth phenotype in the SMC3 KD, it is possible that another protein or even SMC1 could compensate for loss of SMC3 at these promoter regions. We now state these possibilities on lines 346 383 of the Discussion.

      *So the changes could in theory also be explained by the differences in cell cycle progression which are present between +/- GlcN. cultures (Sup. Fig. 3). The presented normalization to the microarray data is a well-established practice to correct for this but, as presented seems to have its limitation with these parasite lines (line 233, glucosamine treated parasites harvested at 24 hpi correspond statistically to approximately 18-19 hpi (Supp. Fig. 3).) *

      __Response: __In the analysis presented in what is now Supp. Fig. 5B, regardless of glucosamine presence or absence, the differences among replicates and strains at 12 and 24hpi are, in our opinion, minimal, amounting to one or two hours of the 48-hour IDC. In our extensive experience with RNA-seq across the P. falciparum lDC, this synchronization is extremely tight. As we describe on lines 416-421 of the Materials and Methods, there is a ±3 hour window in our synchronization method, meaning that parasites harvested at 24hpi could be anywhere from 21-27hpi. In addition, the dataset that was used for comparison (from Bozdech et al., 2003) was generated in 2003 in a different laboratory using different strains with microarray. While comparing more recent RNA-seq data to this classic study has become well-established practice and is useful for comparing transcriptional age between replicates and strains, it is inevitable that the calculated “hpi” from (Bozdech et al., 2003) will differ somewhat from our experimental “hpi”. We have indeed seen this small discrepancy in predicted transcriptional age in several of our RNA-seq datasets from trophozoites harvested at 24hpi.

      By including additional later time points, one could actually follow the expression profiles over the whole cycle and elucidate if there's an actual transcriptional up-regulation of the genes, or if the + GlcN. parasites show a faster cell cycle progression, with a shifted peak expression timing compared to the - GlcN. parasites. __Response: __We did collect a 36hpi time point in the SMC3-3HA-glmS and WT strain, with and without glucosamine. We have added this last time point and the WT data from the other two time points to what is now Supp. Fig. 5. Unfortunately, and for reasons unknown, the WT replicates treated with glucosamine showed a significantly advanced “transcriptional age” compared to the other replicates at 36hpi. Thus, we did not feel comfortable performing the RNA-seq analysis as we did with the other two time points (i.e. subtracting up- and down-regulated genes from the WT control from the SMC3-3HA-glmS data sets). We have added this information to the results section (Lines 256 and 261). As the WT parasites treated with glucosamine were approximately 8 hours in advance of the untreated WT parasites for the 36hpi time point, any up- and down-regulated genes might have been due to differences in the cell cycle rather than due to glucosamine treatment. The glmS system of inducible knockdown is widely used in P. falciparum; however, to our knowledge, no lab has investigated whether glucosamine treatment affects transcription in wildtype cells over the course of the IDC. Thus, for accurate phenotypic characterization of any protein with this system with regard to transcriptomics, we thought it was important to provide an RNA-seq dataset to define the cohort of genes affected by glucosamine treatment in WT parasites. We hope that our study will demonstrate the importance of using stringent controls when using inducible knockdown systems.

      *"These genes show SMC3 enrichment at their promoter regions at 12 and 24 hpi, but not at 36 hpi (Fig. 4C), and depletion of SMC3 resulted in upregulation at both 12 and 24 hpi (Fig. 4D). Comparison of the SMC3 ChIP-seq data with published Assay for Transposase-Accessible Chromatin using sequencing (ATAC-seq) data (Toenhake et al., 2018) and mRNA dynamics data (Painter et al., 2018) from similar time points in the IDC revealed that SMC3 binding at the promoter regions of these genes inversely correlates with chromatin accessibility (Fig. 4C) and their mRNA levels (Fig. 4E), which both peak in schizont stages. These data are consistent with a role of SMC3 in repressing this gene subset until their appropriate time of expression in the IDC."

      The presented correlations certainly make an intriguing point towards the authors conclusion that SMC3/cohesin depletion from the promoter regions of the genes results in a de-repression of these genes and their transcriptional activation. However, the SMC3 knockdown is not complete and only up to 69% as presented on RNA level in these parasites. Therefore a control experiment which needs to be done is to actually show the loss of SMC3 from the presented activated example genes in the knockdown parasites. This could easily be done by ChIP-qPCR or even ChIP-seq, to get a global picture of the actual changes in SMC3 occupation in the knockdown parasites in correlation with changes in transcript levels. *__Response: __While SMC3-3HA-glmS knockdown is not complete at the RNA level, it is fairly robust at the protein level, especially at 12hpi (Fig. 3A).

      *"These data suggest that SMC3 knockdown results in a faster progression through the cell cycle or a higher rate of egress/invasion."

      The authors could greatly strengthen their conclusions by investigating this thoroughly. Pinpointing the observed phenotype to an actual increase in invasion or egress would add to the authors main conclusion that the loss of SMC3 de-regulates the timing of gene expression for these invasion related genes thereby increasing their transcript levels and thus leading to a higher rate of egress/invasion. To determine cell cycle progression simple comparisons between DNA content using a flow cytometer at timepoints together with visual inspection of Giemsa stained blood smears would give a ggod indication towards changes in cell cycle progression. In addition invasion/egress assays by counting newly invaded rings per schizont could reveal, if there are changes in the rate of egress/invasion upon SMC3 knockdown.*

      Response: __We have repeated our growth curve analysis several times and with more clones and have concluded that there is not a significant growth phenotype in SMC3 KD parasites (see what is now Supp. Fig. 4B). We have added images of Giemsa-stained parasites from the knockdown time course we performed to what is now Supp. Fig. 5A. We see no obvious differences in cell morphology caused by glucosamine treatment in the WT or SMC3-3HA-glmS parasites. As we discuss on line 327, very little intact cohesin complex seems to be required for normal growth and mitosis in S. cerevisiae and D. melanogaster, which is probably why we do not see an obvious growth or morphological phenotype. We believe that SMC3 is probably only a part of a complex controlling transcription of these invasion or egress genes. Thus, the up-regulation of these genes upon SMC3 KD might not be enough to lead to a significant growth or invasion phenotype. __

      *Minor points:

      In the MM section on the Cas9 experiments it says dCas9 where it should be Cas9 (line 425)*

      __Response: __Thank you for pointing this out. We have corrected this.

      It would be great to add which HP1 antibody was used in which dilution in the IFAs to the MM section. __Response: __We have added this information to the Materials and Methods section.

      In Figure 4C for the gap45 gene there's is some green peak floating around which should not be there. __Response: __Thank you for pointing this out, we have corrected it.

      *Reviewer #3 (Significance (Required)):

      Significance: The manuscript investigates a very timely topic by trying to uncover new molecular mechanisms of transcriptional regulation in P. falciparum. Investigating the role of the cohesin complex/SMC3 in this context provides valuable new insights to the field. While the first part with the description of the SMC3 cell line and the co-IP experiments largely confirms published data on the existence and composition of the cohesin complex in Plasmodium and its enrichment at the centromeres, the second part is especially intriguing since it investigates the molecular function of SMC3 in more detail. The results pointing to a role of SMC3/cohesin as a transcriptional repressor are of great interest to the field and will open up new concepts for future investigation.*

      *Audience: The work is particularly interesting for people interested in gene regulatory processes in Plasmodium and Apicomplexan parasites in general. At the same time it also nicely points towards shared principles of gene regulation to other eukaryotes in relation to the spatial organization of the genome making the work also very interesting for a broader audience with interest in the general principles of gene regulatory processes in eukaryotic organisms.

      Expertise: P. falciparum epignetics and chromatin biology / gene regulation / Cas9 gene editing*

      CROSS-CONSULTATION COMMENTS

      All reviewers agree that the paper addresses an important topic and provides convincing evidence for enrichment of the cohesin component Smc3 at P. falciparum centromers. In contrast, evidence for a function of Smc3 as a transcriptional repressor of genes in the first part of the parasite life cycle is less well supported. All reviewers agree that the statistical significance of the ChIP experiments needs to be impoved by including biological replicates. In addition, the phenotype of the conditional knock-down should be analysed in more detail by clarifying whether faster cell cycle progression or higher invasion rate are responsible for the observed growth adavantage. Inclusion of transcriptional data from a later time point in addition to the presented data for 12 hpi and 24 hpi was also requested by all reviewers. Finally, several inconsistencies require clarification.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      Summary:

      In the presented manuscript by Rosa et al. the authors investigate the longstanding question of how P. falciparum achieves the tight transcriptional regulation of its genome despite the apparent absence of many canonical sequence specific transcription factor families found in other eukaryotes. To do this the authors investigate the role of the spatial organization of the genome in this context, by performing a functional characterization of the conserved cohesion subunit SMC3 and its putative role in transcriptional regulation in P. falciparum.

      Using Cas9 mediated genome editing the authors generated a SMC3-3xHA-glmS parasite line, which they subsequently used to show expression of the protein over the asexual replication cycle by western blot and IFA analysis. In addition, using co-IP experiments coupled with mass spectrometry they identified the additional components of the cohesion complex also found in other eukaryotes as interaction partners of SMC3 in the parasite, thereby confirming the presence of the conserved cohesin complex in P. falciparum. By using a combination of ChIP-seq and RNA-seq experiments in SMC3 knockdown parasites the authors furthermore show that a reduction of SMC3 resulted in the up-regulation of a specific set of genes involved in invasion and egress in the early stages of the asexual replication cycle and that this up-regulation in transcription is correlated with a loss of SMC3 enrichment at these genes. From these observations the authors conclude, that SMC3 binds dynamically to a subset of genes and works as a transcriptional repressor, ensuring the timely expression of the bound genes.

      Overall, the presented data is intriguing, of high quality and very well presented. However, there are some points, which should be addressed to bolster the conclusions drawn by the authors.

      Major points:

      I was not able to find the deposited datasets in the BioProject database under the given accession number. This should obviously be addressed and would have been nice to be able to have a look at these datasets also for the review process.

      SMC3-ChIP-seq experiments:

      "168 were bound by SMC3 across all three time points (Fig. 2D). However, most SMC3-bound genes showed a dynamic binding pattern, with a peak present at only one or two time points (Fig. 2B,D)."

      Here it would be interesting to actually have more than one replicate of each of these ChIP-seq time points. This could provide a better idea of how "dynamic" these binding patterns actually are. Furthermore, I was missing a list of these 168 genes, which are constantly bound by SMC3. Anything special about those? What actually happens to this subset of genes in the SMC3 knockdown parasites? Do they show similar transcriptional changes?

      SMC3-knockdown experiments:

      In Sup. Fig. 1 there is a double band in the HA-western blot in the 2nd cycle -GlcN. sample. This second band is absent in all other HA-western shown. Have the authors any idea where that second band comes from?

      In Figure 3A, the WB data shown is slightly contrasting the RNA-seq quantification (3B). The knock-down on protein level seems to be stronger in the 12 hpi samples here than in the 24 hpi samples. Although the band for HA-SMC3 is stronger at the 12 hpi TP there's no band visible in the + GlcN. sample. There's however in the 24 hpi samples. Could the authors comment on this?

      "Comparison of our RNA-seq data to the time course transcriptomics data from (Painter et al., 2018) revealed that SMC3 depletion at 12 hpi caused downregulation of genes that normally reach their peak expression in the trophozoite stage (18-30 hpi), with the majority of upregulated genes normally reaching their peak expression in the schizont and very early ring stages (40-2 hpi) (Fig. 3E). At 24 hpi, a similar trend is observed, with most downregulated genes normally peaking in expression in trophozoite stage (24-32 hpi) and the majority of upregulated genes peaking in expression at very early ring stage (2 hpi) (Fig. 3F)."

      I'm not fully convinced by these presented results/conclusions. This dataset would greatly benefit from the inclusion of additional later time points. The presented upregulation of the egress and invasion related genes is hard to pinpoint to be a direct effect of transcriptional changes due to the SMC3 knockdown. While there's a slight upregulation of these genes they still seem to be regulated in their normal overall transcriptional program as shown in Figure 4D/E. So the changes could in theory also be explained by the differences in cell cycle progression which are present between +/- GlcN. cultures (Sup. Fig. 3). The presented normalization to the microarray data is a well-established practice to correct for this but, as presented seems to have its limitation with these parasite lines (line 233, glucosamine treated parasites harvested at 24 hpi correspond statistically to approximately 18-19 hpi (Supp. Fig. 3).) By including additional later time points, one could actually follow the expression profiles over the whole cycle and elucidate if there's an actual transcriptional up-regulation of the genes, or if the + GlcN. parasites show a faster cell cycle progression, with a shifted peak expression timing compared to the - GlcN. parasites.

      "These genes show SMC3 enrichment at their promoter regions at 12 and 24 hpi, but not at 36 hpi (Fig. 4C), and depletion of SMC3 resulted in upregulation at both 12 and 24 hpi (Fig. 4D). Comparison of the SMC3 ChIP-seq data with published Assay for Transposase-Accessible Chromatin using sequencing (ATAC-seq) data (Toenhake et al., 2018) and mRNA dynamics data (Painter et al., 2018) from similar time points in the IDC revealed that SMC3 binding at the promoter regions of these genes inversely correlates with chromatin accessibility (Fig. 4C) and their mRNA levels (Fig. 4E), which both peak in schizont stages. These data are consistent with a role of SMC3 in repressing this gene subset until their appropriate time of expression in the IDC."

      The presented correlations certainly make an intriguing point towards the authors conclusion that SMC3/cohesin depletion from the promoter regions of the genes results in a de-repression of these genes and their transcriptional activation. However, the SMC3 knockdown is not complete and only up to 69% as presented on RNA level in these parasites. Therefore a control experiment which needs to be done is to actually show the loss of SMC3 from the presented activated example genes in the knockdown parasites. This could easily be done by ChIP-qPCR or even ChIP-seq, to get a global picture of the actual changes in SMC3 occupation in the knockdown parasites in correlation with changes in transcript levels.

      "These data suggest that SMC3 knockdown results in a faster progression through the cell cycle or a higher rate of egress/invasion."

      The authors could greatly strengthen their conclusions by investigating this thoroughly. Pinpointing the observed phenotype to an actual increase in invasion or egress would add to the authors main conclusion that the loss of SMC3 de-regulates the timing of gene expression for these invasion related genes thereby increasing their transcript levels and thus leading to a higher rate of egress/invasion. To determine cell cycle progression simple comparisons between DNA content using a flow cytometer at timepoints together with visual inspection of Giemsa stained blood smears would give a ggod indication towards changes in cell cycle progression. In addition invasion/egress assays by counting newly invaded rings per schizont could reveal, if there are changes in the rate of egress/invasion upon SMC3 knockdown.

      Minor points:

      In the MM section on the Cas9 experiments it says dCas9 where it should be Cas9 (line 425)

      It would be great to add which HP1 antibody was used in which dilution in the IFAs to the MM section.

      In Figure 4C for the gap45 gene there's is some green peak floating around which should not be there.

      Significance

      The manuscript investigates a very timely topic by trying to uncover new molecular mechanisms of transcriptional regulation in P. falciparum. Investigating the role of the cohesin complex/SMC3 in this context provides valuable new insights to the field. While the first part with the description of the SMC3 cell line and the co-IP experiments largely confirms published data on the existence and composition of the cohesin complex in Plasmodium and its enrichment at the centromeres, the second part is especially intriguing since it investigates the molecular function of SMC3 in more detail. The results pointing to a role of SMC3/cohesin as a transcriptional repressor are of great interest to the field and will open up new concepts for future investigation.

      Audience:

      The work is particularly interesting for people interested in gene regulatory processes in Plasmodium and Apicomplexan parasites in general. At the same time it also nicely points towards shared principles of gene regulation to other eukaryotes in relation to the spatial organization of the genome making the work also very interesting for a broader audience with interest in the general principles of gene regulatory processes in eukaryotic organisms.

      Expertise:

      P. falciparum epignetics and chromatin biology / gene regulation / Cas9 gene editing

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Rosa et al, Review Commons

      The manuscript by Rosa et al. addresses the function of the cohesion subunit Smc3 in gene regulation during the asexual life cycle of P. falciparum. Cohesin is a conserved protein complex involved in sister chromatin cohesion during mitosis and meiosis in eukaryotic cells. Cohesin also modulates transcription and DNA repair by mediating long range DNA interactions and regulating higher order chromatin structure in mammals and yeast. In P. falciparum, the Cohesin complex remains largely uncharacterized. In this manuscript, the authors present mass spectrometry data from co-IPs showing that Smc3 interacts with Smc1 and a putative Rad21 orthologue (Pf3D7_1440100, consistent with published data from Batugedara et al and Hilliers et al), as well as a putative STAG domain protein orthologue (PF3D7_1456500). Smc3 protein appears to be most abundant in schizonts, but ChIPseq indicates predominant enrichment of Smc3 in centromers in ring and trophozoite stages. In addition, Smc3 dynamically binds with low abundance to other loci across the genome; however, the enrichment is rather marginal and only a single replicate was conducted for each time point making the data interpretation difficult. Conditional knock-down using a GlmS ribozyme approach indicates that parasites with reduced levels of Smc3 have a mild growth advantage, which is only evident after five asexual replication cycles and which the authors attribute to the transcriptional upregulation of invasion-linked genes following Smc3 KD. Indeed, Smc3 seems to be more enriched upstream of genes that are upregulated after Smc3 KD in rings than in downregulated genes, indicating that Smc3/cohesin may have a function in supressing transcription of these schizont specific genes until they are needed. The manuscript is concise and very well written, however it suffers from the lack of experimental replicates for ChIP experiments and a better characterization of the phenotype of conditional KD parasites.

      Major comments

      • In the mass spectrometry analysis, many seemingly irrelevant proteins are identified at similar abundance to the putative rad21 and ssc3 orthologues, and therefore the association with the cohesion complex seems to be based mostly on analogy to other species rather than statistical significance. Hence, it would be really nice to see a validation of the novel STAG domain and Rad21 proteins, for example by Co-IP using double transgenic parasites.
      • The ChIPseq analysis presented here is based on single replicates for each of the three time points. The significance cutoffs for the peaks are rather high (q < 0.05). Therefore, the relevance of the marginally enriched dynamic peaks (average relative enrichment of <1.2 fold for genes upregulated in rings 12 hpi in Figure 4A and B) does not appear to be very robust. Even in ChIPseq experiments using non-immune IgG, hundreds of peaks are usually called with MACS2 with a similar magnitude. So, to substantiate the data for extra-centromeric peaks convincingly, replicates and more stringent statistics are necessary. In addition, the authors should also compare their data to published PfSmc3 ChIP data from Batugedara et al 2020 (GSE116219).
      • The authors argue that during schizogony, cohesin may no longer be required at centromers, explaining the low ChIPsignal at this stage (Line 301). However, during schizogony parasites undergo repeated rounds of DNA replication (S-phase) and mitosis (M-phase) to generate multinucleated parasites; and concentrated spots of Smc3 are observed in each nucleus in schizonts by IFA. In turn, the strong presence of Smc3 at centromers in ring stage parasites is surprising, particularly since the Western Blot in Figure 1D shows most expression of Smc3 in schizonts and least in rings; and Smc3 is undetectable in rings by IFA. Yet, the ChIP signal shows very strong enrichment at centromers, long before S phase produces sister chromatids. What could be the reason for this discrepancy? Again, ChIP replicates and controls would be helpful in distinguishing technical problems with the ChIP from biologically relevant differences.
      • It is surprising that a conserved protein like Smc3 shows such a subtle phenotype, given that it is predicted to be essential and its orthologues have a function in mitosis. Generally, only limited data are presented to characterize the Smc3 KD parasites, and more detail should be included. For example validation of the parasite line using a PCR screen for integration and absence of wt, parasite morphology after KD, and/or analysis of the KD parasites for cell cycle status.
      • Synchronization was performed at the beginning of the growth time course, which would be expected to result in a stepwise increase in parasitemia every 48 hours; however, the parasitemia according to Fig. 4F rises steadily, which would indicate that the parasites are actually not very synchronous.
      • The question of whether Smc3 causes a shorter parasite life cycle (quicker progression) or more invasion is important and could be experimentally addressed by purifying synchronous schizont stage parasites and determining their invasion rates as well as morphological examination of the Giemsa smears over the time course.
      • Please also compare Smc3 transcriptional levels in transgenic parasites to those in wt parasites to rule out that the genetic modification has lead to artificial upregulation of Smc3 transcription.
      • According to Figure S2, even more genes were deregulated at the 12 hpi time point in the WT parasites than in Smc3 parasites, and even to a much higher extent. What "transcriptional age" did the WT control parasites have at each time point?
      • A negative correlation with transcription is well established in S. cerevisiae, particularly at inducible genes. How does Smc3 enrichment generally look like for genes that show maximal expression at each of the time point?
      • Line 590: according to the methods, a 36 hpi KD time point was also harvested. Why are the data not shown/analysed?

      Minor Comments

      • Line 103/104: the hinge domain and ATPase head domain are mentioned, please annotate these in Figure 1A.
      • Figure 1D: the kDa scale is missing from the H3 WB.
      • What is the scale indicated by different colors in Fig. 2A?
      • Line 189: it would also be interesting how many peaks are "conserved" between the different time points studied, so not only to compare the gene lists of closest genes but also the intersecting peaks and then the closest genes to the intersecting peaks.
      • What is the distribution of the peaks over diverse genetic elements, such as gene bodies, introns, convergent/ divergent/ tandem intergenic regions? In yeast, cohesion is particularly enriched in convergent intergenic regions, so it would be interesting to see how this behaves in P. falciparum.
      • Line 130 intra-chromosomal interactions (word missing)
      • Contrary to Figure 1D, the WB in Figure 3A indicates strong expression of Smc3 in rings. Please comment on this discrepancy.
      • What time point after glucosamine addition represents the WB in Fig. 3A?
      • Line 233 / Suppl Figure 3: Isn't it a bit concerning that the untreated control parasites at 24 hpi statistically corresponded to 18-19 hpi? And to what timepoint did the wt parasites correspond?
      • Line 264: "whether naturally or via knockdown" - the meaning of this sentence is not entirely clear
      • Figure 4 Legend: A, B, C etc. are mixed up.
      • Figure 4D: the differences seem to be marginally significant, even not significant at all (q=0.8) for gap45 at 12hpi.
      • Figure 4F shows FACS data using SYBR green as a DNA stain. The authors could exploit this data to look at the relative DNA content per cell as a measure of parasite stage, since more mature parasites will have more DNA (mean fluorescence intensity). How did the corresponding parasite cultures look in Giemsa smears?
      • Are RNAseq replicates biological replicates from independent experiments or technical replicates?
      • Why does the number of genes analysed for differential gene expression differ between the comparisons?
      • Line 372: Do you mean the proteins or the genes? AP2-I has a peak at 24 hpi and 36 hpi, and its interacting AP2 factor Pf3D7_0613800 at all time points.
      • Line 480: no aldolase was shown.
      • Line 838: include GO analysis in methods

      Referees cross-commenting

      All reviewers agree that the paper addresses an important topic and provides convincing evidence for enrichment of the cohesin component Smc3 at P. falciparum centromers. In contrast, evidence for a function of Smc3 as a transcriptional repressor of genes in the first part of the parasite life cycle is less well supported. All reviewers agree that the statistical significance of the ChIP experiments needs to be impoved by including biological replicates. In addition, the phenotype of the conditional knock-down should be analysed in more detail by clarifying whether faster cell cycle progression or higher invasion rate are responsible for the observed growth adavantage. Inclusion of transcriptional data from a later time point in addition to the presented data for 12 hpi and 24 hpi was also requested by all reviewers. Finally, several inconsistencies require clarification.

      Significance

      The paper addresses the function of the cohesin complex in gene regulation of malaria parasites for the first time. Due to the conserved nature of the complex, the data may be interesting for a broad audience of scientists interested in nuclear biology and cell division/ gene regulation.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary

      The present work by Rosa et al., provides convincing data about the presence and functional relevance of the cohesin complex in Plasmodium falciparum blood stages. In accordance with other organisms, the composition of the cohesin complex containing SMC1, SMC3 RAD21 and putatively STAG could be confirmed via pulldown and mass spectrometry. Basic characterization of endogenous tagged SMC3 demonstrated the expression and nuclear localization during IDC, as well as the relatively stable accumulation at centromeric regions, consistent with the known cohesin function in chromatid separation. Furthermore, dynamic and stage-dependent binding to intergenic regions observed in ChIPseq and major transcriptome aberrations upon knockdown of SMC3 (<70% mRNA reduction via glmS-system) suggest an important function in transcriptional regulation. The underlying mechanism of gene regulation by cohesin via the creation of chromatin clusters or DNA loops as well as its specificity to target sites remain speculation.

      Major criticism

      • Accuracy of ChIPseq with only one replicate per time point (and lacking negative controls without antibody) is not convincing. The authors should include more replicates.
      • Proposed mechanism of repressive effect of SMC3 early in IDC on genes, that get de-repressed in late stages: To claim this mode of function, it would be necessary to include a KD on late stage parasites. If there is an early repressive role of SMC3, upregulated genes should not be affected by late SMC3-KD. Furthermore, the hypothesized repressive effect of SMC3 does not explain the numerous genes downregulated in KD.
      • Due to the fact, that the KD was induced at the exact same timepoint and analysed 12h and 24h after induction it is possible that identified, differentially expressed genes at 24h are not directly regulated by SMC3, but rather due to a general deregulation of gene expression. Did the authors attempt to analyse gene expression upon induction at ring, trophozoite and schizont stage?
      • Based on rapid parasite growth, the authors hypothesize a higher invasion rate due to upregulation of invasion genes. This hypothesis is not supported by quantitative invasion assays or quantification of invasion factors on the protein level. An alternative explanation could be a shorter cell cycle (<48h), as the different cell cycle progression estimation of KD/WT could indicate (SuppFigure 3). Giemsa-stain images of KD/WT parasites should be included to show normal stage development over time.
      • Correlation of SMC3-occupancy/ATAC/expression profile of the exemplary genes rap2 and gap45 (Figure 4C,D,E): is this representative for all upregulated genes?
      • Given that SMC3 appears to be not essential for parasite growth, the authors could generate a null mutant for SMC3, which might allow for easier analysis of differences in gene regulation, cell cycle progression and/or invasion efficiency.

      Significance

      Own opinion

      The authors provide a basic characterization of the cohesin component SMC3 using NGS methods to investigate chromatin binding sites and its potential influence on gene expression. The localisation of SMC3 at centromers as described previously (Batugedara 2020) was confirmed. However, the dynamic binding to other regions in the genome, potentially mediated by other proteins, could not be resolved unequivocal with only one replicate of ChIPseq per time point. Similarly, the RNAseq data demonstrate the relevance of SMC3 for gene expression, but no clear picture of a regulatory mechanism can be drawn at his point. Lacking information about the mode of binding as well as the setup of transcriptome analysis (only two time-shifted sampling points after simultaneous glmS treatment for 96h resulting in incomplete knockdown) cannot definitely elucidate, if SMC3/cohesin is a chromatin factor that affects transcription of genes in general or a specific repressor of stage-specific genes.

      The work will be interesting to a general audience, interested in gene regulation and chromatin remodelling

      The reviewers are experts in Plasmodium cell biology and epigenetic regulation.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      The authors do not wish to provide a response at this time. The full point-by-point reply is attached together with the manuscript files.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      Review Commons recommends including the following components in referee reports:

      1. Evidence, reproducibility and clarity

      Summary:

      Provide a short summary of the findings and key conclusions (including methodology and model system(s) where appropriate). Please place your comments about significance in section 2.

      The manuscript by Awoniyi et al is an elegant study that addresses the protein composition of the lipid rafts upon BCR activation. The authors use an elegant system, employing the enzyme ascorbate peroxidase (APEX2), which in cellulo generates short-lived biotin radicals, that in turn randomly bind to proteins in their vicinity (10-20 nm) within 1 min. APEX2 is furthermore fused with the 7-amino acid sequence MGCVCSS, which allows its targeting to lipid rafts (Raft-APEX2) and with an mCherry marker. Using modern microscopy methods as well as quantitative mass-spectrometry proteomics, the authors provide a spatially and temporally resolved dynamic insight into the changes within the lipid raft and. are able to enrich multiple proteins in the lipid rafts previously not associated with BCR signaling. Furthermore, they identify Golga3 and Vti1b as proteins proximally responding to BCR activation possibly enabling vesicle transport.

      The manuscript is generally well written, the study is well-conceived and well-controlled. Nevertheless, the authors may answer some important questions (see below)

      Major comments:

      • Are the key conclusions convincing?

      Yes, the key conclusions of the study are convincing and based on elegant experiments

      • Should the authors qualify some of their claims as preliminary or speculative, or remove them altogether?

      • Would additional experiments be essential to support the claims of the paper? Request additional experiments only where necessary for the paper as it is, and do not ask authors to open new lines of experimentation.

      • In Figure 2, the HEL-specific A20 B cells are stimulated with anti-IgM F(ab)'2. While, beyond a doubt, anti-IgM F(ab)'2 is a potent stimulus, which triggers BCR signaling activation, I am curious why the authors chose it over the HEL antigen.

      • Describing figures 4 and 5, the authors state that they did not identify prominent BCR signaling pathway regulators. My major concern here is that the authors employ cancerous B cells for their analyses. The lipid raft composition and proteins recruited to the rafts in these cells may vary from those in primary wild-type B cells. While the authors do keep in mind that the signaling protein composition may vary between cell lines, it may vary even more between lymphoma B cell line and primary wild-type cells. Therefore, it may be beneficial to verify the expression of the "unexpected" proteins, such as Golga3, Kif20a, and Vtib1b in primary cells using immunofluorescence analyses similar to the ones presented in Fig 6.

      • The authors mention in the discussion, that Syk was not identified in their data set. This is surprising as Syk has been attributed with an important role in the proximal BCR signaling (Kulathu et al, https://doi.org/10.1111/j.1600-065X.2009.00837.x)

      • Would it be possible to detect Syk using the immunofluorescence technique from Figure 6?

      • Additionally, as stated in the text, A20 cells express endogenous IgG2a. Have the authors tried to conduct similar experiments stimulating with anti-IgG antibodies instead of anti-IgM F(ab)'2?

      • Have the authors tried to co-express the IgD-BCR to mimic mature peripheral B cells?

      • Are the suggested experiments realistic in terms of time and resources? It would help if you could add an estimated cost and time investment for substantial experiments.

      I cannot estimate the cost but if conducted, some experiments might take several months

      • Are the data and the methods presented in such a way that they can be reproduced?

      Yes

      • Are the experiments adequately replicated and statistical analysis adequate?

      Yes

      Minor comments:

      • Specific experimental issues that are easily addressable.

      • Are prior studies referenced appropriately?

      Yes

      • Are the text and figures clear and accurate?

      Yes, but, if possible, please provide the data instead of writing "data not shown"

      • Do you have suggestions that would help the authors improve the presentation of their data and conclusions?

      Fig. 1D and Supp. Fig. S1C: the authors state that after IgM cross-linking, the non-transfected and Raft-APEX2-transfected cells showed "indistinguishable" p-Tyr levels. From my perspective, the Raft-APEX2-transfected cells show higher levels of p-Tyr. It is possible to quantify it?

      Some paragraph titles are very short and descriptive (e.g. Proteomic analysis, membrane-proximal proteome etc.). It could improve the reading if the paragraph titles consisted of respective key findings

      Significance

      2. Significance

      • Describe the nature and significance of the advance (e.g. conceptual, technical, clinical) for the field.

      • This study dissects in a spatio-temporal manner the early events upon BCR stimulation and the enrichment of various proteins in the vicinity of lipid rafts. While conceptually not novel, the study provides novel methodology to address this question. This is technically relevant and worth to be published after a major revision.

      • Place the work in the context of the existing literature (provide references, where appropriate).

      *This study prominently overlooks a bulk of literature that supports the BCR dissociation activation model and does not comment that (reviewed in Maity et al, Volume 1853, Issue 4, April 2015, Pages 830-840)

      • State what audience might be interested in and influenced by the reported findings.

      The findings of this manuscript are specifically interesting for researchers who study early events of B cells activation, specifically the changes in the membrane composition and early BCR signaling

      • Define your field of expertise with a few keywords to help the authors contextualize your point of view. Indicate if there are any parts of the paper that you do not have sufficient expertise to evaluate.

      Immunology, Molecular and Cell Biology

      Referee Cross-commenting

      I agree totally that "the article would greatly benefit from a follow-up investigation on the functional/physiological relevance of the proposed players", however only if this is easily done with the CRISP mediated knock out as mentioned by both reviewers. In addition it s interesting to see data on cells stimulated with the antigen instead of anti IgM fab'2.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Summary

      Awoniyi et al. utilizes APEX2-mediated proximity proteomics to investigate the protein composition of lipid rafts and their dynamics in the context of B cell receptor (BCR) signaling. The authors add a 7 amino acid guide sequence to an APEX2-mCherry construct to specifically target the fusion protein into lipid raft plasma membrane domains and thereby spatially label and identify contained proteins. While a larger number of lipid raft-related proteins were verified, the study focuses on a smaller subset that is proposed to be specifically related to BCR signaling. Unexpectedly, this approach suggests key players of BCR signaling to be excluded from lipid rafts in an inducible manner. Finally, two of the identified proteins, Golga3 and Vti1b, were further investigated by immunofluorescence microscopy. Since both proteins are shown to be recruited to the plasma membrane and to colocalize with antigen, the authors propose Golga3 and Vti1b as novel targets of BCR activation and drivers of subsequent antigen internalization.

      Major Comments

      • A major claim of this study is that the majority of BCR signaling proteins (including CD79a and CD79b as parts of the BCR as well as BLNK) get excluded from lipid rafts upon stimulation. Moreover, many components of the endocytosis/vesicle trafficking pathways have been identified and the authors raise interesting points regarding the BCR as signaling platform versus the BCR as antigen internalization complex. This is intriguing and could even be explored further (e.g. by presenting Figure S3 in the main manuscript). However, the claim that Vti1b and Golga3 (and possibly Kif20) play key roles in the endocytic processes underlying BCR/antigen endocytosis and subsequent processing needs further verification e.g. by gene targeting experiments. In its present form, the manuscript links these proteins to B cell activation but does not convincingly back up the implied functional relevance to antigen/BCR endocytosis and/or trafficking leading to antigen presentation via MHC II.
      • It should be explained why the proteomic experiments were conducted using anti-IgM antibodies as opposed to the more physiological stimulation via HEL antigen, used for the microscopy studies.
      • Even though it is the central approach, the number of figures derived from the APEX2 proteomic experiments is quite high and should be condensed. For example, Figures 4 and 5 could be merged.
      • Figure 1D/E and Figure S1C seem to be the same pictures.
      • In contrast to Golga3, Vti1b is not mentioned in Figure 4 and the authors should explain why this particular protein was chosen for further investigation among all others (as opposed to proteins enriched upon anti-IgM treatment).
      • In Figures 6 and S4, the most apparent changes in Golga3 staining appear to be the increased (cytoplasmic and peripheral) vesicle size and intensity. For the analysis and quantitation of peripheral Golga3 staining, a tubulin-based masking algorithm was used to segment the image. This raises three concerns: 1) The tubulin staining that was used for masking appears to be rather blurry and the expected microtubule network is barely visible. 2) More information is needed on how the masking algorithm treated Golga3 vesicles touching the mask border. Based on the images in S4, there seems to be substantial overlap between (visibly peripheral) Golga3 vesicles and tubulin, so this will likely have an impact on quantification results. 3) Authors should comment on the overall increase in Golga3 upon activation.

      Minor Comments

      • While the APEX2 construct is globally targeted into the lipid raft environment, the study uses this approach to investigate proteins that are in the proximity of the IgM-BCR. The authors mention in the discussion that there have been "challenges" to target the BCR directly. It may be beneficial to briefly discuss those problems the authors have been facing with.
      • Figure 5B: It will be informative to show the BCR-induced (fold change) enrichment of Golga3 and Vti1b (and Kif20) in relation to IgM /kappa LC and the "classical" BCR signaling-related players.
      • Figure 6AB: Please clearly indicate that unmasked images are displayed, but masked images were quantified for Golga3 staining.
      • Figure 6CD: Since the quantification protocol of vesicle positioning involves nuclear staining, please depict respective DAPI stainings.
      • Figure S1D: It should be indicated that AF633-streptavidin was used for the flow cytometry experiment in Figure S1D (x axis).

      Significance

      Overall, the presented study offers an interesting approach and provides a novel, unbiased view on BCR-mediated lipid raft dynamics. The method is appealing in its technicality and its presentation, and hence, might attract the attention of a larger community working on plasma membrane localization of signaling platforms. It proposes two candidate signaling proteins and verifies their BCR-dependent colocalization with lipid rafts and antigen. While Golga3 and Vti1b are novel and interesting target proteins in the context of BCR activation, a functional assessment of these proteins is not presented. Certainly, the article would greatly benefit from a follow-up investigation on the functional/physiological relevance of the proposed players. As it stands, the manuscript largely remains on the level of exploration.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      This is an interesting study identifying membrane RAFT associated proteins in a mouse B cell line, before and after BCR stimulation, using a proximity biotinylation method. This method relies on the expression of an biotinylating enzyme APEX2 with a RAFT targeting domain that is activated by H2O2 addition. The system is well controlled by comparing transfected to non-transfected cells and by titrating H2O2 etc. The expected anti-IgM induced recruitment of the BCR to the RAFT domain is well documented in this system. The authors identify by proteome analysis over 1600 proteins in proximity to the membrane-targeted APEX2, most of which are constitutively labelled, i.e. do not change upon BCR stimulation. Only a minority of proteins (less than 100) changes dynamically between resting and stimulated state. Some results are surprising, as the authors discuss, as the known players of the BCR signalling pathway hardly change in their Raft association. Interesting is also the exclusion of signalling proteins such as Btk, BLNK and Ig-alpha/Ig-beta from BCR clusters upon activation. The strength of the system is that the APEX2 system causes a biotinylation with 1 min, which is an advantage to other systems and that the authors analyse 3 time points after BCR stimulation. The data are thoroughly analysed and discussed. The following points should be addressed: 1. Why did the authors not use the HEL antigen to stimulate their cells, as the A20 line expresses a Ag-specific BCR? Would this not be more physiological than Fab2-anti IgM? 2. Many proteins of pathways like RNA transport, Spliceosome, mRNA surveillance, mismatch repair etc. are identified. Although the authors try to explain some of these data, they should also consider unspecific labelling or unspecific enrichment of these proteins which have nothing to do with raft association. This should be more openly discussed. 3. The authors follow up two proteins that dynamically change during activation, Golga3 and Vti1b, and demonstrate their membrane association upon activation. This is of course relevant. What is missing, is some genetic studies. CRISPR-mediated KO is not difficult to do in cell lines. Have the authors produced such mutants for these two genes and analysed possible phenotypes in BCR signalling or other aspects? This would certainly strengthen the study.

      Significance

      This is a unique approach to globally identify proteins associated with the BCR in Rafts upon BCR stimulation. Comparable studies with other methods have been published before for B cell lines. Gupta et al. used quantitative proteomics of isolated RAFT-associated proteins before and after BCR stimulation. They also found that the association of most proteins to RAFTs was not changed after BCR stimulation. Saeki et al. used a proteomic approach in another B cell line to identify RAFT associated proteins, but without comparing stimulated to unstimulated cells. The approach used here has the advantage of not selecting only membrane bound proteins, but equally identifiying cytosolic proteins in vicinity to the Raft as well. Furthermore, dynamic changes are better analysed than in the other two studies. Therefore, the findings are relevant and a good advance in the field.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Thank you for conducting the peer-review of our manuscript. We really appreciate the constructive criticism of the reviewers, and we are happy to note the positive appreciation of our core findings regarding the role of the decapping machinery during apical hook and lateral root formation and the identification of ASL9 as a target of the decapping machinery. However, both reviewers note we over-interpretate about the function of ASL9 in cytokinin and auxin responses which is not always supported by our data. Based on their feedback, we have toned down our claims and performed additional experiments and analyses and addressed all the comments raised by both reviewers. We hope this substantially revised and improved version of our manuscript will be better accepted.

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      In this manuscript, the authors describe the role of the mRNA decay machinery in apical hook formation during germination in darkness in A.thaliana. As reported, this machinery is predominantly described in literature in stress response processes, whereas little is known about its involvement during developmental processes. In detail, the authors demonstrated, via RNA immunoprecipitation (RIP) and genetic experiments, the direct regulation of the LATERAL ORGAN BOUNDARIES DOMAIN 3 (LBD3)/ASYMMETRIC LEAVES 2-19 LIKE 9 (ASL9) mRNA stability by the mRNA decapping machinery subunits DCPs. According to the manuscript, ASL9 controls apical hooking, LR development and primary root growth is regulating cytokinin signalling and hence its regulation helps to maintain a correct balance of auxin/cytokinin. Indeed, they showed an impair apical hooking and LR defects both in mRNA decapping mutants, where they observed more capped ASL9 compared to WT, and in ASL9 over-expressor lines. Moreover, they reported a largely restoration of over-expressor lines phenotype in the arr10-5arr12-1 double mutants. This work present simple but interesting data that corroborate the authors hypothesis.

      Our response: We thank the reviewer for acknowledging the significance of our findings although we wonder what it´s meant by “simple data”. Through a combination of (complicated) genetics, phenotyping, cell imaging and molecular biology, we have provided mechanistic evidence on the function of the decapping machinery during 2 different post embryonic developmental events. Please see our detailed answers to the reviewer’s comments in the following.

      Nonetheless, I have both major comments and minor comments to improve the manuscript: MAJOR COMMENTS: 1. I am a bit concerned by the fact that cytokinin, auxin, LBD3, ARR12 and ARR10 have been largely involved in vasculature development and that the obtained results might be due to their role in vasculature development more than in LBD3 mRNA decapping process. Authors should provide evidence that their results are independent from vasculature defects present in those backgrounds or in case discuss this possibility.

      __Our response: __We are a bit puzzled on how vasculature development could explain the apical hook phenotype observed in the decapping mutant. Data like the rapid assembly of P-bodies upon IAA (Fig. 3C) treatments and the overall decreased DR5 signal in dcp mutants (Fig.S5&6) are all consistent with a process precluding vasculature formation. However, we still discuss the possibility that the developmental defects observed in mRNA decapping mutants and ASL9 overexpressor might be related to the vasculature development in these plants (Line 239-244).

      The interaction between the described players and auxin is not clear. From the reported experiments it is difficult to understand what authors wants to report as in S4 and S5 are reported experiments not fully described in the text (authors report about introgression of DR5::GFP in dcp1 and 2 mutants, but SD4 reports ACC treatments of DR5::GFP,dcp2 mutants and SD5 of 7 dpg root meristems of this strain ). Please describe and discuss better the experiment. Also, to this reviewer it is difficult to understand whether the absence of auxin activity in the dcp2 mutants hypocotyl is merely an effect of the lack of the hook formation in this background or a cause. Please clarify this point including new experiments (axr1 or axr3 mutants might help in understand this point).

      __Our response: __We follow the reviewer’s suggestions and trust we now describe and discuss Fig S5&6 (old Fig S4&S5) clear in Line 188-193. As axr1 has been published with apical hook and lateral root defect (old Line 42, new Line 39&169), we did not repeat it in new experiments but emphasize it in Line 169.

      Authors conclude that mRNA decapping is also involved in root growth. However, they do not report direct evidences regarding root growth but mostly regarding the mere root lenght at a precise developmental stage. Please eliminate this point or provide new experiments (e.g., root length and root meristem activity over time)

      __Our response: __We follow the reviewer’s suggestions and eliminate the data regarding to primary root growth (Fig. 3-6 &S2)

      Regarding root growth defects, these might be due to defect in the vasculature development, please analyse this point or report new experiments (e.g., vasculature analysis of dcp1,2 mutants or tissue specific expression of DCP2).

      __Our response: __We largely agree with the reviewer, all the decapping components DCP1, DCP2, DCP5 and PAT1 exhibit high expression in xylem cells and low expression in procambium cells (Brady et al., 2007) indicating functions of decapping components in vasculature development. However, we did not include this knowledge in our manuscript since we decided to eliminate the primary root growth data (Fig.3-6&S2).

      For consistency the last paragraph of result section: "ASL9 directly contributes to apical hooking, LR formation and primary root growth" should be part of the result section entitled "Accumulation of ASL9 suppresses LR formation and primary root growth". Authors should move this result in the paragraph before "Interference of a cytokinin pathway and/or exogenous auxin restores developmental defects of ASL9 over-expressor and mRNA decay deficient mutants".

      __Our response: __We agree thus we reorganize the result sections and move "ASL9 directly contributes to apical hooking and LR formation" before "Interference of a cytokinin pathway and/or exogenous auxin restores developmental defects of ASL9 over-expressor and mRNA decay deficient mutants" (Line 152).

      I suggest being consistent in the description of the statistical analysis. In particular: - I suggest reporting the meaning of ANOVA letters and the P-value in each figure as sometimes these information are missing, especially in Fig.2.

      __Our response: __We used ANOVA letters when comparing among genotypes and treatments, for example Fig 2A; and we used stars when comparing to controls, for example old Fig 2F. For consistency, we use letters for all the statistical analysis now and we report the meaning of the letters clearly in the figure legends (Fig. 1-6, S1-5&7). However, we think that putting the P-values in each figure would not be reader-friendly, and thus we have not done this.

      • in Fig.S3 please report the statistical significance on bars and the statistical analysis performed.

      __Our response: __We thank the reviewer for pointing it out, we report the statistical analysis now in new Fig. S2 (old Fig. S3).

      MINOR COMMENTS: L31- please replace "normal" with "proper"

      __Our response: __We thank the reviewer for the suggestion, now we replace "normal" with "proper"(Line 30)

      L42-please report the acronym of axr1

      __Our response: __The acronym of axr1 is correctly reported (Line 40).

      L57, L59-please include the entire name of DCP2 and XRN

      __Our response: __The entire name of DCP2 and XRN are correctly included (Line 55 &57).

      -Please report how many plants were analysed in legend or in methods section

      __Our response: __The numbers of plants in analysis are now reported in figure legends (Fig. 1-6, S1,2&7).

      -Please report how many transgenic independent lines were obtained in methods section

      __Our response: __The numbers of transgenic independent lines are now reported in methods (Line 292)

      • Please, try to change the colours of the graph in Fig.S2A-B, as it quite difficult to distinguish light grey shades.

      __Our response: __We thank the reviewer’s suggestions, the colours of new Fig.S3&4 (old Fig.S2) are changed.

      • In Fig. 5A and S5A scale bars are missing.

      __Our response: __We thank the reviewer for pointing this out, scale bars are correctly added in new Fig 4 &S6 (old Fig 5 &S5).

      Reviewer #1 (Significance (Required)): The manuscript is interesting and analyse important and overlooked aspects of the role of mRNA decapping in development. Nonetheless experiments reported are not particularly innovative and not always sound. Also authors analysis are a bit superficial probably because they decide to utilize too many systems in their research (root development, hook development and lateral root development).

      Our response: We thank the reviewer again for acknowledging the significance of our findings and hope we satisfied the reviewer with our answers above. However, we would like to ask what is the purpose of writing “experiments are not particularly innovative”? We admit we used established and robust experiments which we found sufficient to answer the overlooked aspects of the role of mRNA decpping in apical hook and lateral root development as also noted by the reviewer, but maybe we simply don't understand the comment.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      Major Comments 1. My main concern is about the authors' conclusions on the role of mRNA decay and ASL9/LBD3 in the control over cytokinin and auxin responses. I don't think that based on the data presented the authors may do the conclusions stated on lines 184-185, see also the points below.

      __Our response: __We agree thus we tone down our conclusion in our new manuscript (Line 197-199), see answers below for detail.

      The conclusion about the role of ASL9 and its direct involvement in the apical hook formation and lateral root development/main root growth is a bit exaggerated, based on rather tiny effects mediated by the introduction of asl9-1 into the dcp5-1. Rather, the data suggest that misregulation of other transcripts in the mRNA decay-deficient lines might be responsible for the observed defects. That is also apparent from slightly different phenotypes seen in dcp5-1/pat triple compared to oxASL9 (Fig. 3A). The strong dependency of oxASL9 phenotype on the presence of functional ARR10 and ARR12 implies cytokinin signaling-dependent mechanism of ASL9/LBD3 action (see also point 3 below). Considering the aforementioned phenotype differences between the dcp5-1/pat triple and oxASL9, it would be interesting to see the possible dependence of the mRNA decay-deficient line phenotypes on the cytokinin signaling, too.

      __Our response: __We note restoration of dcp5-1 developmental defects in asl9 backgrounds is partial, indicating other ASLs or non-ASLs also contributing to apical hook and lateral root development (old Line 224-225, new Line 229-230 &234-235). We also note that partial suppression is a common phenomenon when studying discrete developmental traits. Two such examples could include the knockout of TPXL5 which partially suppressed the increase of LR density in the hy5 mutant and the introduction of a point mutation in SnRK2.6 in the gsnor1-3/ost1-3 double-mutant partially suppressed the effect of gsnor1-3 on ABA-induced stomatal closure (Qian et al., 2022 The Plant Cell doi.org/10.1093/plcell/koac358; Wang et al., 2015 PNAS 112, 613). In addition to such discrete developmental traits, more dramatic phenotypes like autoimmunity may also only be partially suppressed (Zhang et al., 2012 CH&M 11, 253). However, we agree that it’s interesting to check the dependence of cytokinin signaling of the developmental defects in mRNA decay-deficient mutants. Unfortunately, we were only able to cross arr10 arr12 into dcp5-1. This line showed similar partial restoration of dcp5-1 developmental defects as seen for dcp5-1asl9-1. Overall, these data indicates that contribution of mRNA decapping targeting ASL9 transcripts during apical hook and LR formation depends on ARR10 and ARR12 (Fig. 4&6, Line 180-186).

      Also the hypothesis on the upregulation of cytokinin signaling in the mRNA decay mutants and Col-0/oxASL9 is very indirect and should be tested using e.g. TCSn:GFP. The type A ARRs (RRAs) are not only the negative regulators of cytokinin signaling, but also the cytokinin primary response genes. Thus, the downregulation of RRAs could mean the downregulation of the cytokinin signaling pathway in the mRNA decay mutants and/or Col-0/oxASL9. The latter seems to be the case as shown recently (Ye et al., 2021).

      __Our response: __We thank the reviewer for suggesting a different annotation of our result regarding to type-A ARRs. Ye et al reported accumulation of ASL9/LBD3 induced downregulation of cytokinin pathway based on weaker ARR5 and TCSn-GFP signal(Ye et al., 2021). However, the fact that knocking out cytokinin signaling activator genes ARR10 and ARR12 largely restored developmental defects in ASL9 over-expressors lead to the hypothesis of upregulated cytokinin signaling in ASL9 over-expressors (Fig 5). Therefore, we substitute “upregulation” with “misregulation” for cytokinin signaling to compromise in our new manuscript (Line 174).

      The hypothesis on the causal link between the observed auxin-related defects and upregulated cytokinin signaling (Discussion, lines 214-216) is more than speculation. This could be tested by introducing arr10 arr12 into the dcp2-1/DR5-GFP and/or dcp5-1/DR5-GFP.

      __Our response: __We thank the reviewer for the suggestions, due to time and funds management, we decided to check auxin related gene expression in dcp5-1arr10-5arr12-1 mutants instead of making transgenic plants in triple mutant. The repressed expression of SAUR23 and TAR2 in dcp5-1 is partially restored (Fig. S4), indicating possible repression of auxin signaling caused by upregulated cytokinin signaling. However, for consistency in cytokinin signaling description, we tone down the hypothesis on the link between auxin-related defects and cytokinin signaling (Line 218-220).

      Compared to the text/quantification of the effect of asl9-1 mutant on the hook formation (Fig. S1D), I see exaggerated hook formation both in the presence and absence of ACC in asl9-1, at least on the figures shown in Fig. S1C. Are the shown seedlings not representative?

      __Our response: __We thank the reviewer for pointing our mistakes out, the shown seedlings are representative but mislabeled and the mistakes are corrected now in our new manuscript (Fig. S1C).

      Minor Comments 1. Syntax problem in the sentence on lines 45-46 (?).

      __Our response: __We thank the reviewer for pointing it out, syntax problem of this sentence is solved now in new manuscript (Line 41-44).

      The sentence on lines 48-49 should be rephrased. It implies the cytokinins regulate the amount of RRBs, which is not correct (cytokinins control phosphorylation of RRBs, not their abundance, RRAs are not TFs).

      __Our response: __We now rephrase the sentence in a correct way (Line 46)

      In the FL for Fig. 2F there is mentioned that MYC-YFP was used as a control compared to the main text mentioning YFP-WAVE (?).

      __Our response: __We thank the reviewer for pointing this out, the YFP-WAVE line we used is MYC-YFP transgenic plants, we now include this information in our manuscript (Line 136) and for consistency we changed MYC-YFP to YFP-WAVE in Fig. 2F.

      Naito et al. (2007) suggest ASL9 as a target of cytokinin signaling, but I don't think they imply the involvement of ASL9 in the cytokinin signaling as mentioned e.g. on line 166 (?)

      __Our response: __We largely agree with the reviewer thus we also cite Ye’s paper here in our new manuscript (Line 165)

      References Ye L, Wang X, Lyu M, Siligato R, Eswaran G, Vainio L, Blomster T, Zhang J, Mahonen AP. 2021. Cytokinins initiate secondary growth in the Arabidopsis root through a set of LBD genes. Curr Biol 31(15): 3365-3373 e3367.

      Reviewer #2 (Significance (Required)):

      The authors provide interesting data suggesting possible role of mRNA decay machinery in the hook and lateral root formation and main root growth via decapping-mediated control over ASL9/LBD3 transcript abundance. Based on the observed interaction of the observed phenotypes with hormonal regulations, the authors' conclude mechanistic link between the mRNA decay/ASL9 and cytokinin and auxin responses.

      Our response: We thank the reviewer for acknowledging the significance of our findings.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Major Comments

      1. My main concern is about the authors' conclusions on the role of mRNA decay and ASL9/LBD3 in the control over cytokinin and auxin responses. I don't think that based on the data presented the authors may do the conclusions stated on lines 184-185, see also the points below.
      2. The conclusion about the role of ASL9 and its direct involvement in the apical hook formation and lateral root development/main root growth is a bit exaggerated, based on rather tiny effects mediated by the introduction of asl9-1 into the dcp5-1. Rather, the data suggest that misregulation of other transcripts in the mRNA decay-deficient lines might be responsible for the observed defects. That is also apparent from slightly different phenotypes seen in dcp5-1/pat triple compared to oxASL9 (Fig. 3A). The strong dependency of oxASL9 phenotype on the presence of functional ARR10 and ARR12 implies cytokinin signaling-dependent mechanism of ASL9/LBD3 action (see also point 3 below). Considering the aforementioned phenotype differences between the dcp5-1/pat triple and oxASL9, it would be interesting to see the possible dependence of the mRNA decay-deficient line phenotypes on the cytokinin signaling, too.
      3. Also the hypothesis on the upregulation of cytokinin signaling in the mRNA decay mutants and Col-0/oxASL9 is very indirect and should be tested using e.g. TCSn:GFP. The type A ARRs (RRAs) are not only the negative regulators of cytokinin signaling, but also the cytokinin primary response genes. Thus, the downregulation of RRAs could mean the downregulation of the cytokinin signaling pathway in the mRNA decay mutants and/or Col-0/oxASL9. The latter seems to be the case as shown recently (Ye et al., 2021).
      4. The hypothesis on the causal link between the observed auxin-related defects and upregulated cytokinin signaling (Discussion, lines 214-216) is more than speculation. This could be tested by introducing arr10 arr12 into the dcp2-1/DR5-GFP and/or dcp5-1/DR5-GFP.
      5. Compared to the text/quantification of the effect of asl9-1 mutant on the hook formation (Fig. S1D), I see exaggerated hook formation both in the presence and absence of ACC in asl9-1, at least on the figures shown in Fig. S1C. Are the shown seedlings not representative?

      Minor Comments

      1. Syntax problem in the sentence on lines 45-46 (?).
      2. The sentence on lines 48-49 should be rephrased. It implies the cytokinins regulate the amount of RRBs, which is not correct (cytokinins control phosphorylation of RRBs, not their abundance, RRAs are not TFs).
      3. In the FL for Fig. 2F there is mentioned that MYC-YFP was used as a control compared to the main text mentioning YFP-WAVE (?).
      4. Naito et al. (2007) suggest ASL9 as a target of cytokinin signaling, but I don't think they imply the involvement of ASL9 in the cytokinin signaling as mentioned e.g. on line 166 (?)

      References

      Ye L, Wang X, Lyu M, Siligato R, Eswaran G, Vainio L, Blomster T, Zhang J, Mahonen AP. 2021. Cytokinins initiate secondary growth in the Arabidopsis root through a set of LBD genes. Curr Biol 31(15): 3365-3373 e3367.

      Significance

      The authors provide interesting data suggesting possible role of mRNA decay machinery in the hook and lateral root formation and main root growth via decapping-mediated control over ASL9/LBD3 transcript abundance. Based on the observed interaction of the observed phenotypes with hormonal regulations, the authors' conclude mechanistic link between the mRNA decay/ASL9 and cytokinin and auxin responses.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      In this manuscript, the authors describe the role of the mRNA decay machinery in apical hook formation during germination in darkness in A.thaliana. As reported, this machinery is predominantly described in literature in stress response processes, whereas little is known about its involvement during developmental processes. In detail, the authors demonstrated, via RNA immunoprecipitation (RIP) and genetic experiments, the direct regulation of the LATERAL ORGAN BOUNDARIES DOMAIN 3 (LBD3)/ASYMMETRIC LEAVES 2-19 LIKE 9 (ASL9) mRNA stability by the mRNA decapping machinery subunits DCPs. According to the manuscript, ASL9 controls apical hooking, LR development and primary root growthis regulating cytokinin signalling and hence its regulation helps to maintain a correct balance of auxin/cytokinin. Indeed, they showed an impair apical hooking and LR defects both in mRNA decapping mutants, where they observed more capped ASL9 compared to WT, and in ASL9 over-expressor lines. Moreover, they reported a largely restoration of over-expressor lines phenotype in the arr10-5arr12-1 double mutants.

      This work present simple but interesting data that corroborate the authors hypothesis. Nonetheless, I have both major comments and minor comments to improve the manuscript:

      Major comments

      1. I am a bit concerned by the fact that cytokinin, auxin, LBD3,ARR12 and ARR10 have been largely involved in vasculature development and that the obtained results might be due to their role in vasculature development more than in LBD3 mRNA decapping process. Authors should provide evidence that their results are independent from vasculature defects present in those backgrounds or in case discuss this possibility.
      2. The interaction between the described players and auxin is not clear. From the reported experiments it is difficult to understand what authors wants to report as in S4 and S5 are reported experiments not fully described in the text (authors report about introgression of DR5::GFP in dcp1 and 2 mutants, but SD4 reports ACC treatments of DR5::GFP,dcp2 mutants and SD5 of 7 dpg root meristems of this strain ). Please describe and discuss better the experiment. Also, to this reviewer it is difficult to understand whether the absence of auxin activity in the dcp2 mutants hypocotyl is merely an effect of the lack of the hook formation in this background or a cause. Please clarify this point including new experiments (axr1 or axr3 mutants might help in understand this point).
      3. Authors conclude that mRNA decapping is also involved in root growth. However, they do not report direct evidences regarding root growth but mostly regarding the mere root lenght at a precise developmental stage. Please eliminate this point or provide new experiments (e.g., root length and root meristem activity over time)
      4. Regarding root growth defects, these might be due to defect in the vasculature development, please analyse this point or report new experiments (e.g., vasculature analysis of dcp1,2 mutants or tissue specific expression of DCP2).
      5. For consistency the last paragraph of result section: "ASL9 directly contributes to apical hooking, LR formation and primary root growth" should be part of the result section entitled "Accumulation of ASL9 suppresses LR formation and primary root growth". Authors should move this result in the paragraph before "Interference of a cytokinin pathway and/or exogenous auxin restores developmental defects of ASL9 over-expressor and mRNA decay deficient mutants".
      6. I suggest being consistent in the description of the statistical analysis. In particular:
        • I suggest reporting the meaning of ANOVA letters and the P-value in each figure as sometimes these information are missing, especially in Fig.2.
        • in Fig.S3 please report the statistical significance on bars and the statistical analysis performed.

      Minor comments

      L31- please replace "normal" with "proper"

      L42-please report the acronym of axr1

      L57, L59-please include the entire name of DCP2 and XRN

      • Please report how many plants were analysed in legend or in methods section
      • Please report how many transgenic independent lines were obtained in methods section
      • Please, try to change the colours of the graph in Fig.S2A-B, as it quite difficult to distinguish light grey shades.
      • In Fig. 5A and S5A scale bars are missing.

      Significance

      The manuscript is interesting and analyse important and overlooked aspects of the role of mRNA decapping in development. Nonetheless experiments reported are not particularly innovative and not always sound. Also authors analysis are a bit superficial probably because they decide to utilize too many systems in their research (root development, hook development and lateral root development).

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Revision Plan

      Manuscript number: RC-2022-01765

      Corresponding author(s): Dr. Huiqing Zhou (Radboud University)

      1. General Statements [optional]

      We like to thank the editor and reviewers for their constructive comments and suggestions for improving the manuscript. We here address the comments point-by-point using the template of the revision plan.

      2. Description of the planned revisions

      Reviewer #1:

      • While the study is complete and describes well, a strong conclusion, including validation of the role of some TFs such as FOSL2 through knock out experiments in model organisms or cell culture will elevate the paper more (optional). *

      To address this point, we will perform siRNA knockdown experiments of TFs identified in our study, including FOSL2, in primary LSCs, and examine the transcriptional consequences of knocking down these TFs by RNA-seq or RT-qPCR analyses.

      Reviewer #2:

        • The findings provide an overview of transcriptional regulators and targets in two essential tissues. This is a valuable tool for future discoveries regarding the processes governing cell differentiation and those involved in the disease mechanism of the cornea. Although the presented predictions are interesting, what is missing is an examination of the functional significance of the findings. * Indeed, we fully agree with the reviewer that additional functional examinations are important and relevant and would strengthen the manuscript. We propose to do the following functional analyses to further demonstrate the importance of the key TFs.
      1. Immunostaining of the key TFs in the human cornea and in LSCs and KCs.

      2. As described above, we will perform siRNA experiments for key TFs identified in our study, followed by RNA-seq or RT-qPCR analysis, to assess the transcriptional program controlled by these key TFs.
      3. The gene regulatory network controlled by these tested TFs will be analysed, to examine the interplay of these TFs in transcriptional regulation and in cell fate determination. Reviewer #2:

      4. Also, the findings indicate an interaction between FOXL2 and other TFS is important for maintaining the corneal epithelium. These interesting predictions indicate an important role for FoxL2 in corneal function. It would be important to verify these predictions by experimental studies, for example, by presenting the association of FOXL2 with the predicted co-factors and presenting data on the effect of the identified mutation on FOXL2 transcriptional activity.

      *

      We assume that Reviewer #2 refers to FOSL2 instead of FOXL2. We agree with this reviewer’s suggestion to functionally address the importance of FOSL2 in the cornea. In order to answer this, we plan to perform FOSL2 staining and FOSL2 siRNA knockdown in LSCs, followed by RNA-seq, as described above. This will show the FOSL2 importance in LSCs and in cornea, and will identify the affected downstream gene networks.

      Regarding the clinical effect of the specific FOSL2 variant reported in our study, we agree that functional validation would strengthen our work even more. We believe that the main message of the study is the use of integrative omics analyses to uncover new transcription factors involved in corneal and limbal fates, and to highlight new candidate genes in corneal disease. Therefore we feel that the disease mechanism behind the specific FOSL2 variant, albeit interesting, is beyond the scope of this study. Nonetheless, we reinforced the pathogenicity of the variant with various in silico prediction platforms (supplementary table 9). Interestingly, a recent study reported that FOSL2 truncating mutations are involved in a new syndrome with ectodermal defects and cataract. This is in line with our findings that FOSL2 is an important shared TF in both LSCs and KCs, and strengthens the predicted role of FOSL2 in the epithelium of the eye and associated diseases. We have included additional discussion on this study in the Discussion line 662-668.

      3. Description of the revisions that have already been incorporated in the transferred manuscript

      Reviewer #2:

      In Figure 1, the authors compare the transcriptome and epigenome (ATAC-seq and histone modifications) of basal KCs from skin donors and cultured LSCs established from limbal biopsies. The authors should clarify the source of the cells in the published studies - specifically, why more data were needed and if these were comparable to their datasets.

      We have included the cell sources and cultured conditions from the published studies and added additional columns in the supplementary tables 1, 2 and 3. Briefly, LSC publicly available samples were extracted from post-mortem cornea and cultured in DMEM/F12, or KSFM.

      Regarding the questions on the necessity of incorporating more data, our reasoning was two-fold. First of all, we have taken an integrated approach to perform our analysis, using both our own and publicly available datasets. We see this as a strength, as the most important differences between cell types that determine cell fates should be consistent with cells generated from different donors and labs. Second, we choose to generate more data in our own lab in order to make sure to have comparisons without the influence of technical differences between publicly available datasets. We include text about this approach in the Discussion (lines) 578-580. Furthermore, to show that the datasets we used are consistent and can be integrated, we have performed a PCA correlation analysis for the RNA-seq analysis (supplementary figures 1A&1B lines 834-837), and added a spearman correlation analysis for the ATAC-seq datasets (supplementary figure 5F & lines 818-820). Both indicated clear biological signal similarities between cell types across different labs and techniques.

      Reviewer #2:

      3.Next, they compared the transcriptomes of LSCs and KCs to the transcription profile of LSCs from two aniridia patients and control. They need to specify the stage of the donors' disease and provide details on the control samples.

      Both aniridia samples were from patients of stage 4 on the Lagali Stages (Lagali, N. et al. (2020) ‘Early phenotypic features of aniridia-associated keratopathy and association with PAX6 coding mutations’, The Ocular Surface, 18(1), pp. 130–140. We have included this information in Material and Methods (lines 738-739). For healthy control cells, no information regarding the stage and gender is available, as they are from anonymous individuals. We added more information on the aniridia and control samples regarding the culture conditions and passage numbers (lines 747:750).

      Reviewer #2:

      • In addition, and as indicated above, when combining published datasets, one should clarify whether the methods of collecting/growing the cells and the disease stage are comparable. This is important with samples from aniridia as it is unclear if the patient LSCs survive the isolation or if other cells take over.*

      Healthy LSC cells used in the direct comparison with aniridia LSC cells were grown using the same expansion and culture conditions. Furthermore, the method of culture, extraction and expansion between the earlier published aniridia cell data and our data are exactly the same (lines 735:750). As described above, we have included the cell sources from the aniridia samples, and added additional columns in the supplementary table 1.

      Reviewer #2:

      • It would be valuable to the community if the presented data were also provided online in a web tool so that CRE activity or gene expression could be easily examined.*

      We have expanded the UCSC track hub to highlight the identified variable CRE elements. This will enable a searchable tool for differential CREs close to genes of interest between KCs and LSCs. We have furthermore added a sentence to explicitly mention the presence of this track hub in the result section (lines 248-249).

      4. Description of analyses that authors prefer not to carry out

      Reviewer #1:

      1. By identifying differential cis regulatory elements in two cells, they identify TFs that are associated with overexpression or repression of genes of interest. However, this approach of relying solely upon nearest genes of CREs is very cursory and the authors could have used methods such as Activity-by-Contact to establish CREs and their target genes and then assessed their correlation with expression (optional). Activity-by-Contact incorporation would be an exciting inclusion in the data analysis, and for the next step in GRN modelling. However, this is out of the scope of this manuscript. In addition, we would like to point out that we did not solely rely on the method of mapping CREs to the nearest genes. Instead, for H3K27ac and ATAC-seq signals, our analysis uses a weighted TSS distance method, within windows of up to 100kb, similar to the method ANANSE and other published gene regulatory network tools. For H3K4me3 and H3K27me3 marks which correlate far better with an expression of the closest genes, we use a window of 2kb at the closest gene.

      Reviewer #2:

      When ATAC-seq was combined with histone modification analyses, about a third of these regions showed different characteristics, inferring tissue-specific activities. These data may be valuable for identifying tissue-specific cis-regulatory elements (CREs) for the key TFs. This, however, remains to be examined experimentally.

      It is not fully clear to us what ‘experimentally examination’ was referred to by this reviewer, whether to test these tissue-specific CREs individually or globally. We agree that it is important to test tissue-specific CREs experimentally to examine their function, e.g., which genes they are regulating, and which role they play in tissue-specificity. However, this is out of the scope of this manuscript.


      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      Multi-omics analyses identify transcription factor interplay in corneal epithelial fate determination and disease The authors of this manuscript describe their work on identifying transcriptional regulators and their interplay in cornea using limbal stem cells and epidermic using keratinocytes. This is a very well written and well described comprehensive manuscript. The authors performed various analyses which were in line with logical workflow of the research question. The authors begin by first identifying differential gene expression signals for the two tissues along with enriched biological processes using GSEA and PROGENy. The strength of this manuscript also includes usage of epigenetic data to determine the cell fate and its drivers. The authors study various epigenetic assays and correlate them expression levels of TFs and genes to identify regulatory patterns that mark differences between LSCs and KCs. By identifying differential cis regulatory elements in two cells, they identify TFs that are associated with overexpression or repression of genes of interest. However, this approach of relying solely upon nearest genes of CREs is very cursory and the authors could have used methods such as Activity-by-Contact to establish CREs and their target genes and then assessed their correlation with expression (optional). In logical progression, the authors use gene regulatory networks using to compare LSC and KC with Embryonic Stem Cells (ESC) to identify most influential TFs to differentiate them. Along with identifying key TFs, they also identify TF regulatory hierarchy to find TFs that regulate other TFs in context-specific manner. They identify "p63, FOSL2, EHF, TFAP2A, KLF5, RUNX1, CEBPD, and FOXC1 are among the shared epithelial TFs for both LSCs and KCs. PAX6, SMAD3, OTX1, ELF3, and PPARD are LSC specific TFs for the LSC fate, and HOXA9, IRX4, CEBPA, and GATA3 were identified as KC specific TFs." And "p63, KLF4 and TFAP2A can potentially co-regulate PAX6 in LSCs." To compare in vitro findings with in vivo results, they also generate single cell data and identify specific TFs that may play pathobiological role in disease development and progression. While the study is complete and describes well, a strong conclusion, including validation of role of some TFs such as FOSL2 through knock out experiments in model organisms or cell culture will elevate the paper more (optional). This study merits publication in high quality journal (IF:10-15)

      Reviewer #1 (Significance (Required)):

      The study is very significant not only in the context of corneal disease biology. The imbalance in interplay of TFs is often envisaged behind disease development but very few efforts of detailed analysis are undertaken. This study is performed very well and the methods are described in clear manner. Appropriate statistical methods are used where required.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      The study by Smits et al. presents detailed multi-omics (transcripts, ATAC-seq, histone marks) analyses comparing human limbal stem cells (LSCs) to skin keratinocytes (KCs). The authors compared these two cell types because they have a shared origin in the epidermal progenitors and because LSC diseases occasionally accompany a transition to KC-like phenotypes. The authors analyzed the "omics" data using several bioinformatic analysis tools. Their analyses resulted in a detailed list of the critical transcription factors (TFs) and their gene regulatory networks shared between the two lineages and those unique to either LSCs or KCs.

      The findings provide an overview of transcriptional regulators and targets in two essential tissues. This is a valuable tool for future discoveries regarding the processes governing cell differentiation and those involved in the disease mechanism of the cornea. Although the presented predictions are interesting, what is missing is an examination of the functional significance of the findings. Also, as detailed below, there is a need to clarify the source of the cells used for the different analyses.

      Comments and suggestions: 1. In Figure 1, the authors compare the transcriptome and epigenome (ATAC-seq and histone modifications) of basal KCs from skin donors and cultured LSCs established from limbal biopsies. The authors should clarify the source of the cells in the published studies - specifically, why more data were needed and if these were comparable to their datasets. 2. Next, they compared the transcriptomes of LSCs and KCs to the transcription profile of LSCs from two aniridia patients and control. They need to specify the stage of the donors' disease and provide details on the control samples. In addition, and as indicated above, when combining published datasets, one should clarify whether the methods of collecting/growing the cells and the disease stage are comparable. This is important with samples from aniridia as it is unclear if the patient LSCs survive the isolation or if other cells take over. The finding that LSC genes are reduced in aniridic LSCs may suggest that the cells resemble KCs, although specific KC genes are not elevated. 3. Figure 2: The authors characterized the regulatory regions in the two cell types based on ATAC-seq and histone marks. Based on ATAC-seq, 80% of the open areas were shared between the two lineages. When ATAC-seq was combined with histone modification analyses, about a third of these regions showed different characteristics, inferring tissue-specific activities. These data may be valuable for identifying tissue-specific cis-regulatory elements (CREs) for the key TFs. This, however, remains to be examined experimentally. 4. It would be valuable to the community if the presented data were also provided online in a web tool so that CRE activity or gene expression could be easily examined. 5. Using motif predictions, the authors point to the TF families that likely control the differential CREs (Figure 3). Next, the authors constructed the gene regulatory network based on the (ANANSE) pipeline, which integrates CRE and TF motif predictions with the expression of TFs and their target genes. To gain further insight into the shared gene regulatory networks, they compared each to similar data from embryonic stem cells. Their analysis further suggests shared TFs regulating each other and some of the tissue-specific transcription factors. Differential gene expression of the TFs was partially validated by analyzing available single-cell data (Figure 4). 6. In the final section of the study, the authors aimed to identify TFs in LSCs that are relevant to corneal disease. They examined whether the LSC TFs are bound to genes associated with LSC deficiency and inherited corneal diseases. To accomplish this task, the authors incorporated single-cell data on corneal gene expression and available datasets on genetic analyses of families. Through this analysis, they identified a mutation in FOSL2 that may be causing corneal opacity in the carriers. Also, the findings indicate an interaction between FOXL2 and other TFS is important for maintaining the corneal epithelium. These interesting predictions indicate an important role for FoxL2 in corneal function. It would be important to verify these predictions by experimental studies, for example, by presenting the association of FOXL2 with the predicted co-factors and presenting data on the effect of the identified mutation on FOXL2 transcriptional activity.

      Reviewer #2 (Significance (Required)):

      The analysis provides an overview of transcriptional regulators and targets in two essential tissues. This is a valuable tool for future discoveries regarding the processes governing cell differentiation and those involved in the disease mechanism of the cornea. The results predict a role for FoxL2 in corneal function.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      The study by Smits et al. presents detailed multi-omics (transcripts, ATAC-seq, histone marks) analyses comparing human limbal stem cells (LSCs) to skin keratinocytes (KCs). The authors compared these two cell types because they have a shared origin in the epidermal progenitors and because LSC diseases occasionally accompany a transition to KC-like phenotypes. The authors analyzed the "omics" data using several bioinformatic analysis tools. Their analyses resulted in a detailed list of the critical transcription factors (TFs) and their gene regulatory networks shared between the two lineages and those unique to either LSCs or KCs.

      The findings provide an overview of transcriptional regulators and targets in two essential tissues. This is a valuable tool for future discoveries regarding the processes governing cell differentiation and those involved in the disease mechanism of the cornea. Although the presented predictions are interesting, what is missing is an examination of the functional significance of the findings. Also, as detailed below, there is a need to clarify the source of the cells used for the different analyses.

      Comments and suggestions:

      1. In Figure 1, the authors compare the transcriptome and epigenome (ATAC-seq and histone modifications) of basal KCs from skin donors and cultured LSCs established from limbal biopsies. The authors should clarify the source of the cells in the published studies - specifically, why more data were needed and if these were comparable to their datasets.
      2. Next, they compared the transcriptomes of LSCs and KCs to the transcription profile of LSCs from two aniridia patients and control. They need to specify the stage of the donors' disease and provide details on the control samples. In addition, and as indicated above, when combining published datasets, one should clarify whether the methods of collecting/growing the cells and the disease stage are comparable. This is important with samples from aniridia as it is unclear if the patient LSCs survive the isolation or if other cells take over. The finding that LSC genes are reduced in aniridic LSCs may suggest that the cells resemble KCs, although specific KC genes are not elevated.
      3. Figure 2: The authors characterized the regulatory regions in the two cell types based on ATAC-seq and histone marks. Based on ATAC-seq, 80% of the open areas were shared between the two lineages. When ATAC-seq was combined with histone modification analyses, about a third of these regions showed different characteristics, inferring tissue-specific activities. These data may be valuable for identifying tissue-specific cis-regulatory elements (CREs) for the key TFs. This, however, remains to be examined experimentally.
      4. It would be valuable to the community if the presented data were also provided online in a web tool so that CRE activity or gene expression could be easily examined.
      5. Using motif predictions, the authors point to the TF families that likely control the differential CREs (Figure 3). Next, the authors constructed the gene regulatory network based on the (ANANSE) pipeline, which integrates CRE and TF motif predictions with the expression of TFs and their target genes. To gain further insight into the shared gene regulatory networks, they compared each to similar data from embryonic stem cells. Their analysis further suggests shared TFs regulating each other and some of the tissue-specific transcription factors. Differential gene expression of the TFs was partially validated by analyzing available single-cell data (Figure 4).
      6. In the final section of the study, the authors aimed to identify TFs in LSCs that are relevant to corneal disease. They examined whether the LSC TFs are bound to genes associated with LSC deficiency and inherited corneal diseases. To accomplish this task, the authors incorporated single-cell data on corneal gene expression and available datasets on genetic analyses of families. Through this analysis, they identified a mutation in FOSL2 that may be causing corneal opacity in the carriers. Also, the findings indicate an interaction between FOXL2 and other TFS is important for maintaining the corneal epithelium. These interesting predictions indicate an important role for FoxL2 in corneal function. It would be important to verify these predictions by experimental studies, for example, by presenting the association of FOXL2 with the predicted co-factors and presenting data on the effect of the identified mutation on FOXL2 transcriptional activity.

      Significance

      The analysis provides an overview of transcriptional regulators and targets in two essential tissues. This is a valuable tool for future discoveries regarding the processes governing cell differentiation and those involved in the disease mechanism of the cornea. The results predict a role for FoxL2 in corneal function.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Multi-omics analyses identify transcription factor interplay in corneal epithelial fate determination and disease The authors of this manuscript describe their work on identifying transcriptional regulators and their interplay in cornea using limbal stem cells and epidermic using keratinocytes. This is a very well written and well described comprehensive manuscript. The authors performed various analyses which were in line with logical workflow of the research question. The authors begin by first identifying differential gene expression signals for the two tissues along with enriched biological processes using GSEA and PROGENy. The strength of this manuscript also includes usage of epigenetic data to determine the cell fate and its drivers. The authors study various epigenetic assays and correlate them expression levels of TFs and genes to identify regulatory patterns that mark differences between LSCs and KCs. By identifying differential cis regulatory elements in two cells, they identify TFs that are associated with overexpression or repression of genes of interest. However, this approach of relying solely upon nearest genes of CREs is very cursory and the authors could have used methods such as Activity-by-Contact to establish CREs and their target genes and then assessed their correlation with expression (optional). In logical progression, the authors use gene regulatory networks using to compare LSC and KC with Embryonic Stem Cells (ESC) to identify most influential TFs to differentiate them. Along with identifying key TFs, they also identify TF regulatory hierarchy to find TFs that regulate other TFs in context-specific manner. They identify "p63, FOSL2, EHF, TFAP2A, KLF5, RUNX1, CEBPD, and FOXC1 are among the shared epithelial TFs for both LSCs and KCs. PAX6, SMAD3, OTX1, ELF3, and PPARD are LSC specific TFs for the LSC fate, and HOXA9, IRX4, CEBPA, and GATA3 were identified as KC specific TFs." And "p63, KLF4 and TFAP2A can potentially co-regulate PAX6 in LSCs." To compare in vitro findings with in vivo results, they also generate single cell data and identify specific TFs that may play pathobiological role in disease development and progression. While the study is complete and describes well, a strong conclusion, including validation of role of some TFs such as FOSL2 through knock out experiments in model organisms or cell culture will elevate the paper more (optional). This study merits publication in high quality journal (IF:10-15)

      Significance

      The study is very significant not only in the context of corneal disease biology. The imbalance in interplay of TFs is often envisaged behind disease development but very few efforts of detailed analysis are undertaken. This study is performed very well and the methods are described in clear manner. Appropriate statistical methods are used where required.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Reviewer #1 (Evidence, reproducibility and clarity):

      This manuscript describes studies that indicate roles for the ALK and LTK receptors in neuronal polarity, cortical patterning and behavior in mice. I really liked the study and overall think that it deserves publication in a high-ranking journal. It reports important and novel results and benefits from a comprehensive analysis at multiple levels, including cell biological, biochemical and behavior. The points raised below are suggestions for consideration at the discretion of the authors.

      We thank the reviewer for the positive and enthusiastic comments on our study and especially for noting that it is appropriate for publication in a high-ranking journal. We greatly appreciate the valuable suggestions, the majority of which we have incorporated into the revised manuscript.

      1. The term "DKO" appears in the Introduction without explanation. I assume this means double KO mice lacking both receptors from birth. It should be indicated here, just in case.

      We have added text at the first appearance of DKO (ie results section) to indicate that this refers to double knockout mice that lack both Ltk and Alk from birth.

      1. The last paragraph of the Introduction is redundant with the Abstract. This is a stylistic question, which is up to the authors. Nevertheless, as a suggestion, they could take the opportunity here to explain the rationale of the study and why they did what they did._

      We have made some modifications to provide an indication of the rationale for the studies.

      1. Is "single cell in situ mRNA analysis" standard in situ hybridization or something else? Why is it called "single-cell"? It could be misleading.

      This was a typographical error and has been corrected to single molecule in situ.

      1. In Fig. S1B, could the authors please include expression patterns of LTK in adult brain? It'd seem that is the most relevant place to look given the analysis that follows in the paper.

      We have replaced the previous panels with new plots (now Fig. S1G) showing the relative expression of Ltk, Alk and their ligand, Alkal2 in embryos (E15.5), newborn (P0) and post-natal Day 2 (P2) and Day 7 (P7) and in adults both in the cortex and whole brain. The results confirm that Alk and Ltk are both expressed in the cortex and brain but in varying patterns with Alk expression decreasing with age and Ltk increasing, particularly in the cortex. In contrast, Alkal2 expression is relatively constant throughout.

      Related comments #5, #7, #8 and #9.

      1. I have an issue in general in the first part of the manuscript with regards to the labeling of cortical layers. How were CP, IZ and SVZ/VZ defined? Specific markers should be used to identify their actual boundaries. Guesswork from the DAPI pattern (if that is what was used) is not really appropriate.

      2. In Fig. 1F, again, how were the boundaries between the cortical areas (dotted lines) determined? This is particularly important for the mutant sections....

      3. In Fig. S3C-F, the all-critical quantification of Ctip2 cells at P2 seems to be missing in this figure. It would important to provide this in light of the comments above. Again, the same problem with the layer boundaries is clear here.....

      4. In Figure 2A and B, % positive cells is plotted but we are not told what is the reference (100%) level. ... Also, the idea of drawing a little rectangle in the IZ and CP and counting only there is flawed. ...Finally, again, we are not told how the boundaries of the different cortex areas were established. ...

      Response to related comments #5, #7, #8 and #9.

      As exemplified in the related comments above, the reviewer indicated that they “__have an issue in general in the first part of the manuscript with regards to the labeling of cortical layers.”

      We thank the reviewer for this insightful comment. Development of the mouse cortex follows a stereotypical pattern, thus we used a combination of DAPI ( ie nuclear density is characteristic of some layers), and layer specific markers (Satb2, Ctip2, Pax6, Sox2, Tbr2) to label the cortical layers. While this is generally acceptable for wild type mice, we agree with the reviewer’s comment that this may not be appropriate in mutant mice. Accordingly, we have now taken a more unbiased approach and repeated all of the quantitation after creating equally sized bins that span the entire cortical length and have plotted the quantitation by bin location. The general location of layers in WT mice has been marked on the images for reference. Our conclusions that there are defects in early patterning that are resolving by ~P7 is unchanged.

      With this re-quantitation, some of the previous reviewer comments within #5, 7, 8 and 9 no longer apply (ie a missing plot, box placement being subjective, etc) and so have not been responded to. With regards to the question of what is the reference (ie 100%) for the plots showing the y-axis as % positive; this was determined based on the total number of DAPI+ cells counted in each region. This information has been added to the legends and methods along with details of the new quantitation method.

      1. Comparing Fig. 1 and Fig. S2, there would seem to be little or no additive nor synergistic effects of the double mutation, as the phenotype in the DKO appears to be completely attributable to the Ltk KO. What does this mean? Providing the expression patterns of the two receptors at the ages used here (i.e., P2 and P7) would also be helpful.

      The relative contribution of Alk or Ltk in comparison to the DKO, varies as a function of age (E15.5, P2, P7) that generally correlates with their level of expression, as per the Reviewer’s suggestion. For example, at E15.5, a reduction in the number of Sox2+ or Tbr2+ cells is observed for either Alk or Ltk knockouts alone, with a more prominent reduction in the case of Alk alone, and with the DKOs showing the greatest reduction. In contrast, when examining Ctip2 levels at P2, the loss of Ltk alone yields a stronger effect. In agreement with these observations, analysis of mRNA expression levels show that Alk levels are highest in the embryonic cortex and brain and steadily decline until adulthood, while Ltk expression increases with maximal levels occurring post-natally. As indicated for our reply to comment #4, we have now added plots showing the relative level of expression of Alk and Ltk at various ages from embryos to adults (Fig S1G).

      1. At the end of page 8, it is concluded that Alk/Ltk promote neuronal migration. Is this a cell-autonomous effect? Given the very sparse expression of these receptors (Fig S1), cell-autonomy (which is being implied by the authors) is not at all clear. Is the migration of Alk+ cells affected in the Ltk mutant? Vice-versa?

      In our analysis of mRNA expression using RNAscope we originally included a widefield image that depicts the entire cortex where it is difficult to see expression at the cell level. We now also provide a magnified image of the E15.5 SVZ/VZ that shows that most cells do express the receptors (Fig. S1B). Thus, the results are consistent with the idea that the defect in migration is a cell autonomous effect.

      1. In Fig. S4A, as every cell in these panels bears probe signal, it'd be important to present a negative control, perhaps from KO cultures or wild type cells lacking receptor expression in the same field as expressing cells. At a 75%, 1 in 4 cells in any field should be receptor-negative.

      As requested, we now provide images with a wider field of view that includes negative cells.

      1. Figure S4B is difficult to interpret in the absence of Tau and MAP2 markers, as GFP does not discriminate between axons and dendrites.

      In the original submission we quantitated Tau-1 and MAP2 co-stained neurons in many experiments to demonstrate that Ltk/Alk act on axons, but in some cases, we used Tuj1 to more easily visualize and quantitate neurites. Nevertheless, as requested by the reviewers, in the revised manuscript we have repeated and replaced most of the results with Tuj1 or phalloidin staining with experiments using Tau-1 and MAP2 antibodies, including Fig. 5B-D and Fig. 6A-D and G as well as for Fig. S4B. The new data is consistent with our results using Tuj1 staining and further support our conclusions that Ltk/Alk act via Igf1-r to regulate neuronal polarity.

      In general, the authors are recommended to show more than one cell per condition in their figures. Readers need to be convinced that these are robust phenotypes easily observed on many cells in the same field.

      Due to space constraints, we included only a single representative image for each condition and then provided quantitation to support our conclusions. We have numerous images for all of the presented data and could provide a collage for all panels if considered appropriate. In the meantime, we have added additional images for several experiments in the Main Figures (Fig. 5A-D, Fig. 6A, C) and in Suppl. Figure S4A, B, C where sufficient space was readily available.

      1. In Fig. S4C and D, do the KO neurons become bipolar? I don't see examples of multipolar neurons in the images provided.

      Upon siRNA mediated knockdown of Ltk and/or Alk, we observe about 50% of the neurons are bipolar (ie display the typical wild type single axon phenotype) while roughly 40% display the multiple axon phenotype. With the exception of the control (siCTL), the images provided were selected to show neurons with multiple axons. However, in some of the images, the arrowheads pointing to the axons were inadvertently omitted. These have now been added.

      1. Is there a way to quantify the effects shown in Fig. 3E?

      We attempted to quantitate the number and direction of neurites in the brain sections but because this is a dense tissue, even with Golgi staining, we found it impossible to trace individual neurites back to the cell body and thus were unable to quantitate the effects. As an alternative, we have provided additional images (Fig. S3B) from distinct mice to support our observations of aberrant horizontal neurites in the adult cortex.

      1. The DKO display a dramatically different behavior phenotype compared to single Kos. How can this result be explained given that DKOs are indistinguishable from single KOs in all other parameters studied?

      The reviewer is correct, that the single KO mice do not manifest noticeable behavioural defects except when older and challenged with the most demanding task, the Puzzle box, which measures complex executive functions. We speculate that alternative cortical re-wiring in the single knockouts is sufficient to maintain normal circuitry that cannot be compensated when both Ltk and Alk receptors are deleted. It is also possible that Ltk/Alk regulated signalling events, besides Igf-1r/PI3K could contribute to the behavioural defects observed in the DKO mice, such as the ALK-LIMK-cofilin pathway which regulates synaptic scaling mentioned by the reviewer (Zhou et al., Cell Rep. 2021). Nevertheless, the strong phenotype of the DKOs confirms that Ltk/Alk are important for proper brain function, thus our preference is to retain the behavioural data in the manuscript but to discuss that alternative Ltk/Alk pathways could contribute to the phenotype (which we have now incorporated into the text).

      1. At the end of the behavior section, the authors attribute the phenotypes observed to defects in neuronal polarization. Given that polarization was only studied in vitro, it may be a premature to conclude that neurons fail to polarize in vivo in the absence of direct evidence showing this.

      We agree and have modified the text to remove this inaccurate assertation.

      1. Regarding P-AKT studies, it would be interesting to assess the effects of the ALK7LTK ligands (e.g., from conditioned medium) on the levels of P-AKT in WT neurons.

      We agree that this would be interesting and we had attempted this experiment, but found that treatment of WT cortical neurons with medium conditioned with the ALKAL2 ligand did not change the levels of pAKT under our experimental conditions (namely 20-30 min treatment with ACM). Because the data is negative, it makes it difficult to make a firm conclusion, but if true, it is possible that other pathways might be involved when WT cortical neurons are stimulated with ligand.

      1. In the mid part of page 14, the sentence "Treatment of WT cortical neurons with AG1024 at a dose (1 μM) at which only IGF-1R but not InsR was inhibited restored the single axon phenotype in DKO neurons" is confusing. Treatment performed in WT neurons but assessed in DKO neurons? This must be a typo.

      Thank you for pointing out this typo. It has been corrected.

      1. For completion, it would be informative to test whether IGF-1 antagonizes the effects of ALK and LTK ligands in axon formation.

      As suggested, we performed the requested experiment (with 3 independent repeats). In brief, four hours post-plating neurons were treated with control or ALKAL2-conditioned media and Igf-1 was added after 1 hour. Neurons were fixed at 36 hours, stained for MAP2 and Tau-1 and axons (Tau-1+) quantitated. Consistent with our previous findings, Igf-1 promotes the formation of multiple axons while ligand inhibits axon formation. In the ligand-treated neurons, addition of Igf-1 did not result in a statistically-significant change in the number of axons. These findings are consistent with our model that activation of Ltk/Alk promotes a decrease in cell-surface Igf1-r. This data has been added to the manuscript (Fig. 7J).

      1. The quality of the blot provided to illustrate levels of activated Igf-1r in Fig. 7A is clearly suboptimal. It is not apparent from that blot that phosphorylation of Igf1r is increased in the mutant neurons as the band intensities are indistinguishable. Was this performed in cortex extracts or cultured neurons? Is it affected by treatment with ALK/LTK ligands?

      We apologize for a labelling error that has caused confusion for both reviewers. We have replaced the blots and corrected the labels. We have noted in the legend that the experiments were performed using cultured cortical neurons.

      1. Given the physical interaction between ALK/LTK and IGF-R1, these receptors are presumably co-internalized upon ligand treatment, or? Does treatment with IGF1 induces internalization of ALK or LTK?

      This is a very interesting question. Unfortunately, due to the lack of suitable antibodies for the mouse versions of Alk or Ltk, we are not able to perform these experiments in cortical neurons with endogenous receptor expression. However, our co-immunoprecipitation experiments and in vitro kinase assays, indicate that only versions of LTK and/or ALK with active kinase domains can interact with IGF-1R and that the activated LTK/ALK receptors then phosphorylate IGF-1R and trigger IGF-1R internalization (Fig. 7 and Fig. 8 model). Thus, we would expect that treatment with IGF-1 in the absence of LTK/ALK activation will not affect LTK/ALK internalization but will trigger IGF-1R endocytosis.

      1. The last paragraph in the Results section may be more appropriate for Discussion to avoid repetition. But it is of course up to the authors to decide on stylistic issues.

      We prefer to include a summary of the experimental findings and the model figure at the end of the results.

      1. There is a discussion of possible redundancies between ALK and LTK in the Discussion section which appears to contradict itself. It is first stated (end of p. 18) that the two receptors are not redundant but both required for function. But in p. 19, the significant behavioral phenotypes observed in DKO mice, but not in single KO mice, are attributed to redundancy and compensation between the receptors. This needs some clarification. It's difficult to understand how there can be redundancy for behavior but not for structure or function.

      We have clarified in the discussion, that both receptors are required in the context of neuronal polarity and migration whereas in the case of behaviour, compensatory mechanisms in neural circuitry or perhaps non-redundant Igf-1r independent pathways result in a strong phenotype only in DKO and can compensate for single but not double knockouts.

      Reviewer #1 (Significance):

      see above

      Reviewer #2 (Evidence, reproducibility and clarity):

      Christova et al. analyzed single and double knockout mice for Alk and Ltk to investigate their function in the nervous system and describe defects in cortical development and behavioral deficits. The defects in the formation of cortical layers suggest a delay in radial migration. In culture, 40% of cortical neurons from knockout embryos extend multiple axons. The mechanism responsible for this phenotype is explored in some detail. The authors conclude that Alk and Ltk function non-redundantly to regulate the Igf-1 receptor (Igf-1r). Inactivation of Alk or Ltk increases surface expression and activity of Igf-1r, which induces the formation of multiple axons. The authors propose that Alk and Ltk interact with Igf-1r and promote its endocytosis after activation by their ligand Alkal2, thereby preventing the formation of additional axons. However, the defects in neurogenesis, migration and behavior may have a different cause and should not be attributed only to Igf-1r.

      We would like to thank the reviewer for all the insightful comments and suggestions which we feel have strengthened our study.

      We appreciate the reviewer’s acknowledgement that we have shown that Igf-1r is in involved in Alk/Ltk-mediated regulation of axon outgrowth. To provide evidence that Igf-1r is also important for Ltk/Alk regulated migration in vivo, we explored the effect of the Igf-1r inhibitor, PPP on the migration of neurons in WT and DKO mice by BrdU labelling. Excitingly, this analysis revealed that PPP administration resulted in a partial rescue of the migration defect in Ltk/Alk DKO mice, with BrdU+ neurons being localized to the most superficial layers in P2 mice (Fig. 6F). Thus, these data are consistent with our model that loss of Ltk/Alk can disrupt both neuronal polarity and migration via IGF-1r. We do agree with the reviewer that we have not directly shown that the behavioural defects can be attributed to Igf-1r and it is certainly possible that other pathways or mechanisms may be involved in the complex phenotype. We have updated the manuscript and discuss the potential involvement of other pathways in the discussion.

      Major comments<br /> 1) The role of Alk/Ltk in suppressing the formation of multiple axons is demonstrated by culturing neurons from knockout mice, suppression with siRNAs and treatment with inhibitors. These experiments consistently show that about 40% of cultured neurons extend more than one axon when Alk, Ltk or both are inactivated. Single and double knockout mice are largely normal with the exception of a delay in the formation of distinct cortical layers. The phenotypes of the knockout lines indicate a function in cortical development but Alk and Ltk are not "indispensable" as suggested (p. 18)._

      We will modify the wording to remove the statement that Alk and Ltk are “indispensable” for cortical patterning and rather will indicate that the receptors ‘contribute’ to the timing of cortical patterning.

      The morphology of cortical neurons was analyzed by Golgi staining. A few potential axons (Fig. 3E) were identified only by an absence of dendritic spines and their aberrant trajectory. These results indicate that there are ectopic extensions in the cortex but do not demonstrate that neurons extend multiple axons also in vivo. It has to be confirmed that these extensions are positive for axon-specific markers and that several axons originate from one soma to demonstrate a multiple axon phenotype in vivo. A quantification of the number of neurons with multiple axons would be required to conclude that this phenotype occurs at a similar frequency in vivo.

      As indicated in response to reviewer #1, we attempted to quantitate the Golgi stained images but found it impossible to trace individual neurites to the cell body and thus could not unambiguously identify and quantitate axons. Accordingly, and as suggested by the reviewer, we have modified our conclusion to simply state there are aberrant extensions in the cortex in vivo. Although we were unable to do quantitation, to further support our conclusions, we have provided additional Golgi stained images of WT and DKO mice from an independent experiment (Fig. S3B).

      2) According to the model presented in Fig. 7, Alkal2 activates Alk and Ltk, which stimulate the endocytosis of Igf-1r and thereby prevents the formation of additional axons. A quantification of Igf-1r surface levels by the biotinylation of surface proteins and Western blot shows an increase in knockout neurons. The authors suggest that Alk/Ltk activation stimulates Igf-1r endocytosis but do not demonstrate this directly. An increase in surface expression could also result from a stimulation of exocytosis or recycling.

      We showed that ligand-induced activation of Ltk/Alk in WT neurons resulted in a loss of biotin-labelled cell-surface Igf-1r, which is strongly indicative of increased internalization and cannot be explained by exocytosis. However, the reviewer is correct, that we cannot exclude the possibility that changes in exocytosis or recycling might also occur and that in the unstimulated DKO neurons, the increase in surface expression of Igf-1r could also result from a stimulation of exocytosis or recycling. Indeed, several papers (Laurino et al, 2005, PMID: 16046480; Oksdath et al, 2017, PMID: 27699600; Quiroga et al, 2018, PMID: 29090510) have reported that exocytosis mediated transport of IGF-1R and activation of IGF-1R/PI3K pathway is essential for the regulation of membrane expansion during axon formation. Accordingly, we have modified the discussion text to incorporate this possibility.

      3) The localization of Alk, Ltk and Alkal2 was determined by in situ hybridization. The signals are weak and it is not clear if they are specific because a negative control is missing. An analysis by immunofluorescence staining would be more informative.

      RNAscope is designed so that a single molecule of RNA is visualized as a punctuate signal dot with high specificity. In lower magnification images, such as those we showed to provide an overall view of expression in the cortex, it is difficult to discern the individual ‘dots’, particularly for genes with low expression, giving the impression that the signal is weak. However, at high magnification (63X) the signals are readily visible as seen in a new panel in Fig. S1B). We also neglected to mention that positive probes with all 3 labels (POLR2A: Channel C1, PPIB: Channel C2, UBC:Channel C3) as well as a negative probe (Bacterial dap gene) supplied by the manufacturer were used on our samples to validate specificity. We have corrected the oversight and have now added this information to the methods section.

      Regarding immunofluorescence, we have rigorously tested numerous commercially-available antibodies and have undertaken repeated attempts to produce our own antibodies that recognize mouse Ltk or Alk, and are appropriate for immunofluorescence, but have had no success. The high specificity enabled by the RNAscope technology is thus currently the most reliable way we can examine expression, with the added advantage that we can simultaneously assess expression of both receptors and the ligand in an individual cell within a section.

      Alk appears to be expressed mainly in the ventricular zone (VZ) while Ltk shows a low expression in the SVZ and the cortical plate (CP). This expression pattern is not consistent with a function in regulating axon formation in multipolar neurons, which extend axons in the lower intermediate zone (IZ) (Namba et al., Neuron 2014) and not in the VZ or SVZ (p. 18).

      It is well described that multipolar neurons can be found in the SVZ, while bipolar neurons are preferentially in the IZ. Neurons expressing Ltk, Alk and their ligand, Alkal2 can be found in both compartments (albeit levels appear higher in the SVZ), thus we feel our results are consistent with a role for the receptors in regulating neuronal polarization.

      It is also essential to analyze the subcellular localization of Alk and Ltk at least in cultured neurons. Ltk has been reported as an ER-resident protein that regulates the export from the ER (Centonze et al., 2019), which would not be consistent with the model.

      Unfortunately, the lack of antibodies with mouse reactivity prevents us from analyzing the subcellular localization of Alk and Ltk in cultured neurons. As mentioned by the reviewer, LTK has been reported as an ER-resident protein (in cancer cells) and similarly, many other tyrosine kinase receptors including IGF1R, have been reported to be localized to diverse intracellular compartments like Golgi, nucleus or mitochondria (reviewed in Rieger and O’Connor, 2021, Front Endocrinol:PMID: 33584548). However, since extracellular ligands for LTK and ALK are known, we feel it is a reasonable expectation that they will have a role as cell-surface receptors. Understanding the functions of RTK receptors and the interplay between the various compartments would nevertheless be an interesting area for future research.

      4) The results convincingly show that an increased activity of Igf-1r is responsible for the formation of additional axons by cultured knockout neurons. The model in Fig. 7 explains how Alk/Ltk suppress the formation of multiple axons in culture but a key question remains to be addressed: why does Igf-1r remain active in the future axon? Are Alk/Ltk restricted to or selectively activated in dendrites? It is important to determine if Alk and Ltk are absent from the future axon before or after neuronal polarity is established.

      We thank the reviewer for acknowledging that we have provided convincing data that increased activity of Igf-1r is responsible for the formation of multiple axons. Addressing why Igf-1r remains active in the future axon and if and how Ltk/Alk are selectively activated in dendrites and axons are all excellent questions, which we plan to pursue in future work, particularly when antibodies for Alk and Ltk become available.

      Which cells produce Alkal2 in neuronal cultures and in vivo?_ _These points can be easily addressed and should be investigated.

      We have confirmed that Alkal2 is expressed in the isolated cortical neurons, consistent with our demonstration that siRNA-mediated abrogation of Alkal2 expression in cultured neurons regulates polarity and that ligand levels do not change in Ltk/Alk double knock out mice (Fig. S1G and S6A). Whether other non-neuronal cell types also express Alkal2 would be an interesting future direction.

      Why does an increase of Igf-1r surface expression in knockout neurons result in a stimulation of Igf-1r autophosphorylation? Neurons are cultured in a defined medium without Igf-1 and increased surface levels by themselves should not lead to an increased activity.

      We have not mechanistically determined why/how Igf-1r displays enhanced autophosphorylation in DKO neurons. Thus, we can only speculate about possibilities. Perhaps there are low levels of Igf-1 in the cortical cell extracts, or is produced by the cortical neurons; there may be compensatory mechanisms engaged when Ltk/Alk are lost to ensure neuronal survival, or perhaps the increase in cell-surface Igf-1r promotes ligand-independent activation of receptors in the absence of ligand.

      The results presented in this manuscript are consistent with a role of Igf-1r in the formation of multiple axons in the absence of Alk/Ltk. However, inhibition of Igf-1r by various means does not prevent axon formation in controls. Igf-1 has been implicated in axon formation (Sosa at al., 2006) but a knockout of Igf-1r does not result in a loss of axons but a reduction of axon length in cultured neurons (Jin et al., PLoS One 2019). Axon-specific markers are used only for some experiments but not in Figs. 3D, 5B-D and 6 where the neuronal marker Tuj1 does not allow the unambiguous identification of axons. Staining with an axonal marker and a quantification of axon length are required to distinguish between a block in axon formation and a reduction in axon growth in Figs. 3A, 5 and 6.

      In the original submission we quantitated Tau-1 and MAP2 co-stained neurons in many experiments to demonstrate that Ltk/Alk act on axons, but in some cases we used Tuj1 to more easily visualize and quantitate neurites. Nevertheless, as requested by the reviewers, in the revised manuscript we have repeated and replaced most of the results with Tuj1 or phalloidin staining with experiments using Tau-1 and MAP2 antibodies, including Fig. 5B-D and Fig. 6A-D and G, as well as for Fig. S4B requested by reviewer #1). The new data is consistent with our results using Tuj1 staining and further support our conclusions that Ltk/Alk act via Igf1-r to regulate neuronal polarity. With regards to Fig. 3D, we have been experiencing ongoing technical issues in generating human stem cell derived cortical neurons and have been unable to undertake Tau1/MAP2 staining of the human cortical neurons. Given that the point being made is minor, we have removed this panel from the paper.

      With regards to the comment on that inhibition of Igf1-r did not prevent basal axon formation: in our prior quantitation of WT neurons in which Igf1-r was inhibited using either siIgf1-r or PPP, we noticed a trend towards an increase in the number of neurons with no axons, but this was not statistically significant. Upon the repeat of experiments and re-quantitation with Tau-1/MAP2 co-staining, we do see a statistically-significant increase in the number of WT neurons without axons. This is in agreement with several prior studies (including one cited by the reviewer) indicating Igf1-r is important for neuronal polarity (Sosa, 2006; PMID:16845384, Neito Guil 2017 PMID:28794445). The text has been modified accordingly.

      5) The analysis with layer specific markers and BrdU labeling reveals defects in the formation of cortical layers that suggest a delay in neuronal migration. The number of Sox2+ and Tbr2+ cells is lower in knockout neurons indicating a possible reduction in the number of proliferating progenitors and a defect in neurogenesis (Fig. 1). The number of neurons positive for layer-specific markers or BrdU was quantified as the percent of DAPI-positive cells. This does not allow distinguishing between a change in the distribution and a reduction in the number of neurons due to defects in neurogenesis. It would be more informative to quantify the total number Ctip+, Satb2+ or BrdU+ cells in the VZ, SVZ, IZ and CP._

      In the in vivo BrdU labelling experiment, we did not co-stain sections with DAPI. However, in the immunofluorescence analysis in mice of the same ages, we did determine the total number of cells (ie by DAPI) that is shown in the plots in Fig. 1A and Fig. S2A/B. These results show that there are a similar number of cells in WT and mutant SVZ/VZ, consistent with the notion that there is a change in distribution rather than in reduction in the number of neurons due to defective neurogenesis. We neglected to mention this important point in the results and have now modified the text accordingly.

      6) The deficits observed in behavioral tests do not correlate with the defects in neuronal development. While the single knockouts show defects in cortical development only the double knockout displays behavioral deficits. The behavioral phenotype could be completely independent of Igf-1r. Alk has been implicated in regulating retrograde transport (Fellows et al., EMBO Rep. 2020) and synaptic scaling (Zhou et al., Cell Rep. 2021). Since there is no clear correlation between structural and behavioral changes these data are not obviously linked to the other results.

      The reviewer is correct, that the single KO mice do not manifest noticeable behavioural defects except when older and challenged with the most demanding task, the Puzzle box, which measures complex executive functions. We speculate that alternative cortical re-wiring in the single knockouts is sufficient to maintain normal circuitry that cannot be compensated when both Ltk and Alk receptors are deleted. However, we do agree that Ltk/Alk regulated signalling events, besides Igf-1r/PI3K could contribute to the behavioural defects observed in the DKO mice, such as the ALK-LIMK-cofilin pathway which regulates synaptic scaling as cited by the reviewer (Zhou et al., Cell Rep. 2021). Nevertheless, the strong phenotype of the DKOs confirms that Ltk/Alk are important for proper brain function, thus our preference is to retain the behavioural data in the manuscript but to discuss that alternative Ltk/Alk pathways could contribute to the phenotype (which we have now incorporated into the text).

      It should be noted that the study by Fellows et al in EMBO Rep 2020 shows Igf1-r, not ALK regulates retrograde transport so we have not included this study in the updated text.

      Minor comments

      1) Fig. 3 shows defects in the corpus callosum where axons are restricted to the upper half in the wild type but not the knockout. These results could indicate a guidance defect but do not show a "failure in axon migration through the corpus callosum" (p. 17). It is also not demonstrated "that the aberrant axon tracts may be the result of effects on neuronal morphology" (p. 19). Without additional experiments to trace axonal projections e.g. by DiI labeling it is not possible to determine the actual cause for the observation shown in Fig. 3F._

      We agree with the reviewer and have modified the concluding sentence so that the defects are described without attributing the cause to the defects on neuronal morphology.

      2) Active kinases from SignalChem are used for the in vitro kinase assays. The increased phosphorylation of Igf-1r could also result from a stimulation of auto-phosphorylation and not a direct phosphorylation by Ltk. Previous results indicate that phosphorylation of Y1250/1251 leads to increased internalization and degradation (Rieger et al., Sci. Signal. 2020), which would be an alternative explanation how Alk/Ltk regulate surface expression. Antibodies that are specific for Igf-1r phosphorylation at Y1135/1136 or Y1250/1251 could address this possibility (Rieger at al., Sci. Signal. 2020).

      It is rather surprising that for the Igf-1r, which is such a well-studied receptor, the mechanisms that regulate trafficking, exocytosis recycling, etc are so poorly understood and that this topic is currently an active area of investigation. The focus of our study was on understanding the role of Ltk/Alk in the brain and as part of this effort we demonstrated that Ltk/Alk can control neuronal polarity through Igf-1r phosphorylation. We believe that shedding light on the detailed mechanism of how enhanced Igf-1r phosphorylation induced by Ltk/Alk activation regulates Igf-1r trafficking is an exciting project for future work, but we feel that to thoroughly investigate this question is beyond the scope of the current study. We have, nevertheless, highlighted these points with additional references in the discussion.

      3) The specificity of the siRNAs has to be verified in neurons by rescue experiments and the suppression of the targeted proteins confirmed by immunofluorescence staining.

      We agree that rescue experiments are the gold standard, and we attempted to do this. However, we found that nucleofection of both siRNAs and cDNAs encoding either EGFP alone or Ltk/Alk was highly toxic to neurons with few surviving the treatment. As an alternative we used a pool of siRNAs, to minimize off-target effects and used genetic KOs or chemical inhibitors to verify the observations.

      4) The position of molecular weight markers is missing for most Western blots.

      We added the position of molecular weight markers for all the western blots in the revised manuscript.

      5) It is not indicated which conditions show a significant difference in Fig. 6.

      We thank the reviewer for pointing this out. We added the significant differences to all figures, including Fig. 6.

      6) Why does the Western blot in Fig. 7A show a double band with the anti-phospho-Igf-1r antibody in the knockout? Which of the bands was used for the quantification?

      We apologize for a labelling error that has caused confusion for both reviewers. We have replaced the blots and corrected the labels.

      7) Details of the plasmids used and information (catalog number) for recombinant GST-Ltk and His-Igf-1r should be included in Materials and Methods.

      The additional information and catalog numbers have been added to the Materials and Methods.

      Reviewer #2 (Significance):

      The receptor tyrosine kinase Alk has been studied mainly for its involvement in several types of cancer but the physiological functions of Alk and its close relative Ltk remain poorly understood. The regulation of Igf-1r is an interesting and important result to understand the physiological function of Alk and Ltk. However, several points have to be addressed before the manuscript would be suitable for publication.

      We thank the reviewer for indicating that this is interesting and important study. We trust that the additional data and clarifications provided, have addressed the reviewers concerns.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Christova et al. analyzed single and double knockout mice for Alk and Ltk to investigate their function in the nervous system and describe defects in cortical development and behavioral deficits. The defects in the formation of cortical layers suggest a delay in radial migration. In culture, 40% of cortical neurons from knockout embryos extend multiple axons. The mechanism responsible for this phenotype is explored in some detail. The authors conclude that Alk and Ltk function non-redundantly to regulate the Igf-1 receptor (Igf-1r). Inactivation of Alk or Ltk increases surface expression and activity of Igf-1r, which induces the formation of multiple axons. The authors propose that Alk and Ltk interact with Igf-1r and promote its endocytosis after activation by their ligand Alkal2, thereby preventing the formation of additional axons. However, the defects in neurogenesis, migration and behavior may have a different cause and should not be attributed only to Igf-1r.

      Major comments

      1. The role of Alk/Ltk in suppressing the formation of multiple axons is demonstrated by culturing neurons from knockout mice, suppression with siRNAs and treatment with inhibitors. These experiments consistently show that about 40% of cultured neurons extend more than one axon when Alk, Ltk or both are inactivated. Single and double knockout mice are largely normal with the exception of a delay in the formation of distinct cortical layers. The phenotypes of the knockout lines indicate a function in cortical development but Alk and Ltk are not "indispensable" as suggested (p. 18). The morphology of cortical neurons was analyzed by Golgi staining. A few potential axons (Fig. 3E) were identified only by an absence of dendritic spines and their aberrant trajectory. These results indicate that there are ectopic extensions in the cortex but do not demonstrate that neurons extend multiple axons also in vivo. It has to be confirmed that these extensions are positive for axon-specific markers and that several axons originate from one soma to demonstrate a multiple axon phenotype in vivo. A quantification of the number of neurons with multiple axons would be required to conclude that this phenotype occurs at a similar frequency in vivo.
      2. According to the model presented in Fig. 7, Alkal2 activates Alk and Ltk, which stimulate the endocytosis of Igf-1r and thereby prevents the formation of additional axons. A quantification of Igf-1r surface levels by the biotinylation of surface proteins and Western blot shows an increase in knockout neurons. The authors suggest that Alk/Ltk activation stimulates Igf-1r endocytosis but do not demonstrate this directly. An increase in surface expression could also result from a stimulation of exocytosis or recycling.
      3. The localization of Alk, Ltk and Alkal2 was determined by in situ hybridization. The signals are weak and it is not clear if they are specific because a negative control is missing. An analysis by immunofluorescence staining would be more informative. Alk appears to be expressed mainly in the ventricular zone (VZ) while Ltk shows a low expression in the SVZ and the cortical plate (CP). This expression pattern is not consistent with a function in regulating axon formation in multipolar neurons, which extend axons in the lower intermediate zone (IZ) (Namba et al., Neuron 2014) and not in the VZ or SVZ (p. 18).<br /> It is also essential to analyze the subcellular localization of Alk and Ltk at least in cultured neurons. Ltk has been reported as an ER-resident protein that regulates the export from the ER (Centonze et al., 2019), which would not be consistent with the model.
      4. The results convincingly show that an increased activity of Igf-1r is responsible for the formation of additional axons by cultured knockout neurons. The model in Fig. 7 explains how Alk/Ltk suppress the formation of multiple axons in culture but a key question remains to be addressed: why does Igf-1r remain active in the future axon? Are Alk/Ltk restricted to or selectively activated in dendrites? Which cells produce Alkal2 in neuronal cultures and in vivo? These points can be easily addressed and should be investigated. It is important to determine if Alk and Ltk are absent from the future axon before or after neuronal polarity is established. Why does an increase of Igf-1r surface expression in knockout neurons result in a stimulation of Igf-1r autophosphorylation? Neurons are cultured in a defined medium without Igf-1 and increased surface levels by themselves should not lead to an increased activity.<br /> The results presented in this manuscript are consistent with a role of Igf-1r in the formation of multiple axons in the absence of Alk/Ltk. However, inhibition of Igf-1r by various means does not prevent axon formation in controls. Igf-1 has been implicated in axon formation (Sosa at al., 2006) but a knockout of Igf-1r does not result in a loss of axons but a reduction of axon length in cultured neurons (Jin et al., PLoS One 2019). Axon-specific markers are used only for some experiments but not in Figs. 3D, 5B-D and 6 where the neuronal marker Tuj1 does not allow the unambiguous identification of axons. Staining with an axonal marker and a quantification of axon length are required to distinguish between a block in axon formation and a reduction in axon growth in Figs. 3A, 5 and 6.
      5. The analysis with layer specific markers and BrdU labeling reveals defects in the formation of cortical layers that suggest a delay in neuronal migration. The number of Sox2+ and Tbr2+ cells is lower in knockout neurons indicating a possible reduction in the number of proliferating progenitors and a defect in neurogenesis (Fig. 1). The number of neurons positive for layer-specific markers or BrdU was quantified as the percent of DAPI-positive cells. This does not allow distinguishing between a change in the distribution and a reduction in the number of neurons due to defects in neurogenesis. It would be more informative to quantify the total number Ctip+, Satb2+ or BrdU+ cells in the VZ, SVZ, IZ and CP.
      6. The deficits observed in behavioral tests do not correlate with the defects in neuronal development. While the single knockouts show defects in cortical development only the double knockout displays behavioral deficits. The behavioral phenotype could be completely independent of Igf-1r. Alk has been implicated in regulating retrograde transport (Fellows et al., EMBO Rep. 2020) and synaptic scaling (Zhou et al., Cell Rep. 2021). Since there is no clear correlation between structural and behavioral changes these data are not obviously linked to the other results.

      Minor comments

      1. Fig. 3 shows defects in the corpus callosum where axons are restricted to the upper half in the wild type but not the knockout. These results could indicate a guidance defect but do not show a "failure in axon migration through the corpus callosum" (p. 17). It is also not demonstrated "that the aberrant axon tracts may be the result of effects on neuronal morphology" (p. 19). Without additional experiments to trace axonal projections e.g. by DiI labeling it is not possible to determine the actual cause for the observation shown in Fig. 3F.
      2. Active kinases from SignalChem are used for the in vitro kinase assays. The increased phosphorylation of Igf-1r could also result from a stimulation of auto-phosphorylation and not a direct phosphorylation by Ltk. Previous results indicate that phosphorylation of Y1250/1251 leads to increased internalization and degradation (Rieger et al., Sci. Signal. 2020), which would be an alternative explanation how Alk/Ltk regulate surface expression. Antibodies that are specific for Igf-1r phosphorylation at Y1135/1136 or Y1250/1251 could address this possibility (Rieger at al., Sci. Signal. 2020).
      3. The specificity of the siRNAs has to be verified in neurons by rescue experiments and the suppression of the targeted proteins confirmed by immunofluorescence staining.
      4. The position of molecular weight markers is missing for most Western blots.
      5. It is not indicated which conditions show a significant difference in Fig. 6.
      6. Why does the Western blot in Fig. 7A show a double band with the anti-phospho-Igf-1r antibody in the knockout? Which of the bands was used for the quantification?
      7. Details of the plasmids used and information (catalog number) for recombinant GST-Ltk and His-Igf-1r should be included in Materials and Methods.

      Significance

      The receptor tyrosine kinase Alk has been studied mainly for its involvement in several types of cancer but the physiological functions of Alk and its close relative Ltk remain poorly understood. The regulation of Igf-1r is an interesting and important result to understand the physiological function of Alk and Ltk. However, several points have to be addressed before the manuscript would be suitable for publication.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      This manuscript describes studies that indicate roles for the ALK and LTK receptors in neuronal polarity, cortical patterning and behavior in mice. I really liked the study and overall think that it deserves publication in a high-ranking journal. It reports important and novel results and benefits from a comprehensive analysis at multiple levels, including cell biological, biochemical and behavior. The points raised below are suggestions for consideration at the discretion of the authors.

      1. The term "DKO" appears in the Introduction without explanation. I assume this means double KO mice lacking both receptors from birth. It should be indicated here, just in case.
      2. The last paragraph of the Introduction is redundant with the Abstract. This is a stylistic question, which is up to the authors. Nevertheless, as a suggestion, they could take the opportunity here to explain the rationale of the study and why they did what they did.
      3. Is "single cell in situ mRNA analysis" standard in situ hybridization or something else? Why is it called "single-cell"? It could be misleading.
      4. In Fig. S1B, could the authors please include expression patterns of LTK in adult brain? It'd seem that is the most relevant place to look given the analysis that follows in the paper.
      5. I have an issue in general in the first part of the manuscript with regards to the labeling of cortical layers. How were CP, IZ and SVZ/VZ defined? Specific markers should be used to identify their actual boundaries. Guesswork from the DAPI pattern (if that is what was used) is not really appropriate.
      6. Comparing Fig. 1 and Fig. S2, there would seem to be little or no additive nor synergistic effects of the double mutation, as the phenotype in the DKO appears to be completely attributable to the Ltk KO. What does this mean? Providing the expression patterns of the two receptors at the ages used here (i.e., P2 and P7) would also be helpful.
      7. In Fig. 1F, again, how were the boundaries between the cortical areas (dotted lines) determined? This is particularly important for the mutant sections, as apparent cortical thickness would be easily be affected by the plane of the section. Simply assuming that the CP is of equal thickness than the one in the WT may be incorrect. I feel the authors cannot just place dotted lines in the figure without explaining the criteria that was used to determine their location. Also, there is a significant (many fold) increase in Ctip2 cells in the IZb of the mutant (1F) that it's not explained in the text. The quantification of Ctip2 cells in the CP and IZa of the mutant is missing in the histogram. It should be indicated, even if very low. Again, the key point here is the criteria used for the<br /> boundaries between areas. May be what it's marked as IZa in the mutant is still part of the CP, in which case the number of Ctip2 cells would be increased there, not decreased, as claimed in the text.
      8. In Fig. S3C-F, the all-critical quantification of Ctip2 cells at P2 seems to be missing in this figure. It would important to provide this in light of the comments above. Again, the same problem with the layer boundaries is clear here. The Ltk KO would have normal levels of Ctip2 cells if the CP thickness were to be larger (due to e.g., the plane of the section not being perfectly perpendicular to the brain surface).
      9. In Figure 2A and B, % positive cells is plotted but we are not told what is the reference (100%) level. Was it the total number of cells in the entire cortex (including SVZ and VZ)? That cannot be the case, since CP+IZ in WT alone reaches almost 100%. What is 100% here please? Also, the idea of drawing a little rectangle in the IZ and CP and counting only there is flawed. The values would change drastically depending on where the rectangle is placed. They need to count the whole field of view, as it was done in the previous figures. Finally, again, we are not told how the boundaries of the different cortex areas were established. As explained earlier, distance from the surface (or from<br /> the bottom) of the cortex would be greatly affected by the plane of the section. This problem will need a more satisfying solution for the data to be interpreted in the way it has been done.
      10. At the end of page 8, it is concluded that Alk/Ltk promote neuronal migration. Is this a cell-autonomous effect? Given the very sparse expression of these receptors (Fig S1), cell-autonomy (which is being implied by the authors) is not at all clear. Is the migration of Alk+ cells affected in the Ltk mutant? Vice-versa?
      11. In Fig. S4A, as every cell in these panels bears probe signal, it'd be important to present a negative control, perhaps from KO cultures or wild type cells lacking receptor expression in the same field as expressing cells. At a 75%, 1 in 4 cells in any field should be receptor-negative.
      12. Figure S4B is difficult to interpret in the absence of Tau and MAP2 markers, as GFP does not discriminate between axons and dendrites. In general, the authors are recommended to show more than one cell per condition in their figures. Readers need to be convinced that these are robust phenotypes easily observed on many cells in the same field.
      13. In Fig. S4C and D, do the KO neurons become bipolar? I don't see examples of multipolar neurons in the images provided.
      14. Is there a way to quantify the effects shown in Fig. 3E?
      15. The DKO display a dramatically different behavior phenotype compared to single Kos. How can this result be explained given that DKOs are indistinguishable from single KOs in all other parameters studied?
      16. At the end of the behavior section, the authors attribute the phenotypes observed to defects in neuronal polarization. Given that polarization was only studied in vitro, it may be a premature to conclude that neurons fail to polarize in vivo in the absence of direct evidence showing this.
      17. Regarding P-AKT studies, it would be interesting to assess the effects of the ALK7LTK ligands (e.g., from conditioned medium) on the levels of P-AKT in WT neurons.
      18. In the mid part of page 14, the sentence "Treatment of WT cortical neurons with AG1024 at a dose (1 μM) at which only IGF-1R but not InsR was inhibited restored the single axon phenotype in DKO neurons" is confusing. Treatment performed in WT neurons but assessed in DKO neurons? This must be a typo.
      19. For completion, it would be informative to test whether IGF-1 antagonizes the effects of ALK and LTK ligands in axon formation.
      20. The quality of the blot provided to illustrate levels of activated Igf-1r in Fig. 7A is clearly suboptimal. It is not apparent from that blot that phosphorylation of Igf1r is increased in the mutant neurons as the band intensities are indistinguishable. Was this performed in cortex extracts or cultured neurons? Is it affected by treatment with ALK/LTK ligands?
      21. Given the physical interaction between ALK/LTK and IGF-R1, these receptors are presumably co-internalized upon ligand treatment, or? Does treatment with IGF1 induces internalization of ALK or LTK?
      22. The last paragraph in the Results section may be more appropriate for Discussion to avoid repetition. But it is of course up to the authors to decide on stylistic issues.
      23. There is a discussion of possible redundancies between ALK and LTK in the Discussion section which appears to contradict itself. It is first stated (end of p. 18) that the two receptors are not redundant but both required for function. But in p. 19, the significant behavioral phenotypes observed in DKO mice, but not in single KO mice, are attributed to redundancy and compensation between the receptors. This needs some clarification. It's difficult to understand how there can be redundancy for behavior but not for structure or function.

      Significance

      see above

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Reviewer #1 (Evidence, reproducibility and clarity):

      The manuscript from Li et al. describes the authors' attempt to redirect the exocytic Rab Sec4 to endocytic vesicles by fusing the GEF-domain of Sec2 to the CUE domain of the endosomal GEF Vps9, which binds to ubiquitin. The authors show that the localization of the Sec2GEF-GFP-CUE construct is slightly shifted from polarized towards non-polarized sites. Sec2GFP-CUE positive structures acquire Sec4 and Sec4 effectors like exocytic vesicles but are less motile and show delayed plasma membrane fusion. Expression of Sec2GEF-GFP-CUE was enhanced if expressed in a subset of secretory and endocytic mutants and cause delayed Mup1 uptake from the plasma membrane. As Vps9, Sec2GEF-GFP-CUE accumulated on Class E compartments in vps4Δ strains.<br /> The authors ask here whether vesicular identity is largely predetermined by the correct localization of the specific GEFs of small GTPases and thus localization of the Rab. Although this an interesting hypothesis, the authors observed that endocytic traffic was not reversed by relocating Sec4 to these vesicles. This seems to be due to the strong affinity of the Sec2 GEF-domain for Sec4 but probably also due to the rather weak relocalization via the CUE domain. Thus, only a portion of Sec2 was displaced from its native site. Since the efficiency of this rewiring was not defined, it remains unclear whether the observed mild effects indeed speak against the assumed dominant role of the GEFs and small GTPases in shaping organelle identity or whether they are rather due to an inefficient relocalization.

      Our data demonstrate a dramatic relocalization of Sec2-GEF-GFP-CUE relative to Sec2-GEF-GFP. In the case of Sec2-GEF-GFP or Sec2-GEF-GFP-CUE M419D the cytoplasmic pool is predominant and only 30% of cells exhibit a detectable concentration, while in the case of Sec2-GEF-GFP-CUE 80% of cells show bright puncta and there is little or no detectable cytoplasmic pool (Fig 1A). Clearly the CUE domain can function as a localization domain that relies upon ubiquitin binding. Furthermore, half of the Sec2-GEF-GFP-CUE puncta colocalize with Vps9 (Fig S1). The high cytoplasmic background of Vps9 could mask additional colocalization, therefore we reexamined colocalization in a vps4__D_ _mutant in which the Vps9 cytoplasmic pool is reduced due to increased association with the expanded Class E late endosomes. In this situation we observe about 80% colocalization with Vps9 as well as substantial colocalization with Ypt51 and Vps8 (Fig 2). We now also show significant colocalization with PI(3)P (Fig S3D). Thus, our data demonstrate that addition of the CUE domain does indeed relocalize Sec2GEF to endocytic membranes. The Sec2 GEF activity then leads to the recruitment of Sec4 and Sec4 effectors, including Myo2 which in turn leads to their delivery to polarized sites. We now show by EM that the bright Sec2-GEF-GFP-CUE puncta correlate with clusters of 80 nm vesicles (Fig 5B). Our data argues that these are hybrid compartments carrying both endocytic and exocytic markers. We have restructured our paper to help clarify and emphasize this key point.

      Specific comments:<br /> 1. The authors state decidedly that the recruitment of Vps9 occurs ubiquitin-dependent via the CUE-domain. While the CUE-domain is the only known and a likely localization determinant of Vps9, it was not a strong localization determinant. Apart from being present in some puncta, Vps9 localized strongly to the cytosol (Paulsel et al. 2013, Nagano et al. 2019). Shideler et al. also showed that ubiquitin-binding is not required for Vps9 function in vivo, which indicates that other localizing mechanisms may play a role e. g. by positive feedback of GEF-domain-Rab5 interactions which might be initiated by the other Rab5-GEF Muk1 or as suggested by transport from the Golgi (Nagano et al. 2019). These observations indicate that the CUE-domain is a rather weak recruitment domain, which was not discussed in this manuscript. The localization of the Sec2GEF-GFP-control to the polarized sites in 30% of the cells furthermore suggests that the used Sec2GEF-GFP-CUE retains some native localization via the GEF-domain. Since the relocation efficiency of Sec2GEF-GFP-CUE was not defined, the obtained phenotypic effects allow for only vague conclusions. Although the mild endo- and exocytosis defects as well as the accumulation of Sec2GEF-GFP-CUE at Class E compartments indicate that the CUE-domain indeed conferred some relocation to endosomes, this was not shown for the sec2Δ strain e. g. by looking at colocalizations with endocytic versus exocytic markers and comparing their relative abundance at the Sec2GEF-GFP-CUE-positive structures. While some of the Sec2GEF-GFP-CUE-positive structures colocalized with Mup1 in the Mup1-uptake assay, it would be important to clarify how many endosomal properties are retained and how many exocytic properties are gained by these chimeric vesicles e. g. by looking for the presence of specific phosphoinositides, or Rab5 and Rab5 effectors. A competition between endosomal and the acquired exocytic factors could also be another possible explanation for the immobility of the Sec2GEF-GFP-CUE structures and less efficient recruitment of Sec4 effectors in addition to the proposed lack of PI4P.

      As summarized above, we observed dramatic relocalization of Sec2GEF that was strongly dependent upon the ability of the CUE domain to bind to ubiquitin. We also observed colocalization with Ypt51 and Vps8 as well as transient colocalization with internalized Mup1. We now also show significant colocalization with PI(3)P (Fig S3D). Full length Vps9 is probably subject to additional levels of regulation, perhaps autoinhibitory in nature, however our construct contains only the CUE domain which can clearly function as an efficient localization domain on its own. The high cytoplasmic pool of Vps9 reflects the rapid turnover of its ubiquitin binding sites, since it is efficiently recruited to membranes in vps4__D_ cells. The relocalized Sec2GEF domain was quite effective in recruiting Sec4 as well as most known Sec4 effectors. The recruitment of Myo2 leads to localization to sites of polarized growth. All of our studies were done in a sec2__D _background except for the analysis of dominant growth effects, as now explicitly stated at the beginning of the Results section.

      1. While the colocalization of the Sec2GEF-GFP-CUE-signal with Sec4 indicates that this GEF-construct is generally active, it remains unclear whether the activity of the tagged constructs differ from that of the wild type Sec2 protein. This could be analyzed in vitro via a MANT-GDP GEF-activity assay (Nordmann et al., 2010). Again, it remains unclear how much of the Sec2GEF-Sec4 colocalization represents the retained native localization versus synthetic localization at chimeric endo-exocytic vesicles.

      The structure and nucleotide exchange mechanism of the Sec2 GEF domain have been thoroughly analyzed in prior studies and are well understood. There is no reason to think that the constructs we generated here would alter the exchange activity as the fusions are far removed from the Sec4 binding site and our analysis here confirms that they are active in vivo. We do not feel that there would be much to be gained by doing in vitro exchange assays and it would entail a great deal of work.

      1. The authors mention that tagging with GFP increases the stability of the expressed constructs. However, it remains unclear whether this is also the case for the other tags (NeonGreen, mCherry) used in the other experiments. Are the constructs expressed at similar levels?

      We have compared the levels of the various tagged constructs and they appear to be similar (Fig S5A).

      1. In Figure 5: The incomplete colocalization of Sec2GEF-GFP-CUE with Vps9 is explained by the short-timed accessibility of ubiquitin moieties. Apart from the likely retained native localization or weak CUE-domain-function, this observation could also be due to competition between Vps9 and Sec2GEF-GFP-CUE for the available ubiquitin target structures.

      As previously shown, Vps9 normally displays a prominent cytoplasmic pool. Deletion of Vps4 leads to recruitment of this pool to expanded endosomes through an increase in the lifetime of the ubiquitin binding sites. The high cytoplasmic background in VPS4 cells could obscure some colocalization with Sec2GEF-GFP-CUE and indeed we observe increased colocalization in vps4__D_ _cells in which the cytoplasmic pool of Vps9 has been recruited to endosomes. Expression of Sec2GEF-GFP-CUE does not appear to significantly alter the localization of Vps9.

      Minor remarks:<br /> 1. Fig. 3C do not contain the arrowheads as indicated in the legend, making it harder to interpret.

      These have been added.

      1. The image chosen for Sec2-GFP in Fig. 4B suggests less colocalization between Sec2-GFP and Sec8 than between Sec2GEF-GFP-CUE and Sec8. They rather look next to each other.

      The images initially chosen were not representative. We have replaced them with better images from the same experiment.

      1. Figure 5: While resolution limits are possibly reached regarding endosomes, it might be interesting to check by thin section electron microscopy whether and how class E compartment formation is affected by Sec2GEF-GFP-CUE expression.

      We have now done EM using permanganate fixation of both VPS4 and vps4__D_ cells (Fig 5B and below). In both backgrounds Sec2GEF-GFP-CUE expression leads to the formation of clusters of 80 nm vesicles that appear to correlate with the fluorescent puncta visible by light microscopy. The vps4__D _cells have in addition curved linear membrane structures that represent class E endosomes (see images at end of this file). The class E endosomes appear similar in cells expressing Sec2GEF-GFP-CUE, Sec2-GFP or Sec2. We did not observe any obvious spatial relationship between the class E structures and the vesicle clusters.

      1. Discussion: "Furthermore, delivery of Mup1-GFP to the vacuole was slowed in Sec2GEF-GFP-CUE cells..." - The authors studied "the clearance of Mup1-GFP from the plasma membrane" and not vacuolar delivery. They did not show much vacuolar localization.

      We now include quantitation of Mup1-GFP at both the plasma membrane and vacuole (Fig 6 and Fig S8). This shows a reduced rate of depletion from the plasma membrane and a delayed appearance in the vacuole.

      Literature:<br /> Nagano, M., Toshima, J. Y., Siekhaus, D. E., & Toshima, J. (2019): Rab5-mediated endosome formation is regulated at the trans-Golgi network. Nature Communications Biology, 2 (1), 1-12.<br /> Nordmann, M., Cabrera, M., Perz, A., Bröcker, C., Ostrowicz, C., Engelbrecht-Vandré, S., & Ungermann, C. (2010): The Mon1-Ccz1 complex is the GEF of the late endosomal Rab7 homolog Ypt7. Current Biology, 20(18), 1654-1659.<br /> Paulsel, A. L., Merz, A. J., & Nickerson, D. P. (2013): Vps9 family protein Muk1 is the second Rab5 guanosine nucleotide exchange factor in budding yeast. Journal of Biological Chemistry, 288 (25), 18162-18171.<br /> Shideler, T., Nickerson, D. P., Merz, A. J., & Odorizzi, G. (2015): Ubiquitin binding by the CUE domain promotes endosomal localization of the Rab5 GEF Vps9. Molecular Biology of the Cell, 26 (7), 1345-1356.

      Reviewer #1 (Significance):

      • see above
      • has some deficits in interpretation as the Rab relocalization was not complete and thus conclusions are limiting

      Reviewer #2 (Evidence, reproducibility and clarity):

      This paper tries to address a fundamental question in cell biology, namely, what machinery is sufficient to tell a vesicle know where to go and what to do when it gets there. Several groups have shown that localization of some Rab/Ypt GEFs to an orthogonal compartment can lead to redirecting a Rab/Ypt to that membrane, where they can bind their partners abnormally. This story tries to explore what happens next.

      Here, Novick and colleagues took a part of the SEC2 GEF for secretory vesicle SEC4 Rab/Ypt and anchored it to endocytic structures to ask whether that was enough to relocalize those structures and drive inappropriate trafficking events. A challenge and advantage in the study is the fact that not all of the GEF relocalized-and that enables the cells to survive as SEC4p is needed for cell growth and membrane delivery--but this incomplete relocalization complicates phenotypic analysis--some SEC4 is on secretory vesicles and some is relocalized apparently to endocytic structures. Another challenge is that the two compartments both show "polarized" distributions so it is hard to know what compartment the reader is looking at, in a given figure. This makes the story very challenging to digest for a non-yeast expert trying to understand the conclusions.

      The authors show that the CUE domain can serve to partially localize SEC2GEF-GFP-CUE and this function relies on its ability to interact with ubiquitin. The localization is distinct from that of full length Sec2, nonetheless "many structures bearing Sec2GEF-GFP-CUE localize close to the normal sites of cell surface growth despite their abnormal appearance". The authors conclude that SEC4p and its effectors were recruited to these puncta with variable efficiency and the puncta were static; normal secretion was not blocked. This is not really a surprise as some SEC4p is still directed to secretory granules and cells do not show a vesicle accumulation phenotype by EM. Missing seems to be a clear-cut visual assay for exocytosis of secretory granules or endocytic structures despite attempts to include live cell imaging.

      We now show that the bright Sec2GEF-GFP-CUE_ puncta correspond to clusters of 80nm vesicles (Fig 5B). Our FRAP analysis demonstrates that Sec2GEF-GFP-CUE _is able to enter into pre-existing, bleached puncta (Fig 1E). One interpretation is that the vesicle cluster remains static, while individual vesicles enter and exit the cluster.

      The authors showed that SEC2-GFP-CUE structures fail to acquire Sro7 and do not seem to be able to assemble a complex with the tSNARE SEC9. Is this because Sro7 is being retained on the remaining secretory vesicles that also have SEC4 and other effectors that may be recruited to those structures by coordinate recognition?

      We demonstrate that at least half of the Sec2GEF-GFP-CUE puncta colocalize with Vps9 and this becomes even more evident in a vps4__D_ _mutant (Fig 2A). There is also substantial colocalization with the Rab5 homolog Ypt51, the endocytic marker Vps8 and PI(3)P (Fig 2 and Fig S3D). Nearly all of these puncta also colocalize with Sec4 and most of its downstream effectors. Thus, it seems that we have generated a hybrid compartment, as we intended. The surprise is how well the cells can cope with this situation. One possible explanation is offered in the Discussion: In yeast the TGN is thought to play the role of the early endosome and may be the site of Vps9 membrane recruitment. Thus Sec2GEF-GFP-CUE might be initially recruited to the TGN and the hybrid vesicles formed from this compartment might function to bring secretory cargo from the TGN to the cell surface just like normal secretory vesicles, with the caveat that the presence of endocytic machinery is somewhat inhibitory to Sro7 function, slowing fusion.

      There seem to be no issues with data as presented; a diagram of the SEC2-GFP-CUE would help the reader as would use of terms "secretory vesicle" and "endocytic vesicle" and how they were always distinguished rather than "polarized structure" which cannot distinguish these compartments.

      We have tried to be careful in our use of terms. We refer to the Sec2-GFP-CUE puncta using the unbiased terms “structures” or “puncta” until we show EM demonstrating that these puncta represent clusters of 80 nm vesicles.

      CROSS-CONSULTATION COMMENTS<br /> The two assessments come to the same conclusion--I agree that better definition of the precise phenotypes could be valuable but the limitation of incomplete relocalization will be hard to overcome in the absence of enormous effort.

      Reviewer #2 (Significance):

      This story represents a valiant effort and presents clean data but the impact and significance of the findings are limited due to the difficult phenotypic starting points (SEC4 in two places), and lack powerful exo- or endocytosis assays and better compartment-specific markers.

      The work will be of interest to yeast cell biologists studying the secretory and endocytic pathways. My expertise is mammalian cell biology of the secretory and endocytic pathways.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      This paper tries to address a fundamental question in cell biology, namely, what machinery is sufficient to tell a vesicle know where to go and what to do when it gets there. Several groups have shown that localization of some Rab/Ypt GEFs to an orthogonal compartment can lead to redirecting a Rab/Ypt to that membrane, where they can bind their partners abnormally. This story tries to explore what happens next.

      Here, Novick and colleagues took a part of the SEC2 GEF for secretory vesicle SEC4 Rab/Ypt and anchored it to endocytic structures to ask whether that was enough to relocalize those structures and drive inappropriate trafficking events. A challenge and advantage in the study is the fact that not all of the GEF relocalized-and that enables the cells to survive as SEC4p is needed for cell growth and membrane delivery--but this incomplete relocalization complicates phenotypic analysis--some SEC4 is on secretory vesicles and some is relocalized apparently to endocytic structures. Another challenge is that the two compartments both show "polarized" distributions so it is hard to know what compartment the reader is looking at, in a given figure. This makes the story very challenging to digest for a non-yeast expert trying to understand the conclusions.

      The authors show that the CUE domain can serve to partially localize SEC2GEF-GFP-CUE and this function relies on its ability to interact with ubiquitin. The localization is distinct from that of full length Sec2, nonetheless "many structures bearing Sec2GEF-GFP-CUE localize close to the normal sites of cell surface growth despite their abnormal appearance". The authors conclude that SEC4p and its effectors were recruited to these puncta with variable efficiency and the puncta were static; normal secretion was not blocked. This is not really a surprise as some SEC4p is still directed to secretory granules and cells do not show a vesicle accumulation phenotype by EM. Missing seems to be a clear-cut visual assay for exocytosis of secretory granules or endocytic structures despite attempts to include live cell imaging.

      The authors showed that SEC2-GFP-CUE structures fail to acquire Sro7 and do not seem to be able to assemble a complex with the tSNARE SEC9. Is this because Sro7 is being retained on the remaining secretory vesicles that also have SEC4 and other effectors that may be recruited to those structures by coordinate recognition?

      There seem to be no issues with data as presented; a diagram of the SEC2-GFP-CUE would help the reader as would use of terms "secretory vesicle" and "endocytic vesicle" and how they were always distinguished rather than "polarized structure" which cannot distinguish these compartments.

      Referees cross-commenting

      The two assessments come to the same conclusion--I agree that better definition of the precise phenotypes could be valuable but the limitation of incomplete relocalization will be hard to overcome in the absence of enormous effort.

      Significance

      This story represents a valiant effort and presents clean data but the impact and significance of the findings are limited due to the difficult phenotypic starting points (SEC4 in two places), and lack powerful exo- or endocytosis assays and better compartment-specific markers.

      The work will be of interest to yeast cell biologists studying the secretory and endocytic pathways. My expertise is mammalian cell biology of the secretory and endocytic pathways.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      The manuscript from Li et al. describes the authors' attempt to redirect the exocytic Rab Sec4 to endocytic vesicles by fusing the GEF-domain of Sec2 to the CUE domain of the endosomal GEF Vps9, which binds to ubiquitin. The authors show that the localization of the Sec2GEF-GFP-CUE construct is slightly shifted from polarized towards non-polarized sites. Sec2GFP-CUE positive structures acquire Sec4 and Sec4 effectors like exocytic vesicles, but are less motile and show delayed plasma membrane fusion. Expression of Sec2GEF-GFP-CUE was enhanced if expressed in a subset of secretory and endocytic mutants and cause delayed Mup1 uptake from the plasma membrane. As Vps9, Sec2GEF-GFP-CUE accumulated on Class E compartments in vps4Δ strains.<br /> The authors ask here whether vesicular identity is largely predetermined by the correct localization of the specific GEFs of small GTPases and thus localization of the Rab. Although this an interesting hypothesis, the authors observed that endocytic traffic was not reversed by relocating Sec4 to these vesicles. This seems to be due to the strong affinity of the Sec2 GEF-domain for Sec4 but probably also due to the rather weak relocalization via the CUE domain. Thus, only a portion of Sec2 was displaced from its native site. Since the efficiency of this rewiring was not defined, it remains unclear whether the observed mild effects indeed speak against the assumed dominant role of the GEFs and small GTPases in shaping organelle identity or whether they are rather due to an inefficient relocalization.

      Specific comments:

      1. The authors state decidedly that the recruitment of Vps9 occurs ubiquitin-dependent via the CUE-domain. While the CUE-domain is the only known and a likely localization determinant of Vps9, it was not a strong localization determinant. Apart from being present in some puncta, Vps9 localized strongly to the cytosol (Paulsel et al. 2013, Nagano et al. 2019). Shideler et al. also showed that ubiquitin-binding is not required for Vps9 function in vivo, which indicates that other localizing mechanisms may play a role e. g. by positive feedback of GEF-domain-Rab5 interactions which might be initiated by the other Rab5-GEF Muk1 or as suggested by transport from the Golgi (Nagano et al. 2019). These observations indicate that the CUE-domain is a rather weak recruitment domain, which was not discussed in this manuscript. The localization of the Sec2GEF-GFP-control to the polarized sites in 30% of the cells furthermore suggests that the used Sec2GEF-GFP-CUE retains some native localization via the GEF-domain. Since the relocation efficiency of Sec2GEF-GFP-CUE was not defined, the obtained phenotypic effects allow for only vague conclusions. Although the mild endo- and exocytosis defects as well as the accumulation of Sec2GEF-GFP-CUE at Class E compartments indicate that the CUE-domain indeed conferred some relocation to endosomes, this was not shown for the sec2Δ strain e. g. by looking at colocalizations with endocytic versus exocytic markers and comparing their relative abundance at the Sec2GEF-GFP-CUE-positive structures. While some of the Sec2GEF-GFP-CUE-positive structures colocalized with Mup1 in the Mup1-uptake assay, it would be important to clarify how many endosomal properties are retained and how many exocytic properties are gained by these chimeric vesicles e. g. by looking for the presence of specific phosphoinositides, or Rab5 and Rab5 effectors. A competition between endosomal and the acquired exocytic factors could also be another possible explanation for the immobility of the Sec2GEF-GFP-CUE structures and less efficient recruitment of Sec4 effectors in addition to the proposed lack of PI4P.
      2. While the colocalization of the Sec2GEF-GFP-CUE-signal with Sec4 indicates that this GEF-construct is generally active, it remains unclear whether the activity of the tagged constructs differ from that of the wild type Sec2 protein. This could be analyzed in vitro via a MANT-GDP GEF-activity assay (Nordmann et al., 2010). Again, it remains unclear how much of the Sec2GEF-Sec4 colocalization represents the retained native localization versus synthetic localization at chimeric endo-exocytic vesicles.
      3. The authors mention that tagging with GFP increases the stability of the expressed constructs. However, it remains unclear whether this is also the case for the other tags (NeonGreen, mCherry) used in the other experiments. Are the constructs expressed at similar levels?
      4. In Figure 5: The incomplete colocalization of Sec2GEF-GFP-CUE with Vps9 is explained by the short-timed accessibility of ubiquitin moieties. Apart from the likely retained native localization or weak CUE-domain-function, this observation could also be due to competition between Vps9 and Sec2GEF-GFP-CUE for the available ubiquitin target structures.

      Minor remarks:

      1. Fig. 3C do not contain the arrowheads as indicated in the legend, making it harder to interpret.
      2. The image chosen for Sec2-GFP in Fig. 4B suggests less colocalization between Sec2-GFP and Sec8 than between Sec2GEF-GFP-CUE and Sec8. They rather look next to each other.
      3. Figure 5: While resolution limits are possibly reached regarding endosomes, it might be interesting to check by thin section electron microscopy whether and how class E compartment formation is affected by Sec2GEF-GFP-CUE expression.
      4. Discussion: "Furthermore, delivery of Mup1-GFP to the vacuole was slowed in Sec2GEF-GFP-CUE cells..." - The authors studied "the clearance of Mup1-GFP from the plasma membrane" and not vacuolar delivery. They did not show much vacuolar localization.

      Literature:

      Nagano, M., Toshima, J. Y., Siekhaus, D. E., & Toshima, J. (2019): Rab5-mediated endosome formation is regulated at the trans-Golgi network. Nature Communications Biology, 2 (1), 1-12.

      Nordmann, M., Cabrera, M., Perz, A., Bröcker, C., Ostrowicz, C., Engelbrecht-Vandré, S., & Ungermann, C. (2010): The Mon1-Ccz1 complex is the GEF of the late endosomal Rab7 homolog Ypt7. Current Biology, 20(18), 1654-1659.

      Paulsel, A. L., Merz, A. J., & Nickerson, D. P. (2013): Vps9 family protein Muk1 is the second Rab5 guanosine nucleotide exchange factor in budding yeast. Journal of Biological Chemistry, 288 (25), 18162-18171.

      Shideler, T., Nickerson, D. P., Merz, A. J., & Odorizzi, G. (2015): Ubiquitin binding by the CUE domain promotes endosomal localization of the Rab5 GEF Vps9. Molecular Biology of the Cell, 26 (7), 1345-1356.

      Significance

      • see above
      • has some deficits in interpretation as the Rab relocalization was not complete and thus conclusions are limiting
    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Reviewer #1 (Evidence, reproducibility and clarity):

      This manuscript by Gouignard et al., reports that a matrix metalloproteinase MMP28 regulates neural crest EMT and migration by transcriptional control rather than matrix remodeling. The manuscript is clearly written and provides sufficient evidence and control experiments to demonstrate that the MMP28 can translocate into nucleus of non-producing cells and that nuclear localization and catalytic activity are essential for the activity of MMP28 to regulate gene transcription. ChIP-PCR analysis also suggests that MMP28 can bind to the proximal promoters of Twist and others. However, since weak binding is also detected between MMP14 and the promoters, a more direct evidence that such binding can indeed promote Twist expression will be more appreciated.

      Thank you for this comment. First, to represent the data from our ChIP assays we normalized all intensities to the GFP condition such that all levels are expressed fold change to GFP and we performed statistical comparisons. This shows that the enrichment of promoter regions by MMP28 and MMP14 are not equivalent.

      Second, to substantiate our previous ChIP data, we performed a new set of ChIP experiments, by performing three independent chromatin immunoprecipitations (biological replicates), and used primers targeting three new domains in the proximal promoter of Twist and primers against two domains in the proximal promoter of E-cadherin and one domain 1kb away from transcription start of E-cadh. We found that pull down with MMP28 significantly enriches the three tested domains within the proximal promoter of Twist but not those of the E-cadherin promoter, compared to GFP pull down. These data were added to Figure 7.

      However, we do not propose that MMP28 might act as a transcription factor and be able to promote Twist expression on its own. We apologize if some of the initial description of our data were too blunt and might have misled the reviewers. First, the protein sequence of MMP28, like those of all other MMPs, does not contain any typical DNA binding sites. In addition, ectopic overexpression of MMP28 is not sufficient to promote ectopic Twist expression (as shown in supplementary Figure 4) whereas, by contrast, Twist is able to promote ectopic expression of Cadherin-11 (see new Supplementary Figure 11). This indicates that MMP28 has an effect on Twist expression in the context of neural crest only and is not capable of activating Twist expression by itself.

      Also, it should be added that enrichments of promoter domains by MMP28 pull-down are very modest in comparison to enrichments obtain with Twist pull-downs. Therefore, a more plausible role for MMP28 is to be part of a regulatory cascade with other factors involved in regulating the expression of the target genes important for EMT. Other MMPs such as MMP14 and MMP3 have been shown to interact with chromatin with some transcriptional downstream effects but multiple domains of these proteins seem to equally mediate such interactions. None of the data published in these studies rules out a relay via cofactors. We extensively modified the text describing our data and provided additional context.

      Identifying the putative partners and their functional relationship with MMP28 is a project on its own and beyond the scope of this study.

      While the nuclear translocation and transcription regulation activity of MMP28 is clearly the focus of the study, there are some minor issues that should be further clarified in the functional studies in the earlier part of the manuscript.

      First, the effect of the splicing MO is somewhat unexpected. I would think that the splicing MO would lead to the retention of intron one and therefore premature termination or frameshift of the protein product, but RT-PCR or RT-qPCR suggest that there is no retention of intron 1, but a reduction in the full-length transcript, exon 1, or exon 7-8. Why is that?

      Thank you for this comment. This is presumably due to nonsense mediated RNA decay. We have not explored the biochemistry of MMP28 RNA following injection with MOspl. Splicing MOs can have multiple effects. As explained on the GeneTools website splicing MOs disturb the normal processing of pre-mRNA and cells have various ways to deal with this and there are multiple possible outcomes. The PCR with E1-I1 suggests that intron 1 is not retained. Therefore, a putative concern would be that MOspl led to exon-skipping and to the generation of a truncated form of MMP28. However, we have checked that it is not the case. The fact that the PCR using E7-E8 primers indicates a reduction as well suggests an overall degradation of the mRNA for MMP28. Importantly, the effect of MOspl can be rescued using MMP28 mRNA indicating that the knockdown is specific.

      Second, the effect of the splicing MO and ATG MO in NC explant spreading seems to be somewhat different, with ATG MO strongly repressed explant spreading, cell protrusion, and cell dispersion, while splicing MO does not affect cell dispersion, but affects the formation of cell protrusions. Does this reflects different severity of the phenotype or does the product of splicing MO display some activity?

      Thank you for this comment. However, we think that there may be a confusion. Data on Fig2 (MOatg) and Fig3 (MOspl) both show a decrease of neural crest migration in vivo (Figure 2a-b) and of neural crest dispersion ex vivo (Fig2c, Fig3i-k). Along the course of the project we have never observed a difference in penetrance or intensity of the phenotypes between the two MOs.

      Also, the switch between ATG MO and splicing MO is a bit confusing, maybe it is better to keep splicing MO only in the main text and move results involving ATG MO to supplementary studies.

      The reason is purely historical. We had an effect with MOatg that can be rescued but there is no available anti-Xenopus MMP28 to assess its efficiency. So we turned to MOspl to have an internal control of efficiency by PCR. This provides an independent knockdown method reinforcing the findings. Both MOs have been controlled for specificity by rescue with MMP28 and display similar effect on NC migration/dispersion. We see no harm in keeping both in the main figures but if the reviewer feels strongly about this we could perform the suggested redistribution of data between main and supp figures.

      Lastly, in Figure 3C and 3J, it says that the distance of migration or explant areas were normalized to CMO, while normalization against the contralateral uninjected side, or explant area at time 0 makes more sense.

      Thank you for this comment as it will allow us to explain better these quantifications. Regarding in vivo measurements (Figure 3c), it is indeed the ratio between injected and non-injected sides that is performed in all conditions and then the ratios are normalized to CMO. We have now clarified this point on all instances throughout the figures.

      Regarding ex vivo measurements (Figure 3j), NC explants are placed onto fibronectin and left to adhere for 1 hour before time-lapse imaging starts. NC cells extracted from MMP28 morphant embryos are not as efficient at adhering and spreading as control NC cells. Therefore, normalizing to t0 would erase that initial difference between control and MMP28 conditions. By normalizing to CMO at t_final we can visualize the initial defect of adhesion and spreading as well as the overall defects since CMO at t_final represents the 100% dispersion possible over the time course of the movie.

      Referee Cross-commenting

      I agree with comments from both Reviewers 2 and 3, especially that whether MMP28 regulates placode development (through Six1 expression) should be addressed.

      Reviewer #1 (Significance):

      This work provides novel insights of how a metalloprotease that is normally considered to function extracellularly can transfer into the nucleus of neighboring cells and regulate transcription. This would be of interest to researchers studying EMT, cell migration, and the functions of extracellular proteins in general. My expertise is in neural crest EMT and migration, and cytoskeletal regulation of cell behavioral changes. I do not have enough background on biochemical analysis.

      Reviewer #2 (Evidence, reproducibility and clarity):

      Summary:

      In this study, Gouignard et al. beautifully use the Xenopus neural crest as a model system to examine the role of the matrix metalloproteinase MMP28 during EMT. The authors show that mmp28 is expressed by the placodes adjacent to the neural crest. Using in vivo and in vitro perturbation experiments, they show that the catalytic function of MMP28 is necessary for the expression of several neural crest markers, as well as neural crest migration and adhesion. Next, the authors use grafting, confocal imaging, and biochemistry to convincingly demonstrate that MMP28 is translocated into the nucleus of neural crest cells from the adjacent placodes. Finally, nuclear localization of MMP28-GFP is necessary to rescue twist and sox10 expression in MMP28 morphants, and ChIP-PCR experiments suggest direct interactions between MMPs and the proximal promoters of several neural crest genes. These results have significant implications on the field of EMT and highlight an underappreciated role for MMPs as direct regulators of gene expression.

      Major comments:

      Overall, the experiments presented in this study are thoroughly controlled and the results are clearly quantitated and rigorously analyzed. Most claims are well supported by multiple lines of experimental evidence; however, there are a few experiments or observations that this reviewer thinks should be reconsidered for more clarity and accuracy.

      1. Supplementary Figure 1 shows the effect of MMP28-MOspl on additional ectodermal markers and shows that there is a significant loss of six1 expression from the placodal domain following MMP28 knockdown. The authors note this as a "slight reduction" on line 95, but since this shows a larger reduction in gene expression than some of the neural crest markers (snai2, sox8, foxd3), this reviewer thinks these results warrant a more significant discussion in this study.

      Thank you for this comment. We apologize for the poor choice of word regarding the description of the effect on Six1 expression. We corrected the associated paragraph.

      Although we do observe a reduction of Six1 expression upon MMP28 knockdown, this cannot explain the observed downregulation of some neural crest genes in our MMP28 experiments. There are noticeable differences between the effects of Six1 loss of function that have been reported in the literature and the MMP28 knockdown phenotypes we describe. As suggested by the reviewer, we added a paragraph in the discussion.

      Does MMP28 localize to the nucleus of placodal cells as it does with neural crest? If so, is it through interaction with the six1 proximal promoter? If MMP28 does not localize to the nucleus, that would suggest MMP28 function with a different mechanism between epithelial cells distinct from role in EMT. These questions could be addressed by analysis of the placode cells in the images in Figure 5 and use of primers against the six1 proximal promoter on any remaining samples from the ChIP experiment.

      Thank you for this comment. To address whether nuclear entry is specific to the neural crest-placodes interaction, we performed new grafts:

      • 1/ we replaced neural crest cells from embryos expressing MMP28-GFP by placodal cells injected with Rhodamine-dextran. This generates grafted embryos with control placodes next to placodes overexpressing MMP28-GFP. There, we can analyze entry of MMP28-GFP in placodal cells that do not overexpress it. We detected MMP28 in the cytoplasm and in the nucleus of these placodal cells. However, the rate of nuclear entry was lower than in NC cells.

      • 2/ To assess the importance of the cell type producing MMP28, we grafted NC cells injected with Rhodamine-dextran next to caudal ectoderm expressing MMP28-GFP. MMP28 was detected in cytoplasm and the nucleus of the NC cells but with a lower efficiency than when NC are grafted next to placodes expressing MMP28-GFP.

      • 3/ We made animal caps sandwiches with animal caps injected with Rhodamine-dextran and animal caps expressing MMP28-GFP. In this case MMP28-GFP is detected in the cytoplasm but fails to reach the nucleus.

      Collectively, these data indicate that placodes can import MMP28 produced by placodes and that NC can import MMP28 produced by other cells than placodes. However, in both cases the rate of nuclear entry was lower than in the NC-placode situation. Finally, the animal cap sandwiches indicate that entry into the cells does not predict entry into the nucleus. All these data were added to Supp Figure 7. Statistical comparisons of the proportion of cells with cytoplasmic and nuclear MMP28-GFP in all grafts were added to Figure 5.

      The Six1 promoter analysis suggested is beyond the scope of this study as our focus is primarily on the role of MMP28 in neural crest development.

      1. In Figure 2c, the authors rescue MMP28-MOatg with injection of MMP28wt mRNA. Does the MOatg bind to the exogenous mRNA? If so, this may just reflect titration of the MOatg. If this is the case, this experiment should be repeated with MOspl instead of MOatg.

      Thank you for this comment. MOatg is designed upstream of the ATG and thus the binding site is not included in the expression construct. We added this important technical information in the methods. Of note, we already have the suggested equivalent of Fig2C with the MOspl on figure 3.

      1. Is there a missing data point in Figure 2d corresponding to the upper bounds of the whisker in the 6 hour time point for the MMP28-MOatg dataset?

      Thank you for pointing this out. The top data point was indeed missing from the graph, and we apologize for this oversight. We have now updated the figure with the correct graph.

      1. The authors present ChIP-PCR results in Figure 7 as the major evidence to support the mechanism of nuclear MMP28 in regulating neural crest EMT through physical interaction with target gene promoters. However, the experimental design and presentation in Figure 7 are somewhat unconventional, and as such, difficult to interpret. First, instead of displaying the band brightness across the gel, the authors should normalize their bands to their negative GFP control, thus allowing for interpretation as a "fold enrichment over GFP control". It would be most clear to present these results in the form of a plot similar to Shimizu-Hirota et al., 2012, Figure 6D. Using qPCR instead of gel-based quantitation would further increase reproducibility by removing any bias in image analysis.

      Thank you for this comment. For each band the value of the adjacent local background was subtracted. We have now normalized to GFP to provide graphs showing the fold change to GFP enrichment as requested.

      However, we would like to point out that we do not propose that MMP28 might act as a transcription factor and be able to promote Twist expression on its own. First, the protein sequence of MMP28 does not contain any typical DNA binding sites, as is the case for any other MMPs. In addition, ectopic overexpression of MMP28 is not sufficient to promote ectopic Twist expression (see sup figure 4) contrary to Twist that can ectopically induce Cadherin-11 for instance (see sup figure 11). Further, enrichments of promoter domains by MMP28 pull downs are very modest in comparison of the enrichments promoted by Twist pull downs.

      A more plausible role for MMP28 is that it is recruited via an interaction with other factors involved in regulating the expression of the target genes related to EMT. Identifying the partners and their functional relationship with MMP28 is a project on its own, and beyond the scope of this study.

      Second, a proximal promoter sequence represents only ~250 bp upstream from the transcriptional start site. What is the rationale for testing multiple loci up to 3 kb upstream?

      Thank you for pointing this out. The use of the term “proximal” was indeed misleading we have now corrected this part in the text. Regulatory sequences can be located anywhere so we initially had a broader approach to test for interactions. Following on this reviewer’s comment, we removed the data points corresponding to the very distal sites. In addition, we performed three new independent ChIP-PCR assays with primers in the proximal portion of Twist and E-cadherin promoters and found enrichment in ChIP with MMP28-GFP compared to GFP for Twist but not for E-cadherin (whose expression was not affected by MMP28 knockdown). These data were added to Figure 7.

      It is surprising to see that most of these proteins do not show significant enrichment to a particular locus across this ~3 kb territory, while this reviewer would expect to see enrichment close to the TSS that quickly is lost as you move further upstream. Can you explain why MMP28, MMP14, and often Twist, show similar enrichment across this long genomic region?

      Thank you for this comment. Our initial choice of representation did not allow to compare profiles properly. Fold-enrichment to GFP, as suggested by this reviewer, now shows that Twist, MMP28 and MMP14 do not display the same pattern of enrichment across the various loci and that MMP28 pull downs leads to significant enrichments of some of the domains tested in Cad11 and Twist promoters.

      Third, the authors should include additional genomic loci to act as negative controls. For example, E-cadherin was unaffected by MMP28-MOspl, thus there may be no physical interaction between the E-cadherin locus and MMP28. It would be ideal to display results from at least one neural crest-related and one non-neural crest-related gene. Finally, this experiment requires statistical analyses to increase confidence in these interactions.

      Thank you for this comment. We tested binding to E-cadherin promoter for GFP and MMP28-GFP and found no enrichment with MMP28. We also performed statistics as requested. These data were added to Figure 7.

      Minor comments:

      1. The authors should expand their abstract to more explicitly describe the experiments and results presented within this study.

      Done

      1. In the introduction, line 57 is unclear. "MMP28 is the latest member..." Is this chronologically? Evolutionarily? After this, the authors' statement that the roles of MMP28 are "poorly described" (lines 59-60) seems contradicting with their next sentences citing several studies that document the roles of MMP28 in diverse systems.

      Thank you for this comment. The term “poorly described” was meant with respect to other MMPs with more extensive literature. We have now rephrased this part. Regarding the “latest member” we meant the last to be identified. We have now rephrased this part.

      1. To increase clarity, the authors should define which cell types are labeled by in situ hybridization for sox10 and foxi4.1 in Figure 1e.

      Thank you, we performed the requested clarifications and expanded the change to add the cell types labelled by the other genes used on the figure (see figure legend).

      1. The PCR analysis for mmp28 splicing shown in Figure 1g is very clear and well demonstrates the efficacy of the MMP28-MOspl. However, the authors should note in the figure legend what the "ODC" row represents as this is unclear.

      We added the definition of ODC in the figure legends and in the methods.

      1. On line 118 the authors first reference "MOatg" but should explicitly define this reagent and its mechanism of action for clarity.

      We performed the requested clarification.

      Referee Cross-commenting

      As with Reviewer #1, I was surprised that the RT-PCR analysis presented in support of the splicing MO lacked retention of intron one. I reasoned this might be due to reduced transcript abundance through a mechanism such as nonsense-mediated decay, but I agree that this data raises questions that the authors should address.

      Thank you for this comment. Indeed, this is presumably due to nonsense mediated RNA decay. We have not explored the biochemistry of MMP28 RNA following injection with MOspl. Splicing MOs can have multiple effects. As explained on the GeneTools website splicing MOs disturb the normal processing of pre-mRNA and cells have various ways to deal with this and there are multiple possible outcomes. The PCR with E1-I1 suggests that intron 1 is not retained. Therefore, a putative concern would be that MOspl led to exon-skipping and to the generation of a truncated form of MMP28. However, we have checked that it is not the case. The fact that the PCR using E7-E8 primers indicates a reduction as well suggest an overall degradation of the mRNA for MMP28. Importantly, the effect of MOspl can be rescued using MMP28 mRNA indicating that the knockdown is specific.

      I also agree with the other comments from Reviewers 1 and 3.

      Reviewer #2 (Significance):

      This study by Gouignard et al. provides compelling evidence for the role of MMP28 during neural crest EMT. As neural crest cells share similar EMT and migration mechanisms with cancer progression, they represent a powerful system in which to study these biological processes in vivo. Previous work on MMP function has focused primarily on extracellular matrix remodeling and the effect on cell migration, with less attention given to the role of MMPs during EMT. More recent reports in other systems have begun to elucidate a role for MMP translocation into the nucleus, indicating a surprising and novel mechanism for these proteins. This work would be of particular interest to audiences interested in cancer, cell, and developmental biology, as it highlights the importance of the non-canonical function of metalloproteinases during EMT and migration.

      Reviewer #3 (Evidence, reproducibility and clarity):

      Summary

      This study by Gouignard and colleagues explores the mechanisms involving the matrix-metalloprotease MMP28 in the epithelial-to-mesenchymal transition (EMT) of neural crest cells. Interestingly and provocatively, they focus not only on the extracellular functions of this protease but also on the roles of MMP28 in the nucleus. This in non-conventional sub-cellular localization is shared with other MMPs, but its significance remains poorly understood. Here, the authors show that the nuclear function of MMP28 impacts the expression of key EMT regulators in neural crest cells in vivo.

      Using Xenopus laevis as a powerful animal model to explore the early development, the authors show that mmp28 expression is found in the ectodermal placodal tissue adjacent to the neural crest prior and after EMT.<br /> In the first part of the study, the authors show that MMP28 depletion affects a subset of neural crest marker gene expression (snai2, twi, sox10) but not others (sox9, snai1), suggesting a specific role on a subset of the genes important for neural crest EMT. The MMP28 depletion phenotype is restored by coinjecting MMP28 MO and MMP28 mRNA, provided that the catalytic activity of the encoded protein is maintained. Next, epistasis (rescue) experiments show that Twist1 can compensate MMP28 depletion.<br /> The second part of the study elegantly shows that MMP28 produced by host adjacent tissues can translocate into the nucleus of neural crest cells grafted from a donor embryo (devoid of MMP28-GFP expression). It also shows that MMP28 nuclear localization as well as its catalytic activity are both required for activating the neural crest gene twist1 and sox10; and that MMP28 is found bound on the chromatin of twist1, cad11 and sox10.<br /> Altogether, these experiments strongly support a model for the nuclear role of MMP28 in the activation (or maintenance) of key genes of the EMT program in vertebrate neural crest cells.

      Major comments

      The key conclusions are:

      Conclusion 1: MMP28, expressed and secreted by placodes, is important for complete neural crest patterning prior to EMT, including activation of twist1 and EMT effector cadherin 11 genes. MMP28 is important for neural crest EMT and migration in vivo and in explant assay in vitro.

      However, this conclusion omits potential indirect effect of interfering with placode formation itself, as indicated by the strong decrease in six1 expression in morphant embryos. The effect of MMP28MO on the expression of six1 is as strong as for neural crest markers snai2, twi, for example. Line 95, "slight reduction" should be modified.

      Thank you or this comment. We have now modified the associated text.

      What this may mean for placodal development itself, as well as for indirect effects on neural crest cells need to be discussed.

      Following this comment, we added a paragraph in the discussion about Six1.

      Conclusion 2: Gain of Twist 1 (but not Cadherin 11) rescues MMP28 morphant phenotype, allowing EMT to occur and restoring several parameters of cell migration in vivo and in explant assay

      Conclusion 3: When secreted from adjacent cells, MMP28 is translocated into the nucleus of neural crest cells and displays a nuclear function important for the activation of twist1 expression.

      Both conclusions 2 and 3 are supported by multiple elegant and convincing experimental data. These conclusions do not depend on mmp28 exclusive expression by the placodal ectoderm, and would still be important if there was a minor expression in the neural crest cells themselves (and thus an autocrine effect).

      Additional experiments to strengthen the conclusions<br /> Related to Conclusion 1:

      • line 102-106: In the rescue experiment, is six1 expression rescued too?

      Thank you for this comment. As detailed in the newly added discussion paragraph about the effects of Six1 loss of function that have been described in the literature, it is very unlikely that our NC phenotypes stem from the observed reduction of Six1 expression.

      Nonetheless, following this comment we checked for Six1 expression in the placodal domain following MMP28 knockdown and rescue condition. In the rescue condition, only 25% of the embryos had recovered Six1 expression in placodes while 75% of the embryos recovered Sox10 expression in neural crest cells. These data further confirm that rescue of placodal genes is not a pre-requisite for the rescue of neural crest genes and were added in Supp Figure 5.

      Although MMP28 is likely to have a role in placodes as well, the expansion of Sox2 and Pax3 expression domain and the loss of Eya1 expression typically associated with Six1 knockdown did not occur in MMP28 knockdown. Our story being focused on neural crest cells, we did not investigate further how the MMP28-dependent effect on Six1 might impair placode development.

      • Figure 2g: qPCR analysis suggests that mmp28 is expressed in the neural crest explants themselves, levels being lowered by the MO injection. The levels of this potential expression in the neural crest itself should be compared to the levels in the placodal ectoderm. How do the authors exclude an effect of the MO within the neural crest tissue, independently of roles from the placodal tissue?

      Thank you for this comment. There is a very small subpopulation of NC cells called the medial crest that expresses MMP28. They are along a thin line along the edge of the neural folds. We previously described this in Gouignard et al Phil Trans Royal Soc B 2020. It is useful for us as an internal control for MO efficiency but the expression in placodes is much stronger and involves many more cells. However, this expression called our attention at the onset of the project and we performed some experiments to assess whether some of the observed effects were due to a NC-autonomous effect, as suggested by this reviewer. To test for this we performed targeted injected of the MO such that the medial crest would receive the MO but not the placodes. Targeting the medial crest with MMP28-MO had no effect on Sox10 expression. These data were added to new supp Figure 1.

      The cost and time for these additional experiments is limited (about 3 weeks), and uses reagents already available to the authors.

      Data and Methods are described with details including all necessary information to replicate the study. Replication is carefully done and statistical analysis seems convincing.

      Minor comments

      Experimental suggestions to further strengthen the conclusions.<br /> Related to Conclusion 1: - Figure 1e, frontal histological sections would help distinguishing between placodal tissue and neural crest mesenchyme.

      Thank you for this comment. We previously published a detailed expression pattern with such sections (Gouignard et al Phil Trans Royal Soc B, 2020). We rephrased the text to better refer to this previous publication.

      Related to Conclusion 2: - Figure 3: in explants co-injected with twist1 mRNA, is cad11 expression restored? Could this indicate if cad11 is (or is not) part of the program controlled by Twist1 (as suggested by the last main figure)?

      Thank you for this comment. We checked for Cadherin-11 expression in control MO, MMP28-MOspl and MOspl+Twist mRNA and Twist is indeed capable of inducing Cadherin-11 and even leads to ectopic activation of Cad11 on the injected side. These data were added to new Supp Figure 11.

      Related to Conclusion 3: is MMP28 translocation seen in any cell context? Could the authors repeat experiments in Figure 6a with animal cap ectoderm? And with sandwich animal cap ectoderm, one expressing MMP28-GFP versions (wt, deltaSPNLS) and the other Rhodamine Dextran only? This would allow to generalize the mechanism or on the contrary to show a neural crest specificity.

      Thank you for this comment. Following this suggestion and comments from the other reviewers, we performed new grafting experiments.

      • 1/ we replaced neural crest cells from embryos expressing MMP28-GFP by placodal cells injected with Rhodamine-dextran. This generates grafted embryos with control placodes next to placodes overexpressing MMP28-GFP. There, we can analyze entry of MMP28-GFP in placodal cells that do not overexpress it. We detected MMP28 in the cytoplasm and in the nucleus of these placodal cells. However, the rate of nuclear entry was lower than in NC cells.
      • 2/ To assess the importance of the cell type producing MMP28 we grafted NC cells injected with Rhodamine-dextran next to caudal ectoderm expressing MMP28-GFP. MMP28 was detected in cytoplasm and the nucleus of the NC cells but with a lower efficiency than when NC are grafted next to placodes expressing MMP28-GFP.
      • 3/ We made animal caps sandwiches with animal caps injected with Rhodamine-dextran and animal caps expressing MMP28-GFP. In this case MMP28-GFP is detected in the cytoplasm but fails to reach the nucleus. These data indicate that placodes can import MMP28 produced by placodes and that NC can import MMP28 produced by other cells than placodes. However, in both cases the rate of nuclear entry was lower than in the NC-placode situation. Finally the animal cap sandwiches indicate that entry into the cells does not predict entry into the nucleus. All these data were added to new Supp Figure 7 and quantifications of import of MMP28-GFP in the cytoplasm and the nucleus all conditions added to Figure 5.

      In supplementary figure 4a, the grey (RDx) is not visible in the zoom in images.

      As the grey channel interferes with visualizing the green channel, we only show the grey channel on the first low magnification image so that the position of grafted cells can be seen. We found it better to omit it from the zoomed in images to avoid masking the GFP signal.

      In figure 7a,b MMP14 is green, GFP is grey (mentioned wrongly in line 276)

      Thank you for pointing this out. We have extensively modified Figure 7 and such issues are now resolved.

      Bibliographical references are accurate. Clarity of the text and figures is excellent, except maybe Figure 7, where a qPCR analysis would be easier to visualize, especially with low-level or fuzzy bands on the gel.

      Thank you. We have now modified Figure 7, including normalization to GFP to show fold-change enrichment and have added new data from three independent ChIP assays for proximal Twist and E-cadherin promoters that we hope further substantiate our initial observations.

      Reviewer #3 (Significance):

      Place of the work in the field's context:

      In cancer, the MMP proteins are widely described in multiple tumor contexts and promote cell invasion. In development, several studies have focused on their functions in the extracellular space. The nuclear localization of MMP family proteins has been described previously but remained poorly understood so far. This work is thus a pioneer study aiming to understand MMP28 nuclear function.

      Advance:

      This study makes a significant advance in the field, by unraveling the importance of the MMP28 activity in the cell nucleus for the expression of key EMT regulators. Moreover, the study suggests that extracellular MMP28 secreted by adjacent cells or tissues can be internalized and transported to cell nucleus into cells located several cell diameters away. This study thus supports a novel facet of MMP proteins activity, complementary to their previously described role on the extracellular matrix, and further favoring cell invasion, in development and potentially in cancer too.

      The target audience goes without doubt beyond developmental biologists (the primary interest) and also includes cell and cancer biologists, and any biologist interested by MMPs or cell invasion mechanisms in vivo.

      My field of expertise is developmental biology focused on neural and neural crest early development, mainly using animal models in vivo and some cell culture experiments. I also focus on some aspects of cancer cell migration.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      Summary

      This study by Gouignard and colleagues explores the mechanisms involving the matrix-metalloprotease MMP28 in the epithelial-to-mesenchymal transition (EMT) of neural crest cells. Interestingly and provocatively, they focus not only on the extracellular functions of this protease but also on the roles of MMP28 in the nucleus. This in non-conventional sub-cellular localization is shared with other MMPs, but its significance remains poorly understood. Here, the authors show that the nuclear function of MMP28 impacts the expression of key EMT regulators in neural crest cells in vivo.

      Using Xenopus laevis as a powerful animal model to explore the early development, the authors show that mmp28 expression is found in the ectodermal placodal tissue adjacent to the neural crest prior and after EMT.<br /> In the first part of the study, the authors show that MMP28 depletion affects a subset of neural crest marker gene expression (snai2, twi, sox10) but not others (sox9, snai1), suggesting a specific role on a subset of the genes important for neural crest EMT. The MMP28 depletion phenotype is restored by coinjecting MMP28 MO and MMP28 mRNA, provided that the catalytic activity of the encoded protein is maintained. Next, epistasis (rescue) experiments show that Twist1 can compensate MMP28 depletion.<br /> The second part of the study elegantly shows that MMP28 produced by host adjacent tissues can translocate into the nucleus of neural crest cells grafted from a donor embryo (devoid of MMP28-GFP expression). It also shows that MMP28 nuclear localization as well as its catalytic activity are both required for activating the neural crest gene twist1 and sox10; and that MMP28 is found bound on the chromatin of twist1, cad11 and sox10.<br /> Altogether, these experiments strongly support a model for the nuclear role of MMP28 in the activation (or maintenance) of key genes of the EMT program in vertebrate neural crest cells.

      Major comments

      The key conclusions are:

      Conclusion 1: MMP28, expressed and secreted by placodes, is important for complete neural crest patterning prior to EMT, including activation of twist1 and EMT effector cadherin 11 genes. MMP28 is important for neural crest EMT and migration in vivo and in explant assay in vitro.

      However, this conclusion omits potential indirect effect of interfering with placode formation itself, as indicated by the strong decrease in six1 expression in morphant embryos. The effect of MMP28MO on the expression of six1 is as strong as for neural crest markers snai2, twi, for example. Line 95, "slight reduction" should be modified. What this may mean for placodal development itself, as well as for indirect effects on neural crest cells need to be discussed.

      Conclusion 2: Gain of Twist 1 (but not Cadherin 11) rescues MMP28 morphant phenotype, allowing EMT to occur and restoring several parameters of cell migration in vivo and in explant assay

      Conclusion 3: When secreted from adjacent cells, MMP28 is translocated into the nucleus of neural crest cells and displays a nuclear function important for the activation of twist1 expression.

      Both conclusions 2 and 3 are supported by multiple elegant and convincing experimental data. These conclusions do not depend on mmp28 exclusive expression by the placodal ectoderm, and would still be important if there was a minor expression in the neural crest cells themselves (and thus an autocrine effect).

      Additional experiments to strengthen the conclusions<br /> Related to Conclusion 1:

      • line 102-106: In the rescue experiment, is six1 expression rescued too?
      • Figure 2g: qPCR analysis suggests that mmp28 is expressed in the neural crest explants themselves, levels being lowered by the MO injection. The levels of this potential expression in the neural crest itself should be compared to the levels in the placodal ectoderm. How do the authors exclude an effect of the MO within the neural crest tissue, independently of roles from the placodal tissue?

      The cost and time for these additional experiments is limited (about 3 weeks), and uses reagents already available to the authors.

      Data and Methods are described with details including all necessary information to replicate the study. Replication is carefully done and statistical analysis seems convincing.

      Minor comments

      Experimental suggestions to further strengthen the conclusions.<br /> Related to Conclusion 1: - Figure 1e, frontal histological sections would help distinguishing between placodal tissue and neural crest mesenchyme.<br /> Related to Conclusion 2: - Figure 3: in explants co-injected with twist1 mRNA, is cad11 expression restored? Could this indicate if cad11 is (or is not) part of the program controlled by Twist1 (as suggested by the last main figure)?<br /> Related to Conclusion 3: is MMP28 translocation seen in any cell context? Could the authors repeat experiments in Figure 6a with animal cap ectoderm? And with sandwich animal cap ectoderm, one expressing MMP28-GFP versions (wt, deltaSPNLS) and the other Rhodamine Dextran only? This would allow to generalize the mechanism or on the contrary to show a neural crest specificity.

      In supplementary figure 4a, the grey (RDx) is not visible in the zoom in images.<br /> In figure 7a,b MMP14 is green, GFP is grey (mentioned wrongly in line 276)<br /> Bibliographical references are accurate. Clarity of the text and figures is excellent, except maybe Figure 7, where a qPCR analysis would be easier to visualize, especially with low-level or fuzzy bands on the gel.

      Significance

      Place of the work in the field's context:

      In cancer, the MMP proteins are widely described in multiple tumor contexts and promote cell invasion. In development, several studies have focused on their functions in the extracellular space. The nuclear localization of MMP family proteins has been described previously but remained poorly understood so far. This work is thus a pioneer study aiming to understand MMP28 nuclear function.

      Advance:

      This study makes a significant advance in the field, by unraveling the importance of the MMP28 activity in the cell nucleus for the expression of key EMT regulators. Moreover, the study suggests that extracellular MMP28 secreted by adjacent cells or tissues can be internalized and transported to cell nucleus into cells located several cell diameters away. This study thus supports a novel facet of MMP proteins activity, complementary to their previously described role on the extracellular matrix, and further favoring cell invasion, in development and potentially in cancer too.

      The target audience goes without doubt beyond developmental biologists (the primary interest) and also includes cell and cancer biologists, and any biologist interested by MMPs or cell invasion mechanisms in vivo.

      My field of expertise is developmental biology focused on neural and neural crest early development, mainly using animal models in vivo and some cell culture experiments. I also focus on some aspects of cancer cell migration.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Summary:

      In this study, Gouignard et al. beautifully use the Xenopus neural crest as a model system to examine the role of the matrix metalloproteinase MMP28 during EMT. The authors show that mmp28 is expressed by the placodes adjacent to the neural crest. Using in vivo and in vitro perturbation experiments, they show that the catalytic function of MMP28 is necessary for the expression of several neural crest markers, as well as neural crest migration and adhesion. Next, the authors use grafting, confocal imaging, and biochemistry to convincingly demonstrate that MMP28 is translocated into the nucleus of neural crest cells from the adjacent placodes. Finally, nuclear localization of MMP28-GFP is necessary to rescue twist and sox10 expression in MMP28 morphants, and ChIP-PCR experiments suggest direct interactions between MMPs and the proximal promoters of several neural crest genes. These results have significant implications on the field of EMT and highlight an underappreciated role for MMPs as direct regulators of gene expression.

      Major comments:

      Overall, the experiments presented in this study are thoroughly controlled and the results are clearly quantitated and rigorously analyzed. Most claims are well supported by multiple lines of experimental evidence; however, there are a few experiments or observations that this reviewer thinks should be reconsidered for more clarity and accuracy.

      1. Supplementary Figure 1 shows the effect of MMP28-MOspl on additional ectodermal markers and shows that there is a significant loss of six1 expression from the placodal domain following MMP28 knockdown. The authors note this as a "slight reduction" on line 95, but since this shows a larger reduction in gene expression than some of the neural crest markers (snai2, sox8, foxd3), this reviewer thinks these results warrant a more significant discussion in this study. Does MMP28 localize to the nucleus of placodal cells as it does with neural crest? If so, is it through interaction with the six1 proximal promoter? If MMP28 does not localize to the nucleus, that would suggest MMP28 function with a different mechanism between epithelial cells distinct from role in EMT. These questions could be addressed by analysis of the placode cells in the images in Figure 5 and use of primers against the six1 proximal promoter on any remaining samples from the ChIP experiment.
      2. In Figure 2c, the authors rescue MMP28-MOatg with injection of MMP28wt mRNA. Does the MOatg bind to the exogenous mRNA? If so, this may just reflect titration of the MOatg. If this is the case, this experiment should be repeated with MOspl instead of MOatg.
      3. Is there a missing data point in Figure 2d corresponding to the upper bounds of the whisker in the 6 hour time point for the MMP28-MOatg dataset?
      4. The authors present ChIP-PCR results in Figure 7 as the major evidence to support the mechanism of nuclear MMP28 in regulating neural crest EMT through physical interaction with target gene promoters. However, the experimental design and presentation in Figure 7 are somewhat unconventional, and as such, difficult to interpret. First, instead of displaying the band brightness across the gel, the authors should normalize their bands to their negative GFP control, thus allowing for interpretation as a "fold enrichment over GFP control". It would be most clear to present these results in the form of a plot similar to Shimizu-Hirota et al., 2012, Figure 6D. Using qPCR instead of gel-based quantitation would further increase reproducibility by removing any bias in image analysis. Second, a proximal promoter sequence represents only ~250 bp upstream from the transcriptional start site. What is the rationale for testing multiple loci up to 3 kb upstream? It is surprising to see that most of these proteins do not show significant enrichment to a particular locus across this ~3 kb territory, while this reviewer would expect to see enrichment close to the TSS that quickly is lost as you move further upstream. Can you explain why MMP28, MMP14, and often Twist, show similar enrichment across this long genomic region? Third, the authors should include additional genomic loci to act as negative controls. For example, E-cadherin was unaffected by MMP28-MOspl, thus there may be no physical interaction between the E-cadherin locus and MMP28. It would be ideal to display results from at least one neural crest-related and one non-neural crest-related gene. Finally, this experiment requires statistical analyses to increase confidence in these interactions.

      Minor comments:

      1. The authors should expand their abstract to more explicitly describe the experiments and results presented within this study.
      2. In the introduction, line 57 is unclear. "MMP28 is the latest member..." Is this chronologically? Evolutionarily? After this, the authors' statement that the roles of MMP28 are "poorly described" (lines 59-60) seems contradicting with their next sentences citing several studies that document the roles of MMP28 in diverse systems.
      3. To increase clarity, the authors should define which cell types are labeled by in situ hybridization for sox10 and foxi4.1 in Figure 1e.
      4. The PCR analysis for mmp28 splicing shown in Figure 1g is very clear and well demonstrates the efficacy of the MMP28-MOspl. However, the authors should note in the figure legend what the "ODC" row represents as this is unclear.
      5. On line 118 the authors first reference "MOatg" but should explicitly define this reagent and its mechanism of action for clarity.

      Referee Cross-commenting

      As with Reviewer #1, I was surprised that the RT-PCR analysis presented in support of the splicing MO lacked retention of intron one. I reasoned this might be due to reduced transcript abundance through a mechanism such as nonsense-mediated decay, but I agree that this data raises questions that the authors should address.

      I also agree with the other comments from Reviewers 1 and 3.

      Significance

      This study by Gouignard et al. provides compelling evidence for the role of MMP28 during neural crest EMT. As neural crest cells share similar EMT and migration mechanisms with cancer progression, they represent a powerful system in which to study these biological processes in vivo. Previous work on MMP function has focused primarily on extracellular matrix remodeling and the effect on cell migration, with less attention given to the role of MMPs during EMT. More recent reports in other systems have begun to elucidate a role for MMP translocation into the nucleus, indicating a surprising and novel mechanism for these proteins. This work would be of particular interest to audiences interested in cancer, cell, and developmental biology, as it highlights the importance of the non-canonical function of metalloproteinases during EMT and migration.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      This manuscript by Gouignard et al., reports that a matrix metalloproteinase MMP28 regulates neural crest EMT and migration by transcriptional control rather than matrix remodeling. The manuscript is clearly written and provides sufficient evidence and control experiments to demonstrate that the MMP28 can translocate into nucleus of non-producing cells and that nuclear localization and catalytic activity are essential for the activity of MMP28 to regulate gene transcription. ChIP-PCR analysis also suggests that MMP28 can bind to the proximal promotors of Twist and others. However, since weak binding is also detected between MMP14 and the promoters, a more direct evidence that such binding can indeed promote Twist expression will be more appreciated.

      While the nuclear translocation and transcription regulation activity of MMP28 is clearly the focus of the study, there are some minor issues that should be further clarified in the functional studies in the earlier part of the manuscript.

      First, the effect of the splicing MO is somewhat unexpected. I would think that the splicing MO would lead to the retention of intron one and therefore premature termination or frameshift of the protein product, but RT-PCR or RT-qPCR suggest that there is no retention of intron 1, but a reduction in the full-length transcript, exon 1, or exon 7-8. Why is that?

      Second, the effect of the splicing MO and ATG MO in NC explant spreading seems to be somewhat different, with ATG MO strongly repressed explant spreading, cell protrusion, and cell dispersion, while splicing MO does not affect cell dispersion, but affects the formation of cell protrusions. Does this reflects different severity of the phenotype or does the product of splicing MO display some activity? Also, the switch between ATG MO and splicing MO is a bit confusing, maybe it is better to keep splicing MO only in the main text and move results involving ATG MO to supplementary studies.

      Lastly, in Figure 3C and 3J, it says that the distance of migration or explant areas were normalized to CMO, while normalization against the contralateral uninjected side, or explant area at time 0 makes more sense.

      Referee Cross-commenting

      I agree with comments from both Reviewers 2 and 3, especially that whether MMP28 regulates placode development (through Six1 expression) should be addressed.

      Significance

      This work provides novel insights of how a metalloprotease that is normally considered to function extracellularly can transfer into the nucleus of neighboring cells and regulate transcription. This would be of interest to researchers studying EMT, cell migration, and the functions of extracellular proteins in general. My expertise is in neural crest EMT and migration, and cytoskeletal regulation of cell behavioral changes. I do not have enough background on biochemical analysis.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      1. General Statements [optional]

      *All three referee reports are very supportive. The referees acknowledge the insight obtained for NF2 tumor suppressor function, and they state unanimously that the appeal to the broader audience stems from the systematic deep mutational scanning approach employed. *

      Indeed, the goal of the study was to utilize conformation dependent NF2 protein interaction partners as a read out in deep mutational scanning interaction perturbation, which lead to the identification of an novel region, the F3 part of the FERM domain, important for NF2 conformation. The referees recognized the advance of the study and provided constructive feedback with excellent opportunities to improve the manuscript.

      *The points raised by the referees relate to the deep scanning analyses which needs additional explanations. Referee 1 has several comments with respect to experimental details, which we will address through text revisions and addition of data. Referee 2 suggests to include the Y2H in full (as supplemental part) and asks for more methodological discussion. We plan to include the data and will provide a new advantage / disadvantage discussion section for the deep scanning results. This is in line with Referee 3 who similarly says that “the deep mutational scanning interaction perturbation assay … message is somewhat lost in the main text”. *

      2. Description of the planned revisions

      Referee 1:

      In his/her first point the referee asks about justification of the use of the kinase in the Y2H experiments. Here we will report in more detail which kinases were used, in fact it was a discovery that ABL2 in contrast to all others tested did promote the NF2-PIK3R3 interaction. However, in the manuscript we provide evidence that the kinase dependency does not necessarily relate to NF2 phosphorylation. Rather we find mutations that relieved the PIK3R3-NF2 interaction from the kinase dependency. We show that the kinase promotes the PIK3R3 dimerization. We will make this point more clear in text revisions.

      We want to address the minor points 1-3 and 6-8 through revisions in the text, as we feel confident that the points can be addressed through better explanations and more detail.

      *Point 4: *

      We have examined expression of the YFP construct and will include the data in the revision.

      *Point 5: *

      We will reexamine the fluorescence images and provide better resolution pictures. Depending on the data we have, this may include new data were we record the localization of the NF2 variants again at higher resolution.

      Referee 2:

      Point 1: The bait construct which is missing from the panel was tested, but is autoactive and therefore the result can not be included in the figure. This will be clearly stated in the manuscript.

      *Point 2: The methodological part of the paper is important, however we failed to provide a discussion on the deep scanning result and agree that a critical discussion of advantages and disadvantages is warranted. *

      Minor points 1,2,4,5,6,7,9,10,12,13,14,15 can be addressed in full through text revisions.

      Point 3: Data will be added to supplemental Figure S1, however as we mentioned in the main text, the Iso1N and Iso7N, when used as prey do not result any interactions.

      Point 8: Taking the suggestion of the referee on board, we will provide a new Supplemental figure showing all variants that did not change the interaction patterns.

      *Point 11: We will fix the inconsistencies in Figure 5. We will include Q147 in the overall structure, S265 is a surface residue providing little structural information. *

      Referee 3:

      We thank referees 3 for their time and effort providing an assessment as experts on the molecular and clinical aspects of NF2.

      In response to the comments, we will strengthen the deep mutational scanning message through a new critical discussion part and fix the mistakes pointed at in the text.

      *We agree with the referees that “The use of isoform 7 as a construct is helpful to locate protein binding regions, but its physiological relevance is unclear.” This is exactly the point, to use a non-tumor suppressive isoform as a construct contrasting the binding behavior of the canonical isoform 1. We tried to summarize the knowledge about the non-canonical isoforms in the introduction (page2 bottom to page 3 top paragraph) as well as in Supplemental Figure 1. Unfortunately literature information is sparse. *

      Finally, we will check carefully (again) whether we used isoform 1 numbering throughout the manuscript.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      Summary:

      The authors developed a deep mutational scanning interaction perturbation technique, based on reverse yeast two-hybrid analysis, to identify important regions influencing conformation dependent protein function in NF2.

      They test the tumor suppressive NF2 isoform 1 and a shorter non-tumor suppressive isoform 7 (lacking exons 2 and 3 and containing exon 16 instead of 17) and find three interacting proteins, KDM1A, EMILIN1 and PIK3R3 (KDM1A and EMILIN1 have been identified previously). They map binding regions of these proteins using fragments of NF2 isoforms 1 and 7 and by large-scale interaction perturbation mutation scanning.

      Major comments:

      The main scientific advancement in the study is the development of the deep mutational scanning interaction perturbation assay, but this message is somewhat lost in the main text of the results.

      The relevance of the binding protein that did not bind isoform 1 is unclear (PIK3R3) and the relevance of characterising the binding domains for three proteins with an unknown function is not made clear. Were these the only binding partners identified in the yeast screen? The use of isoform 7 as a construct is helpful to locate protein binding regions, but its physiological relevance is unclear. Does it have known expression or a known function in human cells?

      Minor comments:

      Nomenclature should be updated in line with the new guidelines (i.e. NF2 vs neurofibromin)

      The two major isoforms are 1 and 2, differentiated by their C-terminal region (exon 17 or Exon 16). It would be helpful to describe protein binding regions using the amino acid numbering of the full-length transcripts throughout the manuscript, rather than using isoform 7 numbering in some sections.

      "Closeness", should perhaps be changed to closed-ness

      The significance of the RT4-D6P2T and HEI-193 cell lines should be explained/indicated in the text.

      PPI should be expanded at first use.

      Results are included in the context of previous studies, but it needs to be made clearer in some places which results were found in previous studies and which were identified in the current study.

      Specific recommendations

      1. 'NF2 (Neurofibromine 2, merlin)' -delewte 'neurofibromine' this has been deleted by HGNC
      2. 'Genetic mutations or deletion of NF2 cause neurofibromatosis type 2,' -Replace neurofibromatosis type 2 with NF2 related-schwannomatosis and cite Legius et al Genet Med 2022

      Referees cross-commenting

      I cannot see any changes to this manuscript. In particular the terms 'neurofibromine' and neurofibromatosis should be deleted

      Significance

      The authors developed a deep mutational scanning interaction perturbation technique, based on reverse yeast two-hybrid analysis, to identify important regions influencing conformation dependent protein function in NF2.

      They test the tumor suppressive NF2 isoform 1 and a shorter non-tumor suppressive isoform 7 (lacking exons 2 and 3 and containing exon 16 instead of 17) and find three interacting proteins, KDM1A, EMILIN1 and PIK3R3 (KDM1A and EMILIN1 have been identified previously). They map binding regions of these proteins using fragments of NF2 isoforms 1 and 7 and by large-scale interaction perturbation mutation scanning.

      The main scientific advancement in the study is the development of the deep mutational scanning interaction perturbation assay, but this message is somewhat lost in the main text of the results.

      Dr Smith and Professor Evans are experts on the molecular and clinical aspects of NF2

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Summary

      In this manuscript the authors describe the use of a reverse Y2H-based, systematic mutational analysis method to study effects on conformation-dependent interactions of the NF2 tumor suppressor protein. Using this approach, they identified regions important for NF2 protein interaction and homomer formation and correlated some of these with cellular proliferation and matched patterns of known disease mutations. Overall, this work provides useful insight into NF2 tumor suppressor function (by identifying amino acids critical for NF2 conformational regulation) while demonstrating the power of their mutational scanning approach.

      Major Comments

      1. Why does Figure 1b not include interaction results for the NF2-Iso1N fragment as bait? Did the authors test this?
      2. The authors state that the majority of retested interactions behaved like WT (i.e., could not be confirmed; page 7 last paragraph) and claim this may be due to a difference in sensitivity between the deep scanning screen and pair wise spot testing. This seems like a very vague justification for the differences between the two assays; also, it's not immediately clear to me that the high-throughput scanning assay would necessarily be more sensitive than the lower-throughput pairwise comparison assay. The authors should provide a bit more discussion on this and address the possibility of false positives in their deep mutational scanning assay.

      Minor Comments

      1. Page 4, Line 3 from the bottom - should ready 'three isoform-specific protein interaction partners' not 'partner'.
      2. In Figure 1b, the interaction of NF2-Iso7-ex17 with PIK3R3 in the absence of ABL3 suggests that the observed kinase-dependence interaction of the NF2-Iso7 form may actually not be solely due to PIK3R3 homodimerization driven by phosphorylation. The authors should make note of this possibility in the text.
      3. On page 5 the authors mention that Iso1N and Iso7N, when used as preys, did not interact with full-length NF2. I don't see this experiment in the figures, however.
      4. On Page 6 (first paragraph) the authors state that the PIK3R3 interaction was 'promoted through pY-dependent PIK3R3 homodimerization'. While this is a likely and reasonable conclusion, they haven't explicitly shown this, so they should be careful about making such a strong statement. I'd recommend saying 'likely promoted' or something similar instead.
      5. In Figure S2, the Iso7 / EMILIN1 interaction does not appear to be giving the expected result in the rY2H (i.e., there is strong growth under both Y2H and r2H conditions). The authors should comment on/acknowledge this.
      6. For the deep mutagenesis screen, why wasn't an ABL2 condition used for NF2-Iso1C (see Fig. S2b)?
      7. For KDM1A and EMILIN1 the authors ran mutagenesis screens with both active and kinase dead ABL2, yet results were pooled. Were any differences observed in the effects of mutations on interaction between the two kinase conditions?
      8. Why aren't the yeast plates shown for most of the unconfirmed interactions? These could still be included in the Supplementary Material.
      9. On page 7, under Assessing Single Site Mutations, the authors refer to the Q147E mutation and reference Figure 3. However, Figure 3 shows only a Q147A mutation. Q147A is also referred to elsewhere. Which is the correct mutation?
      10. Figure S3b shows the 20 mutations presented in Figure 3. The DMS row indicates that some of these did not produce perturbations in the DMS experiments. Perhaps I'm misunderstanding here, but weren't the 20 mutations shown (and 60 total mutations) selected based on activity in the DMS assay? Or did some of the ones selected correspond to mutations which not produce an effect? Please clarify in the text.
      11. Why was the S265 mutation not considered in the structural analysis (other than being shown in Figure 4a, it isn't discussed). Also, Q147 (in the F2 region) is discussed and shown in Figure 4b, but not shown in the larger overall structure in Figure 4a.
      12. The cell proliferation results are very difficult to meaningfully interpret. While it is clear that certain mutations do affect proliferation, consistency between different types of experiments and cell lines appears to be low.
      13. Perhaps a bit more discussion of the possible consequences of using yeast to study human NF2 interactions and how these might affect results would be useful (i.e., due to differences in membrane composition, cellular environment, post-translational modifications etc. between yeast and mammalian cells).
      14. Page 13, line 10 says 'your hypothesis'. Believe should read 'the hypothesis'.
      15. Page 13, line 15 refers to '15' NF2 variants showing altered PPI patterns; however, 16 were described in the manuscript.

      Significance

      This work provides insight into how NF2 conformational changes relate to tumor suppressor function, which is particularly valuable since this area is still not well understood and published results have sometimes appeared contradictory. In addition to the insights into NF2 biology provided, the manuscript also demonstrates the value of the deep scanning mutagenesis approach. Overall, the presented research is very solid and, assuming the comments presented above (most of which are minor) are addressed I have no trouble recommending it for publication.

      I believe that the NF2 biology section will be of interest to a more specialized audience, while the general demonstration of the utility of the deep scanning mutagenesis will have broader appeal.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      The manuscript "Missense variant interaction scanning reveals a critical role of the FERM-F3 domain for tumor suppressor protein NF2 conformation and function" examines the effect of a reasonably exhaustive set of point mutations on the NF2 protein on protein-protein interactions and intra-protein interactions for two isoforms of NF2 (1 and 7), finding an interesting pattern of mutations in the region not associated with bindings nevertheless impact binding, and that this binding is sometimes dependent on the presence of kinase ABL2. Authors justify this by arguing conformation shifts in the protein, potentially regulated by phosphorylation, and with distinct conformations between isoforms 1 and 7 creating different interaction patterns, must explain the differences in binding properties. The paper specifically examines mutations to phosphomimetic (i.e., charged, so as to mimic phosphorylation) amino acid residues, with relevance for the probable biological regulation of this binding. Authors note that previous work has found inconsistent protein binding properties for phosphomimetic or phosphor-inhibiting substitutions on S518, in different conditions, which would be explained by other regulation of these conformational changes, a reasonable argument. Structural modeling of the mutants and their potential effects on a "closed" NF2 structure are intriguing and well-appreciated to support the paper's conclusions, and the paper is overall well-reasoned and convincing, and it should be published.

      Concerns:

      The kinase ABL2 is used to perturb NF2 phosphorylation, and this is not adequately justified. Kinases such as PAK2 (PMID: 11782491, PMID: 11719502) and PKA (PMID: 14981079) target NF2. In the methods referred to (Grossmann et al), nine tyrosine kinases were used for their screen, and while ABL2 was used in this paper and generated numerous interactions, it is not clear that ABL2 is the appropriate kinase to use here. The exhaustive use of many kinases would obviously be impractical and unreasonable for this study, but the choice of this kinase should be clearly explained.

      Minor issues:

      1. In the intro, authors write "While the other ERM protein family members do not have activities directly linked to cancer, NF2 tumor suppressor activity was initially characterized in flies and mice". While "directly" makes the statement technically true, it could be argued that ERM protein involvement is as legitimate as the tumor suppression activity of NF2 (PMID: 11092524, PMID: 24421310), and therefore the suggested contrast is slightly misleading. This has no relevance to the broader paper or its findings.
      2. Figure 2b: Authors state mutational coverage is fairly even across the protein, however there appears to be a notable spike around a.a. 180? This does not match any of the site mutations later found to be particularly relevant for interactions, which cluster around 250 and 450, and is therefore not a significant issue.
      3. In the methods, cell concentration is at one point said to be 'concentrated to an OD600 of 40-80'. I have never seen cell concentration expressed this way. Authors no doubt grew cells to an OD between 1 and 2 and concentrated ~40-fold as is standard, and wish perhaps to avoid estimating concentrations as cell numbers, which would only be approximate and cell size-dependent? However, OD is only linear between 1 and 2 for cell concentrations. An OD above 4 simply cannot be observed, as all light would be blocked. Methodology here is sound, this is merely an unusual way of expressing things.
      4. Page 10: The authors point out that they cannot see any difference in the expression levels of the NF2 mutants. However there is no quantification of the immunofluorescence signal supporting this information. Maybe a western blot could suffice this argument.
      5. It is very difficult to see the localization of NF2 mutants with the immunofluorescence images as they are very small. May be try with a 63X objective or focusing on just one or two cells or adding insets with higher magnification would allow the reader to view the details of Nf2 localization.
      6. 5th line from the bottom on page 8: allowed to model -> allowed us to model
      7. Line 8 from the top on page 12: inY2H -> in Y2H
      8. Line 10 from the top on page 13: your hypothesis -> our hypothesis

      Significance

      Dear Editor,

      The manuscript "Missense variant interaction scanning reveals a critical role of the FERM-F3 domain for tumor suppressor protein NF2 conformation and function" examines the effect of a reasonably exhaustive set of point mutations on the NF2 protein on protein-protein interactions and intra-protein interactions for two isoforms of NF2 (1 and 7), finding an interesting pattern of mutations in the region not associated with bindings nevertheless impact binding, and that this binding is sometimes dependent on the presence of kinase ABL2. Authors justify this by arguing conformation shifts in the protein, potentially regulated by phosphorylation, and with distinct conformations between isoforms 1 and 7 creating different interaction patterns, must explain the differences in binding properties. The paper specifically examines mutations to phosphomimetic (i.e., charged, so as to mimic phosphorylation) amino acid residues, with relevance for the probable biological regulation of this binding. Authors note that previous work has found inconsistent protein binding properties for phosphomimetic or phosphor-inhibiting substitutions on S518, in different conditions, which would be explained by other regulation of these conformational changes, a reasonable argument. Structural modeling of the mutants and their potential effects on a "closed" NF2 structure are intriguing and well-appreciated to support the paper's conclusions, and the paper is overall well-reasoned and convincing, and it should be published.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Response to reviewers' comments

      We thank the reviewers for their constructive evaluation of our manuscript. In the following point-by-point response, we explain how we will implement the suggested modifications.

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      Summary:

      The formation of meiotic double-stranded DNA breaks is the starting point of meiotic recombination. DNA breaks are made by the topoisomerase-like SPO11, which interacts with a number of regulatory factors including REC114, MEI4 and IHO1. Despite the key role this process has in the continuation, and genetic variation, or eukaryotic life, there is very little known about how this process is regulated. Laroussi et al make use of biochemical, biophysical and structural biological approaches to extensively characterise the REC114-MEI4-IHO1 complex.

      This is an outstanding biochemical paper. The experiments are well planned and beautifully executed. The protein purifications used are very clean, and the figures well presented. Importantly Laroussi et. al describe, and carefully characterise through point mutational analysis, the direct physical interaction between IHO1 and REC114-MEI4. This is an interaction that has, at least in yeast, previously been suggested to be driven by liquid-liquid separation. The careful and convincing work presented here represents an important paradigm-shift for the field.

      I am fully supportive of publication of this excellent and important study.

      We thank the reviewer for his/her positive comments, appreciation of the importance of our study and suggested modifications.

      Major comments:

      Point 1:

      My only major concern is regarding Figure 4, and specifically the AF2 model of the coiled-coil tetramer of IHO1. Given the ease with which MSAs of coiled-coils can become "contaminated" with non-orthologous sequences, I would urge some caution with this model. This is especially since the yeast ortholog of IHO1, Mer2, has been previously reported to be an anti-parallel tetramer (albeit, not very well supported by the data). The authors have several choices here. 1) They could simply reduce the visibility of the IHO1 tetramer model, and indicate caution in the parallel tetramer model. 2) They could consider using a structure prediction algorithm that doesn't use an MSA (e.g. ESMFold). 3) They could try to obtain experimental evidence for a parallel coiled-coil tetramer, e.g. through EM, SAXS or FRET approaches. I would like to make it crystal clear, however, that I would be *very* supportive of approach 1) or 2). An experimental approach is *not* necessary.

      Assuming the authors don't take a wet-lab approach, this shouldn't take more than a couple of weeks.

      This is a very good suggestion. We are aware of the previously reported anti-parallel architecture of the yeast IHO1 ortholog Mer2 (Claeys Bouuaert et al., Nature 2021). It should be noted, that in the recent preprint, posted by the Claeys Bouuaert lab (BioRxiv, https://doi.org/10.1101/2022.12.16.520760), a high confidence model of yeast Mer2 (and for human) parallel tetrameric coliled-coil is presented, apparently consistent with their previous XL-MS results (Claeys Bouuaert et al., Nature 2021).

      To clarify this issue we will follow the suggestions of Reviewer 1 and 2.

      1. As suggested also by Reviewer 2, we will produce a tethered dimer of IHO1125-260, connected by a short linker and determine its MW by SEC-MALLS (and SAXS).
      2. In the meantime we followed the suggestion of Reviewer 1 and modelled the IHO1130-281 by the ESMfold, which is another recent powerful AI-based program that does not use multiple sequence alignments. Remarkably, the predicted structure is very similar to the one predicted by AlphaFold, also predicting the parallel arrangement of IHO1. This model will be included as a supplementary figure.
      3. We will also point out in the text that these models, despite being very convincing, remain models.

        Minor comments:

      Point 2:

      The observation that REC114 and MEI4 can also form a 4:2 complex is very interesting and potentially important. Did the authors also try to model this higher order complex in AF2?

      Yes, we did this with the hope that we could identify residues whose mutation could limit the fast exchange between the 2:1 and 4:2 states. Unfortunately, no convincing additional contacts are modelled by AlphaFold. This PAE plot will be included as a supplementary figure.

      Point 3:

      Similarly to above, what does the prediction of the full-length REC114:MEI4 2:1 complex look like? Presumably the predicted interaction regions align well with experimental data, but it would be interesting to see (and easy to run).

      The AlphaFold modelling of the FL REC114:MEI4 (2:1) complex will be included as supplementary figure. It is consistent with the model comprising only the interacting regions. No additional convincing contacts are predicted.

      Point 4:

      Did the authors carry out SEC-MALS experiments on any IHO1 fragment lacking the coiled-coil domain? It was previously reported for Mer2 that the C-terminal region can form dimers, for example (OPTIONAL).

      We can easily do that. We have the N- and C- terminal regions lacking the coiled-coil expressed as MBP fusions and they will be analysed by SEC-MALLS.

      Point 5:

      Given that full-length REC114 is used for the IHO1 interaction studies, do the authors have any data as to the stoichiometry of the REC114FL-MEI41-127 complex? (OPTIONAL)

      We have repeatedly analysed the REC114-MEI4-IHO1 complex sample by SEC-MALLS and native mass spectrometry, but in both cases the sample is too complex to be interpreted. This is like due to the fast exchange between REC114-MEI4 2:1 and 4:2 complexes and low binding affinity of IHO1 for REC114.

      Point 6:

      Did the authors try AF2 modelling of the REC114-IHO1 interaction using orthologs from other species?

      Yes, but not extensively. We will repeat this modelling again.

      **Referees cross commenting**

      I will add cross-comments to the comments of Reviewer #2

      Firstly, the comments made by Reviewer #2 are technically correct. Firstly, reviewer #2 points out that the oligomerization states that the authors report could, in part, be artifactual the based on the his-tag purification method. This is indeed correct. However, given that none of the oligomerization states reported are per se unusual, given what is already known (including pre-prints from the Keeney and Claeys Bouuaert laboratories), I think the authors could forego this step.

      Secondly, the use of an experimental structural method, such as SAXS, would certainly add value to the paper. Also Reviewer #2 is correct in pointing out the availability of the ESRF beamlines to the authors. However, while SAXS is a useful method, I personally consider the use of mutants to validate the interactions, an even stronger piece of evidence that the AlphaFold2 interactions are correct. I must disagree somewhat with Reviewer #2 with their argument that SAXS would validate the fold. Certainly if one of the AF2 predicted structures is radically wrong, then SAXS would produce scattering data, and a subsequent distance distribution plot that is incompatible with the AF2 model. However, a partly correct AF2 model, of roughly the right shape, might still fit into a SAXS envelope.

      Reviewer #2 shares my concern on the parallel coiled-coil of IHO1, and their suggested solution is very elegant.

      In my view, due to the time constraints imposed by the partially competing work from the Keeney and Claeys Bouuaert laboratories (recently on biorxiv). I would support the authors if they chose the quickest route to publication.

      Reviewer #1 (Significance (Required)):

      General assessment: The strengths of the paper are as follows:

      1) Quality of experiments - The proteins used have been properly purified (SEC) and properly handled. The experiments are carefully carried out and controlled.

      2) Detail - The authors carry out the considerable effort of characterising protein interactions. through separation-of-function mutants. This adds to the quality of the paper, and renders the AF2 models as convincing as experimentally determined structures

      3) Conceptual advances - The most important conceptual advance is the direct binding of the N-term of IHO1 to REC114. That this is the same region as used by both TOPOVIBL and ANKRD31 points to a complex regulation.

      4) Integrity - the authors have taken great care not to "oversell" the results. The data are presented, and analysed, without hyperbole.

      Limitations - The only limitation of the paper is the lack of in vivo experiments to test their findings. However given the time and effort required, and the pressing need to publish this exciting study, this is not a problem.

      Advance: The paper provides advances from a number of directions, both conceptual and mechanistic. Mechanistically the description of the REC114-MEI14 complex is important, and in particular the observation that it can also form a higher order 4:2 structure. Likewise, while IHO1 was inferred to be a tetramer (based on work on Mer2) this was never proven formally. Most importantly, is the physical linkage between IHO1 and REC114, and that this is an interaction that is incompatible with TOPOVIBL and ANKRD31.

      Audience:

      Given the central role of meiotic recombination in eukaryotic life, any studies that shed additional light on the regulation of meiosis are suitable for a broad audience. However, this subject paper will be more specifically of interest to the meiosis community. The elegant methodology will also be of interest to structural biologists and protein biochemists.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      This manuscript addresses the structure of the REC114-MEI4-IHO1 complex, which controls the essential process of programmed DSB induction by SPO11/TOPOVIBL in meiosis.

      The manuscript carefully combines biochemistry, biophysics and modelling in an integrative manner to report the architecture of the full REC114-MEI4-IHO1 complex that is not itself amenable to direct structure elucidation such as by X-ray crystallography. These are important results that will be of interest to the recombination and meiosis fields. The data are generally convincing and interpretations appear correct, so the manuscript is certainly suitable for publication. I have included some suggestions below that I believe would strengthen the manuscript and enhance our confidence in the findings. Whilst the manuscript is publishable in its current format, I believe the suggestions given below would make it into a much stronger paper.

      We thank the reviewer for his/her positive comments on our study and the suggestions below.

      I have two general suggestions:

      Point 1:

      Analyses have been performed on fusion proteins (His, His-MBP etc). we have previously observed that bulky tags such as MBP can interfere with oligomeric state through steric hindrance, and that His-tags can mediated formation of larger oligomers, seemingly through coordination of metals leached from IMAC purification. This latter point has also been observed by others

      https://www.sciencedirect.com/science/article/pii/S1047847722000946.

      Where possible, I would repeat SEC-MALS experiments using untagged proteins, or at least following incubation with EDTA to mitigate the potential for His-mediated oligomerization.

      We agree with this reviewer’s comment that expression tags can have unexpected impact of the protein behaviour.

      1. For REC114-MEI4 complex the stoichiometry is assessed by several techniques. Figure 1f,g shows analytical ultracentrifugation, which was performed on the minimal REC114226-254-MEI41-43 complex that contains no fusion tag showing that this stoichiometry is independent of fusion tags. We will nevertheless repeat the SEC-MALLS on REC114-MEI41-127 after removing the His-tag of MEI4 as suggested.
      2. For the REC114 dimer, we cannot remove the His-MBP tag since this short fragment of REC114226-254 is no stable without MBP. The dimerization of Rec114 was already reported in (Claeys Bouuaert et al., Nature 2021). The dimerization is sensitive to specific point mutations within REC114. We will however, repeat the SEC-MALLS experiment following incubation with EDTA to mitigate the potential for His-mediated oligomerization.
      3. The presented SEC-MALLS on IHO1 fragments (Figure 4b) was done on proteins without fusion tags. Reviewer 1 and 2 also agreed that additional repeats of the experiments without fusion tags are not necessary.

      The authors have relied upon mutagenesis to validate Alphafold2 models. Their results are convincing but only confirm that contacts involved in structures rather than the specific fold per se. Their finding would be greatly strengthen by collecting SEC-SAXS data and fitting models directly to the scattering data. This is extremely sensitive, so a close fit provides the best possible evidence of accuracy of the model. SAXS is affected by unstructured regions and tags, so would have to be performed using structural cores of untagged proteins rather than full-length constructs. Given the local availability of world-class SAXS beamlines at the ESRF, which is next door to the leading author's institute, it seems that the collection of SAXS data would be practical for them.

      The usage of SAXS is discussed in the specific points below. We will attempt to do SEC-SAXS on the REC114-MEI4 complex. Due to instability of REC114226-254 without MBP, SAXS cannot be done. We will also do SAXS on the IHO1 tetramer.

      My specific comments are below:

      Point 2:

      Figure 1d

      The SEC-MALS shows multiple species, with 2:1 and 4:2 representing a minority of total species present. What are the larger oligomers? Could these be an artefactual consequence of the His-tags (as described above)?

      This SEC-MALLS will be repeated without the His-tag on MEI4.

      Point 3:

      Figure 1f,g

      The AUC changes over concentration and pH are intriguing - have they tried MALS in these conditions? This would be much more informative as it would reveal the range of species present. Low concentrations could be analysed by peak position even if scattering is insufficient to provide interpretable MW fits. I would advise doing this without his tag or adding EDTA (as described above).

      We will perform this experiment as suggested.

      Point 4:

      Figure 2

      I would like to see the models validated by SAXS using minimum core untagged constructs. This could be sued to test the validity of the 2:1 model directly, and to model the 4:2 complex by multiphase analysis and/or docking together of 2:1 complexes.

      The hydrophobic LALALAII region of MEI4 is interesting and the mutagenesis data do agree with the model. However, it is important to point out that any decent model would place this hydrophobic helix in the core of the complex, and so would be disrupted by mutagenesis. Hence, the mutagenesis results confirm that the hydrophobic helix is critical for the interaction, but does not confirm that the specific alphafold model is more valid than any other model in which the helix is similarly in a core position.

      We will attempt to perform the SEC-SAXS measurements. The challenge here will be obtaining a sample that is monodisperse in solution being required for SAXS. We showed the fast exchange between the 2:1 and 4:2 oligomeric state. The AUC data indicates that the sample has a predominantly 2:1 stoichiometry at 0.2 mg/ml, pH 4.5 and 500mM NaCl. Given the small size of the complex, the signal at 0.2 mg/ml is likely to be noisy.

      Point 5:

      Figure 3

      This would also benefit from SAXS validation of the structural core. The mutagenesis here provides convincing evidence in favour of the structure as specific hydrophobics ether disrupt or have no effect, exactly as predicted. Hence, their data strongly support the dimer model. As this provides the framework for the 2:1 complex, these data make me far more confident of the previous 2:1 model in figure 2. I am wondering whether it would be better to present these data first such that the reader can see the 2:1 model being built upon these strong foundations?

      We agree with this suggestion and will present the REC114 dimerization data before the REC114-MEI4 complex. However, REC114226-254 is not stable without the MBP tag so is not suitable for SAXS analysis.

      Point 6:

      Figure 4

      The MALS data convincingly show formation of a tetramer. How do we know that it is parallel? The truncation supports this but coiled-coils do sometimes form alternative structures when truncated (e.g. anti-parallel can become parallel when sequence is removed), and alphafold seems to have a tendency of predicting parallel coiled-coils even when the true structure of anti-parallel (informal observation by us and others). A simple test would be to make a tethered dimer of 110-240, with a short flexible linker between two copies of the same sequence - if parallel it should form a tetramer of double the length, if anti-parallel it should form a dimer of the same length - determinable by MALS (and SAXS).

      To address this point we will perform this experiment as suggested by Reviewer 2. We will produce a tethered dimer of IHO1 110-240, connected by a short linker and determine its MW by MALS (and possibly SAXS). We also performed ESMfold modelling (Reviewer 1, Point 1), resulting in the same model. As the IHO1 tetramer is likely suitable for SAXS analysis, we will also perform SAXS on it.

      Point 7:

      Figures 5/6

      The interaction is clear albeit low affinity (but within the biologically interesting range). It would be nice to obtain MALS (using superose 6) data showing the stoichiometry of the complex - are the data too noisy to be interpretable owing to dissociation? The alpahfold model and mutagenesis data strongly support the conclusion that the IHO1 N-term binds to the PH domain, as presented.

      We have repeatedly analysed the REC114-MEI4-IHO1 complex sample by SEC-MALLS (on Superose 6) and native mass spectrometry, but in both cases the sample is too complex to be interpreted. This is likely due to the fast exchange between REC114-MEI4 2:1 and 4:2 complexes and low binding affinity of IHO1 for REC114.

      **Referees cross commenting**

      Just to clarify a couple of points regarding consultation comments from reviewer 1:

      The suggestion regarding tags was mostly directed to the cases in which MALS data are noisy, with multiple oligomeric species (such as figure 1d). In these cases, i wondered whether the large MW species may be artefactual and could be resolved by removal of the tags. In cases where oligomers agree with those reported by other labs, I agree that there's no need to explore these further.

      In terms of SAXS, I agree that fitting models into envelopes will not distinguish between similar folds. However, fitting models directly to raw scattering data is extremely sensitive and I have never seen good fits with low chi2 values for incorrect models (even when very similar in overall shape to the correct structure).

      Reviewer #2 (Significance (Required)):

      The manuscript carefully combines biochemistry, biophysics and modelling in an integrative manner to report the architecture of the full REC114-MEI4-IHO1 complex that is not itself amenable to direct structure elucidation such as by X-ray crystallography. These are important results that will be of interest to the recombination and meiosis fields. The data are generally convincing and interpretations appear correct, so the manuscript is certainly suitable for publication. I have included some suggestions below that I believe would strengthen the manuscript and enhance our confidence in the findings. Whilst the manuscript is publishable in its current format, I believe the suggestions given below would make it into a much stronger paper.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      Laroussi et al used Alphafold models to predict the assembly of REC114-MEI4-IHO1 complex, and verified the structure using different biochemical experiments. Both Alphafold predictions and experiment data are convincing for the overall protein complex assembly. Importantly, they identified a motif on IHO1 that share the same binding site on REC114 with TOPOVIBL and ANKRD31, suggesting that REC114 acts as a regulatory base coordinating different binding partners during meiosis progression. Overall, I believe this is a nice biochemistry paper, but lacks insights into the biology (I believe those in vivo data is beyond the scope of this paper), at least more discussions are needed in terms of these findings.

      We thank the reviewer for the supportive comments on our manuscript and its evaluation. We agree with the reviewer, that including in vivo data, that might provide further biological insights, would be useful. However, there is currently no good cellular model for meiotic recombination in mouse and thus our structure-based mutations will need to be tested in transgenic mice. Such data will take a long time to obtain and would delay the publication these in-vitro results that already provide novel insight into the REC114-MEI4-IHO1 complex architecture. We will, nevertheless, as suggested, strengthen the discussion of the biological implications of our findings.

      Some minor points:

      Point 1:

      Any data showing MEI4 forms a dimer on its own?

      As mentioned in the manuscript, full-length MEI4 is difficult to produce in bacteria or insect cells. Thus, we worked with the N-terminal fragment which in absence of REC114 is nor very stable. We will perform SEC-MALLS to assess its oligomeric state. Alphafold suggests dimeric arrangement of MEI4, but only with low confidence.

      Point 2:

      In Fig2 and Sup Fig4, HisMBP-MEI4, you see more MBP than the fusion protein, especially more obvious in the mutants. What's your explanation?

      The N-terminus of MEI4 is well produced when co-expressed with REC114. For the pull-down experiments in Figure 2 we expressed it as His-MBP fusion in absence of REC114. In this situation, there is a degradation between MBP and MEI4. We find this very often for proteins that not very stable, which is the case of MEI4 without REC114. This is the best way we could produce at least some MEI4 in absence of REC114. The MBP protein could probably be removed by other chromatography techniques, but we think that for the purpose of the pull-down its presence is not interfering with the REC114-MEI4 binding.

      Point 3:

      TOPOVIBL and ANKRD31, I am curious if you have looked at the conserved residues on these motifs.

      We show a strong conservation of the IHO1 among vertebrates (Fig. 6c). We will further analyse the sequence conservation in more distant species.

      Point 4:

      Reference needed when stating that IHO1 was not interacting with REC114 in previous biochemical assay in the discussion part.

      This will be corrected

      Point 5:

      Also, have you run AlphaFold that gives multiple models? Sometimes, with short motifs, 1 or 2 models of several models give good confidence for the interaction.

      Using in-house Alphafold installation producing 25 models did not reveal better models.

      Reviewer #3 (Significance (Required)):

      While most of the interactions between REC114 and MEI4 or IHO1 were established with Y2H or other biochemical assays before. This paper used the AlphaFold, and finally verified the findings with biochemical experiments, which helps to establish the exact motifs/residues involved in the interaction. For example, the MEI4-REC114 interfaces are novel, more interestingly, the IHO1 shares the same interface with ANKRD31 and TOPOVIBL. Thus, this finding of REC114-MEI4-IHO1 complex assembly would be interesting to people with different working areas. I would like to see more studies on the coordination IHO1 with ANKRD31 or TOPOVIBL in the future.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      Laroussi et al used Alphafold models to predict the assembly of REC114-MEI4-IHO1 complex, and verified the structure using different biochemical experiments. Both Alphafold predictions and experiment data are convincing for the overall protein complex assembly. Importantly, they identified a motif on IHO1 that share the same binding site on REC114 with TOPOVIBL and ANKRD31, suggesting that REC114 acts as a regulatory base coordinating different binding partners during meiosis progression. Overall, I believe this is a nice biochemistry paper, but lacks insights into the biology (I believe those in vivo data is beyond the scope of this paper), at least more discussions are needed in terms of these findings.

      Some minor points:

      Any data showing MEI4 forms a dimer on its own? In Fig2 and Sup Fig4, HisMBP-MEI4, you see more MBP than the fusion protein, especially more obvious in the mutants. What's your explanation? Nice finding on the IHO1 N terminus, which shares the same binding sites on REC114 with TOPOVIBL and ANKRD31, I am curious if you have looked at the conserved residues on these motifs. Reference needed when stating that IHO1 was not interacting with REC114 in previous biochemical assay in the discussion part. Also, have you run AlphaFold that gives multiple models? Sometimes, with short motifs, 1 or 2 models of several models give good confidence for the interaction.

      Significance

      While most of the interactions between REC114 and MEI4 or IHO1 were established with Y2H or other biochemical assays before. This paper used the AlphaFold, and finally verified the findings with biochemical experiments, which helps to establish the exact motifs/residues involved in the interaction. For example, the MEI4-REC114 interfaces are novel, more interestingly, the IHO1 shares the same interface with ANKRD31 and TOPOVIBL. Thus, this finding of REC114-MEI4-IHO1 complex assembly would be interesting to people with different working areas. I would like to see more studies on the coordination IHO1 with ANKRD31 or TOPOVIBL in the future.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      This manuscript addresses the structure of the REC114-MEI4-IHO1 complex, which controls the essential process of programmed DSB induction by SPO11/TOPOVIBL in meiosis.

      The manuscript carefully combines biochemistry, biophysics and modelling in an integrative manner to report the architecture of the full REC114-MEI4-IHO1 complex that is not itself amenable to direct structure elucidation such as by X-ray crystallography. These are important results that will be of interest to the recombination and meiosis fields. The data are generally convincing and interpretations appear correct, so the manuscript is certainly suitable for publication. I have included some suggestions below that I believe would strengthen the manuscript and enhance our confidence in the findings. Whilst the manuscript is publishable in its current format, I believe the suggestions given below would make it into a much stronger paper.

      I have two general suggestions:

      1. Analyses have been performed on fusion proteins (His, His-MBP etc). we have previously observed that bulky tags such as MBP can interfere with oligomeric state through steric hindrance, and that His-tags can mediated formation of larger oligomers, seemingly through coordination of metals leached from IMAC purification. This latter point has also been observed by others https://www.sciencedirect.com/science/article/pii/S1047847722000946. Where possible, I would repeat SEC-MALS experiments using untagged proteins, or at least following incubation with EDTA to mitigate the potential for His-mediated oligomerisation.
      2. The authors have relied upon mutagenesis to validate Alphafold2 models. Their results are convincing but only confirm that contacts involved in structures rather than the specific fold per se. Their finding would be greatly strengthen by collecting SEC-SAXS data and fitting models directly to the scattering data. This is extremely sensitive, so a close fit provides the best possible evidence of accuracy of the model. SAXS is affected by unstructured regions and tags, so would have to be performed using structural cores of untagged proteins rather than full-length constructs. Given the local availability of world-class SAXS beamlines at the ESRF, which is next door to the leading author's institute, it seems that the collection of SAXS data would be practical for them.

      My specific comments are below:

      Figure 1d The SEC-MALS shows multiple species, with 2:1 and 4:2 representing a minority of total species present. What are the larger oligomers? Could these be an artefactual consequence of the His-tags (as described above)?

      Figure 1f,g The AUC changes over concentration and pH are intriguing - have they tried MALS in these conditions? This would be much more informative as it would reveal the range of species present. Low concentrations could be analysed by peak position even if scattering is insufficient to provide interpretable MW fits. I would advise doing this without his tag or adding EDTA (as described above).

      Figure 2 I would like to see the models validated by SAXS using minimum core untagged constructs. This could be sued to test the validity of the 2:1 model directly, and to model the 4:2 complex by multiphase analysis and/or docking together of 2:1 complexes. The hydrophobic LALALAII region of MEI4 is interesting and the mutagenesis data do agree with the model. However, it is important to point out that any decent model would place this hydrophobic helix in the core of the complex, and so would be disrupted by mutagenesis. Hence, the mutagenesis results confirm that the hydrophobic helix is critical for the interaction, but does not confirm that the specific alphafold model is more valid than any other model in which the helix is similarly in a core position.

      Figure 3 This would also benefit from SAXS validation of the structural core. The mutagenesis here provides convincing evidence in favour of the structure as specific hydrophobics ether disrupt or have no effect, exactly as predicted. Hence, their data strongly support the dimer model. As this provides the framework for the 2:1 complex, these data make me far more confident of the previous 2:1 model in figure 2. I am wondering whether it would be better to present these data first such that the reader can see the 2:1 model being built upon these strong foundations?

      Figure 4 The MALS data convincingly show formation of a tetramer. How do we know that it is parallel? The truncation supports this but coiled-coils do sometimes form alternative structures when truncated (e.g. anti-parallel can become parallel when sequence is removed), and alphafold seems to have a tendency of predicting parallel coiled-coils even when the true structure of anti-parallel (informal observation by us and others). A simple test would be to make a tethered dimer of 110-240, with a short flexible linker between two copies of the same sequence - if parallel it should form a tetramer of double the length, if anti-parallel it should form a dimer of the same length - determinable by MALS (and SAXS).

      Figures 5/6 The interaction is clear albeit low affinity (but within the biologically interesting range). It would be nice to obtain MALS (using superose 6) data showing the stoichiometry of the complex - are the data too noisy to be interpretable owing to dissociation? The alpahfold model and mutagenesis data strongly support the conclusion that the IHO1 N-term binds to the PH domain, as presented.

      Referees cross commenting

      Just to clarify a couple of points regarding consultation comments from reviewer 1:

      The suggestion regarding tags was mostly directed to the cases in which MALS data are noisy, with multiple oligomeric species (such as figure 1d). In these cases, i wondered whether the large MW species may be artefactual and could be resolved by removal of the tags. In cases where oligomers agree with those reported by other labs, I agree that there's no need to explore these further.

      In terms of SAXS, I agree that fitting models into envelopes will not distinguish between similar folds. However, fitting models directly to raw scattering data is extremely sensitive and I have never seen good fits with low chi2 values for incorrect models (even when very similar in overall shape to the correct structure).

      Significance

      The manuscript carefully combines biochemistry, biophysics and modelling in an integrative manner to report the architecture of the full REC114-MEI4-IHO1 complex that is not itself amenable to direct structure elucidation such as by X-ray crystallography. These are important results that will be of interest to the recombination and meiosis fields. The data are generally convincing and interpretations appear correct, so the manuscript is certainly suitable for publication. I have included some suggestions below that I believe would strengthen the manuscript and enhance our confidence in the findings. Whilst the manuscript is publishable in its current format, I believe the suggestions given below would make it into a much stronger paper.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary:

      The formation of meiotic double-stranded DNA breaks is the starting point of meiotic recombination. DNA breaks are made by the topoisomerase-like SPO11, which interacts with a number of regulatory factors including REC114, MEI4 and IHO1. Despite the key role this process has in the continuation, and genetic variation, or eukaryotic life, there is very little known about how this process is regulated. Laroussi et al make use of biochemical, biophysical and structural biological approaches to extensively characterise the REC114-MEI4-IHO1 complex.

      This is an outstanding biochemical paper. The experiments are well planned and beautifully executed. The protein purifications used are very clean, and the figures well presented. Importantly Laroussi et. al describe, and carefully characterise through point mutational analysis, the direct physical interaction between IHO1 and REC114-MEI4. This is an interaction that has, at least in yeast, previously been suggested to be driven by liquid-liquid separation. The careful and convincing work presented here represents an important paradigm-shift for the field.

      I am fully supportive of publication of this excellent and important study.

      Major comments:

      My only major concern is regarding Figure 4, and specifically the AF2 model of the coiled-coil tetramer of IHO1. Given the ease with which MSAs of coiled-coils can become "contaminated" with non-orthologous sequences, I would urge some caution with this model. This is especially since the yeast ortholog of IHO1, Mer2, has been previously reported to be an anti-parallel tetramer (albeit, not very well supported by the data). The authors have several choices here. 1) They could simply reduce the visibility of the IHO1 tetramer model, and indicate caution in the parallel tetramer model. 2) They could consider using a structure prediction algorithm that doesn't use an MSA (e.g. ESMFold). 3) They could try to obtain experimental evidence for a parallel coiled-coil tetramer, e.g. through EM, SAXS or FRET approaches. I would like to make it crystal clear, however, that I would be very supportive of approach 1) or 2). An experimental approach is not necessary.

      Assuming the authors don't take a wet-lab approach, this shouldn't take more than a couple of weeks.

      Minor comments:

      1. The observation that REC114 and MEI4 can also form a 4:2 complex is very interesting and potentially important. Did the authors also try to model this higher order complex in AF2?
      2. Similarly to above, what does the prediction of the full-length REC114:MEI4 2:1 complex look like? Presumably the predicted interaction regions align well with experimental data, but it would be interesting to see (and easy to run).
      3. Did the authors carry out SEC-MALS experiments on any IHO1 fragment lacking the coiled-coil domain? It was previously reported for Mer2 that the C-terminal region can form dimers, for example (OPTIONAL).
      4. Given that full-length REC114 is used for the IHO1 interaction studies, do the authors have any data as to the stoichiometry of the REC114FL-MEI41-127 complex? (OPTIONAL)
      5. Did the authors try AF2 modelling of the REC114-IHO1 interaction using orthologs from other species?

      Referees cross commenting

      I will add cross-comments to the comments of Reviewer #2

      Firstly, the comments made by Reviewer #2 are technically correct. Firstly, reviewer #2 points out that the oligomerization states that the authors report could, in part, be artifactual the based on the his-tag purification method. This is indeed correct. However, given that none of the oligomerization states reported are per se unusual, given what is already known (including pre-prints from the Keeney and Claeys Bouuaert laboratories), I think the authors could forego this step.

      Secondly, the use of an experimental structural method, such as SAXS, would certainly add value to the paper. Also Reviewer #2 is correct in pointing out the availability of the ESRF beamlines to the authors. However, while SAXS is a useful method, I personally consider the use of mutants to validate the interactions, an even stronger piece of evidence that the AlphaFold2 interactions are correct. I must disagree somewhat with Reviewer #2 with their argument that SAXS would validate the fold. Certainly if one of the AF2 predicted structures is radically wrong, then SAXS would produce scattering data, and a subsequent distance distribution plot that is incompatible with the AF2 model. However, a partly correct AF2 model, of roughly the right shape, might still fit into a SAXS envelope.

      Reviewer #2 shares my concern on the parallel coiled-coil of IHO1, and their suggested solution is very elegant.

      In my view, due to the time constraints imposed by the partially competing work from the the Keeney and Claeys Bouuaert laboratories (recently on biorxiv). I would support the authors if they chose the quickest route to publication.

      Significance

      General assessment: The strengths of the paper are as follows:

      1. Quality of experiments - The proteins used have been properly purified (SEC) and properly handled. The experiments are carefully carried out and controlled.
      2. Detail - The authors carry out the considerable effort of characterising protein interactions. through separation-of-function mutants. This adds to the quality of the paper, and renders the AF2 models as convincing as experimentally determined structures
      3. Conceptual advances - The most important conceptual advance is the direct binding of the N-term of IHO1 to REC114. That this is the same region as used by both TOPOVIBL and ANKRD31 points to a complex regulation.
      4. Integrity - the authors have taken great care not to "oversell" the results. The data are presented, and analysed, without hyperbole.

      Limitations - The only limitation of the paper is the lack of in vivo experiments to test their findings. However given the time and effort required, and the pressing need to publish this exciting study, this is not a problem.

      Advance: The paper provides advances from a number of directions, both conceptual and mechanistic. Mechanistically the description of the REC114-MEI14 complex is important, and in particular the observation that it can also form a higher order 4:2 structure. Likewise, while IHO1 was inferred to be a tetramer (based on work on Mer2) this was never proven formally. Most importantly, is the physical linkage between IHO1 and REC114, and that this is an interaction that is incompatible with TOPOVIBL and ANKRD31.

      Audience: Given the central role of meiotic recombination in eukaryotic life, any studies that shed additional light on the regulation of meiosis are suitable for a broad audience. However, this subject paper will be more specifically of interest to the meiosis community. The elegant methodology will also be of interest to structural biologists and protein biochemists.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons

      Reply to the reviewers

      We sincerely thank the reviewers for their comprehensive and constructive feedback. Below, we submit our revision plan addressing the points raised by the reviewers.

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      The study analyzes the role of SLIT2 in clearance of S. aureus via neutrophils. It suggests that N-SLIT2 play a key role as an amplifier of the ROS response and release of antimicrobial peptides. The manuscript is well written and technologically sound. However, a few issues need to be addressed that preclude publication of the manuscript:

      We thank the reviewer for the positive feedback.

      Major comments:

      1. The study analyzes different parameters of neutrophil function. One major effect of neutrophil activation is NETosis. This has not been addressed in the study albeit it is deemed to act in concert with the other immune mechanisms described.

      We thank the reviewer for the suggestion. S. aureus is known to promote NET formation as well as to enhance NET degradation to increase bacterial survival in vivo (Meyers, Crescente et al., 2022, Thammavongsa, Missiakas et al., 2013). Several cellular kinases (Erk, Akt, p38) have been implicated in ROS-induced NETosis, but the exact role of p38 signaling in NETosis remains less clear (Douda, Khan et al., 2015). As recommended by the reviewers, we will now investigate whether N-SLIT2 regulates S. aureus-induced NETosis in neutrophils using Sytox Green, a membrane-impermeable nucleic acid label, as previously described (Douda et al., 2015).

      Furthermore, the authors discuss a role of SLIT2 in the regulation of neutrophil migration. However, the current data set does not provide sufficient evidence for this. The reviewer suggests that the authors provide migration/chemotaxis assays and/or in vivo data to prove their hypothesis or revise their argumentation.

      Several groups, including ours, have previously demonstrated that SLIT2-ROBO1 signaling potently inhibits neutrophil chemotaxis in vitro and in vivo. The in vivo models, in which the negative effects of SLIT2 on neutrophil migration have been shown, include mouse models of peritonitis (Tole, Mukovozov et al., 2009), allergic airway inflammation (Ye, Geng et al., 2010), renal ischemia-reperfusion injury (Chaturvedi, Yuen et al., 2013), and cholangiocarcinoma (Zhou, Luo et al., 2022). Additionally, a recent study showed that shRNA-mediated knockdown of SLIT2 resulted in increased neutrophil infiltration into murine tumors further supporting negative regulatory effect of SLIT2 on neutrophil migration (Geraldo, Xu et al., 2021). In the revised version of the manuscript, we will now discuss these important points in the Introduction and Discussion sections.

      In our current study, in an effort to selectively examine the effects of SLIT2 on neutrophil function rather than on neutrophil migration, we intentionally administered N-ROBO1 to block endogenous SLIT2 signaling at 48 and 72 hours after inducing skin and soft tissue infection (SSTI) with S. aureus. In this model, the majority of neutrophil influx occurs early on, namely within 24 hours (Prabhakara, Foreman et al., 2013). We observed that blocking endogenous SLIT2 signaling in a murine model of SSTI resulted in enhanced localized infection and injury. We will now use immunohistochemical analysis to measure tissue infiltration of neutrophils (Ly6G+F4/80-) (Chadwick, Macdonald et al., 2021). In addition, as previously described we will also use IHC to evaluate within the tissue 8-hydroxydeoxyguanosine (8-OHdG), an indicator of oxidative damage (Sima, Aboodi et al., 2016). We will compare levels of 8-OHdG to the number of neutrophils in the tissue as a gross indicator of local ROS production by infiltrating neutrophils.

      The timeline of SLIT2 expression indicates that environmental conditions could influence the expression of SLIT2. Have the authors analyzed whether SLIT2 expression is affected by low pH or hypoxia? Is there any data indicating what factors regulate SLIT2 expression? In the same line, it would be interesting to know whether SLIT2 immune effects (specifically ROS and LL37 release) are similarly triggered under hypoxic conditions often found in an abscess.

      We thank the reviewer for raising this important point and for the suggestions. The regulation of SLIT2 levels in tissues is an active area of research. Hypoxia has been reported to increase SLIT2 expression in placental tissue (Liao, Laurent et al., 2012) but this has not been investigated in the context of bacterial infection. In different physiologic and pathophysiologic settings, vascular endothelial cells, including dermal microvascular endothelial cells (DMEC), have been shown to be an important source of SLIT2 (Romano, Manetti et al., 2018, Tavora, Mederer et al., 2020). We will therefore investigate the effects of hypoxia and low pH, conditions founds within bacterial abscesses, on production of SLIT2 by DMEC. DMEC will be infected with S. aureus and grown in normoxic and hypoxic (2% O2) conditions for up to 72 hours, the time-point at which maximal SLIT2 levels were detected in S. aureus-induced SSTI. We will collect cells and cultured supernatant for measurement of levels of Slit2 mRNA and SLIT2 protein at different time points ranging from 0 to 72 hours after infection. We will incubate neutrophils with the conditioned medium from hypoxic DMEC to measure the effect on LL-37 secretion. Finally, we will expose neutrophils to S. Aureus (+/- N-SLIT2) in a medium with pH ranging from 5.5 to 7.4 and then measure the LL-37 secretion as the reviewer suggested (Zhou & Fey, 2020).

      Lastly, it is unclear whether SLIT2 binds to a defined target on the neutrophil. This needs to be highlighted in the discussion in respect to future work and ideally resolved experimentally.

      We apologize for the confusion. We and others have previously demonstrated that human and murine neutrophils express ROBO1 but not ROBO2, and that ROBO1 is the primary Roundabout receptor which binds N-SLIT2 in immune cells (Rincon, Rocha-Gregg et al., 2018, Tole et al., 2009). We have now included this information in the Introduction section (please see page- 3). In our manuscript we showed experimentally that incubation of N-SLIT2 with the soluble N-terminal fragment of ROBO1 (N-ROBO1), which contains the N-SLIT2 binding Ig1 motif (Morlot, Thielens et al., 2007), blocked the effect of N-SLIT2 on ROS production, thereby confirming that the observed actions of SLIT2 occurred through ROBO1 (Fig. 1G). In the revised version of the manuscript, we will clarify this point.

      Reviewer #1 (Significance (Required)):

      The manuscript provides insight into a new mechanism regulating neutrophil function in the presence of S. aureus. The study provides evidence that the N-terminus of SLIT2 is involved in these effects and highlights p38-mediated signaling events as molecular targets increasing antibacterial effects in neutrophils. However, some contradictory findings imply that timing of the response is crucial.

      Nevertheless, with the molecular mechanisms not fully understood many questions remain and the study adds to the complexity of the anti-staphylococcal immune response. Therefore, the audience for this manuscript requires knowledge on S. aureus-specific host-pathogen interaction and is not suitable for a broad audience as it does not provide information on a generally new mechanism of neutrophil activation or defense.

      We thank the reviewer for pointing out the complexity of host-pathogen (neutrophils and S. aureus) interactions. SLIT2 is well-known for its anti-inflammatory properties via its effects on immune cell chemotaxis in vivo (Anand, Zhao et al., 2013, Chaturvedi et al., 2013, Geraldo et al., 2021). We demonstrated that SLIT2-ROBO1 signaling inhibits macropinocytosis in macrophages, and consequently, attenuates NOD2-induced inflammasome activation in mice (Bhosle, Mukherjee et al., 2020). Based on these earlier observations, SLIT2 would be anticipated to impair the innate immune response to infection. Unexpectedly, we found that SLIT2 does not impair, but instead enhances the ability of neutrophils to kill S. aureus. Indeed, through different mechanisms SLIT2 has been shown to have widespread anti-microbial properties against not only S. aureus but instead against diverse pathogens, including Mycobacterium tuberculosis, intestinal pathogens, H5N1 influenza, and most recently, COVID-19 (Gustafson, Ngai et al., 2022, London, Zhu et al., 2010). Together, these studies highlight the importance of spatiotemporal regulation of SLIT2 levels in tissues during bacterial and viral infection and the direct effects of SLIT2 on modulating host-pathogen interactions.

      Additionally, SLIT2-induced p38 MAPK activation is not limited to innate immune cells. Li et al. reported this week that SLIT2-ROBO1 signaling activates p38 in pancreatic ductal adenocarcinoma cells as well as metastatic tumors (Li, Zhang et al., 2023). In the revised manuscript, we will discuss all of the important points above.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      Summary: The manuscript deals with the role of the neurorepellent SLIT2 in killing of the bacterial pathogen Staphylococcus aureus. The authors show that neutrophils incubated with the N-terminal region of SLIT2 kill S. aureus more efficiently than neutrophils without pre-exposure to N-SLIT2. This effect was due to an increased production of reactive oxygen species by NADPH oxidase complex activation and stimulating exocytosis of antibacterial peptide containing granules. The concept was proven in an animal model of skin and soft tissue infection in mice in which neutralization of endogenous SLIT2 reduced CFU numbers in ear skin and decreased tissue destruction in response to S. aureus infection.

      Major comments:

      1. In general the findings and key conclusions are convincingly covered by the results presented in the manuscript. The methods are adequate to allow the conclusions drawn. Data are clearly presented and easy to follow. Statistical methods are appropriate.

      We thank the reviewer for the positive feedback. In the present study, we investigated the effects of SLIT2 on NADPH oxidase (NOX – p47phox) priming. Using novel methodology, neutrophil priming was recently shown to be associated with characteristic cytoskeletal changes (Bashant, Vassallo et al., 2019). We are now collaborating with Dr. Nicole Toepfner (Technische Universität Dresden, Dresden) to investigate SLIT2-induced cytoskeletal changes in neutrophils isolated from whole blood using Real-time deformability cytometry (RT-DC). We believe that these novel studies will further enhance the revised manuscript.

      Minor comments:

      1. In the Materials and Methods section line 340 a GFP-expressing S. aureus USA300 strain is indicated. What was the exact strain designation, e.g. LAC or JE2, as USA300 is not a strain name (different strains belong to this pulsed-field electrophoresis based classification).

      We thank the reviewer for this comment. The strain designation of the GFP-expressing S. aureus we used is USA300 LAC (Flannagan, Kuiack et al., 2018). In the revised version of the manuscript we will include the correct information (please see page- 10).

      In the legend of figure 3 the inhibitors are mentioned for part B and E but not C and D.

      We apologize for the error. Figure 3 legend has now been corrected in the revised manuscript.

      Figure S4 would be nice to have in the main manuscript.

      We thank the reviewer for the suggestion. In the revised manuscript we moved original Supplementary Fig. S4B to main Fig. 4B in the manuscript. The schematic from main Fig. 4B is moved to the new Supplementary Fig. 4B. The graphical summary (original Supplementary Fig. S4C) is now presented as new main Figure 5.

      Reviewer #2 (Significance (Required)):

      The manuscript deals with a novel mechanism of neutrophil activation by SLIT-2, a protein which was originally thought to act in the nervous system but is also expressed in many peripheral tissues. Importantly SLIT-2 may be involved in tumor suppression but also chemotaxis of immune cells. In this manuscript a novel, rather unexpected role of the N-terminal region of SLIT-2 in activation of antibacterial mechanisms of neutrophils was shown. This could be interesting for a broader readership interested in innate immune mechanisms and bacterial infections. Since little is known on the role of SLIT-2 in response to bacterial infections the paper could initiate a number of new studies in this field. This reviewer has experience with S. aureus virulence and resistance mechanisms and animal infection models.

      We thank the reviewer for the very positive feedback regarding the appeal of our manuscript to a broad readership. As noted in our response to Reviewer #1 Significance, recent studies suggest that SLIT2 could not only serve as a therapeutic to combat S. aureus, but could have broad anti-microbial activity against a number of pathogens including Mycobacterium tuberculosis, intestinal pathogens, H5N1 influenza, and COVID-19 (Borbora, Bhatt et al., 2022, Gustafson et al., 2022, London et al., 2010). We believe that the ability of SLIT2 to combat diverse bacterial and viral infections will even further enhance the appeal of our manuscript to a broad audience. In the revised manuscript we will expand the discussion to include these very important points.

      References:

      Anand AR, Zhao H, Nagaraja T, Robinson LA, Ganju RK (2013) N-terminal Slit2 inhibits HIV-1 replication by regulating the actin cytoskeleton. Retrovirology 10: 2

      Bashant KR, Vassallo A, Herold C, Berner R, Menschner L, Subburayalu J, Kaplan MJ, Summers C, Guck J, Chilvers ER, Toepfner N (2019) Real-time deformability cytometry reveals sequential contraction and expansion during neutrophil priming. J Leukoc Biol 105: 1143-1153

      Bhosle VK, Mukherjee T, Huang YW, Patel S, Pang BWF, Liu GY, Glogauer M, Wu JY, Philpott DJ, Grinstein S, Robinson LA (2020) SLIT2/ROBO1-signaling inhibits macropinocytosis by opposing cortical cytoskeletal remodeling. Nat Commun 11: 4112

      Borbora SM, Bhatt S, Balaji KN (2022) Mycobacterium tuberculosis infection elevates SLIT2 expression to modulate oxidative stress responses in macrophages. bioRxiv: 2022.10.13.512188

      Chadwick JW, Macdonald R, Ali AA, Glogauer M, Magalhaes MA (2021) TNFalpha Signaling Is Increased in Progressing Oral Potentially Malignant Disorders and Regulates Malignant Transformation in an Oral Carcinogenesis Model. Front Oncol 11: 741013

      Chaturvedi S, Yuen DA, Bajwa A, Huang YW, Sokollik C, Huang L, Lam GY, Tole S, Liu GY, Pan J, Chan L, Sokolskyy Y, Puthia M, Godaly G, John R, Wang C, Lee WL, Brumell JH, Okusa MD, Robinson LA (2013) Slit2 prevents neutrophil recruitment and renal ischemia-reperfusion injury. J Am Soc Nephrol 24: 1274-87

      Douda DN, Khan MA, Grasemann H, Palaniyar N (2015) SK3 channel and mitochondrial ROS mediate NADPH oxidase-independent NETosis induced by calcium influx. Proc Natl Acad Sci U S A 112: 2817-22

      Flannagan RS, Kuiack RC, McGavin MJ, Heinrichs DE (2018) Staphylococcus aureus Uses the GraXRS Regulatory System To Sense and Adapt to the Acidified Phagolysosome in Macrophages. mBio 9

      Geraldo LH, Xu Y, Jacob L, Pibouin-Fragner L, Rao R, Maissa N, Verreault M, Lemaire N, Knosp C, Lesaffre C, Daubon T, Dejaegher J, Solie L, Rudewicz J, Viel T, Tavitian B, De Vleeschouwer S, Sanson M, Bikfalvi A, Idbaih A et al. (2021) SLIT2/ROBO signaling in tumor-associated microglia and macrophages drives glioblastoma immunosuppression and vascular dysmorphia. J Clin Invest 131

      Gustafson D, Ngai M, Wu R, Hou H, Schoffel AC, Erice C, Mandla S, Billia F, Wilson MD, Radisic M, Fan E, Trahtemberg U, Baker A, McIntosh C, Fan CS, Dos Santos CC, Kain KC, Hanneman K, Thavendiranathan P, Fish JE et al. (2022) Cardiovascular signatures of COVID-19 predict mortality and identify barrier stabilizing therapies. EBioMedicine 78: 103982

      Li Q, Zhang XX, Hu LP, Ni B, Li DX, Wang X, Jiang SH, Li H, Yang MW, Jiang YS, Xu CJ, Zhang XL, Zhang YL, Huang PQ, Yang Q, Zhou Y, Gu JR, Xiao GG, Sun YW, Li J et al. (2023) Coadaptation fostered by the SLIT2-ROBO1 axis facilitates liver metastasis of pancreatic ductal adenocarcinoma. Nat Commun 14: 861

      Liao WX, Laurent LC, Agent S, Hodges J, Chen DB (2012) Human placental expression of SLIT/ROBO signaling cues: effects of preeclampsia and hypoxia. Biol Reprod 86: 111

      London NR, Zhu W, Bozza FA, Smith MC, Greif DM, Sorensen LK, Chen L, Kaminoh Y, Chan AC, Passi SF, Day CW, Barnard DL, Zimmerman GA, Krasnow MA, Li DY (2010) Targeting Robo4-dependent Slit signaling to survive the cytokine storm in sepsis and influenza. Sci Transl Med 2: 23ra19

      Meyers S, Crescente M, Verhamme P, Martinod K (2022) Staphylococcus aureus and Neutrophil Extracellular Traps: The Master Manipulator Meets Its Match in Immunothrombosis. Arterioscler Thromb Vasc Biol 42: 261-276

      Morlot C, Thielens NM, Ravelli RB, Hemrika W, Romijn RA, Gros P, Cusack S, McCarthy AA (2007) Structural insights into the Slit-Robo complex. Proc Natl Acad Sci U S A 104: 14923-8

      Prabhakara R, Foreman O, De Pascalis R, Lee GM, Plaut RD, Kim SY, Stibitz S, Elkins KL, Merkel TJ (2013) Epicutaneous model of community-acquired Staphylococcus aureus skin infections. Infect Immun 81: 1306-15

      Rincon E, Rocha-Gregg BL, Collins SR (2018) A map of gene expression in neutrophil-like cell lines. BMC Genomics 19: 573

      Romano E, Manetti M, Rosa I, Fioretto BS, Ibba-Manneschi L, Matucci-Cerinic M, Guiducci S (2018) Slit2/Robo4 axis may contribute to endothelial cell dysfunction and angiogenesis disturbance in systemic sclerosis. Ann Rheum Dis 77: 1665-1674

      Sima C, Aboodi GM, Lakschevitz FS, Sun C, Goldberg MB, Glogauer M (2016) Nuclear Factor Erythroid 2-Related Factor 2 Down-Regulation in Oral Neutrophils Is Associated with Periodontal Oxidative Damage and Severe Chronic Periodontitis. Am J Pathol 186: 1417-26

      Tavora B, Mederer T, Wessel KJ, Ruffing S, Sadjadi M, Missmahl M, Ostendorf BN, Liu X, Kim JY, Olsen O, Welm AL, Goodarzi H, Tavazoie SF (2020) Tumoural activation of TLR3-SLIT2 axis in endothelium drives metastasis. Nature 586: 299-304

      Thammavongsa V, Missiakas DM, Schneewind O (2013) Staphylococcus aureus degrades neutrophil extracellular traps to promote immune cell death. Science 342: 863-6

      Tole S, Mukovozov IM, Huang YW, Magalhaes MA, Yan M, Crow MR, Liu GY, Sun CX, Durocher Y, Glogauer M, Robinson LA (2009) The axonal repellent, Slit2, inhibits directional migration of circulating neutrophils. J Leukoc Biol 86: 1403-15

      Ye BQ, Geng ZH, Ma L, Geng JG (2010) Slit2 regulates attractive eosinophil and repulsive neutrophil chemotaxis through differential srGAP1 expression during lung inflammation. J Immunol 185: 6294-305

      Zhou C, Fey PD (2020) The acid response network of Staphylococcus aureus. Curr Opin Microbiol 55: 67-73

      Zhou SL, Luo CB, Song CL, Zhou ZJ, Xin HY, Hu ZQ, Sun RQ, Fan J, Zhou J (2022) Genomic evolution and the impact of SLIT2 mutation in relapsed intrahepatic cholangiocarcinoma. Hepatology 75: 831-846

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Summary:

      The manuscript deals with the role of the neurorepellent SLIT2 in killing of the bacterial pathogen Staphylococcus aureus. The authors show that neutrophils incubated with the N-terminal region of SLIT2 kill S. aureus more efficiently than neutrophils without preexposure to N-SLIT2. This effect was due to an increased production of reactive oxygen species by NADPH oxidase complex activation and stimulating exocytosis of antibacterial peptide containing granules. The concept was proven in an animal model of skin and soft tissue infection in mice in which neutralization of endogenous SLIT2 reduced CFU numbers in ear skin and decreased tissue destruction in response to S. aureus infection.

      Major comments:

      In general the findings and key conclusions are convincingly covered by the results presented in the manuscript. The methods are adequate to allow the conclusions drawn. Data are clearly presented and easy to follow. Statistical methods are appropriate.

      Minor comments:

      In the Materials and methods section line 340 a GFP-expressing S. aureus USA300 strain is indicated. What was the exact strain designation, e.g. LAC or JE2, as USA300 is not a strain name (different strains belong to this pulsed-field electrophoresis based classification). In the legend of figure 3 the inhibitors are mentioned for part B and E but not C and D. Figure S4 would be nice to have in the main manuscript.

      Significance

      The manuscript deals with a novel mechanism of neutrophil activation by SLIT-2, a protein which was originally thought to act in the nervous system but is also expressed in many peripheral tissues. Importantly SLIT-2 may be involved in tumor suppression but also chemotaxis of immune cells. In this manuscript a novel, rather unexpected role of the N-terminal region of SLIT-2 in activation of antibacterial mechanisms of neutrophils was shown. This could be interesting for a broader readership interested in innate immune mechanisms and bacterial infections. Since little is known on the role of SLIT-2 in response to bacterial infections the paper could initiate a number of new studies in this field.

      This reviewer has experience with S. aureus virulence and resistance mechanisms and animal infection models.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      The study analyzes the role of SLIT2 in clearance of S. aureus via neutrophils. I suggests that N-SLIT2 play a key role as an amplifier of the ROS response and release of antimicrobial peptides. The manuscript is well written and technologically sound. However, a few issues need to be addressed that preclude publication of the manuscript:

      Major comments

      The study analyzes different parameters of neutrophil function. One major effect of neutrophil activation is NETosis. This has not been addressed in the study albeit it is deemed to act in concert with the other immune mechanisms described.

      Furthermore, the authors discuss a role of SLIT2 in the regulation of neutrophil migration. However, the current data set does not provide sufficient evidence for this. The reviewer suggests that the auhtors provide migration/chemotaxis assays and/or in vivo data to prove their hypothesis or revise their argumentation. The timeline of SLIT2 expression indicates that environmental conditions could influence the expression of SLIT2. Have the authors analyzed whether SLIT2 expression is affected by low pH or hypoxia? Is there any data indicating what factors regulate SLIT2 expression?

      In the same line, it would be interesting to know whether SLIT2 immune effects (specifically ROS and LL37 release) are similarly triggered under hypoxic conditions often found in an abscess? Lastly, it is unclear whether SLIT2 binds to a defined target on the neutrophil. This needs to be highlighted in the discussion in respect to future work and ideally resolved experimentally.

      Significance

      The manuscript provides inisght into a new mechanism regulating neutrophil function in the presence of S. aureus. The study provides evidence that the N-terminus of SLIT2 is involved in these effects and highlights p38-mediated signaling events as molecular targets increasing antibacterial effects in neutrophils. However, some contradictory findings imply that timing of the response is crucial. Nevertheless, with the molecular mechanisms not fully understood many questions remain and the study adds to the complexity of the antistaphyloccocal immune response. Therefore, the audience forthis manuscript requires knowledge on S. aureus-specific host-pathogen interaction and is not suitable for a broad audience as it does not provide information on a generally new mechanism of neutrophil activation or defense.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      We thank the reviewer for their comments. We are encouraged that the reviewers found our research “important study that addresses the interplay between two major Rho-type small GTPases involved in cell division” and “of interest to those interested in the cell biology of mitotic exit”. We agree with the comments raised by the reviewers and have provided new data as per their recommendation. We have also made changes to the text and format of the paper. We feel that with these changes the manuscript is stronger and we thank the reviewers for their suggestions. Below we provide a detailed response to the reviewers’ comments.

      Reviewer #1

      *This manuscript focuses on the role of Cdc42 in Rho1 activation during fission yeast cytokinesis. The primary finding is that active Cdc42 and its downstream effector Pak1 prevents accumulation of active Rho1 and the synthesis of cell wall material, at early stages of cytokinesis and despite the local recruitment of the Rho1 GEF Rgf1. The data supporting these conclusions are reasonably sound. *

      *Additional experiments are presented to suggest that Cdc42 and Pak1 negatively regulate Rgf1, this conclusion is not as strongly supported (though it may be true) *

      *These study relies on a newly described probe for active Rho1. However this probe is not sufficiently well validated. *

      *Overall the manuscript was not assembled with sufficient care and rigor, these deficits could be readily corrected. *

      The major point of the paper is that Cdc42 and Pak1 negatively regulate Rho1 activation. However, during late cytokinesis, active Cdc42 and active Rho1 co-exist at the division site. Thus, Cdc42 activation induces a delay in Rho1 activation, but how this delay is overcome is not investigated or even discussed. Indeed, while the delay is shown the transience of this inhibition is not explicitly mentioned. At a minimum, the authors should highlight this point for the readers.

      We are encouraged by the fact that the reviewer found our data “reasonably sound”. We agree that this manuscript does not provide the molecular details of how Cdc42 inhibits Rho1 activation. Our genetic data suggests that this is likely mediated by multiple pathways possibly involving the regulation of the Rho regulators Rgf1, Rgf2 and Rga5. We are currently investigating the molecular details of this regulation and hope to report it in another manuscript.

      Our data shows that while Cdc42 inhibits Rho1, the SIN pathway is essential for Rho1 activation regardless of the presence of Cdc42. While Cdc42 is activated at the division site as the ring completes assembly, the SIN pathway is activated immediately prior to ring constriction similar to that of Rho1 activation. It is possible that once the SIN is activated at the division site, it overcomes Cdc42-mediated Rho1 inhibition. We have highlighted this in the discussion section of this manuscript and are currently investigating the molecular details of this regulation.

      *Specific points 1 - RBD probe This probe is central to this manuscript. However, there is insufficient validation of its target. Figure 1 shows the localization and its independence of Rho2. The authors should provide direct evidence that it recognizes Rho1 (for example using a repressible promotor or an anchor away approach).

      *

      We thank the reviewers for their comments on the RBD probe. We have now provided validation for the RBD-probe. We have used rho1 temperature-sensitive and switch-off mutants to show loss of RBD-probe localization in these mutants. This data is provided I the revised manuscript in Fig1 and Supplementary fig. S1.

      At various places in the manuscript the authors refer to this probe as "Rho-probe", RBD-probe, RBD, RBD-(mNG or tdTomato). On page 11 the authors state, "As per our observations, we refer to the Rho-probe signal at the division site as active Rho1 from here onwards." Yet, in the very next paragraph they refer to the localization of the "Rho probe". * This is also an issue with the figures. For example, in figures 4B,C ; 5B,C; 6B; 7B,C the figures are titled either "Rho1 activation at division site", "Rho1-probe at division site"; "Rho1-probe appearance at division site" ; "Rho1-probe in non-constricting rings". *

      We agree that these multiple terms to describe the probe is confusing. We have restricted the terms to either “RBD-mNG” or “RBD-tdTomato” when reporting the data and use “Rho-probe” for descriptive purposes.

      In fig 3, RBD-nNG is quantified in a graph entitled "localizaton [sic] of Rho1-GEFs at division site"

      We thank our reviewers for identifying this error in our labeling of the graph in Fig. 3E. This figure now reads “Localization of Rgf1, Rgf3, active Rho1 at the division site”

      In all figures but two, 5c and 7c, the authors quantify Rho1 activation by the presence or absence of the probe, rather than a quantitative measure or the extent of recruitment of the probe. This could be analyzed my quantitatively.

      We appreciate this comment and provide this response in order to clarify our reasoning for presenting this data. We quantified the intensities of RBD-mNG or RBD-tdTomato where ever relevant to the question we are addressing for each experiment performed.

      Where we look at Rho1 activation at the division site with respect to SPB distances, we are reporting the differences in the timing of Rho activation with respect to mitotic progression. However, in Figures 5c and 7c, and now also Fig 1 of the revised manuscript, we quantified the intensities of the probe as this indicated the changes in overall active Rho1 levels under our experimental conditions. We have added in the text for earlier experiments where we do not report intensity measurements for the active Rho probe that we do not observe any differences in the intensity levels.

      *2 - Regulation of Rgf1 by Cdc42 and Pak1. The results shown in figure 8 show that "early Rho1 activation in gef1 mutants is not Rgf3-dependent". Figure 9 establishes "loss of rgf1 prevents premature Rho1 activation in gef1Δ cells restoring it to normal in late anaphase (Fig.9A, B)." This finding indicates that Rgf1, but not Rgf3, is required for Rho1 premature activation. This finding doesn't rule out the possibility that Cdc42 and Pak1 might be required to turn off RhoGAPs to allow active Rho1 to accumulate. This analysis concludes with this unclear and ungrammatical sentence, "While we were unable to assess the Rho-probe in the rgf1Δ rgf2Δ double mutants due to its lethality [sic; is the Rho probe lethal?], our observations suggest that apart from Rgf1 early Rho1 activation in gef1Δ cells is either due to activation of Rgf2 or due to inhibition of Rga5." *

      We thank you for your insight and agree with these remarks. We could not investigate Rho1 activation in rgf1Δ rgf2Δ double mutants since the double mutants are inviable. We have re-worded the sentence to reflect our findings appropriately.

      *The conclusion that this regulation is due to control of Rgf1 should be toned down. E.g. from the abstract: "We provide functional and genetic evidence which indicates that Pak1 regulates Rho1 activation likely via the regulation of its GEF Rgf1." *

      We have now removed this statement from the abstract. We have also clarified in the discussion that the molecular details of how Cdc42 inhibits Rho1 is not known and needs to be investigated. While our data suggests that the regulator Rgf1 and Rga5 may be involved in the process the details are unclear and we are currently investigating this regulation.

      *SECTION B - Significance ======================== This manuscript ties together several recent papers from the author's lab on the control of Cdc42 activation during cytokinesis and older papers on the role of Rho1 in Bgs1 activation. It provides missing information into the temporal regulation of septum assembly.

      The authors make a point of the similarities of fission yeast cytokinesis to animal cell cytokinesis. Indeed the second sentence reads, "The fission yeast model system divides via an actomyosin-based contractile ring, which is assembled in the medial region of the cell, as in animal cells (Balasubramanian et al., 2004; Pollard, 2010).". However, the authors fail to point out the many differences between yeast and animal cell cytokinesis until the last paragraph of the discussion. If the authors want to include the similarities in the introduction, they should also include the differences. For example, ring assembly is independent of Rho1 activation in fission yeast, but dependent on RhoA activation in animal cells. *

      We thank the reviewer for pointing out this deficiency in our writing. We have now amended the introduction to highlight the differences between Rho1 activity in fission yeast and animal cells during cytokinesis. We have added the following text to the Introduction section.

      “The animal Rho1 homolog RhoA is required for ring formation and is essential for cytokinesis (Basant and Glotzer, 2018). While in yeast, Rho1 is essential for septum formation, the current literature suggests that it is dispensable for ring formation (Onishi et al., 2013; Yoshida, 2009). In fission yeast where both the actomyosin ring and the septum have important roles in the proper coordination of cytokinesis, Rho1 has no reported roles in ring formation but is essential for septation (Balasubramanian et al., 2004).”

      *This work will be of interest to biologists working on yeast cell division. To a lesser extent it will be of interest to biologists interested in cytokinesis and coordination of distinct GTPase pathways.

      Additional points*

      1 - The text is overly wordy and needs extensive revision. Many of the experiments could be explained more clearly and with somewhat less genetic jargon. The introduction has quite a bit of extraneous information and lacks relevant facts, such as the function of Bgs1, which is central to the results.

      We have now modified the text to remove unnecessary genetic jargon. We have also provided additional text to describe the role of Bgs1 in the Introduction.

      2 - page 4 "GEFs promote GTP binding, thus keeping the GTPase active while the GAPs increase GTP hydrolysis, thus promoting GTPase inactivation." GEFs promote GTP binding, but they do not keep the GTPase active (an inhibitor of a RhoGAP would do that), they activate the GTPases.

      We thank the reviewers for highlighting this error. We have corrected this sentence, which now reads “GEFs promote GTP exchange to activate the GTPase, while the GAPs increase GTP hydrolysis to promote GTPase inactivation.”

      *3 - The current literature on animal cell cytokinesis indicates little direct role in cytokinesis, rather than the author's statement, "In larger eukaryotes, the role of Cdc42 activation has been reported mostly in meiotic division events such as polar body extrusion in oocytes, but not much is known about its role in cytokinesis in somatic cell division (Drechsel et al., 1997; Na and Zernicka-Goetz, 2006)." See for example, PMID 10898977, 10871280 which indicate Cdc42 does not play a major role during cytokinesis in at least a few systems where it has been analyzed. *

      We thank our reviewer for this observation and agree that this statement can be expanded to further explain the role of Cdc42 in animal cytokinesis. The paragraph has been re-written as follows-

      Pg5 - “In animal cells, the direct role of Cdc42 in cytokinesis remains indefinite. In Xenopus embryos and mouse fibroblasts for example, constitutively active Cdc42 impairs cytokinesis completion (Drechsel et al., 1997). However, in other cases such as in mouse embryonic stem cells, Cdc42 was only critical for development but not cytokinesis (Chen et al., 2000). RNA interference in animal cells demonstrate that that while RhoA is required for cytokinesis, Cdc42 is not required for this process (Jantsch-Plunger et al., 2000). Cdc42 also promotes spindle positioning and polar body extrusion in mouse oocytes, but it is not known whether its localization at these spindles affects RhoA (Na and Zernicka-Goetz, 2006). Thus, the role of Cdc42 in the cytokinetic process may be cell-type specific, and these data highlight the importance for more investigation to elucidate Cdc42 regulation in dividing cells (Jordan and Canman, 2012).”

      Reviewer #2

      *In many fungal cells, including fission yeast, the deposition of a new cell wall (a septum) between daughter cells is essential for cytokinesis. Cell wall synthases are trafficked to and activated at the division site, and dysregulated trafficking and/or synthase activation can lead to cytokinetic defects. In this study, the authors use fluorescent probes for Cdc42 and Rho1 activity and live-cell imaging to investigate the timing and regulation of Rho1 activity in fission yeast, and specifically, the role of Cdc42 in regulating Rho1. Summary of the proposed model: Gef1 -> active Cdc42 -> Pak1 --| Rgf1 -> active Rho1 -> septum formation

      Major comments

      (1) As far as I can gather from the authors' description in the manuscript and quick literature search, this will be the first publication in S. pombe utilizing the HR1-C2 domain of Pkc2p as fluorescent probe for active Rho1 (RBD-mNG). While a comparable domain of S. cerevisiae Pkc1p (not "pck2" as referenced by the authors in Page 25) has been used for similar purposes, given the importance of this probe and the precedent it sets in the S. pombe literature, it is imperative that proper tests are performed to validate that its localization reflects activity of Rho1 and nothing else (such as membrane binding of the C2 domain or transcriptional regulation of the pkc2 promoter). Such tests should also be independent of the hypotheses central to the current study (i.e., effects of Gef1, Pak1, Rgf1/2 on the timing of RBD-mNG localization). Can the authors provide data to address this point? Examples include, but not limited to, rho1 mutants, expression of constitutively active Rho1, or temporary expression of dominant-negative Rho1.*

      We agree with the reviewer and now provide data to show loss of the localization of the Rho-probe RBD-mNG in rho1 mutants. Using temperature-sensitive and switch-off mutants we show that under mutant conditions the RBD-mNG localization is lost at the division site and also from the cell ends. This provides strong evidence that the probe detects active Rho1 in the cells.

      *(2) Related, M&M does not provide sufficient details about the amino-acid positions corresponding to the "RBD" domain of Pkc2, thus precluding readers from reproducing the experiments. This needs to be clarified. *

      We now provide in the materials and methods the details of how this probe was generated including the base pairs of the budding yeast PKC1 and the fission yeast pck2 promoter.

      (3) In Figure 1B, RBD1-mNG localizes clearly to the medial region of rho2∆ cells when the Rlc1-tdTomato ring has not formed. Does this mean that Rho2 has a major role in forming the contractile ring that is independent of Rho1 activation? On this other hand, however, data in Fig. S2BC suggest that RBD-mNG does not localize to the medial region in rho2∆ cells until Rlc1-tdTomato ring forms (the timing of which seems normal). This discrepancy needs to be addressed.

      In response to the issue raised here, we do not see active Rho1 at the division site of cells without rings. However, after cytokinesis, while cells are in septation, although the ring has disappeared, active Rho1 lingers at the division site. The cell shown in the panel is a septated cell after ring constriction completes. We have included DIC panels of these cells to show that active Rho1 lingers in septating cells.

      *(4) Given the nature of RBD-mNG localization, it seems unavoidable to have some level of arbitrariness in measuring the onset of its localization at the division site. It would be advisable for the authors to be specific in M&M about how they defined the onset of localization, i.e., whether it was based on universal threshold in signal intensity, ratio, etc. or on manual curation (ideally double-blind).

      *

      We have updated the methods to describe that “onset of localization” was performed via double-blind visual observations.

      Minor comments (1) Throughout the manuscript, there are quite a few places where inconsistencies in genetic nomenclature can cause confusion to readers. Below are some examples. Figs. 6B, 7B, 10B: pak1(-ts), shk1, and orb2-34 (including faint labels under category marks in 6B). Fig. 9B (gef1+ rgf1∆) vs 9C (rgf1∆). Wild-type alleles are implicit in some figures, while explicit in others.

      We have corrected these inconsistencies.

      *(2) The first hypothesis (Fig. 1C) is that the AMR might regulate Rho1 activation. The ring is disrupted with LatA, but Rho remains active. They cite this as evidence that the AMR does not activate Rho1, but were the cells treated before or after the rings formed? If before, then the experiment demonstrates what the authors claim, but if after, it only shows that the AMR is not essential to maintain Rho activity. *

      We agree with the reviewer that this is an important distinction. We have modified this statement to “These results indicate that while at the division site the actin cytoskeleton is not required for maintaining Rho1 activation, it is necessary at the growth sites of interphase cells.”

      *(3) Page 8: "Time-lapse imaging of cells simultaneously expressing CRIB-3xGFP and RBD-tdTomato [...] while Rho1 is activated ~20 minutes after SPB duplication (Fig. 2B)." This appears to refer to Fig. 2C. *

      We thank the reviewers for catching this error in the text. We have now corrected it, showing timelapse as Fig. 2C, and an Image of cells simultaneously expressing CRIB and RBD as Fig. 2B.

      *(4) Page 9: "[...] Rgf1 and Rgf3 localize as early as the time of ring assembly at an average SPB distance of 4-5 µm (Fig. 3D)." This sentence is confusing. How was the average calculated over the earliest ring assembly in non-time-lapse data? Fig. 3DE show distances between SPBs as short as 2.5 µm, not 4-5 µm, and average of ~8 µm for all cells at different stages of mitosis. This confusion needs to be clarified. *

      We thank the reviewer for observing this mistake in our writing and interpretation. We agree that the text does not reflect the accurate interpretations of the data collected and have now fixed these errors. The current sentence reading “In an asynchronous population of cells, we find that Rgf1 and Rgf3 localize as early as the time of ring assembly at an average SPB distance of 4-5µm.” has now been replaced with the description shown below-

      “Using the distance between SPBs of anaphase cells as a proxy for timing of cytokinesis, we find that in most anaphase cells, Rgf1-GFP and Rgf3-eGFP was localized at the division site at very early stages in anaphase (Fig. 3D, E). This can be observed by the short distance between the SPBs of ~2µm (Fig. 3D). We also measured the distance for which active Rho1 appeared at the division site, and find that at the distance between SPBs of ~10µm, active Rho1 was present at the division site in ~50% of the population of control cells (Fig. 3E).”

      *(5) Fig. 5. Both the intensity and onset of RBD-mNG localization were affected by cdc42g12v expression. These two may form a causative relationship: reduced overall RBD signal may cause failed detection of early RBD localization. Can the authors compare cells with similar mean RBD-mNG signal intensities (Fig. 5B) and confirm that the timing of appearance at the division site is still delayed in gef1+ cdc42g12v relative to gef1+ empty? *

      We thank the reviewers for pointing this out and appreciate the opportunity to further clarify our observations. While there is clear decrease in Rho-probe intensity at the division site of on cells expressing cdc42G12V, we did see some variation in the extent of the decrease likely due to the variation in the expression levels of cdc42g12V. To provide a more accurate analysis of our observation we have shown the changes in the timing and intensities of Rho-probe localization. However, due to the noisy nature of the data we cannot compare the intensities in individual cells at specific spindle pole body distance between cells. As observed cdc42G12V significantly reduces Rho1 activity globally, not just at the division site. To cherry-pick cdc42G12V cells with similar active rho1 intensity to assess time of Rho1 activation may lead to subconscious data manipulation and will not address how early Rho1 activation is regulated.

      *Reviewer #3

      Onwubiko et al., present a clear and well written manuscript detailing the mechanistic understanding of how Rho1 is activated in a timely manner to ensure cytokinesis occurs in a scheduled manner at the end of telophase. Using fission yeast as a model system, and with the development of a novel Rho1 biosensor, they implicate a series of GTPases, exchange factors, GTPase activating proteins and kinases acting downstream of Cdc42 in the timely activation of Rho1. Specifically, they find that Cdc42 prevents premature Rho1 activation in early anaphase in a manner requiring the kinase Pak1. They observe that the Rho1 activators Rgf1 and Rgf3 localise to the division site in early anaphase, but Rho1 doesn't get activated until late anaphase, suggesting that control mechanisms ensure that these GEFs are held inactive, or that RhoGAP activity is able to balance this activation in early anaphase. This suppression of Rho1 activity in early anaphase requires Cdc42 and Pak1 and implicate (by omission) Rgf1, rather than Rgf3, is the relevant GEF.

      I liked this manuscript, it was clearly written the experimental progression was logical and the data were easy to interpret from the figures. The conclusions were precise, believable and not overstated. The manuscript provides novel observations and through good use of a series of rescues/mutants, illuminates a pathway that is held in check by Cdc42 to ensure timely Rho1 activation. The novel Rho1 probe is exciting and shows well differently regulated pools of active Rho1 at the division site and the growing tips. I thought the co-imaging/measurement of ring placement and SBP duplication allowed a really clear understanding of the kinetics during this rapid phase of the cell cycle. A critique of the study is that the the mechanism by which Cdc42 controls Pak1, and by which Pak1 controls Rgf1/Rgf2 is left unclear. I guess there could always be a molecular expansion of these points (e.g., how does Cdc42 control Pak1; how does Pak1 control Rgf1; how is Rgf activity restricted when localised), but I think that would only enhance, rather than change, the level of detail of the paper's message. I think the paper's current conclusions stand on their own, the data is clear and believable, the experiments are well performed. There are a number of observations in the paper that are left open for future studies, and I think this is a positive (e.g., any separable role of Rgf1/Rgf2 and how Rga5 integrates into this pathway. As such, I am tempted to recommend accept with only minor amendments as outlined below.

      1. P8 P15: should the call out be to Fig 2C, rather than 2B. *

      We thank reviewer for their highlighting this error in our text. We have now fixed it.

      *P14 L17: should it be 'gef1+ rgf3-', not 'gef1+, rgf3+' *

      We have fixed this error and further clarified the terms for easy understanding.

      Structure wise, I thought the section on Rga5 didn't really fit well on P16; it seemed sandwiched between two sections on GEFs. Is there a more appropriate place to place these data - perhaps between the paragraph breaks on P17? Related to this data, the conclusion on P16 suggests 'other' regulators of RhoGAP activity act to repress Rho1 function. Would 'additional' regulators of RhoGAP activity be more appropriate as there is some function contributed by Rga5?

      We have now moved this section to the end of the section on Rho1 regulators after we discuss the Rho1 GEFs. We have also modified the text to clarify that multiple regulators are likely involved in the regulation of Cdc42-mediated Rho1 inhibition.

      *In Fig 10b, you haven't defined orb2-34. Is it the rgf1-delete?

      *

      The mutant orb2-34 is a temperature sensitive allele of the pak1 kinase. To avoid confusion, we have replaced the allele name with pak1-ts in figure 10 and in the text.

      • I find the sentence at the top of P18: 'Rho1 activation in pak1+ rgf1+....at 25oC and 35.5oc occurred at longer and similar SBP distances' quite hard to interpret. Could you perhaps expand it to make your message clearer? *

      We thank the reviewer for pointing this out. These statements have now been re-written for clarity. 'Rho1 activation in pak1+ rgf1+....at 25ºC and 35.5ºC” has been changed, and now reads as follows:

      “The timing of RBD-mNG localization at the division site occurs late in cytokinesis during late anaphase as depicted by longer SPB distances in pak1+ rgf1+, pak1-ts rgf1+, and pak1+ rgf1Δ cells at 25ºC (Fig.10B). As previously shown, RBD-mNG localizes to the division site in early anaphase in pak1-ts rgf1+ cells at the restrictive temperature (35.5ºC, Fig. 7A, B). In agreement with our reasoning, early RBD-mNG localization in pak1-ts mutants at 35.5ºC was rescued in the absence of rgf1 (Fig. 10A, B).”

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      Onwubiko et al., present a clear and well written manuscript detailing the mechanistic understanding of how Rho1 is activated in a timely manner to ensure cytokinesis occurs in a scheduled manner at the end of telophase. Using fission yeast as a model system, and with the development of a novel Rho1 biosensor, they implicate a series of GTPases, exchange factors, GTPase activating proteins and kinases acting downstream of Cdc42 in the timely activation of Rho1. Specifically, they find that Cdc42 prevents premature Rho1 activation in early anaphase in a manner requiring the kinase Pak1. They observe that the Rho1 activators Rgf1 and Rgf3 localise to the division site in early anaphase, but Rho1 doesn't get activated until late anaphase, suggesting that control mechanisms ensure that these GEFs are held inactive, or that RhoGAP activity is able to balance this activation in early anaphase. This suppression of Rho1 activity in early anaphase requires Cdc42 and Pak1 and implicate (by omission) Rgf1, rather than Rgf3, is the relevant GEF.

      I liked this manuscript, it was clearly written the experimental progression was logical and the data were easy to interpret from the figures. The conclusions were precise, believable and not overstated. The manuscript provides novel observations and through good use of a series of rescues/mutants, illuminates a pathway that is held in check by Cdc42 to ensure timely Rho1 activation. The novel Rho1 probe is exciting and shows well differently regulated pools of active Rho1 at the division site and the growing tips. I thought the co-imaging/measurement of ring placement and SBP duplication allowed a really clear understanding of the kinetics during this rapid phase of the cell cycle. A critique of the study is that the the mechanism by which Cdc42 controls Pak1, and by which Pak1 controls Rgf1/Rgf2 is left unclear. I guess there could always be a molecular expansion of these points (e.g., how does Cdc42 control Pak1; how does Pak1 control Rgf1; how is Rgf activity restricted when localised), but I think that would only enhance, rather than change, the level of detail of the paper's message. I think the paper's current conclusions stand on their own, the data is clear and believable, the experiments are well performed. There are a number of observations in the paper that are left open for future studies, and I think this is a positive (e.g., any separable role of Rgf1/Rgf2 and how Rga5 integrates into this pathway. As such, I am tempted to recommend accept with only minor amendments as outlined below.

      1. P8 P15: should the call out be to Fig 2C, rather than 2B.
      2. P14 L17: should it be 'gef1+ rgf3-', not 'gef1+, rgf3+'
      3. Structure wise, I thought the section on Rga5 didn't really fit well on P16; it seemed sandwiched between two sections on GEFs. Is there a more appropriate place to place these data - perhaps between the paragraph breaks on P17? Related to this data, the conclusion on P16 suggests 'other' regulators of RhoGAP activity act to repress Rho1 function. Would 'additional' regulators of RhoGAP activity be more appropriate as there is some function contributed by Rga5?
      4. In Fig 10b, you haven't defined orb2-34. Is it the rgf1-delete?
      5. I find the sentence at the top of P18: 'Rho1 activation in pak1+ rgf1+....at 25oC and 35.5oc occurred at longer and similar SBP distances' quite hard to interpret. Could you perhaps expand it to make your message clearer?

      Significance

      I think the advance here is a genetic understanding of control mechanisms that order the exit from mitosis. The interplay between numerous GTPases and kinases must ensure a timely and ordered progression through M-exit, but it is often unclear how these activities are coordinated. A strength of the yeast system is that dependencies can be clearly visualised and the authors do a good job here to order the enzymatic activities needed to activate Rho1 in a timely manner for cytokinesis at the end of telophase.

      I think this manuscript will be of interest to those interested in the cell biology of mitotic exit, the interplay between kinases and GTPases and those interested in the systems/netwoek biology of these processes. The description of a new Rho1 biosensor is an excellent tool for the community.

      I am a cell biologist (mammalian) with interests in M-exit programmes that ensure a timely and ordered reestablishment of interphase architecture.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      In many fungal cells, including fission yeast, the deposition of a new cell wall (a septum) between daughter cells is essential for cytokinesis. Cell wall synthases are trafficked to and activated at the division site, and dysregulated trafficking and/or synthase activation can lead to cytokinetic defects. In this study, the authors use fluorescent probes for Cdc42 and Rho1 activity and live-cell imaging to investigate the timing and regulation of Rho1 activity in fission yeast, and specifically, the role of Cdc42 in regulating Rho1. Summary of the proposed model: Gef1 -> active Cdc42 -> Pak1 --| Rgf1 -> active Rho1 -> septum formation

      Major comments

      1. As far as I can gather from the authors' description in the manuscript and quick literature search, this will be the first publication in S. pombe utilizing the HR1-C2 domain of Pkc2p as fluorescent probe for active Rho1 (RBD-mNG). While a comparable domain of S. cerevisiae Pkc1p (not "pck2" as referenced by the authors in Page 25) has been used for similar purposes, given the importance of this probe and the precedent it sets in the S. pombe literature, it is imperative that proper tests are performed to validate that its localization reflects activity of Rho1 and nothing else (such as membrane binding of the C2 domain or transcriptional regulation of the pkc2 promoter). Such tests should also be independent of the hypotheses central to the current study (i.e., effects of Gef1, Pak1, Rgf1/2 on the timing of RBD-mNG localization). Can the authors provide data to address this point? Examples include, but not limited to, rho1 mutants, expression of constitutively active Rho1, or temporary expression of dominant-negative Rho1.
      2. Related, M&M does not provide sufficient details about the amino-acid positions corresponding to the "RBD" domain of Pkc2, thus precluding readers from reproducing the experiments. This needs to be clarified.
      3. In Figure 1B, RBD1-mNG localizes clearly to the medial region of rho2∆ cells when the Rlc1-tdTomato ring has not formed. Does this mean that Rho2 has a major role in forming the contractile ring that is independent of Rho1 activation? On this other hand, however, data in Fig. S2BC suggest that RBD-mNG does not localize to the medial region in rho2∆ cells until Rlc1-tdTomato ring forms (the timing of which seems normal). This discrepancy needs to be addressed.
      4. Given the nature of RBD-mNG localization, it seems unavoidable to have some level of arbitrariness in measuring the onset of its localization at the division site. It would be advisable for the authors to be specific in M&M about how they defined the onset of localization, i.e., whether it was based on universal threshold in signal intensity, ratio, etc. or on manual curation (ideally double-blind).

      Minor comments

      1. Throughout the manuscript, there are quite a few places where inconsistencies in genetic nomenclature can cause confusion to readers. Below are some examples. Figs. 6B, 7B, 10B: pak1(-ts), shk1, and orb2-34 (including faint labels under category marks in 6B). Fig. 9B (gef1+ rgf1∆) vs 9C (rgf1∆). Wild-type alleles are implicit in some figures, while explicit in others.
      2. The first hypothesis (Fig. 1C) is that the AMR might regulate Rho1 activation. The ring is disrupted with LatA, but Rho remains active. They cite this as evidence that the AMR does not activate Rho1, but were the cells treated before or after the rings formed? If before, then the experiment demonstrates what the authors claim, but if after, it only shows that the AMR is not essential to maintain Rho activity.
      3. Page 8: "Time-lapse imaging of cells simultaneously expressing CRIB-3xGFP and RBD-tdTomato [...] while Rho1 is activated ~20 minutes after SPB duplication (Fig. 2B)." This appears to refer to Fig. 2C.
      4. Page 9: "[...] Rgf1 and Rgf3 localize as early as the time of ring assembly at an average SPB distance of 4-5 µm (Fig. 3D)." This sentence is confusing. How was the average calculated over the earliest ring assembly in non-time-lapse data? Fig. 3DE show distances between SPBs as short as 2.5 µm, not 4-5 µm, and average of ~8 µm for all cells at different stages of mitosis. This confusion needs to be clarified.
      5. Fig. 5. Both the intensity and onset of RBD-mNG localization were affected by cdc42g12v expression. These two may form a causative relationship: reduced overall RBD signal may cause failed detection of early RBD localization. Can the authors compare cells with similar mean RBD-mNG signal intensities (Fig. 5B) and confirm that the timing of appearance at the division site is still delayed in gef1+ cdc42g12v relative to gef1+ empty?

      Referees cross-commenting

      I find all reviewer comments fair and have nothing specific to add.

      Significance

      The mechanisms governing septum formation during cytokinesis represent a key regulatory step in cytokinesis. Prior work showed that the Rho GTPases Cdc42 and Rho1 together control the timing of septum formation in S. pombe, and in S. cerevisiae, similar antagonistic regulation between Cdc42 and Rho1 has been reported previously (Atkins et al., J. Cell Biol. 2013 202: 231-240; Onishi et al., J Cell Biol. 2013 202: 311-329), but the precise molecular mechanisms remained unclear.

      This is an important study that addresses the interplay between two major Rho-type small GTPases involved in cell division of many eukaryotic cells, and highlights their roles outside of the regulation of contractile ring. However, there are some issues that need to be addressed prior to publication, as listed above.

      Keywords for the reviewer's field of expertise: S. pombe, S. cerevisiae, cytokinesis, Rho1, Cdc42, septum, MEN/SIN, genetics, cell biology, biochemistry.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      This manuscript focuses on the role of Cdc42 in Rho1 activation during fission yeast cytokinesis. The primary finding is that active Cdc42 and its downstream effector Pak1 prevents accumulation of active Rho1 and the synthesis of cell wall material, at early stages of cytokinesis and despite the local recruitment of the Rho1 GEF Rgf1. The data supporting these conclusions are reasonably sound.

      Additional experiments are presented to suggest that Cdc42 and Pak1 negatively regulate Rgf1, this conclusion is not as strongly supported (though it may be true)

      These study relies on a newly described probe for active Rho1. However this probe is not sufficiently well validated.

      Overall the manuscript was not assembled with sufficient care and rigor, these deficits could be readily corrected.

      The major point of the paper is that Cdc42 and Pak1 negatively regulate Rho1 activation. However, during late cytokinesis, active Cdc42 and active Rho1 co-exist at the division site. Thus, Cdc42 activation induces a delay in Rho1 activation, but how this delay is overcome is not investigated or even discussed. Indeed, while the delay is shown the transience of this inhibition is not explicitly mentioned. At a minimum, the authors should highlight this point for the readers.

      Specific points

        • RBD probe This probe is central to this manuscript. However, there is insufficient validation of its target. Figure 1 shows the localization and its independence of Rho2. The authors should provide direct evidence that it recognizes Rho1 (for example using a repressible promotor or an anchor away approach).

      At various places in the manuscript the authors refer to this probe as "Rho-probe", RBD-probe, RBD, RBD-(mNG or tdTomato). On page 11 the authors state, "As per our observations, we refer to the Rho-probe signal at the division site as active Rho1 from here onwards." Yet, in the very next paragraph they refer to the localization of the "Rho probe". This is also an issue with the figures. For example, in figures 4B,C ; 5B,C; 6B; 7B,C the figures are titled either "Rho1 activation at division site", "Rho1-probe at division site"; "Rho1-probe appearance at division site" ; "Rho1-probe in non-constricting rings". In fig 3, RBD-nNG is quantified in a graph entitled "localizaton [sic] of Rho1-GEFs at division site"

      In all figures but two, 5c and 7c, the authors quantify Rho1 activation by the presence or absence of the probe, rather than a quantitative measure or the extent of recruitment of the probe. This could be analyzed my quantitatively. 2. - Regulation of Rgf1 by Cdc42 and Pak1. The results shown in figure 8 show that "early Rho1 activation in gef1 mutants is not Rgf3-dependent". Figure 9 establishes "loss of rgf1 prevents premature Rho1 activation in gef1Δ cells restoring it to normal in late anaphase (Fig.9A, B)." This finding indicates that Rgf1, but not Rgf3, is required for Rho1 premature activation. This finding doesn't rule out the possibility that Cdc42 and Pak1 might be required to turn off RhoGAPs to allow active Rho1 to accumulate. This analysis concludes with this unclear and ungrammatical sentence, "While we were unable to assess the Rho-probe in the rgf1Δ rgf2Δ double mutants due to its lethality [sic; is the Rho probe lethal?], our observations suggest that apart from Rgf1 early Rho1 activation in gef1Δ cells is either due to activation of Rgf2 or due to inhibition of Rga5." The conclusion that this regulation is due to control of Rgf1 should be toned down. E.g. from the abstract: "We provide functional and genetic evidence which indicates that Pak1 regulates Rho1 activation likely via the regulation of its GEF Rgf1."

      Referees cross-commenting

      I think reviews are appropriate and speak for themselves.

      Significance

      This manuscript ties together several recent papers from the author's lab on the control of Cdc42 activation during cytokinesis and older papers on the role of Rho1 in Bgs1 activation. It provides missing information into the temporal regulation of septum assembly.

      The authors make a point of the similarities of fission yeast cytokinesis to animal cell cytokinesis. Indeed the second sentence reads, "The fission yeast model system divides via an actomyosin-based contractile ring, which is assembled in the medial region of the cell, as in animal cells (Balasubramanian et al., 2004; Pollard, 2010).". However, the authors fail to point out the many differences between yeast and animal cell cytokinesis until the last paragraph of the discussion. If the authors want to include the similarities in the introduction, they should also include the differences. For example, ring assembly is independent of Rho1 activation in fission yeast, but dependent on RhoA activation in animal cells.

      This work will be of interest to biologists working on yeast cell division. To a lesser extent it will be of interest to biologists interested in cytokinesis and coordination of distinct GTPase pathways.

      Additional points

        • The text is overly wordy and needs extensive revision. Many of the experiments could be explained more clearly and with somewhat less genetic jargon. The introduction has quite a bit of extraneous information and lacks relevant facts, such as the function of Bgs1, which is central to the results.
        • page 4 "GEFs promote GTP binding, thus keeping the GTPase active while the GAPs increase GTP hydrolysis, thus promoting GTPase inactivation." GEFs promote GTP binding, but they do not keep the GTPase active (an inhibitor of a RhoGAP would do that), they activate the GTPases.
        • The current literature on animal cell cytokinesis indicates little direct role in cytokinesis, rather than the author's statement, "In larger eukaryotes, the role of Cdc42 activation has been reported mostly in meiotic division events such as polar body extrusion in oocytes, but not much is known about its role in cytokinesis in somatic cell division (Drechsel et al., 1997; Na and Zernicka-Goetz, 2006)." See for example, PMID 10898977, 10871280 which indicate Cdc42 does not play a major role during cytokinesis in at least a few systems where it has been analyzed.
    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      We thank the reviewers for their enthusiastic support for our work and their insightful comments and suggestions which we believe strengthen the manuscript. Below we detail how we propose to respond to each of the specific points raised by each reviewer.

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      • Summary:*

      • In the article entitled "Unique functions of two overlapping PAX6 retinal enhancers", Uttley and coworkers characterize in detail the activity of two conserved human enhancers (i.e. NRE and HS5) previously reported to drive Pax6 expression to the neural retina. By integrating these enhancers in a PhiC31 landing site using a dual enhancer-reporter cassette, they generated a zebrafish stable line in which their activity can be followed by the expression of GFP (NRE) and mCherry (HS5). The authors show that although the enhancers have a partially overlapping activity at early stages (24hpf), later on (48 and 72hpf) they activity domains segregate: to stem cells and differentiated amacrine cells for NRE, and to proliferating progenitors and differentiated Müller glia cells for HS5. To this end they used two different approaches: a scRNA-seq analysis of sorted cells from the transgenic line and a immunofluorescent analysis employing cell specific markers. The authors conclude that their analysis allowed the identification of unique cell type-specific functions.*

      • Major comments:*

      • In general terms, the article is technically sound (please, see section B for an assessment of the significance of the findings). The methodology used and the data analysis are accurate. The work is well presented, the figures are clear, and the previous literature properly cited. My main concerns are the following:*

      • 1) A general concern on the main conclusion of the work "the identification of unique cell type-specific functions for these enhancers". This is in my opinion only partially addressed by the study, as the conclusions are limited due to the absence of genetic experiments: such as deleting the enhancers in their native genomic context (either in human organoids or the homologous sequence in animal models), or at least assessing the effect of mutating their sequence in transgenesis assays in zebrafish. I understand that these functional assays may be out of the scope of the current work, but then the text should be toned down (the word "function" is extensively used) to make clear that the authors mean just expression. I would suggest substituting the word by "activity" in many instances.*

      • The absence of further genetic experiments also limits the significance of the study (see section B).*

      We appreciate and agree with the reviewer’s concern and would substitute the word “function” with “activity” throughout the manuscript.

      2) Whereas the work in general is technically correct (particularly transgenic lines and scRNA-seq data are well described and presented), the co-expression analyses using cell-specific markers (figure 5) need to be improved. There are several issues here. First, the magnification shown is too low to appreciate the colocalization details in the figure. The panels should be replaced by others with higher magnification/resolution (see also minor comment on color-blind compatible images) * In addition, the selection of the markers is suboptimal. Although PCNA is a good general marker of the entire CMZ, it would be advisable to repeat the experiments using more specific markers of the stem cell niche (e.g. rx1, vsx2; Raymond et al 2006; BMC dev Biol) to better define the enhancers expression domain. In addition, HuC/D labels both RGCs and amacrines, and the colocalization could also be refined using amacrine specific markers (e.g. ptf1a : Jusuf & Harris 2009, Neural Dev).*

      In the revised version of the manuscript, we would:

      1. Provide higher magnification images as suggested by the reviewer
      2. Provide additional stainings and justification for our choice of markers used in these colocalizaion experiments Minor comments:

      3. 1.- The work includes several figures (1, 2, 5, 6 and S1) showing colocalization experiments in which channels are shown in red and green. I would advise replacing the red channel with magenta (or the green with cyan) in order to make the figures accessible to readers with color-blindness. This also applies to the schematic representations in figure 6.*

      We will change the channel colours throughout the manuscript as suggested by the reviewers

      2.- It is unclear in the text/images whether the expression driven by the HS5 enhancer is exclusively restricted to temporal retina throughout development (By the way, this differential nasal vs temporal expression should also be included in the final scheme in Figure 6). Does this mean that the expression of Pax6 in proliferating progenitors and Müller glia cells in the nasal retina is not controlled by this enhancer? To which extent is Pax6 needed to maintain the identity of these cell types?

      We will modify the figures as suggested and also include more details of expression overlap with PAX6 expression in the text of the revised manuscript.

      3.- The following sentence in the Discussion "To the best of our knowledge, ours is the first report where the activities of developmental enhancers have been mapped in vivo at single-cell resolution to reveal distinct patterns of activity" should be removed/rephrased. I would argue that the activity of cis-regulatory regions associated to any developmental gene are genome-wide mapped at single cell resolution in each scATACseq experiment.

      We agree that scATAC-seq gives information about potentially active enhancers but it does not define the precise cell-types unless overlapped with expression data. Our method is aimed at ‘defining’ the precise cell-types where the enhancer is active and has the potential to be used to build high resolution maps of cell-type specific enhancer usage for loci with multiple enhancers driving a single gene. We will discuss this in detail in the revised version of the manuscript.

      4.- In the methods section: * (a) FACS experiments: Please provide a supplementary Figure to graphically account for all gating/sorting strategies. * (b) ScRNA-seq analysis: Please provide the values of mean reads per cell and median genes per cell as obtained from Cell Ranger. This would be informative for others performing similar experiments

      This will be included in the revised version of the manuscript.

      **Referees cross-commenting** * I agree with the comments by reviewer #2 on the FACsorting experiments, the description of the landing sites, and the limited significance of the results.*

      Reviewer #1 (Significance (Required)):

      • As described in the previous section, the technical quality of this work is high in general terms. The experiments presented are clear and the conclusions straightforward. In that sense, the study will be a useful reference for those interested in the regulatory logic of Pax6 during eye development, including mainly developmental biologists and human geneticists. This may be particularly the case if new variants can be associated with these enhancers in microphthalmic patients.*

      • The significance and novelty of the findings is however limited by several factors:*

      • a) First, although the level of detail described in this article was not achieved previously, the human enhancers NRE and HS5 (or their conserved homologous in other vertebrates) were previously reported to drive Pax6 expression to the neural retina in transgenesis assays.(Kammandel et al 1999; Marquardt et al 2001; McBride et al 2011; Ravi et al 2013; Kim et al 2017).*

      We agree that the enhancers we describe in this study have been studied before. However, we would like to argue that ours is the first study where we define precise cell-types for the activity of these enhancers. We will revise the discussion to strengthen this argument.

      b) As mentioned in the previous section, the transgenesis assays are not complemented with genetic experiments. The function of the enhancers on retina differentiation and cell fate determination could have been investigated either by deleting them (or their homologous in different species) in their native context, or by exploring their regulatory grammar introducing point mutations or micro-deletions in transgenesis assays.

      We agree that the suggested experiments would be useful for unambiguously establishing the functions of these enhancers and we will discuss these prospects in the revised version of the manuscript.

      c) For reasons not explained in the text, the analysis focuses only in two of the many cis-regulatory regions controlling Pax6 expression in the retina (Lima Cunha et al 2019, Genes). In the absence of a more comprehensive analysis is difficult assessing the relevance of the findings here described.

      We agree that other enhancers for the PAX6 locus should be investigated using similar analysis pipeline to build a complete picture of the enhancer mediated regulation of PAX6. We will discuss this in the revised version of the manuscript.

      d) Finally, from a very general methodological point of view, the approach of using scRNA-seq to investigate enhance activity at a single-cell level is valid and original. However, it is unclear to which extent will be a useful method for many studies, particularly if the activity of endogenous elements is being assessed. In such cases, available scATAC-seq data will provide genome-wide information on the activity of any cis-regulatory element with cell resolution with no need for transgenesis assays and sorting experiments. * We thank the reviewer for recognising the novelty of the approach we describe in this manuscript. We will discuss the merits and demerits of our method with scATAC-seq experiments in the revised version of the manuscript.*

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      In this work, Uttley et al fine characterize two previously described Pax6 retinal enhancers (NRE and HS5) by combining QSTARZ transgénesis method in zebrafish (allowing to produce site-specific integrations of a dual enhancer reporter cassette), scRNAseq and co-immunostaining with specific markers for different retinal cell populations. * The work is experimentally very well performed and well presented and only minor considerations are raised below: * - Authors observe that a large fraction Of FACs sorted cells do not display expression of mCherry or EGFP RNAm in their scRNAseq analysis and attribute this to read dropout in the scRNAseq data and/ or to false-positive FAC cell selection. However, a third possibility exists: n fact due to the high stability of the EGFP and mCherry reporters cells or their progeny could maintain relatively high levels of these reporters even after transcriptional downregulation. Accordingly, the two reporters are strongly expressed in retinal precursor at early stages (24hpf). Thus, in my opinion, it is possible that some cells expressing these reporters retained significant EGFP/mCherry protein levels at 48hpf. Could the authors comment on this? Besides, authors could provide the FACsorting data to give an idea of whether only highly EGFP/ mCherry expressing cells were selected or whether also the low or mild expressing ones were included in the scRNAseq analysis. Finally, a combination of HCR/FSH and GFP//mCherry immunostaining could be used to assess whether a discrepancy in the protein vs mRNA distribution of the reporters exists. * - The authors could provide the information on the landing site used for the QSTARZ transgene integration. While from their previous publication (Bhatia et al 2021) I assume it is the chr6 landing site, it would be worth having this information in the manuscript, as well as a genotyping validation of the correct integration.*

      We will address these points and provide relevant additional data where needed in the revised version of the manuscript.

      **Referees cross-commenting** * I agree with all the points raised by reviewer 1. Particularly I also find that scATACseq experiments already allow testing, to some extent, enhancer activity at cellular level.*

      • Reviewer #2 (Significance (Required)):*

      • From the biological point of view the work provides only an incremental advance in our understanding of the functions of the HS5 and NRE PAX6 enhancers and of PAX6 regulation in the retina. In fact, unraveling the precise contribution of these enhancers to Pax6 retinal expression and the trans-regulatory code controlling their activity would require complex genetic experiments and would fall out of the scope of this work, requiring an extensive amount of work which could not be addressed in the short term. Thus, this work should be regarded as a methodological resource, with its main strength consisting of the use scRNAseq to fine-characterize enhancer activity.*

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      In this work, Uttley et al fine characterize two previously described Pax6 retinal enhancers (NRE and HS5) by combining QSTARZ transgénesis method in zebrafish (allowing to produce site-specific integrations of a dual enhancer reporter cassette), scRNAseq and co-immunostaining with specific markers for different retinal cell populations.

      The work is experimentally very well performed and well presented and only minor considerations are raised below:

      • Authors observe that a large fraction Of FACs sorted cells do not display expression of mCherry or EGFP RNAm in their scRNAseq analysis and attribute this to read dropout in the scRNAseq data and/ or to false-positive FAC cell selection. However, a third possibility exists: n fact due to the high stability of the EGFP and mCherry reporters cells or their progeny could maintain relatively high levels of these reporters even after transcriptional downregulation. Accordingly, the two reporters are strongly expressed in retinal precursor at early stages (24hpf). Thus, in my opinion, it is possible that some cells expressing these reporters retained significant EGFP/mCherry protein levels at 48hpf. Could the authors comment on this? Besides, authors could provide the FACsorting data to give an idea of whether only highly EGFP/ mCherry expressing cells were selected or whether also the low or mild expressing ones were included in the scRNAseq analysis. Finally, a combination of HCR/FSH and GFP//mCherry immunostaining could be used to assess whether a discrepancy in the protein vs mRNA distribution of the reporters exists.
      • The authors could provide the information on the landing site used for the QSTARZ transgene integration. While from their previous publication (Bhatia et al 2021) I assume it is the chr6 landing site, it would be worth having this information in the manuscript, as well as a genotyping validation of the correct integration.

      Referees cross-commenting I agree with all the points raised by reviewer 1. Particularly I also find that scATACseq experiments already allow testing, to some extent, enhancer activity at cellular level.

      Significance

      From the biological point of view the work provides only an incremental advance in our understanding of the functions of the HS5 and NRE PAX6 enhancers and of PAX6 regulation in the retina. In fact, unraveling the precise contribution of these enhancers to Pax6 retinal expression and the trans-regulatory code controlling their activity would require complex genetic experiments and would fall out of the scope of this work, requiring an extensive amount of work which could not be addressed in the short term. Thus, this work should be regarded as a methodological resource, with its main strength consisting of the use scRNAseq to fine-characterize enhancer activity.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary:

      In the article entitled "Unique functions of two overlapping PAX6 retinal enhancers", Uttley and coworkers characterize in detail the activity of two conserved human enhancers (i.e. NRE and HS5) previously reported to drive Pax6 expression to the neural retina. By integrating these enhancers in a PhiC31 landing site using a dual enhancer-reporter cassette, they generated a zebrafish stable line in which their activity can be followed by the expression of GFP (NRE) and mCherry (HS5). The authors show that although the enhancers have a partially overlapping activity at early stages (24hpf), later on (48 and 72hpf) they activity domains segregate: to stem cells and differentiated amacrine cells for NRE, and to proliferating progenitors and differentiated Müller glia cells for HS5. To this end they used two different approaches: a scRNA-seq analysis of sorted cells from the transgenic line and a immunofluorescent analysis employing cell specific markers. The authors conclude that their analysis allowed the identification of unique cell type-specific functions.

      Major comments:

      In general terms, the article is technically sound (please, see section B for an assessment of the significance of the findings). The methodology used and the data analysis are accurate. The work is well presented, the figures are clear, and the previous literature properly cited. My main concerns are the following:

      1. A general concern on the main conclusion of the work "the identification of unique cell type-specific functions for these enhancers". This is in my opinion only partially addressed by the study, as the conclusions are limited due to the absence of genetic experiments: such as deleting the enhancers in their native genomic context (either in human organoids or the homologous sequence in animal models), or at least assessing the effect of mutating their sequence in transgenesis assays in zebrafish. I understand that these functional assays may be out of the scope of the current work, but then the text should be toned down (the word "function" is extensively used) to make clear that the authors mean just expression. I would suggest substituting the word by "activity" in many instances. The absence of further genetic experiments also limits the significance of the study (see section B).
      2. Whereas the work in general is technically correct (particularly transgenic lines and scRNA-seq data are well described and presented), the co-expression analyses using cell-specific markers (figure 5) need to be improved. There are several issues here. First, the magnification shown is too low to appreciate the colocalization details in the figure. The panels should be replaced by others with higher magnification/resolution (see also minor comment on color-blind compatible images) In addition, the selection of the markers is suboptimal. Although PCNA is a good general marker of the entire CMZ, it would be advisable to repeat the experiments using more specific markers of the stem cell niche (e.g. rx1, vsx2; Raymond et al 2006; BMC dev Biol) to better define the enhancers expression domain. In addition, HuC/D labels both RGCs and amacrines, and the colocalization could also be refined using amacrine specific markers (e.g. ptf1a : Jusuf & Harris 2009, Neural Dev).

      Minor comments:

      1. The work includes several figures (1, 2, 5, 6 and S1) showing colocalization experiments in which channels are shown in red and green. I would advise replacing the red channel with magenta (or the green with cyan) in order to make the figures accessible to readers with color-blindness. This also applies to the schematic representations in figure 6.
      2. It is unclear in the text/images whether the expression driven by the HS5 enhancer is exclusively restricted to temporal retina throughout development (By the way, this differential nasal vs temporal expression should also be included in the final scheme in Figure 6). Does this mean that the expression of Pax6 in proliferating progenitors and Müller glia cells in the nasal retina is not controlled by this enhancer? To which extent is Pax6 needed to maintain the identity of these cell types?
      3. The following sentence in the Discussion "To the best of our knowledge, ours is the first report where the activities of developmental enhancers have been mapped in vivo at single-cell resolution to reveal distinct patterns of activity" should be removed/rephrased. I would argue that the activity of cis-regulatory regions associated to any developmental gene are genome-wide mapped at single cell resolution in each scATACseq experiment.
      4. In the methods section:
        • (a) FACS experiments: Please provide a supplementary Figure to graphically account for all gating/sorting strategies.
        • (b) ScRNA-seq analysis: Please provide the values of mean reads per cell and median genes per cell as obtained from Cell Ranger. This would be informative for others performing similar experiments

      Referees cross-commenting I agree with the comments by reviewer #2 on the FACsorting experiments, the description of the landing sites, and the limited significance of the results.

      Significance

      As described in the previous section, the technical quality of this work is high in general terms. The experiments presented are clear and the conclusions straightforward. In that sense, the study will be a useful reference for those interested in the regulatory logic of Pax6 during eye development, including mainly developmental biologists and human geneticists. This may be particularly the case if new variants can be associated with these enhancers in microphthalmic patients.

      The significance and novelty of the findings is however limited by several factors:

      • a) First, although the level of detail described in this article was not achieved previously, the human enhancers NRE and HS5 (or their conserved homologous in other vertebrates) were previously reported to drive Pax6 expression to the neural retina in transgenesis assays.(Kammandel et al 1999; Marquardt et al 2001; McBride et al 2011; Ravi et al 2013; Kim et al 2017).
      • b) As mentioned in the previous section, the transgenesis assays are not complemented with genetic experiments. The function of the enhancers on retina differentiation and cell fate determination could have been investigated either by deleting them (or their homologous in different species) in their native context, or by exploring their regulatory grammar introducing point mutations or micro-deletions in transgenesis assays.
      • c) For reasons not explained in the text, the analysis focuses only in two of the many cis-regulatory regions controlling Pax6 expression in the retina (Lima Cunha et al 2019, Genes). In the absence of a more comprehensive analysis is difficult assessing the relevance of the findings here described.
      • d) Finally, from a very general methodological point of view, the approach of using scRNA-seq to investigate enhance activity at a single-cell level is valid and original. However, it is unclear to which extent will be a useful method for many studies, particularly if the activity of endogenous elements is being assessed. In such cases, available scATAC-seq data will provide genome-wide information on the activity of any cis-regulatory element with cell resolution with no need for transgenesis assays and sorting experiments.
    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Response to Reviewers' Comments on Fumagalli et al. "Nirmatrelvir treatment blunts the development of antiviral adaptive immune responses in SARS-CoV-2 infected mice" (Preprint RC-2022-01777).


      We wish to thank the reviewers for the scholarly review of our work and the very helpful comments. Based on their constructive suggestions, we have generated substantial new experimental data that, in our opinion, positively address all the major and minor concerns raised. In particular, we have confirmed the negative impact of nirmatrelvir treatment on adaptive immune responses in setting of robust SARS-CoV-2 replication (Delta infection in K18-hACE2 transgenic mice and mouse-adapted SARS-CoV-2 infection of wild-type mice).

      One main and one supplemental figure have been added in response to the reviewers' comments. One additional figure – termed Reviewer Figure 1 – has been included in this letter for the reviewers' benefit; while addressing specific comments, we believe that the data depicted in this latter figure remain tangential to the main message of our work and, as such, it should not be incorporated in the final version. To aid the reviewers in the re-evaluation of this study, all relevant passages in the revised text have been written in red. A summary of the changes made to the figures and tables is provided as an appendix at the end of this letter.


      Reviewers' comments:

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      In this study, Fumagalli et. al evaluated the impact of Nirmatrelvir drug treatment on the development of SARS-CoV-2-specific adaptive immune responses in a mice model. Nirmatrelvir is one of the component of Paxlovid drug that has been shown to reduce the risk of progression to severe COVID-19 and long COVID. Herein, authors show that nirmatrelvir administration early after infection blunts the development of SARS-CoV-2-specific antibody and T cell responses. Upon secondary challenge, nirmatrelvir-treated mice developed fewer memory T and B cells to the infected lungs and to mediastinal lymph nodes, respectively. Overall, the experimental methods, figures, results, statistical analysis and findings of this study are interesting and convincing.

      We wish to thank the reviewer for the overall positive assessment of our work.

      CROSS-CONSULATION COMMENTS I agree with the Reviewer 2 comments.

      Reviewer #1 (Significance (Required)): It was known that nirmatrelvir reduces the risk of severe covid and long covid but, whether its treatment has any impact on adaptive immune response was not known/evaluated. This study has importantly addressed that impact of nirmatrelvir treatment can impair both T and B cell adaptive immune responses. It would have been impactful to understand the mechanism of T and B cell immune response impairment following nirmatrelvir treatment in mice which they have already mentioned a limitation of the study.

      We agree with this reviewer that the mechanism of T and B cell impairment following nirmatrelvir treatment should be addressed in future studies.

      Moreover this study provides important implications for clinical management of COVID patients and to revise the treatment strategies to avoid virological and/or symptomatic relapse after Paxlovid/nirmatrelvir treatment completion that have been reported in some individuals.

      We thank the reviewer for highlighting the impact of our results.

      I am not a mice model expert. Not sure whether the viral dose given to mice in this study was optimal to study the impact of the said drug.

      Depending on the virus used, we infected mice with 105-106 TCID50. This is in line with most studies of SARS-CoV-2 infection in mice. It is difficult to know what the average infectious dose in humans is, but the human challenge trial in young adults shows that exposure of individuals to as low as 10 TCID50 of SARS-CoV-2 led to detectable viral RNA in the upper airways (Killingley et al, 2022).

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      Summary:

      In this manuscript, the authors show that Paxlovid, a commonly used antiviral for SARS-CoV-2 infections, blunts the adaptive immune response to the virus. Indeed, they show convincing effects on T cell and B cell responses in the K18-hACE2 mouse model infected with Omicron variant. The effect is observed when drug treatment was started at 4, 24, or 48 h post infection. Experiments are well done and the data are presented clearly.

      We thank the reviewer for the overall positive assessment of our work.

      However, the early timing of drug administration resulted in minimal virus replication, thus likely limiting innate immune activation and antigenic exposure. Indeed, the authors show that the drug did not decrease adaptive responses to other viral infections, indicating that the effect on adaptive immunity in SARS-CoV-2 infection can be explained by decreased viral antigen production. Whether this is the mechanism by which relapse infections occur in humans after Paxlovid treatment is unclear.

      Major comments:

      The authors should discuss whether the timing of drug administration in their experiments is relevant to the timing of when Paxlovid is commonly started in humans. Does Paxlovid limit the adaptive immune response when given later in infection?

      We thank the reviewer for raising this valid comment. First, we would like to point out that the kinetics of viral replication upon SARS-CoV-2 exposure differ between mice and humans. When mice are exposed to a high-dose (105 TCID50) aerosolized SARS-CoV-2, they show peak viral replication in the airways at day 3 post exposure and viral RNA is undetectable in the upper and lower airways after day 7 (Reviewer Figure 1A and (Fumagalli et al, 2021)). It is difficult to extract precise data in humans, but the human challenge trial in young adults shows that exposure of individuals to an extremely low dose (10 TCID50!) of SARS-CoV-2 led to the detection of viral RNA in the upper airways for longer than 14 days (Reviewer Figure 1B and (Killingley et al, 2022)). Therefore, it is very difficult to estimate what would possibly mimic what is occurring in treated COVID-19 patients, especially in line of the current COVID-19 guidelines for ritonavir-boosted nirmatrelvir that suggests to initiate treatment as soon as possible and within 5 days of symptoms (https://www.covid19treatmentguidelines.nih.gov/therapies/antiviral-therapy/ritonavir-boosted-nirmatrelvir--paxlovid-/). The choice to start treatment 4 hours after infection was motivated by the original paper that reported in vivo antiviral activity of nirmatrelvir against SARS-CoV-2 (Owen et al, 2021). That said, we performed additional experiments whereby we treated mice with nirmatrelvir 24 or 48 hours after infection (at or near the peak of viral replication). As shown in the new Figure 3, such treatment also resulted in blunted adaptive immune responses.

      Reviewer Figure 1. (A) K18-hACE2 mice were exposed to a target dose of 2 x 105 TCID50 of aerosolized SARS-CoV-2 (D614G). Quantification of SARS-CoV-2 RNA in the lung after infection. RNA values are expressed as copy numbers per ng of total RNA and the limit of detection is indicated as a dotted line. (B) Healthy adult volunteers were challenged intranasally with SARS-CoV-2. In the infected individuals (n = 18 biologically independent participants). Viral load in twice-daily nose and throat swab samples was measured by qPCR (blue) and focus-forming assay (red) (a). Results are expressed as mean ± SEM. Adapted from ref. (Killingley et al, 2022).

      Omicron variant has limited replication in the K18 mouse model and does not cause disease. Thus, the authors are starting from a model with artificially limited viral antigen production. Does Paxlovid limit the adaptive immune response when given during an infection with a variant strain that replicates robustly in the K18 mice?

      We thank the reviewer for raising this issue. In the revised manuscript we have now performed experiments where we infected K18-hACE2 transgenic mice with the Delta (B.1.617.2) variant, known to replicate at higher level compared to the Omicron variants (Shuai et al, 2022). Additionally, we have infected WT mice with a mouse-adapted SARS-CoV-2 (rSARS2-N501YMA30)(Wong et al, 2022) that replicates robustly and induces significant disease. These new results, now shown in the new Figure 3 and new Figure S4, confirm that nirmatrelvir treatment blunts the development of antiviral adaptive immune responses regardless of the variants/strain used for infection.

      Reviewer #2 (Significance (Required)):

      Significance: Nirmatrelvir/Paxlovid is used clinically for treatment of COVID-19. Relapse infections have been reported after courses of the drug. The authors show here that Paxlovid treatment during a mouse model of SARS-CoV-2 infection results in diminished induction of adaptive immunity and immune memory. This is most probably due to decreased production of viral antigenic stimuli due to inhibition of virus replication. The concept that less viral antigen will result in less induction of immunity is not surprising. Further, whether the phenomenon observed here in a mouse model with poor susceptibility to the chosen virus strain is related to relapse infections in humans was not established. Nonetheless, the audience for this work is broad and this work could be of interest due to the common use of Paxlovid and the ongoing SARS-CoV-2 infections across the world.

      Although we did not investigate the mechanism underlying the reported observation in depth, we agree with this reviewer that the most likely explanation for the reduced adaptive immune responses is decreased production of viral antigens. In this regard, it is probably not terribly surprising. However, it is worth noting that successful antimicrobial treatment does not inevitably result in reduced adaptive immune responses to any pathogen. For instance, treatment of mice infected with Listeria monocytogenes with amoxicillin early after infection did not significantly impair the development of T cell responses (Corbin & Harty, 2004; Mercado et al, 2000). Furthermore, treatment with antibiotics before L. monocytogenes infection allowed the development of functional antigen-specific memory CD8+ T cells in the absence of contraction (Badovinac et al, 2004). An additional, and possibly more relevant, example was published during the revision process: monoclonal antibody therapy with bamlanivimab during acute COVID-19 did not impact the development of a robust antiviral T cell response (Ramirez et al, 2022).

      As per the comment related the poor susceptibility of the mouse model to the Omicron variants of SARS-CoV-2, we believe that the new data obtained with the Delta variant and with the mouse-adapted SARS-CoV-2 (new Figure 3 and S4) convincingly show that nirmatrelvir treatment blunts antiviral adaptive immune responses to SARS-CoV-2 in mice.

      List of modifications

      New figures:

      • Figure 3: new data as per reviewer’s suggestion.
      • Figure S4: new data as per reviewer’s suggestion.

      References

      Badovinac VP, Porter BB & Harty JT (2004) CD8+ T cell contraction is controlled by early inflammation. Nat Immunol 5: 809–817

      Corbin GA & Harty JT (2004) Duration of Infection and Antigen Display Have Minimal Influence on the Kinetics of the CD4+ T Cell Response to Listeria monocytogenes Infection. J Immunol 173: 5679–5687

      Fumagalli V, Ravà M, Marotta D, Lucia PD, Laura C, Sala E, Grillo M, Bono E, Giustini L, Perucchini C, et al (2021) Administration of aerosolized SARS-CoV-2 to K18-hACE2 mice uncouples respiratory infection from fatal neuroinvasion. Sci Immunol 7: eabl9929

      Killingley B, Mann AJ, Kalinova M, Boyers A, Goonawardane N, Zhou J, Lindsell K, Hare SS, Brown J, Frise R, et al (2022) Safety, tolerability and viral kinetics during SARS-CoV-2 human challenge in young adults. Nat Med 28: 1031–1041

      Mercado R, Vijh S, Allen SE, Kerksiek K, Pilip IM & Pamer EG (2000) Early Programming of T Cell Populations Responding to Bacterial Infection. J Immunol 165: 6833–6839

      Owen DR, Allerton CMN, Anderson AS, Aschenbrenner L, Avery M, Berritt S, Boras B, Cardin RD, Carlo A, Coffman KJ, et al (2021) An oral SARS-CoV-2 Mpro inhibitor clinical candidate for the treatment of COVID-19. Science 374: 1586–1593

      Ramirez SI, Grifoni A, Weiskopf D, Parikh UM, Heaps A, Faraji F, Sieg SF, Ritz J, Moser C, Eron JJ, et al (2022) Bamlanivimab therapy for acute COVID-19 does not blunt SARS-CoV-2-specific memory T cell responses. Jci Insight 7

      Shuai H, Chan JF-W, Hu B, Chai Y, Yuen TT-T, Yin F, Huang X, Yoon C, Hu J-C, Liu H, et al (2022) Attenuated replication and pathogenicity of SARS-CoV-2 B.1.1.529 Omicron. Nature 603: 693–699

      Wong L-YR, Zheng J, Wilhelmsen K, Li K, Ortiz ME, Schnicker NJ, Thurman A, Pezzulo AA, Szachowicz PJ, Li P, et al (2022) Eicosanoid signaling blockade protects middle-aged mice from severe COVID-19. Nature: 1–9

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Summary:

      In this manuscript, the authors show that Paxlovid, a commonly used antiviral for SARS-CoV-2 infections, blunts the adaptive immune response to the virus. Indeed, they show convincing effects on T cell and B cell responses in the K18-hACE2 mouse model infected with Omicron variant. The effect is observed when drug treatment was started at 4, 24, or 48 h post infection. Experiments are well done and the data are presented clearly. However, the early timing of drug administration resulted in minimal virus replication, thus likely limiting innate immune activation and antigenic exposure. Indeed, the authors show that the drug did not decrease adaptive responses to other viral infections, indicating that the effect on adaptive immunity in SARS-CoV-2 infection can be explained by decreased viral antigen production. Whether this is the mechanism by which relapse infections occur in humans after Paxlovid treatment is unclear.

      Major comments:

      The authors should discuss whether the timing of drug administration in their experiments is relevant to the timing of when Paxlovid is commonly started in humans.

      Does Paxlovid limit the adaptive immune response when given later in infection?

      Omicron variant has limited replication in the K18 mouse model and does not cause disease. Thus, the authors are starting from a model with artificially limited viral antigen production. Does Paxlovid limit the adaptive immune response when given during an infection with a variant strain that replicates robustly in the K18 mice?

      Significance

      Nirmatrelvir/Paxlovid is used clinically for treatment of COVID-19. Relapse infections have been reported after courses of the drug. The authors show here that Paxlovid treatment during a mouse model of SARS-CoV-2 infection results in diminished induction of adaptive immunity and immune memory. This is most probably due to decreased production of viral antigenic stimuli due to inhibition of virus replication. The concept that less viral antigen will result in less induction of immunity is not surprising. Further, whether the phenomenon observed here in a mouse model with poor susceptibility to the chosen virus strain is related to relapse infections in humans was not established. Nonetheless, the audience for this work is broad and this work could be of interest due to the common use of Paxlovid and the ongoing SARS-CoV-2 infections across the world.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      In this study, Fumagalli et. al evaluated the impact of Nirmatrelvir drug treatment on the development of SARS-CoV-2-specific adaptive immune responses in a mice model. Nirmatrelvir is one of the component of Paxlovid drug that has been shown to reduce the risk of progression to severe COVID-19 and long COVID. Herein, authors show that nirmatrelvir administration early after infection blunts the development of SARS-CoV-2-specific antibody and T cell responses. Upon secondary challenge, nirmatrelvir-treated mice developed fewer memory T and B cells to the infected lungs and to mediastinal lymph nodes, respectively. Overall, the experimental methods, figures, results, statistical analysis and findings of this study are interesting and convincing.

      Referees cross-commenting

      I agree with the Reviewer 2 comments.

      Significance

      It was known that nirmatrelvir reduces the risk of severe covid and long covid but, whether its treatment has any impact on adaptive immune response was not known/evaluated. This study has importantly addressed that impact of nirmatrelvir treatment can impair both T and B cell adaptive immune responses. It would have been impactful to understand the mechanism of T and B cell immune response impairment following nirmatrelvir treatment in mice which they have already mentioned a limitation of the study.

      Moreover this study provides important implications for clinical management of COVID patients and to revise the treatment strategies to avoid virological and/or symptomatic relapse after Paxlovid/nirmatrelvir treatment completion that have been reported in some individuals.

      I am not a mice model expert. Not sure whether the viral dose given to mice in this study was optimal to study the impact of the said drug.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      1. General Statements We thank the reviewers for their thoughtful comments and suggestions, which have improved the manuscript. We are particularly gratified by their positive comments about the significance of the findings. Our point-by-point responses to the reviewer comments and suggestions are summarized below. Line numbers have been added to the revised manuscript to make it easier to locate the changes.

      Point-by-point description of the revisions

      Reviewer #1__ __

      *1) In the study there is a lack of consideration of other targets. In and of itself this is not a problem, but once the author's identified the T130A mutation as being a key for protection it would have been good to Sanger sequence the other T. gondii myosins - a quick alignment of the TgMyo's A, C, H (class XIV), along with D and E suggests that the motif is highly conserved. This raises the currently unexplored (and exciting!) prospect of a pan-myosin inhibitor, and that there might have been mutations at an equivalent position in the other four KNX002 resistant clones - for example, MyoC has been proposed to provide some level of functional redundancy in the absence of MyoA. *

      Because the goal of this work was to evaluate the druggability of TgMyoA, we specifically designed our experiments to identify resistance-conferring mutations in TgMyoA or its light chains, as described on lines 366-372. This strategy yielded the TgMyoA T130A mutation, which enabled us to rigorously determine that inhibiting TgMyoA, and TgMyoA only, was sufficient to slow the progression of disease in vivo. Because we took this targeted approach, our results did not address: (a) the basis of resistance in the 4 resistant clones that did not contain a mutation in TgMyoA or its light chains and (b) whether KNX-002 inhibits any of the other ten parasite myosins.

      The most informative way to address (a) would be to do whole genome sequencing on each of the mutants, since resistance might have nothing to do with the other parasite myosins or their light chains. Any potential resistance-conferring mutations identified would need to be regenerated in a non-mutagenized background and functionally characterized, as we have done here for the T130A mutation, to be certain that this particular mutation was responsible for resistance. The most direct way to address (b) would be to individually express each of the other ten parasite myosins together with its specific associated light chains and the myosin co-chaperone protein TgUNC, purify the motor and determine the effect of the compound on motor activity (as we have done for TgMyoA; Fig. 1). These are both major undertakings that are beyond the goals and scope of the current manuscript. Critically, the absence of such data does not impact the conclusions of our phenotypic studies, which used the CRISPR-engineered T130A parasite line.

      We nevertheless agree with the reviewer that these are both interesting questions that should be studied further, and we now discuss them on lines 416-422 and 451-453.

      2) The fact that T130 is not thought to be the binding site of KNX002 is only introduced quite late on - this also relates to the next point - is the binding pocket conserved??? It is intriguing that the residue and proximal amino acid environment are highly conserved with vertebrates, but that KNX002 does not have an effect on their activity in their screen assay. It would be useful to know if the differences in the structures of the myosins can provide an explanation for this - along the same lines, given that the crystal structure of TgMyoA is available (PMID: 30348763), it would be useful for the authors to provide a molecular model for the binding of the inhibitor to the proposed point of engagement.

      These are excellent questions that we unfortunately cannot yet answer. Docking simulations of KNX-002 to the published structure of TgMyoA in its pre-powerstroke state have thus far not yielded any promising results. The site of KNX-002 binding to P. falciparum MyoA was determined by X-ray crystallography (ref. 54); however, the PfMyoA in that study was in the post-rigor state and the coordinates of the co-crystal structure have not yet been made available in the PDB database for homology modeling.

      The lack of effect of KNX-002 on the vertebrate muscle myosins may not be surprising. Although the 3D structures of myosins are rather conserved, their primary structures are quite different, which likely contributes to the different effects of KNX-002 on the different myosins. TgMyoA and PfMyoA are more similar to each other than they are to the vertebrate muscle myosins, which may enable the specific targeting of MyoA in apicomplexan parasites (lines 308-310).

      *If this is an allosteric site it is possible that the mutation functions indirectly upon binding of KNX002 to the orthosteric site, but this would be useful to help the reader to understand this (and there are bioinformatic prediction tools that will score allostery - which would be interesting to include). This is explained somewhat in the discussion - but this should be introduced much earlier to clarify. What is known about allosteric regulation of Myo function? Is this a known site of regulation? *

      Allosteric modulation of human cardiac myosin by small molecules such as omecamtiv is well established, and allosteric effects of the T130A mutation are certainly a possibility. As molecular motors, myosins depend on a complex and highly interconnected network of allosteric interactions to perform their function (for example, see ref. 59). This complexity, combined with the fact that the data on the PfMyoA-KNX-002 structure have not yet been released, makes it very difficult to generate any sort of model that would support meaningful conclusions. A statement to this effect has been added to the Discussion (line 375-382), and the likelihood that T130 is not part of the actual binding site for the compound is now mentioned at the very beginning of the paragraph that discusses the potential mechanism of action of the T130A mutation (lines 375-376).

      *3) Introduction: 'Nearly one third of the world's population is infected with the apicomplexan parasite' - given that these data are extrapolated from serology, this should be reworded - it's fairer to say that they 'are or have been infected...' *

      Done – line 65.

      *4) Page 4: figure 1A - can you provide some explanation for incomplete inhibition in the screen - there seems to be a residual amount (15-20%) of activity that is not inhibited. *

      The compound inhibits 80-90% of the motor’s activity at 40uM. We did not test higher concentrations in the ATPase assay; presumably we would see incrementally more inhibition as we increase compound concentration further, but the concentrations used enabled us to construct a reproducible IC50 curve without adding potentially confounding amounts of DMSO (carrier) to the assay.

      *5) The authors demonstrate a general effect on growth over 7 days. It would be good to use a replication assay (e.g. parasites/vacuole over a single lytic cycle) to confirm that KNX002 does not affect cellular division. This would further strengthen the argument that the phenotypic effect is primarily via impacts on motility. *

      A figure showing the lack of effect of KNX-002 on replication has now been added (new Supplemental Figure 2) and a paragraph describing these data and their implications added to the Results section (lines 137-143).

      *6) Page 5: 'selected for parasites resistant to KNX-002 by growth in 40 μM KNX-002.' - could the authors add text to explain why that concentration was chosen. *

      40 μM is close to the compound’s IC90 of 37.6 μM and, although we tried a number of different compound concentrations and selection schemes, 40 μM yielded parasites with the greatest shift in IC50. We now include this rationale on lines 606-607, as well as a new figure showing the shift in IC50 curves for all 5 resistant lines (Suppl. Figure 8).

      *7) Page 6: 'suggesting that the effects of the T130A mutation on motor function are due to more subtle structural changes' - it's fair to say that there are not gross structural changes based on the data presented, but that does not mean it is therefore a 'more subtle structural change' - surely the mutation could prevent KNX002 binding without effecting TgMyoA structure? *

      Based on the residues within P. falciparum MyoA that participate in binding to KNX-002 (ref. 54), it is unlikely that T130 of TgMyoA participates directly in compound binding. Mutation of T130 to alanine therefore seems most likely to impact compound binding through a change in protein structure, discussed more fully now on lines 375-382.

      *8) Page 6: 'the proportion of filaments moving' - in the figure it's referred to as the 'fraction of filaments', which makes more sense for the data presented. Please correct to 'fraction' throughout the manuscript (discussion, page 9 - possibly other instances!). Along the same lines, in figure 6 it would be good to change the y axes on the '% moving' to be 'fraction moving' and change the numbers - this would make it easier for the reader to understand the index values presented in the lower panels - if you do the calculation with the % values presented the numbers don't make sense (as fractions they do). The axes for motility also go up to 125% - please correct - based on the data presented there is no need for this to be above 100% (or 1 - see above). *

      We thank the reviewer for this suggestion; “percent moving” and “proportion moving” have been changed throughout the manuscript and figures to “fraction moving”. The y-axis labels on the motility and IC50 curves have also been modified as suggested.

      *9) Page 7: 'tested whether KNX-002 (20mg/kg, administered intraperitoneally on the day of infection and two days later' - please provide some rationale for the concentration used. *

      A preliminary dose tolerance study was conducted prior to the infection experiments, with doses ranging from 5-20 mg/kg. The study showed that two doses of 20 mg/kg, administered two days apart, resulted in minor hepatoxicity without signs of pain or distress. 20mg/kg was therefore considered the maximal tolerated dose. This rationale is now included on lines 715-721.

      *10) Page 10: 'the T130A mutation is likely to have long range structural impact that could alter the KNX-002 binding pocket' - this is particularly interesting, and should be addressed with a model - do the authors think that the T130 region be a conserved site of allosteric regulation? This would be good to expand upon in the discussion - mutation of an allosteric site as a mechanism of resistance is unusual, and typically described as being unlikely - and used as justification for the targeted drugging of allosteric sites. *

      See response to comment #2 above and the new text on lines 375-382.

      Reviewer #2

      *1) Considering (i) the moderate effect of KNX-002 on the acute infection process in CBA mice that received tachyzoites intraperitoneally, (ii) the fact that the drug application cannot be envisaged outside of the context of reactivation of cystogenic strains (in particular with respect to cerebral toxoplasmosis as emphasized in the introductive section), which implies the drug would have to be delivered and active in the brain parenchyma, a condition not analyzed here, it would be appropriate to modify the current title. It would be more relevant to highlight the solid body of data on the identification and functional characterization of the compound and derivatives in vitro and in the host mouse model. Apart from the title, the discussion should also recontextualize the in vivo assays and the information these assays bring on the slight delay of the "mortality" of some but not all mice. *

      We agree that the major clinical application of any new anti-Toxoplasma chemotherapy would be treatment of a reactivated infection, particularly in the brain (although there could also be a role for treatment of pregnant women), and that the data we present with this compound do not speak directly to clinical efficacy in this context. That said, reactivation leads to an active infection whose pathogenesis requires TgMyoA-dependent motility, invasion and egress, like the active infections analyzed here. The KNX-002 scaffold would likely need to be modified to enable it to cross the blood-brain barrier and access parasites in the brain, but that would be a normal step in any campaign to develop new drugs for toxoplasmosis (which is well beyond the scope of this study; see response to comment #11).

      Given these considerations, we gave much thought to how to accurately describe the results from the animal experiments – and we therefore appreciate the reviewer’s comment. For the title, we arrived the word “druggable”, because it has the very specific meaning described on lines 100-101: a protein whose activity is amenable to inhibition by small molecules. In our experiments with mice infected with wild-type parasites, nine of the ten compound-treated animals survived longer than the untreated controls, and 40% of the treated mice were still alive at the end of the experiment. Nevertheless, we stayed away from terms like “therapeutic” or “treatment”, for exactly the reasons the reviewer raises. We believe that the current title is an accurate summary of what we found, since we have indeed shown that MyoA is amenable to inhibition by a small molecule in a well-established animal model of infection (CBA mice infected intraperitoneally). Showing for the first time that the MyoA is druggable, in vivo, provides the rationale for identifying more potent compounds that can access the brain and serve as bona fide leads for drug development.

      To the reviewer’s point, we also reviewed all sections of the text where we described the animal experiments, and in the revised manuscript we replaced all instances in the text of “ameliorate disease”, “prevent disease” and “decrease the susceptibility of mice to a lethal infection” with the more circumspect phrases “alter disease progression” or “slow disease progression” (lines 46, 56, 110, 297, 315, Figure 9 legend). We also changed the title of the Results section describing these data from “KNX-002 treatment decreases the susceptibility of mice to lethal infection with T. gondii” to “KNX-002 treatment slows disease progression in mice infected with a lethal dose of T. gondii” (line 284).

      *2) Motility analysis: This comment concerns the Figure 7. It seems to the reviewers that the major hypothesis to test in data presented in panel B is that the wild type and the T130A mutant tachyzoite respond differently under similar drug conditions rather than the two populations without drug. These statistics could be added easily, hence it would validate that the proportion of motile mutant parasites is not affected by the drug when compared to vehicle. *

      These statistical comparisons have now been added to revised figure 7, as suggested. Since this comparison was between different parasite lines, it required the use of unpaired t-tests (vs. the paired t-tests used for different compound treatments of the same parasite line). We have therefore revised all 3D motility figures (Figures 4 and 7, Suppl. Figures 7 and 12) and their legends to clearly indicate which samples are being compared to which and whether paired or unpaired statistical tests are being used.

      However, the statistics shown panel C rather suggest that the drug does impact on the speed of the moving parasites, including when these carry the "resistance" T130 A mutation. It is not clear what we can gain in terms of messages with the motility index except to "slightly reverse" the analysis on panel B and to favor a no-effect of KNX-002 on the mutant parasite motile skills, on which the author might give more explanation. When comparing these quantitative tests with the panel presented above (panel A) it seems that the mutant parasite is still impacted by the MyoA inhibitor. Although there is no doubt for the reviewers that the T130A mutant emerging from the selected T. gondii resistant clones is a valuable probe for assessing drug selectivity: indeed the assays validate KNX-002 as a direct TgMyoA ATPase inhibitor, it might be good to rephrase some sentences and to have a harmonized definition of the parasite motility index throughout the text (Figure 7 legend, result and discussion sections).

      The reviewer is correct that there is a decrease in the speed of compound-treated T130A parasites, as the p-values on Figure 7C indicate. This is why we state in the text that “the mutant parasites retain some sensitivity to the compound” (line 263). We were careful throughout the manuscript to refer to the resistance provided by the mutation as “partial”, or to describe it as a “reduced sensitivity”. Partial resistance is still sufficient to establish compound specificity, as noted by the reviewer in this comment.

      We present the motility index not to try to “reverse” the effect of the compound on the mutant’s speed, but because the compound has two simultaneous effects on motility -- a decrease in the fraction moving and a decrease in speed of those that do move. Combining these two effects into one value (while still showing each component individually, as we have) enables comparison to the analogous actin filament motility index from the in vitro motility assays, and provides a more complete picture of the impact of compound treatment on parasite motility. This is a similar approach to that used in studies of e.g., phagocytosis, where the widely reported “phagocytic index” corresponds to the fraction of cells that have internalized at least one particle multiplied by the average number of beads internalized. The motility index of the mutant parasites is significantly less impacted by KNX-002 than the motility index of wild-type parasites (Figure 7D).

      We have further clarified the definition and rationale for using the parasite motility index throughout, as suggested (lines 233-235, 264-267, 345-348).

      *This reviewer's concern was accentuated by the comparison between the actin filament sliding index and the parasite motility index which appears as such far stretch; Aside from the "far stretched claims" easy to re-address in a revised version, the readers have appreciated the writing quality and most figure illustration. The discussion nicely synthetizes the whole dataset, including those related to the 4 T. gondii clones that resisted to KNX-002 but not through mutations targeting any of the myosinA chains. *

      We have added additional text to the discussion listing possible reasons for the differential effects of the mutation on the filament and parasite motility indices (lines 403-406).

      4) Ab*stract: the concept of "ameliorate disease" in this framework is odd and the objective of the work can be rephrased in a simple way (see below) *

      See response to Comment #1; “ameliorate” has been replaced with “alter disease progression” (line 46).

      *5) Introduction section: we think that the references on the impairment of invasiveness for the KoMyoA should be included (Bichet et al., BMC Biology 2016) as it has provided proof of an alternative and suboptimal mode of entry in many different cell types, thereby arguing that in absence of MyoA function, parasite invasiveness is not fully abolished and this without considering any MyoC-driven MyoA compensation. *

      We thank the reviewer for catching this oversight; the Bichet citation has been added (line 93).

      6) Introduction, third paragraph: in the sentence "Because the parasite can compensate for the loss or reduced expression of proteins important to its life cycle [29-31], small-molecule inhibitors of TgMyoA would serve as valuable complementary tools for determining how different aspects of motor function contribute to parasite motility and the role played by TgMyoA in parasite dissemination and virulence ». We definitively agree with this view but saying that, we think it would be worth evaluating (or simply discussing) the potency of the KNX-002 against MyoC, which compensatory contribution has been debated and remains questionable (at least to the reviewers) with respect to cell invasiveness restoration (related to the comment above).

      We have included a discussion of a potential compensatory role for MyoC and the value of determining in future studies whether KNX-002 (or its more potent downstream analogs) inhibit any of the other parasite myosins (lines 419-423). Whether or not MyoC can functionally compensate for a lack of MyoA – we agree this is a controversial question – it is important to note (as we do on line 440-442) that “T. gondii engineered to express low levels of TgMyoA … are completely avirulent [28], arguing that sufficiently strong inhibition of TgMyoA is likely, on its own, to be therapeutically useful”.

      *7) If we are correct, the screen and the characterization study have been performed with two different products (CK2140597 and KNX-002 the compound library and the re-synthetized one, respectively). Could we make sure that the two have the same potency? *

      The source of compound used in each of the assays is now explicitly described on lines 481-490). Commercially obtained compound yielded an IC50 in growth assays of 16.2 and 14.9 μM (Figures 2 and 5, respectively), and compound synthesized by us yielded an IC50 value of 19.7 μM (Figure 3). The 95% confidence intervals of these three independent IC50 determinations with two different sources of compound overlap (lines 484-486).

      8) We understood how the authors came to the conclusion that the KNX-002 impact on growth of the parasite and they stated "growth in culture" in the subsection title but then refers to parasite growth. Therefore, it looks a bit confusing for the reader since intracellular growth per se is probably not modified but this feature was not looked at it in this study (we would expect no impact based on published data on MyoA- genetically deficient tachyzoites, except if the drug impacts host cell metabolism for instances). Instead, it is the overall expansion of the parasite population that is analyzed here and clearly shown to be impacted. This decrease in population expansion on a cell monolayer likely results from impaired MyoA-dependent egress and invasiveness upon chemical inactivation of MyoA. Accordingly, it appears difficult to understand what is an IC50 for the "overall" growth in the context of this study. The authors should rephrase for better accuracy when necessary, including in the graph Fig2 legend axis.

      While assays that measure parasite expansion in culture are by convention called “growth” assays (e.g., see Gubbels et al, High-Throughput Growth Assay for Toxoplasma gondii Using Yellow Fluorescent Protein AAC 47 (2003) 309, the paper on which our assay was based), we take the reviewer’s point that a reader may incorrectly ascribe the inhibition to some other aspect of the lytic cycle (e.g., intracellular replication), rather than a myosin-dependent motility-based process. We have therefore now: (a) more clearly defined the growth assay as one that measures parasite expansion in culture (lines 132-138); (b) described the myosin-dependent and -independent steps of the lytic cycle (lines 137-140); and (c) added a new figure (new Suppl. Figure 2, lines 140-143) showing that the compound has no effect on intracellular replication.

      *9) The authors should clarify for the reader (i) why they use in some case myofibrils and other muscle F actin when measuring the Myosin ATPase activity, (ii) what does mean XX% calcium activation and (iii) why using 75% in these assays which is 3 times higher from the original assays. (iv) Why they did not include non muscle actins in their study since Myosins also extensively work on non muscle actins. *

      (i) For both striated and smooth muscle myosins, the assays used here are well established and have identified compounds that have translated into animal models of disease. To assay the activity of myosins from striated muscle types, particularly to determine compound selectivity, myofibril assays are preferred as they recapitulate more of the biology as a more "native", membrane-free preparation and respond cooperatively to calcium activation. For cardiac, fast and slow skeletal muscle it is possible to derive high quality myofibril preparations that can be activated by calcium. A reference describing the value of using myofibrils in assays of striated muscle myosin ATPase activity has been added (ref. 71, line 517).

      Smooth muscle, a non-striated tissue, is regulated differently and calcium exerts an effect not through binding to troponin as in the striated muscle but through g-protein signaling, with phosphorylation as an end result, making the contraction slower and also much slower to reverse - in line with the physiological role of the muscle. The only way to reliably reconstitute smooth muscle ATPase activity has been through purification and reconstitution of a more reductionist system. The SMM S1 needs to be crosslinked to the actin to achieve high enough local concentrations to generate robust ATPase activity. A reference describing the use of this assay to identify small molecule inhibitors of SMM is now included (ref. 73, line 522).

      (ii, iii) Striated muscle myofibrils are responsive to calcium, as muscle contraction is mediated in vivo through calcium release from the sarcoplasmic reticulum. Titrating calcium can activate the myofibril ATPase activity up to the plateau (100%) and provide optimal signal to noise and sensitivity for the particular activity being assayed. For counterscreening to determine selectivity, we adjusted the assay conditions to a high basal ATPase activity (75% calcium) to provide high sensitivity for detecting inhibition. A sentence explaining this rationale has been added on lines 519-520.

      (iv) We used skeletal muscle actin in all of our in vitro assays since we have shown skeletal muscle actin to be a good substrate for TgMyoA (ref 33, cited on line 536) and skeletal muscle actin can be purified in larger quantities than native actin from parasites or functional recombinant protein from insect cells. Others have also shown that the closely related MyoA from P. falciparum moves skeletal muscle actin at the same speeds as recombinant P. falciparum actin (Bookwalter et al [2017] JBC 292:19290).

      *10) The protocol of image analysis of the 3D motility assay was increased to 80 seconds for the test of KNX-002 selectivity using wild type and mutant parasites (Fig 7) when compared to the test of KXN-002 concentration effect on wild type tachyzoites (60 sec in the result section, in Fig 4 legend and in the Methods' section). Is there any specific reason? *

      The data for Figure 4 were captured earlier in the project than those of Figure 7 and Suppl. Figure 7. In the intervening time we upgraded our Nikon Elements software from v.3.20 to v.5.11 (as already described on lines 583 and 588). With the upgrade to v.5.11, we also began using Nikon’s Illumination Sequence (IS) module, a graphical user interface that provides greater time resolution through a more efficient approach to building the z-stacks and saving the data. With the addition of v.5.11 and the IS module we were able to capture twice the number of image volumes in 80 sec than we were in 60 sec using v.3.20, and that became our standard operating procedure. Other than the improved time resolution, the 60s and 80s assays give indistinguishable relative results. We have now clarified in the methods (line 588-589) that we used the IS module to acquire the data in Figure 7 and Suppl. Figure 7.

      *11) In the mouse infection experimental design (Method section), it seems that they were no biological replicates in the case of the drug-treated (parasites + mice) which is not the case for the comparison of virulence between MyoA wild type and T130 mutants. If true, and considering what the authors wish to emphasize as a main message, it is fairly complicated to convincingly conclude about the KNX-002 effectiveness in vivo. Maybe the authors could explain their limitations. *

      Since we did not know how the compound and parasites would interact in mice – and in keeping with animal welfare standards – we decided that rather than doing multiple replicates with smaller numbers of infected mice we would do a single experiment with a large enough number of mice per treatment condition to ensure that if any animals died unexpectedly or had to be euthanized prematurely we would still have sufficient numbers for robust statistical comparison. Single experiments with ten treated and ten untreated mice are a generally accepted approach in early studies of drug effectiveness (e.g., Ferrreira et al Parasite 2002, 9:261; Rutaganira et al, J. Med. Chem. 2017, 60: 9976; Zhang et al IJP Drugs and Drug Resistance 2019, 9:27), and power analysis shows that if mortality is 100% in untreated mice and 50% in treated mice, 10 mice per group will provide an 80% probability of detecting the difference with a p value<br /> *We are also not sure why the compound has been injected only twice, at the time of parasite injection and two days after whereas the mice succumbed after 8 to 9 days even without MyoA inhibitors. Although quite difficult to measure, do the authors have any knowledge (based on the chemistry for example) of the compound stability and lipophilicity in blood and tissues? Because the IC50 on free tachyzoites appears significantly higher (5.3 uM, Fig4) than the in vitro molecular assay, when assessed in motility tests, and is increased for intracellular growth (Fig 8), it is somehow expected that the current compound would not work that great in vivo. Did the author try to provide the inhibitor intravenously every day? *

      IP injection is a standard method of administration for early drug treatment studies, and two considerations contributed to our decision to inject on days 0 and 2 post-infection: (a) the preliminary dose-tolerance studies, which were done with two IP doses of compound two days apart, showed evidence of mild toxicity so we were hesitant to inject more frequently, inject IV, or use more compound/injection; (ii) we expect the compound to work primarily on egressing and extracellular parasites, and since the parasite’s lytic cycle takes approximately 48 hours, this two-day injection schedule was chosen to maximize exposure of the extracellular parasites to freshly injected compound early in establishment of the infection. This rationale has now been added to the Methods section (lines 715-721).

      In terms of the doing systematic studies of dosing, stability, PK/PD, drug partitioning etc., it is important to restate that the primary goal of this work was to test whether inhibiting TgMyoA activity in vivo alters the course of infection. The data reported in the manuscript demonstrated this to be the case. As we state on lines 454-457, “While KNX-002 provided the means to rigorously test the druggability of TgMyoA, it caused weight loss and histological evidence of liver damage in the treated infected mice. Before further animal work, it will therefore be necessary to develop more potent and less toxic analogs that retain specificity for parasite myosin.” Our colleagues at Kainomyx have in fact initiated a drug development campaign based on the KNX-002 scaffold and have already identified a derivative named KNX-115, that is 20-fold more potent against recombinant P. falciparum MyoA (described on lines 356-361). Given Kainomyx’s ongoing efforts we do not believe it makes sense to do any further animal experiments at this time with KNX-002. It will be more informative and ethical to undertake, e.g., dosing, PK and PD studies with the more potent and less toxic derivatives that emerge from the Kainomyx drug development program, once these compounds become publicly available. This does not diminish the importance of the proof-of-principle experiments reported here, which as the reviewer stated, “provide a strong rationale for developing new therapeutic strategies based on targeting MyoA”; rather, it makes it hard to justify doing additional animal studies with a compound that we know will soon be replaced with more potent and less toxic derivatives.

      12) Figure 4: 2D and 3D Motility- the authors should comment on the fact that in 2D conditions with 10 uM of KNX-002, circular trajectories (one complete circle so at least 2 parasite lengths but sometimes more) largely dominate over others, whereas in absence of KNX-002 these circular trajectories are barely detectable and helical trajectories predominate. What could that mean as regard to the MyoA functional contribution to either process?

      This is an interesting question that we cannot currently answer. Perhaps helical 2D gliding requires more myosin-generated force than circular 2D gliding, but this is pure speculation at this point. Whatever the explanation, the observation is striking and we believe should be reported as it shows a clear effect of the compound on motility in the widely-used 2D trail deposition assay.

      *13) Figure 7: Besides the major point raised above for panel C, the information carried by the Figure could be stronger if an additional panel is introduced regarding the interesting assay on the preserved structural stability of the MyoA mutant over the WT MyoA (currently in SupFig7) *

      Former Suppl. Figure 7 (now Suppl. Figure 9) addresses one particular explanation for the differential effects of the mutation in the in vitro motility assay (Figure 6) and the parasite 3D motility assay (Figure 7). The data in Suppl. Figures 14A and 14B address two other possibilities. For consistency with the other figures and clarity of the narrative, we would prefer to leave the data in Suppl. Figure 9 as a supplemental figure.

      14) Material and Methods - Parasite motility assays: remove the duplicated [16] reference.

      Done.

      *15) The discussion starts with the ongoing debate on mechanisms underlying zoite motility; We found that the work of Pavlou et al. (ACS nano, 2020) should be part of the references listed there, as it brings evidence that a specific traction polar force is required probably in concert with microtubule storage energy at the focal point, a result that questions the prevailing model. *

      This was another oversight; the citation has been added (line 307).

      *16) Concerning the C3-20 and C3-21 compounds, the sentence "they have no effect on the activity of the recombinant TgMyoA (AK and GEW, unpublished data)" in the paragraph starting by "There have been only two previously..." should be refrained unless showing the results. *

      We have removed reference to this unpublished work, as suggested (lines 338-340).

      17) If possible, the authors should expand more on the effect of KNX-002 on Plasmodium falciparum and its homolog PfMyoA.

      We have expanded our discussion of these preprint data from others on lines 356-361.

      Reviewer #3

      *1) The T130A IC50 was done on the mutagenized clone 5. The authors currently don't have data showing IC50 on the independently generated T130A mutant, to see if the IC50s are similar to one another, or if there were additional resistance mutations present in clone 5. *

      Because we did not insert the T130A mutation into a fluorescent parasite background, we cannot directly compare its IC50 in the fluorescence-based growth assay to that of the line generated by chemical mutagenesis. Plaque assays do not require fluorescent parasites but, in our hands, these assays lack the sensitivity to reproducibly detect the expected subtle (50. While we agree that it would be interesting to know if the mutant generated by chemical mutagenesis contains any additional resistance-conferring mutations, not having this information does not alter the conclusion that the T130A mutation alone reduces the sensitivity of the motor to KNX-002 (Figures 6-9). See also response to Reviewer 1, comment 1; a discussion of the value of determining what other resistance mechanisms are available to the parasite for this class of compounds is now included on lines 416-422.

      *2) For 3D motility assays, it is currently unclear from the data and text what the expected maximal inhibition of motility would be; e.g., would parasites depleted of MyoA display 0% motility. Understanding the dynamic range of this assay could help clarify whether this residual 5% motility explains why parasites treated with 20 uM KNX-002 can still form small plaques. This could be achieved by referencing previous work that assesses 3D motility after depletion of a critical motility factor. *

      A small fraction of TgMyoA knockout parasites are still capable of motility in 3D (13% when normalized to wildtype for displacements > 2 μm [ref. 46]), so the dynamic range of the 3D assay for TgMyoA-deficient parasites compared to wild-type parasites is 0.13-1.0. The 13% residual motility of the TgMyoA parasites is now referred to on lines 419-420. Treatment of wild-type parasites with 20μM KNX-002 results in a fractional motility of ~0.24 compared to untreated controls (Figures 4 and 7). This less than complete inhibition compared to the knockout is not surprising, since motor activity is not completely inhibited at 20 μM compound (Figures 1 and 6) and parasite growth as assayed either by the fluorescence-based method (Figure 2A) or plaquing (Figure 8) shows greater inhibition at 40 and 80 μM compound than at 20 μM.

      *3) It would be informative for the authors to discuss the rationale for the selected treatment regime. Since many drug-treatments involve daily dosing, was the two-dose regime based on poor tolerance of the compound in mice or other considerations? *

      See response to reviewer 2, comment 11; the rationale for this dosing regimen has now been added to the Methods (line 715-721).

      *4) Track length is not considered as a parameter in the filament sliding assays (Fig. 6) or the 3D motility assays (Fig. 7). These may be valuable parameters for the authors to examine; however, the time frames analyzed might be insufficient to capture track lengths. Could the authors include analyses of track lengths or discuss the technical limitations of their assays? *

      In the in vitro motility assays, almost all of the actin filaments move for the entire 60s of video recording so trajectory length is directly proportional to speed and therefore does not provide any additional information. For the parasite 3D motility assay, we have added a new figure (Suppl. Figure 12) showing the effect of the compound on the displacement of wild-type and T130A parasites, along with new text describing these data (lines 269-273).

      *5) When discussing the minor discrepancies between the results with recombinant protein and parasite motility, the authors could consider the relative concentration of motors in the pellicle; i.e. it might be necessary to inhibit a greater % of all the motors to truly block motility, perhaps consistent with the higher compound concentrations needed to affect parasite motility. *

      This possible explanation has been added to the Discussion (lines 403-406).

      6) The authors should include the IC50 data for all 5 KNX-002 resistant clones in the supplementary data. While the 5/26 clones showed >2.5-fold increase in IC50 for KNX-002, it's unclear how the IC50 of the single clone harboring the T130A MyoA mutation compared to the other resistant clones.

      A figure has been added showing these data (new Suppl. Figure 8).

      *7) For plaque assays, the authors should indicate how much DMSO was used for 0 KNX-002 conditions. It should presumably be the corresponding concentration at 80 µM drug and if not, that control should be performed to account for effects of DMSO at higher concentrations at all drug concentrations tested. *

      In all experiments involving treatment with compound, the compound was serially diluted in DMSO to the appropriate range of concentrations prior to dissolving it in aqueous buffer for the experiment itself, enabling an equivalent amount of DMSO to be added to all samples in that experiment, including the DMSO only vehicle controls. This clarifying statement and the final range of DMSO concentrations in each of the different types of experiments has been added to the Methods section (lines 486-491). * *

      *8) Authors should indicate the origins of their hexokinase for counter screens. *

      The hexokinase used was from Millipore Sigma (#H6380); the supplier has been added on line 507.

      *9) Authors should indicate µM on graphs. *

      The μM label has been added to the graphs where it was missing (Figures 2 and 5, Suppl. Figures 4, 6, 8).

      *10) In Figures 2A, 5A, and 5B, the use of colored lines (e.g., of different hues) could make the graphs more legible. *

      We have experimented with color as a way to discriminate between the different doses on these graphs, but found the use of 8 different colors to be more distracting than helpful. The color-coding approach would be even less useful for readers who have color vision deficiency (including one of our authors). Symbol groupings have been added to the right of all growth curves to improve the legibility of the graphs.

      *11) In Figure 2C, it isn't clear which cell line was treated with sodium azide to generate the positive control. *

      It was the HFF cells that were treated with azide as a positive control; Figure 2C has been modified to make this clear.

      *12) In the discussion, "a" is missing in the phrase "...mutation is likely to have long range structural impact..." *

      Done. * *

      *13) The abbreviation of species (spp.) should be followed by a period. *

      Done.

      Other

      Further SAR analyses using an optimized actin-dependent myosin ATPase assay resulted in minor changes to Suppl. Figure 3 and Figure 3, with no significant changes to the conclusions. The text has been modified accordingly (lines 155-161, 178-180).

      All other changes to the manuscript not noted above were editorial in nature, made to either improve clarity or correct minor errors in the previous version.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      The authors identify a small-molecule inhibitor of T. gondii MyoA, the major apicomplexan myosin that is required for gliding motility and pathogenesis. Reconstitution of MyoA ATPase activity using recombinant protein enabled quantitative fluorescence measurements of actin-activated ATP usage. The authors screened a library of ~50,000 small molecules using their cell-free assay and counter screened hits by measuring their effects on hexokinase ATPase activity. The inhibitor, KNX-002, inhibited MyoA (IC50 of 2.8 µM), but had no effect on the ATPase activity of an array of vertebrate myosins. 15 analogues of KNX-002 were generated for SAR analysis, providing information on the functional groups of the molecule, despite not improving overall potency or specificity. In the context of T. gondii infection in human foreskin fibroblasts (HFFs), KNX-002 inhibited parasite growth (IC50 of 19.7 µM) while host cell viability was unaffected at the highest concentrations tested (80 µM). KNX-002 treatment (20-25 µM) reduced the percentage of motile parasites to approximately 5% compared to 30-40% in vehicle-treated parasites. The authors go on to demonstrate that MyoA is the biologically relevant target of KNX-002 during parasite infection, by generating resistant parasites by directed evolution. One of the resistant clones harbored a T130A mutation in the MyoA motor domain. While KNX-002 treatment of recombinant WT MyoA displayed dose-dependent inhibition of actin filament motility, the T130A proteoform was unaffected at all concentrations tested. T130A mutant parasites were independently generated and indeed conferred partial resistance to KNX-002 in growth and motility assays. Lastly, the therapeutic potential of KNX-002 was assessed during infection of CBA/J mice. At 10 days post-infection, mice treated with KNX-002 displayed a 40% survival rate compared to 0% in the vehicle-treated group. This was in contrast to mice challenged with T130A mutant parasites, in which KNX-002 treatment did not improve survivability. Together, these data indicate that the small molecule KNX-002 can mitigate T. gondii pathogenesis and one mechanism of action of KNX-002 is inhibition of MyoA-mediated gliding motility.

      Major comments

      • The T130A IC50 was done on the mutagenized clone 5. The authors currently don't have data showing IC50 on the independently generated T130A mutant, to see if the IC50s are similar to one another, or if there were additional resistance mutations present in clone 5.
      • For 3D motility assays, it is currently unclear from the data and text what the expected maximal inhibition of motility would be; e.g., would parasites depleted of MyoA display 0% motility. Understanding the dynamic range of this assay could help clarify whether this residual 5% motility explains why parasites treated with 20 uM KNX-002 can still form small plaques. This could be achieved by referencing previous work that assesses 3D motility after depletion of a critical motility factor.
      • It would be informative for the authors to discuss the rationale for the selected treatment regime. Since many drug-treatments involve daily dosing, was the two-dose regime based on poor tolerance of the compound in mice or other considerations?
      • Track length is not considered as a parameter in the filament sliding assays (Fig. 6) or the 3D motility assays (Fig. 7). These may be valuable parameters for the authors to examine; however, the time frames analyzed might be insufficient to capture track lengths. Could the authors include analyses of track lengths or discuss the technical limitations of their assays?
      • When discussing the minor discrepancies between the results with recombinant protein and parasite motility, the authors could consider the relative concentration of motors in the pellicle; i.e. it might be necessary to inhibit a greater % of all the motors to truly block motility, perhaps consistent with the higher compound concentrations needed to affect parasite motility.

      Minor comments

      • The authors should include the IC50 data for all 5 KNX-002 resistant clones in the supplementary data. While the 5/26 clones showed >2.5-fold increase in IC50 for KNX-002, it's unclear how the IC50 of the single clone harboring the T130A MyoA mutation compared to the other resistant clones.
      • For plaque assays, the authors should indicate how much DMSO was used for 0 KNX-002 conditions. It should presumably be the corresponding concentration at 80 µM drug and if not, that control should be performed to account for effects of DMSO at higher concentrations at all drug concentrations tested.
      • Authors should indicate the origins of their hexokinase for counter screens.
      • Authors should indicate µM on graphs.
      • In Figures 2A, 5A, and 5B, the use of colored lines (e.g., of different hues) could make the graphs more legible.
      • In Figure 2C, it isn't clear which cell line was treated with sodium azide to generate the positive control.
      • In the discussion, "a" is missing in the phrase "...mutation is likely to have long range structural impact..."
      • The abbreviation of species (spp.) should be followed by a period.

      Significance

      This important work substantially advances technical and clinical aspects of studying the motility of apicomplexan pathogens by identifying a new small molecule inhibitor of gliding motility and uncovering its mode of action by inhibition of a motor protein. The evidence supporting the conclusions is convincing, with a new screening assay for myosin motor activity and advanced methods to characterize 3D motility for Toxoplasma gondii. The authors provide compelling evidence that KNX-002 inhibits MyoA, gliding motility, and MyoA-mediated virulence during mouse infection. The evidence suggests that some secondary or off-target effects remain uncharacterized within the parasite and in murine hosts. KNX-002 will enable targeted pharmacological inhibition of the motor complex, as opposed to broad inhibition of actin using cytochalasin D. While other small molecules inhibiting the motor complex have been identified-such as the myosin ATPase inhibitor 2,3-butanedione monoxime (Dobrowolski et al. 1997) and the myosin light chain 1 inhibitor TachypleginA (Heaslip et al. 2010; Leung et al. 2014)-these inhibitors have major off-target effects that render them unsuitable for therapeutic use. These findings are of interest to those studying apicomplexan pathogens, including T. gondii, Plasmodium spp., and Cryptosporidium spp. These include those interested in developing small molecule therapies and those interested in gliding motility. Our relevant expertise during this review process include: chemical genetics, cell biology of apicomplexan parasites, and signaling. We have limited expertise in the SAR strategies implemented to improve the effectiveness of KNX-002.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Summary

      The manuscript by Kelsen et al. reports on the identification of a compound referred to as KNX-002 that inhibits the unconventional MyosinA motor ATPase activity from the intracellular parasite Toxoplasma gondii myosin A (TgMyoA), an unconventional myosin characterized by both its high divergence from those of the parasite host repertoire (i.e., about all homeotherms) and a functional contribution to crucial processes during the parasite life cycle. To identify KNX-002, the authors used assays they had previously developed to produce recombinant active TgMyoA in insect cells combined with those now designed to quantify the TgMyoA ATPase activity. With these tools in hand, the authors screened about 50.000 molecules from a library referred to as small inhibitors and further characterized the potency of the top list MyoA inhibitory compound (i.e., KNX-002) by conducting in vitro, ex vivo and in vivo studies.

      The following sections of the manuscripts bring evidence that:

      1. the KNX-002 "re-synthetized" compound is at least 10 times more efficient at inhibiting MyoA ATPase activity when compared to muscle actin from different vertebrates in vitro (IC50 data).
      2. the KNX-002 can be chemically modified with chemical substitution and structural analysis. Up to 15 derivatives (all with lower potency at that stage) were structurally and functionally tested for comparison with respect to parental KNX-002.
      3. exposing the motile-invasive-replicative stage of T. gondii called tachyzoite to the KNX-002 compound (5 to 10 times higher doses than in vitro) impairs in a dose dependent way the tachyzoite's motility and the overall expansion of the population in host cell culture.
      4. mice injected intraperitoneally with type I tachyzoites and subsequently with two intraperitoneal injections of KNX-002 (at day 0 and day 2 post infection) showed slightly longer survival time when compared to those injected with parasites and then vehicle, thereby indicating a moderate effectiveness of KXN-002 in mice under the protocol used.

      The authors further established the KNX-002 selectivity against TgMyoA parasites by applying chemical mutagenesis and subsequent screening for "resistance" to the KNX-002 compound. Using nucleic acid sequencing of the few genes encoding the myosin motor components (i.e., heavy and light chains), the authors eventually identified a TgMyoA mutation (T130A) which does not concern the predicted pocket to accommodate KNX-002 binding but does confer a 2.9-fold decreased sensitivity to KNX-002. Selectivity towards MyoA was also documented in vitro by analysis Actin filament sliding and ex vivo using CRISPR/Cas9 gene editing to engineer parasites expressing "exclusively" the TgMyoA on its mutated form (T130A mutant). These mutants indeed displayed fairly similar motile skills regardless of the presence of vehicle or KNX-002.

      The authors conclude on the interest to consider the potential of KNX-002 (more specifically some promising derivatives) to enrich the limited current therapeutic regimens against T. gondii and other Apicomplexa (in particular Plasmodium) for which MyoA has already been argued as a relevant therapeutic target.

      Major comments

      The reviewers found the large set of assays appropriately designed, executed and presented to be reproduced by other scientists. The results are also mostly analyzed with enough detail and care throughout the work (except a few minor points raised below), but the reviewers also stress a few overstated conclusions easy to mitigate in particular related to the diseased model.

      To the reviewer's opinion, there is no need for additional experiments but we would appreciate some rephrasing for higher accuracy and improved clarity.

      Below are listed few major concerns to address.

      1. Considering (i) the moderate effect of KNX-002 on the acute infection process in CBA mice that received tachyzoites intraperitoneally, (ii) the fact that the drug application cannot be envisaged outside of the context of reactivation of cystogenic strains (in particular with respect to cerebral toxoplasmosis as emphasized in the introductive section), which implies the drug would have to be delivered and active in the brain parenchyma, a condition not analyzed here, it would be appropriate to modify the current title. It would be more relevant to highlight the solid body of data on the identification and functional characterization of the compound and derivatives in vitro and in the host mouse model. Apart from the title, the discussion should also recontextualize the in vivo assays and the information these assays bring on the slight delay of the "mortality" of some but not all mice.
      2. Motility analysis: This comment concerns the Figure 7 It seems to the reviewers that the major hypothesis to test in data presented in panel B is that the wild type and the T130A mutant tachyzoite respond differently under similar drug conditions rather than the two populations without drug. These statistics could be added easily, hence it would validate that the proportion of motile mutant parasites is not affected by the drug when compared to vehicle. However, the statistics shown panel C rather suggest that the drug does impact on the speed of the moving parasites, including when these carry the "resistance" T130 A mutation. It is not clear what we can gain in terms of messages with the motility index except to "slightly reverse" the analysis on panel B and to favor a no-effect of KNX-002 on the mutant parasite motile skills, on which the author might give more explanation. When comparing these quantitative tests with the panel presented above (panel A) it seems that the mutant parasite is still impacted by the MyoA inhibitor. Although there is no doubt for the reviewers that the T130A mutant emerging from the selected T. gondii resistant clones is a valuable probe for assessing drug selectivity : indeed the assays validate KNX-002 as a direct TgMyoA ATPase inhibitor, it might be good to rephrase some sentences and to have a harmonized definition of the parasite motility index throughout the text (Figure 7 legend, result and discussion sections). This reviewer's concern was accentuated by the comparison between the actin filament sliding index and the parasite motility index which appears as such far stretch;

      Minor comments

      Aside from the "far stretched claims" easy to re-address in a revised version, the readers have appreciated the writing quality and most figure illustration. The discussion nicely synthetizes the whole dataset, including those related to the 4 T. gondii clones that resisted to KNX-002 but not through mutations targeting any of the myosinA chains. Few comments are listed as:

      Abstract: the concept of "ameliorate disease" in this framework is odd and the objective of the work can be rephrased in a simple way (see below)

      Introduction section: we think that the references on the impairment of invasiveness for the KoMyoA should be included (Bichet et al., BMC Biology 2016) as it has provided proof of an alternative and suboptimal mode of entry in many different cell types, thereby arguing that in absence of MyoA function, parasite invasiveness is not fully abolished and this without considering any MyoC-driven MyoA compensation. Introduction, third paragraph: in the sentence "Because the parasite can compensate for the loss or reduced expression of proteins important to its life cycle [29-31], small-molecule inhibitors of TgMyoA would serve as valuable complementary tools for determining how different aspects of motor function contribute to parasite motility and the role played by TgMyoA in parasite dissemination and virulence ». We definitively agree with this view but saying that, we think it would be worth evaluating (or simply discussing) the potency of the KNX-002 against MyoC, which compensatory contribution has been debated and remains questionable (at least to the reviewers) with respect to cell invasiveness restoration (related to the comment above).<br /> Result section:

      1. If we are correct, the screen and the characterization study have been performed with two different products (CK2140597 and KNX-002 the compound library and the re-synthetized one, respectively). Could we make sure that the two have the same potency?
      2. we understood how the authors came to the conclusion that the KNX-002 impact on growth of the parasite and they stated "growth in culture" in the subsection title but then refers to parasite growth. Therefore, it looks a bit confusing for the reader since intracellular growth per se is probably not modified but this feature was not looked at it in this study (we would expect no impact based on published data on MyoA- genetically deficient tachyzoites, except if the drug impacts host cell metabolism for instances). Instead, it is the overall expansion of the parasite population that is analyzed here and clearly shown to be impacted. This decrease in population expansion on a cell monolayer likely results from impaired MyoA-dependent egress and invasiveness upon chemical inactivation of MyoA. Accordingly, it appears difficult to understand what is an IC50 for the "overall" growth in the context of this study. The authors should rephrase for better accuracy when necessary, including in the graph Fig2 legend axis.
      3. The authors should clarify for the reader (i) why they use in some case myofibrils and other muscle F actin when measuring the Myosin ATPase activity, (ii) what does mean XX% calcium activation and (iii) why using 75% in these assays which is 3 times higher from the original assays. Why they did not include non muscle actins in their study since Myosins also extensively work on non muscle actins.
      4. The protocol of image analysis of the 3D motility assay was increased to 80 seconds for the test of KNX-002 selectivity using wild type and mutant parasites (Fig7) when compared to the test of KXN-002 concentration effect on wild type tachyzoites (60 sec in the result section, in Fig 4 legend and in the Methods' section). Is there any specific reason?
      5. In the mouse infection experimental design (Method section), it seems that they were no biological replicates in the case of the drug-treated (parasites + mice) which is not the case for the comparison of virulence between MyoA wild type and T130 mutants. If true, and considering what the authors wish to emphasize as a main message, it is fairly complicated to convincingly conclude about the KNX-002effectiveness in vivo. Maybe the authors could explain their limitations. We are also not sure why the compound has been injected only twice, at the time of parasite injection and two days after whereas the mice succumbed after 8 to 9 days even without MyoA inhibitors. Although quite difficult to measure, do the authors have any knowledge (based on the chemistry for example) of the compound stability and lipophilicity in blood and tissues? Because the IC50 on free tachyzoites appears significantly higher (5.3 uM, Fig4) than the in vitro molecular assay, when assessed in motility tests, and is increased for intracellular growth (Fig 8), it is somehow expected that the current compound would not work that great in vivo. Did the author try to provide the inhibitor intravenously every day?

      Figure 4: 2D and 3D Motility- the authors should comment on the fact that in 2D conditions with 10 uM of KNX-002, circular trajectories (one complete circle so at least 2 parasite lengths but sometimes more) largely dominate over others, whereas in absence of KNX-002 these circular trajectories are barely detectable and helical trajectories predominate. What could that mean as regard to the MyoA functional contribution to either process?

      Figure 7: Besides the major point raised above for panel C, the information carried by the Figure could be stronger if an additional panel is introduced regarding the interesting assay on the preserved structural stability of the MyoA mutant over the WT MyoA (currently in SupFig7)

      Material and Methods

      Parasite motility assays: remove the duplicated [16] reference.

      Discussion:

      The discussion starts with the ongoing debate on mechanisms underlying zoite motility; We found that the work of Pavlou et al. (ACS nano, 2020) should be part of the references listed there, as it brings evidence that a specific traction polar force is required probably in concert with microtubule storage energy at the focal point, a result that questions the prevailing model.

      Concerning the C3-20 and C3-21 compounds, the sentence "they have no effect on the activity of the recombinant TgMyoA (AK and GEW, unpublished data)" in the paragraph starting by "There have been only two previously..." should be refrained unless showing the results.

      If possible, the authors should expand more on the effect of KNX-002 on Plasmodium falciparum and its homolog PfMyoA.

      Significance

      This multi-disciplinary work timely brings to the research communities (basic research and pre-clinical research) new knowledge and a new reagent quite valuable for future dissection of the T. gondii MyoA contribution across different scales of study. It also provides a strong rationale and preliminary orientations for developing a new compound targeting MyoA in the context of anti-toxoplasma or possibly anti-Apicomplexa therapeutic strategies.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary:

      In this study the authors use an in vitro screen to identify a novel inhibitor of the actin-activated ATPase activity of myosin A. The lead molecule, KNX-002, was shown to inhibit parasite growth and motility, with initial SAR studies failing to improve on the potency of the parent molecule. The author's then focus on confirming the expected mechanism of action of KNX-002 in parasites. They use a chemical mutagenesis and drug-pressure protocol to select for a drug-resistant parasite population. They identify a drug-resistant clone harbouring a missense mutation in the TgMyoA locus, converting a threonine at position 130 into an alaninie. These parasites demonstrate resistance to KNX002, and the equivalent mutation introduced de novo into the MyoA locus in otherwise wild-type parasites confirms that the T130A mutation is sufficient to provide protection from the effects of the drug. Finally, they confirm that KNX-002 can protect mice from T. gondii infection.

      Overall the manuscript is very well written, with a clear and logical narrative. The data presented broadly support their conclusion, and the general quality of the figures is very high. I would recommend that the manuscript should be accepted once the following points have been addressed:

      Major comments:

      While the following would strengthen the manuscript, they could be addressed in the discussion or with clarification of the text:

      • In the study there is a lack of consideration of other targets. In and of itself this is not a problem, but once the author's identified the T130A mutation as being a key for protection it would have been good to Sanger sequence the other T. gondii myosins - a quick alignment of the TgMyo's A, C, H (class XIV), along with D and E suggests that the motif is highly conserved. This raises the currently unexplored (and exciting!) prospect of a pan-myosin inhibitor, and that there might have been mutations at an equivalent position in the other four KNX002 resistant clones - for example, MyoC has been proposed to provide some level of functional redundancy in the absence of MyoA. The fact that T130 is not thought to the binding site of KNX002 is only introduced quite late on - this also relates to the next point - is the binding pocket conserved???
      • It is intriguing that the residue and proximal amino acid environment are highly conserved with vertebrates, but that KNX002 does not have an effect on their activity in their screen assay. It would be useful to know if the differences in the structures of the myosins can provide an explanation for this - along the same lines, given that the crystal structure of TgMyoA is available (PMID: 30348763), it would be useful for the authors to provide a molecular model for the binding of the inhibitor to the proposed point of engagement. If this is an allosteric site it is possible that the mutation functions indirectly upon binding of KNX002 to the orthosteric site, but this would be useful to help the reader to understand this (and there are bioinformatic prediction tools that will score allostery - which would be interesting to include). This is explained somewhat in the discussion - but this should be introduced much earlier to clarify. What is known about allosteric regulation of Myo function? Is this a known site of regulation?

      Minor comments:

      • Introduction: 'Nearly one third of the world's population is infected with the apicomplexan parasite' - given that these data are extrapolated from serology, this should be reworded - it's fairer to say that they 'are or have been infected...'
      • Page 4: figure 1A - can you provide some explanation for incomplete inhibition in the screen - there seems to be a residual amount (15-20%) of activity that is not inhibited.
      • The authors demonstrate a general effect on growth over 7 days. It would be good to use a replication assay (e.g. parasites/vacuole over a single lytic cycle) to confirm that KNX002 does not affect cellular division. This would further strengthen the argument that the phenotypic effect is primarily via impacts on motility.
      • Page 5: 'selected for parasites resistant to KNX-002 by growth in 40 μM KNX-002.' - could the authors add text to explain why that concentration was chosen.
      • Page 6: 'suggesting that the effects of the T130A mutation on motor function are due to more subtle structural changes' - it's fair to say that there are not gross structural changes based on the data presented, but that does not mean it is therefore a 'more subtle structural change' - surely the mutation could prevent KNX002 binding without effecting TgMyoA structure?
      • Page 6: 'the proportion of filaments moving' - in the figure it's referred to as the 'fraction of filaments', which makes more sense for the data presented. Please correct to 'fraction' throughout the manuscript (discussion, page 9 - possibly other instances!). Along the same lines, in figure 6 it would be good to change the y axes on the '% moving' to be 'fraction moving' and change the numbers - this would make it easier for the reader to understand the index values presented in the lower panels - if you do the calculation with the % values presented the numbers don't make sense (as fractions they do). The axes for motility also go up to 125% - please correct - based on the data presented there is no need for this to be above 100% (or 1 - see above).
      • Page 7: 'tested whether KNX-002 (20mg/kg, administered intraperitoneally on the day of infection and two days later' - please provide some rationale for the concentration used.
      • Page 10: 'the T130A mutation is likely to have long range structural impact that could alter the KNX-002 binding pocket' - this is particularly interesting, and should be addressed with a model - do the authors think that the T130 region be a conserved site of allosteric regulation? This would be good to expand upon in the discussion - mutation of an allosteric site as a mechanism of resistance is unusual, and typically described as being unlikely - and used as justification for the targeted drugging of allosteric sites.

      Significance

      Strengths: Discovery of new parasite-selective inhibitor of TgMyo-A motility will be a valuable tool, and potential therapeutic lead.

      Weaknesses: Molecular mode of action on a modelled binding of KNX002 could have strengthened the proposed mechanism of action via a site outside of the expected KNX002 binding pocket.

      Advance: the findings advance our understanding of drug-resistance mechanisms, and also validate TgMyoA as a druggable therapeutic target.

      Audience: this work will appeal to molecular parasitologists, as also be of broader interest to research communities including myosin structure-function researchers, and drug discovery groups interested in drug-resistance mechanisms.

      Expertise: molecular parasitology, chemical biology, proteome engineering

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Reply to the Reviewers

      I thank the Referees for their...

      Referee #1

      1. The authors should provide more information when...

      Responses + The typical domed appearance of a hydrocephalus-harboring skull is apparent as early as P4, as shown in a new side-by-side comparison of pups at that age (Fig. 1A). + Though this is not stated in the MS 2. Figure 6: Why has only...

      Response: We expanded the comparison

      Minor comments:

      1. The text contains several...

      Response: We added...

      Referee #2

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      This work is is distinguished by impressive technical feats and experimental breadth, and is another excellent contribution from the Zurzolo lab. My comments are advisory regarding more explicit descriptions and qualified conclusions.

      Introduction: Please define how filopodia are distinguished from TNTs - is it length only or are there other characteristics? Do filopodia and individual TNTs have the same diameter? There is presumably a functional difference as well?

      Please state the number of cells in each array spot?

      Paragraph 2 of Results would benefit from a general description of procedure and rationale for assessing protrusions in the artificial setups used in this study of isolated cells. It would help to explicitly state when protrusions were assessed after fixation and when the observations were made with unfixed cells. What are the issues of concern with these methods and what aspects are relevant to general cell behavior? Isn't it important to point out that the conclusions regarding Arp2/3 inhibition and TNT formation are operational for the conditions used?

      Ln 148: If filopodia are distinguished/defined by their shorter relative length, the observation that "filopodia lengths showed that a majority of filopodia were far shorter" is not informative. Do cells with TNTs also have filopodia?

      Does the negative effect of increasing array separation distance on frequency of TNTs suggest that the observations represent a steady state, and the possibility that the observed frequencies are measures of protrusion stability? If the experiments monitor the steady state, can the authors distinguish between stability and inherent ability to extend filopodia to longer distances? Is the conclusion (ln 151) "there seems to be an upper limit to F-actin-based elongation" justified if stability or relative rates of extension and retraction are factors? Another possibility is that the observations reflect protrusion:protrusion interactions that promote stable TNTs. There is the precedent of cytoneme:cytoneme interactions associated with stable signaling contacts (Gonzalez-Mendez et al PMID: 28825565) as well as previous work from the Zurzolo lab (Sartori-Rupp et al PMID: 30664666). A kinetic analysis in real time might be very informative.

      Ln 158: "cells displaying only lamellipodia accounted for 4.1% of [cells with?] TNTs examined"

      Significance

      This work offers new insights into the cytoskeletal processes that generate long cell protrusions. The implications for understanding cell:cell interactions and signaling are fundamental and important.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      I applaud the authors for the creative experimentation and intriguing findings presented in this work, but the narrative lacks a clear biological question and, as written, comes across more like a collection of thematically related results, rather than a logical point A > B > C progression of studies that significantly advances our understanding of TNT formation beyond the current published literature. In addition, there are a number of inconsistencies and ambiguities in the approach - at least as described - that make it hard to follow the logic flow of the authors. Below I list some of the major inconsistencies and questions I had after reading through the manuscript.

      1. From Figure 1b - the micro patterned substrates separated by different distances also appear to be printed as different diameters - is this true? I could find no mention of it in the text. My concern is that changing the contact area between the cell and substrate might impact the cell's ability to extend very long membrane protrusions towards its neighbors. Why not print patterns of exactly the same diameter separated by increasing distances?
      2. By using micropatterned substrates the Authors hope to force the extension of TNTs using actin driven mechanisms, while eliminating the possibility that cells are form these connections by "dislodging" from the substrate. The Authors also state that the cells do not wander into the region in between the circular patterns. However, in many images featured in multiple figures, I can find examples where cells clearly extend into the space between the circular patterns (see Fig. 2.a.i for an example). The primary concern here is that the authors did not fully eliminate the possibility that cells are making direct contact and then pulling away from each other/dislodging to form TNTs. In the supplemental material, there were movies showing TNTs that had already formed, but I was unable to find examples of TNTs in the act of forming. If the authors do have timelapse data that clearly shows this, it should be front and center in this data set.
      3. The authors make use of CK-666 to inhibit Arp2/3, which is thought to free up actin monomers that can be used to further elongate TNTs. Other orthogonal methods should be employed to corroborate the results from CK-666 treatment. There are other drugs that inhibit Arp2/3 (e.g. arpin, wiskostatin) and of course there is always genetic manipulation (shRNA KD).
      4. The authors also employ a formin agonist, IMM-01, and the results from those experiments (Fig. S4) suggest that activating formin mDia could facilitate TNT elongation, but the authors do not follow up with direct molecular manipulation to further test this idea. Are formins (specifically mDia, the target of IMM-01) needed to elongate TNTs?
      5. With the experiments shown in Figure 3, the authors apply optical tweezers to pull what they refer to as "nanotubes" from the cell surface under conditions where Arp2/3 is inhibited with CK-666. The panels appear to show that CK-666 allows actin to assemble out into a pulled nanotube more readily than control cells. However, the reporter for actin assembly in these experiments is F-Tractin, and it only partially fills the protrusion. I note here that F-Tractin appears more soluble under the CK-666 condition. Can the Authors rule out the possibility that there is just a larger soluble pool of F-Tractin probe under these conditions?
      6. Related to the previous point, it is not clear to me why the Authors need to invoke the application of external forces with an optical trap to study the enhanced elongation of TNTs under CK-666 conditions. Why don't the authors directly visualize actin accumulation and TNT elongation after treatment with this inhibitor?
      7. In Figure 4, the Authors move away from TNTs and instead focus on "longer protrusions" (filopodia?) to examine the effects of EPS8 and IRSp53 on growth of these structures. The general findings here are consistent with the role of these factors in protrusion growth from previous studies.
      8. The experiments in Figure 5 are performed with a truncated "bundling active" form of EPS8 allegedly lacking actin capping activity. The logic behind this choice is unclear. These experiments need to be repeated in parallel with full length WT EPS8 to allow for a full and clear interpretation of these results. Along these lines, could the Authors stain for endogenous Esp8/IRSp53 complex within TNT-connected cells?
      9. Data in Figure 5 show that the Eps8dCAP/IRSp53 complex increases the vesicle transfer within TNT-connected cells from Eps8dCAP/IRSp53 donors to EBFP-H2B acceptors indicating the functionality of TNT. Interestingly, cells with overexpression of Eps8dCAP/IRSp53 and CK-666 treatment do not increase TNT-connections. Could the authors examine the stability of TNTs under this condition? The lack of increased vesicle transfer may be due to the instability of the TNT structure rather the saturation of the system.
      10. Figure 5c. The data show that vesicle transfer from EpsdCAP/IRSp53 donors to EBFP-H2B acceptors increases under the overexpression of EpsdCAP/IRSp53. Are the EBFP-H2B acceptors able to form TNT? If so, could the authors show the vesicle transfer in those TNT-connected cells? The images indicate that there is no presence of TNT structures in these conditions.

      Significance

      This study from Henderson et al. seeks to understand the mechanisms that drive tunneling nanotube (TNT) formation. TNTs are essentially giant filopodia that extend many microns from the cell surface to contact protrusions extending from neighboring cells, to establish channels that allow for exchange of biological material. The authors use an approach that involves micro patterned substrates, various inhibitors/agonists, construct overexpression experiments, and biophysical measurements with optical tweezers. The major insights from these studies are that actin monomer availability is limiting for the formation of long TNTs, and that proteins that are well known to regulate the formation of filopodia and related linear actin structures (namely EPS8 and IRSp53) promote TNT formation. These are interesting findings that are certainly consistent with the previously published literature on actin-based protrusions, and as such they should be of interest to cell biologists.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      We thank both reviewers for their constructive criticism and the insightful comments on our manuscript. Reviewer 1 states that:

      „The strength of this manuscript lies in its comprehensive analysis of Bim1 function, the quality of the results and that the experiments are generally well controlled and interpreted. „

      And „the findings of this comprehensive analysis are of great value to the microtubule field, especially for people working in budding yeast. „

      • *

      While Reviewer 2 adds:

      „The current study is indeed rich with new insights into the mechanisms by which these molecules function, and will no doubt prove valuable to a number of people in the microtubule/motor/yeast mitosis fields. As someone who is interested in and studies mitosis in budding yeast, I found the study to be interesting.

      • *

      Both reviewers conclude that:

      “…there are useful data in the manuscript that make this an important contribution and that it should definitely be published”

      • *

      • *

      Both reviewers raised two major areas of concern: 1. A confusing overall structure makes the study hard to follow. 2. A clearer distinction needs to made between what has already been reported in the literature, and what are new insights provided in this study. In this regard, the appropriate citations need to be made at various positions throughout the manuscript.

      In this full revision, we have addressed these major points of criticism of the reviewers as follows:

      We have re-organized and re-focused the manuscript to make it more accessible and easier to follow for the reader. We have followed a suggestion from reviewer 1 and now present all experiments characterizing mitotic spindle phenotypes and how they can be suppressed consecutively in Figures 2-5 and then finish the manuscript with the characterization of the spindle orientation phenotype. This way of ordering by biological pathway allows for a better flow of the manuscript.

      Throughout the text, we have added citations to better indicate the previous state of knowledge and how the presented experiments either confirm or extend the previous findings in the field. This helps to put our current study better into and overall perspective.

      In addition, we have addressed the specific points raised by both reviewers in full. Please see below our point-by-point answer.

      Reviewer1

      There is already a huge body of published information on mitotic spindle positioning via the Kar9 and dynein pathways that grew since the late 1990s. The genetic relationships and molecular interactions between the components of these 2

      pathways are well studied (many studies, including Liakopoulos et al. 2003, are not cited by the authors). The authors

      should make sure to cite and compare to the relevant primary literature when they report findings that have been

      described before. This will help to distinguish novel findings from validation of previous results.

      We have added relevant citations throughout the manuscript, please see below.

      "The strict dependence of Kar9 and Cik1-Kar3 on the presence of Bim1, as well as the different effects of bim1Δ on

      nuclear and cytoplasmic Bik1, may reflect the formation of stable complexes between Bim1 and these binding partners in

      cells." I believe this has already been shown (Kumar et al., 2021 and Manatschal et al., 2016). There are several other

      instances as well where additional literature should be cited, for example Gardner et al., 2008 and Gardner et al. 2014.

      We have now cited the Manatschal and Kumar papers in this section of the revised manuscript. We have also cited the mentioned Gardner papers later in the manuscript.

      The selection of targets to study in figure 1 doesn't seem to follow the listed criteria. Many proteins included in the

      study were not found by IP-MS, but some perfect targets according to the listed criteria like Duo1 were not included in the

      study. In addition, there are more sophisticated ways of finding Bim1 binding motifs in the literature

      (https://doi.org/10.1016/j.cub.2012.07.047). I suggest, the authors declare that they rationally chose to study 21 proteins

      of interest but remove the claim that their approach was systematic.

      We have changed the wording accordingly and removed the claim of systematic target selection.

      Much of the microscopy data was acquired after release from alpha factor arrest. What is the reason for this

      perturbation? An exponentially growing culture should mostly consist of mitotic cells anyway. Since this treatment affects

      cell size and potentially protein levels/concentrations, testing its influence on spindle position as well as levels on MTs for

      the most relevant proteins of interest would be important to exclude introduction of artifacts.

      In principle that’s correct, but using synchronized cultures has the great advantage that mitotic timing and all the parameters associated related to it (spindle length etc.) can be quantified much better and we obtain larger N and thus get better statistics using this approach. In a typical log culture only one third of the cells are in mitosis and this entails very different states of mitosis. Observations times are limited due to fluorescent bleaching and low signal intensity. We therefore feel the benefits of alpha-factor release outweigh the problems and we compare all mutants under the same conditions.

      Some of the results obtained from bim1Δ cells are a challenge to interpret due to the wide range of processes that

      involve Bim1 and therefor the potential for many off-target effects- including a global change in microtubule dynamical

      behavior in both the cytoplasm and the nucleus that will influence the length distributions and microtubule lifetime (and

      thus number). The authors must carefully consider these caveats.

      We agree in principle and have therefore not only characterized the bim1 deletion, but also more specific bim1 mutants. We also show that some aspects of the bim1 delta phenotypes, but not others, can be rescued by different strategies.

      The results section on page 12 refers to phenotypes of kar9 delete cells with respect to Bim1-GFP on cytoplasmic

      microtubules. In the figure 3D,F I only found data for Kar9-AID, though. The authors should refer to supplementary figure

      5A or even better include quantification similar to figure 3F.

      We have corrected this in the revised text. We refer to the Kar9-AID, for which we have the quantification.

      The observation that cytoplasmic Bim1 localization depends on interaction with its cargo Kar9 (figure 3 + 7) fits into the

      model that Kumar et al (https://doi.org/10.1016/j.str.2021.06.012) proposed in which Kar9 oligomerization is required for

      its Bim1 dependent localization to microtubules. It would be valuable to point that out.

      We have now included a sentence that our findings support this model and added the respective citation.

      I don't fully understand the model proposed in Figure 5H and discussion page 26. Based on figure 5E, it does not look

      like there is a higher concentration of Bik1 along the lattice in bim1 delete. So how would Bik1 increase Kip2 processivity

      if its levels are only increased due to a MT length change? If Kip2 was not fully processive, you would rather expect to

      see less of it at the tip of a longer microtubule in bim1 delete. The model suggested by Chen et al

      (https://doi.org/10.7554/eLife.48627.001) suggests that Kip2 only gets loaded at the minus-end and processively walks

      towards the +end without falling off. Are the authors suggesting that bim1 deletion changes this behavior?

      We have rephrased this section in results and discussion and more clearly state that there is no increase in Bik1 per MT length unit in the bim1 deletion. We have amended the discussion and grant that we currently cannot explain by which molecular mechanisms Bik1 may contribute to the observed increase in Kip2 plus-end localization under conditions of a bim1 deletion.

      I don't see evidence for independent pools of Bik1 in the cytoplasm and nucleus as claimed on top of page 21. Total

      Bik1 levels on cytoplasmic microtubules seem to be well explained by their length. Please explain better or remove the

      statement.

      We have removed the respective statement from the revised manuscript.

      The experiments in supplementary figure 7B are difficult to interpret. The localization on cytoplasmic microtubules is

      different, but probably explained by the formation of Bim1 heterodimers. Therefore this experiment is difficult to interpret

      and should be removed.

      As requested, we have removed this experiment from the revised manuscript.

      top of page 24: Kar9 localization in metaphase depends exclusively on SxIP, not on LxxPTPh (Manatschal 2016). The

      paragraph should be removed as it is not supported by published data or sufficiently by the authors to merit the

      conclusion.

      We have reformulated this to avoid a misunderstanding. We merely show that in the context of the artificial GCN4 construct a fragment just including the LxxPTPh motif is sufficient for Bim1-dependent localization to microtubules in nucleus and cytoplasm. This makes no statement about localization determinants of the authentic Kar9 protein.

      Top of page 26: The genetic interactions between the Kar9 pathway and the dynein pathway were already well known

      before this work. Please reformulate accordingly.

      We have re-written this section and introduce the two pathways with the respective citations in the very beginning of the section before describing the experiments.

      page 27 second paragraph: There is no selective pressure to evolve compensation mechanisms for gene deletions. I

      suggest the authors consider that Kar9 and dynein partially redundant, with Kar9 acting to position the spindle prior to

      metaphase and dynein to maintain spindle position in the mother and bud compartments in late metaphase and

      anaphase. The authors should consider the quantitative analysis of Kar9 and dynein dependent spindle positioning

      reported in Shulist et al. 2017 and the method for analysis of spindle length and position in 3D in Meziane et al. 2021.

      We have rephrased the section on the partially redundant Kar9 and Dynein pathways. See below our answer for measuring spindle length.

      In addition, it is not clear to me which results suggest that the relocalization of Bik1 is required in the bim1 delete. Why

      would wild type levels not be sufficient for dynein pathway function? The authors have not conclusively shown that

      nuclear migration relies on upregulating the dynein pathway in bim1Δ cells. If there is no supporting data, the paragraph

      should be removed.

      In this revised manuscript we have phrased our observations more carefully and acknowledge the limitations regarding molecular insights. We present indications for increased levels of Dynein-Dynactin pathway components at plus-ends in the bim1 deletion cells, but it is indeed unclear, whether an increased Bik1 level in the cytoplasm is required to achieve this.

      Please provide more details about intensity quantification on page 35. Were these measured on sum or max

      projected stacks? What was the method of background subtraction?

      Analysed images are optical axis integration scans over 3 μm taken on a Deltavision microscope. This procedure gives a sum projection. Local background was determined for every cell by drawing a line under a signal curve derived by line scan. The background line connects regions that are still within the cell but are outside of spindle (or microtubule). We added a sentence in the materials and methods section under point 2.

      Are the spindle lengths in Figure 2E measured in 2D or 3D? Bim1 deletion might lead to more misalignment of the

      spindles in z due to inactivation of the Kar9 pathway and thus partially explain the shorter spindles. The measurements

      should therefore be performed in 3D.

      As we have used optical axis integration (OAIs) on the Deltavision microscope and obtained a sum projection of this virtual stack, the spindles were measured in 2D and we don’t have the information to measure in 3D (this would require a regular stack). We show that there are different ways to restore different aspects of spindle length with alternative strategies. These are unlikely to influence just spindle orientation. In addition, we see that Bim1 deletion has an effect on the size of a nascent bipolar spindle when spindle orientation is similar to wild-type cells. We agree that z-misalignment may affect absolute values of spindle size of Bim1 deletion in late metaphase and it would be better to measure in 3D. However, we think in this case it is unlikely to affect our conclusions in this study.

      The authors should try to shorten the text. There is a lot of redundancy between results and discussion sections.

      We have to shortened the text to avoid redundancy (before >43000 characters, now around 41000 characters, and we have decreased the number of main figures from 9 to 8.

      Data is shown that leads to conclusions that are already supported by the literature should be moved to the

      supplementary material.

      In the course of re-organizing the manuscript we have tried to do this.

      Reviewer 2:

      "Robustness of Ndc80 loading might be achieved by the coexistence of multiple kinetochore assembly pathways or

      alternatively determined by intrinsic Ndc80 properties." Wouldn't Ndc80 levels be determined by Ndc80 kinetochore

      loading, and not by end-binding proteins? This seems to be the more likely means to regulate Ndc80 levels.

      We have removed this statement from the revised manuscript.

      "Upon analyzing the associations in the cytoplasm, we found that Kar9-3xGFP foci on bud-directed cytoplasmic

      microtubules were abolished in the bim1Δ strain, consistent with earlier reports." It would be helpful if the authors

      commented on the how the localization of some of these proteins are affected by bim1Δ on the mother-directed plus

      ends. Although I understand the need to account for one class of plus end for the sake of consistency (and the distinct

      behaviors of the mother vs bud-directed plus end), the text as written leaves me wondering about the other plus end.

      We have noticed that the bim1 deletion led to the loss of asymmetric distribution on cytoplasmic microtubules for a number of components. Most prominent are Bik1, Kip2 and proteins of dynein-dynactin complex. We felt that further analysing this phenotype was beyond the scope of this study.

      "The CAP-Gly domain construct, expressed from a BIM1 promoter, almost exclusively localized to the spindle of yeast

      cells." For clarity, the authors should explicitly state that the CAP-Gly domain in question is from Bik1. Although this can

      be deduced, this was not abundantly clear.

      We have clarified this in the text and in the figure.

      "In addition to Ase1, we followed the kinetochore proteins Ndc80-GFP and Sgo1-GFP which specifically marks

      kinetochores that lack tension." This sentence should add "the latter of which..." to clarify that SgoI, but not Ndc80

      exhibits this behavior.

      We have added the phrase “the latter of which” to clarify this point.

      "We observed that bim1Δ cells had mispositioned kinetochores with a bright Sgo1-GFP signal that was much stronger

      than in wild-type cells." I don't see the mispositioned kinetochores described here. Are the authors referring to the fact

      that Sgo1 is brighter, which suggests tension-free KTs? If so, this should be clearly stated as such, since the authors are

      not explicitly assessed kinetochore "positioning".

      We have rephrased the sentence to clarify. We refer to a lack of bi-lobed Ndc80 signal and a bright Sgo1-GFP signal as two aspects of the phenotype.

      "We speculate that Bim1-Bik1 in a complex with its cargo Cik1-Kar3 is active after bi-polar spindle formation but before

      late metaphase and Ase1 can partially substitute for nuclear Bim1 functions." I struggled to grasp the reasoning for these

      conclusions. I assume the former point (the timing for Bim1-Bik1-Cik-Kar3) is due to the localization dynamics of Bim1

      and Bik1, while the latter (Ase1 can substitute for Bim1) is due to the synthetic interaction between Bim1 and Ase1 (I

      needed to look this latter point up myself). Or is this latter point due to the brighter spindle Ase1-GFP intensity? In either

      case, the authors should more clearly state their reasoning.

      We have clarified this statement in the revised discussion.

      The error bars in Figures 3A and 6E (shown as 95% CI) and elsewhere seem very small for the parameters that are

      being plotted. Spindle length values as shown in Figure 2E cover a broad range (as would be expected for a biological

      process), and it would be more accurate if the error bars in Fig 3A and 6E reflect this, even if it means they start

      overlapping each other. I find the error as shown to be misleading to your readers, and unless the authors have very

      good reason to use 95% CI (which is not as meaningful as standard deviation), then I would encourage them to use

      standard deviation.

      We prefer to use CI for the spindle length plots over time for consistency reason and to avoid overlap, which would make the graphs difficult to read. We have changed the text to provide the standard deviation instead of the standard error of the mean for spindle length and metaphase duration, see point below.

      The same is true for the values stated throughout the text (e.g., for mitotic timing "47{plus minus}2 min" for metaphase

      duration; for distance between SPB and bud neck {plus minus} 0.1 μm, etc). I am highly skeptical that metaphase

      duration (for example) ranged from only 46-48 minutes. Please use standard deviation to describe a more accurate

      description of the range of values for these parameters.

      In the revised manuscript, we now give the mean values plus/minus standard deviation, instead of the standard error of the mean, as requested. In addition, the range of values is directly visible from the individual data points in the plots.

      "Unexpectedly, the kar9 deletion mutant displayed a slightly accelerated metaphase progression relative to wild-type

      cells (26{plus minus}1 min) (Figure 3C). This could be attributed to an increased level of Bim1 on the metaphase spindle

      of kar9Δ (or Kar9-AID) cells." The authors should give us more rationale to explain the "attributing the increased levels of

      Bim1" point here. Do they think that the levels of spindle-associated Bim1 impact metaphase duration somehow? If so,

      how?

      We have added a sentence, speculating about how this could be accomplished.

      "Overall, our cell biology data suggested that major nuclear Bim1 functions are conducted in a complex with Cik1-

      Kar3, while Bik1 and Kar9 have a smaller impact, probably affecting the nuclear- cytoplasmic distribution of Bim1."

      Although I understand and agree with the former conclusion (that Bim1 functions are conducted via Cik1-Kar3"), the latter

      was confusing to me. Did the authors mean that "Bim1 impacts Bik1 and Kar9 to a lesser extent", rather than vice versa?

      The authors are discussing Bim1 functioning via Cik1, but then switch to discussing how Bik1 and Kar9 affect Bim1.

      We have removed the second part of the sentence from the revised manuscript.

      "Next, we compared the comparing genetic interaction profile of a bim1 deletion to that of various other factors by reanalyzing the synthetic genetic interaction data..." Remove "comparing".

      Thanks for pointing out this typo, we have removed it in the revised manuscript.

      As someone who is unfamiliar with the analysis shown in Figure 3H, I think it would be useful to list a Pearson

      correlation value for two genes that are not functionally related. This would help define a lower limit for this analysis.

      For functionally unrelated genes the Pearson correlation between genetic interaction (GI) profiles is very close to zero. The graph below depicts Pearson correlation between GI profile of Bim1 and GIs of every yeast gene (data used for graph is taken from thecellmap.org).

      The axes for the plots in Figure 5E and 5I are very confusing to me. I don't understand what I'm looking at. Why does

      it go from 0 to 1, and then back to 0-1 again? I don't see how this can account for MTs of different lengths. Normalizing all MT length values to 1 would do this, no?

      We have clarified the labelling in the revised manuscript. The x-axis gives the relative position from either the plus-end, or the Spindle pole body (both set to position 0) in micrometres. This allowed us to compare fluorescent intensities on cytoplasmic microtubules of different lengths in wild-type and bim1 delete.

      "These observations are consistent with the idea that Bik1 acts as a processivity factor for Kip2: If more Bik1 is

      present on the lattice, then more Kip2 molecules are able to reach plus-ends without detachment." Perhaps I'm

      misunderstanding the plot shown in Figure 5E, but it seems to indicate that the levels of lattice-bound Bik1 are the same

      in BIM1 and bim1Δ cells (higher SPB-localized levels, though). There are also lower levels of Bik1 at the plus ends in

      bim1Δ cells. So, if Bik1 were a processivity factor for Kip2, this would suggest that they would remain bound at plus ends

      as well, which these data suggest is not the case…

      We have added a section to the discussion that deals with this point and we speculate about the reasons why Kip2 is increased at plus-ends, while Bik1 is not.

      "The data on the CH-Cik1 fusion is very compelling, and indeed supports their hypothesis that Bim1's main role in the

      nucleus is to target Cik1 to the spindle MT plus ends. That being said, it would be a simple, but important task to ensure

      that this fusion behaves as suggested (restores Cik1 plus end binding in cells). Otherwise, it can't' be ruled out that this

      fusion is rescuing bim1Δ functions by some other means. However, as stated above, it's unclear how much was already

      known about this fusion from the lab's previous work.

      In our previous study (Kornakov et al., 2020) we have shown that the CH-Cik1Delta74 fusion indeed is sufficient to enrich Kar3 at plus ends. We expect the same to be true for this slightly different fusion construct. We have added a respective sentence to the results section.

      Regarding the p1-p6 promoter data: p6 is missing from Figure S6A, in spite of it being referenced in the text and the

      figure.

      Thanks for pointing this out, we have corrected that in the revised manuscript and do not refer to p6 anymore.

      "Exogenously expressed Ase1 displayed a similar level and kinetics of localization compared to the endogenous

      protein, indicating that binding sites for microtubule crosslinkers are not a limiting factor on the budding yeast spindle."

      Specifically, the authors show that binding sites for Ase1 may not be limiting (the overlapping 95% CI bars if Fig S6B

      suggest this is not significant), not all crosslinkers. The authors should not use such broad language to describe results

      from one experiment with one crosslinker.

      We have rephrased to make clear that our statement only refers to Ase1.

      "We found that all bim1 mutants were less well recruited to the metaphase spindle compared to the wild-type protein,

      indicating that Bim1-interacting proteins strongly contribute to Bim1 localization." Can the authors rule out the defects in

      localization of these mutants is not compromised MT binding by the Bim1 mutants? Also, regarding this statement: "To

      test that the observed recruitment defects of bim1 mutants are not a result of a compromised spindle or microtubule

      structure, we examined their localization in a situation when GFP-tagged mutants were covered with the unlabeled wildtype

      allele. Indeed, in this situation, the Bim1 mutants displayed very similar localization profiles (Supplementary Figure

      7B)." I wasn't sure what these results were similar to: the wild-type protein, or the mutant without the presence of WT

      Bim1? The lack of quantitation made this difficult to determine.

      At the request of reviewer 1, we have removed the analysis of Bim1-GFP mutants over an unlabelled Bim1 wild-type from the manuscript.

      The zoom crops for many of the images (Fig 1F and C, 3D, 5J, etc) are not labeled. I realize the legends indicated

      what was what, but it would be much easier for the reader if these panels were labeled in the figure.

      We have indicated the channel by a respective frame around the zoom throughout the manuscript. We think this makes orientation easier.

      "While in vitro reconstitution experiments have suggested that Bim1 is required to fully reconstitute the Kip2-

      dependent loading of the Dynein-Dynactin complex to microtubule-plus ends in vitro (Roberts et al., 2014), our

      experiments indicate that it may contribute relatively little to this pathway in cells." Work from other labs have also shown

      Bim1 is dispensable for dynein function in cells. This should be noted by the authors, and the appropriate work cited (see

      work from Lee and Pellman labs. In fact work from the Lee lab showed that Kip2 is dispensable for plus end binding of

      dynein).

      We have re-written this section and now also refer to the Markus 2009 paper (Wei-Lih Lee lab).

      References are missing throughout the text. I have listed a few examples below:

      "We have previously shown that the phenotype of Bim1-binding deficient Cik1 mutants can be rescued by fusing the

      CH-domain to this Cik1 mutant (cik1-Δ74)."

      We have listed the citation of our 2020 paper (Kornakov et al.)

      "We constructed a series of strains expressing an extra copy of Ase1-GFP under different constitutive promoters of

      increasing strength (p1 to p6)"; where did these promoters come from?

      They were selected based on a systematic analysis of promoter strength in Shaw et al., 2019, DOI: 10.1016/j.cell.2019.02.023 . We have added that citation to the methods section.

      "double point mutation exchanging two conserved residues in the EBH domain (bim1 Y220A E228A) is predicted to

      eliminate all EBH-dependent cargo interactions, but does not affect protein dimerization."

      We have cited the Honnapa 2009 paper here.

      "A deletion of the terminal five amino acids is predicted to prevent binding of the CAP-Gly domain of Bik1 to Bim1. The

      combination of both mutations is expected to simultaneously prevent both types of interaction."

      We have cited the Stangier 2018 paper here.

      "Spindle positioning in budding yeast is achieved via two pathways, one relying on the protein Kar9 which interacts

      with the actin-based motor Myo2." Yin et al 2000 should be added (in addition to Hwang et al).

      We have now included the Yin et al. 2000 citation.

      "For nuclear migration to occur efficiently, the Dynein-Dynactin complex must be enriched at the plus-ends of

      cytoplasmic microtubules..." Should cite work from the Lee lab here.

      We now cite Markus and Lee, 2011 as an example.

      "These long microtubules can interact with the bud cortex and initiate pulling events to move the nucleus (Omer et al.,

      2018)." Many papers pre-dating the Omer study found this to the case, including work from the Cooper lab (see Adames

      et al). These studies should be cited either in place of the Omer study, or in addition.

      We have cited additional studies besides the Omer paper.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      The authors of the study performed a systematic assessment of the role of Bim1 in the MT-binding activity and function of a large number of nuclear and cytoplasmic MT-associated proteins (MAPs), as well as their role during mitosis and spindle positioning. For example, they find that the reliance of MT-binding activity of several MAPs varies from complete reliance on Bim1, to almost no role (in some cases, loss of Bim1 even increases MAP-MT binding). The density and quality of the data, and the large number of players analyzed by the study, are certainly impressive, and there is no doubt a lot of valuable information contained within that will be of use to many people in the MAP/mitosis/yeast cell biology community. However, I feel the manuscript can be greatly improved following some significant revisions. In particular, although some of their findings are indeed interesting and useful, and can be used to reliably draw conclusions, it is difficult to parse out what is novel, and what is a rehashing of old data. For instance, the role of Bim1 in Bik1/Kip2 targeting was described years (Carvalho et al), and I was surprised to see that the CH-Cik1 fusion was previously described by the authors' lab a couple years ago (see note below regarding lack of appropriate citations and lack of description of previous knowledge). Also, how much did we already know about the Bim1 truncations shown in Figure 7 and S7, and how they might disrupt binding to partners? Finally, regarding this statement in the Discussion: "Our analysis indicates that Bim1 contributes to both of these processes as part of two key protein complexes (Figure 9A): Bim1-Kar9-Myo2 in the cytoplasm and Bim1- Bik1-Cik1-Kar3 in the nucleus." As far as I know, these things have been known for many years; their work might help to support these findings, but the statement as written misleads the readers in to believing the present work proves these old concepts.

      One of the main issues with reading a manuscript with so much data about so many different players and pathways is that this leads to a situation in which each story is only superficially covered, with only minimal depth or detail. This made the paper somewhat difficult for me to follow (and I am a fan of budding yeast mitosis!), especially given the frequent switching from one pathway to another (e.g., the Cik1 section started on page 12 appears to be continued on page.17, only after talking about the spindle orientation story in between the two Cik1 sections). I'm not sure what to suggest, but the manuscript can be improved if the authors try to refocus some of the sections to make it easier to follow one story at a time, for a particular molecule (e.g., Cik1) or pathway (spindle orientation). In addition to explicitly describing what is already known about a particular molecule/pathway, the writing can be greatly improved by introducing their reasoning for the experiments in question. Some of the sections lack sufficient rationale for me to understand the justification for their experiments (e.g., why try to overexpress Ase1 to rescue bim1∆ phenotypes, as described on page 19?).

      Although there is likely much to learn from this study, I felt that some conclusions were a little bold (see below), while alternative hypotheses were not addressed (perhaps Bim1 simply competes for MT binding with some of these factors, thus accounting for them increasing their spindle-binding behavior?). For example, the authors make a point that loss of Bim1 enhances dynein-dynactin function. However, it is important to note that mutations in tubulin (tub2-430∆) and other MAPs (Kar9 or Ase1, the latter of which the authors point out) also lead to increased dynein activity (see work by Yeh et al., 2000, and work from the Moore lab). It is unknown whether mutations to these genes affect dynein targeting in cells similar to what the authors describe here. Thus, a direct causal relationship between their bim1∆ phenotypes and enhanced dynein activity is unclear, and at best is speculative. It's also worth noting that overexpression of Bik1 has been shown to actually reduce Dhc1 localization to plus ends in cells (see Markus et al 2011), which would argues against a simple mechanism of increasing Bik1 correlating with increasing dynein localization and activity.

      Below are some specific points.

      1. "Robustness of Ndc80 loading might be achieved by the coexistence of multiple kinetochore assembly pathways or alternatively determined by intrinsic Ndc80 properties." Wouldn't Ndc80 levels be determined by Ndc80 kinetochore loading, and not by end-binding proteins? This seems to be the more likely means to regulate Ndc80 levels.
      2. "Upon analyzing the associations in the cytoplasm, we found that Kar9-3xGFP foci on bud-directed cytoplasmic microtubules were abolished in the bim1Δ strain, consistent with earlier reports." It would be helpful if the authors commented on the how the localization of some of these proteins are affected by bim1∆ on the mother-directed plus ends. Although I understand the need to account for one class of plus end for the sake of consistency (and the distinct behaviors of the mother vs bud-directed plus end), the text as written leaves me wondering about the other plus end.
      3. "The CAP-Gly domain construct, expressed from a BIM1 promoter, almost exclusively localized to the spindle of yeast cells." For clarity, the authors should explicitly state that the CAP-Gly domain in question is from Bik1. Although this can be deduced, this was not abundantly clear.
      4. "In addition to Ase1, we followed the kinetochore proteins Ndc80-GFP and Sgo1-GFP which specifically marks kinetochores that lack tension." This sentence should add "the latter of which..." to clarify that SgoI, but not Ndc80 exhibits this behavior.
      5. "We observed that bim1Δ cells had mispositioned kinetochores with a bright Sgo1-GFP signal that was much stronger than in wild-type cells." I don't see the mispositioned kinetochores described here. Are the authors referring to the fact that Sgo1 is brighter, which suggests tension-free KTs? If so, this should be clearly stated as such, since the authors are not explicitly assessed kinetochore "positioning".
      6. "We speculate that Bim1-Bik1 in a complex with its cargo Cik1-Kar3 is active after bi-polar spindle formation but before late metaphase and Ase1 can partially substitute for nuclear Bim1 functions." I struggled to grasp the reasoning for these conclusions. I assume the former point (the timing for Bim1-Bik1-Cik-Kar3) is due to the localization dynamics of Bim1 and Bik1, while the latter (Ase1 can substitute for Bim1) is due to the synthetic interaction between Bim1 and Ase1 (I needed to look this latter point up myself). Or is this latter point due to the brighter spindle Ase1-GFP intensity? In either case, the authors should more clearly state their reasoning.
      7. The error bars in Figures 3A and 6E (shown as 95% CI) and elsewhere seem very small for the parameters that are being plotted. Spindle length values as shown in Figure 2E cover a broad range (as would be expected for a biological process), and it would be more accurate if the error bars in Fig 3A and 6E reflect this, even if it means they start overlapping each other. I find the error as shown to be misleading to your readers, and unless the authors have very good reason to use 95% CI (which is not as meaningful as standard deviation), then I would encourage them to use standard deviation.
      8. The same is true for the values stated throughout the text (e.g., for mitotic timing "47{plus minus}2 min" for metaphase duration; for distance between SPB and bud neck {plus minus} 0.1 µm, etc). I am highly skeptical that metaphase duration (for example) ranged from only 46-48 minutes. Please use standard deviation to describe a more accurate description of the range of values for these parameters.
      9. "Unexpectedly, the kar9 deletion mutant displayed a slightly accelerated metaphase progression relative to wild-type cells (26{plus minus}1 min) (Figure 3C). This could be attributed to an increased level of Bim1 on the metaphase spindle of kar9Δ (or Kar9-AID) cells." The authors should give us more rationale to explain the "attributing the increased levels of Bim1" point here. Do they think that the levels of spindle-associated Bim1 impact metaphase duration somehow? If so, how?
      10. "Overall, our cell biology data suggested that major nuclear Bim1 functions are conducted in a complex with Cik1- Kar3, while Bik1 and Kar9 have a smaller impact, probably affecting the nuclear- cytoplasmic distribution of Bim1." Although I understand and agree with the former conclusion (that Bim1 functions are conducted via Cik1-Kar3"), the latter was confusing to me. Did the authors mean that "Bim1 impacts Bik1 and Kar9 to a lesser extent", rather than vice versa? The authors are discussing Bim1 functioning via Cik1, but then switch to discussing how Bik1 and Kar9 affect Bim1.
      11. "Next, we compared the comparing genetic interaction profile of a bim1 deletion to that of various other factors by re-analyzing the synthetic genetic interaction data..." Remove "comparing".
      12. As someone who is unfamiliar with the analysis shown in Figure 3H, I think it would be useful to list a Pearson correlation value for two genes that are not functionally related. This would help define a lower limit for this analysis.
      13. The axes for the plots in Figure 5E and 5I are very confusing to me. I don't understand what I'm looking at. Why does it go from 0 to 1, and then back to 0-1 again? I don't see how this can account for MTs of different lengths. Normalizing all MT length values to 1 would do this, no?
      14. "These observations are consistent with the idea that Bik1 acts as a processivity factor for Kip2: If more Bik1 is present on the lattice, then more Kip2 molecules are able to reach plus-ends without detachment." Perhaps I'm misunderstanding the plot shown in Figure 5E, but it seems to indicate that the levels of lattice-bound Bik1 are the same in BIM1 and bim1∆ cells (higher SPB-localized levels, though). There are also lower levels of Bik1 at the plus ends in bim1∆ cells. So, if Bik1 were a processivity factor for Kip2, this would suggest that they would remain bound at plus ends as well, which these data suggest is not the case.
      15. "The data on the CH-Cik1 fusion is very compelling, and indeed supports their hypothesis that Bim1's main role in the nucleus is to target Cik1 to the spindle MT plus ends. That being said, it would be a simple, but important task to ensure that this fusion behaves as suggested (restores Cik1 plus end binding in cells). Otherwise, it can't' be ruled out that this fusion is rescuing bim1∆ functions by some other means. However, as stated above, it's unclear how much was already known about this fusion from the lab's previous work.
      16. Regarding the p1-p6 promoter data: p6 is missing from Figure S6A, in spite of it being referenced in the text and the figure.
      17. "Exogenously expressed Ase1 displayed a similar level and kinetics of localization compared to the endogenous protein, indicating that binding sites for microtubule crosslinkers are not a limiting factor on the budding yeast spindle." Specifically, the authors show that binding sites for Ase1 may not be limiting (the overlapping 95% CI bars if Fig S6B suggest this is not significant), not all crosslinkers. The authors should not use such broad language to describe results from one experiment with one crosslinker.
      18. "We found that all bim1 mutants were less well recruited to the metaphase spindle compared to the wild-type protein, indicating that Bim1-interacting proteins strongly contribute to Bim1 localization." Can the authors rule out the defects in localization of these mutants is not compromised MT binding by the Bim1 mutants? Also, regarding this statement: "To test that the observed recruitment defects of bim1 mutants are not a result of a compromised spindle or microtubule structure, we examined their localization in a situation when GFP-tagged mutants were covered with the unlabeled wild-type allele. Indeed, in this situation, the Bim1 mutants displayed very similar localization profiles (Supplementary Figure 7B)." I wasn't sure what these results were similar to: the wild-type protein, or the mutant without the presence of WT Bim1? The lack of quantitation made this difficult to determine.
      19. The zoom crops for many of the images (Fig 1F and C, 3D, 5J, etc) are not labeled. I realize the legends indicated what was what, but it would be much easier for the reader if these panels were labeled in the figure.
      20. "While in vitro reconstitution experiments have suggested that Bim1 is required to fully reconstitute the Kip2- dependent loading of the Dynein-Dynactin complex to microtubule-plus ends in vitro (Roberts et al., 2014), our experiments indicate that it may contribute relatively little to this pathway in cells." Work from other labs have also shown Bim1 is dispensable for dynein function in cells. This should be noted by the authors, and the appropriate work cited (see work from Lee and Pellman labs. In fact work from the Lee lab showed that Kip2 is dispensable for plus end binding of dynein).
      21. References are missing throughout the text. I have listed a few examples below:
        • a. "We have previously shown that the phenotype of Bim1-binding deficient Cik1 mutants can be rescued by fusing the CH-domain to this Cik1 mutant (cik1-Δ74)."
        • b. "We constructed a series of strains expressing an extra copy of Ase1-GFP under different constitutive promoters of increasing strength (p1 to p6)"; where did these promoters come from?
        • c. "double point mutation exchanging two conserved residues in the EBH domain (bim1 Y220A E228A) is predicted to eliminate all EBH-dependent cargo interactions, but does not affect protein dimerization."
        • d. "A deletion of the terminal five amino acids is predicted to prevent binding of the CAP-Gly domain of Bik1 to Bim1. The combination of both mutations is expected to simultaneously prevent both types of interaction."
        • e. "Spindle positioning in budding yeast is achieved via two pathways, one relying on the protein Kar9 which interacts with the actin-based motor Myo2." Yin et al 2000 should be added (in addition to Hwang et al).
        • f. "For nuclear migration to occur efficiently, the Dynein-Dynactin complex must be enriched at the plus-ends of cytoplasmic microtubules..." Should cite work from the Lee lab here.
        • g. "These long microtubules can interact with the bud cortex and initiate pulling events to move the nucleus (Omer et al., 2018)." Many papers pre-dating the Omer study found this to the case, including work from the Cooper lab (see Adames et al). These studies should be cited either in place of the Omer study, or in addition.

      Referees cross-commenting

      It seems that one of my major concerns is reflected in Reviewer #1's review: that a lot of the findings described in the manuscript have been published elsewhere, and are not novel. In spite of this, I do think there are useful data in this manuscript that make this an important contribution, and that it should definitely be published. However, this would first require a significant re-writing with appropriate description of known vs unknown, and additional citations.

      Significance

      The current study aims to clarify the role of Bim1 (EB1 homolog in budding yeast) in the various pathways in which it has been implicated. To achieve this aim, the authors assess the localization of numerous other microtubule-associated proteins in cells with and without Bim1. In addition to high quality localization data (e.g., intensity values), the authors perform a number of cell biological assessments (e.g., mitotic spindle length values before, during and after anaphase), genetic assessments (synthetic interaction assays), and in vitro binding assays. The current study is indeed rich with new insights into the mechanisms by which these molecules function, and will no doubt prove valuable to a number of people in the microtubule/motor/yeast mitosis fields. As someone who is interested in and studies mitosis in budding yeast, I found the study to be interesting.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Kornakov and Westermann provide a comprehensive analysis of the functions of microtubule +end binding proteins (+TIPs) in budding yeast. Bim1 is the EB1 ortholog of budding yeast and serves as a scaffold for other +TIPs. As Bim1 is not essential for cell viability, the authors could use a deletion of Bim1 to evaluate the global loss of function of +TIP proteins on cellular processes involving microtubules in the nucleus and the cytoplasm. During mitosis Bim1 functions almost exclusively in two previously characterized complexes with different functions: 1. The Kar9-Bim1-Bik1 complex which mediates spindle positioning at the bud neck in metaphase and 2. The Kar3-Cik1-Bik1-Bim1 complex which functions in spindle assembly and spindle elongation. Much is already known about Bim1's function in spindle positioning e.g. =TIPs on cytoplasmic microtubules, but the authors provide new insights into Kar9-Bim1 co-dependence in localization to cytoplasmic microtubules and how in turn affects localization of Bik1 and Kip2, both of which act in the dynein dependent spindle positioning pathway. The role of Bim1 in spindle assembly has also been characterized previously. The authors show how Bim1 is required to recruit the kinesin-14 Cik1/Kar3 to mitotic spindles, which interactions are involved, and that spindle elongation is delayed in its absence. Unfortunately, there is considerable overlap between their results and the published literature, and the impact of their finding is therefore reduced. The strength of this manuscript lies in its comprehensive analysis of Bim1 function , the quality of the results and that the experiments are generally well controlled and interpreted.

      Major points:

      1. There is already a huge body of published information on mitotic spindle positioning via the Kar9 and dynein pathways that grew since the late 1990s. The genetic relationships and molecular interactions between the components of these 2 pathways are well studied (many studies, including Liakopoulos et al. 2003, are not cited by the authors). The authors should make sure to cite and compare to the relevant primary literature when they report findings that have been described before. This will help to distinguish novel findings from validation of previous results.
      2. "The strict dependence of Kar9 and Cik1-Kar3 on the presence of Bim1, as well as the different effects of bim1Δ on nuclear and cytoplasmic Bik1, may reflect the formation of stable complexes between Bim1 and these binding partners in cells." I believe this has already been shown (Kumar et al., 2021 and Manatschal et al., 2016). There are several other instances as well where additional literature should be cited, for example Gardner et al., 2008 and Gardner et al. 2014.
      3. The selection of targets to study in figure 1 doesn't seem to follow the listed criteria. Many proteins included in the study were not found by IP-MS, but some perfect targets according to the listed criteria like Duo1 were not included in the study. In addition, there are more sophisticated ways of finding Bim1 binding motifs in the literature (https://doi.org/10.1016/j.cub.2012.07.047). I suggest, the authors declare that they rationally chose to study 21 proteins of interest but remove the claim that their approach was systematic.
      4. Much of the microscopy data was acquired after release from alpha factor arrest. What is the reason for this perturbation? An exponentially growing culture should mostly consist of mitotic cells anyway. Since this treatment affects cell size and potentially protein levels/concentrations, testing its influence on spindle position as well as levels on MTs for the most relevant proteins of interest would be important to exclude introduction of artifacts.
      5. Some of the results obtained from bim1Δ cells are a challenge to interpret due to the wide range of processes that involve Bim1 and therefor the potential for many off-target effects- including a global change in microtubule dynamical behavior in both the cytoplasm and the nucleus that will influence the length distributions and microtubule lifetime (and thus number). The authors must carefully consider these caveats.

      Minor points:

      1. The results section on page 12 refers to phenotypes of kar9 delete cells with respect to Bim1-GFP on cytoplasmic microtubules. In the figure 3D,F I only found data for Kar9-AID, though. The authors should refer to supplementary figure 5A or even better include quantification similar to figure 3F.
      2. The observation that cytoplasmic Bim1 localization depends on interaction with its cargo Kar9 (figure 3 + 7) fits into the model that Kumar et al (https://doi.org/10.1016/j.str.2021.06.012) proposed in which Kar9 oligomerization is required for its Bim1 dependent localization to microtubules. It would be valuable to point that out.
      3. I don't fully understand the model proposed in Figure 5H and discussion page 26. Based on figure 5E, it does not look like there is a higher concentration of Bik1 along the lattice in bim1 delete. So how would Bik1 increase Kip2 processivity if its levels are only increased due to a MT length change? If Kip2 was not fully processive, you would rather expect to see less of it at the tip of a longer microtubule in bim1 delete. The model suggested by Chen et al (https://doi.org/10.7554/eLife.48627.001) suggests that Kip2 only gets loaded at the minus-end and processively walks towards the +end without falling off. Are the authors suggesting that bim1 deletion changes this behavior?
      4. I don't see evidence for independent pools of Bik1 in the cytoplasm and nucleus as claimed on top of page 21. Total Bik1 levels on cytoplasmic microtubules seem to be well explained by their length. Please explain better or remove the statement.
      5. The experiments in supplementary figure 7B are difficult to interpret. The localization on cytoplasmic microtubules is different, but probably explained by the formation of Bim1 heterodimers. Therefore this experiment is difficult to interpret and should be removed.
      6. top of page 24: Kar9 localization in metaphase depends exclusively on SxIP, not on LxxPTPh (Manatschal 2016). The paragraph should be removed as it is not supported by published data or sufficiently by the authors to merit the conclusion.
      7. Top of page 26: The genetic interactions between the Kar9 pathway and the dynein pathway were already well known before this work. Please reformulate accordingly.
      8. page 27 second paragraph: There is no selective pressure to evolve compensation mechanisms for gene deletions. I suggest the authors consider that Kar9 and dynein partially redundant, with Kar9 acting to position the spindle prior to metaphase and dynein to maintain spindle position in the mother and bud compartments in late metaphase and anaphase. The authors should consider the quantitative analysis of Kar9 and dynein dependent spindle positioning reported in Shulist et al. 2017 and the method for analysis of spindle length and position in 3D in Meziane et al. 2021.
      9. In addition, it is not clear to me which results suggest that the relocalization of Bik1 is required in the bim1 delete. Why would wild type levels not be sufficient for dynein pathway function? The authors have not conclusively shown that nuclear migration relies on upregulating the dynein pathway in bim1Δ cells. If there is no supporting data, the paragraph should be removed.
      10. Please provide more details about intensity quantification on page 35. Were these measured on sum or max projected stacks? What was the method of background subtraction?
      11. Are the spindle lengths in Figure 2E measured in 2D or 3D? Bim1 deletion might lead to more misalignment of the spindles in z due to inactivation of the Kar9 pathway and thus partially explain the shorter spindles. The measurements should therefore be performed in 3D.
      12. The authors should try to shorten the text. There is a lot of redundancy between results and discussion sections.
      13. Data is shown that leads to conclusions that are already supported by the literature should be moved to the supplementary material.

      Referees cross-commenting

      I am in agreement with reviewer 2

      Significance

      The role of Bim1 in the Kar9 spindle positioning pathway and in recruiting Kar3/Cik1 to spindles have been extensively characterized in previous publications, however this manuscript adds mechanistic insight into what interactions are essential for localization, what happens to other proteins that have not previously been studied in the context of Bim1 and what are the exact consequences of Bim1 loss with some explanation for the outcomes. Some data presented here was expected from previous work, but never experimentally confirmed and these findings should be the focus of the manuscript. While the manuscript does not provide a huge conceptual advancement, the findings of this comprehensive analysis are of great value to the microtubule field, especially for people working in budding yeast.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      We would like to thank the reviewers for their thorough and positive assessment of our work. We also thank them for their careful review of our manuscript. Our responses to their specific comments are provided in the lines below.

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      Summary:

      The manuscript entitled „Metastatic potential in clonal melanoma cells is driven by a rare, early-invading subpopulation" by Kaur and colleagues provides a phenotypical analysis of the invasive potential of established melanoma cell lines on single cell level. The aim of the study was to answer the question if even homologous tumor cells bear the intrinsic potential to give rise to cells with high invasive (and therefore potentially metastatic) capacity in absence of selection pressure from the tumor microenvironment.

      The authors used clones from two different melanoma cell lines (to prevent the accumulation of random (epi)genetic changes during cultivation) and performed invasion assays with Matrigel-coated transwell inlays to differentiate between cells that were able to invade early (up to 8 h, approx. 1% of the total cell population) or late (8-24 h; approx. 3% of the total cell population) after plating. Comparative RNA sequencing of early invaders and non-invaders populations revealed a high expression of SEMA3C in early invaders, which was then established as marker in the used cell lines. Interestingly, in vivo models using NSG mice injected with a mixture of early and late invading melanoma cells revealed that both contributed similarly to the primary tumor, while metastatic cells in the lung consisted almost exclusively of early invaders. Subsequent ATAC sequencing revealed an increase of binding sites for the transcription factor NKX2.2 in the early invaders. Functional analyses revealed that a knockout of NKX2.2. led to an increase in both invasion and proliferation. Finally, the authors showed with different sorted early and late invaders as well as SEMA3Chigh and SEMA3Clow expressers that pro-invasive features go along with reduced proliferation potential in accordance to previously published data. However, they decrease with time, thus demonstrating a reversion of the phenotype and high plasticity.

      Major comments:

      In general, the paper contains novel and interesting data, is concisely written and supported by replicates. The key conclusion, the presence of a small proportion of highly invasive cells in a seemingly homologous cell population and their striking requirement for lung metastasis, is very convincing. In vitro, SEMA3C was confirmed as a marker for the early invaders in two independent cell lines. However, a few questions remain open, as detailed below:

      We thank the reviewer for their positive assessment of our work. We also thank them for their careful review of our manuscript. Our responses to their specific comments are provided in the lines below.

      1) The relevance of NKX2.2 in the early invaders is currently unclear to me.

      The ATAC sequencing data revealed a high enrichment of accessible NKX2.2 binding sites in early invaders, and data were tested by comparative RNA sequencing of control cells and cells with NKX2.2 ko (Figure 2). The Figure legend of Figure 2 says: "NKX2.2 is a transcription factor that promotes the invasive subpopulation", but the data don`t support this (ko leads to reduced invasion). Accordingly, the authors also state in the Results part "... the direction of the effect is the opposite of what one might have expected".

      To set the role of NKX2.2 into context, it would be useful to confirm the actual involvement of NFX2.2 in the invasive phenotype and clarify if NFX2.2. might probably even suppress some pro-invasive genes. I would advise to investigate the protein levels and/or protein localization of NFX2.2 and probably perform ChIp experiments on selected pro-invasive genes that play a role in the early invaders.

      The reviewer has raised some excellent points about our studies of NKX2.2 and its role in invasion. Indeed, we were also surprised by the fact that NKX2.2 had the opposite effect as expected (its peaks are enriched for accessibility in the early invaders in FS4, but knockout leads to increased invasion). We elected to include the results because it was a hypothesis we tested, so in the interest of full disclosure of results, we chose to leave the result in.

      The reviewer has also made some nice suggestions about how to further explore the role of NKX2.2 in regulation (e.g. ChIP-seq). Owing to the complexity of validating and performing this assay, we felt these experiments were beyond the scope of the current manuscript; we hope to explore these possibilities more fully in the future.

      Another excellent suggestion the reviewer made was to look at the regulatory capacity of NKX2.2 to directly demonstrate the link between NKX2.2 regulation and expression differences between early- and late-invading cells. In order to establish this connection, we used a gene set from molecular signatures database (MSigDB: https://www.gsea-msigdb.org/gsea/msigdb/human/geneset/NKX2_2_TARGET_GENES.html) consisting of genes with an NKX2.2 binding site within their promoter (TSS -1000 bp to TSS +100 bp) identified by the gene transcription regulation database (GTRD–paper here: https://pubmed.ncbi.nlm.nih.gov/33231677/). We used the Fisher’s exact test to see if the overlap between these genes regulated by NKX2.2 and genes that are differentially expressed between early-invading cells versus their respective parental population in both cell lines had more overlap than one would expect by chance. Indeed, the p-values using this approach were 3.937e-16 and 0.037 for the FS4 and 1205Lu cell lines, respectively. These results, combined with the motif analysis with our ATAC-seq data, demonstrated that the activity of NKX2.2 is relevant in the early-invading state. We thank the reviewer for the suggestion and feel this additional analysis has improved our conclusions about NKX2.2.

      Also, we further checked whether NKX2.2 levels correlated in early versus late invading cells across a panel of cell lines (Fig. 2C). We found that in 4/6 of these lines, NKX2.2 expression was higher in the early invaders. These results further support the case that NKX2.2 is an important positive regulator of invasion in multiple contexts.

      “In order to establish the generality of our results, we measured NKX2.2 expression levels across multiple cell lines by single molecule mRNA FISH. We found that the early invaders had higher levels of NKX2.2 expression in four out of the 6 lines tested (Fig. 2C), demonstrating the generality of our results and strengthening the case that NKX2.2 is a potential regulator of early invasiveness. The role of NKX2.2 as a regulator of early invasiveness was further established through comparative analysis between genes with NKX2.2 promoter region binding sites (-1000 bp to +100 bp relative to the transcription start site (TSS) as annotated by the Gene Transcription Regulation Database (GTRD)) and genes differentially expressed in early-invading and parental cells. Analysis using Fisher's exact test revealed a significant overlap between GTRD annotated genes regulated by NKX2.2 and genes expressed in FS4 (****p=3.937e-16) and 1205Lu (*p=0.037) early-invading cells. These results, in complement with our results from ATAC-sequencing motif analysis, further supported the relevance of NKX2.2 regulation in the early-invading state.”

      2) The sequencing data are currently accessible via a Dropbox link. They should be deposited instead in a data repository.

      We thank the reviewer for noting this problem. We have uploaded all data to the SRA/GEO at the following links:

      https://urldefense.com/v3/https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE224772;!!IBzWLUs!SEr5DTViPf08-IBQnv0ml-CoLX3cbaiNlCz-DJbpIKm7UcVXlL9-OD9reVQJs5pm_gzeqJYC_dM-MV8DonwX4c4$

      https://urldefense.com/v3/https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE224769;!!IBzWLUs!SEr5DTViPf08-IBQnv0ml-CoLX3cbaiNlCz-DJbpIKm7UcVXlL9-OD9reVQJs5pm_gzeqJYC_dM-MV8DtY6ZB3A$

      https://urldefense.com/v3/https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE224771;!!IBzWLUs!SEr5DTViPf08-IBQnv0ml-CoLX3cbaiNlCz-DJbpIKm7UcVXlL9-OD9reVQJs5pm_gzeqJYC_dM-MV8Dq_3ghAU$

      Minor comments:

      1) The cell line used for Supplementary Figure 4 should be named in the figure legend.

      We thank the reviewer for the suggestion. We have included the name of the cell line in the figure legend for Supplementary Figure 4. The text reads as follows:

      “A. FS4 melanoma cells were sorted based on SEMA3C expression. Cells were live-imaged for ~10 days every hour and single cells were tracked manually for cell position, cell division and lineage. Lineages were traced manually from single cells. Cell speed was calculated for each cell using the average distance traveled over time.”

      2) In Figures 4H-M and Supplementary Figure 4D-I, the authors describe data performed in "sister" and "cousin" cells. It would be useful to provide a definition for both in the main text or figure legend.

      This is a very good point. We have provided the following definitions in the main text, and have changed the wording from “sister” to “sibling” to avoid gendered terminology:

      “(sibling cells are defined as those that share a common parent cell, and cousin cells are defined as those that share a common grandparent.)”

      3) Discussion: "This lack of permanence may reflect the fact that the invasive cells are not subjected to stress-in our case, cells merely pass through a transwell, which may be the reason for the "burning in" of the phenotype in the case of resistance."

      This sentence is misleading - please clarify.

      We apologize for the confusion caused by this sentence. We have now changed it to the following:

      “It is interesting that the early-invading cells eventually revert to the population average even after going through the transwell. Such a result contrasts with our previous work (Shaffer et al., 2017b), in which a rare subpopulation became permanently therapy resistant and did not revert even after several weeks off-treatment. One possibility is that the stress of undergoing therapy treatment induces a transcriptional rewiring, and this rewiring is not induced by the migration through transwells. Further studies will be required to test these hypotheses.”

      Furthermore, there are some errors in the reference to the Figures throughout the paper. These which should be corrected:

      We thank the reviewer for their detailed reading and finding these issues. We have now fixed them all in our revised manuscript.

      4) Results, section "NKX2.2 is a transcription factor that promotes the invasive subpopulation".

      Here the authors write: "...we performed RNA sequencing on the NKX2.2 knockout cells and compared the effects on gene expression to the gene expression differences between early vs. non- invaders across the two cell lines." This sentence should contain the reference to Supplementary Figure 3B-D (which is otherwise not referred to).

      We thank the reviewer for their detailed reading and noticing this issue. We have now referenced Supplementary Figure 3B-D in the text cited above.

      5) Results: "Overexpression of SEMA3C in FS4 cells revealed no changes in invasiveness, suggesting that SEMA3C is a marker with no functional relevance to invasiveness per se; Fig. 1D, Fig. 2A-B)"

      The correct reference should be: Suppl. Fig. 1D, Fig. 2A-B. Also, in the current manuscript version the authors jump from Figures 1 to Figure 2 A,B, before coming back to Figure 1. To avoid this, I would advise to shift the current Figure 2A, B to Figure 1 or the supplementary information.

      We thank the reviewer for pointing out this error in the reference to these figures. Figure 2A-B is now referenced as “Supp. Fig. 1 E-F”. The figure legend has also been updated.

      6) Results: "We then sampled lungs from mice at various times post-injection to look for metastatic cells (Fig.1F, Suppl. Fig. 2B,C)."

      As Supplementary Figure 2B, C does not show metastasis, but rather primary tumor growth, I would advise the following wording: "We then sampled lungs from mice at various times post-injection to look for metastatic cells (Fig.1F) and overall tumor growth (Suppl. Fig. 2B,C)."

      We thank the reviewer for their advice to reword the sentence cited above. We have now edited the text to read as suggested by the reviewer. In addition, Supp. Fig. 2B,C is not referenced as Supp. Fig. 2C,D.

      "We then sampled lungs from mice at various times post-injection to look for metastatic cells (Fig.1F) and overall tumor growth (Supp. Fig. 2C,D)."

      7) Results: "Interestingly, NKX2.2 knockout cells showed markedly increased invasion and proliferation (Fig. 2A,B), suggesting a change in regulation of both processes. "

      The correct reference is Fig. 2C, D.

      The reviewer is right that we only have results in one cell line, and fully agree that the results in FS4 are only correlative. We have now weakened the language in the abstract and the results to emphasize that this result held in 1205Lu cells only.

      • Given the robust literature regarding phenotypic switching in melanoma, the NKX2.2 knockout increasing both invasiveness and proliferation (figures 2C, 2D) suggests it may not be involved in phenotype switching. Perhaps NKX2.2 is a negative regulator of cell activity/metabolism. We thank the reviewer for highlighting the possible connections with metabolism. To explore this possibility , we performed metabolic assays on NKX2.2 knockout and AAVS control cells and observed no significant changes in Extracellular acidification rate (B). We did observe some differences in oxygen consumption rate in the cells (A), but the differences do not seem to be large enough or systematic enough to be meaningful given the variation within the controls. We have now included these results in Supp. Fig. 3E-F.

      Note, the data previously referenced as Figure 2C,D is now in Figure 2A,B.

      “NKX2.2 is a transcriptional repressor and activator essential for the differentiation of pancreatic endocrine cells (Habener et al., 2005). In mice, deletion of NKX2.2 prevents the specification of pancreatic islet cells resulting in the replacement of insulin-expressing β cells and glucagon-expressing α cells with ghrelin-expressing cells; This lack of specification resulted in mortality of newborn mice due to hyperglycemia (Sussel et al. 1998; Prado et al. 2004). Given the link of NKX2.2 with glucose metabolism, we wondered whether NKX2.2 had an effect on metabolic activity prompting us to test the NKX2.2 knockout lines for metabolic differences in the oxygen consumption rate (OCR; an indicator of oxidative phosphorylation) and the extracellular acidification rate (ECAR; an indicator of glycolysis) of the cells. Seahorse assay analysis revealed no systematic differences in metabolic activity (Supp. Fig. 3E,F).”

      We thank the reviewer for the correction. The reference has now been corrected in the main text.

      Reviewer #1 (Significance (Required)):

      Nature and significance of the advance/ literature context:

      In their manuscript, the authors provide interesting biological data about the presence of intrinsically and reversibly pro-invasive / pro-metastatic melanoma cells in a seemingly homogenous subpopulation. With SEMA3C, they also provide a marker for early invading cells, which might be useful in future studies to identify therapeutic vulnerabilities for this subgroup. This study sheds further light on the functional effects of phenotypic plasticity, which was previously described particularly in the context of therapy resistance, as mentioned by the authors.

      We thank the reviewer for their kind assessment of the impact of our work.

      Audience:

      The study is interesting for scientists from the melanoma field as well as the cancer metastasis field in general.

      Own expertise:

      Melanoma, phenotypic switch, metabolism, signal transduction, stress response

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      Metastatic potential in clonal melanoma cells is driven by a rare, early-invading subpopulation

      Kaur et al.

      In this manuscript the authors highlight a small subpopulation of "early-invading" melanoma cells and functionally characterize the nuances of these early cells compared to their slowly invading counterparts. A cell surface marker, SEMA3C and the transcription factor NKX2.2 were associated with differences in the invasive rates. Importantly, the group demonstrates that existence of the invasive subpopulation is not reliant on genetic changes, and thus exhibits plasticity. While the underlying concept surrounding this paper (phenotypic plasticity) is not novel, highlighting a surface marker and transcription factor that may, at least in part, be associated with phenotype plasticity is interesting. However, the current study seems underdeveloped. Specific points of concern are listed:

      Major

      • Only two cell lines are used throughout this study. We thank the reviewer for pointing out the need for more cell lines. We have now added two new cell lines to our study, WM793 and WM1799, both of which recapitulate the fundamental phenomenology in question. Although we did not show it in our initial submission, we had originally queried a panel of melanoma cell lines in order to determine their suitability for our study (from which we settled on 1205Lu and FS4). This panel has multiple melanoma cell lines obtained from a variety of melanoma tumor samples from Radial Growth Phase (RGP), Vertical Growth Phase (VGP), and metastatic tissues. We now have included these data in our revised manuscript, since they further support our point.

      “We tested a panel of different melanoma cell lines from Radial Growth Phase (RGP), Vertical Growth Phase (VGP), and metastatic tumor types for the existence of fast invading subpopulations. We used four patient-derived melanoma cell lines, FS4, 1205Lu, WM1799, WM793, all of which have BRAF mutations (V600K for FS4, V600E for 1205Lu, WM1799, and WM793) and are known to be highly invasive in vitro and in vivo (27). Out of the 11 melanoma cell lines tested, the FS4 (not shown) and 1205lu cell lines displayed the highest levels of fast invading subpopulations (Supp. Fig. 1A).”

      First, we showed that they all have an invasive subpopulation, with 1205Lu and FS4 (not shown) having the most invasive cells. Second, validating a central claim of the manuscript, we showed that many of these cell lines, including WM1799 and WM793, showed much higher levels of both SEMA3C (4/6) and NKX2.2 (4/6) expression in the early invading population as compared to the late invading population.

      Together, these data make a strong case that our findings generalize across multiple cell lines, including RGP and VGP models. We have incorporated new text that reads as follows:

      “In order to establish the generality of our results, we measured expression of the surface marker SEMA3C across the early and late invading subpopulations of a panel of melanoma cell lines. We found that SEMA3C levels were higher in the early invading subpopulation in 4 of the 6 lines tested (Supp. Fig. 1H). Thus, these results held across a variety of cell lines and, thus, were not a unique feature of a particular patient sample.”

      • The in vivo metastasis assay in figure 1 is difficult to interpret and presents a number of concerns. 1) Only ~50% of early invading cells were labeled with GFP, this confounds many aspects of the experiment. The authors comment that in the primary tumor, as expected "...a roughly equal mix of human melanoma cells that were GFP positive and negative." If there was an expectation of equal proliferative rates in the primary tumor of early and late invading cells, given that only 1/2 of the early cells were GFP+, wouldn't we expect only 25% of the human cells to be GFP+?

      The reviewer has raised a very important quantitative question about our experiments, which we have now addressed with a more thorough set of analyses. Initially, we quantified GFP positivity post -transduction by looking at fluorescent protein levels, for which the threshold was fairly arbitrary, and potentially could have miscounted many GFP positive cells as GFP negative due to low but non-zero levels of expression. We hence recalculated our positivity rate based on single molecule RNA FISH for GFP and mCherry, given that the technique is sensitive down to even veryl ow levels of expression.

      As can be seen in Supp. Fig. 2B, the vast majority of transduced cells did indeed get the transgene and had some level of expression of GFP/mCherry. At a threshold of 5/10 molecules (GFP/mCherry, respectively), we obtained 88% and 96.15% positivity rates for GFP and mCherry, respectively. At these rates of positivity, we would expect much closer to 50% of the cells being GFP positive in the tumors, as observed. We thank the reviewer for noticing this discrepancy, and feel that our new analysis clears up the confusion and strengthens our results. These results are described in the main text as follows:

      “We labeled the cells with sufficient virus so that 88% of the early invaders were labeled with GFP and 96.15% of the late invaders were labeled with mCherry (Supp. Fig. 2B). We then sampled lungs from mice at various times post-injection to look for metastatic cells (Fig.1F) and overall tumor growth (Supp. Fig. 2C,D).”

      2) The authors note technical difficulties in detecting mCherry in sections. It seems as though this forced them to use a RNA FISH probe to identify human vs. mouse and by extension/negative selection the human FISH positive, GPF negative cell represented a mCherry stained late-invading cell. This is not ideal and seems over complicated. If the population of interest was engineered to express mCherry, why not directly probe for mCherry?

      The reviewer has raised an important point about our experimental design. Indeed, we attempted multiple times and in multiple ways to detect mCherry protein directly. We tried multiple times with multiple antibodies, but the signal was simply not detectable. Hence, we arrived at the experimental design we outlined. We felt that a fully transparent disclosure of the issues was preferable, even if it did make the design sound overly complex. We will note that our primary result—that the vast majority of the metastatic cells are GFP positive and hence derived from fast invaders—is robust to any detection issues for mCherry.

      3) Given the poor initial labeling/transduction of the early invaders, how can the authors be confident that all human cells without GFP signal are late invaders?

      The reviewer raises a great point that is addressed by our GFP and mCherry RNA FISH analysis above, showing that the transduction efficiency was actually quite a bit higher than initially thought due to low but non-zero GFP signal being counted as GFP negative. With the much higher transduction efficiencies we have now validated, we believe that the vast majority of human cells with no GFP signal should be late invaders.

      • The authors may have missed an opportunity to study FS4 clone F6 and 1205 clone E11. What is the SEMA3C and NKX2.2 status of these clones? Are they able to revert expressions? The reviewer has pointed out an interesting opportunity for further exploration. Unfortunately, because they were identified as part of an initial screening study, those particular clones were not kept for subsequent analysis. However, in our revised manuscript, we have now worked up multiple additional cell lines (WM1799 and WM793), both of which had high expression levels of both SEMA3C (Supp. Fig. 1H, shown above) and NKX2.2 (Fig. 2C) in the early invading subpopulation. Currently, we do not have data on reversion experiments for these two cell lines, but we would expect them to behave similarly to the other cell lines we examined in this study.

      • The lack of statistical analysis/comparisons throughout the paper needs to be addressed. We thank the reviewer for pointing out these deficiencies. We have now added statistical comparisons throughout.

      • In figures 1E and 3B, why do the parental (homogenous) cells demonstrate less invasiveness than the selected for the SEMA3C low or "late-invaders" respectively? This is an important point that the reviewer has raised. The finding did occur in every replicate, so we assume it is biologically and not statistical. We have now included the following language in the discussion noting the issue and some possible explanations.

      “It is worth noting that, while the SEMA3C-high (early-invading) subpopulation drove the highly invasive phenotype, the SEMA3C-low (late-invading) subpopulation also displayed a somewhat more invasive phenotype than the parental population. It is unclear what the underlying cause of this difference in invasive behavior is between the SEMA3C-low and parental populations. One possibility is that paracrine signaling between cells in the parental population confers them with less invasive potential than when the cells are isolated into early- and late-invading subpopulations. Another possibility is that technical factors associated with the sorting of SEMA3C-low cells from the parental population alter their invasive properties, thus making them distinct from the parental population.”

      • Conclusions that NKX2.2 knockout increases invasiveness and proliferation are based on 1 cell line. The comparisons done with FS4 early and late invading cells in Figure 1F may be supportive but is correlative in nature. The reviewer is right that we only have results in one cell line, and fully agree that the results in FS4 are only correlative. We have now weakened the language in the abstract and the results to emphasize that this result held in 1205Lu cells only.

      • Given the robust literature regarding phenotypic switching in melanoma, the NKX2.2 knockout increasing both invasiveness and proliferation (figures 2C, 2D) suggests it may not be involved in phenotype switching. Perhaps NKX2.2 is a negative regulator of cell activity/metabolism. We thank the reviewer for highlighting the possible connections with metabolism. To explore this possibility , we performed metabolic assays on NKX2.2 knockout and AAVS control cells and observed no significant changes in Extracellular acidification rate (B). We did observe some differences in oxygen consumption rate in the cells (A), but the differences do not seem to be large enough or systematic enough to be meaningful given the variation within the controls. We have now included these results in Supp. Fig. 3E-F.

      Note, the data previously referenced as Figure 2C,D is now in Figure 2A,B.

      “NKX2.2 is a transcriptional repressor and activator essential for the differentiation of pancreatic endocrine cells (Habener et al., 2005). In mice, deletion of NKX2.2 prevents the specification of pancreatic islet cells resulting in the replacement of insulin-expressing β cells and glucagon-expressing α cells with ghrelin-expressing cells; This lack of specification resulted in mortality of newborn mice due to hyperglycemia (Sussel et al. 1998; Prado et al. 2004). Given the link of NKX2.2 with glucose metabolism, we wondered whether NKX2.2 had an effect on metabolic activity prompting us to test the NKX2.2 knockout lines for metabolic differences in the oxygen consumption rate (OCR; an indicator of oxidative phosphorylation) and the extracellular acidification rate (ECAR; an indicator of glycolysis) of the cells. Seahorse assay analysis revealed no systematic differences in metabolic activity (Supp. Fig. 3E,F).”

      • Given that sorted SEMA3C high levels did not revert to parental FS4 levels, yet the invasive phenotype reverted to parental-like behavior undermines the usefulness of SEMA3C as a marker of invasiveness. The reviewer has brought up an important point. We were able to show that 1205Lu cells had SEMA3C levels revert to those of the parental. The reviewer is right that FS4 did not, which may be because it takes longer for FS4 to revert. It is true that the phenotypic behavior did revert. We have seen similar things in our therapy resistance work (Shaffer et al. 2017, etc.). One possible reason is that the phenotype is governed by multiple factors, and so the phenotype can revert before the expression of SEMA3C. We still think that SEMA3C is a good marker, just perhaps context dependent. We have added text to the discussion to make these important points.

      “We note that SEMA3C levels in FS4-SEMA3C-high cells did not revert to the parental levels within two weeks. This incomplete reversion may be because SEMA3C takes longer to revert than the tested time period. Interestingly, the invasive phenotype did revert in this time period, suggesting that there may be multiple factors associated with the phenotype beyond SEMA3C. It may thus be that SEMA3C is a marker of the early-invading population, but only in certain contexts.”

      Minor

      • How does SEMA3C and/or NKX2.2 expression (here 1.5% of FS4 cells were noted as "SEMA3C high") of metastatic cell lines (FS4 and 1205) compare to RGP and VGP cell lines? The reviewer has asked a great question about radial and vertical growth phase cells. We have tested several other cell lines to determine cell lines that were suitable for transwell assays. We have now included two figures (Supp. Fig. 1H and Fig. 2C) showing the SEMA3C and NKX2.2 status of each of these cell lines (parental cells) and their different subpopulations (early invaders and late invaders)—see also Reviewer #2, Major point 1. We found that the same pattern of SEMA3C-high cells held for both RGP and VGP cell lines.

      • There were a number of instances throughout the manuscript that were not clear, colloquial, or simply unnecessary - i.e. description of transwell assay. The reviewer has raised a good point about our language. We have gone through and tried to improve the clarity and precision. As for descriptions of the various assays, we have found that some readers of our papers are unfamiliar with these assays, so we elected to keep those descriptions in. We hope the reviewer does not object too strenuously.

      • The authors only analyze/mention lung metastases. Were metastases observed at other sites? The reviewer has posed a very good question about whether metastasis occurred at other locations. We stained additional tissues (liver and kidney) that were collected from the same mice and stained as per our lung invasion assays. As shown in our new Supplemental Fig. 2E, we found a similar pattern with the vast majority of metastatic cells being GFP positive; i.e., early-invaders, just as was the case for lung. We thank the reviewer for this helpful suggestion.

      “In the lung, however, we saw predominantly GFP-positive cells, showing that the vast majority of cells that migrated from the primary tumor site were initially early invading cells (Fig. 1I,J). The number of GFP cells in the lung was variable, but generally increased with time. The liver and kidney also showed an enrichment of GFP-positive cells (early invaders), suggesting that the metastatic potential of these cells is not limited to any one particular metastatic location (Supp. Fig. 2E). Thus, we established that the highly invasive subpopulation was able to drive metastasis in vivo.”

      • What is PE indicating in Figure 1D? Apologies, PE refers to the channel we used for the sorting on the FACS machine and stands for “Phycoerythrin”. To avoid any confusion, we have omitted the “PE” text on the y-axis of Fig. 1D.

      • The number of invaded cells seems to vary quite a bit between experiments - Parental 1205 cells in Fig 2C = ~200, yet 1205 clone F6 and the non-clonal 1205 cell line demonstrate ~10,000. Similar differences observed with Fs4 cells - Parental Fig 1E vs. Empty control Figure 2A. The reviewer has a good eye—indeed, there is a wide variability in the amount of invading cells. We have now remarked on this variability in the results section:

      “We note that the number of invading cells varied significantly between experiments. This variability is due to the fact that we employed transwell dishes with different growth areas, ranging from 0.33 cm2 to 4.67 cm2, leading us to collect different cell numbers for individual experiments. The cell density per cm2, however, was kept constant between experiments.”

      Note that Figure 2C and Figure 2A are now referenced as Figure 2A and Supplemental Figure 1F, respectively .

      Reviewer #2 (Significance (Required)):

      This work contributes to the growing fields of phenotypic plasticity and intratumoral heterogeneity. The authors claim to have identified a surface marker SEMA3C and a transcription factor NKX2.2 that may play a role in driving invasive proclivity. Importantly, the group demonstrates that changes in these proteins are not genetic, and therefore represent "intrinsic differences" that are a property of the tumor. Furthermore, the authors indicate how the present observations of early invading cells parallels drug resistance phenomena as their previous works highlights intrinsically resistant subpopulations (Shaffer et al., Nature 2017, Torre et al., Nature Genetics 2021 and others.). Taken together, the current and previous work underscores the importance of cell to cell non-genetic variability in disease progression and response to therapy.

      We thank the reviewer for their kind comments on the significance of our manuscript.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      In this study, Kaur et al. intended to use similar strategy that the same group had developed (https://www.nature.com/articles/nature22794) to identify the subpopulation in melanoma responsible for metastasis. In brief, the melanoma cell population was subjected to the selection of a specific phenotype (transwell migration dubbed as "invasiveness" behavior). By comparing the early and late invaders, a cell maker was identified to allow distinguishing the high-invasive subpopulation. A series of experiments were devised to validate the metastatic function of the high-invasive cells and delineate the signaling that drove this phenotype. The authors concluded that this rare subpopulation was originated from transcriptional fluctuation, and invasiveness is a trade-off of cell growth. Therefore, as the cells growing, overtime the phenotype was reverted to low invasiveness.

      Consistency is the most important factor for evaluating observation over temporal and spatial range. Therefore, several controls need to be clarified before further investigation in mechanisms:

      1) If the rare invader cells are arising from gene expression fluctuation, the SEMA3C-low population of parental line should generate SEMA3C-high invader subpopulation over time. This should be addressed.

      The reviewer has made an excellent point. Indeed, it is the case that the SEMA3C-low population starts to regenerate the high invader subpopulation over time. We have re-graphed Figure 3D to demonstrate this fact more clearly (See Supplemental Fig. 5A,B), showing that the SEMA3C low population regenerates many more SEMA-3C high cells after 14 days.

      2) Both early and late invader cells exhibited higher invasiveness than the parental line (Fig. 3B). Therefore, the in vivo metastatic potential of the three lines should be compared to validate the role of the invader cells in the metastatic function.

      We thank the reviewer for their comment about testing all three populations in the in vivo context. It is an excellent suggestion, but in order to fully control the experiment, we would need to add all three populations in three separate colors. Given the difficulties we had with getting even the two colors to work together, we think it is beyond the scope of our current efforts to attempt this complex experiment. We have added the following caveat to the text:

      “For unknown reasons, the parental population consistently showed lower invasiveness than the early- and late-invading subpopulations. Given that we did not test the parental population for invasiveness in vivo, future studies may address the sources and mechanisms by which the parental population differs and how those differences manifest in vivo.”

      3) To evaluate the possible intervention of cellular function by fluorescent proteins (https://doi.org/10.1016/j.ccell.2022.01.015), admix of GFP- and mCherry-labeled populations of early invader cells should be used as a control in Fig. 1F. Noticeably, the labeling ratio of the two populations was not even in Fig. 1F.

      The reviewer has brought up an important point about the potential differences brought about by the fluorescent proteins themselves. At this point, it is difficult to redo these complex in vivo experiments, but we can appeal to the fact that the admixture is maintained throughout time as the primary tumor site still has a roughly equal ratio of GFP and mCherry cells in it (Fig. 1I and Supp. Fig. 2E).

      4) When the invader cells were expanded and passed, their invasiveness will revert to the level similar to parental line in 14 days (Fig. 3B). The isolated cells were expanded for further testing and manipulation in Fig. 1C and 1F, respectively. How long did was the period for cell expansion in these experiments?

      We thank the reviewer for bringing up an important question about the details of cell expansion. For the RNA-seq, the cells were directly processed upon going through the transwell, so there was no expansion period. We have made sure to outline this more carefully in our methods section (see below).

      “RNA sequencing and analysis:

      RNA collection and library prep: Each treatment/sample was tested in 3 separate biological replicates. Upon passing through the transwell, cells were immediately collected and processed for RNA sequencing. Total RNA isolation was performed using the phenol-chloroform extraction followed by RNA cleanup using RNAeasy Micro (Qiagen 74004) kit. For transwell assays, library preparation was performed using Nebnext single-cell/low input RNA library prep kit (E6420L, NEB). For NKX2.2 CRISPR experiments, library preparation was done using NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB E7490L) integrated with NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB E7770L).

      Mouse tumor implantation and growth:

      All mouse experiments were conducted in collaboration with Dr. Meenhard Herlyn at The Wistar Institute, Philadelphia, PA. NSG mice (NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ) were bred in-house at The Wistar Institute Animal Facility. All experiments were performed under approval from the Wistar Institute Care and Use Committee (protocol 201174). As in the case of RNA sequencing experiments, cells were not expanded prior to injection into the mouse, but were collected and implanted right after passing through the transwell. 50,000 melanoma cells were suspended in DMEM with 10% FBS and injected subcutaneously in the left flank of the mouse.”

      5) If invasiveness and growth are trade-off, why did the mCherry-labeled cells not dominate the population of primary tumors in Fig. 1J?

      Note that Figure 1J is now referenced as Figure 1I. The reviewer brings up a good point. For potential explanations, first, the difference in growth rate is not large, so we would not necessarily expect mCherry cells to dominate on this timescale. Also, we believe that in vivo, the tradeoff may be mitigated by other factors and cell-cell interactions that are not present in vitro. We have added a note on this point to the results.

      “(Note that these numbers were similar despite the slightly increased growth rate of the late-invading subpopulation; we assume this is due to the relatively small difference and cell-cell interactions that could prevent one population from dominating the other.)”

      6) In Fig. 1G, why RNA FISH was not used to detect mCherry-labeled cells?

      Another excellent point. RNA FISH in tissue sections can often be rather challenging due to various reasons including RNA degradation, and mCherry RNA signal was hard to definitively show in these sections. Hence, we opted for MALAT1, which is very heavily expressed and hence provided a strong and reliable signal.

      “For technical reasons, the mCherry cells were not detectable due to the fluorescence of the mCherry protein not being visible in the mouse sections. Nevertheless, we were able to detect late invaders in the population by using a human-specific MALAT1 RNA FISH probe that binds only to human MALAT1 RNA and not mouse MALAT1 RNA (28).”

      7) In vivo cycling (harvesting the cells from metastatic site and implanting them to the primary site in mouse models) has been employed to select metastatic sublines from a parental line. Could in vivo cycling make the early invader phenotype fixed?

      The reviewer has raised a very interesting point about cycling and selection. Indeed, the 1205Lu cells were derived from repeated cycling of invasive lung cells. That is probably the reason that these cells were useful for our assay, because the percentage of early-invading cells was higher. Nevertheless, the cells still have a significant proportion of late invaders, suggesting that the phenotype has not yet been fixed in the population. Perhaps with further cycling, such a fixation could be achieved. We have now noted this possibility in our discussion.

      “It is also possible that repeated cycles of selection, even of non-genetic phenotypes, could lead to an increased fraction of invasive cells. Indeed, 1205Lu cells were derived by exactly such repeated cycles, which presumably are the reason they have a higher percentage of invasive cells; however, despite these repeated rounds of selection, most cells are still not highly invasive, suggesting that it is difficult for this property to fully fix in the population.”

      **Referees cross-commenting**

      Both reviewers' questions are important for adequate controls.

      Reviewer #3 (Significance (Required)):

      There are several studies trying to identify subpopulation responsible for the metastasis of melanoma and other types of cancer, and a few mechanisms have been revealed. However, the significance depends on if the results can be validated on clinical data. It is lacking in this study.

      We thank the reviewer for their statement of interest in the problem. We agree that it is helpful to link these results to clinical data. We did perform TCGA analyses of several different genes, including SEMA3C, that emerged from our data, and there were no systematic relationships to phenotype. Of course, the relationship to clinical data is complex and many important factors are not obvious from the TCGA data, so we do not think that necessarily diminishes our results. Rather, we think our results raise a conceptual point that there can be rare cells with non-genetic differences that can drive metastasis. Further work will be required to translate these results to the clinic.

      We have added the following to the main text:

      “We found that the SEMA3C-high cells were far more invasive, intrinsically, than SEMA3C-low cells and the population overall, thus demonstrating that cells vary intrinsically in their invasiveness, and the very invasive subpopulation is marked by the expression of SEMA3C (Fig. 1E). Note, overexpression of SEMA3C in FS4 single cell clones revealed no changes in invasiveness, suggesting that SEMA3C is a marker with no functional relevance to invasiveness per se (Fig. 1D; Supp. Fig. 1E-G). We verified the expression levels of the genes identified in our RNA sequencing study in the The Cancer Genome Atlas (TCGA) data. We combined the list of differentially expressed genes in early invaders with the gene set enrichment analysis (GSEA) “Hallmarks of cancer epithelial-mesenchymal transition” and compared expression in primary vs. metastatic TCGA samples, finding no appreciable difference (Fig. 5A-B). These data suggest that these markers do not have obvious clinical correlates. Moreover, Kaplan Meier analysis comparing the survival time (days to death) between patient cohorts with either high or low SEMA3C expression levels revealed that SEMA3C does not predict survival time post-diagnosis, as both survival curves (p=0.898) follow comparable trends between the two cohorts (Fig. 5C). However, conceptually, our results raise the possibility that a rare, non-genetically defined subpopulation of cells may drive metastasis due to its increased degree of invasiveness, which further data collection efforts in patient samples may help validate.”

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      In this study, Kaur et al. intended to use similar strategy that the same group had developed (https://www.nature.com/articles/nature22794) to identify the subpopulation in melanoma responsible for metastasis. In brief, the melanoma cell population was subjected to the selection of a specific phenotype (transwell migration dubbed as "invasiveness" behavior). By comparing the early and late invaders, a cell maker was identified to allow distinguishing the high-invasive subpopulation. A series of experiments were devised to validate the metastatic function of the high-invasive cells and delineate the signaling that drove this phenotype. The authors concluded that this rare subpopulation was originated from transcriptional fluctuation, and invasiveness is a trade-off of cell growth. Therefore, as the cells growing, overtime the phenotype was reverted to low invasiveness.

      Consistency is the most important factor for evaluating observation over temporal and spatial range. Therefore, several controls need to be clarified before further investigation in mechanisms:

      1. If the rare invader cells are arising from gene expression fluctuation, the SEMA3C-low population of parental line should generate SEMA3C-high invader subpopulation over time. This should be addressed.
      2. Both early and late invader cells exhibited higher invasiveness than the parental line (Fig. 3B). Therefore, the in vivo metastatic potential of the three lines should be compared to validate the role of the invader cells in the metastatic function.
      3. To evaluate the possible intervention of cellular function by fluorescent proteins (https://doi.org/10.1016/j.ccell.2022.01.015), admix of GFP- and mCherry-labeled populations of early invader cells should be used as a control in Fig. 1F. Noticably, the labeling ratio of the two population was not even in Fig. 1F.
      4. When the invader cells were expanded and passed, their invasiveness will revert to the level similar to parental line in 14 days (Fig. 3B). The isolated cells were expanded for further testing and manipulation in Fig. 1C and 1F, respectively. How long did was the period for cell expansion in these experiments?
      5. If invasiveness and growth are trade-off, why did the mCherry-labeled cells not dominate the population of primary tumors in Fig. 1J?
      6. In Fig. 1G, why RNA FISH was not used to detect mCherry-labeled cells?
      7. In vivo cycling (harvesting the cells from metastatic site and implanting them to the primary site in mouse models) has been employed to select metastatic sublines from a parental line. Could in vivo cycling make the early invader phenotype fixed?

      Referees cross-commenting

      Both reviewers' questions are important for adequate controls.

      Significance

      There are several studies trying to identify subpopulation responsible for the metastasis of melanoma and other types of cancer, and a few mechanisms have been revealed. However, the significance depends on if the results can be validated on clinical data. It is lacking in this study.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      RC-2022-01474 Metastatic potential in clonal melanoma cells is driven by a rare, early-invading subpopulation Kaur et al.

      In this manuscript the authors highlight a small subpopulation of "early-invading" melanoma cells and functionally characterize the nuances of these early cells compared to their slowly invading counterparts. A cell surface marker, SEMA3C and the transcription factor NKX2.2 were associated with differences in the invasive rates. Importantly, the group demonstrates that existence of the invasive subpopulation is not reliant on genetic changes, and thus exhibits plasticity. While the underlying concept surrounding this paper (phenotypic plasticity) is not novel, highlighting a surface marker and transcription factor that may, at least in part, be associated with phenotype plasticity is interesting. However, the current study seems underdeveloped. Specific points of concern are listed:

      Major

      • Only two cell lines are used throughout this study.
      • The in vivo metastasis assay in figure 1 is difficult to interpret and presents a number of concerns.
        • 1.) Only ~50% of early invading cells were labeled with GFP, this confounds many aspects of the experiment. The authors comment that in the primary tumor, as expected "...a roughly equal mix of human melanoma cells that were GFP positive and negative." If there was an expectation of equal proliferative rates in the primary tumor of early and late invading cells, given that only 1/2 of the early cells were GFP+, wouldn't we expect only 25% of the human cells to be GFP+?
        • 2.) The authors note technical difficulties in detecting mCherry in sections. It seems as though this forced them to use a RNA FISH probe to identify human vs. mouse and by extension/negative selection the human FISH positive, GPF negative cell represented a mCherry stained late-invading cell. This is not ideal and seems over complicated. If the population of interest was engineered to express mCherry, why not directly probe for mCherry?
        • 3.) Given the poor initial labeling/transduction of the early invaders, how can the authors be confident that all human cells without GFP signal are late invaders?
      • The authors may have missed an opportunity to study FS4 clone F6 and 1205 clone E11. What is the SEMA3C and NKX2.2 status of these clones? Are they able to revert expressions?
      • The lack of statistical analysis/comparisons throughout the paper needs to be addressed.
      • In figures 1E and 3B, why do the parental (homogenous) cells demonstrate less invasiveness than the selected for the SEMA3C low or "late-invaders" respectively?
      • Conclusions that NKX2.2 knockout increases invasiveness and proliferation are based on 1 cell line. The comparisons done with FS4 early and late invading cells in Figure 1F may be supportive but is correlative in nature.
      • Given the robust literature regarding phenotypic switching in melanoma, the NKX2.2 knockout increasing both invasiveness and proliferation (figures 2C, 2D) suggests it may not be involved in phenotype switching. Perhaps NKX2.2 is a negative regulator of cell activity/metabolism.
      • Given that sorted SEMA3C high levels did not revert to parental FS4 levels, yet the invasive phenotype reverted to parental-like behavior undermines the usefulness of SEMA3C as a marker of invasiveness.

      Minor

      • How does SEMA3C and/or NKX2.2 expression (here 1.5% of FS4 cells were noted as "SEMA3C high") of metastatic cell lines (FS4 and 1205) compare to RGP and VGP cell lines?
      • There were a number of instances throughout the manuscript that were not clear, colloquial, or simply unnecessary - i.e. description of transwell assay.
      • The authors only analyze/mention lung metastases. Were metastases observed at other sites?
      • What is PE indicating in Figure 1D?
      • The number of invaded cells seems to vary quite a bit between experiments - Parental 1205 cells in Fig 2C = ~200, yet 1205 clone F6 and the non-clonal 1205 cell line demonstrate ~10,000. Similar differences observed with Fs4 cells - Parental Fig 1E vs. Empty control Figure 2A.

      Significance

      This work contributes to the growing fields of phenotypic plasticity and intratumoral heterogeneity. The authors claim to have identified a surface marker SEMA3C and a transcription factor NKX2.2 that may play a role in driving invasive proclivity. Importantly, the group demonstrates that changes in these proteins is not genetic, and therefore represents "intrinsic differences" that is a property of the tumor. Furthermore, the authors indicate how the present observations of early invading cells parallels drug resistance phenomena as their previous works highlights intrinsically resistant subpopulations (Shaffer et al., Nature 2017, Torre et al., Nature Genetics 2021 and others.). Taken together, the current and previous work underscores the importance of cell to cell non-genetic variability in disease progression and response to therapy.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary:

      The manuscript entitled „Metastatic potential in clonal melanoma cells is driven by a rare, early-invading subpopulation" by Kaur and colleagues provides a phenotypical analysis of the invasive potential of established melanoma cell lines on single cell level. The aim of the study was to answer the question if even homologous tumor cells bear the intrinsic potential to give rise to cells with high invasive (and therefore potentially metastatic) capacity in absence of selection pressure from the tumor microenvironment. The authors used clones from two different melanoma cell lines (to prevent the accumulation of random (epi)genetic changes during cultivation) and performed invasion assays with Matrigel-coated transwell inlays to differentiate between cells that were able to invade early (up to 8 h, approx. 1% of the total cell population) or late (8-24 h; approx. 3% of the total cell population) after plating. Comparative RNA sequencing of early invaders and non-invaders populations revealed a high expression of SEMA3C in early invaders, which was then established as marker in the used cell lines. Interestingly, in vivo models using NSG mice injected with a mixture of early and late invading melanoma cells revealed that both contributed similarly to the primary tumor, while metastatic cells in the lung consisted almost exclusively of early invaders. Subsequent ATAC sequencing revealed an increase of binding sites for the transcription factor NKX2.2 in the early invaders. Functional analyses revealed that a knockout of NKX2.2. led to an increase in both invasion and proliferation. Finally, the authors showed with different sorted early and late invaders as well as SEMA3Chigh and SEMA3Clow expressers that pro-invasive features go along with reduced proliferation potential in accordance to previously published data. However, they decrease with time, thus demonstrating a reversion of the phenotype and high plasticity.

      Major comments:

      In general, the paper contains novel and interesting data, is concisely written and supported by replicates. The key conclusion, the presence of a small proportion of highly invasive cells in a seemingly homologous cell population and their striking requirement for lung metastasis, is very convincing. In vitro, SEMA3C was confirmed as marker for the early invaders in two independent cell lines. However, a few questions remain open, as detailed below:

      1. The relevance of NKX2.2 in the early invaders is currently unclear to me. The ATAC sequencing data revealed a high enrichment of accessible NKX2.2 binding sites in early invaders, and data were tested by comparative RNA sequencing of control cells and cells with NKX2.2 ko (Figure 2). The Figure legend of Figure 2 says: "NKX2.2 is a transcription factor that promotes the invasive subpopulation", but the data don`t support this (ko leads to reduced invasion). Accordingly, the authors also state in the Results part "... the direction of the effect is the opposite of what one might have expected". To set the role of NKX2.2 into context, it would be useful to confirm the actual involvement of NFX2.2 in the invasive phenotype and clarify if NFX2.2. might probably even suppress some pro-invasive genes. I would advise to investigate the protein levels and/or protein localization of NFX2.2 and probably perform ChIp experiments on selected pro-invasive genes that play a role in the early invaders.
      2. The sequencing data are currently accessible via a Dropbox link. They should be deposited instead in a data repository.

      Minor comments:

      1. The cell line used for Supplementary Figure 4 should be named in the figure legend.
      2. In Figures 4H-M and Supplementary Figure 4D-I, the authors describe data performed in "sister" and "cousin" cells. It would be useful to provide a definition for both in the main text or figure legend.
      3. Discussion: "This lack of permanence may reflect the fact that the invasive cells are not subjected to stress-in our case, cells merely pass through a transwell, which may be the reason for the "burning in" of the phenotype in the case of resistance." This sentence is misleading - please clarify.

      Furthermore, there are some errors in the reference to the Figures throughout the paper. These which should be corrected: 4. Results, section "NKX2.2 is a transcription factor that promotes the invasive subpopulation". Here the authors write: "...we performed RNA sequencing on the NKX2.2 knockout cells and compared the effects on gene expression to the gene expression differences between early vs. non- invaders across the two cell lines." This sentence should contain the reference to Supplementary Figure 3B-D (which is otherwise not referred to). 5. Results: "Overexpression of SEMA3C in FS4 cells revealed no changes in invasiveness, suggesting that SEMA3C is a marker with no functional relevance to invasiveness per se; Fig. 1D, Fig. 2A-B)" The correct reference should be: Suppl. Fig. 1D, Fig. 2A-B. Also, in the current manuscript version the authors jump from Figures 1 to Figure 2 A,B, before coming back to Figure 1. To avoid this, I would advise to shift the current Figure 2A, B to Figure 1 or the supplementary information. 6. Results: "We then sampled lungs from mice at various times post-injection to look for metastatic cells (Fig.1F, Suppl. Fig. 2B,C)." As Supplementary Figure 2B, C does not show metastasis, but rather primary tumor growth, I would advise the following wording: "We then sampled lungs from mice at various times post-injection to look for metastatic cells (Fig.1F) and overall tumor growth (Suppl. Fig. 2B,C)." 7. Results: "Interestingly, NKX2.2 knockout cells showed markedly increased invasion and proliferation (Fig. 2A,B), suggesting a change in regulation of both processes. " The correct reference is Fig. 2C, D.

      Significance

      Nature and significance of the advance/ literature context:

      In their manuscript, the authors provide interesting biological data about the presence of intrinsically and reversibly pro-invasive / pro-metastatic melanoma cells in a seemingly homogenous subpopulation. With SEMA3C, they also provide a marker for early invading cells, which might be useful in future studies to identify therapeutic vulnerabilities for this subgroup. This study sheds further light on the functional effects of phenotypic plasticity, which was previously described particularly in the context of therapy resistance, as mentioned by the authors.

      Audience:

      The study is interesting for scientists from the melanoma field as well as the cancer metastasis field in general.

      Own expertise:

      Melanoma, phenotypic switch, metabolism, signal transduction, stress response

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      RC-2022-01661

      Response to reviewers:

      Review Commons questions and Reviewers’ comments verbatim in plain text.

      Authors’ responses in bold text. Line numbers refers to numbers in the marked-up manuscript. In text citations in this document – see bibliography at bottom of this document.

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      Summary: Cells within multicellular organisms are mutually dependent on each other - cells of one type or in one location provide signals that can regulate the health and differentiation of the target cells that receive those signals. Such signalling can operate bi-directionally, emphasizing the co-dependence of cells upon each other. The ovarian follicle provides an excellent model system to study intercellular signaling and its consequences, in this case between the oocyte and the somatic granulosa cells that surround it. Oocytes secrete members of the TGFbeta growth factor family that are required for normal differentiation of the granulosa cells, which in turn is necessary for normal development of the oocyte. Here the autohors show that adding TGFB-type growth factors (cumulin or BMP15) to the cuture medium during in vitro maturation increases the fraction of oocytes that can reach the blastocyst stage (improved developmental competence) and alters the pattern of protein landscape in both the (cumulus) granulosa cells and the oocyte. Changes in the mitochondria and parameters relevant to energy metabolism are also altered. They conclude that these changes underpin the acquisition of developmental competence by the oocytes.

      Major issues: The authors are world leaders in this field and therefore exceptionally well-qualified to carry out the proposed work. There are a number of issues, however, that limit the confidence with which conclusions may be drawn.

      First, the experimental strategy makes drawing inferences about the role of cumulin and BMP15 challenging. Maturing oocytes express GDF9 and BMP15 (the components of cumulin). Thus, the experiments are not comparing presence vs absence of cumulin and BMP15, but rather comparing oocytes and cumulus cells exposed to supra-physiological levels of these factors to controls that are exposed to physiological levels. In other words, the experimental setup detects changes that occur in response to higher than normal levels of the factors. Ideally, one would have complementary experiments where GDF9 and BMP15 were deleted from the system, to illustrate the effects of their absence. This would be a massive additional undertaking, however. Yet, without such experiments, relying on the results of the overexpression approach to understand the functions of cumulin and BMP15 at physiological levels is risky. RESPONSE #1 We appreciate these insightful perspectives. We apologise for not making it clear that the model used is not in fact an overexpression model. This is because, by removing the cumulus-oocyte complex from the follicle and studying it in vitro (oocyte IVM), secretion of these growth factors by the oocyte is notably compromised, so the controls are not exposed to normal physiological levels as suggested by the reviewer. This loss of normal secretion ex vivo is evidenced by: 1) in Mester B. et al _[1]_; Figure 2, we showed the mouse oocytes matured in vitro (i.e. as per the current study) are essentially devoid of the mature domain BMP15 protein, which will therefore be likewise for cumulin as cumulin contains one subunit of BMP15, and 2) mammalian cumulus-oocyte complexes explanted and cultured in vitro by IVM benefit (in terms of developmental competence) from the addition of exogenous oocyte-secreted factors such as BMP15, GDF9 and cumulin, demonstrating that they are rate-limiting under IVM conditions. We were the first to demonstrate this in 2006 _[2]_ which has been subsequently verified in many papers, including in the current paper for cumulin. The exact extent to which the controls are deficient in BMP15 and cumulin is unclear, as there are not yet reliable mouse ELISAs for these, but the model is an add-back model rather than an overexpression model. We have now added text at lines 150-152 and in the Fig 1 legend, to make this point clearer.

      Re using complimentary deletion, knock-out or antagonist-type experiments: we agree this would be ideal. However, this is likely impossible as cumulin is a non-covalent heterodimer of BMP15 and GDF9 (as first named and characterised by us: Mottershead DG et al ____[3]____). Hence, to knockout cumulin one needs to knockout either or both of BMP15 and GDF9, making it impossible to discriminate the actions of the heterodimer from the homodimers. In support of this, reviewer #3 made exactly this point, and stated “Such functional analysis cannot be done using gene knockout mouse lines…… only functional work as the one presented in this manuscript can find the mechanisms of action of these hormones”. This issue is further complicated by the fact that BMP15 and GDF9 are thought to exist as homodimers, as well as monomers, including in equilibrium in heterodimeric form as cumulin (also noted by Reviewer #3). Furthermore, there is no cumulin-specific antagonist, e.g. a cumulin-specific neutralizing antibody. Small molecule signaling inhibitors (e.g. Smad2/3 or Smad1/5/8 antagonists) certainly block cumulin actions, but therefore simultaneously also block GDF9 or BMP15 actions. Collectively, these unique (with the TGFβ superfamily) structural peculiarities of cumulin make it complex to interrogate its mechanisms of action, to the extent that others have largely focused on BMP15 or GDF9 homodimer actions only, when in reality, cumulin is likely the key natural protagonist responsible for oocyte paracrine signalling. We have added a paragraph to this effect to the discussion, at lines 417-423, including acknowledging the experimental limitations of the study dictated by having to deal with a noncovalent heterodimer.

      Second, the granulosa cells and oocytes interact throughout the prolonged period of growth, and this is the time when the beneficial effects of the granulosa cells on the oocyte have been most clearly documented. Yet the experiments focus on the much shorter period of meiotic maturation. This is when oocyte-granulosa cell interaction is being down-regulated, even if not entirely disrupted. RESPONSE #2: Indeed, oocyte-granulosa interaction is absolutely essential during oocyte growth, development and meiotic maturation, for healthy oocyte function, including the orchestrated down-regulation of oocyte-granulosa interactions during the latter phase. As pioneered by John Eppig and others, including ourselves ____[4]____ (ref has 673 citations), the master conductor of this dynamic oocyte-granulosa interaction during oocyte meiotic maturation are the oocyte-secreted factors. Hence, these factors are critical at this stage, and we maintain that this is a very important phase of oocyte development to study.

      Third, the data reported illustrate associations or correlations, but no experiments test the function of the changes in the proteome or of the changes in the morphology of the mitochondria or ER. Which if any of these is linked to the improved development of the oocytes after fertilization is unknown. Moreover, no experiments address how the growth factors cause the observed changes, which occur over a period of a few hours. RESPONSE #3 This is true. The study is already very large and has many functional experiments (e.g. oocyte respiration, oocyte MS, etc), that follow-up the findings from the proteomic analysis. Hence, the study has taken a global cellular metabolism approach, e.g. we show that cumulin downregulates oxidative phosphorylation globally, c.f. pathways within OXPHOS. We found an abundance of individual proteins altered in this period (see figure 4) and to follow up on the actions and consequences of individual proteins would: 1) at best show small incremental effects, as metabolism of such a cellular syncytium is vastly complex and inter-connected, 2) further increase the size of what is already a large study, and 3) detract from the more important wholistic effects on cumulus-oocyte complex metabolism, which must act as whole, interacting entity, to support the complexities of supporting early life post-fertilization.

      __Taken together, these issues unfortunately limit the potential impact of the work. But the amount of work required to address them would be substantial and not really feasible for this manuscript. The best route may be to present the work as an overexpression study that has identified associations, with a discussion that acknowledges the limitations of this approach. __RESPONSE #4 This is not an over-expression study – see RESPONSE #1 above. We have added text in the discussion at lines 417-423, that acknowledges the limitations of the study by the impossibility to conduct a killer knockout experiment of cumulin.

      Minor issues: The text of the manuscript should be revised in a number of places. 32: We characterized the molecular mechanisms by which two model OSFs, cumulin and BMP15, regulate oocyte maturation and cumulus-oocyte cooperativity. --Mechanistic studies were not performed. RESPONSE #5 The scope of this work was to; (a) identify global changes to protein expression, and (b) to use this data to implement follow-up experiments on some of the lead indicators, such as metabolism (respiration, small molecule metabolic markers) and cellular morphology. This work provides the groundwork, insight and rationale for future additional studies of specific mechanisms of COC interactions. As discussed at RESPONSE# 1, these studies are as close as anyone can probably get currently to mechanistic studies of a NOVEL noncovalent heterodimer, when the noncovalent homodimers are also in play, as also noted by reviewer #3 who specifically references mechanisms: “…… only functional work as the one presented in this manuscript can find the mechanisms of action of these hormones”.

      In some instances, in the interests of brevity, we made remarks based on our data, but without specifying details in the text. To redress this, we have now added specific details which illustrate and justify our statements based on the data collected (see RESPONSES #6, #7, #9 below). For greater clarity, we have also restructured our supplementary data set to cover the analysis progression from full raw proteomic data to differentially expressed proteins, to use of differentially expressed proteins in network analysis. The supplementary data set now includes the full proteomics lists for both cells and treatments (Supplementary Tables S1, S2, S3, S4), protein sequences confidently identified by both proteomic software platforms (Supplementary Tables S5, S6), differentially expressed proteomics lists for both cells and treatments (Supplementary Tables S7, S8, S9, S10), differentially expressed protein list used for the network analysis (supplementary Table S11). The Table S11 lists are intended to facilitate use by readers to perform their own analyses, if they so wish, since they can simply copy and paste the list to the on-line STRING platform. Finally, the reanalysed network analysis output, based on the differentially expressed proteins shown in supplementary Table S11, are shown in supplementary Tables S12 and S13.

      __40: Collectively, these data demonstrate that OSFs remodel cumulus cell metabolism during oocyte maturation in preparation for ensuing fertilization and embryonic development. --No mechanistic studies demonstrate this. __RESPONSE #6 There is no mention of mechanism in this sentence at line 40 and we have provided exhaustive evidence that cumulus cell metabolism is remodelled as stated (Figures 4B and 4C). For example, of the 59 upregulated proteins in the cumulus cells of cumulin treated COC (Figure 4C and supplementary Table S11), 38 (i.e. 64%) are involved in primary metabolic processes (supplementary Table S12), including amino acid metabolism (GOT2, SHMT1, CTH, MAT2B), lipid and steroid metabolism (CERS5, DHCR7, HSD17b4), aldehydes metabolism (RDH11), nucleotides biosynthesis (RRM1, GMPR2), glycans biosynthesis and protein glycosylation (UGDH, GFPT2, GALNT2), respiratory chain (mt-ND1). The cellular macromolecule metabolic process is also a significantly enriched network, involving 26 out of the 59 upregulated proteins (i.e. 44%, Figure 4C and supplementary Table S11) and includes processes such as protein complex assembly (TM9sF4, DHX30, AP2M1), RNA metabolism and mRNA processing (DDX17, DDX5, DDX39bPRPF19, PRPF6, HNRNPF, CPSF6). To help clarify the specificity of our findings, we have added this text to the revised manuscript (lines 465-474).

      __46: Oocyte-secreted factors downregulate protein catabolic processes, and upregulate DNA binding, translation, and ribosome assembly in oocytes. --No direct evidence is provided. __RESPONSE #7 The proteomic data provides direct evidence that these processes are involved. Sentence modified at lines 47-48 to be more specific re processes. Additional text has been included (revised manuscript lines 434-443) to provide specific details of the differentially expressed proteins involved in each of these processes.

      48: Oocyte-secreted factors alter mitochondrial number... --Need to establish that the MitoTracker is a suitable tool to measure the number of mitochondria. RESPONSE #8____ We recognise that total mitochondrial uptake of the MitoTracker Orange dye could be a reflection of either mitochondrial function (polarity) and/or mitochondrial number, given the manufacturer’s (Thermo Fischer) statement that “MitoTracker™ Orange CMTMRos is an orange-fluorescent dye that stains mitochondria in live cells and its accumulation is dependent upon membrane potential”, as we specified in several places in the original manuscript (Lines 354-355, 366-367 and 235 of the marked up manuscript version) . However, we agree that in several places in the manuscript we also indicated that MitoTracker was being used as a measure of mitochondrial number. To avoid this ambiguity, we have made some clarifications in the text (revised manuscript lines 235, 351-352, 377, 481-482, and in Figure 5B legend). Given the extensive and diverse metabolic changes indicated by the proteomic data, our aim was to explore the potential role of mitochondria in response to cumulin and BMP15 treatment of COCs, which we did by use of EM morphology studies (figure 5A), mitochondrial respiration (figures 6B and 6C), quantification of energy metabolites, such as ATP, NAD and related compounds, by mass spectrometry (figure 6D), metabolites identified in multispectral unmixing studies (figure 7) and mitochondrial function using MitoTracker (figure 5B). Collectively this data suggested a modest downturn of energy metabolism, particularly in cumulin treated COCs. This downturn did not cause a change in net energy charge in COCs (figure 6D) despite a reduction in redox ratio in both cells (figure 7A and 7B) and respiration in COCs (Figure 6B and 6C), and could reflect adaptive changes in response to cumulin and BMP15, reflecting metabolic plasticity/Warburg effect, as explained in the discussion (revised manuscript lines 453-551).

      79: ...for maintaining genomic stability and integrity of the oocyte... 83: ...minimizing secondary production of potentially DNA damaging free radicals. --Please provide supporting references from the literature. RESPONSE #9 References have been added (lines 82 and 85 of the revised manuscript)

      373: This study provides a detailed exploration of the mechanisms by which oocyte-secreted factors... --No mechanistic studies were performed. RESPONSE #10 We respectfully disagree. One of many mechanisms we have studied here is OXPHOS. We have shown this is how OSFs change metabolism – that is a mechanism. As discussed at RESPONSE #1, these studies are as close as anyone can probably get currently to mechanistic studies of a noncovalent heterodimer, when the noncovalent homodimers are also in play, as also noted by reviewer #3 who specifically references mechanisms: “…… only functional work as the one presented in this manuscript can find the mechanisms of action of these hormones”. Please also refer to the comments in RESPONSE #5.

      383: Collectively, these data demonstrate that oocyte paracrine signaling remodels COC metabolism in preparation for ensuing fertilization and embryonic development. --Studies do not show that the differences observed between control and treatment groups are related to fertilizability or embryonic development. RESPONSE #11 The data in Fig 2C, 2D show exactly that; that the difference between control and treatment (cumulin) is an increase in embryonic development. It does not show fertilizability, so we removed that at lines 41 and 415.

      396: suggesting that cumulin affects meiosis in the oocyte and may increase meiotic fidelity... --This statement is highly speculative. RESPONSE #12 We accept this critique - reference to meiosis and meiotic fidelity removed, line 435 (revised manuscript).

      409: ...lacks the machinery for amino acid uptake... --Is the oocyte unable to take up any amino acids or only certain amino acids? RESPONSE #13 Thank you for noting this as this sentence is too absolute. Oocytes have a very poor capacity to take up most or even all AAs, which are instead supplied to the oocyte via cumulus cells. Sentence modified at lines 455-456 to be less absolute.

      In general, the manuscript is written clearly. However, in several places, technical terms or jargon will make tough going for readers who are not already familiar with the techniques being used. These should be explained using language that will be understood by journal readers who are unfamiliar with the details of the techniques. Examples include:

      51: define metabolic workload using scientific terms.

      RESPONSE #14____ “metabolic workload” rephrased to “metabolic processes”. Lines 52-53.

      67: metabolically 'inept' requires more precision. RESPONSE #15 “metabolically inept” rephrased to “metabolically dependent on surrounding granulosa cells” ____[5]____. Line 69

      262: explain 'multispectral analysis' RESPONSE #16 A citation has been added, which explains the technique (ref ____[6]____ at the end of this response letter, which is the same paper as citation [34] in the revised manuscript; lines 111 and 217; revised manuscript). A detailed explanation of this technique has also been added in the supplementary information, under the section “Multispectral microscopy”.

      268: how is 'limited' overlap defined. RESPONSE #17 The phrase “distinct profiles, with limited overlap between…” has been rephrased to “distinct profiles, between…” (line 279 of the revised manuscript), as the main point is that the patterns/profiles across treatments are different, and we did not quantify the extent of overlap.

      318: define higher workload RESPONSE #18 the phrase “…implying a higher workload for both organelles” has been replaced with a more specific explanation; “We suggest that such changes in morphology may be related to the remarkable increase in a diversity of metabolic processes which we observed (Figure 4C and supplementary Table S12), since ER morphology and architecture is known to be highly dynamic in response to environmental and developmental factors which affect cells” ____[7]____ (Lines 342-345).

      324: provide documentation or citations to support the assertion that the intensity of MitoTracker staining is an accurate proxy for the number of mitochondria.

      RESPONSE #19____ Please refer to explanation under RESPONSE #8

      358: Multispectral discrimination modelling utilised cellular image features from the autofluorescent profiles of oocytes and cumulus cells. --Please clarify this merthodology and provide support for its utility.

      RESPONSE #20____ The supplementary information section (Multispectral microscopy, lines 239-258) has been expanded and clarifications provided as to the wavelengths of the channels, the features used and the unsupervised nature of algorithms.

      360: intersection of union of 5-22%

      RESPONSE #21____ This is a measure of the extent of overlap of data distribution for each class (treatment), i.e. of how different they are. The ellipse (Fig 3D) represents one standard deviation around the central mean value for that data set. The overlap of these ellipses is quantified by their intersection over union (IoU) value, which is the ratio of the area of the two-ellipse intersections, divided by the area of their union (the shape created by their overlap being treated as creating one continuous object). IoU values range from 0 to 100% for fully separated and fully overlapping, respectively. Hence, a 5% IoU represents a low level of overlap of data distribution between treatments. Brief explanatory text has now been added at line 387-388.

      Comments on Figures. Fig. 3A, B. The total number of proteins and the number of differentially expressed proteins among the treatment groups don't match between A and B. For example, A (Mascot-Sheffield) indicates that 17 proteins were differentially expressed between untreated and cumulin-treated oocytes. B shows (138 + 74) expressed un the untreated but not cumulin-treated and (156 + 87) expressed in the cumulin-treated but not untreated. Please account for this difference. RESPONSE #22 The panels in Fig 3A and Fig 3B each contain different representations of the information contained within the proteomics dataset, and explain different aspects of the data. The Venn diagram panels in Figure 3B display the level of overlap of specific proteins identified in each cell, treatment and software subgroup. The degree of overlap in each cluster is high (i.e., 76 – 78% for Mascot/scaffold and 95 - 97 % for PD2.4) as would be expected within the same cell type and analysis approach, where the main variable is cell treatment. We agree that the total numbers in the Venn diagrams did not exactly match the total numbers in Figure 3A, which likely resulted from using slightly different parameters during data processing. We have now used exactly the same data set in panels A and B (the full PD2.4 and Mascot/scaffold datasets are shown in the supplementary proteomics summary Excel spreadsheet), so that total numbers are now identical, and will hopefully avoid any confusion in comparing across panels. However, the main conclusion to be drawn from Fig 3B remains unchanged, in that it shows that by far the majority of identified proteins overlap between treatments (control, BMP, cumulin), regardless of cell type or data analysis approach. However, it should be noted that Figure 3B has no information about protein fold change/differential expression, and only represents numbers of proteins confidently identified, and the level of overlap of identified proteins between treatments. Only panel 3A shows differential protein expression relative to the respective control groups.

      Fig. 3D. What do the circles represent and how were their parameters (size, position) established? RESPONSE #23 The separation of data distributions for each class is shown by an ellipse for each cluster, which encompasses one standard deviation around the central mean values. This text has now been added to the Fig 3 legend.

      Reviewer #1 (Significance (Required)): These studies identify changes in cumulus cells and oocytes that occur in response to addition of cumulin or BMP15 to the culture medium during in vitro maturation. While the data are new, the significance of the advance is limited by (i) the fact that the control group were exposed to physiological levels of GDF9 and BMP15, so this is essentially an over-epxression study and (ii) no mechanistic studies experimentally tested how the observed changes (eg, in quantity of a specific protein) affect the developmental potential of the oocytes or cumulus cells. RESPONSE #24 We thank the reviewer for their perspectives however we respectfully disagree on all accounts. We have rebutted these 2 concerns: point (i) at RESPONSE #1, and point (ii) at RESPONSE #5 above.

      Reviewer expertise: growth and meiotic maturation of the mammalian oocyte

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      Summary: The report by Richani et al, presents a research carried out in mice, in which they treated cumulus-oocyte complexes with either BMP15 and cumulin. Upon treatment they evaluated a series of biologically relevant parameters in oocytes and cumulus cells. Their findings indicate that the treatment with these molecules alter the molecular composition of oocytes and cumulus cells (proteome and metabolome), mitochondrial morphology in cumulus cells and overall oxygen consumption in COCs.

      Major comments: - Are the key conclusions convincing? - Should the authors qualify some of their claims as preliminary or speculative, or remove them altogether? * part of the discussion related to metabolic pathways being up regulated due to the treatments need to the revised because For instance, It is hard for me to grasp how a pathway with 2 proteins achieved FDR significance below 0.01, as I see in figure 4c

      RESPONSE #25____ Network enrichment was performed using the open access software STRING ( ____https://string-db.org/ [8]____), and we have now provided additional information on how we utilised STRING in the supplementary information section, under “Gene Ontology Network Enrichment Analysis” (lines 176-217). STRING utilises information available in the Gene Ontology (GO) database ( ____http://geneontology.org/docs/ontology-documentation/____ ) to determine; (a) how many of the differentially expressed proteins identified in the proteomics experimental data fall into specific networks, (b) how much enrichment this represents relative to a random network of the same size, and (c) whether the enrichment is statistically significant based on the FDR statistic. The size of each GO network within the background set (whole genome or other) will therefore be a major determinant of whether the number of proteins identified in the proteomics experiment represents significant enrichment of a particular network. A few proteins identified within a small background network will represent greater enrichment (and lower FDR score) than the same number of proteins in a much larger network. In fact the “count in network” is often approximately the inverse of the enrichment strength (see supplementary Table S12, within the supplementary dataset Excel spreadsheet). Note that only significantly differentially expressed proteins were used for the network analysis presented in this paper, so even in the case where just 2 proteins are significantly enriched in a network (e.g., “Farnesyl diphosphate metabolic process” identified in the GO biological process section of BMP15 treated cumulus cells) they represent two upregulated proteins in a small network, so the functional/biological significance of this is likely quite high.

      In revision of the manuscript we noticed that we had likely originally used the full lists of differentially expressed proteins for network analysis, rather than separating up and downregulated proteins as intended. Furthermore an updated version of STRING is now available, with improvements in the method of correction for multiple testing within the FDR output (STRING version 11.5, current since August 12, 2021). We have therefore revised the STRING network analyses, and have provided a list of the STRING input proteins (supplementary Table S11), STRINGv11.5 gene ontology (GO) functional enrichments for up and downregulated proteins in BMP and cumulin treated cumulus cells and oocytes respectively (supplementary Tables S12 and S13), and replaced the very large Figure 4C and D heatmaps (submitted version) with a summary (new Figure 4C; revised version). The updated heat maps can still be viewed in supplementary Tables S12 and S13 (the heatmaps now being the updated ones, deriving from our review response).

      * In the discussion the authors use the term "oocyte secreted factors" a lot (one example lanes 490, 515, 516, 517), but they should specify BMP15 and cumulin, because these were their treatments. *Including in the title, you did not evaluate all oocyte paracrine factors, just BMP15 and cumulin RESPONSE #26 “Oocyte secreted factors (OSFs)” replaced with BMP15 and cumulin throughout the manuscript where we refer specifically to our treatments, results or discussion of results, except where we refer to “these OSFs” (eg line 34), and not where we refer to the principal of OSF signalling more generically. Re the latter, hence we wish to retain the title as is, as BMP15 and cumulin are prototypical oocyte secreted factors, as the title refers to the principal more generally.

      - Would additional experiments be essential to support the claims of the paper? Request additional experiments only where necessary for the paper as it is, and do not ask authors to open new lines of experimentation. NA

      • Are the suggested experiments realistic in terms of time and resources? It would help if you could add an estimated cost and time investment for substantial experiments. NA

      • Are the data and the methods presented in such a way that they can be reproduced? *no, in some instances, the methods are not described, see my comment below about enrichment analysis. RESPONSE #27 Addressed next below

      • Are the experiments adequately replicated and statistical analysis adequate? *I was not able to access enrichment analysis.

      RESPONSE #28____ The method of Network Enrichment is now described in more detail in the supplementary methods section. See previous explanation under RESPONSE #25 above.

      *lines 241-242: "MitoTracker staining and data from metabolite analysis by mass spectrometry were analysed by one-way ANOVA with Tukey's (parametric data) or Kruskal-Wallis (non- parametric data) post-hoc tests. " Specify which test was used for which data RESPONSE #29 Post-hoc test for MitroTracker data was Tukey’s, as already stated in Figure 5 legend. Post-hoc test for metabolite analyses was Kruskal-Wallis – text now added to Figure 6 legend.

      Minor comments: - Specific experimental issues that are easily addressable. NA

      • Are prior studies referenced appropriately? Yes

      • Are the text and figures clear and accurate? *lines 178-180: "expressed proteins list was further analyzed using STRING software to explore clustering and enrichment of specific molecular functions, and biological pathways. Detailed methodology and rationale for this approach is provided in the supplementary methods." I did not read text in the supplementary materials indicating how enrichment analysis was carried out.

      RESPONSE #30____ Our apologies for this oversight. We have now provided additional information on how we utilised STRING in the supplementary information, in a new section titled “Gene Ontology Network Enrichment Analysis” (lines 176-217).

      * What was the concentration of treatment for the samples used for proteome and mascot/scaffold experiments?

      RESPONSE #31____ The two bioinformatic analyses were conducted on common biological samples, so naturally the treatment concentrations were also the same. Text modified at line 175 to make this clearer.

      * lanes 263 and 264: "Cell types and treatment conditions can be clearly distinguished based on these orthogonal global approaches." I did not see what is the basis for this statement

      RESPONSE #32____ The sentences immediately following this (i.e. lines 274-281) elaborated the basis for this statement, particularly where it is explicitly stated “____Proteomic heat maps (Fig. 3C) and multispectral analysis plots (Fig. 3D) both show distinct profiles, between controls, BMP15 and cumulin treated COCs, in both cell types.____”, at lines 277-281.

      The data for the two global approaches are shown in Figure 3C (heat maps generated by PD2.4 comparing differences in protein abundance across treatments, shown separately for cumulus cells and oocytes), and Figure 3D (linear discriminant analysis comparing differences in multispectral imaging data across treatments, shown separately for cumulus cells and oocytes). Both of these global analyses show clear differences in distribution pattern between controls (untreated) and treated samples (BMP15 and cumulin), in both oocytes and cumulus cells. The approaches are (a) global, since each relates to analysis of the complete cell extracts (as opposed to targeting a specific component/analyte), and (b) orthogonal because different and unrelated measurement techniques are used i.e., proteomics (mass spectrometry) and multispectral imaging (spectroscopy).____ *I did not understand the discrepancy between the numbers observed in Figure 3A and Figure 3B.

      RESPONSE #33____ Refer to RESPONSE #22 above. We have checked the data, and revised the Venn diagrams (Figure 3B) with data analysed using identical parameters, for both Figures 3A and 3B, to avoid confusion over protein numbers. We also noticed and corrected a discrepancy with regard to the number of differentially expressed oocyte proteins under the merged data column of Figure 3A.____ *I could not make sense of the shades of green or red that were used in 4C and 4D. Is the reader only supposed to make those comparisons within column? RESPONSE #34 Note: Figures 4C and 4D are now Supplementary Tables S12 and S13. The red shades represent network enrichment analysis of upregulated proteins, while the green shades represent network enrichment analysis of downregulated proteins. The colour gradients in each case follow the numerical values for “count in network”, enrichment strength, and lower FDR, with greater colour intensity for higher numbers (and lower FDR). However, we agree that the original four panels (A, B, C and D) comprising figure 4, made for a very large and potentially overwhelming figure. To simplify the data presentation we have reprocessed the data in STRING (see details under RESPONSE #25 above) and have moved the now considerably shorter network lists (originally displayed as Figures 4C and 4D) to supplementary Tables S12 and S13, and the new Figure 4C provides a network enrichment summary instead. This is likely easier to comprehend, with the marked contrast in networks identified between oocytes and cumulus cells easier to see. The numbers of up and downregulated proteins on which the network analysis is based are also shown in Figure 4C, while the specific proteins used and networks identified are shown in supplementary tables S11, S12 and S13 (original colour coding retained, and also explained within each table). - Do you have suggestions that would help the authors improve the presentation of their data and conclusions? *Figure 4 is really hard to process. At least in my pdf it spanned 4 pages.

      RESPONSE #35____ Indeed Figure 4 was large and has now been shortened. We made considerable effort to attempt to present in Fig 4 the vast amount of proteomic data in a summarized, hopefully comprehensible fashion. We have now moved Figs 4C and 4D to the supplementary, and replaced it with the simplified new Fig 4C (tabular format). Pease also see comments under RESPONSES#25 and #34 re this. *I did not understand why put networks that are not significant as up-regulated or down-regulated. Besides, as mentioned above, I do not know how significance was assessed.. RESPONSE #36 Network analysis was performed using only those proteins which were significantly differentially expressed and had a consistent direction of fold change in both mascot/scaffold spectral counting and PD2.4 peak intensity proteomics quantitative approaches. Proteins with no significant expression change (i.e., the majority of proteins, which represented proteins with __Reviewer #2 (Significance (Required)):

      • Describe the nature and significance of the advance (e.g. conceptual, technical, clinical) for the field. - Place the work in the context of the existing literature (provide references, where appropriate). *This paper is significant because it provided a variety of measurements following the treatment of cumulus cells with BMP15 and cumulin. The authors show that these two oocyte factors can impact the molecular structure, physiology and structure of organelles in cumulus cells. The work is well contextualized with the current literature. RESPONSE #37 We thank the reviewer for these positive remarks.

      • State what audience might be interested in and influenced by the reported findings. *Researchers in the field of developmental biology would be most interested in this report.

      • Define your field of expertise with a few keywords to help the authors contextualize your point of view. Indicate if there are any parts of the paper that you do not have sufficient expertise to evaluate. * I do not have expertise in hyperspectral analysis. I have been working with cumulus-oocyte complexes for over a decade, mixing technologies in cell biology, microscopy, high-throughput genome, and proteome analysis. We do all our bioinformatics work in-house.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      The work is interesting. Cumulin is a heterodimer hormone formed of GDF9 and BMP15. It is the main oocyte secreted factor. Being an heterodimer, gene knockout provides very little information about its mechanism of action. The team has a unique form of cumulin that is stable. This is why I think this work is important. However, I found two technical issues: one regarding mitochondrial count using MitoTracker and the other about comparing gene lists between the two cell types when protein input submitted to mass spectrometry differ between the two cell types. It is expected to find more with more input material. The text would need to be adjusted accordingly. Also, there is a lot of free statements and a lack of precision that is annoying. In my opinion, there are many overstatements that are not supported by the data because the work was not designed to test what is stated. The Discussion is very circular as the same statements come back on the next pages. RESPONSE #38 See specific responses below

      Detailed review:

      The manuscript entitled "Oocyte and cumulus cell cooperativity and metabolic plasticity under the direction of oocyte paracrine factors" reports an in depth analysis of the exposure of cumulus oocyte complexes to either BMP15 or cumulin, the GDF9-BMP15 heterodimer. Impact assessment was done by determining developmental competence of the exposed oocytes, comparative profiling of the proteomes and spectral emissions as well as testing a potential impact at the ultrastructure level by electron microscopy imagery. Mitochondrial respiration as well as abundance of related metabolites was contrasted between the two treatments.

      Overall, the work is interesting. It is very difficult to study hormonal heterodimers because they originate from two different genes and they can naturally be found in a monomeric as well as a dimeric state. Such functional analysis cannot be done using gene knockout mouse lines. Genetic disruption provided the background that GDF9 and BMP15 are key oocyte secreted factors however only functional work as the one presented in this manuscript can find the mechanisms of action of these hormones. RESPONSE #39 We thank the reviewer for these positive comments, especially in relation to the difficulty of getting to the mechanism of actions of a non-covalent heterodimer, and hence the importance of functional experiments in providing mechanistic insights.

      Comments:

      I really appreciated the reference to auto-symbiosis. We often see the reference to a cellular syncytium but this one is interesting. RESPONSE #40 Thank you.

      Although I appreciated the work, two important technical issues (between cell types comparisons and mitochondrial count) have been raised and there is a bit of unnecessary overselling throughout the manuscript. Sticking to the results would keep the value of the work high and wouldn't give that impression of overstatement. RESPONSE #41 Technical issues – see responses below, as well as responses to other reviewers. We have provided additional methodological information for greater clarity, and added specific observations from our data, to support all statements, to avoid the impression of unsubstantiated overstatements.

      Technical issues:

      While the gene/protein enrichment analysis can be influenced by the input material submitted to mass spectrometry, the gene network analysis is influenced by the number of gene/proteins available for the enrichment analysis. It is thus difficult to compare both cell types. RESPONSE #42 We agree that shorter protein lists might be expected to result in fewer networks. However, it is interesting to consider the possible reasons for the shorter list:

      (1) In our case the amount of protein extracted from oocytes (2-3____m____g) was much less than from cumulus cells (15-17____m____g) as explained in the “Mass Spectrometry for proteomic analysis” section in the Supplementary Information. This is because COCs have many more cumulus cells than oocytes by number as well as total mass. Consequently it was possible to load a larger ____m____g amount of total peptides from cumulus cells onto the nanoLCMSMS system, but it should be noted that on-column loading is not only determined by the total amount of material injected, but also by the limits in capacity of the C18 peptide capture cartridge upstream from the column (which is 1 – 1.5 ug estimated from the binding capacity of C18 with a bed volume of 0.35____m____L, since the trap cartridges have dimensions of 300____m____m ID and 5mm length; ____http://tools.thermofisher.com/content/sfs/manuals/Man-M5001-LC-Nano-Capillary-Micro-Columns-ManM5001-EN.pdf____ and ____https://www.optimizetech.com/opti-pak-trap-columns/____ ). Consequently, the different initial loading of oocyte vs cumulus cell proteins/peptides are likely to have made little if any contribution to proteome coverage, since 2-17____m____g all exceed the trap cartridge binding capacity, and consequently 1 - 1.5____m____g was captured and transferred to the nano-column, while the excess was transferred to waste. Based on the capacity limits of the capture cartridge, there was likely enough peptides/proteins in both oocyte and cumulus cell extracts to reach the saturation point, and therefore much more consistent on-column loadings than the initial ____m____g loadings would imply. We have added some additional information re this to the method section (see the section “Mass Spectrometry for proteomic analysis” in the Supplementary Information).

      (2) The expressed proteomes of different cell types may be expected to differ not only in specific proteins expressed but also in the number of different proteins. In a recent study by Marei et al ____[9]____, equal amounts of total protein (9.5ug) from bovine oocytes and matching cumulus cells were prepared for their proteomics comparisons, and interestingly these authors also report about half as many proteins identified in oocytes as compared with cumulus cells, despite equal amounts of total protein used; “A total of 1703 and 1185 proteins were identified in CCs and oocytes, respectively, 679 of which were common.” Furthermore, a transcriptomic study of bovine oocytes and cumulus cells by Moorey et al ____[10]____, showed 69 and 128 differentially expressed genes (DEGs) in oocytes and cumulus cells respectively (comparing small vs large cells in each case), pointing to about double the differential gene expression in cumulus cells than oocytes, again implying a larger cumulus cell vs oocyte transcriptome. Our data support these observations, which collectively suggest a real difference in proteome size between oocytes and cumulus cells. If the difference in proteome size is real, then differences in network enrichment are also likely to have biological relevance, despite differences in size of the differentially expressed proteins lists.

      (3) Even if initial protein loading was a contributing factor to the size of the oocyte vs cumulus cell proteomes, it is of note that we observed approximately 2 fold fewer total proteins identified in oocytes as in cumulus cells (Figure 3A, 3B and new Figure 4C), yet the difference between number of identified networks is multiple-fold (a cumulative total of 2 networks identified in BMP15 and cumulin treated oocytes vs 143 networks identified in BMP15 and cumulin treated cumulus cells – see new Figure 4C). Furthermore, there does not seem to be a strictly linear relationship between the number of proteins submitted for network analysis and the numbers of networks identified. For example, 34 upregulated proteins in cumulin treated oocytes identified a single enriched network, while a similar number of 38 upregulated proteins in BMP15 treated cumulus cells, identified a total of 42 networks (new Figure 4C), and similarly cumulin treated cumulus cells had 59 upregulated proteins and 58 downregulated proteins, which resulted in 57 and 23 enriched networks respectively.

      Also, when performing GO terms analysis, the level of "branching" can explain the results. In other words, GO terms are organized in a tree like structure where general elements (e.g. nucleus) are delineated in finer elements (e.g. nuclear function) leading to finer ones (e.g. DNA binding)... to finer ones (e.g. DNA repair)... etc. The number of genes/proteins available in the initial list directly dictates to which level of precision the analysis can reach. In the present work, the number of identified network may simply reflect the number of elements available in the initial lists. With more info on the cumulus cells side, it is logical to be able to reach finer branches that contain only a few genes. I have looked in the supplemental data files but could not find more info about the background used. Was it all known proteins? Was it all identified proteins where the differentially expressed proteins are compared to the detected proteins? Using the list of detected proteins as background for the analysis could help. Proteome Discoverer generated much less differentially expressed proteins between treatments than Mascot/Scaffold (2-17 vs. 74-390). Maybe use the Mascot/Scaffold data using the same number of top genes (e.g. 87) between both cell types. Then it would be much more comparable. RESPONSE #43 Please also refer to the explanations under RESPONSE #34 and #42 above. We have added an additional explanation of how we performed the enrichment analysis, in the supplementary information section under the heading “Gene Ontology Network Enrichment Analysis”. In the data presented here we used the whole mouse genome as our background set. The number of total proteins identified by Mascot/Scaffold and ProteomeDiscoverer were similar, but actually considerably more differentially expressed proteins were identified using ProteomeDiscoverer (Fig 3A), as expected using peak intensity vs spectral counting ____[11]____. The spectral counting approaches usually identify fewer differentially expressed proteins, but also with a lower quantitative false positive rate, while peak intensity approaches tend to identify more differentially expressed proteins, but with a higher quantitative false positive rate ____[11]____. Our reasoning was therefore to combine proteins which vary in common across both platforms, to maximise the differentially expressed proteins list while simultaneously minimising the quantitative false positive rate. We thank the reviewer for the suggestion of using our full protein list as the background set. Initially we revised our network enrichment analysis (see comments under RESPONSE #25) still using the mouse whole genome, resulting in fewer overall networks, but improved contrast between oocytes and cumulus cells (see summary in new Figure 4C, and network analysis details in supplementary Tables S12 and S13). We then repeated the network analyses using our full protein list (4450 proteins identified in both oocytes and cumulus cells; see background list in Supplementary Table S11) as the background set. With this we similarly found no enriched GO networks for BMP15 and cumulin treated oocytes, and only 6 and 1 enriched network in BMP15 and cumulin treated cumulus cells. We suggest that detecting network enrichment against a cell specific background list may not give us the same level of “contrast” as can be achieved when comparing against the whole mouse genome.

      Line 226 and 324-328 and line 350: I have never seen the use of MitoTracker Orange to count mitochondria. According to the manufacturer: "MitoTracker Orange CMTMRos is an orange-fluorescent dye that stains mitochondria in live cells and its accumulation is dependent upon membrane potential. The dye is well-retained after aldehyde fixation." It is indicative of mitochondrial potential but it is not a method to count the number of mitochondria within a cell. I do not agree that more fluorescence means more mitochondria. RESPONSE #44 We agree and in places we used ambiguous language re mitochondrial function vs mitochondrial number. We have now clarified and corrected this - please refer to detailed comments and manuscript changes under RESPONSE #8.

      I understand that the MitoTracker data is counterintuitive to the oxygen consumption rate and stable levels of energetic metabolites. However, as the authors mention, mitochondria are known to be capable of switching from aerobic to anaerobic energy production. In some cases, heterogeneity in the mitochondrial population (such as the one in the oocyte) could mean that a mosaic respiratory potential exists where some mitochondria are more aerobic than others... To change the number of mitochondria, either fission or mitophagy must occur. Although mitochondrial DNA replication is done in approximatively 2 h and fission/division can occur over 1 h, and protein ubiquitination is done over 12 h-18 h during mitophagy, TEM micrographs (figure 5) do not show elongated mitochondria in the process of division. To detect active mitophagy, protein markers and association with lysosome would be needed. A shift in mitochondrial number may not be the suitable interpretation of the data. RESPONSE #45 Please refer to comments under RESPONSE #8

      For the spectral data analysis (Figure 3D), how did the three replicates perform? The figure does not show the replication variance relative to the treatment variance. RESPONSE #46 A version of Figure 3D but with the replicates colour-coded has been added to Supplementary Material (Supplementary Figure 2) and the manuscript text has been revised with the information that data from the three replicates are shown, added to the caption to Figure 3D.

      Wording/interpretation issues

      Lines 114-116: "This intercellular cooperativity facilitates oocyte maturation while simultaneously protecting germ-line genomic integrity, in a manner which could not be achieved by a single cell." This is an overstatement because genomic integrity was not assessed. Why consider that the nuclear function found in the proteome contrast is necessarily associated with genomic integrity. Miosis requires in dept chromatin handling. What evidence provided from the results is associated with cellular numbers. The presence of cumulus cells is known to support meiosis but it doesn't mean that some of the cellular processes have been imparted to the surrounding somatic cells. The work done for this manuscript does not test any of this claim. RESPONSE #47 We accept this point and agree that, especially the claim re germ-line genomic integrity, is an overstatement. This has been removed. We maintain however that there is ample evidence in our results that there is clear inter-cellular metabolic cooperativity between oocyte and cumulus cells and that this ultimately leads to an oocyte with improved developmental competence. The sentence has been modified to reflect this, line 117-118.

      On numerous occasions, the statements are imprecise. For example: Line 274: "More than double the number..." Since doubling a minute value does not mean the same thing as doubling a large value, values, measurements with units and ideally with SEM should be added. RESPONSE #48 Has been rephrased (see line 284 of the revised manuscript)

      Line 287: "... and almost a third more significant networks..." Please add values. RESPONSE #49 Section has been deleted (line 291-300 of the revised manuscript)

      On the same statement, since sample input material to the mass spectrometry is vastly different between cumulus cells and oocytes, is it truly comparable? Could these differences between the two cell types be associated with the amounts of proteins in the extracted samples? Typically, more variable results are obtained with the low input. It sometimes lead to apparently more difference between treatments simply because of low count numbers. On line 292, authors mentioned that protein loading was considered. How was that done? Low input cannot be compensated or normalized. The following statement on line 293 indicate that more proteins were identified in cumulus cells. This is probably due to more input material submitted to mass spectrometry. It is not necessarily a difference in protein diversity between cumulus cells and oocytes. RESPONSE #50 Please refer to detailed explanations under RESPONSES #42 and #43

      Line 293: "... resulted in the identification of about double the number..." Please add values. RESPONSE #51 Values added at lines 305-306, and additional detail has been added to this section of the manuscript (lines 305-317 revised manuscript). Line 294: "However, there were 4-5 times as many differentially expressed proteins..." Please add values. RESPONSE #52 Values added and additional detail added to this section (new lines 309-312 of the revised manuscript).

      Line 298: "...difference was quite marked..." More factual info should be added. RESPONSE #53 Values added and additional detail has been provided (lines 314-317 of the revised manuscript), as follows; “____Cumulin appeared to have a greater impact on proteomic differential expression in both cell types than BMP15 did, with 59 vs 38 and 34 vs 27 upregulated proteins in cumulin vs BMP15 treated cumulus cells and oocytes respectively, and similarly 14 vs 6 downregulated proteins in cumulin vs BMP15 treated cumulus cells and oocytes respectively (Figure 4C)”.

      Line 305: Again, the whole comparison between cell types could be argued from the standpoint of input material subjected to the analysis. Given the point is to state that cumulin has a profound impact on cumulus cells, maybe it is not necessary to compare with the oocyte data. It is logical that an oocyte secreted factor targets the neighbouring cells. The point can be made without raising the question about the potential issue of input material. RESPONSE #54 We agree with the reviewers point that it is logical that OSFs should target cumulus cells, with lesser impact on the oocyte. Nonetheless the treatments were performed on COCs, and even though the OSFs are targeting the cumulus cells, however ultimately the cumulus cells response is expected to impact oocytes. Therefore, it is relevant to look at proteomic changes to both cell types and also the related network analysis. We have however rephrased this section, to be more specific as to which data we are reporting, and have included additional citations (lines 325-334 of the revised manuscript).

      __Line 317-317: "... exhibited more rounded and swollen mitochondria..." How was that determined? In the periphery of the oolemma, mitochondria aggregates in clusters which can be quite different from one another. Maybe proportions of different shapes of mitochondria could be provided if enough mitochondria are counted from the EM micrographs. __RESPONSE #55 These are subjective observations of the typical morphological features seen in response to the different treatments. This is the typical application of TEM. Quantitative features of mitochondria are better assessed using confocal than TEM, which is the complimentary approach we took using MitroTracker in the companion figure 5B, the text for which immediately follows the TEM results. We altered the text at the sentence in question to note that these are subjective observations (line 340).

      Line 169: What do you mean by "The results were merged based on consistency..."? This seems to be a trivial way to analyse the data. RESPONSE #56 The majority of published papers reporting data dependent analysis (DDA) proteomics results utilise just a single quantitative method (i.e., either spectral counting or peak intensity). This certainly simplifies reporting, and avoids confronting uncomfortable discrepancies between different analytical approaches. However, we reasoned that robust expression change data would maintain consistency, despite the orthogonal quantitative methods. We consider it a notable strength of the approach used here that we have utilised a differentially expressed proteins list which includes only those proteins with consistent direction of fold-change in both the spectral counting and peak intensity workflows. Please also refer to comments under RESPONSE #43, re spectral counting vs peak intensity quantitative methods in data dependent analysis (DDA) proteomics.

      Line 170: "A further requirement was that at least one, if not both methods..." Again, when did you decide to use one method or to use both? Why not use the common ground from both methods? RESPONSE #57 Refer also to RESPONSE #43. In fact the main question being asked in many/most proteomics experiments is whether there is a real expression change between treatment groups. Therefore fold-change is the most pertinent common ground across disparate quantitative methodology, and indeed commonality of fold-change was the basis for merging the datasets. Since integrating peak areas is a very different approach to counting the number of spectra, then this difference in approach can make a big difference to the p-values, and is the reason why spectral counting is less sensitive to detect differential expression. For similar reasons the fold-change ratio may differ somewhat between these quantitative methodologies. However direction of fold-change is a minimum requirement for demonstrating consistent trends, hence we used this as the common ground for merging the datasets.

      Line 384: Is the paracrine signaling remodeling COC metabolism or is it enhancing the rate at which it is done? I believe this switch in metabolism occurs in untreated COCs. RESPONSE #58 We see the reviewers point in this subtle difference in wording. We agree that there is a switch in metabolism in untreated COCs during maturation – our point is that that process of changing metabolism is further remodelled by oocyte paracrine signals, to the overall betterment of the oocyte in terms of competence. We have edited this sentence to make this point clearer (line 413-415). Our data on energy charge, respiration, energy metabolite levels (Figure 6), redox potential (Figure 7) and mitotracker intensity (Figure 5) are all presented in comparison with “untreated” cells, and our conclusion that there is remodelling of metabolism is therefore relative to “untreated” COCs.

      __ __The Discussion is somewhat circular. Section will need to be adjusted if the Mitotracker-based mitochondrial count and between cell types gene/protein lists comparisons are removed.

      Accounts for mitochondrial counts: (lines 387-393) (lines 424-427) (line 463).

      RESPONSE #59 All reference to Mitotracker in the context of mitochondrial counts only have been altered to Mitotracker being an indicator of mitochondrial function/polarity and/or counts. Accounts for comparisons of gene lists length between cell types: Lines 389-391 and 475-477 and 496-499). RESPONSE #60 Please see comments under RESPONSE # 53 and the new Figure 4C.

      Line 395: "... a substantial number of oocyte upregulated proteins... Please provide number. RESPONSE #61 Additional specific proteins have been listed to support our claims of effects on specific processes (see lines 435-443 of the revised manuscript). Also see comments under RESPONSE # 7.

      Line 397: The data was not designed to test the potential of cumulin to preserve meiotic fidelity. This is an overstatement since DNA binding is part of the normal course of even during meiosis. Again, cumulin could accelerate the kinetic of meiosis. RESPONSE #62 Reference to meiosis and meiotic fidelity removed, line 435.

      __ __Line 402-405: the work was not designed to determine if cumulin would shift work allocation between the oocyte and the cumulus cells. Showing that cumulin drives meosis is interesting by itself.

      __RESPONSE #63____ Not clear that any change is requested or needed. This sentence is interpreting the significance of the results, as required in a Discussion.


      __Line 453-455: the link with the epigenome is an overstatement. RNA and DNA processing pathways are general cellular processes.

      RESPONSE #64____ The link to the epigenome was a reference to some published work. However it was linked to observations in the current data, and additional information has now been added to the updated manuscript to explain this further, as follows (currently lines 509-516);

      "These included significantly enriched networks of RNA binding, helicase activity, ribonucleoprotein complex biogenesis, and mRNA processing (supplementary Tables S11 and S12; upregulated proteins RNF20, SHMT1, DHX30, DDX17, DDX5, PRPF19, RPS4X, NOP58, DDX39b, HNRNPF, RPS271, NOP56, PRPF6, POLR2b, CPSF6, OOEP), as well as upregulation of key epigenetic regulators (HDAC2 and UHRF1; see supplementary Table S11), histone modifying protein MTA2, and significant network enrichment of the spliceosomal complex (supplementary Table S12; proteins DDX5, PRPF19, HNRNPF, PRPF6, POLR2B), which has been linked to epigenetic regulation ____[12]____.

      Minor details Line 36: I suggest to be more precise on the "nuclear" function that is affected in the oocyte. Given that oocytes are transcriptionaly quiescent at this stage, some might argue that it is a vague statement.

      RESPONSE #65____ Information relating to specific oocyte upregulated proteins and their cellular roles has been added to the updated manuscript (currently lines 434-443).

      DNA binding and ribosomal constituents (Fig. 4A, 4C),

      In vitro should be in italic because it is Latin. RESPONSE #6____6 corrected throughout

      __Lines 125-126: are the batch numbers relevant to anything? __RESPONSE #6____7 We would assume so – for the historical record. These are in-house produced proteins, cumulin is complex to produce and only a few labs worldwide have made it.

      __Line 168: Mascor = Mascot __RESPONSE #6____8 Corrected

      __Line 168: a reference for the software? __RESPONSE #6____9 URL and published references added (lines 172-175 revised manuscript)

      Line 178: need a reference for the software? RESPONSE #70 URL and published references added (line 185)

      __Line 187: Need a complete source for "Procure, 812" __RESPONSE #71 Added

      Line 188: Need a complete source for "Diatome" RESPONSE #72 Added

      Line 197: Need a complete source for "Cell-Tak" RESPONSE #73 Added

      Line 232: though = through RESPONSE #74 Corrected

      Line 243: define OCR RESPONSE #75 Added

      Line 268: If I am not mistaking, it is not a multispectral analysis. The multispectral values were analysed through a principal component analysis. RESPONSE #7____6 Data was analysed through linear discriminative analysis (LDA). This information has been added in Line 278.

      Line 363: What is the "behaviour" of an oocyte and cumulus cells? RESPONSE #77 replaced with “function”

      Line 512-513: Maybe add more on the fact that most clinics use ovulated eggs and do not perform IVM. However, IVM is needed is specific contexts such as PCOS. RESPONSE #78 Edited accordingly; lines 575-577.

      Reviewer #3 (Significance (Required)):

      Cumulin is the most potent oocyte secreted factor. Its mecanism of action is still unknown.

      I have been working on the mammalian oocyte for the past 25 years.

      References

      1. Mester, B., et al., Oocyte expression, secretion and somatic cell interaction of mouse bone morphogenetic protein 15 during the peri-ovulatory period. Reprod Fertil Dev, 2015. 27(5): p. 801-11.
      2. Hussein, T.S., J.G. Thompson, and R.B. Gilchrist, Oocyte-secreted factors enhance oocyte developmental competence. Dev Biol, 2006. 296(2): p. 514-21.
      3. Mottershead, D.G., et al., Cumulin, an Oocyte-secreted Heterodimer of the Transforming Growth Factor-beta Family, Is a Potent Activator of Granulosa Cells and Improves Oocyte Quality. J Biol Chem, 2015. 290(39): p. 24007-20.
      4. Gilchrist, R.B., M. Lane, and J.G. Thompson, Oocyte-secreted factors: regulators of cumulus cell function and oocyte quality. Hum Reprod Update, 2008. 14(2): p. 159-77.
      5. Sugiura, K., F.L. Pendola, and J.J. Eppig, Oocyte control of metabolic cooperativity between oocytes and companion granulosa cells: energy metabolism. Dev Biol, 2005. 279(1): p. 20-30.
      6. Campbell, J.M., et al., Multispectral autofluorescence characteristics of reproductive aging in old and young mouse oocytes. Biogerontology, 2022. 23(2): p. 237-249.
      7. Schwarz, D.S. and M.D. Blower, The endoplasmic reticulum: structure, function and response to cellular signaling. Cell Mol Life Sci, 2016. 73(1): p. 79-94.
      8. Szklarczyk, D., et al., STRING v11: protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Res, 2019. 47(D1): p. D607-D613.
      9. Marei, W.F.A., et al., Proteomic changes in oocytes after in vitro maturation in lipotoxic conditions are different from those in cumulus cells. Sci Rep, 2019. 9(1): p. 3673.
      10. Moorey, S.E., et al., Differential Transcript Profiles in Cumulus-Oocyte Complexes Originating from Pre-Ovulatory Follicles of Varied Physiological Maturity in Beef Cows. Genes (Basel), 2021. 12(6).
      11. Ramus, C., et al., Benchmarking quantitative label-free LC-MS data processing workflows using a complex spiked proteomic standard dataset. J Proteomics, 2016. 132: p. 51-62.
      12. Luco, R.F., et al., Epigenetics in alternative pre-mRNA splicing. Cell, 2011. 144(1): p. 16-26.
    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      The work is interesting. Cumulin is a heterodimer hormone formed of GDF9 and BMP15. It is the main oocyte secreted factor. Being an heterodimer, gene knockout provides very little information about its mechanism of action. The team has a unique form of cumulin that is stable. This is why I think this work is important. However, I found two technical issues: one regarding mitochondrial count using MitoTracker and the other about comparing gene lists between the two cell types when protein input submitted to mass spectrometry differ between the two cell types. It is expected to find more with more input material. The text would need to be adjusted accordingly. Also, there is a lot of free statements and a lack of precision that is annoying. In my opinion, there are many overstatements that are not supported by the data because the work was not designed to test what is stated. The Discussion is very circular as the same statements come back on the next pages.

      Detailed review:

      The manuscript entitled "Oocyte and cumulus cell cooperativity and metabolic plasticity under the direction of oocyte paracrine factors" reports an in depth analysis of the exposure of cumulus oocyte complexes to either BMP15 or cumulin, the GDF9-BMP15 heterodimer. Impact assessment was done by determining developmental competence of the exposed oocytes, comparative profiling of the proteomes and spectral emissions as well as testing a potential impact at the ultrastructure level by electron microscopy imagery. Mitochondrial respiration as well as abundance of related metabolites was contrasted between the two treatments.

      Overall, the work is interesting. It is very difficult to study hormonal heterodimers because they originate from two different genes and they can naturally be found in a monomeric as well as a dimeric state. Such functional analysis cannot be done using gene knockout mouse lines. Genetic disruption provided the background that GDF9 and BMP15 are key oocyte secreted factors however only functional work as the one presented in this manuscript can find the mechanisms of action of these hormones.

      Comments:

      I really appreciated the reference to auto-symbiosis. We often see the reference to a cellular syncytium but this one is interesting.

      Although I appreciated the work, two important technical issues (between cell types comparisons and mitochondrial count) have been raised and there is a bit of unnecessary overselling throughout the manuscript. Sticking to the results would keep the value of the work high and wouldn't give that impression of overstatement.

      Technical issues:

      While the gene/protein enrichment analysis can be influenced by the input material submitted to mass spectrometry, the gene network analysis is influenced by the number of gene/proteins available for the enrichment analysis. It is thus difficult to compare both cell types.

      Also, when performing GO terms analysis, the level of "branching" can explain the results. In other words, GO terms are organized in a tree like structure where general elements (e.g. nucleus) are delineated in finer elements (e.g. nuclear function) leading to finer ones (e.g. DNA binding)... to finer ones (e.g. DNA repair)... etc. The number of genes/proteins available in the initial list directly dictates to which level of precision the analysis can reach. In the present work, the number of identified network may simply reflect the number of elements available in the initial lists. With more info on the cumulus cells side, it is logical to be able to reach finer branches that contain only a few genes. I have looked in the supplemental data files but could not find more info about the background used. Was it all known proteins? Was it all identified proteins where the differentially expressed proteins are compared to the detected proteins? Using the list of detected proteins as background for the analysis could help. Proteome Discoverer generated much less differentially expressed proteins between treatments than Mascot/Scaffold (2-17 vs. 74-390). Maybe use the Mascot/Scaffold data using the same number of top genes (e.g. 87) between both cell types. Then it would be much more comparable.

      Line 226 and 324-328 and line 350: I have never seen the use of MitoTracker Orange to count mitochondria. According to the manufacturer: "MitoTracker{trade mark, serif} Orange CMTMRos is an orange-fluorescent dye that stains mitochondria in live cells and its accumulation is dependent upon membrane potential. The dye is well-retained after aldehyde fixation." It is indicative of mitochondrial potential but it is not a method to count the number of mitochondria within a cell. I do not agree that more fluorescence means more mitochondria.

      I understand that the MitoTracker data is counterintuitive to the oxygen consumption rate and stable levels of energetic metabolites. However, as the authors mention, mitochondria are known to be capable of switching from aerobic to anaerobic energy production. In some cases, heterogeneity in the mitochondrial population (such as the one in the oocyte) could mean that a mosaic respiratory potential exists where some mitochondria are more aerobic than others... To change the number of mitochondria, either fission or mitophagy must occur. Although mitochondrial DNA replication is done in approximatively 2 h and fission/division can occur over 1 h, and protein ubiquitination is done over 12 h-18 h during mitophagy, TEM micrographs (figure 5) do not show elongated mitochondria in the process of division. To detect active mitophagy, protein markers and association with lysosome would be needed. A shift in mitochondrial number may not be the suitable interpretation of the data.

      For the spectral data analysis (Figure 3D), how did the three replicates perform? The figure does not show the replication variance relative to the treatment variance.

      Wording/interpretation issues

      Lines 114-116: "This intercellular cooperativity facilitates oocyte maturation while simultaneously protecting germ-line genomic integrity, in a manner which could not be achieved by a single cell." This is an overstatement because genomic integrity was not assessed. Why consider that the nuclear function found in the proteome contrast is necessarily associated with genomic integrity. Miosis requires in dept chromatin handling. What evidence provided from the results is associated with cellular numbers. The presence of cumulus cells is known to support meiosis but it doesn't mean that some of the cellular processes have been imparted to the surrounding somatic cells. The work done for this manuscript does not test any of this claim.

      On numerous occasions, the statements are imprecise. For example: Line 274: "More than double the number..." Since doubling a minute value does not mean the same thing as doubling a large value, values, measurements with units and ideally with SEM should be added.

      Line 287: "... and almost a third more significant networks..." Please add values.

      On the same statement, since sample input material to the mass spectrometry is vastly different between cumulus cells and oocytes, is it truly comparable? Could these differences between the two cell types be associated with the amounts of proteins in the extracted samples? Typically, more variable results are obtained with the low input. It sometimes lead to apparently more difference between treatments simply because of low count numbers. On line 292, authors mentioned that protein loading was considered. How was that done? Low input cannot be compensated or normalized. The following statement on line 293 indicate that more proteins were identified in cumulus cells. This is probably due to more input material submitted to mass spectrometry. It is not necessarily a difference in protein diversity between cumulus cells and oocytes.

      Line 293: "... resulted in the identification of about double the number..." Please add values.

      Line 294: "However, there were 4-5 times as many differentially expressed proteins..." Please add values.

      Line 298: "...difference was quite marked..." More factual info should be added.

      Line 305: Again, the whole comparison between cell types could be argued from the standpoint of input material subjected to the analysis. Given the point is to state that cumulin has a profound impact on cumulus cells, maybe it is not necessary to compare with the oocyte data. It is logical that an oocyte secreted factor targets the neighbouring cells. The point can be made without raising the question about the potential issue of input material.

      Line 317-317: "... exhibited more rounded and swollen mitochondria..." How was that determined? In the periphery of the oolemma, mitochondria aggregates in clusters which can be quite different from one another. Maybe proportions of different shapes of mitochondria could be provided if enough mitochondria are counted from the EM micrographs.

      Line 169: What do you mean by "The results were merged based on consistency..."? This seems to be a trivial way to analyse the data.

      Line 170: "A further requirement was that at least one, if not both methods..." Again, when did you decide to use one method or to use both? Why not use the common ground from both methods?

      Line 384: Is the paracrine signaling remodeling COC metabolism or is it enhancing the rate at which it is done? I believe this switch in metabolism occurs in untreated COCs.

      The Discussion is somewhat circular. Section will need to be adjusted if the Mitotracker-based mitochondrial count and between cell types gene/protein lists comparisons are removed.

      Accounts for mitochondrial counts: (lines 387-393) (lines 424-427) (line 463).

      Accounts for comparisons of gene lists length between cell types: Lines 389-391 and 475-477 and 496-499).

      Line 395: "... a substantial number of oocyte upregulated proteins... Please provide number.

      Line 397: The data was not designed to test the potential of cumulin to preserve meiotic fidelity. This is an overstatement since DNA binding is part of the normal course of even during meiosis. Again, cumulin could accelerate the kinetic of meiosis.

      Line 402-405: the work was not designed to determine if cumulin would shift work allocation between the oocyte and the cumulus cells. Showing that cumulin drives meosis is interesting by itself.

      Line 453-455: the link with the epigenome is an overstatement. RNA and DNA processing pathways are general cellular processes.

      Minor details

      Line 36: I suggest to be more precise on the "nuclear" function that is affected in the oocyte. Given that oocytes are transcriptionaly quiescent at this stage, some might argue that it is a vague statement.

      In vitro should be in italic because it is Latin.

      Lines 125-126: are the batch numbers relevant to anything?

      Line 168: Mascor = Mascot

      Line 168: a reference for the software?

      Line 178: need a reference for the software?

      Line 187: Need a complete source for "Procure, 812"

      Line 188: Need a complete source for "Diatome"

      Line 197: Need a complete source for "Cell-Tak"

      Line 232: though = through

      Line 243: define OCR

      Line 268: If I am not mistaking, it is not a multispectral analysis. The multispectral values were analysed through a principal component analysis.

      Line 363: What is the "behaviour" of an oocyte and cumulus cells?

      Line 512-513: Maybe add more on the fact that most clinics use ovulated eggs and do not perform IVM. However, IVM is needed is specific contexts such as PCOS.

      Significance

      Cumulin is the most potent oocyte secreted factor. Its mecanism of action is still unknown.

      I have been working on the mammalian oocyte for the past 25 years.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Summary:

      The report by Richani et al, presents a research carried out in mice, in which they treated cumulus-oocyte complexes with either BMP15 and cumulin. Upon treatment they evaluated a series of biologically relevant parameters in oocytes and cumulus cells. Their findings indicate that the treatment with these molecules alter the molecular composition of oocytes and cumulus cells (proteome and metabolome), mitochondrial morphology in cumulus cells and overall oxygen consumption in COCs.

      Major comments:

      • Are the key conclusions convincing?
      • Should the authors qualify some of their claims as preliminary or speculative, or remove them altogether?
        • part of the discussion related to metabolic pathways being up regulated due to the treatments need to the revised because For instance, It is hard for me to grasp how a pathway with 2 proteins achieved FDR significance below 0.01, as I see in figure 4c
        • In the discussion the authors use the term "oocyte secreted factors" a lot (one example lanes 490, 515, 516, 517), but they should specify BMP15 and cumulin, because these were their treatments.
        • Including in the title, you did not evaluate all oocyte paracrine factors, just BMP15 and cumulin
      • Would additional experiments be essential to support the claims of the paper? Request additional experiments only where necessary for the paper as it is, and do not ask authors to open new lines of experimentation.

      NA - Are the suggested experiments realistic in terms of time and resources? It would help if you could add an estimated cost and time investment for substantial experiments.

      NA - Are the data and the methods presented in such a way that they can be reproduced? - no, in some instances, the methods are not described, see my comment below about enrichment analysis. - Are the experiments adequately replicated and statistical analysis adequate? - I was not able to access enrichment analysis. - lines 241-242: "MitoTracker staining and data from metabolite analysis by mass spectrometry were analysed by one-way ANOVA with Tukey's (parametric data) or Kruskal-Wallis (non- parametric data) post-hoc tests. " Specify which test was used for which data

      Minor comments:

      • Specific experimental issues that are easily addressable.

      NA - Are prior studies referenced appropriately?

      Yes - Are the text and figures clear and accurate? - lines 178-180: "expressed proteins list was further analyzed using STRING software to explore clustering and enrichment of specific molecular functions, and biological pathways. Detailed methodology and rationale for this approach is provided in the supplementary methods." I did not read text in the supplementary materials indicating how enrichment analysis was carried out. - What was the concentration of treatment for the samples used for proteome and mascot/scaffold experiments? - lanes 263 and 264: "Cell types and treatment conditions can be clearly distinguished based on these orthogonal global approaches." I did not see what is the basis for this statement - I did not understand the discrepancy between the numbers observed in Figure 3A and Figure 3B. - I could not make sense of the shades of green or red that were used in 4C and 4D. Is the reader only supposed to make those comparisons within column? - Do you have suggestions that would help the authors improve the presentation of their data and conclusions? - Figure 4 is really hard to process. At least in my pdf it spanned 4 pages. - I did not understand why put networks that are not significant as up-regulated or down-regulated. Besides, as mentioned above, I do not know how significance was assessed..

      Significance

      • Describe the nature and significance of the advance (e.g. conceptual, technical, clinical) for the field. - Place the work in the context of the existing literature (provide references, where appropriate).

      This paper is significant because it provided a variety of measurements following the treatment of cumulus cells with BMP15 and cumulin. The authors show that these two oocyte factors can impact the molecular structure, physiology and structure of organelles in cumulus cells. The work is well contextualized with the current literature. - State what audience might be interested in and influenced by the reported findings.

      Researchers in the field of developmental biology would be most interested in this report. - Define your field of expertise with a few keywords to help the authors contextualize your point of view. Indicate if there are any parts of the paper that you do not have sufficient expertise to evaluate.

      I do not have expertise in hyperspectral analysis. I have been working with cumulus-oocyte complexes for over a decade, mixing technologies in cell biology, microscopy, high-throughput genome, and proteome analysis. We do all our bioinformatics work in-house.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary:

      Cells within multicellular organisms are mutually dependent on each other - cells of one type or in one location provide signals that can regulate the health and differentiation of the target cells that receive those signals. Such signalling can operate bi-directionally, emphasizing the co-dependence of cells upon each other. The ovarian follicle provides an excellent model system to study intercellular signaling and its consequences, in this case between the oocyte and the somatic granulosa cells that surround it. Oocytes secrete members of the TGFbeta growth factor family that are required for normal differentiation of the granulosa cells, which in turn is necessary for normal development of the oocyte. Here the autohors show that adding TGFB-type growth factors (cumulin or BMP15) to the cuture medium during in vitro maturation increases the fraction of oocytes that can reach the blastocyst stage (improved developmental competence) and alters the pattern of protein landscape in both the (cumulus) granulosa cells and the oocyte. Changes in the mitochondria and parameters relevant to energy metabolism are also altered. They conclude that these changes underpin the acquisition of developmental competence by the oocytes.

      Major issues:

      The authors are world leaders in this field and therefore exceptionally well-qualified to carry out the proposed work. There are a number of issues, however, that limit the confidence with which conclusions may be drawn.

      First, the experimental strategy makes drawing inferences about the role of cumulin and BMP15 challenging. Maturing oocytes express GDF9 and BMP15 (the components of cumulin). Thus, the experiments are not comparing presence vs absence of cumulin and BMP15, but rather comparing oocytes and cumulus cells exposed to supra-physiological levels of these factors to controls that are exposed to physiological levels. In other words, the experimental setup detects changes that occur in response to higher than normal levels of the factors. Ideally, one would have complementary experiments where GDF9 and BMP15 were deleted from the system, to illustrate the effects of their absence. This would be a massive additional undertaking, however. Yet, without such experiments, relying on the results of the overexpression approach to understand the functions of cumulin and BMP15 at physiological levels is risky.

      Second, the granulosa cells and oocytes interact throughout the prolonged period of growth, and this is the time when the beneficial effects of the granulosa cells on the oocyte have been most clearly documented. Yet the experiments focus on the much shorter period of meiotic maturation. This is when oocyte-granulosa cell interaction is being down-regulated, even if not entirely disrupted.

      Third, the data reported illustrate associations or correlations, but no experiments test the function of the changes in the proteome or of the changes in the morphology of the mitochondria or ER. Which if any of these is linked to the improved development of the oocytes after fertilization is unknown. Moreover, no experiments address how the growth factors cause the observed changes, which occur over a period of a few hours.

      Taken together, these issues unfortunately limit the potential impact of the work. But the amount of work required to address them would be substantial and not really feasible for this manuscript. The best route may be to present the work as an overexpression study that has identified associations, with a discussion that acknowledges the limitations of this approach.

      Minor issues:

      The text of the manuscript should be revised in a number of places. 32: We characterized the molecular mechanisms by which two model OSFs, cumulin and BMP15, regulate oocyte maturation and cumulus-oocyte cooperativity.

      --Mechanistic studies were not performed.

      40: Collectively, these data demonstrate that OSFs remodel cumulus cell metabolism during oocyte maturation in preparation for ensuing fertilization and embryonic development.

      --No mechanistic studies demonstrate this.

      46: Oocyte-secreted factors downregulate protein catabolic processes, and upregulate DNA binding, translation, and ribosome assembly in oocytes.

      --No direct evidence is provided.

      48: Oocyte-secreted factors alter mitochondrial number...

      --Need to establish that the MitoTracker is a suitable tool to measure the number of mitochondria.

      79: ...for maintaining genomic stability and integrity of the oocyte...

      83: ...minimizing secondary production of potentially DNA damaging free radicals.

      --Please provide supporting references from the literature.

      373: This study provides a detailed exploration of the mechanisms by which oocyte-secreted factors...

      --No mechanistic studies were performed.

      383: Collectively, these data demonstrate that oocyte paracrine signaling remodels COC metabolism in preparation for ensuing fertilization and embryonic development.

      --Studies do not show that the differences observed between control and treatment groups are related to fertilizability or embryonic development.

      396: suggesting that cumulin affects meiosis in the oocyte and may increase meiotic fidelity...

      --This statement is highly speculative.

      409: ...lacks the machinery for amino acid uptake...

      --Is the oocyte unable to take up any amino acids or only certain amino acids?

      In general, the manuscript is written clearly. However, in several places, technical terms or jargon will make tough going for readers who are not already familiar with the techniques being used. These should be explained using language that will be understood by journal readers who are unfamiliar with the details of the techniques.

      Examples include:

      51: define metabolic workload using scientific terms.

      67: metabolically 'inept' requires more precision.

      262: explain 'multispectral analysis'

      268: how is 'limited' overlap defined.

      318: define higher workload

      324: provide documentation or citations to support the assertion that the intensity of MitoTracker staining is an accurate proxy for the number of mitochondria.

      358: Multispectral discrimination modelling utilised cellular image features from the autofluorescent profiles of oocytes and cumulus cells.

      --Please clarify this merthodology and provide support for its utility.

      360: intersection of union of 5-22%

      Comments on Figures.

      Fig. 3A, B. The total number of proteins and the number of differentially expressed proteins among the treatment groups don't match between A and B. For example, A (Mascot-Sheffield) indicates that 17 proteins were differentially expressed between untreated and cumulin-treated oocytes. B shows (138 + 74) expressed un the untreated but not cumulin-treated and (156 + 87) expressed in the cumulin-treated but not untreated. Please account for this difference.

      Fig. 3D. What do the circles represent and how were their parameters (size, position) established?

      Significance

      These studies identify changes in cumulus cells and oocytes that occur in response to addition of cumulin or BMP15 to the culture medium during in vitro maturation. While the data are new, the significance of the advance is limited by (i) the fact that the control group were exposed to physiological levels of GDF9 and BMP15, so this is essentially an over-epxression study and (ii) no mechanistic studies experimentally tested how the observed changes (eg, in quantity of a specific protein) affect the developmental potential of the oocytes or cumulus cells.

      Reviewer expertise: growth and meiotic maturation of the mammalian oocyte

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      This manuscript reports an investigation into the metabolic alterations induced by Zika virus (ZIKV) infection in human neuronal progenitor cells. The authors differentiated human iPSCs to derive neuronal progenitor cells (NPCs) at different days of incubation to represent the different stages of foetal CNS development. They found differences in the levels of ZIKV NS1 proteins as well as marginal differences in ZIKV titres in infected early and late hi-NPCs. Correspondingly, they also showed differences in glucose consumption, lipid metabolism and mitochondrial stress in ZIKV-infected early and late hi-NPCs. They concluded that differences in energy metabolism in neuronal progenitors both before and upon infection may contribute to the brain damage observed in congenital Zika syndrome.

      The evidence supporting a role for dysregulated metabolism in mediating the pathogenesis of congenital Zika syndrome is gaining traction and findings from this study could add to this body of knowledge. However, in its present form, this study has several gaps that limit the extent to which it informs on the clinical pathogenesis of congenital Zika syndrome.

      Major concerns: 1. The most important concern in this study is the strain of ZIKV used in all of the studies. ZIKV MP1751 was isolated from a mosquito and belongs to the African lineage of ZIKV. Unlike the Asian lineage ZIKV isolated from Latin America and French Polynesia, gestational infection with ZIKV of the African lineage has not been clinically associated with increased risk of foetal abnormality. It is thus uncertain how the changes observed in this study relates to the observed neonatal pathology. Perhaps a way to address this issue is to argue that a difference in these lineages it the ability of the virus to evade systemic and endothelial innate immune responses to cross the placental and blood brain barriers (several papers on attenuated ZIKV have shown this data). Once these barriers are breached, strain differences should not materially affect the similar pathogenic processes in neuronal cells, as also been shown by others using the MR766 strain of ZIKV. Such a discussion would be helpful to contextualise the clinical relevance of this study.

      The authors agree with the reviewer and have now included a discussion paragraph to address this relevant point. In addition, the authors acquired a strain from the Asian lineage (PRVACB59) and performed a single round side-by-side infection in three patient-derived lines with the two different strains of ZIKV. From the infected samples, the authors measured glucose consumption, lactate release and viral output to demonstrate, within the same research, that in in vitro assays, whereas number of ZIKV particles available to infect pools of brain progenitors is not mediated by tissue tropism/advantage. This data has been included in the extended figure 5.

      While the metabolic changes upon ZIKV infection are all interesting, how these changes affect CNS development is unclear. Figure 2F shows marginal impact on productive ZIKV infection and comparable extent of cell death in early and late hi-NPCs. What specific CNS pathology is dependent on the reported metabolic changes?

      The authors acknowledge that a correlation of findings from in vitro research and Zika congenital syndrome would be e.g., observing greater differences in cell survival and/or viral replication kinetics. After revisions of the current data, the authors have reanalysed the datasets corresponding to glucose and lactate metabolism, cell survival and viral output and corrected the results and discussion, accordingly. This correction was done due by calculating cell survival/death using lactate dehydrogenase (LDH) readouts. Thus, the data from CCK-8 was replaced due to the conversion of tetrazolium-based salts are metabolically depending on NAD+ and mitochondrial function– which may well have skewed the results as Zika virus potentially alters mitochondrial homeostasis. The preliminary graphs presented in the previous version of this manuscript are presented in the extended data figure 8 for comparison purposes. Datasets corrected for LDH mirror the in-vitro observations in which Zika-infected early hi-NPCs exhibit greater cell death than late hi-NPCs – this may potentially translate to the fetal pathogenesis observed over different trimesters. The corrected data also shows a significantly greater ZIKV release from late hi-NPCs at 48 and 56 h.p.i. suggesting a window of efficient replication in these cells. Lastly, the authors have expanded the conclusion paragraph highlighting intrauterine pathogenesis correlated with impaired brain metabolism to link how metabolic changes induced by ZIKV may correlate with pathophysiological phenotypes aggravated during early trimesters.

      Figure 2D: The most remarkable virological difference observed is the significant difference in cytoplasmic NS1 levels between early and late hi-NPCs at 56 hpi. Although the data in Fig 2D in general could have been compromised by the quality of the anti-NS1 mAb (the anti-E assay in Fig 2E used polyclonal antibody), it would have been useful to test for NS1 expression using western blot on a denaturing gel (and appropriate anti-NS1 antibody). The mAb used in this study binds a conformational epitope on NS1. The difference in data in Figure 2D and 2E could thus have been misfolding of NS1. Misfolded NS1 could contribute to ER stress that could be important for dysregulated CNS development. A more detailed investigation of the finding in Figure 2D could be highly informative.

      The authors appreciate the comments and hypothesis that NS1 detection may have been compromised due to potential misfolding. This hypothesis was tested by the authors showing no detection of NS1 by denaturing western blot with the referred antibody. However, before using a different NS1 antibody to investigate this potentially relevant phenomenon, the authors attempted to detect NS1 by flow cytometry using fewer markers than in the previous experiments. The authors decided to take this approach due to, although to low levels, NS1 was detected by imaging flow cytometry at early timepoints. When using a combination of markers that did not compromise the signal of NS1 by light compensations and low signal secondary fluorophore, the authors successfully detected NS1 and to similar levels of the Envelope protein. Thus, the authors discarded the possibility that the lowered levels presented in the previous version were due to misfolded NS1. The graphs within Figure 2 have now been corrected with this newly generated dataset.

      Figure 3A and related text: The fold-change in GLUT1, HK-1 and GAPDH expression are shown in log10 scale. In this scale, 1 would indicate 10-fold increase in expression. The data in Figure 3A are entirely inconsistent with the description in the related text. Which is correct?

      The authors thank the reviewer and would like to highlight that both the Figure 3A and its description were correct in the previous version of this manuscript. The description of the data, however, may have been misleading and unclear thus, the authors have amended the text for clarity. Figure 3 displays the fold-change of key glycolytic genes in early and late Zika infected hi-NPCs, each normalised to their respective controls. The in-text description, besides highlighting this important feature of the ZIKV infection in hi-NPCs, it highlight a more important finding correlated to the significances computed when compare the ratio of fold change between infected early and late hi-NPCs.

      Minor concerns:

      1. Figure 5: The effects of ZIKV infection on the mitochondria of hi-NPCs are interesting and the comparison between ZIKV-infected and uninfected cells in the same culture is a strength of this study. It would be helpful to readers if the authors could include a discussion on the kinetics of ZIKV infection; diminished differences at 48 and 72 hours could be due to the mixture of cells infected at inoculation and hence observed at 24 hours and newly infected cells that were negative for ZIKV E protein at 24 hours. Emphasis should thus be on the 24 h data in Figures 5 C-E.

      The authors thank the reviewer for highlighting the relevance of our experimental approach. The authors also thank for the interpretation of the data focused at early timepoints during the infection kinetics of ZIKV when the metabolic alterations are likely to be exclusive from cells infected at inoculation. The discussion of the data in this new revision of the manuscript emphasises the results based on the kinetics of infection and also clarify and strengthen the findings on Env+ and Env- cells within the pool of infected cells.

      1. Hi-NPCs likely have a diploid genome and thus a finite lifespan. Using the term "cell line" to describe these cells is technically incorrect. Please consider using other terms, such as cell strain.

      The authors appreciate the comment and have amended the text accordingly. The authors decided to use the terminology patient line.

      Discussion section, 3rd paragraph, lines 6-7. The authors suggest thermal decay as an explanation for their observation yet Figure 2B argues against this explanation. Moreover, Kostyuchenko et al (Nature 2016; 533:425-8) have also shown that ZIKV is relatively thermostable. This explanation offered by the authors lack supporting evidence.

      The authors thank the reviewer for the observation. Regarding the discussion on thermal decay, the authors aimed to highlight that circulating virions without available hosts to continue replication (due to cell death) may suffer from thermal decay as the difference in collection timepoints exceeds the tested 3 h reported in this research (Fig 2B). The results from Kostyuchenko et al (Nature 2016; 533:425-8) show thermal stability of ZIKV at different ranges of temperature yet, similar to Fig 2B, only under 2 h. Unpublished data from our group using an FFU assay shows that infectivity of ZIKV virions decrease after 10 h at 37C, knowledge that was used for the discussion. Moreover, the authors have strengthened the discussion by including in the discussion the native immunity of hi-NPCs at different stages of differentiation.

      Discussion section, 3rd paragraph, line 16 and Supplementary Figure 2. I believe the authors are referring to Supplementary Figure 3 and not 2. The indentations observed could be due to ZIKV replication although the data, as presented is not convincing. Co-staining for ZIKV E protein would be useful.

      The authors have corrected the issue and confirm that the reference to potential replication sites of ZIKV was made to the Extended Figure 3 rather than 2. To strengthen these findings, the authors have now acquired nuclear data by confocal imaging of infected late hi-NPCs co-stained for ZIKV E protein and DAPI. Representative images are included in the Extended Figure 6.

      CROSS-CONSULTATION COMMENTS

      • I fully agree with both Reviewers #2 and #3 on the quality of the immunofluorescence images and that these images alone are not sufficiently convincing to support the inferences the authors are making.

      The authors would like to clarify that the confocal imaging displayed in the current manuscript was not used for the interpretation of the data but rather validation of the immunostaining used in fluorescence flow cytometry. The nuclear screening comprised the only result generated from microscopy analysis. The bulk of data presented on this manuscript was generated by imaging flow cytometry (Imagestream) due to the higher degree of unbiased screening and the larger sample size. The authors acknowledge that Imagestream produces low quality immunofluorescence imaging compared to confocal imaging but believe this is justified by the greater data and unbiased analysis offered by imaging flow cytometry. The power of analysis displayed in this research is unlikely to be achieved by confocal microscopy in which no more than 1.000 cells are screened whilst the authors screened 10.000 cells from each patient line to generate each dataset. Lastly, the authors acknowledge the lack of robustness in the images from nuclei and ZIKV replication thus, for late hi-NPCs in which the perinuclear replication sites where evident, data was acquired by confocal imaging; samples co-stained for ZIKV E protein and nuclei DAPI (Extended Figure 6).

      • I also appreciate the first major comment from Reviewer #3. That is important insight and the authors should test their assumption that they have monocultures of human progenitor cells.

      The authors have paraphrased the document for better clarity and accuracy as consider the text was confusing causing misinterpretation of the data. This research is intended to show the impact of ZIKV in two pools of cortical progenitor cells (less and more differentiated/mature) clustered by their distinct metabolic profiles rather than single cell types present at different stages of brain development. Both early and late hi-NPCs comprise pools of cells generated during hiPSC differentiation of cortical progenitors. The authors showed in Fig.1 that both pools have brain identity and express several brain markers to similar levels. When gating these cells by populations present in the developing brain small differences were observed exclusively in one out of three subgroups. Nevertheless, the main distinction of these two populations was due to significant differences in their metabolic profile. Thus, the results obtained in this research are likely to obey to the metabolic maturation of early and late hi-NPCs rather than the percentages of different brain cell types present within these pools.

      Reviewer #1 (Significance (Required)):

      The focus on the metabolism and mitochondrial stress in ZIKV infected neuronal progenitors is interesting and could fill an important gap in knowledge on Zika pathogenesis. The study uses human iPSC derived NPCs instead of animal cells, which is also more clinically relevant than animal models. The findings would thus be of interest to all who are interested in Zika pathogenesis as well as therapeutic/vaccine development. If the above concerns could be addressed, the findings in this study could form the missing links in our current understanding of congenital Zika syndrome.

      Expertise: Flavivirology and immunology. Flavivirus-host interactions.

      The authors thank the reviewer for the comments provided to improve several aspects of the current research. The authors also thank the reviewer for the positive feedback and for highlighting the relevance of our research.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      In the manuscript entitled "Zika virus-induces metabolic alterations in fetal neuronal progenitors that could influence in neurodevelopment during early pregnancy", Javier G.-J. and colleagues investigated the role of cellular metabolism during ZIKA virus infection in hiPSC-derived neural progenitor cells (NPC) at different stage of differentiation. Indeed, the authors use a modified protocol of 2D cultures to obtain early-hiNPC and by continuing the cultures for two additional passages, they obtain late-hiNPCs. These two cell populations are characterized by cell morphology and marker expression. Then they test their susceptibility to ZIKV infection and show that late-hiNPCs are more efficient than early- hiNPCs to support viral replication. Moreover, authors demonstrate that the two cell populations are characterized by different cellular metabolism as glucose consumption is higher in early-hiNPCs than in late-hiNPCs although the overall glycolytic capacity is not different between the two subtypes. However, during ZIKV productive infection, late-hNPCs increased the glucose consumption (Fig. 3). The authors examined the mitochondrial alterations during infection showing different kinetics in early vs. late hiNPCs. Then, they show alterations of expression in genes of the lipid metabolism and content of lipid droplets that follow different kinetics of expression during infection in early vs. late hiNPCs. Overall, no significant differences were observed in the lipid droplet homeostasis between the two subtypes. This is a potentially interesting manuscript as they analyze the susceptibility of subtypes of neural progenitors to ZIKV infection and their metabolic alterations before and during infection. However, there are some concerns listed below.

      Major issues:

      1. It is well established that the NPC maturation during neurodevelopment is complex and cells at different stage of maturation play an important role. The authors propose a model that may recapitulate distinct populations of neural progenitors present during neurodevelopment. They use a modified protocol that it is well described. However, the characterization of these NPC subtypes needs to be improved. The pictures selected to be shown in Fig 1B and C do not highlight the morphology of these cells as described in the text.

      The authors thank the reviewer for the comment and have improved the description of the morphology of the cells constituting the two pools of cells at different stages of differentiation. In addition, the authors have included a new figure (Extended Fig. 1) with different magnifications of the acquired brightfield images for better representation of the morphological differences observed between early and late hi-NPCS.

      Late-hiNPC are more efficient than early-hiNPC in supporting ZIKV replication, however the differences are present exclusively at 56 h post-infection and they are modest (ca. 2-fold). Nevertheless, ZIKV cytopathic effects are similar between the two subtypes at 72 h post-infection. Authors should try to lower the MOI and extend the timing of analysis to up 10 days post-infection. They used MOI of 1, but it would be informative to know whether the different efficiency of viral replication is dependent on the MOI. Furthermore, are the differences between early and late-hiNPCs dependent on expression of entry receptor, or a different interferon response to virus infection or state of cell proliferation?

      The authors thank the reviewer for the insights provided on this matter and appreciate the overall positive response towards the research. After several revisions, the authors have corrected the data using a normalisation method that is expected to rely less on cellular metabolism which may well be disturbed during ZIKV infection. Although still modest, differences in virion release between early and late hi-NPCs are observed at 48 and 56 h.p.i. This data matches the increased accumulation of transcripts. Moreover, in the new version of this manuscript, the cytopathic effects are distinct between hi-NPCs. Regarding the reviewer’ comment on MOI. The authors selected the MOI of 1 due to metabolic dysregulations due to viral infection require a good proportion of cells infected with the inoculum. To support this, the authors highlight the comments from reviewer 1 whom encouraged that the main interpretation should be done at the 24 h timepoint as the population is reflecting alterations due to the initial round of infection rather than differences potentially being masked by cells at different stages of ZIKV replication. In addition, MOI of 1 has been reported elsewhere for ZIKV and other flaviviruses. Although it sounds interesting to the authors the lower MOI exposure for longer period of times, this approach is not feasible to conduct in our models as early hi-NPCs have a length of 3-4 days in culture due to exacerbated cell proliferation. After this time, cells need to be passaged. Similar technical complications will be faced if extending the infection times in late hi-NPCs as these cells require passaging/freezing after day 5. Lastly, the authors consider studying the expression of entry receptors in early and late hi-NPCs to be important in explaining potential differences in viral kinetics yet, the lack of differences in virion release at early timepoints of infection suggest the entry and length of the ZIKV replication cycle is conserved between early and late hi-NPCs. Thus, differences during the ZIKV kinetics potentially due to other mechanisms. For this reason, the authors have included a discussion paragraph in which they highlight potential differences may be due to the development of the native immunity of hi-NPCs during differentiation. It is still controversial whether IFN responses are significant in hi-NPCs, with research suggesting that greater IFN responses are observed upon maturation of NPCs.

      The authors state that that this is the first report showing differential changes in nuclear morphology between neural progenitor cells. They show a main finding that is the perinuclear centers only visible in late but not in early-hiNPC in a supplemental figure. These results are not convincing, and an effort should be made in order to support these claims.

      The authors have now addressed this issue by using confocal microscopy and co-stained DAPI (nuclei) and ZIKV envelope protein to better show the perinuclear centres in late hi-NPCs (Extended Fig. 6). Confocal images of early hi-NPCs with non-perinuclear replication centres than late hi-NPCs was not possible to acquire as early hi-NPCs did not adhere to glass coverslips for more than 24 h.

      Gene expression should be supported by data of protein expression (western blot) of some of the enzymes reported in Fig. 5.

      The authors have detected some of the proteins (western blot) involved in lipid metabolism in both early and late hi-NPCs. The authors screened for FASN, PDK2 and ACACA to validate the findings at the mRNA level. The authors selected 56 h.p.i. as a timepoint to measure proteins mainly due to high ZIKV infection levels but not abundant cell death that facilitates obtaining sufficient material for WB. The image of the WB is included in the Extended Fig. 4 of the new version of this manuscript.

      Minor issues: 1. Since this work is based on in vitro data, I would suggest using the term infection rather than challenge when referring to infection experiments.

      The authors have edited the document and replaced the terminology for what was suggested by the reviewer.

      Improve quality of the graphs. Enlarge symbols as in Fig. 6. Try to use linear scales as the differences are not dramatic and a linear scale would highlight them better.

      The authors thank the reviewer for the observation on the graphs. The authors have enlarged the symbols where possible – in some cases this could not be conducted as otherwise the error bars were not visible for example when displaying the viral output. The authors appreciate the comment on plotting the data on a linear scale to reflect subtle differences to a larger magnitude yet, this may well fit into misleading the interpretation of some results due to the nature of the analysis (e.g., fold-change); where possible, these changes have been applied.

      CROSS-CONSULTATION COMMENTS

      I agree with all comments of Rev#1 and 3. Some/many of the claims are made without the supporting evidence.

      Reviewer #2 (Significance (Required)):

      Many papers have reported the efficient ZIKV infection of neural progenitor cells that have been derived from the reprogramming of human pluripotent stem cells (PSC). Most of this literature has not been cited. In fact, ZIKV virus infects human PSC-derived brain neural progenitors causing heightened cell toxicity, dysregulation of cell-cycle and reduced cell growth as reported in many papers. In this manuscript, the advancement consists in having used NPC subtypes that are at different stage of differentiation and having studied their susceptibility to ZIKV infection. Then, the author analyze the fluctations of the glucose and lipid metabolism during infection.

      The audiance that is interested in this manuscript are virologists and , in particular, experts in arboviruses that are for the most part neurotropic viruses. In addition, this is a topic for experts of neurodevelopment.

      My expertise is virology. Key words: Zika virus, neural progenitors, antivirals.

      The authors thank the reviewer for the productive constructivism provided to this research. We would like to highlight that most of the literature in Zika infection and hi-NPCs was not included as this does not directly focuses on metabolism. However, as the document has been amended, some of this literature has now been included to contextualise the current knowledge of ZIKV infectivity in relevant in vitro systems.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      Summary The authors present the analysis of the cellular metabolism in Zika virus-infected human neural cell cultures differentiated from fibroblast-derived hiPSCs. Neural cell cultures from days 12-15 after hiPSC induction to neuronal lineages were designated as 'early neuronal progenitors' (early hi-NPCs), while cultures from days 18-21 post induction were designated as 'late neuronal progenitors' (late hi-NPCs). The outcomes of ZIKV infection in both types of neural cell cultures were analyzed. The authors first characterized several viral parameters of infection including accumulation of viral RNA and proteins and ZIKV replication, as well as nuclear morphology of infected cells. The major body of evidence in the presented study encompasses the comparative analysis of several parameters of glucose and lipid metabolism as well as mitochondrial function and cellular lipid accumulation and storage. The authors postulate that ZIKV replicates differentially in early and late hi-NPCs, inducing some common metabolic responses like upregulated glycolytic capacity, as well as responses unique to either early or late differentiation stage of the neural cultures like the lipid metabolism, lipid droplet homeostasis or mitochondrial function. The authors propose that the differential metabolic responses to ZIKV infection in early and late neural progenitors might help to explain the differences in the fetal brain damage in early or late pregnancy.

      Major comments 1. The authors refer to the induced neural cell cultures as monocultures of human neural progenitors. This assumption is incorrect and it undermines the proper interpretation of the presented data. The neural lineage induction of iPSC produces neural cell cultures, which depending on the differentiation stage consist of neural stem cells of neuroepithelial-like morphology (Nestin and Sox-2 positive) which differentiate further to more elongated early progenitors with radial glial cell morphology (Nestin, sox2 and PAX-6 positive). Radial glial cells differentiate further into several neural lineages including oligodendrocyte precursors, astrocytes (S100B - positive) and intermediate progenitors (TBR2 - positive). The intermediate progenitors then divide to produce one progenitor and one post mitotic immature neuron (still TBR-positive and also beta II tubulin, Tuj1/TuB3-positive). The neurons then mature further and become NeuN and MAP2-positive. All the above mentioned differentiation markers were used by the authors to characterize the early and late cell cultures. According to the data presented in Fig 1E, both cultures were positive for all the markers indicating that they are not monocultures. The immunofluorescence data provided in Extended Fig.1 in support of the analysis presented in Fig. 1E clearly shows that both cultures stain similarly for Tuj1 (also known as TuB3), a marker of post-mitotic neurons, which are clearly present in both cultures. Abundant MAP2 positive cells (marker of mature neurons) in "early hi-NPCs" presented in extended figure 1B is quite surprising and confusing and is not presented for 1A panel - "late hi-NPCs", which suggests that perhaps figure 1A and 1B were mislabeled. The immunostaining for PAX6 presented in the same figure 1B presents strong cytoplasmic staining while PAX6 is expected to be detected in the cell nucleus, suggesting that the red staining comes most probably from the overexposed background. On a closer look the PAX6 staining presented on panel 1A shows weak and underexposed but most probably positive nuclear staining. Of note, the authors argue that the only significant difference in the staining for differentiation markers was observed for PAX6 (early neural progenitor marker) which was higher in late cultures than the early ones. In the same figure all the pictures in red are generally underexposed except from PAX6, while the DAPI staining is overexposed. This makes the interpretation of the data difficult especially when looking at the merged images. Despite the overall confusion with this part of results it is clear that the early and late cultures consist of different cell types including early and intermediate progenitors as well as astrocytes (S100B - positive), probably glial cells (not tested for) and post-mitotic neurons. The relative ratio of these populations might be different in the two cultures, however the cultures are not monocultures of early or late neural progenitors. They might contain different ratios of both and thus respond differently to the infection. Therefore, the metabolic and virological analysis performed globally on these cell cultures might just as well reflect the cell type ratio related effects rather than the differential responses of the early or late progenitors. This has never been addressed or explained by the authors.

      The authors thank the reviewer for the comment and observation regarding the nomenclature used in the preliminary version of this document. The authors used the terminology “subtypes” not to refer as a monoculture of a particular cell type within the developing brain but to the group of cells that share a metabolic profile. This was due to the abundance of markers to characterize cellular lineages within each population reflected to be similar at the two stages of differentiation. The authors showed cell type differences only in the ratio of glial Pax6 +ve cells (Fig. 1D) whilst greater significant differences were observed in the metabolism between both cultures. Thus, differences to viral responses are most likely to obey to the maturation stage (longer times under culture) rather than different ratio of brain cells. Nevertheless, the authors acknowledge the confusion that the terminology “neuronal subtypes” could have caused and have changed it to “cortical progenitors at different stages of differentiation” or “hi-NPCs”. The authors would like to address the reviewer’ comment on the data presented in Extended Fig. 2 (MAP2 staining in early hi-NPCs). This is not a mislabel between the figure but rather a demonstration that the staining was observed in early hi-NPCs. This staining was not performed in late hi-NPCs thus not showed. Moreover, the data used to quantify the presence of brain markers in early and late hi-NPCs was generated by flow cytometry and not by confocal imaging (ICC). The ICC included in the Extended Fig. 2 was used to demonstrate the antibody staining and to discard potential unspecific antibody binding that may generate false positive detection by flow cytometry. The authors agree with the reviewer that the staining for Pax6 was not clear in the previous version of this manuscript and have redone the figure.

      The data presented is often based on the analysis of the immunofluorescence images, however the quality of the images presented (resolution, magnification, over or under saturation) is often insufficient to support the findings and claims. The most striking example are images supporting the analysis of nuclear morphology in ZIKV-infected cells presented in the Extended figure 2.

      The authors thank the reviewer and would like to clarify that, although displaying some confocal images within the figure, the graphs were generated from data collected by imaging flow cytometry (Imagestream). In response to the comments from reviewer 1 and 2, the authors explained the advantages and disadvantages of using Imagestream over confocal imaging. The main rationale behind this is the greater sample size and unbiased acquisition of data yet compromising the immunostaining resolution. Regarding the displayed confocal images within the text, the authors have redone the figures and/or acquired new images to correct the issues of oversaturation/overexposure. The authors acknowledge that the data interpretation from the nuclear imaging needs to be done with caution due to its low quality yet, as early hi-NPCs do not adhere to glass as efficiently as late, any confocal acquisition will be limited to plastic-based materials ending in lower resolution. Thus, thanking the reviewers for the observation, the authors have now conducted confocal microscopy co-stained for ZIKV envelope protein and nuclei (DAPI) in late hi-NPCs to better display the nuclear morphology upon infection and the replication centres.

      Some of the claims are made without the supporting evidence. For example in the discussion the authors claim that "Our main finding was that viral perinuclear replication centers (26) (white arrows, Supplementary Figure 2) were only visible in late hi-NPCs and not in early hi-NPCs". This conclusion is made based presumably on Extended Figure 3 (Figure 2 does not have arrows) based on the nuclear morphology of infected cells without staining for any of the viral proteins localizing to the replication centers. Despite low image quality similar crescent-shaped nuclei to the ones indicated by the arrows in "late hi-NPCs" and many more of them are visible in "early hi-NPCs" (Extended Fig.2), however the authors seem ignore them.

      The authors thank the reviewer for the comment and notify that the respective amendments have been done. The data presented in the new version of this manuscript related to the nuclear morphology is from a new dataset of co-stained ZIKV envelope and DAPI (Extended Fig. 6).

      Based on the arguments presented above the conclusions are not convincing, lacking the supporting evidence or ignoring some of the essential facts of the chosen experimental system.

      The authors thank the reviewer for the criticism on the research and notify that several changes throughout the document have been made to support the claims and conclusions of this manuscript.

      The study in presented form, where all the analysis is performed in globally is not informative and would require the characterization of the metabolic and virological responses in different cell populations as characterized by the expression of neural differentiation markers. Alternatively, the population sizes of different types of cells should be determined and accounted for when analyzing the experimental data. It should be determined which types of cells are targeted by the Zika virus and replicate the virus. It could be done by, for example, co-staining for viral and neural differentiation markers. This would however require the entirely different experimental approach from the one presented in this manuscript.

      The authors thank the reviewer for the comments and inputs provided to our research. We would like to highlight that, although it would be highly relevant to distinguish ZIKV infection and metabolic dysregulations in different cell populations; all the published literature in neuronal progenitors and ZIKV infection do not contain insights on the infection per cell populations. This may be due to the difficulties in isolating/sorting populations of immature cells within the pool of in vitro cortical differentiation whilst achieving significant cell survival. The authors would like to address this comment by highlighting that the population sizes of different types of cells within the pools of early and late hi-NPCs was accounted as a starting point of this research (Fig 1D). This characterization was done using a commercially available kit aimed for the sorting of human neural stem cells. These results showed small differences in the ratio of cell types present in early and late hi-NPC cultures. ZIKV has been reported to target all brain cells with lower impact on mature neurons, which arguably will be present in either of the cortical progenitor pools used for this research. Thus, the authors focused on interpreting the results as an impact of ZIKV infection in the overall metabolism of each pool of hi-NPCs used in this study. Metabolism that is likely influenced by most of the cell types present within each hi-NPC pool.

      Some methods are not explained clearly. For the metabolic analysis like Oleic acid oxidation and others, it is not clear at which step of the protocol ZIKV infection was performed. In "Extracellular lactate measurement" freshly made running buffer is mentioned but no composition of the buffer is provided.

      The authors thank the observation of the reviewer and have now amended the method section to clearly state several methods that could have been difficult to understand in the previous version of this manuscript.

      Minor comments 1. Figure 2G shows the survival of ZIKV-infected hi-NPC subtypes. Clearly for "late hi-NPCs" there is 50% cell death at 56 hours post infection and about 70% death at 72 hours. Subsequent analysis of many metabolic parameters is measured at 56 and sometimes even at 72 hours when the significant differences in responses are observed for example Fig. 3 B and C. The role of cell death in the critical analysis of these parameters is not provided.

      The authors appreciate the reviewers’ comment and would like to emphasise that all the analysis at every timepoint during ZIKV infection was normalised to the cell number present at the time. The use of different timepoints for different measurements (e.g., 56 and 72 h.p.i.) were selected by the authors to adjust the used methodology. In short, 56 h.p.i. was used as the last timepoint to study mitochondrial and lipid dysregulations by imagestream as we observed the highest viral output with sufficient cell survival in early hi-NPCs; 72 h.p.i. will not give sufficient cell number for counting 10.000 cells by Imagestream. However, 72 h.p.i. was used to assess the genetic expression of metabolically relevant genes as the material obtained was sufficient and will signify the interpretation of the latest point during the ZIKV kinetics in our models.

      There are multiple spelling mistakes throughout. The professional terminology of the virology part of the study is often missing. Example the levels of ZIKV RNA measured in the infected cells are designated as "transcriptional levels of ZIKV" which seems incorrect as the level of the genomes is the effect of viral replication and not transcription.

      The authors thank the reviewer for the observation made and have corrected the terminology throughout the document. The spelling has been checked.

      CROSS-CONSULTATION COMMENTS

      Agree with Rev #1 comment on Fig 2D and the levels of NS1. It is striking that the levels of expression drop below the level detected at 48h while the ZIKV E protein continues to accumulate (Fig. 2E) at the same time. Both proteins are translated from the same polyprotein and are processed similarly. It is also confusing that at 48h only about 5% live cells express NS1 while at the same time 15% of live cells express E protein. In my experience both proteins are expressed in all infected cells. The reason why 10% of infected and still alive cells would express only E and not NS1 is difficult to conceive.

      The authors have addressed this issue and highlighted that the limitations of the Imagestream technique may have caused this oddity due to loss of signal detection by compensation. The experiments conducted to correct this manuscript include a new detection by flow cytometry using a smaller panel of markers and labelled-secondary antibodies that will provide greater signal. This approach has demonstrated that detection levels of NS1 mirror those of Envelope.

      I stand with the Rev #1 in asking what specific CNS pathology is dependent on the reported metabolic changes? There is no attempt to link the findings to ZIKV-induced CNS pathologies.

      The authors have included discussion paragraphs to link the observed phenotypes during ZIKV infection to relevant CNS pathologies.

      In relation to major comment 2 from the Rev #2, I disagree that Late-hiNPC are more efficient than early-hiNPC in supporting ZIKV replication. 2-fold difference in a viral plaquing assay falls within the error of the assay which is usually quite substantial for the plaquing assay. Lack of error bars for late hi-NPCs 56 h raise my suspicion as to how real is this effect in viral replication.

      The authors would like to clarify that the error bars were present in the graph but the size of the symbol difficulted the visualisation. After correcting all the datasets to a less dependent metabolic assay (LDH based survival), the differences in virion release are observed at 48 and 56 h.p.i., like that of ZIKV replication measured by qPCR. The authors also clarify that, although a 2-fold difference may fall within the technical error of plaque assay, minor differences observed in our research are potentially greater if displayed in a different form as our analysis comprises three independent ZIKV infection conducted in three patients’ lines and further normalisation to cell number.

      I stand behind Rev #2 major comment 2 there there is no evidence to support the claims about the nuclear morphology or the replication centers

      This issue has now been addressed (Extended Fig. 6).

      Reviewer #3 (Significance (Required)):

      Despite global research efforts the course of Zika virus infection of the fetal brain during pregnancy is not clear. Among many knowledge gaps, the molecular determinants of differential outcomes of Zika virus infection during early or late pregnancy are unknown. The study aims to address this highly significant issue by focusing on the metabolic responses of cells to infection. In the presented form the study however, fails to deliver significant progress in our understanding of Zika virus infection of developing fetal brain. The experimental design and the quality of presented data does not allow to make unbiased conclusions and to support the claims. My expertise is in iPSC-derived neural cell cultures, molecular virology, in particular that of Flaviviruses like Zika virus and hepatitis c virus and confocal microscopy. I am not familiar with metabolic techniques and I find the description of methods for this part of the study insufficient to fully understand the experimental approach.

      The authors thank the reviewer for the valuable inputs provided to the research. We would like to highlight that, whereas possible, new sets of experiments have been conducted to better support some of the conclusions and claims. Lastly, the authors would like to mention that the method section has been corrected for a better understanding of the metabolic assays and data normalisation. Within the text, paragraphs have been added to clarify the nature of the results and data acquisition.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      Summary

      The authors present the analysis of the cellular metabolism in Zika virus-infected human neural cell cultures differentiated from fibroblast-derived hiPSCs. Neural cell cultures from days 12-15 after hiPSC induction to neuronal lineages were designated as 'early neuronal progenitors' (early hi-NPCs), while cultures from days 18-21 post induction were designated as 'late neuronal progenitors' (late hi-NPCs). The outcomes of ZIKV infection in both types of neural cell cultures were analyzed. The authors first characterized several viral parameters of infection including accumulation of viral RNA and proteins and ZIKV replication, as well as nuclear morphology of infected cells. The major body of evidence in the presented study encompasses the comparative analysis of several parameters of glucose and lipid metabolism as well as mitochondrial function and cellular lipid accumulation and storage. The authors postulate that ZIKV replicates differentially in early and late hi-NPCs, inducing some common metabolic responses like upregulated glycolytic capacity, as well as responses unique to either early or late differentiation stage of the neural cultures like the lipid metabolism, lipid droplet homeostasis or mitochondrial function. The authors propose that the differential metabolic responses to ZIKV infection in early and late neural progenitors might help to explain the differences in the fetal brain damage in early or late pregnancy.

      Major comments

      1. The authors refer to the induced neural cell cultures as monocultures of human neural progenitors. This assumption is incorrect and it undermines the proper interpretation of the presented data. The neural lineage induction of iPSC produces neural cell cultures, which depending on the differentiation stage consist of neural stem cells of neuroepithelial-like morphology (Nestin and Sox-2 positive) which differentiate further to more elongated early progenitors with radial glial cell morphology (Nestin, sox2 and PAX-6 positive). Radial glial cells differentiate further into several neural lineages including oligodendrocyte precursors, astrocytes (S100B - positive) and intermediate progenitors (TBR2 - positive). The intermediate progenitors then divide to produce one progenitor and one post mitotic immature neuron (still TBR-positive and also beta II tubulin, Tuj1/TuB3-positive). The neurons then mature further and become NeuN and MAP2-positive. All the above mentioned differentiation markers were used by the authors to characterize the early and late cell cultures. According to the data presented in Fig 1E, both cultures were positive for all the markers indicating that they are not monocultures. The immunofluorescence data provided in Extended Fig.1 in support of the analysis presented in Fig. 1E clearly shows that both cultures stain similarly for Tuj1 (also known as TuB3), a marker of post-mitotic neurons, which are clearly present in both cultures. Abundant MAP2 positive cells (marker of mature neurons) in "early hi-NPCs" presented in extended figure 1B is quite surprising and confusing and is not presented for 1A panel - "late hi-NPCs", which suggests that perhaps figure 1A and 1B were mislabeled. The immunostaining for PAX6 presented in the same figure 1B presents strong cytoplasmic staining while PAX6 is expected to be detected in the cell nucleus, suggesting that the red staining comes most probably from the overexposed background. On a closer look the PAX6 staining presented on panel 1A shows weak and underexposed but most probably positive nuclear staining. Of note, the authors argue that the only significant difference in the staining for differentiation markers was observed for PAX6 (early neural progenitor marker) which was higher in late cultures than the early ones. In the same figure all the pictures in red are generally underexposed except from PAX6, while the DAPI staining is overexposed. This makes the interpretation of the data difficult especially when looking at the merged images. Despite the overall confusion with this part of results it is clear that the early and late cultures consist of different cell types including early and intermediate progenitors as well as astrocytes (S100B - positive), probably glial cells (not tested for) and post-mitotic neurons. The relative ratio of these populations might be different in the two cultures, however the cultures are not monocultures of early or late neural progenitors. They might contain different ratios of both and thus respond differently to the infection. Therefore, the metabolic and virological analysis performed globally on these cell cultures might just as well reflect the cell type ratio related effects rather than the differential responses of the early or late progenitors. This has never been addressed or explained by the authors.
      2. The data presented is often based on the analysis of the immunofluorescence images, however the quality of the images presented (resolution, magnification, over or under saturation) is often insufficient to support the findings and claims. The most striking example are images supporting the analysis of nuclear morphology in ZIKV-infected cells presented in the Extended figure 2.
      3. Some of the claims are made without the supporting evidence. For example in the discussion the authors claim that "Our main finding was that viral perinuclear replication centers (26) (white arrows, Supplementary Figure 2) were only visible in late hi-NPCs and not in early hi-NPCs". This conclusion is made based presumably on Extended Figure 3 (Figure 2 does not have arrows) based on the nuclear morphology of infected cells without staining for any of the viral proteins localizing to the replication centers. Despite low image quality similar crescent-shaped nuclei to the ones indicated by the arrows in "late hi-NPCs" and many more of them are visible in "early hi-NPCs" (Extended Fig.2), however the authors seem ignore them.
      4. Based on the arguments presented above the conclusions are not convincing, lacking the supporting evidence or ignoring some of the essential facts of the chosen experimental system.
      5. The study in presented form, where all the analysis is performed in globally is not informative and would require the characterization of the metabolic and virological responses in different cell populations as characterized by the expression of neural differentiation markers. Alternatively, the population sizes of different types of cells should be determined and accounted for when analyzing the experimental data. It should be determined which types of cells are targeted by the Zika virus and replicate the virus. It could be done by, for example, co-staining for viral and neural differentiation markers. This would however require the entirely different experimental approach from the one presented in this manuscript.
      6. Some methods are not explained clearly. For the metabolic analysis like Oleic acid oxidation and others, it is not clear at which step of the protocol ZIKV infection was performed. In "Extracellular lactate measurement" freshly made running buffer is mentioned but no composition of the buffer is provided.

      Minor comments

      1. Figure 2G shows the survival of ZIKV-infected hi-NPC subtypes. Clearly for "late hi-NPCs" there is 50% cell death at 56 hours post infection and about 70% death at 72 hours. Subsequent analysis of many metabolic parameters is measured at 56 and sometimes even at 72 hours when the significant differences in responses are observed for example Fig. 3 B and C. The role of cell death in the critical analysis of these parameters is not provided.
      2. There are multiple spelling mistakes throughout. The professional terminology of the virology part of the study is often missing. Example the levels of ZIKV RNA measured in the infected cells are designated as "transcriptional levels of ZIKV" which seems incorrect as the level of the genomes is the effect of viral replication and not transcription.

      Referees cross-commenting

      Agree with Rev #1 comment on Fig 2D and the levels of NS1. It is striking that the levels of expression drop below the level detected at 48h while the ZIKV E protein continues to accumulate (Fig. 2E) at the same time. Both proteins are translated from the same polyprotein and are processed similarly. It is also confusing that at 48h only about 5% live cells express NS1 while at the same time 15% of live cells express E protein. In my experience both proteins are expressed in all infected cells. The reason why 10% of infected and still alive cells would express only E and not NS1 is difficult to conceive.

      I stand with the Rev #1 in asking what specific CNS pathology is dependent on the reported metabolic changes? There is no attempt to link the findings to ZIKV-induced CNS pathologies.

      In relation to major comment 2 from the Rev #2, I disagree that Late-hiNPC are more efficient than early-hiNPC in supporting ZIKV replication. 2-fold difference in a viral plaquing assay falls within the error of the assay which is usually quite substantial for the plaquing assay. Lack of error bars for late hi-NPCs 56 h raise my suspicion as to how real is this effect in viral replication.

      I stand behind Rev #2 major comment 2 there there is no evidence to support the claims about the nuclear morphology or the replication centers

      Significance

      Despite global research efforts the course of Zika virus infection of the fetal brain during pregnancy is not clear. Among many knowledge gaps, the molecular determinants of differential outcomes of Zika virus infection during early or late pregnancy are unknown. The study aims to address this highly significant issue by focusing on the metabolic responses of cells to infection. In the presented form the study however, fails to deliver significant progress in our understanding of Zika virus infection of developing fetal brain. The experimental design and the quality of presented data does not allow to make unbiased conclusions and to support the claims.

      My expertise is in iPSC-derived neural cell cultures, molecular virology, in particular that of Flaviviruses like Zika virus and hepatitis c virus and confocal microscopy. I am not familiar with metabolic techniques and I find the description of methods for this part of the study insufficient to fully understand the experimental approach.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      In the manuscript entitled "Zika virus-induces metabolic alterations in fetal neuronal progenitors that could influence in neurodevelopment during early pregnancy", Javier G.-J. and colleagues investigated the role of cellular metabolism during ZIKA virus infection in hiPSC-derived neural progenitor cells (NPC) at different stage of differentiation. Indeed, the authors use a modified protocol of 2D cultures to obtain early-hiNPC and by continuing the cultures for two additional passages, they obtain late-hiNPCs. These two cell populations are characterized by cell morphology and marker expression. Then they test their susceptibility to ZIKV infection and show that late-hiNPCs are more efficient than early- hiNPCs to support viral replication. Moreover, authors demonstrate that the two cell populations are characterized by different cellular metabolism as glucose consumption is higher in early-hiNPCs than in late-hiNPCs although the overall glycolytic capacity is not different between the two subtypes. However, during ZIKV productive infection, late-hNPCs increased the glucose consumption (Fig. 3). The authors examined the mitochondrial alterations during infection showing different kinetics in early vs. late hiNPCs. Then, they show alterations of expression in genes of the lipid metabolism and content of lipid droplets that follow different kinetics of expression during infection in early vs. late hiNPCs. Overall, no significant differences were observed in the lipid droplet homeostasis between the two subtypes.<br /> This is a potentially interesting manuscript as they analyze the susceptibility of subtypes of neural progenitors to ZIKV infection and their metabolic alterations before and during infection. However, there are some concerns listed below.

      Major issues:

      1. It is well established that the NPC maturation during neurodevelopment is complex and cells at different stage of maturation play an important role. The authors propose a model that may recapitulate distinct populations of neural progenitors present during neurodevelopment. They use a modified protocol that it is well described. However, the characterization of these NPC subtypes needs to be improved. The pictures selected to be shown in Fig 1B and C do not highlight the morphology of these cells as described in the text.
      2. Late-hiNPC are more efficient than early-hiNPC in supporting ZIKV replication, however the differences are present exclusively at 56 h post-infection and they are modest (ca. 2-fold). Nevertheless, ZIKV cytopathic effects are similar between the two subtypes at 72 h post-infection. Authors should try to lower the MOI and extend the timing of analysis to up 10 days post-infection. They used MOI of 1, but it would be informative to know whether the different efficiency of viral replication is dependent on the MOI. Furthermore, are the differences between early and late-hiNPCs dependent on expression of entry receptor, or a different interferon response to virus infection or state of cell proliferation?
      3. The authors state that that this is the first report showing differential changes in nuclear morphology between neural progenitor cells. They show a main finding that is the perinuclear centers only visible in late but not in early-hiNPC in a supplemental figure. These results are not convincing, and an effort should be made in order to support these claims.
      4. Gene expression should be supported by data of protein expression (western blot) of some of the enzymes reported in Fig. 5.

      Minor issues:

      1. Since this work is based on in vitro data, I would suggest using the term infection rather than challenge when referring to infection experiments.
      2. Improve quality of the graphs. Enlarge symbols as in Fig. 6. Try to use linear scales as the differences are not dramatic and a linear scale would highlight them better.

      Referees cross-commenting

      I agree with all comments of Rev#1 and 3. Some/many of the claims are made without the supporting evidence.

      Significance

      Many papers have reported the efficient ZIKV infection of neural progenitor cells that have been derived from the reprogramming of human pluripotent stem cells (PSC). Most of this literature has not been cited. In fact, ZIKV virus infects human PSC-derived brain neural progenitors causing heightened cell toxicity, dysregulation of cell-cycle and reduced cell growth as reported in many papers. In this manuscript, the advancement consists in having used NPC subtypes that are at different stage of differentiation and having studied their susceptibility to ZIKV infection. Then, the author analyze the fluctations of the glucose and lipid metabolism during infection.

      The audiance that is interested in this manuscript are virologists and , in particular, experts in arboviruses that are for the most part neurotropic viruses. In addition, this is a topic for experts of neurodevelopment.

      My expertise is virology. Key words: Zika virus, neural progenitors, antivirals.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      This manuscript reports an investigation into the metabolic alterations induced by Zika virus (ZIKV) infection in human neuronal progenitor cells. The authors differentiated human iPSCs to derive neuronal progenitor cells (NPCs) at different days of incubation to represent the different stages of foetal CNS development. They found differences in the levels of ZIKV NS1 proteins as well as marginal differences in ZIKV titres in infected early and late hi-NPCs. Correspondingly, they also showed differences in glucose consumption, lipid metabolism and mitochondrial stress in ZIKV-infected early and late hi-NPCs. They concluded that differences in energy metabolism in neuronal progenitors both before and upon infection may contribute to the brain damage observed in congenital Zika syndrome.

      The evidence supporting a role for dysregulated metabolism in mediating the pathogenesis of congenital Zika syndrome is gaining traction and findings from this study could add to this body of knowledge. However, in its present form, this study has several gaps that limit the extent to which it informs on the clinical pathogenesis of congenital Zika syndrome.

      Major concerns:

      1. The most important concern in this study is the strain of ZIKV used in all of the studies. ZIKV MP1751 was isolated from a mosquito and belongs to the African lineage of ZIKV. Unlike the Asian lineage ZIKV isolated from Latin America and French Polynesia, gestational infection with ZIKV of the African lineage has not been clinically associated with increased risk of foetal abnormality. It is thus uncertain how the changes observed in this study relates to the observed neonatal pathology. Perhaps a way to address this issue is to argue that a difference in these lineages it the ability of the virus to evade systemic and endothelial innate immune responses to cross the placental and blood brain barriers (several papers on attenuated ZIKV have shown this data). Once these barriers are breached, strain differences should not materially affect the similar pathogenic processes in neuronal cells, as also been shown by others using the MR766 strain of ZIKV. Such a discussion would be helpful to contextualise the clinical relevance of this study.
      2. While the metabolic changes upon ZIKV infection are all interesting, how these changes affect CNS development is unclear. Figure 2F shows marginal impact on productive ZIKV infection and comparable extent of cell death in early and late hi-NPCs. What specific CNS pathology is dependent on the reported metabolic changes?
      3. Figure 2D: The most remarkable virological difference observed is the significant difference in cytoplasmic NS1 levels between early and late hi-NPCs at 56 hpi. Although the data in Fig 2D in general could have been compromised by the quality of the anti-NS1 mAb (the anti-E assay in Fig 2E used polyclonal antibody), it would have been useful to test for NS1 expression using western blot on a denaturing gel (and appropriate anti-NS1 antibody). The mAb used in this study binds a conformational epitope on NS1. The difference in data in Figure 2D and 2E could thus have been misfolding of NS1. Misfolded NS1 could contribute to ER stress that could be important for dysregulated CNS development. A more detailed investigation of the finding in Figure 2D could be highly informative.
      4. Figure 3A and related text: The fold-change in GLUT1, HK-1 and GAPDH expression are shown in log10 scale. In this scale, 1 would indicate 10-fold increase in expression. The data in Figure 3A are entirely inconsistent with the description in the related text. Which is correct?

      Minor concerns:

      1. Figure 5: The effects of ZIKV infection on the mitochondria of hi-NPCs are interesting and the comparison between ZIKV-infected and uninfected cells in the same culture is a strength of this study. It would be helpful to readers if the authors could include a discussion on the kinetics of ZIKV infection; diminished differences at 48 and 72 hours could be due to the mixture of cells infected at inoculation and hence observed at 24 hours and newly infected cells that were negative for ZIKV E protein at 24 hours. Emphasis should thus be on the 24 h data in Figures 5 C-E.
      2. Hi-NPCs likely have a diploid genome and thus a finite lifespan. Using the term "cell line" to describe these cells is technically incorrect. Please consider using other terms, such as cell strain.
      3. Discussion section, 3rd paragraph, lines 6-7. The authors suggest thermal decay as an explanation for their observation yet Figure 2B argues against this explanation. Moreover, Kostyuchenko et al (Nature 2016; 533:425-8) have also shown that ZIKV is relatively thermostable. This explanation offered by the authors lack supporting evidence.
      4. Discussion section, 3rd paragraph, line 16 and Supplementary Figure 2. I believe the authors are referring to Supplementary Figure 3 and not 2. The indentations observed could be due to ZIKV replication although the data, as presented is not convincing. Co-staining for ZIKV E protein would be useful.

      Referees cross-commenting

      • I fully agree with both Reviewers #2 and #3 on the quality of the immunofluorescence images and that these images alone are not sufficiently convincing to support the inferences the authors are making.
      • I also appreciate the first major comment from Reviewer #3. That is important insight and the authors should test their assumption that they have monocultures of human progenitor cells.

      Significance

      The focus on the metabolism and mitochondrial stress in ZIKV infected neuronal progenitors is interesting and could fill an important gap in knowledge on Zika pathogenesis. The study uses human iPSC derived NPCs instead of animal cells, which is also more clinically relevant than animal models. The findings would thus be of interest to all who are interested in Zika pathogenesis as well as therapeutic/vaccine development. If the above concerns could be addressed, the findings in this study could form the missing links in our current understanding of congenital Zika syndrome.

      Expertise: Flavivirology and immunology. Flavivirus-host interactions.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      In this manuscript the authors examine PAR-binding properties of PARP1 and identify ZnF3, BRCT and WGR domains as PAR-binding domains, which show cooperative effects on PAR binding. Their affinity for PARylated PARP2 was slightly higher compared to naked PAR. PAR binding competes with the binding to DNA strand breaks (SSB or DSB) and promotes DNA dissociation. PAR also reduces DNA-dependent activation of PARP1 catalytic activity. The findings are based on biochemical and biophysical experiments and the cellular significance of these findings has not been investigated.

      Major comments:

      1) The conclusion that the binding affinity of the three domains for PAR is high should be adjusted as the Kd is in the low micromolar range (3-5 uM). The PAR-binding affinity of individual domains compared to the full-length protein (Kd=39 nM) is thus rather low.

      Response: We agree with the reviewer that the Kd for PARP1 (measured using BLI) is low compared to that reported for individual PAR-binding domains (measured using ITC). But we have also measured the combined KD for three high-affinity PAR binding domains (ZnF3-BRCT-WGR) which is in the nanomolar range (~140 nM) which infers that the domains show cooperativity or synergy for PAR binding, while the affinity for PARP1 is ~39nM. The difference in KD can be attributed to the absence of ZnF1 and CAT domains in construct ZnF3-BRCT-WGR which could contribute to higher affinity in the case of PARP1.

      2) What is the affinity of PARP1 lacking ZnF3, BRCT and WGR for PAR? What is the DNA binding affinity of this mutant and its catalytic activity? If PAR competes with DNA binding, then this mutant is expected to show stronger DNA binding and stronger catalytic activation.

      Response: We thank the reviewer for raising the concern, but we differ from the reviewer’s assumption “If PAR competes with DNA binding, then this mutant is expected to show stronger DNA binding and stronger catalytic activation” since DNA recognition and DNA-dependent stimulation of PARP1 is independent of PAR binding.

      To address the concern, we cloned, expressed, and purified the ZnF1-2-CAT construct which lacks ZnF3, BRCT, and WGR domains (Figure S2j), and performed FP binding studies. Our results show that ZnF(1-2)-CAT binds to SSB with almost similar affinity as PARP1 while the affinity for DSB has reduced ~9 times due to lack of ZnF3 and WGR domain which contribute to DSB recognition (Figure S8a-d).

      We also assessed the catalytic activity of ZnF(1-2)-CAT using PNC1-OPT assay. Our results show that the construct could not be stimulated by SSB DNA but show a little more than basal-level activity, which is expected because the interdomain contacts required for communication of DNA-dependent stimulation signal from the N-terminus to the catalytic domain are lost due to the absence of ZnF3, BRCT, and WGR domains (Fig 6B). In addition, automodification (PARylation) domain, which is located between BRCT and WGR is also lost. We only performed the assay with SSB because it showed almost the same affinity as PARP1.

      3) The role of the WGR domain in DNA and PAR binding is unclear from the experiments in Figs. 4 and 5. The lower PAR concentration required to dissociate DNA from PARP1 in the case of full-length PARP1 vs ZnF-BRCT construct cannot be interpreted as being due to the WGR domain present in the full-length protein. To clearly show that this effect is due to the WGR domain, two experiments can be conducted: (i) compare full-length PARP1 and PARP1 mutant lacking WGR; (ii) compare ZnF-BRCT and ZnF-BRCT-WGR.

      Response: We thank the reviewer for suggesting experiments to further validate the role of the WGR domain in PAR-dependent DNA dissociation from PARP1. To perform the experiments, we cloned expressed and tried to purify ZnF(1-2-3)-BRCT-CAT (PARP1ΔWGR) and ZnF(1-2-3)-BRCT-WGR (PARP1ΔCAT) variants of PARP1 which lack the WGR domain and CAT domains (Figure S2l), respectively. We were unable to purify PARP1ΔWGR since it ended up in inclusion bodies.

      We conducted the FP binding experiments of ZnF(1-2-3)-BRCT-WGR with DNA breaks and it showed an almost similar binding affinity for DSB and SSB as that of PARP1 since all the domains involved in both the DNA breaks recognition are present in the construct (compare Figure 5c-d to Figure S8a-b). Furthermore, Ki values of PAR required to dissociate DSB and SSB from ZnF(1-2-3)-BRCT-WGR are ~ 1.8 and ~1.4 times, respectively, (Figure 5g-h) lesser than required for DNA dissociation from ZnF(1-2-3)-BRCT (Figure 5e-f), which again indicates that the WGR domain plays important role in PAR-induced DNA-break dissociation from PARP1.

      4) What is missing to make this study of higher impact are cellular assays to show, for example, how the absence of ZnF3, BRCT and WGR affects PARP1 recruitment to and retention at DNA damage sites.

      Response: We strongly agree with the reviewer that having cell-based experiments in the paper will give more insights into the PAR-dependent regulation of PARP1, but our data using several truncated and deleted variants of purified PARP1, binding, and competition binding studies, competition enzyme assays with multiple complementary techniques clearly shows that PAR plays major roles in modulating DNA dependent activities of PARP1. Certainly, this is in future plans with collaboration.

      Minor comments:

      The manuscript should be edited to improve readability and the presentation of the data.

      Response: We have edited the manuscript to improve the readability and presentation of diata.

      Reviewer #1 (Significance (Required)):

      Auto-PARylation of PARP1 was previously shown to cause its dissociation from DNA. Here the authors show that PAR binding through ZnF3, BRCT and WGR domains also causes dissociation from DNA and reduces PARP1 catalytic activity. These findings contribute to our understanding of how PARP1 DNA binding and activity can be regulated and will be of interest to researchers in the field of PARylation.

      I have expertise in biochemical analysis of PARylation.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      The authors investigate the impact of poly adenosine repeats on the parylation activity of Poly(ADP-ribose) polymerase 1 (PARP1). They show that PAR can bind to PARP1 through specific domains and that binding occurs in some cases to be as strong as binding to DNA. This work indicates that PAR binds to PARP1 sufficiently well to allosterically alter the biological consequences of PARP1 through parylation. For example, DNA appears to bind PARP1 and negatively regulate Parylation, therefore the work is potentially highly significant.

      **Referees cross-commenting**

      I agree with comments from Reviewer 1. Especially with the descriptions of binding affinity. low micromolar binding is relatively low affinity. The authors should revise this description. Other comments from Reviewer 1 are also appropriate.

      Response: We have addressed all the comments from reviewer 1.

      Reviewer #2 (Significance (Required)):

      General assessment: the authors use many purified domains from PARP1 that are purified and are used for quantitative binding experiments. The binding experiments appear to be done thoroughly with appropriate instrumentation.

      Advance: This work fills in a gap in understanding PARP1 and its key role in recruiting proteins to damaged DNA; that being the role of PAR in direct binding to PARP1.

      Audience: PARP1 is a major target for inhibition in treating cancer. The audience will include those interested in targeting PARP1 in a different way. As an enzymologist with interests in DNA repair, this paper was interesting and the results were properly analyzed.

      There are a few instances in which the text needs to be checked for grammar. Overall, the manuscript is clearly written. The data appear to be well presented except for items listed below.

      The equation used to fit fluorescence polarization data should be listed in the methods section. The competition binding studies were performed with 40 nM protein and 20 nM probe DNA. Under these conditions, Ki values below 20 nM should represent saturation binding rather than equilibrium binding. It would be useful to know whether the Ki values are reproduced with lower probe concentrations (below the Ki values). How is this taken into account in the data analysis?

      Response: Thanks for the reviewer suggestion to include equation to fit competition-binding data. As the reviewer suggested, we included the equation in the materials and methods section (Fluorescence Polarization (FP) studies).

      We completely agree with the reviewer that at a probe concentration of 20 nM, Ki values below 20 nM would represent saturation binding rather than equilibrium binding, but none of our Ki values are D * and Ki values differed marginally from corresponding values at 20 nM probe (DNA) concentration (Figure 4 and Figure S8a-b and e-h).

      Fig.4. The concentration of PARP1 and concentration of the DSB or SSB DNA should be stated. Also, the equation for fitting the data should be shown.

      Response: We have mentioned the concentrations of proteins and DNAs in the figure legends. The equation used for fitting competition-binding data has been included in the materials and methods (Fluorescence Polarization (FP) studies).

      Fig 5. list the concentration of enzyme and the 5-FAM DNA in the legend.

      Response: We have mentioned the concentrations of proteins and DNAs in the figure legends.

      Fig 6. In panel A, what form of DNA is shown in the gel image?

      Response: In Fig. 6, panel A, SSB has been used to show the DNA-dependent PARP1 stimulation. We have mentioned the name of DNA in figure, figure legend and corresponding text.

      Supplemental fig. 8 also need to list the concentration of the DNA.

      Response: We have mentioned the concentrations DNAs in the figure legends

      Reference is made to Figure S9, but there is no Figure S9.

      Response: Removed.

      A table that summarizes binding activity and catalytic activity would be helpful.

      __Response: __A table summarizing the binding affinity and catalytic activity of the constructs has been included in Supplementary File (Table S2).

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      The authors investigate the impact of poly adenosine repeats on the parylation activity of Poly(ADP-ribose) polymerase 1 (PARP1). They show that PAR can bind to PARP1 through specific domains and that binding occurs in some cases to be as strong as binding to DNA. This work indicates that PAR binds to PARP1 sufficiently well to allosterically alter the biological consequences of PARP1 through parylation. For example, DNA appears to bind PARP1 and negatively regulate Parylation, therefore the work is potentially highly significant.

      Referees cross-commenting

      I agree with comments from Reviewer 1. Especially with the descriptions of binding affinity. low micromolar binding is relatively low affinity. The authors should revise this description. Other comments from Reviewer 1 are also appropriate.

      Significance

      General assessment: the authors use many purified domains from PARP1 that are purified and are used for quantitative binding experiments. The binding experiments appear to be done thoroughly with appropriate instrumentation.

      Advance: This work fills in a gap in understanding PARP1 and its key role in recruiting proteins to damaged DNA; that being the role of PAR in direct binding to PARP1.

      Audience: PARP1 is a major target for inhibition in treating cancer. The audience will include those interested in targeting PARP1 in a different way. As an enzymologist with interests in DNA repair, this paper was interesting and the results were properly analyzed.

      There are a few instances in which the text needs to be checked for grammar. Overall, the manuscript is clearly written. The data appear to be well presented except for items listed below.

      The equation used to fit fluorescence polarization data should be listed in the methods section. The competition binding studies were performed with 40 nM protein and 20 nM probe DNA. Under these conditions, Ki values below 20 nM should represent saturation binding rather than equilibrium binding. It would be useful to know whether the Ki values are reproduced with lower probe concentrations (below the Ki values). How is this taken into account in the data analysis?

      Fig.4. The concentration of PARP1 and concentration of the DSB or SSB DNA should be stated. Also, the equation for fitting the data should be shown.

      Fig 5. list the concentration of enzyme and the 5-FAM DNA in the legend.

      Fig 6. In panel A, what form of DNA is shown in the gel image?

      Supplemental fig. 8 also need to list the concentration of the DNA.

      Reference is made to Figure S9, but there is no Figure S9.

      A table that summarizes binding activity and catalytic activity would be helpful.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      In this manuscript the authors examine PAR-binding properties of PARP1 and identify ZnF3, BRCT and WGR domains as PAR-binding domains, which show cooperative effects on PAR binding. Their affinity for PARylated PARP2 was slightly higher compared to naked PAR. PAR binding competes with the binding to DNA strand breaks (SSB or DSB) and promotes DNA dissociation. PAR also reduces DNA-dependent activation of PARP1 catalytic activity. The findings are based on biochemical and biophysical experiments and the cellular significance of these findings has not been investigated.

      Major comments:

      1. The conclusion that the binding affinity of the three domains for PAR is high should be adjusted as the Kd is in the low micromolar range (3-5 uM). The PAR-binding affinity of individual domains compared to the full-length protein (Kd=39 nM) is thus rather low.
      2. What is the affinity of PARP1 lacking ZnF3, BRCT and WGR for PAR? What is the DNA binding affinity of this mutant and its catalytic activity? If PAR competes with DNA binding, then this mutant is expected to show stronger DNA binding and stronger catalytic activation.
      3. The role of the WGR domain in DNA and PAR binding is unclear from the experiments in Figs. 4 and 5. The lower PAR concentration required to dissociate DNA from PARP1 in the case of full-length PARP1 vs ZnF-BRCT construct cannot be interpreted as being due to the WGR domain present in the full-length protein. To clearly show that this effect is due to the WGR domain, two experiments can be conducted: (i) compare full-length PARP1 and PARP1 mutant lacking WGR; (ii) compare ZnF-BRCT and ZnF-BRCT-WGR.
      4. What is missing to make this study of higher impact are cellular assays to show, for example, how the absence of ZnF3, BRCT and WGR affects PARP1 recruitment to and retention at DNA damage sites.

      Minor comments:

      The manuscript should be edited to improve readability and the presentation of the data.

      Significance

      Auto-PARylation of PARP1 was previously shown to cause its dissociation from DNA. Here the authors show that PAR binding through ZnF3, BRCT and WGR domains also causes dissociation from DNA and reduces PARP1 catalytic activity. These findings contribute to our understanding of how PARP1 DNA binding and activity can be regulated and will be of interest to researchers in the field of PARylation.

      I have expertise in biochemical analysis of PARylation.

  3. Jan 2023
    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Manuscript number: RC-2021-01111

      Corresponding author(s): Esther Stoeckli

      [Please use this template only if the submitted manuscript should be considered by the affiliate journal as a full revision in response to the points raised by the reviewers.

      If you wish to submit a preliminary revision with a revision plan, please use our "Revision Plan" template. It is important to use the appropriate template to clearly inform the editors of your intentions.]

      1. General Statements [optional]

      Dear editors at Review Commons

      Thanks for your patience. We have finally carried out a full revision of our originally submitted manuscript summarizing our findings on the role of Cables1 in axon guidance.

      In our study, we provide in vitro and in vivo evidence for a role of Cables1 as a linker between axon guidance signaling pathways. Commissural axons in the developing spinal cord leave their intermediate target, the floor plate, due to a switch from attraction to repulsion mediated by the specific trafficking of Robo1 receptors to the growth cone surface. The presence of Robo1 on growth cones after contact with the floor plate allows them to respond to Slit, the negative guidance cue associated with the floor plate. After leaving the floor plate on the contralateral side, growth cones respond to a Wnt gradient along the antero-posterior axis. The responsiveness to Wnt of post- but not pre-crossing axons is regulated by the trafficking of Fzd3 receptors to the growth cone membrane of post-crossing axons (Alther et al., 2016), but also by the specific phosphorylation of β-Catenin at tyrosine Y489 by Abl kinase. Cables1 mediates this phosphorylation by transferring Abl kinase from the C-terminus of Robo1 to β-Catenin (this study).

      The revised version of the manuscript contains additional experiments in vitro, in vivo and ex vivo combined with live imaging to further support our conclusion about the role of Cables1 as a linker between Robo/Slit and Wnt signaling.

      It took as longer than expected to carry out these new experiments, as Nikole Zuñiga, the first author of the paper, left the lab after her PhD defense to take up a job in industry. Unfortunately for the study, but fortunately for Giuseppe Vaccaro, he also got a job soon after taking over the project. Therefore, the revision was delayed again. We hope that the additional experiments will solve the issues that were raised by the reviewers. We thank them for their contributions and suggestions.

      Best regards

      Esther Stoeckli

      2. Point-by-point description of the revisions

      This section is mandatory. *Please insert a point-by-point reply describing the revisions that were already carried out and included in the transferred manuscript. *

      Point to point response to reviewers’ comments

      Reviewer #1 (Evidence, reproducibility and clarity (Required)): In this work by Zuñiga et al. the authors study the role of the adaptor protein Cables1 on the guidance of post-comissural spinal cord neurons. They hypothesize that commissural axons need Cables1 to leave the floor plate and turn to ascend to the brain. They propose that during this process, Cables1 acts as a linker of two key axon guidance pathways, Slit and Wnt. Cables1 would localize β-catenin phosphorylated at tyrosine 489 to the distal axon and this would be necessary for the correct turning and navigation of post-crossing commissural axons. Although the work may be potentially interesting, there are major issues that authors need to address in order to state their claims:

      -Fig. 2. To visualize the axonal phenotype after downregulation of Cables1 the authors use DiI labelling. This difficults the interpretation of the results as both electroporated and non- electroporated axons are labelled. Since the authors have a Math1::tdTomatoF reporter construct (as in Fig. 3), it would be desirable to use this construct Math1::tdTomatoF in combination with the dsCables1 plasmid to better visualize the phenotype. Alternatively and less preferred, GFP signal should be also shown in Fig.2B experiments.

      We respectfully disagree. Most likely, the reviewer thinks about a defined nerve that has a particular trajectory and then when labelled with a fluorescent marker, deviations from this pathway, or defasciculated growth can be easily visualized. However, in the spinal cord, the dI1 axons run ventrally more like a ‘curtain’. Therefore, the aberrant behavior of axons is difficult to see. We therefore, opted for the alternative suggestion and added the GFP images to visualize clearly that the axons labelled with DiI are from the injected area. We also would like to add that we are extremely careful in injecting DiI only to the dI1 population of commissural axons to avoid mixing populations with different trajectories. As the analysis is done by a person blind to the experimental condition, we are convinced that our way of analyzing the phenotype is valid. An approach that has been successfully used by many groups for decades now. Please also keep in mind that we are always comparing groups of embryos with each other. Furthermore, having axons traced by DiI which were not targeted by dsRNA electroporation would not increase but rather decrease the likelihood of aberrant behavior. Therefore, we are convinced that our method of quantification is valid.

      However, we have added new experiments using live-imaging which also demonstrate that many axons in embryos electroporated with dsCables1 fail to turn properly at the floor-plate exit site (see Movie 2). These experiments provide additional evidence for the validity of our results.

      -Fig. 2B and Supp.Fig.3. Comparable DiI labellings should be shown in the different conditions. The three examples shown in this panel despite different amount of DiI-labeled axons making it difficult to compare them.

      We have exchanged the image of the control-treated embryo in Figure 2 to have more comparable DiI injection sites. However, as we detail in our Material & Method section, the quantification was done in such a way that the number of axons does not matter. We rephrased this paragraph to make this point more clear (lines 630ff). Please also refer to the GFP-expressing control sample shown in Figure 6A.

      We counted a DiI injection site as showing floor-plate stalling when at least 50% of the fibers entering the floor plate failed to reach the exit site. Similarly, ‘No turn’ means that at least 50% of the axons at the exit site failed to turn rostrally. Because, these two phenotypes are not independent of each other (100% stalling prevents the analysis of the turning phenotype), we only did a statistical analysis for the DiI injection sites with correctly turning axons. We also would like to point out that we hardly had injection sites where it was difficult to decide whether the 50% threshold was reached or not.

      -Fig. 2D. An scheme depicting the different phenotypes: "normal", "FP stalling" and "no turn" would help to understand the results. They can use schemes similar to those shown in Fig. 2K Parra et al. 2010.

      We have added a scheme outlining the different phenotypes, as suggested to Figure 2A.

      -Fig. 3A. The open-book drawing is confusing. It seems that they are analyzing open-book preparations in this experiment when this is not the case.

      Now Figure 4: We have changed the schematic explaining our experimental design. We wanted to illustrate that we only took the dorsal-most part of the spinal cord, dissected from open-book preparations of the spinal cord, as explants to avoid the inclusion of other cell types.

      -Fig. 3B. Authors claim that Cables1 is not required in pre-crossing axons as dsCables electroporation does not affect axonal growth of DiI neurons taken at HH22. However, to be sure that Cables1 mRNA levels are downregulated in pre-crossing axons, relative levels of Cables1 mRNA and/or protein should be also determined at HH22 not only at HH25.

      We have clarified the quantification of downregulation efficiency. The qPCR data are taken from HH23, that is one day after electroporation. The Western blot data show differences in protein levels at HH25, that is 2 days after electroporation. In both cases, the downregulation efficiency is about 50%. This means that we got rid of all Cables1 mRNA, as we successfully transfected 50% of the cells in the targeted area (52.5% in n=4 embryos). The cell numbers were determined by counting the ratio of GFP-positive cells from transfected spinal cords in a single cell suspension.

      -Fig. 4. The incapacity of Slit to induce axonal retraction in dsCables1 neurons is used to conclude that Cables1 is required to respond to Slit. However, downregulation of Cables1 by itself is even more effective inhibiting axonal growth than Slit treatment. Upon this strong effect as a background, it is difficult to assay slit response. Authors should point this observation in the manuscript.

      We disagree. There is no significant difference between the neurite lengths between the control neurons in the presence of Slit and the neurons lacking Cables1 (dsCables1), p=023, or the neurons lacking Cables1 in the presence of Slit (dsCables1 and Slit), p>0.9999. As seen in the images and also from the measured neurite lengths, axons still show growth and further reduction would have been possible. We would also like to point out that the conclusion from this experiment is that Cables1 is required for the response of axons to either Slit or Wnt.

      To support our claims, we have added another experiment addressing the need for Cables1 for post-crossing axons’ responsiveness to Slit by downregulation of Robo receptors (Figure 10). These experiments confirmed that Slit/Robo signaling is required for the effect of Cables1 on post-crossing axons, in line with our final conclusion that Slit binding to Robo triggers internalization and Cables then transfers Abl from the C-term of Robo to β-Catenin. This results in phosphorylation of β-Catenin at tyrosine489 (β-Catenin pY489) and responsiveness to Wnt5a.

      -Fig. 5B. In this Figure they do not differentiate between FP stalling or no turn phenotypes. A quantification taking into account the different phenotypes as shown in Fig.2D should be included.

      Done, as suggested. This is Figure 6C in the revised manuscript.

      -Fig. 6D,E. As postulated in the manuscript and based on the Rhee, et al. paper, the β-catenin phosphorylation is triggered by Abl quinase upon Slit-Robo signaling. How the authors explain then that isolated cells with axons growing on a plate recapitulate specific distal phosphorilation of β-catenin at Y489 in the absence of Slit signaling? This experiment shows that postcrossing axons contain more phosphorylated β-catenin as an intrinsic characteristic rather than as a consecuence of contact with floor plate signals. Authors should try a similar experiment but exposing the neurons (or explants) to Slit. Also, why β-catenin phosphorylation was not measured at the growth cone?

      In Figure 6D and E (now Figure 7D,E), we compare pre- and post-crossing axons. Post-crossing axons do have ‘a memory’ of their contact with the floor plate, as this contact has changed the localization of Robo receptors to the surface (Philipp et al., 2012; Alther et al., 2016). Floor-plate contact also initiates differences in gene expression (e.g. Hhip expression in a Shh-and Glypican-dependent manner; Wilson and Stoeckli, 2013). The difference in Robo localization has also been described by others (Pignata et al., Cell Rep 29(2019)347).

      In fact, the distal localization of pY-489 β-Catenin is in perfect agreement with our results: The localization of Robo1 on the distal portion of the axon is in line with published data from our own lab but also from the Castellani and the Tessier-Lavigne lab. Our results suggest that Cables is recruited to Abl bound to the C-term of Robo. Cables transfers Abl then to β-Catenin which is phosphorylated by Abl. Thus pY-489 β-Catenin would be localized predominantly where Robo is localized, i.e. the distal axon. In support of these results, experiments added to the revised version of the manuscript indicate that the response to Slit is required for the increase in β-Catenin pY489 (Figure 10B).

      -Fig. 7. CAG::hrGFP electroporation is not specific for dl1 neurons. This experiment should be performed with Math1::tdTomatoF in order to analyze β-cat pY489 with or without dsCables1 specifically in dl1 neurons. Also, why GFP staining at the growth cones in Fig.7B is not visible in the axon?

      As indicated in our schematic drawing (Figure 7A) we only cultured explants from the dorsal-most part of open-book preparations of spinal cords, making sure that our cultures are not mixtures with more ventral populations of neurons. We opted for CAG::hrGFP because Math1 is a weak promoter and the expression of GFP was very difficult to see after dissociating cells and culturing them in vitro. We used a GFP version that is not farnesylated to avoid interference with axonal staining of pY-489 β-Catenin. Therefore, GFP is not visible in axons with the imaging conditions used.

      -Fig. 8. This experiment does not distinguish whether phosphorylated β-Cat is necessary for the correct navigation of post-crossing commissural axons (as it is claimed in the abstract) or it is also required for midline crossing. As it has been previously shown, correct navigation of post-crossing commisusal axons is a Wnt5 dependent process. As dsCables1 abrogates Wnt5a responsiveness (Fig.4B,C), does the phosphomimetic β-catenin Y489E construc rescue the Wnt5a response in dsCables1 electroporated neurons? Moreover, can the phosphomimetic β-catenin Y489E construc rescue the Slit response in dsCables1 electroporated neurons? Testing these effects on explants as in Fig. 4B,C but including phosphomimetic β-catenin, will help to understand to what extend phosphorylation of β-catenin is important for crossing, turning or both processes.

      Yes, the phosphomimetic Y489E version of β-Catenin reduces the percentage of DiI injections sites with aberrant axonal navigation to control levels (Figure 9 in the revised manuscript). In contrast, a mutant version of β-Catenin that cannot be phosphorylated, β-CateninY489F, cannot rescue the axon guidance phenotype seen in the absence of Cables1.

      -How do the authors envision the mechanism of Cables1/β-catenin mediated crossing and turning? A working model summarizing their hypothesis would help the reader to understand the results.

      **Minor points:** -Homogeneize the term "scale bars" or "bars" in the Figure Legends.

      done

      -Scale bar of insets in Fig.1C is missing.

      The scale bar is now added, we apologize for the mistake.

      -The antisense control for Cables probe should be shown at HH-22/24. Otherwise is not possible to distinguish whether they do not detect signal because is a negative control or because Cables1 is not expressed at HH25.

      We have added the image of an adjacent section hybridized with the sense probe for HH25, in addition to HH22 to clarify that Cables expression is higher during floorplate crossing, exiting and turning rostrally but then levels decrease when post-crossing axons have initiated their growth along the rostro-caudal axis.

      -Figure legend for Fig. 2D is missing

      corrected

      -Fig. 8B right panel is contaminated with growthing axons coming from the below DiI injection. Please replace the picture.

      We have changed the outline of this figure.

      -The quantification of the different phenotypes "FP stalling", "no turn" should be better explained in the Mat and Met section. The sentence " more than 50% of the axons...." is not clear. Was this measured by eye? Otherwise, please indicate the soIware used to measure.

      Yes, as mentioned above, it was hardly ever a close call. It is very easy for a person blind to the experimental condition to go through the DiI injection sites of an open-book preparation and to assess whether 50% or more of the axons that enter the floorplate reach the exit site, or not. Similarly, it is very easy to do the same for the turning behavior. We have changed the text describing this method of quantification to be more explicit (lines 630ff).

      -Provide the quantification of the WB in Supplementary Fig. 2B normalising to Gapdh.

      Added as Supplementary Figure 2C.

      Reviewer #1 (Significance (Required)): Previous results have demonstrated that Slit-induced modulation of adhesion is mediated by cables that links Robo-bound Abl kinase to N-cadherin-bound betacat (Rhee et al., 2007). Here the authors propose that a similar mechanism is operating in commissural neurons leave the midline after crossing and turn immediately after. The role of Cables in the process has not been previously addressed. Thus, after proper addressing of my main concerns, I consider this paper may advance in our knowlege of how growing axons navigate intermediate targets.

      We appreciate this positive evaluation of our study and hope that the additional experiments and more detailed explanations have helped clarify open questions of the reviewer.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)): In this paper entitled "Cables1 links Slit/Robo and Wnt/Frizzled signaling in commissural axon guidance", authors aim to the find the mechanisms the coordinate the floor plate exit and the rostral turning of commissural axons. During development thousands of axons have to navigate long distances to reach their targets and build functional circuits. To facilitate their journey, their paths is divided into small portions by intermediated targets. The most studied intermediated target is the floorplate (FP) at the midline of the ventral spinal cord. Glia cells forming the FP express plethora of guidance cues. Commissural neurons, which have their cells bodies located in the dorsal part of the spinal cord, send their axons towards the FP. These axons are first attracted by the FP which facilitate their entry within the FP. However, they switch this attractive response into a repulsive one in order to exit the FP and turn rostrally to connect their brain targets. In order to ensure that this process will go smoothly, commissural axons have to adapt the composition of their receptors and the signaling pathways to switch from attractiveness to repulsion. So far, many processes have been involved such as the alternative splicing of receptors (Robo3; Chen et al Neuron 2008), protease regulation of receptor expression (Nawabi et al Genes & Dev 2010), trafficking of receptors, or their interaction profiles (Delloye et al Nat Neuro 2015). However, it is still not clear how 2 events (here exit from the FP and rostral turning) are linked. Authors propose an original mechanism that involved the adaptor protein Cables 1. This protein has been shown to link the Robo/Slit1 signaling to Cadherins. Cables regulates the repulsive response to Slit and adhesion by the phosphoryla4on of b-Catenin by the kinase Abelson (Rhee et al Nat Cell Biol 2007). The story developed here is very original and interesting: Cables would link the exit of FP (mediated by Robo/Slit signaling) and the rostral turning of the commissural axons (controlled by the Wnt/Fzd pathway. Below I'm proposing some experiments as many questions raised upon reading this beautiful work. The experiments are sound and could be reproducible. The statistic analysis looks fine.

      We thank the reviewer for this positive assessment of our study.

      I would suggest some experiments to strengthen the whole work: •Authors might want to consider to perform some biochemistry experiments to show that Cables is able to interact with Robo1 and Fzd3: are these proteins in the same molecular complex? They could do 2 experiments: one in vitro by transfecting a cell line (such as HEK293 or cos cells) with plasmids coding for Robo1, Cables and Fzd3 or at least Cables and Fzd3 (as for Robo1/Cables they could refers to Rhee et al 2007). Another one would be in vivo: extracting proteins from the pre-crossing stage, the FP and post crossing stage; immunoprecipitation of Cables1 and see whether Robo1 and/or Fzd are pull down with Cables 1.

      We decided not to do these experiments, as we felt that this would go beyond the current study. In fact, for our effects it is not necessary that Cables interacts physically with Robo or Fzd3. The important aspect is that Abl bound to Robo is transferred by Cables to β-Catenin. A direct interaction with Fzd3 is not necessary.

      • From the pictures it seems that most of the axons are stalling in the FP when embryos are electroporated with dsCables1. It would be nice to show more examples of axons that are able to exit the FP but have turning problems. Given the data, as it is presented, it seems that Cables regulates more the FP exit (and therefore, as it was shown in Rhee et al, the responsiveness to Robo/Slit signaling).

      The major phenotype is ‘no turn’. However, as we describe in response to reviewer 1 and in the manuscript, the ‘floorplate stalling’ and the ‘no turn’ phenotypes are not independent of each other. At DiI injection sites, where almost all axons stall in the floorplate, the turning cannot be assessed. Thus, the ‘no turn’ phenotype tends to be underestimated in conditions where floorplate crossing is also affected, as is the case after silencing Cables1.

      In the same line, in Fig 4, Authors need to add a condition using dsCables and ds Fzd in order to see the effect of Cables on axon turning (response to Wnt). As it is this figure supports the role of Cables on FP exit but it's hard to make the link with commissural axon responsiveness to Wnt.

      We belief that experiment 4 clearly demonstrates the absence of the Wnt responsiveness, as axons fail to grow in response to Wnt when they extend from neurons transfected with dsCables1 (Figure 4C). Because dsCables1 alone already abolishes all responsiveness to Wnt, the removal of Fzd at the same time would not change anything.

      • Authors aim to show that Cables is a linker between 2 events: maybe it should be nice to try to disconnect these events. One way would be (if technically possible) to modulated expression of Cables at different stages. What would happen if Cables was down regulated upon FP crossing? Would axons still be able to respond to Wnt? The question I'm wondering about is whether the responsiveness to Slit and Wnt is acquired at the same time or whether axons should become sensitive to Slit and this event will prime them to respond to Slit. In order to address the following experiment could be performed: explants from HH22-HH23 embryos, could be treated with medium containing Slit first and then Wnt or vice et versa and perform some collapse assay.

      Unfortunately, the experiment as proposed by the reviewer is not possible. The axons take on average 5.5 hours to cross the floorplate (entry – exit; Dumoulin et al., 2021). Most importantly, the protein that is already made before axons are at the exit site, could not be removed. Therefore, it is not possible to prevent the production of Cables only after axons have crossed the midline. As shown in Figure 1, Cables1 mRNA is present at HH22, that is when axons have reached and are about to enter the floorplate. We also do not belief that the in vitro experiment suggested by the reviewer would work. We would have to wash cell intensively to remove Slit added to the medium. This would interefere with their potential to grow in response to Wnt immediately after addition. However, we added experiments where we looked at the effect of Wnt after removal of Robo (Figure 10). These experiments demonstrate that responsiveness to Wnt can only be established when axons can respond to Slit, i.e. when Robo is activated.

      • In Fig3 I was wondering whether post crossing axons were growing less because of the change in the regulation of adhesion: Rhee et al shows that Cables is able to modulate adhesion through N-cadherin. It would be interesting to perform immunostaining on these explant cultures to assess any change in adhesion molecules.

      We have not found any changes in the expression levels of Contactin-2 (Axonin-1), NrCAM, or most importantly β1-Integrin, as our cultures grow on laminin.

      • It is not clear whether Robo1 and/or Fzd induces the phosphorylation of b-catenin: is the Robo1/Slit binding induce the phosphorylation of b-cat and this event will prime the axons to respond to Wnt/Fzd? Or Wnt/Fzd is also able to control b-cat phosphorylation?

      We have added an experiment, where we remove Robo1 from commissural neurons and compare pY489 β-Catenin levels (Figure 10). Furthermore, we demonstrate that in the absence of Robo1, Wnt has no stimulatory effect on axons (Figure 10C,D). These experiments supports our conclusion that Cables1 transfers Abl kinase from the C-terminal part of Robo to β-Catenin, which gets phosphorylated and thus is ready to act in the Wnt signaling pathway.

      • The staining with the antibody needs to be detailed: as it is reported this antibody recognizes "a domain of Cables1 that is 90% identical to the corresponding region of Cables2": it seems that the Cables protein enrichment in the floor plate (around the central canal) is Cables 2 as its mRNA expression matches this profile of expression. The one expressed in the crossing axons might be Cables 1: one way to verify this, is to perform the staining on sections from embryos electroporated with dsCables 1. This is a very important control of the antibody to reinforce this point of the paper.

      We belief that the staining of the cells around the central canal could be due to endfeet of precursors spanning the neural tube from the apical to the basal side. All cells seem to express some Cables1 (Figure 1B,C). As we did not find any effect of Cables2 on commissural axon navigation and we do not use antibodies to functionally interfere with Cables1 function, we did not do this experiment, as the antibody is not able to distinguish the two proteins. Most likely, there is little, if any, Cables2 expressed in the spinal cord during this time window. We still did some functional analyses but found no effect on axon guidance (Supplementary Figure 3).

      • In Figures 3-4: why not performing some co culture of spinal cord explants with COS or HEK 293 cells expressing Slit1 or Wnt? This experiment will provide a clear-cut response to see the role of Cables in axon guidance. As there it is, Fig3 shows a role of Cables in axon growth but not guidance.

      We respectfully disagree that in vitro experiment would help to show guidance versus growth. Guidance can only be shown in vivo. This is what we do. Our in vitro results are only included to address specific responsiveness of axons or expression changes in total β-Catenin or pY489 β-Catenin. But all our conclusions about the role of Cables in axon guidance are demonstrated in vivo. Experiments using co-cultures of axons with COS or HEK cells would be impossible to control for timing and amount of Slit or Wnt release.

      • In Figure 6: my understanding of axon guidance is that every guidance decision happens at the level of the growth cone. However, it seems that in post crossing stage, there is a strong decrease of b-cat and phosphor- b cat within the growth cone compared to the precrossing stage. If beta cat is the effector of Cables to link Robo/Slit and Wnt/Fzd signaling I would expect it to be localized at the growth cone. I think authors should discuss this point. Regarding the normalization, it would be better to counterstaing the neurons with actin and use the measure of its fluorescence to normalize phopho-beta cat.

      There must be a misunderstanding. We do not demonstrate or claim that there is a decrease in β-Catenin or pY489 β-Catenin between pre- and post-crossing axons. We only demonstrate that the distribution of pY489 β-Catenin is clustered in distal post- but not pre-crossing axons. This change in localization of pY489 β-Catenin is supporting our model that Cables1 transfers Abl kinase to β-Catenin and phosphorylates it and prepare it for signaling in the Wnt pathway. And, as demonstrated pY489 β-Catenin and β-Catenin are in the growth cone. However, for quantification we concentrated on the axon, as the difference in growth cone morphology would have complicated the quantification.

      **Minor points:** •In figure 2: it seems that there are few axons labelled with DiI in the dsCables1 condition (Fig2B): it would be the choice of the picture or maybe the downregulation of Cables 1 interfere with the survival of dl1 neurons (even though in supp 1C it is shown that most of the populations are still there with no difference with the control side) or maybe some axons are delayed to reach to FP on time: the picture is focused on the FP: are there any axons still growing in the side of the open book preparation? Again, the picture that could be misleading.

      We have exchanged the images for alternatives with a better matched number of DiI-labelled axons. There is indeed no evidence for cell death, as axons are still there at normal numbers when we analyze open-book preparations a day later than usually. The difference in the number of axons labelled by DiI is only due to the variability in the amount of DiI injected per injection site.

      • In Fig1 legends, maybe Authors wanted to write "At HH18 dl1 commissural neurons start to extend their axons in the ventral spinal cord"?

      No, what we mean is, as shown in Figure 1A, that axons emerge from the cell body at this time. They reach the ventral spinal cord by HH21 and the floor plate by HH22.

      • I would also remove the yellow shadow on the Fig1A: it could be misleading as at first glance the reader might wonder whether there are 2 populations of dl1 neurons.

      We have done as suggested to make the image clearer.

      Reviewer #2 (Significance (Required)): It is still not clear how axons cross the midline. So far, many processes have been involved such as the alternative splicing of receptors (Robo3; Chen et al Neuron 2008), protease regulation of receptor expression (Nawabi et al Genes & Dev 2010), trafficking of receptors, or their interaction profiles (Delloye et al Nat Neuro 2015). However, it is still not clear how 2 events (here exit from the FP and rostral turning) are linked. Authors propose an original mechanism that involved the adaptor protein Cables 1. This protein has been shown to link the Robo/Slit1 signaling to Cadherins. Cables regulates the repulsive response to Slit and adhesion by the phosphorylation of b-Catenin by the kinase Abelson (Rhee et al Nat Cell Biol 2007). The audience that will be interested in this work is the neurodevelopment filed, axon regeneration field and overall people interested in neuronal circuit formation and function. My field of expertise is molecular and cellular neuroscience applied to axon guidance (crossing the FP) in mice models, axon regeneration and circuit formation.

      We are happy to learn about the positive assessment of our work by a specialist.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)): In their manuscript, Zuniga and Stoeckli characterize the role of Cables in commissural axon guidance in the developing chick spinal cord. Based on a combination of in vitro outgrowth assays and in vivo dye-tracing experiments, the authors propose that Cables participates in both normal repulsive responses to Slit and attractive responses to Wnt5. Using combinations of low-does knock down of cables/robo and or B-catenin, the author suggest an in vivo link between these pathways. Using IF with phospho-specific antibodies to B-catenin, the authors suggest that there is elevated P-Bcatenin in the post-crossing segments of distal axons. While potentially interesting, the present study falls short of adequately supporting the major claims. In addition, there are several instances where experiments lack appropriate controls.

      **Specific Comments** The conclusions reached by the authors are over-stated given the experiments performed. For example, the authors describe 'silencing' cables throughout the paper; however, the knock down that they achieve is approximately 50%. Indeed, it is quite surprising that such strong effects on growth/guidance can be achieved with a two-fold depletion of the gene product. Nevertheless, the rescue experiments provide nice evidence that dsRNA for Cables is causing a phenotype. This partial knockdown precludes strong conclusions, like for Figure 3, where they state that 'Cables is not required for pre-crossing.' The language needs to be tempered.

      We rephrased the paragraph where we describe the effect of Cables 1 and the efficiency of downregulation to stress that the parameters that we use for electroporation result in around 50% of the cells successfully transfected (lines 154 – 162, and legend of Supplementary Figure 2). Therefore, to find mRNA levels and protein levels reduced to about half indicates that our method is extremely efficient and removes the targeted mRNA and the protein almost completely. We need to point out here that we always analyze the temporal expression pattern to electroporated embryos before the protein of interest has accumulated, as in ovo RNAi obviously does not remove protein but only prevents translation and therefore the synthesis of new protein. As proteins can be extremely stable compared to the time line of embryonic development, we inject and electroporate dsRNA before we find expression of mRNA.

      Figure 4: the authors use bath application of Slit and Wnt to test effects of cables on Slit and Wnt responses. The observed effect sizes are very small and a single assay of this type does not allow such strong conclusions like 'loss of Cables prevents responsiveness.' Again, it is difficult to imagine that 50% reduction would completely prevent responses, raising questions about the suitability of this assay for measuring responsiveness- perhaps growth cone collapse would give more convincing results.

      As mentioned above, we are almost completely eliminating the targeted protein in the transfected neurons. For the explants, we only looked at the neurons expressing td-Tomato driven by the Math1 promoter. Thus, these neurons were transfected. Obviously, we cannot be sure that 100% of our cells took up the plasmid and the dsRNA, but the chances are very high that this is the case based on the ration between plasmid and dsRNA.

      Figure 5: The authors should more clearly document the effects they are seeing in these manipulations. As written, all we know is that there are 'significant effects on axon guidance.' What are these effects? Do they see the predicted differences between robo/cables and Bcatenin/cables phenotypes? e.g re-crossing defects in the case of robo and anterior turning defects in the case of B-catenin?

      We have added the analysis of the detailed axon guidance problems seen in the absence of Robo1, Cables1, βCatenin, or combinations, now Figure 6C. Indeed, we find that the phenotype ‘no turn’ is more prevalent in the condition with loss of both Cables and βCatenin. However, as mentioned above in response to a question raised by Reviewer 2, the two phenotypes are not independent of each other. Stalling in the floor plate of the majority of axons prevents the analysis of the turning phenotype. That is why we only use the ‘normal’ DiI injection sites for the statistical analysis.

      Also related to Figure 5: The authors do not validate the dsRNA knockdown of either Robo or B catenin. It is unclear what the interpretation or expectation of the triple knock down condition is.

      We have used the same ESTs to produce dsRNA derived from Robo and βCatenin in our previous publications (Alther et al., Development 143(2016)994; Avilés and Stoeckli Dev Neurobiol 76(2016)190). Therefore, we only repeated the functional experiments to verify reproducibility of the effect but we did not quantify the efficiency of downregulation in detail again.

      Figure 6: For this reviewer images showing enhanced P-Catenin in post-crossing distal axons is not convincing. The differences are not obvious by eye and the quantification suggests an ~30% increase. In contrast a nearly 4-fold increase is reported in Figure 7 for this same measurement. This raises concerns about the reproducibility of this 'phenotype.'

      Staining intensities are subject to batch-to-batch variability. Therefore, the experiments shown in Figure 7 (Figure 6 in the original manuscript) cannot be directly compared to the levels in Figure 8 (previously Figure 7). However, within the experiments, we carefully normalized data. We do not make any claims about absolute staining intensities.

      Also related to Figure 6: No validation of antibody specificity is provided or described.

      Again, please keep in mind that we do not make any claims about absolute values. All are results are based on stainings with the same antibody and comparison between different areas of the same axons. Therefore, the specificity of the antibody is important but not a fundamental aspect of our results.

      Figure 8: As for figure 5, phenotypic documentation is incomplete. In addition, no controls are shown to assure that the different mutant forms of B-catenin are comparably expressed, nor is there an unmutated wild-type control. The authors state that expression of these constructs alone has no effect on normal guidance; however, the supplemental data 6B would seem to indicate that both forms lead to increases abnormal phenotypes.

      There is an increase in the number of injection sites with aberrant axon guidance, however, this was not significant. We cannot exclude the possibility that premature expression, or overexpression of βCatenin pY489E or βCatenin pY489F does interfere with the endogenous βCatenin pY489. We still decided to keep these experiments in the revised version of the manuscript as they support our conclusion that Cables1 is required for axonal responsiveness to Slit and Wnts, and that this effect is mediated by phosphorylation of βCatenin at Y489. We are aware that this experiment in isolation is not sufficient.

      Reviewer #3 (Significance (Required)): The work builds on in vitro observa4ons from Rhee, 2007 about links between Robo signaling and Cables func4on. If adequately demonstrated, integra4on and coordina4on of Robo and Wnt axon guidance pathways is quite significant.

      We thank the reviewer for this positive assessment.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      In their manuscript, Zuniga and Stoeckli characterize the role of Cables in commissural axon guidance in the developing chick spinal cord. Based on a combination of in vitro outgrowth assays and in vivo dye-tracing experiments, the authors propose that Cables participates in both normal repulsive responses to Slit and attractive responses to Wnt5. Using combinations of low-does knock down of cables/robo and or B-catenin, the author suggest an in vivo link between these pathways. Using IF with phospho-specific antibodies to B-catenin, the authors suggest that there is elevated P-Bcatenin in the post-crossing segments of distal axons. While potentially interesting, the present study falls short of adequately supporting the major claims. In addition, there are several instances where experiments lack appropriate controls.

      Specific Comments

      The conclusions reached by the authors are over-stated given the experiments performed. For example, the authors describe 'silencing' cables throughout the paper; however, the knock down that they achieve is approximately 50%. Indeed, it is quite surprising that such strong effects on growth/guidance can be achieved with a two-fold depletion of the gene product. Nevertheless, the rescue experiments provide nice evidence that dsRNA for Cables is causing a phenotype.

      This partial knockdown precludes strong conclusions, like for Figure 3, where they state that 'Cables is not required for pre-crossing.' The language needs to be tempered.

      Figure 4: the authors use bath application of Slit and Wnt to test effects of cables on Slit and Wnt responses. The observed effect sizes are very small and a single assay of this type does not allow such strong conclusions like 'loss of Cables prevents responsiveness.' Again, it is difficult to imagine that 50% reduction would completely prevent responses, raising questions about the suitability of this assay for measuring responsiveness- perhaps growth cone collapse would give more convincing results.

      Figure 5: The authors should more clearly document the effects they are seeing in these manipulations. As written, all we know is that there are 'significant effects on axon guidance.' What are these effects? Do they see the predicted differences between robo/cables and Bcatenin/cables phenotypes? e.g re-crossing defects in the case of robo and anterior turning defects in the case of B-catenin?

      Also related to Figure 5:

      The authors do not validate the dsRNA knockdown of either Robo or B catenin. It is unclear what the interpretation or expectation of the triple knock down condition is.

      Figure 6: For this reviewer images showing enhanced P-Catenin in post-crossing distal axons is not convincing. The differences are not obvious by eye and the quantification suggests an ~30% increase. In contrast a nearly 4-fold increase is reported in Figure 7 for this same measurement. This raises concerns about the reproducibility of this 'phenotype.' Also related to Figure 6:

      No validation of antibody specificity is provided or described.

      Figure 8: As for figure 5, phenotypic documentation is incomplete. In addition, no controls are shown to assure that the different mutant forms of B-catenin are comparably expressed, nor is there an unmutated wild-type control. The authors state that expression of these constructs alone has no effect on normal guidance; however, the supplemental data 6B would seem to indicate that both forms lead to increases abnormal phenotypes.

      Significance

      The work builds on in vitro observations from Rhee, 2007 about links between Robo signaling and Cables function. If adequately demonstrated, integration and coordination of Robo and Wnt axon guidance pathways is quite significant.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      In this paper entitled "Cables1 links Slit/Robo and Wnt/Frizzled signaling in commissural axon guidance", authors aim to the find the mechanisms the coordinate the floor plate exit and the rostral turning of commissural axons. During development thousands of axons have to navigate long distances to reach their targets and build functional circuits. To facilitate their journey, their paths is divided into small portions by intermediated targets. The most studied intermediated target is the floorplate (FP) at the midline of the ventral spinal cord. Glia cells forming the FP express plethora of guidance cues. Commissural neurons, which have their cells bodies located in the dorsal part of the spinal cord, send their axons towards the FP. These axons are first attracted by the FP which facilitate their entry within the FP. However, they switch this attractive response into a repulsive one in order to exit the FP and turn rostrally to connect their brain targets.

      In order to ensure that this process will go smoothly, commissural axons have to adapt the composition of their receptors and the signaling pathways to switch from attractiveness to repulsion. So far, many processes have been involved such as the alternative splicing of receptors (Robo3; Chen et al Neuron 2008), protease regulation of receptor expression (Nawabi et al Genes & Dev 2010), trafficking of receptors, or their interaction profiles (Delloye et al Nat Neuro 2015). However, it is still not clear how 2 events (here exit from the FP and rostral turning) are linked.

      Authors propose an original mechanism that involved the adaptor protein Cables 1. This protein has been shown to link the Robo/Slit1 signaling to Cadherins. Cables regulates the repulsive response to Slit and adhesion by the phosphorylation of b-Catenin by the kinase Abelson (Rhee et al Nat Cell Biol 2007). The story developed here is very original and interesting: Cables would link the exit of FP (mediated by Robo/Slit signaling) and the rostral turning of the commissural axons (controlled by the Wnt/Fzd pathway. Below I'm proposing some experiments as many questions raised upon reading this beautiful work. The experiments are sound and could be reproducible. The statistic analysis looks fine.

      I would suggest some experiments to strengthen the whole work:

      •Authors might want to consider to perform some biochemistry experiments to show that Cables is able to interact with Robo1 and Fzd3: are these proteins in the same molecular complex? They could do 2 experiments: one in vitro by transfecting a cell line (such as HEK293 or cos cells) with plasmids coding for Robo1, Cables and Fzd3 or at least Cables and Fzd3 (as for Robo1/Cables they could refers to Rhee et al 2007). Another one would be in vivo: extracting proteins from the pre-crossing stage, the FP and post crossing stage; immunoprecipitation of Cables1 and see whether Robo1 and/or Fzd are pull down with Cables 1.

      •From the pictures it seems that most of the axons are stalling in the FP when embryos are electroporated with dsCables1. It would be nice to show more examples of axons that are able to exit the FP but have turning problems. Given the data, as it is presented, it seems that Cables regulates more the FP exit (and therefore, as it was shown in Rhee et al, the responsiveness to Robo/Slit signaling). In the same line, in Fig 4, Authors need to add a condition using dsCables and ds Fzd in order to see the effect of Cables on axon turning (response to Wnt). As it is this figure supports the role of Cables on FP exit but it's hard to make the link with commissural axon responsiveness to Wnt.

      •Authors aim to show that Cables is a linker between 2 events: maybe it should be nice to try to disconnect these events. One way would be (if technically possible) to modulated expression of Cables at different stages. What would happen if Cables was down regulated upon FP crossing? Would axons still be able to respond to Wnt? The question I'm wondering about is whether the responsiveness to Slit and Wnt is acquired at the same time or whether axons should become sensitive to Slit and this event will prime them to respond to Slit. In order to address the following experiment could be performed: explants from HH22-HH23 embryos, could be treated with medium containing Slit first and then Wnt or vice et versa and perform some collapse assay.

      •In Fig3 I was wondering whether post crossing axons were growing less because of the change in the regulation of adhesion: Rhee et al shows that Cables is able to modulate adhesion through N-cadherin. It would be interesting to perform immunostaining on these explant cultures to assess any change in adhesion molecules.

      •It is not clear whether Robo1 and/or Fzd induces the phosphorylation of b-catenin: is the Robo1/Slit binding induce the phosphorylation of b-cat and this event will prime the axons to respond to Wnt/Fzd? Or Wnt/Fzd is also able to control b-cat phosphorylation?

      •The staining with the antibody needs to be detailed: as it is reported this antibody recognizes "a domain of Cables1 that is 90% identical to the corresponding region of Cables2": it seems that the Cables protein enrichment in the floor plate (around the central canal) is Cables 2 as its mRNA expression matches this profile of expression. The one expressed in the crossing axons might be Cables 1: one way to verify this, is to perform the staining on sections from embryos electroporated with dsCables 1. This is a very important control of the antibody to reinforce this point of the paper.

      •In Figures 3-4: why not performing some co culture of spinal cord explants with COS or HEK 293 cells expressing Slit1 or Wnt? This experiment will provide a clear-cut response to see the role of Cables in axon guidance. As there it is, Fig3 shows a role of Cables in axon growth but not guidance.

      •In Figure 6: my understanding of axon guidance is that every guidance decision happens at the level of the growth cone. However, it seems that in post crossing stage, there is a strong decrease of b-cat and phosphor- b cat within the growth cone compared to the precrossing stage. If beta cat is the effector of Cables to link Robo/Slit and Wnt/Fzd signaling I would expect it to be localized at the growth cone. I think authors should discuss this point. Regarding the normalization, it would be better to counterstaing the neurons with actin and use the measure of its fluorescence to normalize phopho-beta cat.

      Minor points:

      •In figure 2: it seems that there are few axons labelled with DiI in the dsCables1 condition (Fig2B): it would be the choice of the picture or maybe the downregulation of Cables 1 interfere with the survival of dl1 neurons (even though in supp 1C it is shown that most of the populations are still there with no difference with the control side) or maybe some axons are delayed to reach to FP on time: the picture is focused on the FP: are there any axons still growing in the side of the open book preparation? Again, the picture that could be misleading.

      •In Fig1 legends, maybe Authors wanted to write "At HH18 dl1 commissural neurons start to extend their axons in the ventral spinal cord"?

      •I would also remove the yellow shadow on the Fig1A: it could be misleading as at first glance the reader might wonder whether there are 2 populations of dl1 neurons.

      Significance

      It is still not clear how axons cross the midline. So far, many processes have been involved such as the alternative splicing of receptors (Robo3; Chen et al Neuron 2008), protease regulation of receptor expression (Nawabi et al Genes & Dev 2010), trafficking of receptors, or their interaction profiles (Delloye et al Nat Neuro 2015). However, it is still not clear how 2 events (here exit from the FP and rostral turning) are linked.

      Authors propose an original mechanism that involved the adaptor protein Cables 1. This protein has been shown to link the Robo/Slit1 signaling to Cadherins. Cables regulates the repulsive response to Slit and adhesion by the phosphorylation of b-Catenin by the kinase Abelson (Rhee et al Nat Cell Biol 2007). The audience that will be interested in this work is the neurodevelopment filed, axon regeneration field and overall people interested in neuronal circuit formation and function.

      My field of expertise is molecular and cellular neuroscience applied to axon guidance (crossing the FP) in mice models, axon regeneration and circuit formation.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      In this work by Zuñiga et al. the authors study the role of the adaptor protein Cables1 on the guidance of post-comissural spinal cord neurons. They hypothetize that commissural axons need Cables1 to leave the floor plate and turn to ascend to the brain. They propose that during this process, Cables1 acts as a linker of two key axon guidance pathways, Slit and Wnt. Cables1 would localize β-catenin phosphorylated at tyrosine 489 to the distal axon and this would be necessary for the correct turning and navigation of post-crossing commissural axons. Although the work may be potentially interesting, there are major issues that authors need to address in order to state their claims:

      -Fig. 2. To visualize the axonal phenotype after downregulation of Cables1 the authors use DiI labelling. This difficults the interpretation of the results as both electroporated and non-electroporated axons are labelled. Since the authors have a Math1::tdTomatoF reporter construct (as in Fig. 3), it would be desirable to use this construct Math1::tdTomatoF in combination with the dsCables1 plasmid to better visualize the phenotype. Alternatively and less preferred, GFP signal should be also shown in Fig.2B experiments.

      -Fig. 2B and Supp.Fig.3. Comparable DiI labellings should be shown in the different conditions. The three examples shown in this panel despite different amount of DiI-labeled axons making it difficult to compare them.

      -Fig. 2D. An scheme depicting the different phenotypes: "normal", "FP stalling" and "no turn" would help to understand the results. They can use schemes similar to those shown in Fig. 2K Parra et al. 2010.

      -Fig. 3A. The open-book drawing is confusing. It seems that they are analyzing open-book preparations in this experiment when this is not the case.

      -Fig. 3B. Authors claim that Cables1 is not required in pre-crossing axons as dsCables electroporation does not affect axonal growth of DiI neurons taken at HH22. However, to be sure that Cables1 mRNA levels are downregulated in pre-crossing axons, relative levels of Cables1 mRNA and/or protein should be also determined at HH22 not only at HH25.

      -Fig. 4. The incapacity of Slit to induce axonal retraction in dsCables1 neurons is used to conclude that Cables1 is required to respond to Slit. However, downregulation of Cables1 by itself is even more effective inhibiting axonal growth than Slit treatment. Upon this strong effect as a background, it is difficult to assay slit response. Authors should point this observation in the manuscript.

      -Fig. 5B. In this Figure they do not differentiate between FP stalling or no turn phenotypes. A quantification taking into account the different phenotypes as shown in Fig.2D should be included.

      -Fig. 6D,E. As postulated in the manuscript and based on the Rhee, et al. paper, the β-catenin phosphorylation is triggered by Abl quinase upon Slit-Robo signaling. How the authors explain then that isolated cells with axons growing on a plate recapitulate specific distal phosphorilation of β-catenin at Y489 in the absence of Slit signaling? This experiment shows that postcrossing axons contain more phosphorylated β-catenin as an intrinsic characteristic rather than as a consecuence of contact with floor plate signals. Authors should try a similar experiment but exposing the neurons (or explants) to Slit. Also, why β-catenin phosphorylation was not measured at the growth cone?

      -Fig. 7. CAG::hrGFP electroporation is not specific for dl1 neurons. This experiment should be performed with Math1::tdTomatoF in order to analyze β-cat pY489 with or without dsCables1 specifically in dl1 neurons. Also, why GFP staining at the growth cones in Fig.7B is not visible in the axon?

      -Fig. 8. This experiment does not distinguish whether phosphorylated β-Cat is necessary for the correct navigation of post-crossing commissural axons (as it is claimed in the abstract) or it is also required for midline crossing. As it has been previously shown, correct navigation of post-crossing commisusal axons is a Wnt5 dependent process. As dsCables1 abrogates Wnt5a responsiveness (Fig. 4B,C), does the phosphomimetic β-catenin Y489E construc rescue the Wnt5a response in dsCables1 electroporated neurons? Moreover, can the phosphomimetic β-catenin Y489E construc rescue the Slit response in dsCables1 electroporated neurons? Testing these effects on explants as in Fig. 4B,C but including phosphomimetic β-catenin, will help to understand to what extend phosphorylation of β-catenin is important for crossing, turning or both processes.

      -How do the authors envision the mechanism of Cables1/β-catenin mediated crossing and turning? A working model summarizing their hypothesis would help the reader to understand the results.

      Minor points:

      -Homogeneize the term "scale bars" or "bars" in the Figure Legends.

      -Scale bar of insets in Fig.1C is missing.

      -The antisense control for Cables probe should be shown at HH-22/24. Otherwise is not possible to distinguish whether they do not detect signal because is a negative control or because Cables1 is not expressed at HH25.

      -Figure legend for Fig. 2D is missing

      -Fig. 8B right panel is contaminated with growthing axons coming from the below DiI injection. Please replace the picture.

      -The quantification of the different phenotypes "FP stalling", "no turn" should be better explained in the Mat and Met section. The sentence " more than 50% of the axons...." is not clear. Was this measured by eye? Otherwise, please indicate the software used to measure.

      -Provide the quantification of the WB in Supplementary Fig. 2B normalising to Gapdh.

      Significance

      Previous results have demonstrated that Slit-induced modulation of adhesion is mediated by cables that links Robo-bound Abl kinase to N-cadherin-bound betacat (Rhee et al., 2007). Here the authors propose that a similar mechanism is operating in commissural neurons leave the midline after crossing and turn immediately after. The role of Cables in the process has not been previously addressed. Thus, after proper addressing of my main concerns, I consider this paper may advance in our knowleged of how growing axons navigate intermediate targets.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Manuscript number: RC-2022-01758

      Corresponding author(s): Harbison, Susan and Souto-Maior, Caetano

      [Please use this template only if the submitted manuscript should be considered by the affiliate journal as a full revision in response to the points raised by the reviewers.

      If you wish to submit a preliminary revision with a revision plan, please use our "Revision Plan" template. It is important to use the appropriate template to clearly inform the editors of your intentions.]

      1. General Statements [optional]

      This section is optional. Insert here any general statements you wish to make about the goal of the study or about the reviews.

      We thank the reviewers for their time and care in evaluating our manuscript. They raise several important points, which we have addressed, resulting in a greatly improved manuscript. Please note that we numbered the comments from both reviewers for ease of reference, as we cross-referenced comments in some cases. Reviewer comments are in italics; our responses are provided in plain text.

      2. Point-by-point description of the revisions

      This section is mandatory. *Please insert a point-by-point reply describing the revisions that were already carried out and included in the transferred manuscript. *

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      *Summary*:

      *The authors of this work generated a Sleep Advanced Intercross Population from 10 extreme sleeper Drosophila Genetics Reference Panel. This new out-bred population was subjected to a artificial selection with the aim of understanding the genes underlying the sleep duration differences between three populations: short-sleep, unselected, and long-sleep. Using analysis of variance the authors identified up to nearly 400 of genes that were significant selected over the various generations and showed opposite trends for long and short sleep, thus potentially relevant for the regulation of sleep duration. 85 of these genes were consistent between male and females sub-populations, suggesting a small number of genetic divergences may underlie sex-independent mechanisms of sleep.

      Given the time-course nature of the generational data obtained, the authors studied potential correlations and interactions between these 85 identified candidate genes. Initially, the authors used pairwise Spearman correlation, noticing how this method could not filter most of pairwise interaction (around 40% of all possibilities were significant). To overcome the linear limitations of the previous approach, the authors implemented a more complex, non-linear Gaussian process model able to account for pairwise interactions. This new approach was able to identify a smaller number of different, and potentially more informative, correlations between the candidate genes previously identified.

      Lastly, with genetic manipulations, the authors show in vivo that a subset of the candidate genes is causally related with the sleep duration as well as partially validating some of the correlation identified by their new model.

      The authors conclude that, given the non-linear and complex nature of biological systems, simplistic linear approaches may not suffice to fully capture underlying mechanisms of complex traits such as sleep.

      *Major comments*

      1. Most of the the work presented focus on the computational and statistical analysis of different populations submitted (or not) to a process of artificial selection for short or long sleep duration. As such, the amount of potentially relevant biological conclusions to be tested is mostly unfeasible. The authors already present additional experiments to partially support some, though not all, of their findings. Given the manuscript is written as a method innovation, these additional experiments illustrate the potential uses of the method described. *

      Our response: The reviewer raises a very important point, one that is at the very impetus of our work. We agree that it is not possible to test all combinations of genes in all contexts to determine whether they influence sleep or not. In contrast to the situation for circadian rhythms, where the core clock is controlled by just four genes, recent work has concluded that sleep is a set of complex traits influenced by large numbers of genes. Robust computational methods are needed to identify the complex interactions among genes. The current manuscript is a first step towards achieving this goal.

      *(OPTIONAL) However, since the one of the focuses of this work in identifying potential gene interactions, it would be interesting if the authors could test a "double knockout" and perhaps demonstrate evidence for epistasis between two of the identified genes. Having access to single mutants, this experiment should be realistic. However, I have no hands-on experience working with Drosophila and I am unable to accurately estimate the amount of resources and time such and experiment could take. My initial guess would be 3-6 months work should suffice. *

      Our response: The reviewer makes an interesting proposal. While such an experiment would provide some additional information, our method does not make any prediction about what a double knockout would do, either to the sleep phenotypes or to gene expression.

      2. In regards to the gene CG1304, it seems to be an important example used throughout the manuscript. It should be carefully re-analyzed as was considered for interaction analyses without showing opposite trends for short- and long-sleep populations (see minor comments on figure 2).

      Our response: We are not entirely certain that we understand the reviewer’s point. We note that significant genotype-by-selection-scheme interactions may not manifest as opposite trends and this is not what is being tested for significance. The likelihood ratio is a test for a significant effect of including sel x gen coefficients for both short and long schemes; therefore, GLM significance may mean that either one or the two selection schemes are significantly different from controls, not from each other. We could, for instance, apply three different tests: one (i) comparing between long and short flies; the second (ii) __comparing short flies to controls; and the third (iii) __comparing long to controls and find that the first test is significant — i.e. short is different from long — and that the two others are not — i.e. neither scheme is found to be different from controls. The opposite could also happen: short and long flies may not be different from each other, but with both being different from controls.

      Since we are interested in identifying differences of either to controls, our choice of statistical test is equivalent to performing tests (ii) __and (iii)__ without the need to perform and correct for multiple tests. While there are caveats to this choice (like all choices), linear model-based differential expression analysis has its own caveats, and has limited ability to pick up arbitrary trends, so it serves as a coarse-grained filter for large shifts since it’s too costly (computationally) to run the Gaussian process on 50 million pairwise combinations.

      *3. One major comment would be that the claim that the Gaussian process method is more sensitive and specific than simpler approaches, though intuitively understandable, does not seem to be fully correct from a strict statistical point of view, given the lack of a gold standard reference to compare if the new method is indeed picking more true positives/negatives. I would reconsider re-rephrasing such statement in the absence of a biologically relevant validation set. *

      Our response: We agree with the reviewer that there is no ‘gold standard’ reference data set with which to compare our findings. We have softened this language a bit in response, where it occurs in both the Abstract and the Results.

      Under Abstract, we changed “Our method not only is considerably more specific than standard correlation metrics but also more sensitive, finding correlations not significant by other methods” to “Our method appears to be not only more specific than standard correlation metrics but also more sensitive, finding correlations not significant by other methods.”

      Under Results, we changed “Therefore, computing correlations between genes using covariance estimates from the Gaussian Processes greatly increases specificity over direct correlations. Furthermore, the Gaussian processes are not only more specific but more sensitive…” to “Therefore, computing correlations between genes using covariance estimates from the Gaussian Processes appears to increase specificity over direct correlations. Furthermore, the Gaussian Processes appear to be more sensitive…”

      *4. Finally, the study appears to be well powered and it is clear that the authors were careful in their explanation of the statistical methods. However, I could not find the copy of the code/script used for the model. Without it, it would be very difficult to fully reproduce the results as both the language used (Stan) and the method itself are not common in the sleep research field. *

      Our response: We thank the reviewer for noticing this, and apologize for this oversight. The code used for analysis has been deposited in GitHub under: https://github.com/caesoma/Multiple-shifts-in-gene-network-interactions-shape-phenotypes-of-Drosophila-melanogaster.

      We have noted the script location in the Data Availability statement. We added a statement to read “All scripts used for the model have been deposited in Git Hub https://github.com/caesoma/Multiple-shifts-in-gene-network-interactions-shape-phenotypes-of-Drosophila-melanogaster.”

      * * *Minor comments* * 5. The statistical cut-off used for gene expression hierarchical GLMM after BH correction was of 0.001, which is 50 times more strict than the common 0.05. Could the authors comment on how this choice may impact the results compared to those available in the literature and on the rational for choosing such a value.*

      Our response: A FDR of 0.05 would increase the number of genes identified (3,544 for females; 1,136 for males, with 462 overlapping). The FDR of 0.001 is consistent with the lowest threshold typically used for gene expression data collected during other artificial selection experiments (Mackay et al., 2005; Morozova et al., 2007; Edwards et al., 2006), though thresholds as high as 0.20 have been used (Sorensen et al., 2007). We have added to the last statement to the Methods and Materials section under “Generalized Linear Model analysis of expression data” to read “Model p-values were corrected for multiple testing using the Benjamini-Hochberg method (Benjamini and Hochberg, 1995), with significance defined at the 0.001 level, consistent with the lower threshold applied in other artificial selection studies (Mackay et al., 2005; Morozova et al., 2007; Edwards et al., 2006).”

      *6. Heritability calculations are not mentioned in the methods. Could it be useful to include a small paragraph? Could a small comment be done on the differences in h2 for the short sleep replicates which show ~10x difference? *

      Our response: We thank the reviewer for noticing this omission and apologize for the oversight. We have added the following statements to the Methods and Materials under “Quantitative genetic analyses of selected and correlated phenotypic responses.”

      “We estimated realized heritability h2 using the breeder’s equation:

      h2 = ΣR/ΣS

      where ΣR and ΣS are the cumulative selection response and differential, respectively (Falconer and Mackay, 1996). The selection response is computed as the difference between the offspring mean night sleep and the mean night sleep of the parental generation. The selection differential is the difference between the mean night sleep of the selected parents and the mean night sleep of the parental generation.”

      Additionally, we thank the reviewer for noticing the large difference in the realized heritability between the short sleeping population replicates; the heritability for replicate 1 is a typo and should be 0.169, not 0.0169. Hence, the heritabilities of both replicate populations are quite similar, i.e., 0.169 for replicate 1 and 0.183 for replicate 2. We have corrected this error in the Results.

      7. In regards to the model implementation, what would be the implications of not enforcing positive semi-definiteness on the co-variance matrix, given than that these are strictly positive semi-defined?

      Our response: All covariance matrices are by definition positive semi-definite (PSD), since they cannot yield negative values for the probabilities associated to them, so it would not be possible to relax that assumption generally. The only choice we could make would be on the number of genes included (M) in each multi-channel gaussian process model, and this in turn would by design enforce positive semi-definiteness on an matrix of size MN, (N being the number of generations). As noted in the appendix, “enforcing” positive semi-definiteness on smaller blocks of a larger 2D-array of covariances (which is not itself a covariance matrix) does not imply the latter is PSD and therefore seems like a softer constraint. In practice scaling up to a model where M >> 40 is not trivial from a computational and inference point of view, so the choice of smaller M is in a way imposed on us, and fortunately it is the less limiting one. We provide the appendix as a general clarification on the subtleties of Gaussian Processes, but a comprehensive assessment is beyond the multidisciplinary scope of this article and would require a narrower mathematical/statistical description in a standalone methodological article or technical note.

      1. *The methods mention that PCA projection were performed on the first 3 components, however only the first two are showed. *

      Our response: PCA was performed on 10 components, although the algorithms will commonly compute all components and return only the selected number. The variance of the third component is smaller than ~5% (that of the second PC). In practice PC1 is by itself enough to show the clear separation of expression per sex with ~65% of the variance; PC2 is in fact only shown to improve visualization. Plots of the remaining components will not show clear separation among samples as the variance explained is so small. We have corrected the Methods to indicate that PCA was performed on 10 components rather than 3.

      *9. Figure 1 refers to the mean night sleep time of the population. Could some measurement of variability (se or sd) be represented to provide a general idea of the distribution of the values? Additionally, the standard deviation of associated with the CVe estimates are mentioned but not showed explicitly. Could they maybe be added to the text as to illustrate how much such deviations were reduced? *

      Our response: We thank the reviewer for this comment. Including either the standard errors or standard deviations on the plot of the response to selection (Figure 1A) makes visualization unwieldy; thus we have added an additional supplemental table, Supplementary Table S15, that contains the mean night sleep, standard deviation, and number of flies measured for each generation in each replicate population. We also added a plot of the standard deviation in night sleep per generation to Supplemental Figure S2 (letter “Q” in the figure) so that the reduction over time in each population can be seen.

      Under “Data Availability,” We added the following: “Night sleep phenotypes per selection scheme/sex/generation/population replicate are listed in Table S15.”

      *10. Figure 2 shows the linear model fits for gene CG1304. I find this gene on the list of significant genes for both sexes (tables S5/6), but it does not seem to be one that shows opposite trend for short- and long-sleep (tables S7/8). Surprisingly, it shows up again on table S10! However, the text introducing the figure reads like this should be one of the 85 sex-independent genes. Would it be best to provide an example of what a significant gene looks like? *

      Our response: As mentioned in our response to comment #2 above, significance in the likelihood-ratio test does not imply opposite trends between long and short selection schemes, but between a model that includes specific slope coefficients for selection scheme by generation (both long and short) compared to a reduced model where the only slope is one associated to generation and therefore independent of selection scheme.

      11. *Figure 3 would be interesting to have both the GP correlations and the Spearman correlations to illustrate the methodological differences. I would be curious to see at least one pairwise expression scatter-plot as well just to see how they correlate in one plot. *

      __Our response: __Table S11 contains all (significant and nonsignificant) GP and Spearman values side-by-side for comparison. High correlations are likely to conform to the Spearman assumptions of a monotonic relationship; nevertheless, this will not be so for the majority of genes since the difference in the number of Spearman and GP-significant genes is tenfold or more, so it would be misleading to focus on individual-gene relationships without taking into consideration the transcriptome wide results for any method employed.

      We would like to stress that there is nothing particularly special about CG1304 in and of itself; furthermore, there are no “representative” genes or figures in this manuscript. Instead, CG1304 is chosen because its GLM and GP fits are illustrative of the limitations and capabilities of each model to pick up certain kinds of trends, and especially because it is especially instructive of how correlations arise from the GP model, which may not be intuitively clear to all readers.

      12. Figures 3S3/4 are described as showing single- and multi-channel models don't change substantially. Would this be expected and why?

      Our response: This is not necessarily expected, as scaling up from a single to a multi-channel model will add additional parameters as well as constraints, like positive the semi-definiteness mentioned in comment #7 above. If that seemed to have considerable impact on the fits it could challenge our assumption that the signal variance parameters estimated from the single-channel are good priors for the same parameters in the two-channel model (although this is not a hard constraint, so in the worst case the result could still only be a slight bias).

      *13. Having build different networks of pairwise associations of genes (projecting on a unified network as illustrated on figure 5), it could in interesting to compare the network topologies at a basic level such as node degrees, overlapping sub-networks, are they potentially scale free as previously described for biological systems, etc. *

      __Our response: __The reviewer makes an interesting point. Indeed summaries of the network could be useful information about the system level parameters, which are the main results of this paper. We now include the number of connections (i.e., the degree) to each gene in each of the four networks presented in Figure 5 in a new supplemental Table (Table S13). We also plot the distribution of node connectivity below. The distributions do not appear random (i.e., a normal distribution), and appear closer to a power-law or scale-free distribution. However, the small size and low average degree of these networks make a formal test unfeasible, and a recent study suggests that a log-normal distribution is in general more likely than a power-law distribution (Broido et al., Nat Comm, 2019), so we lack the evidence to claim that these networks are scale-free.

      We have added to the Results under “Gaussian Process model analysis uncovers nonlinear trends and specifically identifies covariance in expression between genes”: “Table S13 lists the number of connections (degrees) that each gene has with others in the network. The average number of connections for long-sleeper males was 2.6; the other three networks had average degrees of 2.0 or less (2.0 for long-sleeper females and short-sleeper males; 1.75 for short-sleeper females).”

      *14. On table S6 I noticed some gene symbols were loaded as dates (1-Dec) *

      Our response: We thank the reviewer for noticing this, the gene symbol is supposed to be dec. We have corrected this in Table S6 (now Table S7).

      1. *In results, the phenotypical response to artificial selection is sometimes described in minutes, other times in hours. Though this is an hurdle, it could make the values easier to compere if they were consistently formatted as minutes (hours). *

      Our response: We are unsure what the reviewer is referring to. We only see one sentence in which we used hours, and that was the concluding sentence under Results, “Phenotypic response to artificial selection.” The remainder of the manuscript refers to sleep times in minutes, phenotypes in all of the figures are plotted as minutes, and all of the supplemental material refers to times in minutes.

      16. *Over 99% of chains converged after three runs. Even though the reasons for the lack of convergence of these chains was not investigated, could this be a relevant effect? 1% of 3570 interactions is still 35 potential interactions. Do the non convergent chains relate with specific genes? *

      Our response: Bayesian MCMC inference is a stochastic algorithm, so there is a finite chance that any given run doesn’t converge, and that means that all eight parallel chains must converge and mix as measured by the stringent choice of R-hat metric being within 0.05 of unity. Relaxing the interval to 0.1 or 0.2 could still be acceptable, but we made the choice of a stringent threshold to avoid making interpretations on less-than-ideal runs. There is no evidence that there is any gene-specific problem, usually it would be one out of eight chains that would not mix well and throw off the diagnostic metrics (like relaxing the metrics, an acceptable approach could be accepting a run with 6-7 chains converging properly, but we decided to rerun all chains and only accept 100% convergence but accept a possible loss). Non-converging/nonmixing runs are likely to eventually do so, but since were are running tens of thousands of runs (3570 pairwise combinations × 3 schemes × 8 chains) a massively parallel implementation in a HPC cluster is required. Finally, seeing that 145 is ~4% of the total number of interactions, a naïve expectation would be that no more than one interaction would come out significant — while there is a chance that an interesting interaction was identified, the same can be said for potential false negatives computed using the GLM, which is a consequence of working at a high-throughput scale.

      17. The GO terms identified as significantly enriched after pvalue correction point to a clear association of the 85 genes identified with Serine proteases. Could this be discussed further to highlight biological findings of the work in the context of neuronal function or sleep regulation?

      Our response: The reviewer is correct, nine putative Serine proteases are significantly enriched among the 85 genes. All nine exhibit some expression in neurons and in epithelial cells, and all are expressed at the adult stage. The appearance of these enzymes is interesting given their role in proteolysis.

      We have updated the Discussion to read, “Interestingly, our Gene Ontology analysis identified nine genes from the 85-gene network with predicted Serine endopeptidase/peptidase/hydrolase activity: CG1304, CG10472, CG14990, CG32523, CG9676, grass, Jon65Ai, Jon65Aii, and Jon99Fii. All of these genes are expressed in neurons and epithelial cells, and all genes are expressed at the adult stage (Li et al., 2022). Serine proteases are a large group of proteins (257 in Drosophila) that perform a variety of functions (Cao and Jiang, 2018). Their predicted enzymatic activity suggests a putative role in proteolysis. This is an intriguing observation given pioneering work in mammals which suggested a role for sleep in exchanging interstitial fluid and metabolites between the brain and cerebral spinal fluid (Xie et al., 2013). Recent work demonstrated that a similar function is conserved in flies via vesicular trafficking through the fly blood-brain barrier (Artiushin et al., 2018). It would be interesting to determine whether these genes function in this process.”

      *18. Could the authors discuss the little overlap between males/females and shot/long sleep for 145 gene pairs identified after the MCMC runs. Similarly, how can the network differences be explained from a biological/evolutionary perspective? *

      Our response: The reviewer asks an interesting question. We did not detect sex-specific responses to artificial selection for long or short sleep in the present experiment. Yet differences in gene expression network pairs between males and females exist, and as the reviewer mentions, we also observed differences in network pairs between long sleepers and short sleepers. These differences reflect an inescapable conclusion: a given sleep duration phenotype can originate from more than one gene expression network configuration.

      19. *In the mutational analyses it is pointed out that CG12560 and Jon65Aii only affect females significantly. However, in the following sentence, the authors claim these two genes had the greatest effect on both sexes, which seems contradictory, at least in the way it is described. *

      Our response: Our wording may have been confusing, given that it came after a comment about Jon65Aii. Our exact statement was “Effects of the Minos insertions on night sleep duration were stronger in females than in males; when sexes were examined separately, only mutations in CG12560 and Jon65Aii affected male night sleep duration.” This was meant to convey that the effects of all Minos insertions were the same directionally for both males and females, but that only CG12560 and Jon65Aii insertions had statistically significant effects on each sex separately. We have re-worded this sentence to read “All Minos insertions had the same directional effect on night sleep for both males and females, but only the CG12560 and Jon65Aii insertions had statistically significant effects on night sleep on each sex separately.”

      20. *Maybe a small comment on how unchanged expression could lead to the observed phenotypical variation could help understanding how Minos mutations effects are biological mediated for those not familiar with the method. This seems to be the authors expectation so, could it be non-functional proteins or something else? *

      Our response: The reviewer raises an interesting point. We did not observe changes in gene expression for CG13793, Cyp6a16, or hiw compared to w1118 controls. Thus far, we have examined gene expression relative to the control for a single timepoint, and only in pooled whole flies. Differential gene expression between the Minos mutants and controls might occur at a different timepoint, or in a small set of key neurons that would be undetectable when comparing whole flies.

      We expand on this in Results, under “Mutational analyses confirms the role of candidate genes and interacting expression networks in sleep”: “Potential reasons for the lack of a significant change in gene expression in the remaining lines include: the position of the insertion within the targeted gene, which has variable effects on its expression; the relatively low statistical power of the experiment; confining our observation to a single timepoint during the day; or pooling whole flies, which might obscure gene expression changes occurring at a single-tissue level.”

      *21. The assumption that interacting genes would have their expression ratio changed by the Minos insertion would hold on situation where the affected gene causally interferes with the candidates expression. As far as I understand, causality cannot be inferred by the proposed method. Thus in a situation where both genes are co-regulated by a third factor, no change in expression ratio is to expected. How would the authors re-interpret their final result when considering this direct vs indirect interaction distinction? *

      Our response: Our method only gives us the hypothesis that two genes interact based on their correlation, and that is what we test using the Minos insertions. We do not as yet have a way to identify a third gene or factor that might be regulating the two. Given the number of genes affecting sleep, it is quite likely that there are such factors, but we can only report and test what we’ve observed. Any interpretation based on an arbitrary third factor would be purely speculative.

      **Referees cross-commenting**

      22. *I agree with Reviewer #2 comments which, to me, reads as generally pointing out the lack of biological interpretation of the results (and thus connecting this study with previous literature). Adding this component would make the manuscript well-rounded and attractive to a wider audience. *

      Our response: We agree with both reviewers that additional biological interpretation of the results would make the manuscript more attractive to a wider audience. Accordingly, we have added the following paragraph to the Discussion: “The genes we identify herein overlap and extend previous work. Of the 1,140 genes implicated in the generalized linear model, 151 (13.2 percent) overlapped with previous candidate gene, random mutagenesis, gene expression, and genome-wide association studies of sleep and circadian behavior in flies (Pegoraro e t al., 2022; Dissel et al., 2015; Seugnet et al., 2017; Shalaby et al., 2018; Thimgan et al., 2010, Thimgan et al., 2018, He et al., 2013; Mallon et al., 2014; Roessingh et al., 2019, Feng et al., 2018; Lee et al., 2021; Khoury et al., 2020; Wu et al., 2018; Harbison et al., 2013; Harbison et al., 2009; Harbison et al., 2017; Harbison et al., 2019). Notably, previous studies identified the genes CG17574, cry, dro, mip120, Mtk, NPFR1, pdgy, PGRP-LC, Shal, and vari as affecting sleep duration (Feng e t al., 2018, Dissel et al., 2015; Pegoraro et al., 2022; Thimgan et al., 2018; Mallon et al., 2014; He et al., 2013; Khoury et al., 2020; Harbison et al., 2013). Two genes, ringer and mip120, overlapped with our previous study of DNA sequence variation in flies selected for long and short sleep (Harbison et al., 2017). In that study we identified a polymorphism in an intron of ringer that changed in allele frequency with selection, with increases in the population frequency of the ‘G’ allele with increasing sleep, while the frequency of the ‘A’ allele increased with decreasing sleep. When the selective breeding procedure was relaxed, the frequency of the ‘G’ allele increased in short-sleeping populations, paralleling an increase in sleep (Souto-Maior et al., 2020). One possibility is that this polymorphism contributes to the changes in gene expression in ringer that we observed in the present study. Of the 85 genes common to both sexes that we used in the gene interaction networks, 11 (13 percent) appear in other studies of sleep: CG10444, CG2003, CG5142, CG6785, CG9114, CG9676, CR42646, hiw, NPFR1, Tie, and wb (He et al., 2013; Seugnet et al., 2017; Wu et al., 2018; Harbison et al., 2013). Thus, our study corroborates genes known to affect sleep, and identifies new candidate genes for sleep as well.”

      Reviewer #1 (Significance (Required)):

      *This study proposes the application of advanced non-linear methods to study complex traits such as sleep. As implemented, Gaussian Processes are able to identify non-linear correlations between two biological features (e.g. transcripts) over time (e.g. generations), representing an attempt to push the analytical methods available beyond the single gene paradigm. As such, more than the relevance of the biological results themselves, the authors focus on the explaining and illustrating the application of methodological advances obtained, and its relevance to obtain a better understanding of biological systems.

      However the mathematical principles required to understand the implemented method are not trivial and require advanced knowledge of machine learning and statistics. This is a potential barrier, though not an impediment, to its quick and wide adoption by the community. In addition, even if demonstrated to be a valid method when working with Drosophila, the resolution required to perform such a study may be difficult to obtain with other model systems, which would likely require further refinement of the statistical approach.

      The main audience interested in this work would be basic sleep researchers. However, this work is also related to the understanding gene selection over an artificial evolutionary process, thus evolutionary and developmental biologist may be also be interested. The methodology itself, already used in other fields of study, is a general statistical tool that could be adopted by a broad range of researchers for a diversity of topics. As such, I believe with this work, the authors will be able to stimulate the development and/or rethinking of the available analytical methods to study complex biological systems, though this would likely be done either in collaboration with the authors themselves or by a specific subset of researchers who regularly work with advanced mathematical, statistical and computational principles.

      (disclaimer) My mathematical formation does not reach the PhD level expertise that may be required to fully understand the methodology described. I have never personally worked with D. melonogaster or used Gaussian Processes in a professional setting. As such, I may not be able to fully evaluate/appreciate the more detailed technical aspects of this work.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      Souto-Mairo et al. reports phenotypic and genotypic effects of artificially selecting for short and long sleep in flies. They generated an impressive time-series dataset where one could examine genetic and phenotypic changes across time (generations, total 13 generations) in response to the selection pressure. The authors explored the relationships between pairs of genes in addition to just identifying potential candidate genes involved in the regulation of the amount of sleep.

      Major points:

      1. Harbison et al 2017: This study seems to be a continuation of Harbison et al 2017. There needs to be a clearer approach in the text (introduction?) in elucidating how this study is really advancing the findings of Harbison et al., 2017. Do the two studies use the same selection lines? If not, how are they different? If they are not different, what might cause the phenotypes evolving differently? For example, day sleep, day bout number do not respond to the selection pressure similarly in both studies etc. *

      Our response: We would like to emphasize that this study is not a continuation of the Harbison et al., PLoS Genetics, 2017 paper, where we examined the changes in DNA sequence during artificial selection, and it does not use the same selection lines. The fact that the two studies are different can be seen from an examination of Figure 1A of the current study and Figure 1A of the Harbison et al 2017 study. The trajectories of each population across generation are very different. Out of convenience, we used the same nomenclature to refer to the populations in both studies (L1, L2, S1, S2, etc.), and apologize if this is the source of the confusion. Both studies do originate from the same outbred population, however, and to get to the broader question that the reviewer is asking, should one expect to see the same correlated responses to selection for night sleep among selection lines originating from the same outbred population? The answer is no, not unless the selected trait and the responding trait have a genetic correlation of 1.0. We previously estimated the correlation between day sleep and night sleep to be between 0.29 - 0.38 and between day bout number and night sleep to be -0.05 (Harbison et al., 2013; Harbison et al. 2009). In the Harbison et al. 2017 study we noted that day sleep and day bout number had correlated responses to selection for night sleep, but neither have correlated responses in the current study. The relatively low genetic correlations between these two measures and night sleep explain why we do not see a consistent correlated response among studies.

      We didn’t really elaborate on these observations in the manuscript, and so have added to the Results under “Correlated response of other sleep traits to selection for night sleep” the following: “These correlated responses concur with previous observations we made in selected populations originating from the same outbred population for night sleep and night average bout length, and night sleep and sleep latency (Harbison et al., 2017). However, unlike the previous study, we did not see a correlated response between night sleep and day sleep, and night sleep and day bout number (Harbison et al., 2017). The lack of correlated response reflects the relatively low genetic correlations these two traits have with night sleep (Harbison et al., 2013; Harbison et al., 2009).”

      2. Zeitgeber Time (ZT) for RNA collection: It is puzzling that the study reports that the RNA was collected at 12 PM. I do not understand what this information means; especially in a project where one is working with sleep. The authors might want to report ZT. Also, why a particular ZT was chosen should be discussed. These genes are potential sleep-relevant genes - hence it is not too esoteric to think that the ZT of data collection matters a lot as some of them might be cycling. To get a more appropriate picture, multiple time points of data collection might be even better. The authors seem to have ignored this crucial aspect of a clock/sleep study - time of data collection and how time of data collection might shape your findings.

      Our response: We agree with the reviewer that it would be better to have multiple timepoints for collection, but this is difficult to implement in practice as it would require an additional 5,280 flies per generation (4 pools of 10 flies per sex per population) for 12 timepoints as recommended by Hughes et al., JBR, 2017. We mention collection time in the Methods and Materials because we are aware of the changes in gene expression over the circadian day. 12PM is the midpoint between the start of the lights-on and lights-off period (i.e., ZT6), and was chosen arbitrarily. We have added the ZT notation to the Methods and Materials for clarity.

      3. Short sleeping flies: Are there reports of flies sleeping this less? "We found 2,830 interactions; 8 of these were one of the 3,570 between the 85 genes, but none of them overlapped with the 145 gene pairs found to be different from controls. The gene interactions we observed may therefore be unique to extreme sleep." What is extreme sleep? How does this study then claim to have identified evolution of potential sleep-relevant gene expression for normal, physiologically relevant sleep?

      Our response: Our statement was not very well worded, and we thank the reviewer for noticing this. What we intended to say was that the lack of overlap between our data and a known protein-protein interaction database may due to the interactions being unique to sleep as opposed to some other complex trait. We have re-worded this statement to say “The gene interactions we observed may therefore be unique to sleep.”

      *Minor points:

      4. The article uses an unnecessarily defensive tone to establish their approach to understand underlying mechanisms of sleep 'better' than that of the others (in both introduction and discussion): "In spite the large amount of studies and data generated for many systems, identifying underlying processes is still very rare; this is clear indication that better methods are needed to obtain understanding of biological processes from data." The 'still very rare' part is just factually incorrect and misleading as far as sleep is concerned. Even if we just see Drosophila studies on sleep, there is a huge progress that's being made in terms of genes, neurons and circuits relevant for sleep: both in terms of baseline sleep as an output of the circadian clock and the rebound/homeostatic sleep. Most, if not all, of these elegant and pioneering studies from multiple, independent groups took approaches that did not require artificial selection regimes. As a substitution for their defense, the authors might attempt to present their findings in the context of the existing knowledge of sleep in flies. For example, what about genes already implicated in sleep? Do they show up in their analysis? For example, Sleepless, DATfmn, Sandman, AstA, AstA-receptor, Wide-awake etc. This could really help the manuscript.*

      Our response: We certainly did not intend for this statement to suggest that no progress had been made in the identification of genes and circuits for sleep, and we agree that elegant and pioneering approaches have made significant progress in our understanding of the phenomenon. Rather, we were thinking more in terms of fully described biochemical networks. To avoid this interpretation by other readers, we have altered the “still very rare” sentence in the Introduction to read: “Despite the large amount of studies and data generated for many systems, a full understanding of underlying processes has not yet been achieved…’

      We also agree with the reviewer that it would be helpful to put our work in the context of what is already known in flies. We have added the following paragraph to the Discussion to relate the work with previous work on sleep in flies: “The genes we identify herein overlap and extend previous work. Of the 1,140 genes implicated in the generalized linear model, 151 (13.2 percent) overlapped with previous candidate gene, random mutagenesis, gene expression, and genome-wide association studies of sleep and circadian behavior in flies (Pegoraro e t al., 2022; Dissel et al., 2015; Seugnet et al., 2017; Shalaby et al., 2018; Thimgan et al., 2010, Thimgan et al., 2018, He et al., 2013; Mallon et al., 2014; Roessingh et al., 2019, Feng et al., 2018; Lee et al., 2021; Khoury et al., 2020; Wu et al., 2018; Harbison et al., 2013; Harbison et al., 2009; Harbison et al., 2017; Harbison et al., 2019). Notably, previous studies identified the genes CG17574, cry, dro, mip120, Mtk, NPFR1, pdgy, PGRP-LC, Shal, and vari as affecting sleep duration (Feng e t al., 2018, Dissel et al., 2015; Pegoraro et al., 2022; Thimgan et al., 2018; Mallon et al., 2014; He et al., 2013; Khoury et al., 2020; Harbison et al., 2013). Two genes, ringer and mip120, overlapped with our previous study of DNA sequence variation in flies selected for long and short sleep (Harbison et al., 2017). In that study we identified a polymorphism in an intron of ringer that changed in allele frequency with selection, with increases in the population frequency of the ‘G’ allele with increasing sleep, while the frequency of the ‘A’ allele increased with decreasing sleep. When the selective breeding procedure was relaxed, the frequency of the ‘G’ allele increased in short-sleeping populations, paralleling an increase in sleep (Souto-Maior et al., 2020). One possibility is that this polymorphism contributes to the changes in gene expression in ringer that we observed in the present study. Of the 85 genes common to both sexes that we used in the gene interaction networks, 11 (13 percent) appear in other studies of sleep: CG10444, CG2003, CG5142, CG6785, CG9114, CG9676, CR42646, hiw, NPFR1, Tie, and wb (He et al., 2013; Seugnet et al., 2017; Wu et al., 2018; Harbison et al., 2013). Thus, our study corroborates genes known to affect sleep, and identifies new candidate genes for sleep as well.”

      Reviewer #2 (Significance (Required)):

      5. I believe that the authors should attempt to put this study in the context of what is already known in sleep in flies and how this study advances the knowledge. And how the knowledge generated by this study would help other sleep researchers, who, for obvious reasons, would like to employ techniques other than artificial selection and big data. The data is elegant. The work seems to be extremely laborious. Nonetheless, as it stands now, this manuscript is only very specific for an audience who work with artificial selection to understand underlying genetics of behavior. In fact, even within the fly sleep field, most people might not find this manuscript very useful.

      Our response: The reviewer may not have considered the wider application of this work. This framework is applicable to any data set of gene expression sampled across time, whether sampled across generation, as we did, or across the 24-hour circadian day, or sampled at other time intervals. We have added a statement to the Discussion to stress this fact: “The Gaussian Processes we apply herein have broad applications to other experimental designs, such as gene expression measured at varying time intervals over the circadian day, or time-based sampling of gene expression responses to drug administration.”

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Souto-Mairo et al. reports phenotypic and genotypic effects of artificially selecting for short and long sleep in flies. They generated an impressive time-series dataset where one could examine genetic and phenotypic changes across time (generations, total 13 generations) in response to the selection pressure. The authors explored the relationships between pairs of genes in addition to just identifying potential candidate genes involved in the regulation of the amount of sleep.

      Major points:

      1. Harbison et al 2017: This study seems to be a continuation of Harbison et al 2017. There needs to be a clearer approach in the text (introduction?) in elucidating how this study is really advancing the findings of Harbison et al., 2017. Do the two studies use the same selection lines? If not, how are they different? If they are not different, what might cause the phenotypes evolving differently? For example, day sleep, day bout number do not respond to the selection pressure similarly in both studies etc.
      2. Zeitgeber Time (ZT) for RNA collection: It is puzzling that the study reports that the RNA was collected at 12 PM. I do not understand what this information means; especially in a project where one is working with sleep. The authors might want to report ZT. Also, why a particular ZT was chosen should be discussed. These genes are potential sleep-relevant genes - hence it is not too esoteric to think that the ZT of data collection matters a lot as some of them might be cycling. To get a more appropriate picture, multiple time points of data collection might be even better. The authors seem to have ignored this crucial aspect of a clock/sleep study - time of data collection and how time of data collection might shape your findings.
      3. Short sleeping flies: Are there reports of flies sleeping this less? "We found 2,830 interactions; 8 of these were one of the 3,570 between the 85 genes, but none of them overlapped with the 145 gene pairs found to be different from controls. The gene interactions we observed may therefore be unique to extreme sleep." What is extreme sleep? How does this study then claim to have identified evolution of potential sleep-relevant gene expression for normal, physiologically relevant sleep?

      Minor points:

      The article uses an unnecessarily defensive tone to establish their approach to understand underlying mechanisms of sleep 'better' than that of the others (in both introduction and discussion): "In spite the large amount of studies and data generated for many systems, identifying underlying processes is still very rare; this is clear indication that better methods are needed to obtain understanding of biological processes from data." The 'still very rare' part is just factually incorrect and misleading as far as sleep is concerned. Even if we just see Drosophila studies on sleep, there is a huge progress that's being made in terms of genes, neurons and circuits relevant for sleep: both in terms of baseline sleep as an output of the circadian clock and the rebound/homeostatic sleep. Most, if not all, of these elegant and pioneering studies from multiple, independent groups took approaches that did not require artificial selection regimes. As a substitution for their defense, the authors might attempt to present their findings in the context of the existing knowledge of sleep in flies. For example, what about genes already implicated in sleep? Do they show up in their analysis? For example, Sleepless, DATfmn, Sandman, AstA, AstA-receptor, Wide-awake etc. This could really help the manuscript.

      Significance

      I believe that the authors should attempt to put this study in the context of what is already known in sleep in flies and how this study advances the knowledge. And how the knowledge generated by this study would help other sleep researchers, who, for obvious reasons, would like to employ techniques other than artificial selection and big data.

      The data is elegant. The work seems to be extremely laborious. Nonetheless, as it stands now, this manuscript is only very specific for an audience who work with artificial selection to understand underlying genetics of behavior. In fact, even within the fly sleep field, most people might not find this manuscript very useful.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary:

      The authors of this work generated a Sleep Advanced Intercross Population from 10 extreme sleeper Drosophila Genetics Reference Panel. This new out-bred population was subjected to a artificial selection with the aim of understanding the genes underlying the sleep duration differences between three populations: short-sleep, unselected, and long-sleep. Using analysis of variance the authors identified up to nearly 400 of genes that were significant selected over the various generations and showed opposite trends for long and short sleep, thus potentially relevant for the regulation of sleep duration. 85 of these genes were consistent between male and females sub-populations, suggesting a small number of genetic divergences may underlie sex-independent mechanisms of sleep.

      Given the time-course nature of the generational data obtained, the authors studied potential correlations and interactions between these 85 identified candidate genes. Initially, the authors used pairwise Spearman correlation, noticing how this method could not filter most of pairwise interaction (around 40% of all possibilities were significant). To overcome the linear limitations of the previous approach, the authors implemented a more complex, non-linear Gaussian process model able to account for pairwise interactions. This new approach was able to identify a smaller number of different, and potentially more informative, correlations between the candidate genes previously identified.

      Lastly, with genetic manipulations, the authors show in vivo that a subset of the candidate genes is causally related with the sleep duration as well as partially validating some of the correlation identified by their new model.

      The authors conclude that, given the non-linear and complex nature of biological systems, simplistic linear approaches may not suffice to fully capture underlying mechanisms of complex traits such as sleep.

      Major comments

      Most of the the work presented focus on the computational and statistical analysis of different populations submitted (or not) to a process of artificial selection for short or long sleep duration. As such, the amount of potentially relevant biological conclusions to be tested is mostly unfeasible. The authors already present additional experiments to partially support some, though not all, of their findings. Given the manuscript is written as a method innovation, these additional experiments illustrate the potential uses of the method described.

      (OPTIONAL) However, since the one of the focuses of this work in identifying potential gene interactions, it would be interesting if the authors could test a "double knockout" and perhaps demonstrate evidence for epistasis between two of the identified genes. Having access to single mutants, this experiment should be realistic. However, I have no hands-on experience working with Drosophila and I am unable to accurately estimate the amount of resources and time such and experiment could take. My initial guess would be 3-6 months work should suffice.

      In regards to the gene CG1304, it seems to be an important example used throughout the manuscript. It should be carefully re-analyzed as was considered for interaction analyses without showing opposite trends for short- and long-sleep populations (see minor comments on figure 2)

      One major comment would be that the claim that the Gaussian process method is more sensitive and specific than simpler approaches, though intuitively understandable, does not seem to be fully correct from a strict statistical point of view, given the lack of a gold standard reference to compare if the new method is indeed picking more true positives/negatives. I would reconsider re-rephrasing such statement in the absence of a biologically relevant validation set.

      Finally, the study appears to be well powered and it is clear that the authors were careful in their explanation of the statistical methods. However, I could not find the copy of the code/script used for the model. Without it, it would be very difficult to fully reproduce the results as both the language used (Stan) and the method itself are not common in the sleep research field.

      Minor comments

      The statistical cut-off used for gene expression hierarchical GLMM after BH correction was of 0.001, which is 50 times more strict than the common 0.05. Could the authors comment on how this choice may impact the results compared to those available in the literature and on the rational for choosing such a value.

      Heritability calculations are not mentioned in the methods. Could it be useful to include a small paragraph? Could a small comment be done on the differences in h2 for the short sleep replicates which show ~10x difference?

      In regards to the model implementation, what would be the implications of not enforcing positive semi-definiteness on the co-variance matrix, given than that these are strictly positive semi-defined?

      The methods mention that PCA projection were performed on the first 3 components, however only the first two are showed.

      Figure 1 refers to the mean night sleep time of the population. Could some measurement of variability (se or sd) be represented to provide a general idea of the distribution of the values? Additionally, the standard deviation of associated with the CVe estimates are mentioned but not showed explicitly. Could they maybe be added to the text as to illustrate how much such deviations were reduced?

      Figure 2 shows the linear model fits for gene CG1304. I find this gene on the list of significant genes for both sexes (tables S5/6), but it does not seem to be one that shows opposite trend for short- and long-sleep (tables S7/8). Surprisingly, it shows up again on table S10! However, the text introducing the figure reads like this should be one of the 85 sex-independent genes. Would it be best to provide an example of what a significant gene looks like?

      Figure 3 would be interesting to have both the GP correlations and the Spearman correlations to illustrate the methodological differences. I would be curious to see at least one pairwise expression scatter-plot as well just to see how they correlate in one plot.

      Figures 3S3/4 are described as showing single- and multi-channel models don't change substantially. Would this be expected and why?

      Having build different networks of pairwise associations of genes (projecting on a unified network as illustrated on figure 5), it could in interesting to compare the network topologies at a basic level such as node degrees, overlapping sub-networks, are they potentially scale free as previously described for biological systems, etc.

      On table S6 I noticed some gene symbols were loaded as dates (1-Dec)

      In results, the phenotypical response to artificial selection is sometimes described in minutes, other times in hours. Though this is an hurdle, it could make the values easier to compere if they were consistently formatted as minutes (hours).

      Over 99% of chains converged after three runs. Even though the reasons for the lack of convergence of these chains was not investigated, could this be a relevant effect? 1% of 3570 interactions is still 35 potential interactions. Do the non convergent chains relate with specific genes?

      The GO terms identified as significantly enriched after pvalue correction point to a clear association of the 85 genes identified with Serine proteases. Could this be discussed further to highlight biological findings of the work in the context of neuronal function or sleep regulation?

      Could the authors discuss the little overlap between males/females and shot/long sleep for 145 gene pairs identified after the MCMC runs. Similarly, how can the network differences be explained from a biological/evolutionary perspective?

      In the mutational analyses it is pointed out that CG12560 and Jon65Aii only affect females significantly. However, in the following sentence, the authors claim these two genes had the greatest effect on both sexes, which seems contradictory, at least in the way it is described.

      Maybe a small comment on how unchanged expression could lead to the observed phenotypical variation could help understanding how Minos mutations effects are biological mediated for those not familiar with the method. This seems to be the authors expectation so, could it be non-functional proteins or something else?

      The assumption that interacting genes would have their expression ratio changed by the Minos insertion would hold on situation where the affected gene causally interferes with the candidates expression. As far as I understand, causality cannot be inferred by the proposed method. Thus in a situation where both genes are co-regulated by a third factor, no change in expression ratio is to expected. How would the authors re-interpret their final result when considering this direct vs indirect interaction distinction?

      Referees cross-commenting

      I agree with Reviewer #2 comments which, to me, reads as generally pointing out the lack of biological interpretation of the results (and thus connecting this study with previous literature). Adding this component would make the manuscript well-rounded and attractive to a wider audience.

      Significance

      This study proposes the application of advanced non-linear methods to study complex traits such as sleep. As implemented, Gaussian Processes are able to identify non-linear correlations between two biological features (e.g. transcripts) over time (e.g. generations), representing an attempt to push the analytical methods available beyond the single gene paradigm. As such, more than the relevance of the biological results themselves, the authors focus on the explaining and illustrating the application of methodological advances obtained, and its relevance to obtain a better understanding of biological systems.

      However the mathematical principles required to understand the implemented method are not trivial and require advanced knowledge of machine learning and statistics. This is a potential barrier, though not an impediment, to its quick and wide adoption by the community. In addition, even if demonstrated to be a valid method when working with Drosophila, the resolution required to perform such a study may be difficult to obtain with other model systems, which would likely require further refinement of the statistical approach.

      The main audience interested in this work would be basic sleep researchers. However, this work is also related to the understanding gene selection over an artificial evolutionary process, thus evolutionary and developmental biologist may be also be interested. The methodology itself, already used in other fields of study, is a general statistical tool that could be adopted by a broad range of researchers for a diversity of topics. As such, I believe with this work, the authors will be able to stimulate the development and/or rethinking of the available analytical methods to study complex biological systems, though this would likely be done either in collaboration with the authors themselves or by a specific subset of researchers who regularly work with advanced mathematical, statistical and computational principles.

      (disclaimer) My mathematical formation does not reach the PhD level expertise that may be required to fully understand the methodology described. I have never personally worked with D. melonogaster or used Gaussian Processes in a professional setting. As such, I may not be able to fully evaluate/appreciate the more detailed technical aspects of this work.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      We are very grateful to the reviewers for their constructive comments. In response to their critiques, we have made extensive modifications to the manuscript, including documenting new experiments and analyses, and improving data presentation. Here we provide a point-by-point response to the reviewers’ comments.

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      Summary:

      It is well established that localization of oskar (osk) RNA in the Drosophila ovary proceeds in multiple steps. The first step depends upon dynein and results in delivery of osk into the oocyte. The second step involves kinesin-driven transport of osk to the oocyte posterior pole. The manuscript by Gáspár et al brings together several lines of evidence that support an tantagonistic relationship with respect to motor binding between two osk-interacting proteins, Egalitarian (Egl) and Staufen (Stau). As staufen RNA and protein accumulate in the oocyte, Egl dissociates from osk, down-regulating dynein and enabling the second stage of osk transport to begin.

      Major comments:

      In general the experimental results support the conclusions drawn, and the paper includes a strong mix of in vitro and in vivo approaches. Nevertheless I have a few concerns.

      (1)In Fig 1D it is apparent that stau KD increases the speed of both plus-end and minus-end runs to a highly significant degree, not just minus-end runs. The stimulating effect of loss of Stau on speed of plus-end runs is not mentioned in the text, and it perhaps muddies the argument that Stau is simply a negative regulator of dynein-dependent minus-end directed transport. This result needs to be explicitly discussed in the text.

      We thank the reviewer for this important comment. Indeed, our previous analysis of the overall population of oskar RNPs showed that plus-end-directed runs had increased velocity in the absence of Staufen (although the magnitude of the effect was considerably smaller than observed for minus-end-directed runs). The reviewer’s comment prompted us to analyze the effects on motility in more detail. In particular, we have now stratified the data based on the RNA content of the RNPs to control for effects of Staufen depletion on RNA copy number of the motile oskar RNPs. These analyses, which are documented in Fig 1B-F of the revised manuscript and discussed between lines 96-143, indicate that the previous velocity and run length data was somewhat confounded by the Staufen-depleted condition having a lower fraction of moving complexes with a large RNA content, which generally move more slowly. Accounting for this effect shows that impairing Staufen has no significant effect on plus-end-directed run lengths, whereas minus-end-directed run lengths are substantially increased. The velocity of runs is also specifically increased in the minus-end direction in the Staufen-depleted background for RNPs that have a relative RNA content of 1 or 2 units, which represent the majority of the RNP population in that genotype. Whilst RNPs with larger RNA content (2 relative units) do have significantly higher plus-end-directed velocity compared to the same category in the control, the effect is of much smaller magnitude than observed for minus-end-directed movements by this population. To help clarify these results, magnitudes of the effects are now shown in the new Fig. 1 E and F.

      These data strengthen the case that Staufen predominantly affects minus-end-directed motion. Given many documented examples of the interdependence of dynein and kinesin on bidirectional cargoes (Hancock et al. 2014), it is conceivable that the modest effects on plus-end-directed velocity for a subset of RNPs arise indirectly from the influence of Staufen on dynein activity. However, we agree with the reviewer that we should not rule out the alternative possibility that Staufen has additional roles in regulating oskar transport, including potentially modulating kinesin-1 directly. We have therefore added a section to the Discussion that covers this issue (lines 496-514).

      (2) I recognize the importance of quantitative imaging to rigorously measure small differences in localization patterns. Nevertheless I find the data in Fig 3 extremely difficult to interpret. Presumably there is standard deviation everywhere there is green signal, but the magenta signal that corresponds to SD is not visible in most places that are green. I suggest adding to Fig 3 a single representative image for each genotype to illustrate each localization pattern, as well as a much clearer explanation of the quantitative imaging data. Perhaps the quantitative images could be moved to a supplemental figure.

      Reviewer 2 also suggested that we include representative images in addition to the quantitative readout. We have now replaced the old Figure 3 with a new one showing representative examples of oskar distribution in the different genotypes and moved the quantitative images to the supplement (Figure S4). We have also improved the legends and labeling of this supplementary figure to add clarity.

      **Minor comments:**

      (1)Color/density scales should be added to Figs 1A and S1A, otherwise the yellow/white signal at the posterior could be interpreted as something other than high abundance.

      We thank the reviewer for spotting this. We have now added a color scale to the relevant figures.

      (2)In Fig 4A and 4C, I find it odd to have different halves of images photographed under different intensity settings and would prefer duplicate whole images.

      We used this layout to illustrate in the most compact way possible the (co)localization of the two RBPs and oskar RNA in the nurse cell and oocyte compartments, where signal intensities can differ dramatically. Following the reviewer’s comment, we now show whole images with different intensity settings (Figure 4 A, A’, C, C’).

      (3)The references to Fig 3G on page 13 should be corrected to Fig 4G.

      We thank the reviewer for spotting this error, which has now been corrected.

      Reviewer #1 (Significance (Required)):

      The paper represents a substantial advance over existing knowledge and it extends our understanding about how RNAs can shuttle between different motor proteins to achieve a localized pattern. However, the Mohr et al 2021 PLoS Genetics paper covers some of the same ground. As that paper has now been published for several months, I believe a revised version of this paper should discuss that other work more prominently, making it apparent where the two studies concur and where this study extends the conclusions of the other one. If there are any contradictions between the two, those should be made explicit as well.

      We had discussed the Mohr et al. study in our manuscript, which came out when our work was in preparation. Following the reviewer’s comment, we now address explicitly how our study differs from theirs and how our work extends their findings. The relevant paragraphs in the Discussion begin on lines 437 and 496. Briefly, a key point of difference is that Mohr et al. focused on the Transport and Anchoring Sequence (TAS) (including its ability to associate with Egl) and other Staufen recognition sites (SRSs) in oskar mRNA. Their study also includes an experiment examining the effect of Egl overexpression on oskar localization (as described in our original submission). In contrast, our study directly examines the interplay between the RBPs Staufen and Egl on oskar RNPs. We are the first to show that Staufen directly antagonizes dynein-based transport and that this is associated, at least in part, with an ability to impair Egl association with RNPs. Moreover, we provide insights into the in vivo role of Egl/BicD in recruitment vs activation of dynein on RNPs and how the activity of Staufen is coordinated in space and time via Egl-mediated delivery of stau mRNA, which constitutes a novel type of feed-forward mechanism. We do not believe there are any contradictions between the two studies.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      In this manuscript, Gáspár et al. investigated the molecular mechanisms underlying the switching of motors for osk mRNA transport in the Drosophila ovary: from dynein in the nurse cells to kinesin-1 in the oocyte. They demonstrated that it requires two RNA-binding proteins, Egalitarian (Egl) and Staufen (Stau) to achieve the posterior localization of osk mRNA in the oocyte. Their data show that Egl is responsible for the stau mRNA transport into the oocyte, while Stau protein inhibits Egl-dependent dynein transport in the oocyte. Thus, they proposed a feed-forward mechanism in which Egl transports mRNA encoding its own antagonist Stau into the oocyte and thus achieves the switch of the osk mRNA transport from dynein to kinesin-1.

      The antagonistic interaction between Egl and Staufen is well documented both in vitro and in vivo. All the results are carefully analyzed, but the data presentation is not reader-friendly. Overall, our main concern is about the role of Staufen in osk mRNA transport.

      **Here are specific points:**

      (1)According to the model, lack of Stau should result in failure of displacing Egl from the RNP complex and thus more dynein-driven transport in the oocyte. However, the increase of minus-end run length in stau-RNAi is very small (Figure 1E). It makes us wonder whether Stau is not a dominant inhibitor of Egl/dynein transport of osk RNPs. On the other hand, the speed increase of minus-end run in stau-RNAi is more dramatic than the run length (Figure 1D-1E). Does it mean that in stau-RNAi dynein-driven osk transport has a shorter duration of run? Additionally, in Figure 1D, there is a statistically-significant increase of plus-end-directed transport velocity in stau-RNAi. While the author did mention that in the results "analysis of the speed and length of oskar RNP runs in ooplasmic extracts indicated that Khc activity was not compromised upon staufen knock-down", it does not explain the increased velocity towards the plus-end.

      We thank the reviewer for these insightful comments.

      We and others (Zimyanin et al. 2008; Gaspar et al., 2014) have shown that there is only a small posterior-directed bias in oskar RNP transport in the wild-type ooplasm at mid-oogenesis. Thus, small increases in minus-end-directed transport parameters are expected to be sufficient for anterior mislocalization of a subset of RNPs, as is seen in stau mutants (note that we would not expect a dramatic increase in minus-end-directed motile properties in the stau RNAi condition, as a significant fraction of oskar RNA is targeted posteriorly). To allow the readers to better judge the magnitude of the effects, we now include the percentage change in mean velocity and run length values on the graphs (new Figure 1E and F).

      Regarding the reviewer’s question about the run duration, indeed it is shorter for the minus-end directed runs in the absence of Staufen. In the motor field, it is typical to present velocity and run length only because duration is dependent on these two parameters.

      Reviewer 1 also made a similar comment about plus-end directed velocity of RNPs. As we wrote in response to their comment, we have now stratified the data based on the RNA content of the RNPs to control for effects of Staufen depletion on RNA copy number of the motile oskar RNPs. These analyses, which are documented in Fig 1 B-F of the revised manuscript and discussed between lines 96-143, indicate that the previous velocity and run length data were somewhat confounded by the Staufen-depleted condition having a lower fraction of moving complexes with a large RNA content, which generally move more slowly. Accounting for this effect shows that impairing Staufen has no significant effect on plus-end-directed run lengths, whereas minus-end-directed run lengths are substantially increased. The velocity of runs is also increased only in the minus-end direction in the Staufen-depleted background for RNPs that have a RNA content of 1 or 2 relative units, which represent the majority of the RNP population in that genotype. Whilst RNPs with larger RNA content (2 relative units) do have significantly higher plus-end-directed velocity compared to the same category in the control, the effect is of much smaller magnitude than observed for minus-end-directed movement for this population.

      These data strengthen the case that Staufen predominantly affects minus-end-directed motion. Given many documented examples of the interdependence of dynein and kinesin on cargoes (Hancock et al., 2014), it is conceivable that the modest effects on plus-end-directed velocity arise indirectly due to the influence of Staufen on dynein activity. However, we agree with the reviewer that we should not rule out the alternative possibility that Staufen has additional roles in regulating oskar transport, including potentially modulating kinesin-1 activity directly. We have therefore added a section to the Discussion that covers this issue (lines 496-514).

      (2) What happened to osk mRNP transport in nurse cells with Staufen overexpression? The authors briefly mentioned that "GFP-Staufen overexpression has no major effect on the localization of oskar (Fig S1F-I)" on page 10. This is quite puzzling, as the authors propose that Staufen antagonized the Egl/dynein-driven transport. If the model holds true, we would expect to see that overexpression of Staufen causes less osk transport in nurse cells and thus less osk accumulated in the oocyte. Can the authors examine the osk mRNP transport in nurse cells in control and in GFP-Staufen overexpressing mutant and quantify the total amount of osk mRNA in the oocyte in control and after GFP-Staufen overexpression?

      We showed in the initial submission that strong overexpression of GFP-Staufen in early oogenesis (e.g. with osk-Gal4) disrupts oskar localization, including causing ectopic accumulation in the nurse cells (Fig S7F and G, now marked with arrowheads). Fig S1F-I, to which the reviewer refers, documents an experiment in which the expression of GFP-Staufen was directly driven by the maternal tubulin promoter (i.e. not through the UAS-Gal4 system; now indicated in Fig. S1F). We had assumed that the difference in behavior of the different GFP-Staufen transgenes was caused by the timing and the amount of overexpression – maternal Gal4 drivers are capable of very strong and, in the case of osk-Gal4, early expression of UAS transgenes. Prompted by the reviewer, we have now examined GFP-Staufen expression in these lines in more detail. This confirmed our previous assumptions about timing and levels of ectopic expression. We now included a new panel Fig S7I to document the expression of maternal tubulin promoter-driven GFP-Staufen and have updated the manuscript to include details about the mode of Staufen overexpression used in different experiments (lines 205, 408-417).

      (3)Is osk mRNP transport in the nurse cells affected by stau-RNAi? The authors showed the Khc association with oskar mRNPs in the nurse cells in Figure 1C. We hope they could quantify the velocity and run length of the osk mRNP particles in nurse cells and compare control with stau-RNAi.

      We have never succeeded in making squashes of nurse cells that maintain oskMS2 RNA transport. Therefore, we are unable to evaluate directional transport of oskar in these cells. However, Staufen does not accumulate to appreciable levels in the nurse cells, as shown by Little et al., 2015 and also Figure 4A and A’ (left panels). Moreover, we did not detect significant colocalization between Staufen and oskar in the nurse cells (Fig. 4B). Therefore, depletion of Staufen with RNAi is not expected to influence motility of oskar in this part of the egg chamber.

      (4)The kymograms of in vitro motility assays (Figure 2A and Figure S2) clearly showed two different moving populations, fast and slow. Did the authors include both types of events in their quantifications? What are the N numbers for each quantification? What do the dots mean in Figure 2B-2G? Does each dot represent a single track in the kymograph? If so, we believe that the sample sizes are too small for in vitro motility assay.

      For completeness, we did not exclude particles from our analysis based on their speed of movement. We have now made this point clear in an updated section of the Methods (lines 799-802), which provides additional information on particle inclusion criteria.

      We did document in the legends what the dots represent (values for single microtubules). We have now also included information on the number of complexes analyzed, which is 586-1341 single RNA particles or 1247-2207 single dynein particles per condition. These sample sizes are considerably larger than those used in most in vitro motility studies.

      (5)The in vitro motility assay showed that Staufen impairs dynein-driven transport of osk 5'-UTR (Figure 2). Based on these data, it is unclear whether the effect of Staufen is osk mRNA-dependent or Egl-dependent. We suggest performing the motility assay in the absence of osk 5'-UTR and Egl. Dynein, dynactin, and BicD should be sufficient to constitute the processive dynein complex in vitro. The addition of Staufen to the dynein complex will help to understand whether Staufen could directly affect dynein activity. We bring up this point because we noticed that the Staufen displacement of Egl in osk RNPs does not alter the amount of dynein complex associated (Figure 6), implying that Staufen inactivates dynein activity on the RNP complex, independently of Egl-driven dynein recruitment.

      We cannot look at transport of dynein in the presence of only dynactin and full-length BicD as BicD is not activated (and thus unable to effectively bind dynein and dynactin) without Egl and RNA (McClintock et al. 2018, Sladewski et al. 2018). However, the reviewer’s comment prompted us to investigate the effect of Staufen on dynein-dynactin motility that is stimulated by the constitutively active truncated mammalian BicD2, so called BicD2N (Schlager et al. 2014, McKenney et al. 2014). We find that Staufen partially inhibits DDB motility but not to the extent seen with the full-length BicD in the presence of Egl and RNA (new main figure panels 2H and I, and Figure S3). As stated between lines 187-188, these data suggest that Staufen inhibits both the activation of dynein-dynactin motility by BicD proteins, as well as stimulation of this event by Egl and RNA. This finding is also incorporated in a new section of the Discussion that covers possible roles of Staufen in addition to competing for Egl’s binding to RNA (between lines 496-514). We are very grateful to the reviewer for suggesting this approach, as it has provided significant new insight into Staufen’s function.

      (6)In Figure 4, it is hard to see any colocalization between GFP and osk mRNA. And the authors compared overexpressed Egl-GFP (driven by mat atub-Gal4 in mid-oogenesis) with Staufen-GFP under its endogenous promoter. An endogenous promoter-driven Egl-GFP would be much more appropriate for the comparison.

      Colocalization between GFP and oskar signals is seen as white in Fig. 4A and C. We have now added arrows to highlight a few examples of colocalization. The degree of colocalization was quantified in an unbiased fashion (shown in panels Fig 4B and D).

      Regarding the expression of Egl-GFP: it was driven directly by the aTub84B promoter and not by matTub-Gal4. Western blot analysis performed in response to the reviewer’s comment shows that Egl-GFP is expressed at similar levels to endogenous Egl in this line (new Fig. S5I).

      (7)In a recent publication (Mohr et al., 2021), a different model was proposed, in which Egl mediates transport, and Staufen facilitates the dissociation from the transport machinery for posterior anchoring. Although the authors referred to their paper in the discussion, they should acknowledge the differences and try to reconcile it (at least in the discussion).

      We now further discuss our work in the light of the findings by Mohr et al. (a request also made by Reviewer 1) (in paragraphs starting on lines 436 and 496). In our opinion, the data of Mohr et al. in fixed material cannot discriminate between effects of Staufen (or the TAS) on transport vs anchorage. In contrast, our dynamic imaging in vitro and ex vivo shows unambiguously that Staufen can modulate transport processes. As accumulation of RNA at the cortex is dependent on directional transport, we do not think it necessary to invoke a separate anchorage role of Staufen. We have now raised the possibility that transport and cortical localization are two facets of the same underlying process in the hope that this will stimulate further investigation (lines 455-459).

      (8)In the feed-forward model, Egl is required for the staufen mRNA transport from the nurse cells to the oocyte. Are Egl-GFP dots colocalized with staufen mRNAs in the nurse cells?

      We showed in Fig 7I of the original submission that Egl-GFP puncta are colocalized with stau mRNAs in nurse cells. Indeed, this is a key piece of evidence for our model. These data are now in Figure 7F.

      Furthermore, to our understanding, in this model, the translation of the staufen mRNA would be critical for the switching motors between dynein and kinesin-1. In this sense, staufen mRNA translation is either suppressed in the nurse cells or only activated in the oocytes. I think the authors should at least address this point in the discussion.

      This is another excellent suggestion. We have now included in the Discussion (from line 525) the point that Staufen translation may be suppressed during transit to the oocyte or that the protein may be translated en route but only build up to meaningful levels where the RNA is concentrated in the oocyte.

      **Minor points:**

      1)I hope the authors would show the osk mRNA localization in egl mutant in in individual stage 9 egg chambers. I can only find the osk mRNA in egl-RNAi early stage egg chambers (Figure 7E), in which osk mRNA still shows an accumulation in the oocyte, although to a much lesser extent compared to control. In another publication (Sanghavi et al., 2016), it seems that the knockdown of Egl by RNAi causes some retention of osk mRNA in the nurse cells; but there are still noticeable amount of osk mRNA in the oocyte (Figure 3A-B). We wonder whether the authors could quantify the amount of osk mRNA both in the nurse cells and in the oocyte of control and egl-RNAi. Also I wonder whether the authors could comment on fact that some osk mRNA transported into the oocyte. Could it be due to an egl-independent transport mechanism?

      egl null mutants do not reach stage 9 due to a defect in retention of oocyte fate, hence the use of egl RNAi in our study and the one by Sanghavi et al. Whilst we can’t rule out a (minor) Egl-independent mechanism for localizing oskar RNA in the oocyte, to date no other pathway has been implicated in the delivery of this or any other mRNA from the nurse cells. We favor a scenario in which residual oskar accumulation in the oocyte in egl RNAi egg chambers is due to incomplete depletion of Egl protein in the knockdown condition. We have noted this in the relevant figure legend and also clarify that the RNAi is a tool for knockdown in line 383 of the Results section.

      The below plot shows a quantification of oskar mRNA localization in egl and control RNAi egg chambers, which the reviewer was wondering about.

      In the egl RNAi egg-chambers, there is a significant increase in the mean signal intensity of oskar mRNA in the nurse cells, while oskar mRNA levels are substantially reduced in the oocyte, in line with the findings of Sanghavi et al., 2016.

      2)It is always nice to how the average distribution of osk mRNA (e.g., Figure 3, Figure S1, and Figure S3). But we recommend having a representative image of each genotype (a single egg) next to the average distribution. It will help the readers to better appreciate the differences among these genotypes.

      This suggestion was also made by Reviewer 1. We have added representative images to Figure 3 and moved the images depicting average distributions to the supplement (Fig S4). We have also improved the legend and labeling for Fig S4.

      3)The figure legends are overall hard to read and sometimes impossible to get information about the experiments (for example, Figure 4 legend). Can the authors improve their figure legends making them reader-friendly?

      We have edited the legends to make them clearer, including an extensive reworking of those for Figure 4. We thank the reviewer for encouraging us to do this.

      4)For moderate overexpression, the authors used P{matα4-GAL-VP16} (FBtp0009293). However, there are two different transgenic lines associated with FBtp0009293 (V2H and V37), which have slightly different expression levels. The authors should specify which line they used in the experiments.

      The matTub-Gal4 transgene we used in our study is inserted in the 2nd chromosome. We now mention this in the Methods section (line 567). We received this line from another lab many years ago, with no additional information provided.

      5) On page 13 "PCR on egg-chambers co-expressing Egl-GFP and either staufen RNAi or a control RNAi (white) in the germline (Fig 3G)", it should be Figure 4G.

      We apologize for this mistake, which has now been fixed.

      Reviewer #2 (Significance (Required)):

      see above

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      Some additional experimental evidence is needed to solidify the conclusions and provide definitive support for this model, as discussed below.

      Biochemical experiments using UV crosslinking and GFP immunoprecipitation followed by quantitative PCR were performed to show that Staufen antagonizes the association of Egl with oskar mRNA in vivo. -The authors need to show the quantitative analysis, which was not present in the figure, specifically the effects of Staufen RNAi compared to control.

      These quantitative data, which are key for our model, were shown in the original submission (Fig 4G in the original and revised manuscript). We mistakenly called out the panel as 3G in the original submission. We apologize for this error, which has now been dealt with.

      Is the ability of Staufen to antagonize and displace Egl dependent on Staufen binding to Oscar RNA? Will a Staufen mutant that can't bind to RNA also displace Egl? Alternatively, the mechanism may be independent of RNA binding and perhaps due to protein-protein interactions.

      While the details of how Staufen displaces Egl are certainly an interesting topic for future research, we consider that addressing this goes well beyond the scope of this study, which already covers a lot of ground. Staufen contains four double stranded RNA-binding domains, and deleting or mutating all of these domains is likely to interfere with overall folding of Staufen, thus confounding the interpretation of the results.

      As an alternative approach to elucidating RNA-dependent vs RNA-independent roles of Staufen, we have now assessed the effect of the protein on in vitro motility of dynein-dynactin complexes formed in the presence of a constitutively active truncation of mammalian BicD2 (BicD2N). We find that Staufen partially inhibits motility of these ‘DDB’ complexes but not to the extent seen with the full length BicD in the presence of Egl and RNA (new Fig 2H, I and S3). As stated in the manuscript (lines 187-188) these data suggest that Staufen inhibits both the activation of dynein-dynactin motility by BicD proteins, as well as stimulation of this event by Egl and RNA. We believe these experiments provide significant new insight into Staufen’s function. This finding is also incorporated into a new section of the Discussion dealing with potential roles of Staufen in addition to displacing Egl from RNPs.

      A key question addressed is how does Staufen play a role in directing Oscar RNA localization to the posterior pole. The spatiotemporal control of Staufen at stage 9 seems to be a critical step. A number of experiments are performed to show that Staufen RNA enters the oocyte and accumulates to anterior pole through a process dependent on Egl (Fig. 7).

      -Definitive evidence is needed to show the role of 3'UTR of Stau and Egl binding. As it stands now, no evidence is presented to prove that delivery of staufen RNA via Egl, rather than dumping of Staufen protein into oocytes is the necessary trigger for the switch. It is well known that Staufen protein is also transported through ring canals to deliver Staufen into oocytes. There is no need to invoke an additional mechanism of Egl mediated staufen mRNA delivery. A key experiment is to perturb the Egl interaction with staufen 3'UTR and show this is a necessary component to impact oscar. Related to this comment, they should first perform biochemistry IP and PCR to demonstrate association of Egl with staufen RNA, and then somehow perturb this interaction to assess effects on oscar RNA localization. For example, is the 3'UTR of staufen RNA necessary for this mechanism? What if staufen RNA was ectopically localized in some inappropriate manner, for example localized to posterior pole? Would this prevent the switch of oscar RNA to move to posterior pole? The key question is: is it necessary that translation of Stau be coupled to Egl in order to drive the switch.

      Mapping of the Egl-binding site in stau mRNA is a major undertaking requiring the production and evaluation of multiple new transgenic fly lines. We feel that this would constitute an entirely new study. Moreover, multiple lines of evidence already support a functional interaction between Egl and stau mRNA, notably the presence of Egl on stau RNPs (previously Fig. 7I, now Fig. 7F), the strongly impaired accumulation of stau mRNA in the oocyte of egl RNAi egg chambers, and the ability of Egl overexpression to reposition a subset of the stau mRNA population at the anterior cortex.

      We have now performed new experiments and analyses to test the alternative hypothesis that Staufen protein is transported into the oocyte in the absence of stau mRNA transport. We find that disrupting Egl function with RNAi impairs localisation of both stau mRNA and protein in the proto-oocyte (new Figure 7A-D). As Egl has no known function in protein transport, these data argue against an RNA-independent mechanism for Staufen protein delivery. Moreover, we showed that both stau mRNA and Staufen are enriched in early oocytes lacking oskar mRNA, the main target of Staufen protein in the female germline. This result shows that Staufen protein is not appreciably transported from the nurse cells to the oocyte by hitchhiking on its RNA targets.

      Whilst Mhlanga et al. 2009 did report transport of large GFP-Staufen particles through ring canals, the line used (matTub4>GFP-Staufen from the St Johnston lab, which was also used for our rescue experiments) is known to make protein aggregates which is not the case for the endogenous protein (Zimyanin et al., 2008 and our new Figures 7B and S7E-I) and are therefore likely to be artefactual. Neither we, nor previous studies (Little et al., NCB, 2015), detected endogenous Staufen protein in nurse cells.

      Finally, the reviewer asks if coupling Staufen translation to Egl-mediated enrichment of stau mRNA in the oocyte is important: we showed in the original submission that strong overexpression of GFP-Staufen by Gal4 drivers leads to mislocalization of Staufen in the nurse cells of early egg-chambers, presumably due to saturation of the Egl-based transport machinery. In these egg-chambers, we observed defects in RNA enrichment in the primordial oocyte and defects in oogenesis, consistent with the need to exclude Staufen protein from the nurse cells.

      These findings are now presented in new panels of the updated Figures 7 and S7, with the corresponding section of the manuscript revised accordingly (lines 408-417). We think that altogether these lines of evidence strongly support our model that Egl transports stau mRNA into the developing oocyte and that this process is pivotal for oskar RNA localization.

      **Minor comments**

      "Substantially more oskar mRNA was co-immunoprecipitated with Egl-GFP from extracts of egg-chambers expressing staufen RNAi compared to the control (Fig 3G). -This data is not shown in 3G, but rather only in Fig. S4H which needs quantitative analysis shown.

      This point stems from us calling out the wrong panel in the first submission; this has now been addressed, as described above. We apologize for the error.

      "Addition of recombinant Staufen to the Egl, BicD, dynein and dynactin assembly mix significantly reduced the number of oskar mRNA transport events (Fig. 2A and B)."

      -In Fig. 2A, the Y axis shows velocity not number of transport events

      Fig 2A is a kymograph that is representative of the overall effect, where the Y-axis represents time. The reviewer may be referring to Fig 2B but this shows the frequency of processive oskar RNA movements (expressed as ‘number / micron / minute’), not velocity (micron/minute).

      Fig. 3. - This is very unclear figure as to what is being shown. More details are needed to explain the figure, and add arrows to help reader note what is being described.

      We have changed this figure to show representative images of individual egg chambers, as requested by the other two reviewers. The original Fig 3 is now moved to the Supplement as Fig S4. We have added arrows to the figure to indicate the anterior mislocalization of oskar mRNA and edited the legend for clarity.

      Staufen may also be required for the efficient release of the mRNA from the anterior cortex. This may reflect a role of Staufen in the coupling of the mRNA to the kinesin-dependent posterior transport pathway. This could be discussed as another aspect of the inhibition of dynein and handoff to kinesin.

      This is an interesting idea but it does not fit with our observation that Staufen depletion does not alter the association of oskar RNPs with kinesin-1 (originally Fig. 1C, now Fig. 1D). We do, however, now include in the Discussion a section on other ways, in addition to promoting Egl disassociation, that Staufen might orchestrate oskar mRNA transport.

      Reviewer #3 (Significance (Required)):

      This elegant manuscript by Gaspar et al provides new insight into the spatiotemporal regulation of Staufen mediated localization of oscar mRNA to the posterior pole in Drosophila oocytes. Here the authors demonstrate the competitive displacement of the RNA binding protein Egalitarian, which antagonizes dynein dependent localization at the anterior pole. This work done in this well characterized model of mRNA localization in Drosophila oocytes has broader implications for how the bidirectional transport of mRNAs is regulated in other polarized and highly differentiated cells, where very little is know about how mRNA transport direction might be regulated by opposing activities of kinesin and dynein motors. The strengths of this study are the integration of microscopy, biochemisty and genetic mutants to provide very nice experimental support for the two major aspects to the proposed model: 1) the competition between Staufen and Egl on oscar RNA which affects localization, 2) evidence for Egl mediated localization of staufen RNA into the oocyte as a key trigger for competitive displacement to bias localization of oscar RNA via kinesin. However, some additional experimental evidence is needed to solidify the conclusions and provide definitive support for this model, as discussed in other section.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      Some additional experimental evidence is needed to solidify the conclusions and provide definitive support for this model, as discussed below.

      Biochemical experiments using UV crosslinking and GFP immunoprecipitation followed by quantitative PCR were performed to show that Staufen antagonizes the association of Egl with oskar mRNA in vivo. -The authors need to show the quantitative analysis, which was not present in the figure, specifically the effects of Staufen RNAi compared to control.

      Is the ability of Staufen to antagonize and displace Egl dependent on Staufen binding to Oscar RNA? Will a Staufen mutant that can't bind to RNA also displace Egl? Alternatively, the mechanism may be independent of RNA binding and perhaps due to protein-protein interactions.

      A key question addressed is how does Staufen play a role in directing Oscar RNA localization to the posterior pole. The spatiotemporal control of Staufen at stage 9 seems to be a critical step. A number of experiments are performed to show that Staufen RNA enters the oocyte and accumulates to anterior pole through a process dependent on Egl (Fig. 7). -Definitive evidence is needed to show the role of 3'UTR of Stau and Egl binding. As it stands now, no evidence is presented to prove that delivery of staufen RNA via Egl, rather than dumping of Staufen protein into oocytes is the necessary trigger for the switch. It is well known that Staufen protein is also transported through ring canals to deliver Staufen into oocytes. There is no need to invoke an additional mechanism of Egl mediated staufen mRNA delivery. A key experiment is to perturb the Egl interaction with staufen 3'UTR and show this is a necessary component to impact oscar. Related to this comment, they should first perform biochemistry IP and PCR to demonstrate association of Egl with staufen RNA, and then somehow perturb this interaction to assess effects on oscar RNA localization. For example, is the 3'UTR of staufen RNA necessary for this mechanism? What if staufen RNA was ectopically localized in some inappropriate manner, for example localized to posterior pole? Would this prevent the switch of oscar RNA to move to posterior pole? The key question is: is it necessary that translation of Stau be coupled to Egl in order to drive the switch.

      Minor comments

      "Substantially more oskar mRNA was co-immunoprecipitated with Egl-GFP f rom extracts of egg-chambers expressing staufen RNAi compared t o t he control (Fig 3G). -This data is not shown in 3G, but rather only in Fig. S4H which needs quantitative analysis shown.

      "Addition of recombinant Staufen to the Egl, BicD, dynein and dynactin assembly mix significantly reduced the number of oskar mRNA transport events (Fig. 2A and B)."

      -In Fig. 2A, the Y axis shows velocity not number of transport events

      Fig. 3. - This is very unclear figure as to what is being shown. More details are needed to explain the figure, and add arrows to help reader note what is being described.

      Staufen may also be required for the efficient release of the mRNA from the anterior cortex. This may reflect a role of Staufen in the coupling of the mRNA to the kinesin-dependent posterior transport pathway. This could be discussed as another aspect of the inhibition of dynein and handoff to kinesin.

      Significance

      This elegant manuscript by Gaspar et al provides new insight into the spatiotemporal regulation of Staufen mediated localization of oscar mRNA to the posterior pole in Drosophila oocytes. Here the authors demonstrate the competitive displacement of the RNA binding protein Egalitarian, which antagonizes dynein dependent localization at the anterior pole. This work done in this well characterized model of mRNA localization in Drosophila oocytes has broader implications for how the bidirectional transport of mRNAs is regulated in other polarized and highly differentiated cells, where very little is know about how mRNA transport direction might be regulated by opposing activities of kinesin and dynein motors. The strengths of this study are the integration of microscopy, biochemisty and genetic mutants to provide very nice experimental support for the two major aspects to the proposed model: 1) the competition between Staufen and Egl on oscar RNA which affects localization, 2) evidence for Egl mediated localization of staufen RNA into the oocyte as a key trigger for competitive displacement to bias localization of oscar RNA via kinesin. However, some additional experimental evidence is needed to solidify the conclusions and provide definitive support for this model, as discussed in other section.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      In this manuscript, Gáspár et al. investigated the molecular mechanisms underlying the switching of motors for osk mRNA transport in the Drosophila ovary: from dynein in the nurse cells to kinesin-1 in the oocyte. They demonstrated that it requires two RNA-binding proteins, Egalitarian (Egl) and Staufen (Stau) to achieve the posterior localization of osk mRNA in the oocyte. Their data show that Egl is responsible for the stau mRNA transport into the oocyte, while Stau protein inhibits Egl-dependent dynein transport in the oocyte. Thus, they proposed a feed-forward mechanism in which Egl transports mRNA encoding its own antagonist Stau into the oocyte and thus achieves the switch of the osk mRNA transport from dynein to kinesin-1.

      The antagonistic interaction between Egl and Staufen is well documented both in vitro and in vivo. All the results are carefully analyzed, but the data presentation is not reader-friendly. Overall, our main concern is about the role of Staufen in osk mRNA transport.

      Here are specific points:

      (1)According to the model, lack of Stau should result in failure of displacing Egl from the RNP complex and thus more dynein-driven transport in the oocyte. However, the increase of minus-end run length in stau-RNAi is very small (Figure 1E). It makes us wonder whether Stau is not a dominant inhibitor of Egl/dynein transport of osk RNPs. On the other hand, the speed increase of minus-end run in stau-RNAi is more dramatic than the run length (Figure 1D-1E). Does it mean that in stau-RNAi dynein-driven osk transport has a shorter duration of run? Additionally, in Figure 1D, there is a statistically-significant increase of plus-end-directed transport velocity in stau-RNAi. While the author did mention that in the results "analysis of the speed and length of oskar RNP runs in ooplasmic extracts indicated that Khc activity was not compromised upon staufen knock-down", it does not explain the increased velocity towards the plus-end.

      (2)What happened to osk mRNP transport in nurse cells with Staufen overexpression? The authors briefly mentioned that "GFP-Staufen overexpression has no major effect on the localization of oskar (Fig S1F-I)" on page 10. This is quite puzzling, as the authors propose that Staufen antagonized the Egl/dynein-driven transport. If the model holds true, we would expect to see that overexpression of Staufen causes less osk transport in nurse cells and thus less osk accumulated in the oocyte. Can the authors examine the osk mRNP transport in nurse cells in control and in GFP-Staufen overexpressing mutant and quantify the total amount of osk mRNA in the oocyte in control and after GFP-Staufen overexpression?

      (3)Is osk mRNP transport in the nurse cells affected by stau-RNAi? The authors showed the Khc association with oskar mRNPs in the nurse cells in Figure 1C. We hope they could quantify the velocity and run length of the osk mRNP particles in nurse cells and compare control with stau-RNAi.

      (4)The kymograms of in vitro motility assays (Figure 2A and Figure S2) clearly showed two different moving populations, fast and slow. Did the authors include both types of events in their quantifications? What are the N numbers for each quantification? What do the dots mean in Figure 2B-2G? Does each dot represent a single track in the kymograph? If so, we believe that the sample sizes are too small for in vitro motility assay.

      (5)The in vitro motility assay showed that Staufen impairs dynein-driven transport of osk 5'-UTR (Figure 2). Based on these data, it is unclear whether the effect of Staufen is osk mRNA-dependent or Egl-dependent. We suggest performing the motility assay in the absence of osk 5'-UTR and Egl. Dynein, dynactin, and BicD should be sufficient to constitute the processive dynein complex in vitro. The addition of Staufen to the dynein complex will help to understand whether Staufen could directly affect dynein activity. We bring up this point because we noticed that the Staufen displacement of Egl in osk RNPs does not alter the amount of dynein complex associated (Figure 6), implying that Staufen inactivates dynein activity on the RNP complex, independently of Egl-driven dynein recruitment.

      (6)In Figure 4, it is hard to see any colocalization between GFP and osk mRNA. And the authors compared overexpressed Egl-GFP (driven by mat atub-Gal4 in mid-oogenesis) with Staufen-GFP under its endogenous promoter. An endogenous promoter-driven Egl-GFP would be much more appropriate for the comparison.

      (7)In a recent publication (Mohr et al., 2021), a different model was proposed, in which Egl mediates transport, and Staufen facilitates the dissociation from the transport machinery for posterior anchoring. Although the authors referred to their paper in the discussion, they should acknowledge the differences and try to reconcile it (at least in the discussion).

      (8)In the feed-forward model, Egl is required for the staufen mRNA transport from the nurse cells to the oocyte. Are Egl-GFP dots colocalized with staufen mRNAs in the nurse cells? Furthermore, to our understanding, in this model, the translation of the staufen mRNA would be critical for the switching motors between dynein and kinesin-1. In this sense, staufen mRNA translation is either suppressed in the nurse cells or only activated in the oocytes. I think the authors should at least address this point in the discussion.

      Minor points:

      1)I hope the authors would show the osk mRNA localization in egl mutant in in individual stage 9 egg chambers. I can only find the osk mRNA in egl-RNAi early stage egg chambers (Figure 7E), in which osk mRNA still shows an accumulation in the oocyte, although to a much lesser extent compared to control. In another publication (Sanghavi et al., 2016), it seems that the knockdown of Egl by RNAi causes some retention of osk mRNA in the nurse cells; but there are still noticeable amount of osk mRNA in the oocyte (Figure 3A-B). We wonder whether the authors could quantify the amount of osk mRNA both in the nurse cells and in the oocyte of control and egl-RNAi. Also I wonder whether the authors could comment on fact that some osk mRNA transported into the oocyte. Could it be due to an egl-independent transport mechanism?

      2)It is always nice to how the average distribution of osk mRNA (e.g., Figure 3, Figure S1, and Figure S3). But we recommend having a representative image of each genotype (a single egg) next to the average distribution. It will help the readers to better appreciate the differences among these genotypes.

      3)The figure legends are overall hard to read and sometimes impossible to get information about the experiments (for example, Figure 4 legend). Can the authors improve their figure legends making them reader-friendly?

      4)For moderate overexpression, the authors used P{matα4-GAL-VP16} (FBtp0009293). However, there are two different transgenic lines associated with FBtp0009293 (V2H and V37), which have slightly different expression levels. The authors should specify which line they used in the experiments.

      5)On page 13 "PCR on egg-chambers co-expressing Egl-GFP and either staufen RNAi or a control RNAi (white) in the germline (Fig 3G)", it should be Figure 4G.

      Significance

      see above

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary:

      It is well established that localization of oskar (osk) RNA in the Drosophila ovary proceeds in multiple steps. The first step depends upon dynein and results in delivery of osk into the oocyte. The second step involves kinesin-driven transport of osk to the oocyte posterior pole. The manuscript by Gáspár et al brings together several lines of evidence that support an antagonistic relationship with respect to motor binding between two osk-interacting proteins, Egalitarian (Egl) and Staufen (Stau). As staufen RNA and protein accumulate in the oocyte, Egl dissociates from osk, down-regulating dynein and enabling the second stage of osk transport to begin.

      Major comments:

      In general the experimental results support the conclusions drawn, and the paper includes a strong mix of in vitro and in vivo approaches. Nevertheless I have a few concerns.

      (1)In Fig 1D it is apparent that stau KD increases the speed of both plus-end and minus-end runs to a highly significant degree, not just minus-end runs. The stimulating effect of loss of Stau on speed of plus-end runs is not mentioned in the text, and it perhaps muddies the argument that Stau is simply a negative regulator of dynein-dependent minus-end directed transport. This result needs to be explicitly discussed in the text.

      (2)I recognize the importance of quantitative imaging to rigorously measure small differences in localization patterns. Nevertheless I find the data in Fig 3 extremely difficult to interpret. Presumably there is standard deviation everywhere there is green signal, but the magenta signal that corresponds to SD is not visible in most places that are green. I suggest adding to Fig 3 a single representative image for each genotype to illustrate each localization pattern, as well as a much clearer explanation of the quantitative imaging data. Perhaps the quantitative images could be moved to a supplemental figure.

      Minor comments:

      (1)Color/density scales should be added to Figs 1A and S1A, otherwise the yellow/white signal at the posterior could be interpreted as something other than high abundance.

      (2)In Fig 4A and 4C, I find it odd to have different halves of images photographed under different intensity settings and would prefer duplicate whole images.

      (3)The references to Fig 3G on page 13 should be corrected to Fig 4G.

      Significance

      The paper represents a substantial advance over existing knowledge and it extends our understanding about how RNAs can shuttle between different motor proteins to achieve a localized pattern. However, the Mohr et al 2021 PLoS Genetics paper covers some of the same ground. As that paper has now been published for several months, I believe a revised version of this paper should discuss that other work more prominently, making it apparent where the two studies concur and where this study extends the conclusions of the other one. If there are any contradictions between the two, those should be made explicit as well.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Response to Reviewer Comments

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      Summary:

      In developing systems, morphogens gradients pattern tissues such that cells along the patterning length sense varying levels of the morphogen. This process has a low positional error even in the presence of biological noise in numerous tissues including the early embryo of the Drosophila melanogaster. The authors of this manuscript developed a mathematical model to test the effect of noise and mean cell diameter on gradient variability and the positional error they convey.

      They solved the 1D reaction-diffusion equation for N cells with diameters and kinetic parameters sampled from a physiologically relevant mean and coefficient of variation (CV). They fit the resulting morphogen gradients to a hyperbolic cosine profile and determined the decay length (DL) and amplitude (A) for a thousand independent runs and reported the CV in DL and A.

      The authors found that CV in DL and A increases with increase in mean cell diameter. They propose a mathematical relationship between CV in DL scales as an inverse-square-root of N. Whereas the CV in DL and A is a weak function of CV of cell surface area (CVa) if CVa __They further looked at the shift in readout boundaries and compared four different readout metrics: spatial averaging, centroid readout, random readout and readout along the length of the cilium. Their results show that spatial averaging and centroid have a high readout precision.

      They finally showed that the positional error (PE) increases along the patterning length of the tissue and increases with increasing mean cell diameter.

      The authors also supported their theoretical and simulated results by looking at mean cell areas reported for in patterning tissues in literature which also have a higher readout precision with smaller cell diameters.

      Major comments:

      Most of the key conclusions are convincing. However, there are four major points that should be addressed. First, the authors conclude the section titled, "The positional error scales with the square root of the average cell diameter," by saying that morphogen systems with small cells can have high precision in absolute length scales, but not on the scale of one cell diameter. They state this would result in salt and pepper patterns in the transition zones. The authors should either support this with biological examples or explain why this is not observed experimentally.

      We thank the referee for pointing out this imprecise comment, which we have removed. The exact nature of transition zones between patterning domains is a subject of ongoing research in our group, and goes beyond the scope of the present work. We will be sharing our results on this aspect in a separate forthcoming publication.

      Second, perhaps the main conclusion of the paper is that morphogen gradients pattern best when the average cell diameter is small. The authors support this by reviewing the apical cell area of epithelial systems that are known to be patterned by morphogens and those that are not (presumably taking apical cell area as a proxy for cell diameter). However, the key parameter is not absolute cell diameter, but the cell diameter relative to the morphogen length scale. The authors should report the ratio of these two quantities in their literature analysis.

      Since cell areas and cell diameters are monotonically increasing functions of one another for reasonably regular cell shapes, we indeed consider apical cell areas as proxies for the cell diameter, as the referee correctly noted. Cell areas are more frequently reported in the literature than cell diameters, which is why we compiled these in our analysis.We have now revised our analysis of the effect of the cell diameter on patterning precision to further length scales relevant in the patterning process. We show by example of the Drosophila wing disc how the parallel changes in cell diameter and morphogen source size compensate for the increase in gradient length and domain size, which would otherwise reduce patterning precision over time as the readout positions shift away from the source to maintain the same relative position in the growing wing disc.

      Lamentably, accurate measurements of morphogen gradients in epithelial tissues are still rare. In fact, among the listed tissues that are patterned by gradients, we are only aware of measurements of the SHH and BMP gradients in the mouse NT (lambda = 20 µm) and of the Dpp gradients in the Drosophila wing and eye discs [Wartlick, et al., Science, 2011 & Wartlick et al., Development, 2014]. We agree that it would be great if experimental groups would measure this in more tissues. In this revised and extended analysis, we show that the positional error increases with the cell diameter in absolute terms, not only relative to any reference length, be it the gradient length or cell diameter.

      Third, as part of their literature analysis, the authors state that in the Drosophila syncytium, there are morphogen gradients, but they imply that because these gradients operate prior to cellularization, one cannot use the large distances between nuclei as counter evidence to their main conclusion. Rather than simply dismissing the case of the Drosophila syncytium, the authors should explain why this case does not apply, using reasoning based on their model assumptions.

      Our paper is concerned with patterning of epithelia (which we now make clearer in the manuscript), and we would not want to stretch our paper to other tissue types, as the reaction-diffusion process in them differs. But we do not share the referee’s sentiment that the syncytium would present a counter-example. Since our model explicitly represents kinetic variability between spatial regions bounded by cell membranes, which are absent in the syncytium, our model is not directly applicable to it. We now provide this argument in the discussion, as requested by the referee.

      At 100 µm [Gregor et al., Cell, 2007], the Bicoid gradient is 5 times longer than the SHH/BMP gradients in the mouse neural tube and more than 10 times the reported length of the WNT gradient in the Drosophila wing disc [Kicheva et al., Science, 2007]. The nuclei become smaller as they divide because the anterior-posterior length of the Drosophila embryo remains about 500 µm [Gregor et al., Cell, 2007], but even at the earliest patterning stage their diameter will not be larger than 10 µm at midinterphase 12 [Gregor et al., Cell, 2007, Fig. 3A].

      Fourth, related to the above: the authors then state that there are no morphogen gradients known during cellularization. Unless I am misunderstanding their point, this is untrue. The Dpp gradient acts during the process of cellularization and specifies at least three distinct spatial domains of gene expression. Furthermore, not long after gastrulation, EGFR signaling patterns the ventral ectoderm into at least two distinct domains of gene expression. What are the cell areas in that case?

      Unfortunately, the referee does not provide literature references, and we were not able to find anything in the literature ourselves. We have now rephrased the statement to “we are not aware of morphogen gradient readout during cellularisation”.

      Minor comments:

      Figs 1cd:

      The way the system is set-up: (DL = 20 micron, Patterning Length (LP) = 250 micron, Nominal cell diameter (D) = 5 micron) the DL/L ~ 0.08 which makes the exponential profile far to a small value around 100 micron. This means in all these simulations, the LP was only around 100 micron, cells beyond that saw nearly zero concentration.

      Because of this, when diameters were varied from 0.2 - 40 micron, there could be as few as 2.5 cells in the "patterning region" which could be responsible for higher variability in DL and A.

      Patterning in the neural tube works across several 100 µm. At x=100µm, there is still exp(-5)=0.0067 of the signal left, which likely well translates into appreciable numbers of the morphogen molecule (see [Vetter & Iber, 2022] for a discussion of concentration ranges cells might sense). Unfortunately, very little is known about absolute morphogen numbers in the different patterning systems — experimental data is available only on relative scales, not in absolute nu mbers. While more quantitative experiments are still outstanding, modeling work needs to be based on reasonable assumptions. The seemingly quick decay of exponential profiles (when plotted on a linear scale) can be deceiving. In fact, exponential profiles describe the same fold-change over repeated equal distances, which makes them biologically very useful for different readout mechanisms operating on different levels of morphogen abundance. Our simulations are not limited to a patterning length of 100µm. Our work merely shows that variable exponential gradients stay precise over a long distance. We draw no conclusion on whether cells are able to interpret the low morphogen concentrations that arise far in the patterning domain - this aspect certainly deserves further research.

      The referee’s observation is correct in that for a cell diameter of up to 40 µm, there are only few cells in the patterning domain (namely down to about six, for a length of 250µm, as used in the simulations). It is also correct that this is the reason why gradients in such a tissue have greater variability in lambda and C0. This is precisely the main point we are making in this study: The narrower the cells in a tissue of given size, the less variable the morphogen gradients, and the more accurate the positional information they carry. Conversely, the wider the cells in x direction, the more variable the gradients.

      Would any of the results change if DL/L was higher, around 0.2?

      As we consider steady state gradients, nothing changes if we fix the (mean) gradient decay length and only shorten the patterning domain, except for a small boundary effect at the far end of the tissue due to zero-flux conditions applied there. At a fixed gradient length, the steady-state gradients just extend further if DL/L is increased (for example to 0.2), reaching lower concentrations, but the shape remains unchanged, and so does the morphogen concentration at a given absolute readout position.

      To demonstrate what happens at DL/L = 0.2, as requested by the referee, we repeated simulations with an increased gradient decay length of DL=50 micrometers; the length of the patterning domain remained unchanged at L=250 micrometers. As it is not possible to include image files in this response, we have made the plots available at https://git.bsse.ethz.ch/iber/Publications/2022_adelmann_vetter_cell_size/-/blob/main/revision_increased_dl.pdf for the time of the reviewing process. The plots show the resulting gradient variability, which is analogous to Fig 1c,d in the original manuscript. For both gradient parameters, we still recover the identical scaling laws.

      The source region is 25 microns in length and all cell diameters above 25 micron get defaulted back to 25 micron which explains the flatness lines in the region beyond mu_delta/mu_DL> 1

      Thanks for pointing this out. We now mention this in the manuscript. Note that it’s the ratio mu_delta/L_s that matters, not mu_delta/mu_lambda. It just so happens in this case, that both are nearly equal, because L_s=5*mu_lambda/4 in our simulations.

      Results:

      Pg 2 (bottom left): In the git repository code, the morphogen gradients are fit to a hyperbolic cosines function (described in reference 19) which is not described in the main text. Having this in the main text would help readers understand why fig 1c has variation in d only, D only and all k parameters whereas fig 1d has variation with all individual parameters p, d and D and all k.

      The reason why the impact of CV_p alone on CV_lambda is not plotted in Fig 1c is that it is minuscule. We now mention this in the figure legend. This follows from the fact that the gradient length lambda is determined in the patterning domain, whereas the production rate p sets the morphogen concentration in the source domain, and thus, the gradient amplitude, but not its characteristic length. This is unrelated to the functional form used to fit the shape of the gradients, be it exponential or a hyperbolic cosine. We mention that we fit hyperbolic cosines to the numerical gradients in section Gradient parameter extraction in the Methods section, and we refer the interested reader to the original reference [Vetter & Iber, 2022], which contains all mathematical details, should they be needed.

      Figure 3b:

      In figures where markers are overlapping perhaps the authors can use a "dot" to identify one set of simulations and a "o" to identify the ones under it. The way the plots are set up currently makes it hard for the reader to understand where certain points on the plot are.

      We use a color code to represent the readout strategy and different symbols to represent the cell diameter in Fig 3b. We agree that for the smallest of the cell diameters, the diamond-shaped data points lie so close that they are not easy to tell apart at first sight. For this reason, we chose different symbol sizes. We would like to keep the symbols as they are to maintain visual consistency with the other figures, which we think is an important feature of our presentation that facilitates the interpretation. Note that all our figures are vector graphics, which allow the reader to zoom in arbitrarily deep, and to easily distinguish the data points. Note also that in this particular case, telling the data points apart is not necessary; recognizing that they are nearly identical is sufficient for the interpretation of our results.

      Methods:

      The Methods can be more descriptive to include certain aspects of the simulations such as adjusted lambda which is only described in the code and not the main text or supplementary.

      We apologize for this omitted detail. As shown in Fig. 8g in [Vetter & Iber, 2022], the mean fitted value of lambda drifts away from the prescribed value, depending on which of the kinetic parameters are varied, and by how much. To report the true observed mean gradient length in our results, we corrected for this drift in our implementation, as the referee correctly noticed. We now describe this in the methods section, and we have extended the methods also on other aspects.

      Git code:

      The git code function handles do not represent figure numbers and should be updated to make it easier for readers to find the right code

      Thank you for pointing this out — it was an oversight from an earlier preprint version. The function names now correspond to the figure numbers.

      Reviewer #1 (Significance (Required)):

      This manuscript contributes certain key aspects to the patterning domain. The three most important contributions of this work to the current literature are: (1) the scaling relationships developed here are important, (2) the idea that PE increases at the tail-end of the morphogen profile is nicely shown and (3) Comparison of various readout strategies.

      Thank you for the positive assessment.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      Summary:

      How morphogen gradients yield to precise patterning outputs is an important problem in developmental biology. In this manuscript, Adelmann et al. study the impact of cell size in the precision of morphogen gradients and use a theoretical framework to show that positional error is proportional to the square root of cell diameter, suggesting that the smaller the cells in a patterning field, the more precise patterns can be established against morphogen gradient variability. This result remains true even when cells average the morphogen signal across their surface or spatial correlations between cells are introduced. Thus, the authors suggest that epithelial tissues patterned by morphogen gradients buffer morphogen variability by reducing apical cell areas and support their hypothesis by examining several experimental examples of gradient-based vs. non-gradient-based patterning systems.

      Major comments:

      While the idea that smaller cells yield to more precise morphogen gradient outputs is attractive, it is unclear whether patterning systems use this strategy to make patterns more precise, as there are several mechanisms that could achieve precision. Do actual developmental systems use it as a mechanism to increase precision? Or precision is achieved through other mechanisms (for example, cell sorting as in the zebrafish neural tube; Xiong et al. Cell, 2013). Indeed, classical patterning work on Drosophila embryo suggest that segmentation patterns are of an absolute size rather by an absolute number of cells (Sullivan, Nature, 1987). According to the authors, the patterning stripes should be more precise when embryos have higher cell densities than in the wild-type, but stripes are remarkably precise in wild-type embryos. This is likely due to other precision-ensuring mechanisms (such as downstream transcriptional repressors, in this case).

      We want to emphasize that our predictions concern the precision of the gradients, not the precision of their readout, which can be strongly affected by readout noise, as we will show in a forthcoming paper. Cell sorting can sharpen boundaries in the transition zone, but this would not address errors in target domain sizes and is thus different from gradient precision as we discuss it here. Also, cell sorting as observed in the zebrafish neural tube requires higher cell motility than what is observed in most epithelial tissues. The work by Sullivan, Nature, 1987, is concerned with patterning of the early Drosophila embryo, and the stripes are defined already before cellularisation. We are unfortunately not aware of any work that quantified gradient precision at different cell densities in epithelia. This would, of course, be highly interesting data and would indeed put our predictions to a test. We are, to the best of our knowledge, the first to propose this principle with the present work. We have now made these points and distinctions clearer in the revised manuscript. Thank you for bringing this up.

      Their modeling approach is based on exponential gradients formed by diffusion and linear degradation, but in reality, actual morphogen gradients are affected by receptor and proteoglycan binding and are likely not simply exponential and/or interpreted at the steady state. Do the main results of the manuscript hold even for non-exponential gradients or before they reach a steady state?

      We can confirm that our results also hold for non-exponential gradients, as they emerge for example when morphogen degradation is self-enhanced (i.e., non-linear). This result will be published in a follow-up study [BioRxiv: 10.1101/2022.11.04.514993], which we now cite in the concluding remarks in the revised manuscript.

      The analysis of pre-steady-state gradients lies outside of the scope of the present work, and so the question as to whether our results are applicable to them as well, remains to be answered in future research. We have added a comment on this to the discussion.

      In their Discussion section, the authors note that several patterning systems, such as the Drosophila wing and eye discs, show smaller cells near the morphogen source relative to other regions in the tissue. This observation suggests a prediction of the authors' hypothesis that can be tested experimentally. In the Drosophila wing and eye discs genetic mosaics of ectopic morphogen sources (such as Dpp) can (and have) been made. Therefore, one could predict that the patterning outputs in a region of larger cross-sectional areas will be more imprecise than in the endogenous source. Since this is a theoretical paper, it is understandable that authors are not going to make this experiment themselves, but I wonder if they can use published data to test this prediction or at least mention it in the manuscript to offer the experimental biology reader an idea of how their hypothesis can be tested experimentally.

      We appreciate that the referee would like to help us inspire the experimental community. Unfortunately, the problem with the proposal is that Dpp has been shown to result in a lengthening of the cells (and thus a smaller cell width) [Widmann & Dahman, J Cell Sci, 2009]. The Dpp gradient thus ensures a small cell width close to its source, which makes it virtually impossible to test this proposal experimentally in the suggested way. Nevertheless, we have added brief comments on potential experimental testing of our predictions to the discussion.

      Other comments:

      The Methods section should be expanded and should include more details about how authors consider cell size in their simulations. As presented, I believe that experimental biologists will not be able to grasp how the analysis was done.

      We have expanded on the technical details of our model in the methods section, in particular in relation to the cell size, as requested. To avoid being overly redundant with existing published descriptions of the modeling details [Vetter & Iber, 2022], we focus here on a description of what has not been covered already, and refer the interested reader to our previous publication. It is inevitable for any kind of work, be it theoretical or experimental, to be less accessible to experts in other disciplines, but we believe that the presentation of our results is independent enough of modeling aspects to be accessible to experimental biologists, too.

      Authors use adjectives such as 'little' as 'small' without a comparative reference. For example in the abstract, the authors say that apical areas "are indeed small in developmental tissues." What does "small" mean? This should be avoided throughout the text.

      We thank the referee for raising this point. Where appropriate, we changed the phrasing accordingly to clarify what the comparative reference is. We leave all sentences unchanged where the statement holds in absolute terms. Note that in the substantially revised analysis on the impact of the different length scales involved in the patterning process, we now explicitly show with simulation data and theory that the absolute positional error increases with increasing absolute cell diameter.

      Reviewer #2 (Significance (Required)):

      Overall, I believe that the manuscript is well written and deserves consideration for publication. However, authors should consider the points outlined above in order to make their manuscript more accessible and relevant to the developmental biology community.

      Thank you for the positive assessment.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      In their mansucript "Impact of cell size on morphogen gradient precision" the authors Adelmann, Vetter and Iber numerically analyse a one-dimensional PDE-based model of morphogen gradient formation in tissues in which the cell sizes and cell-specific parameters locally affecting the gradient properties are varied according to predefined distributions. They find that the average cell size has the largest impact on the variance of the gradient shape and the read-out precision downstream, while other factors such as details of the readout mechanism have markedly less influence on these properties. In addition they demonstrate that averaging gradient concentrations over typical cell areas induces a shift of the readout position, which however appears to be insignificant (~1% of the cell diameter) for typical parameters.

      Overall this manuscript is in very good shape already and tackles an interesting topic. I still would like the authors to address the comments below before I would recommend any publication. My main criticism pertains to some of the authors' derivations which, as I find, partly do deserve more detail, and to their conclusions about gradient readout precision.

      Thank you for the positive assessment.

      MAJOR COMMENTS

      p. 1, left column: The positional error of the readout position does not only depend on the variation of the gradient parameters, as suggested by the first part of the introduction. A very important factor is also the fluctuations due to random arrival of molecules to the promoters that perform the readout due to the limited (and typically low) molecule number. In fact, for positions very distant to the source of the gradient, this noise source is expected to be dominant over gradient shape fluctuations. Importantly, these fluctuations also arise for non-fluctuating, "perfect" gradient inputs if copy numbers of the morphogen molecules are limited (which they always are). This important contribution to the noise is neglected in the work of the authors. This is OK if the purpose is focusing on the origin and influence of the gradient shape fluctuations, but that focus should be clearly highlighted in the introduction, saying explicitly that noise due to diffusive arrival of transcription factors is not taken into account in the given work (see, e.g., Tkacik, Gregor, Bialek, PLoS ONE 3, 2008)

      In the present work, only precision of the gradients, but not the readout itself is studied. We have now mentioned this more explicitly in the introduction. We also acknowledge the fact that the readout itself introduces additional noise into the system. We are currently finishing up work that addresses exactly this subject, which is outside of the scope of the present paper.

      What may have led to misinterpretation of the scope of our work is that we called x_theta the readout position. x_theta defines the location where cells sense (i.e., read out) a certain concentration threshold, and is not meant to be interpreted as the location of a certain readout (a downstream transcription factor) of the morphogen. We have made this distinction clearer in the revised manuscript.

      p.1, right column: Why exactly are the parameters p, d, D assumed to follow a log-normal distribution? Such a distribution has been verified for cell size, but the rationale behind choosing it also for the named parameters should be explained, in particular for D. Why would D depend on local properties of the cell? Which diffusion / transport mechanism precisely is assumed here?

      The motivations for the used log-normal distributions for the kinetic parameters are the following:

      The morphogen production rates, degradation rates and diffusivities must be strictly positive. This rules out a normal distribution. The probability density of near-zero kinetic parameters must vanish quickly, as otherwise no successful patterning can occur. For example, a tiny diffusion coefficient would not enable morphogen transport over biologically useful distances within useful timeframes. This rules out a normal distribution truncated at zero, because very low diffusivities would occur rather frequently for such a distribution. Given the absence of reports on distributions for p, d, D from the literature, we chose a plausible probability distribution that fulfills the above two criteria and possesses just two parameters, such that they are fully defined by a mean value and coefficient of variation. This is given by a lognormal distribution. Our results are largely independent of the exact choice of probability distribution assumed for the kinetic parameters, under the constraints mentioned above. To demonstrate this, we have repeated a set of simulations with a gamma distribution with equal mean and variance as used for the lognormal distribution. Below are some simulation results for a gamma distribution with shape parameters a = 1/CV^2 and inverse scale parameter b = mu*CV^2 with CV = 0.3 as used in the results shown in the paper. As can be appreciated from these plots, the results do not change substantially, and our conclusions still hold. As we believe this information is potentially relevant for the readership of our paper, we have added this result and discussion to the supplement and to the conclusion in the main text.

      We assume extracellular, Fickean morphogen diffusion with effective diffusivity D along the epithelial cells, as specified by Eq. 2. We now state this more explicitly just below Eq. 2 in the revised manuscript. Cell-to-cell variability in the effective diffusivity may arise from effects that alter the effective diffusion path and dynamics along the surface of cells, which we do not model explicitly, but lump into the effective values of D. Such effects may include different diffusion paths (different tortuosities) or transient binding, among others.

      Moreover, is there any relationship between A_i and p_i, d_i and D_i, or are these parameters varied completely independently? If yes, is there a justification for that?

      The parameters are all varied independently, as written in the paragraph below Eq. 2 on the first page (“drawn for each cell independently”). To our knowledge there is no reported evidence for correlations between cell areas, morphogen production rates, degradation rates, or transport rates across epithelia, that we could base our model on. The choice of independent cell parameters therefore represents a plausible model of least assumptions made. Note that we explore the effect of potential spatial correlations in the kinetic parameters between neighboring cells in the section “The effect of spatial correlation”, finding that such correlations, if at all present, are unlikely to significantly alter our results.

      p. 2, right column, section on "Spatial averaging": First of all, how is "averaging" exactly defined here? Do the authors assume that the cells can perfectly integrate over their surface in the dimensions perpendicular to their height? If yes, then this should be briefly mentioned here. Secondly, the shift \Delta x calculated by the authors ultimately seems to trace back to the fact that the cells average over an exponential gradient, whose derivative also is exponential, such that levels further to the anterior from the cell center are higher (on average) than levels to the posterior of it. I suppose, therefore, that a similar calculation for linear gradients would not lead to any shift. If these things are true they deserve being mentioned in this part of the manuscript because they provide an intuitive explanation for the shift. Thirdly, in Fig. 2A the cell sizes seem exaggerated with respect to the gradient length. This seems fine for illustrative purposes, but if it is the case it should be mentioned. Also, I believe that this figure panel would benefit from showing another readout case where the average concentration e.g. in cell 1 maps to its corresponding readout position, in order to show that this process repeats in every cell. Moreover, it could be indicated that in the shown case C_\theta matches the average concentration in cell 2 at the indicated position.

      Spatial averaging is defined as perfect integration along the spatial coordinate over a length of 2r (which can generally be equal to, or smaller than, or larger than one cell diameter) as detailed in the supplementary material. In simulations, we use the trapezoid method for numerical integration to get the average concentration a cell experiences along its surface area perpendicular to their height.

      The reviewer is correct, that the shift is a consequence of averaging over an exponential gradient. The average of an exponential gradient is higher compared to the concentration at the centroid of the cell, thus the small shift. This is mentioned e.g. in the caption of Fig. S1, but also in the main text (“spatial averaging of an exponential gradient results in a higher average concentration than centroid readout”). We have now added this information also to the caption of Fig. 2. As pointed out correctly by the referee, linear gradients would not result in such a shift. A brief comment on this has been added to the revised manuscript.

      We now mention that the cell size is exaggerated in comparison to the gradient decay length for illustration purposes in the schematic of Fig. 2a, as requested.

      Unfortunately, we had a hard time following the reviewer’s final point. We show a specific readout threshold concentration, C_theta, in Fig. 2a. A cell determines its fate based on whether its sensed (possibly averaged) concentration is greater or smaller than C_theta. In the illustration, cells 1 and 2 sense a concentration greater than C_theta, and all further cells sense a concentration smaller than C_theta. Cell fate boundaries necessarily develop at cell boundaries (here; between cells 2 and 3, red). Additionally, the readout position for a continuous domain, where morphogen sensing can occur at an arbitrary point along the patterning axis, is shown (blue). This position can be different from the one restricted to cell borders. Thus, different readout positions in the patterning domain result from the two scenarios, which is what the schematic illustrates. Given that our illustration seems to go well with the other referees, we are unsure in what way it could be improved.

      As for the significance of the magnitude of the shift for typical parameters as calculated by the authors: I believe that it could be said more explicitly and clearly that under biological conditions the calculated shift overall seems insignificant, as it amounts to a small fraction of the cell diameter.

      We have made this more explicit in the text.

      Finally, and most importantly: The term "spatial averaging" can have a different meaning in developmental biology than the one employed by the authors. While the authors mean by it that individual cells average the gradient concentration over their area, in other works "spatial averaging" typically means that individual cells sense "their" gradient value (by whatever mechanism) and then exchange molecules activated by it, which encode the read-out gradient value downstream, between neighboring cells, in order to average out the gradient values "measured" under noisy conditions. The noise reduction effect of such spatial averaging can be very significant, as evidenced by this (incomplete) list of works which the authors can refer to:

      - Erdmann, Howard, ten Wolde, PRL 103, 2009

      - Sokolowski & Tkacik, PRE 91, 2015

      - Ellison et al., PNAS 113, 2016

      - Mugler, Levchenko, Nemenman, PNAS 113, 2016

      The main point, however, is that this is a different mechanism as the one described by the authors, and this should be clearly mentioned in order to distinguished them. I would therefore also advise the authors to make the section title more precise here, by changing "Spatial averaging barely affects ..." to "Spatial averaging across the cell area barely affects ..." for clarity.

      Most theory development has previously indeed been done with the syncitium of the early Drosophila embryo in mind. However, most patterning in development happens in epithelial (or mesenchymal) tissues, where spatial averaging via translated proteins is not as straightforward and natural as in a syncitium. In fact, a bucket transport of a produced protein from cell to cell would be difficult to arrange (as upon internalization, degradation would have to be prevented), be subject to much molecular noise, and be rather slow. Our paper is concerned with patterning in epithelia, which we have now stated more clearly in the manuscript.

      Regarding the section title: Our analysis does not only cover spatial morphogen averaging over the cell area, but it also includes averaging radii below (in the theory) and far above (in the theory and in the new Fig. 4c, previously 3c) half a cell diameter. With cilia of sufficient length r, epithelial cells could potentially average over spatial regions extending further than their own cell area, without need for inter-cellular molecular exchange between neighboring cells. This is the kind of spatial averaging we explored here. Restricting the section title to the cell area only would therefore be misleading. However, we agree with the referee that the distinction between different meanings of “spatial averaging” is important, and we now emphasize our interpretation and the scope of our work more in the revised text.

      p. 3, Figure 3: It would be good to highlight the fact that the colours in panel A correspond to the bullet colors in the other panels also in the main text.

      We now added this also in the main text.

      As to the comparison of different readout strategies: How exactly were the different readout mechanisms compared on the mathematical side? More precisely: How was the readout by the whole area matched (in terms of fluxes) to the readout at a single point, be it in the center of the cell or a randomly chosen point? How was it ensured that the comparison is done at equal footing?

      Our model considers that a cell can sense a single concentration even if it is exposed to a gradient of concentrations. Assuming the French flag model is correct, a cell must make a binary decision based on a sensed concentration in order to determine its fate. The different readout strategies are hypothetical and simplified mechanisms for how a cell could, in principle, detect a local morphogen signal. It is unclear to us what the referee is referring to when mentioning “matching in terms of fluxes”, as there are no fluxes involved in the modeled readout strategies. We make no assumption on the underlying biochemical mechanism that would allow cells to implement one of the strategies. The main goal of this analysis was to determine whether various different sensing strategies had a significant effect on the precision of morphogen gradients experienced by cells. To assure that we can compare the different mechanisms at equal footing, we simulated gradients and then calculated from each gradient the readout concentration in each cell and for each of the methods.

      p. 3, right column: "... similar gradient variabilities, and thus readout precision": Linking to comment 1 above, this is strictly speaking only the case when the only source of fluctuations in the readout is the gradient fluctuations. I would therefore leave this statement out.

      To avoid confusion, we have removed parts of the sentence. Thank you for pointing this out.

      p. 3, section on positional error (right column): In this part I had most troubles following the thoughts of the authors.

      First of all, the measure that the authors use for the positional error is sigma_x / mu_lambda, i.e. the standard deviation of the readout position relative to the gradient length. The question is whether this is the correct measure. It should be specified what the motivation for normalizing by mu_lambda is. In the end, one could argue, what the cells really do care about would be that the developmental process can assign cell fates with single cell precision, for which the other measure shown in Eq. (6) is the representative one. Now in contrast to the former measure, the latter actually increases with decreasing cell diameter.

      We thank the referee for raising this point, and acknowledge that we have not presented this aspect well enough. We have rewritten the entire section and the discussion about biological implications. Instead of normalizing with a constant mean gradient length in the formulas and figures, which has left room for misinterpretation, we now instead varied all relevant length scales in the patterning system, to determine the impact of each of them independently on the positional error. We now show that the positional error increases (to leading order) proportionally to the mean gradient length, the square root of the cell diameter, the square root of the location in the patterned tissue, and inversely proportional to the length of the source domain. We support these new aspects with new simulation data (Fig. 2E-2H, Fig. 3D-G, Fig. S5, Fig. S6). As the positional error is now reported in absolute terms, rather than relative to a particular length scale, the question of the relevant scale is addressed. We now show that the absolute positional error increases with increasing absolute cell diameter.

      We believe that this extension provides additional important insight into what affects the patterning precision. We thank the referee very much for motivating us to expand our analysis.

      Secondly, even when the former measure (sigma_x / mu_lambda) is employed, Fig. 3(D) shows that while it decreases with decreasing cell diameters, in the regime of small diameters the std. dev. of the readout position becomes larger than the average cell diameter, which actually would mean that cell fates cannot be assigned with single-cell precision. While the authors later report both quantities for specific gradients, it should be clarified beforehand which of the measures is the relevant one.

      This has now been addressed by considering absolute length scales as discussed at length in our answer to the previous point.

      Moreover, in the following derivations, mu_x is not properly introduced. What exactly is the definition of that quantity? Is it the mean readout position? If yes, it is not clear why exactly it would be interesting and relevant to the cell. This should be properly explained in a way that does not require the reader to look up further details in another publication.

      The referee is correct in that mu_x is the mean readout position. We apologize for not being clear enough on this, and have now defined this in the introduction together with the definition of sigma_x.

      At the end of this section the authors come back to the sigma_x / mu_delta measure again and indeed point out that it increases with decreasing mu_delta, which causes a bit of confusion because the initial part of the section only talks about the increase of the pos. error with mu_delta. Overall I find that this section should be rewritten more clearly. Right now it leaves the reader with the "take home message" that small cells are good because they lead to smaller pos. error, but when the--in my opinion--relevant measure (sigma_x/mu_delta) is employed the opposite is the case. This is confusing and unclear about the authors' intentions in that part.

      See the answer above. The “take-home message” is now reformulated in absolute terms regarding the effect of cell diameter, rather than relative to a certain choice of reference scale. Our new analysis revealed a new relative ratio that determines the positional error, mu_lambda/L_s. We now discuss this relative measure also regarding its biological significance. Once again, we thank the referee for pointing us at this source of confusion, the elimination of which allowed us to improve our analysis.

      __Finally, the authors could also supplement the numbers that they name for the FGF8 and SHH gradients by the known numbers for the Bcd gradient in Drosophila, which has been studied excessively and constitutes a paradigm of developmental biology. Here mu_delta ~= 6.5 um, while mu_lambda ~= 100 um, such that mu_delta/mu_lambda While we appreciate that most theoretical work has been done for syncytia, this paper is concerned with patterning of epithelia, which have different patterning constraints, as also explained in a reply further above. We now make the scope of our work clearer in the revised manuscript. But as the referee points out, the diameter of the nucleus relative to the gradient length is such that gradients can be expected to be sufficiently precise.

      p. 4, section on the effect of spatial correlation: Here the authors chose to order the kinetic parameters in ascending or descending order. Is there any biological motivation for that particular choice? Other types of correlations seem possible, e.g. imposing the rule that successive parameter values are sampled starting from the previous value, p_i+1 = o_i +- delta_i+1 where delta_i+1 are random numbers with a defined variance.

      In the simulations we go from zero correlation (every cell has independent kinetic parameters) to maximal correlation (every cell has the same parameters, resulting effectively in a patterning domain that consists of a single effective “cell”), see Fig. S3. Biologically plausible correlations in between these extremes should retain the same kinetic variability levels (same CVs) which we took from the measured range reported in the literature. We accomplish this by ordering the parameters after independently sampling the parameters for each cell from probability distributions with the desired CV. The motivation for this approach is that this produces a type of maximal correlation that still reflects the measured biological cell-to-cell variability, to demonstrate in Fig. S3, that even such a maximal degree of spatial correlation does not qualitatively alter our results. The kind of correlation that the referee suggests introduces a spatial correlation length that lies in between the extremes that we simulated. Since even for maximal correlation using the ordering approach, we find our conclusions to still apply, we have no reason to expect that intermediate levels of correlation would behave any differently.

      The idea brought forward by the referee effectively introduces a correlation length scale. We discuss this case in the paper, noting that the positional error will scale as x~N , where N is the number of cells sharing the same kinetic parameters. A correlation length scale will be proportional to N and will therefore simply uniformly scale the positional error accordingly, but will likely not reveal any new insight beyond that.

      Moreover, using the idea of the referee as an additional way to introduce correlation is difficult to realise in practice, as we need to recover the mean and variance of the kinetic parameters, while ensuring strict positivity for each of them. A simple random walk, as proposed, would not lend itself easily to achieve this without introducing a bias in the distribution, because negative values need to be prevented. As explained in a reply further above, an important feature of the kinetic parameters is that they are not too small to prevent the formation of a meaningful gradient, which is not straightforward to ensure with the proposed method.

      We acknowledge that there are different types of correlations conceivable, but we expect these correlations to lie between the two extremes that we present in the paper, which show no qualitative difference in the results.

      p.5, Discussion: "..., but with nuclei much wider than the average cell diameter". To be honest, I could not completely imagine what is meant with this sentence. Intuitively, it seems that the nuclei cannot be larger than the cells, but I suppose that some kind of special anisotropy is considered here? In any case, this should be made precise.

      The main tissues that are patterned by gradients are epithelia. Our paper focuses on such tissues. It is a well-known feature of pseudostratified epithelia that nuclei are on average wider than the cell width averaged over the apical-basis axis. Nature solves this problem by stacking nuclei above each other along the apical-basal axis, resulting in a single-layered tissue that appears to be a multi-layered stratified tissue when only looking at nuclei. For a schematic illustration of this, see Fig. 1 in [DOI: 10.1016/j.gde.2022.101916]. An image search for “pseudostratified epithelia” on Google yields a plethora of microscopy images. Right at the end of the quote recited by the referee, we also cite our own study [Gomez et al, 2021], which quantifies this in Fig. 5.

      Moreover, I find that the conclusion that morphogen gradients "provide precise positional information even far away from the morphogen source" goes to far based on the authors' work, precisely for the fact input fluctuations due to limited morphogen copy number, which can become detrimentally low far away from the source, are not considered, neither the timescales needed to both establish and sample such low concentrations far away from the source. While thus, according to the work of the authors, the fluctuations in the morphogen signal may be favorably small, these other factors are supposed to exert a strong limit on positional information. This conclusion therefore seems unjustified and should be toned down, or even better taken out and replaced by a more accurate one, which only focuses on the gradient shape fluctuations, not on the conveyed positional information.

      There is no evidence so far that morphogen gradient concentrations become too low to be sensed by epithelial cells, to the best of our knowledge. What we show is that the gradient variability between embryos remains low enough that precise patterning remains possible. Whether the morphogen concentration remains high enough to be read out reliably by cells is a subject that requires future research. Genetic evidence from the mouse neural tube demonstrates that the SHH gradient is still sensed at a distance beyond 15 lambda (SHH signalling represses PAX7 expression at the dorsal end of the neural tube) [Dessaud et al., Nature, 2007], where an exponential concentration has dropped more than 3-million-fold.

      As the referee correctly recites, we state that “morphogen gradients remain highly accurate over very long distances, providing precise positional information even far away from the morphogen source”. This statement is restricted to the positional information that the gradients convey, and does not touch potentially precision-enhancing or -deteriorating readout effects, nor does it concern the absolute number of morphogen molecules.

      Positional information goes through several steps. The gradients themselves convey a first level of positional information, by being variable in patterning direction, as quantified by the positional error. This is what we draw our conclusion about. This positional information from the gradients can then be translated into positional information further downstream, by specific readout mechanisms, inter-cellular processes, temporal averaging, etc. About these further levels of positional information, we make no statement.

      We therefore disagree that our conclusion is unjustified. In fact, we have phrased it exactly having the limited scope of our study in mind, making sure that we restrict the conclusion to the gradients themselves.

      MINOR COMMENTS

      - p. 1: "and find that positional accuracy is the higher, the narrower the cells".

      (This sentence, however, should be anyhow revised in view of major comment 5 above.)

      We have added “the”.

      - p. 4: "... with an even slightly smaller prefactor."

      We have removed “even”.

      Reviewer #3 (Significance (Required)):

      I believe that this work is significant to the community working on the theoretical foundations of morphogen gradient precision in developmental systems. The main interesting findings are that small cell diameters lead to smaller positional error (although the relevant measure should be clarified according to my comment no. 5), and that the gradient shape fluctuations are surprisingly robust with respect to the readout mechanism.

      Its limitations consist of the fact that the impact of small copy numbers on the readout and associated timescales are neglected, such that the findings of the authors on gradient robustness cannot be simply transferred by simple conversion formulas to readout robustness / positional information. Comment 5 goes hand in hand with this, as a different conclusion may emerge depending on how the relevant positional error measure is defined. This should be fixed by the authors as indicated in the main part of the report.

      Thank you for your assessment.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      In their mansucript "Impact of cell size on morphogen gradient precision" the authors Adelmann, Vetter and Iber numerically analyse a one-dimensional PDE-based model of morphogen gradient formation in tissues in which the cell sizes and cell-specific parameters locally affecting the gradient properties are varied according to predefined distributions. They find that the average cell size has the largest impact on the variance of the gradient shape and the read-out precision downstream, while other factors such as details of the readout mechanism have markedly less influence on these properties. In addition they demonstrate that averaging gradient concentrations over typical cell areas induces a shift of the readout position, which however appears to be insignificant (~1% of the cell diameter) for typical parameters.

      Overall this manuscript is in very good shape already and tackles an interesting topic. I still would like the authors to address the comments below before I would recommend any publication. My main criticism pertains to some of the authors' derivations which, as I find, partly do deserve more detail, and to their conclusions about gradient readout precision.

      MAJOR COMMENTS

      1 - p. 1, left column: The positional error of the readout position does not only depend on the variation of the gradient parameters, as suggested by the first part of the introduction. A very important factor is also the fluctuations due to random arrival of molecules to the promoters that perform the readout due to the limited (and typically low) molecule number. In fact, for positions very distant to the source of the gradient, this noise source is expected to be dominant over gradient shape fluctuations. Importantly, these fluctuations also arise for non-fluctuating, "perfect" gradient inputs if copy numbers of the morphogen molecules are limited (which they always are). This important contribution to the noise is neglected in the work of the authors. This is OK if the purpose is focusing on the origin and influence of the gradient shape fluctuations, but that focus should be clearly highlighted in the introduction, saying explicitly that noise due to diffusive arrival of transcription factors is not taken into account in the given work (see, e.g., Tkacik, Gregor, Bialek, PLoS ONE 3, 2008)

      2 - p.1, right column: Why exactly are the parameters p, d, D assumed to follow a log-normal distribution? Such distribution has been verified for cell size, but the rationale behind choosing it also for the named parameters should be explained, in particular for D. Why would D depend on local properties of the cell? Which diffusion / transport mechanism precisely is assumed here?

      Moreover, is there any relationship between A_i and p_i, d_i and D_i, or are these parameters varied completely independently? If yes, is there a justification for that?

      3 - p. 2, right column, section on "Spatial averaging": First of all, how is "averaging" exactly defined here? Do the authors assume that the cells can perfectly integrate over their surface in the dimensions perpendicular to their height? If yes, then this should be briefly mentioned here. Secondly, the shift \Delta x calculated by the authors ultimately seems to trace back to the fact that the cells average over an exponential gradient, whose derivative also is exponential, such that levels further to the anterior from the cell center are higher (on average) than levels to the posterior of it. I suppose, therefore, that a similar calculation for linear gradients would not lead to any shift. If these things are true they deserve being mentioned in this part of the manuscript because they provide an intuitive explanation for the shift. Thirdly, in Fig. 2A the cell sizes seem exaggerated with respect to the gradient length. This seems fine for illustrative purposes, but if it is the case it should be mentioned. Also, I believe that this figure panel would benefit from showing another readout case where the average concentration e.g. in cell 1 maps to its corresponding readout position, in order to show that this process repeats in every cell. Moreover, it could be indicated that in the shown case C_\theta matches the average concentration in cell 2 at the indicated position.

      As for the significance of the magnitude of the shift for typical parameters as calculated by the authors: I believe that it could be said more explicitly and clearly that under biological conditions the calculated shift overall seems insignificant, as it amounts to a small fraction of the cell diameter.

      Finally, and most importantly: The term "spatial averaging" can have a different meaning in developmental biology than the one employed by the authors. While the authors mean by it that individual cells average the gradient concentration over their area, in other works "spatial averaging" typically means that individual cells sense "their" gradient value (by whatever mechanism) and then exchange molecules activated by it, which encode the read-out gradient value downstream, between neighboring cells, in order to average out the gradient values "measured" under noisy conditions. The noise reduction effect of such spatial averaging can be very significant, as evidenced by this (incomplete) list of works which the authors can refer to:

      • Erdmann, Howard, ten Wolde, PRL 103, 2009
      • Sokolowski & Tkacik, PRE 91, 2015
      • Ellison et al., PNAS 113, 2016
      • Mugler, Levchenko, Nemenman, PNAS 113, 2016

      The main point, however, is that this is a different mechanism as the one described by the authors, and this should be clearly mentioned in order to distinguished them. I would therefore also advise the authors to make the section title more precise here, by changing "Spatial averaging barely affects ..." to "Spatial averaging across the cell area barely affects ..." for clarity.

      4 - p. 3, Figure 3: It would be good to highlight the fact that the colours in panel A correspond to the bullet colors in the other panels also in the main text.

      As to the comparison of different readout strategies: How exactly were the different readout mechanisms compared on the mathematical side? More precisely: How was the readout by the whole area matched (in terms of fluxes) to the readout at a single point, be it in the center of the cell or a ranomly chosen point? How was it ensured that the comparison is done at equal footing?

      p. 3, right column: "... similar gradient variabilities, and thus readout precision": Linking to comment 1 above, this is strictly speaking only the case when the only source of fluctuations in the readout is the gradient fluctuations. I would therefore leave this statement out.

      5 - p. 3, section on positional error (right column): In this part I had most troubles following the thoughts of the authors.

      First of all, the measure that the authors use for the positional error is sigma_x / mu_lambda, i.e. the standard deviation of the readout position relative to the gradient length. The question is whether this is the correct measure. It should be specified what the motivation for normalizing by mu_lambda is. In the end, one could argue, what the cells really do care about would be that the developmental process can assign cell fates with single cell precision, for which the other measure shown in Eq. (6) is the representative one. Now in contrast to the former measure, the latter actually increases with decreasing cell diameter.

      Secondly, even when the former measure (sigma_x / mu_lambda) is employed, Fig. 3(D) shows that while it decreases with decreasing cell diameters, in the regime of small diameters the std. dev. of the readout position becomes larger than the average cell diameter, which actually would mean that cell fates cannot be assigned with single-cell precision. While the authors later report both quantities for specific gradients, it should be clarified beforehand which of the measures is the relevant one.

      Moreover, in the following derivations, mu_x is not properly introduced. What exactly is the definition of that quantity? Is it the mean readout position? If yes, it is not clear why exactly it would be interesting and relevant to the cell. This should be properly explained in a way that does not require the reader to look up further details in another publication.

      At the end of this section the authors come back to the sigma_x / mu_delta measure again and indeed point out that it increases with decreasing mu_delta, which causes a bit of confusion because the initial part of the section only talks about the increase of the pos. error with mu_delta. Overall I find that this section should be rewritten more clearly. Right now it leaves the reader with the "take home message" that small cells are good because they lead to smaller pos. error, but when the--in my opinion--relevant measure (sigma_x/mu_delta) is employed the opposite is the case. This is confusing and unclear about the authors' intentions in that part.

      Finally, the authors could also supplement the numbers that they name for the FGF8 and SHH gradients by the known numbers for the Bcd gradient in Drosophila, which has been studied excessively and constitutes a paradigm of developmental biology. Here mu_delta ~= 6.5 um, while mu_lambda ~= 100 um, such that mu_delta/mu_lambda < 1/15, which defines yet another regime than the other two gradients. It would be interesting to compare their respective numbers altogether, and also discuss the ones for Drosophila in view of the fact that in experiments sigma_x ~= mu_delta for this species.

      6 - p. 4, section on the effect of spatial correlation: Here the authors chose to order the kinetic parameters in ascending or descending order. Is there any biological motivation for that particular choice? Other types of correlations seem possible, e.g. imposing the rule that successive parameter values are sampled starting from the previous value, p_i+1 = o_i +- delta_i+1 where delta_i+1 are random numbers with a defined variance.

      7 - p.5, Discussion: "..., but with nuclei much wider than the average cell diameter". To be honest, I could not completely imagine what is meant with this sentence. Intuitively, it seems that the nuclei cannot be larger than the cells, but I suppose that some kind of special anisotropy is considered here? In any case, this should be made precise.

      Moreover, I find that the conclusion that morphogen gradients "provide precise positional information even far away from the morphogen source" goes to far based on the authors' work, precisely for the fact input fluctuations due to limited morphogen copy number, which can become detrimentally low far away from the source, are not considered, neither the timescales needed to both establish and sample such low concentrations far away from the source. While thus, according to the work of the authors, the fluctuations in the morphogen signal may be favorably small, these other factors are supposed to exert a strong limit on positional information. This conclusion therefore seems unjustified and should be toned down, or even better taken out and replaced by a more accurate one, which only focuses on the gradient shape fluctuations, not on the conveyed positional information.

      MINOR COMMENTS

      • p. 1: "and find that positional accuracy is the higher, the narrower the cells".

      (This sentence, however, should be anyhow revised in view of major comment 5 above.)

      • p. 4: "... with an even slightly smaller prefactor."

      Significance

      I believe that this work is significant to the community working on the theoretical foundations of morphogen gradient precision in developmental systems. The main interesting findings are that small cell diameters lead to smaller positional error (although the relevant measure should be clarified according to my comment no. 5), and that the gradient shape fluctuations are surprisingly robust with respect to the readout mechanism.

      Its limitations consist of the fact that the impact of small copy numbers on the readout and associated timescales are neglected, such that the findings of the authors on gradient robustness cannot be simply transferred by simple conversion formulas to readout robustness / positional information. Comment 5 goes hand in hand with this, as a different conclusion may emerge depending on how the relevant positional error measure is defined. This should be fixed by the authors as indicated in the main part of the report.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Summary:

      How morphogen gradients yield to precise patterning outputs is an important problem in developmental biology. In this manuscript, Adelmann et al. study the impact of cell size in the precision of morphogen gradients and use a theoretical framework to show that positional error is proportional to the square root of cell diameter, suggesting that the smaller the cells in a patterning field, the more precise patterns can be established against morphogen gradient variability. This result remains true even when cells average the morphogen signal across their surface or spatial correlations between cells are introduced. Thus, the authors suggest that epithelial tissues patterned by morphogen gradients buffer morphogen variability by reducing apical cell areas and support their hypothesis by examining several experimental examples of gradient-based vs. non-gradient-based patterning systems.

      Major comments:

      1. While the idea that smaller cells yield to more precise morphogen gradient outputs is attractive, it is unclear whether patterning systems use this strategy to make patterns more precise, as there are several mechanisms that could achieve precision. Do actual developmental systems use it as a mechanism to increase precision? Or precision is achieved through other mechanisms (for example, cell sorting as in the zebrafish neural tube; Xiong et al. Cell, 2013). Indeed, classical patterning work on Drosophila embryo suggest that segmentation patterns are of an absolute size rather by an absolute number of cells (Sullivan, Nature, 1987). According to the authors, the patterning stripes should be more precise when embryos have higher cell densities than in the wild-type, but stripes are remarkably precise in wild-type embryos. This is likely due to other precision-ensuring mechanisms (such as downstream transcriptional repressors, in this case).

      2. Their modeling approach is based on exponential gradients formed by diffusion and linear degradation, but in reality, actual morphogen gradients are affected by receptor and proteoglycan binding and are likely not simply exponential and/or interpreted at the steady state. Do the main results of the manuscript hold even for non-exponential gradients or before they reach a steady state?

      3. In their Discussion section, the authors note that several patterning systems, such as the Drosophila wing and eye discs, show smaller cells near the morphogen source relative to other regions in the tissue. This observation suggests a prediction of the authors' hypothesis that can be tested experimentally. In the Drosophila wing and eye discs genetic mosaics of ectopic morphogen sources (such as Dpp) can (and have) been made. Therefore, one could predict that the patterning outputs in a region of larger cross-sectional areas will be more imprecise than in the endogenous source. Since this is a theoretical paper, it is understandable that authors are not going to make this experiment themselves, but I wonder if they can use published data to test this prediction or at least mention it in the manuscript to offer the experimental biology reader an idea of how their hypothesis can be tested experimentally.

      Other comments:

      • The Methods section should be expanded and should include more details about how authors consider cell size in their simulations. As presented, I believe that experimental biologists will not be able to grasp how the analysis was done.

      • Authors use adjectives such as 'little' as 'small' without a comparative reference. For example in the abstract, the authors say that apical areas "are indeed small in developmental tissues." What does "small" mean? This should be avoided throughout the text.

      Significance

      Overall, I believe that the manuscript is well written and deserves consideration for publication. However, authors should consider the points outlined above in order to make their manuscript more accessible and relevant to the developmental biology community.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary:

      • In developing systems, morphogens gradients pattern tissues such that cells along the patterning length sense varying levels of the morphogen. This process has a low positional error even in the presence of biological noise in numerous tissues including the early embryo of the Drosophila melanogaster. The authors of this manuscript developed a mathematical model to test the effect of noise and mean cell diameter on gradient variability and the positional error they convey.

      • They solved the 1D reaction-diffusion equation for N cells with diameters and kinetic parameters sampled from a physiologically relevant mean and coefficient of variation (CV). They fit the resulting morphogen gradients to a hyperbolic cosine profile and determined the decay length (DL) and amplitude (A) for a thousand independent runs and reported the CV in DL and A.

      • The authors found that CV in DL and A increases with increase in mean cell diameter. They propose a mathematical relationship between CV in DL scales as an inverse-square-root of N. Whereas the CV in DL and A is a weak function of CV of cell surface area (CVa) if CVa < 1.

      • They further looked at the shift in readout boundaries and compared four different readout metrics: spatial averaging, centroid readout, random readout and readout along the length of the cilium. Their results show that spatial averaging and centroid have a high readout precision.

      • They finally showed that the positional error (PE) increases along the patterning length of the tissue and increases with increasing mean cell diameter.

      • The authors also supported their theoretical and simulated results by looking at mean cell areas reported for in patterning tissues in literature which also have a higher readout precision with smaller cell diameters.

      Major comments:

      • Most of the key conclusions are convincing. However, there are four major points that should be addressed. First, the authors conclude the section titled, "The positional error scales with the square root of the average cell diameter," by saying that morphogen systems with small cells can have high precision in absolute length scales, but not on the scale of one cell diameter. They state this would result in salt and pepper patterns in the transition zones. The authors should either support this with biological examples or explain why this is not observed experimentally.

      • Second, perhaps the main conclusion of the paper is that morphogen gradients pattern best when the average cell diameter is small. The authors support this by reviewing the apical cell area of epithelial systems that are known to be patterned by morphogens and those that are not (presumably taking apical cell area as a proxy for cell diameter). However, the key parameter is not absolute cell diameter, but the cell diameter relative to the morphogen length scale. The authors should report the ratio of these two quantities in their literature analysis.

      • Third, as part of their literature analysis, the authors state that in the Drosophila syncytium, there are morphogen gradients, but they imply that because these gradients operate prior to cellularization, one cannot use the large distances between nuclei as counter evidence to their main conclusion. Rather than simply dismissing the case of the Drosophila syncytium, the authors should explain why this case does not apply, using reasoning based on their model assumptions.

      • Fourth, related to the above: the authors then state that there are no morphogen gradients known during cellularization. Unless I am misunderstanding their point, this is untrue. The Dpp gradient acts during the process of cellularization and specifies at least three distinct spatial domains of gene expression. Furthermore, not long after gastrulation, EGFR signaling patterns the ventral ectoderm into at least two distinct domains of gene expression. What are the cell areas in that case?

      Minor comments:

      • Figs 1cd:

      The way the system is set-up: (DL = 20 micron, Patterning Length (LP) = 250 micron, Nominal cell diameter (D) = 5 micron) the DL/L ~ 0.08 which makes the exponential profile far to a small value around 100 micron. This means in all these simulations, the LP was only around 100 micron, cells beyond that saw nearly zero concentration. Because of this, when diameters were varied from 0.2 - 40 micron, there could be as few as 2.5 cells in the "patterning region" which could be responsible for higher variability in DL and A.

      Would any of the results change if DL/L was higher, around 0.2?

      The source region is 25 microns in length and all cell diameters above 25 micron get defaulted back to 25 micron which explains the flatness lines in the region beyond mu_delta/mu_DL> 1

      Results:

      Pg 2 (bottom left): In the git repository code, the morphogen gradients are fit to a hyperbolic cosines function (described in reference 19) which is not described in the main text. Having this in the main text would help readers understand why fig 1c has variation in d only, D only and all k parameters whereas fig 1d has variation with all individual parameters p, d and D and all k.

      • Figure 3b:

      In figures where markers are overlapping perhaps the authors can use a "dot" to identify one set of simulations and a "o" to identify the ones under it. The way the plots are set up currently makes it hard for the reader to understand where certain points on the plot are.

      Methods:

      The Methods can be more descriptive to include certain aspects of the simulations such as adjusted lambda which is only described in the code and not the main text or supplementary.

      Git code:

      The git code function handles do not represent figure numbers and should be updated to make it easier for readers to find the right code

      Significance

      This manuscript contributes certain key aspects to the patterning domain. The three most important contributions of this work to the current literature are: (1) the scaling relationships developed here are important, (2) the idea that PE increases at the tail-end of the morphogen profile is nicely shown and (3) Comparison of various readout strategies.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Reviewer #1 (Evidence, reproducibility and clarity):

      Summary:<br /> The Authors report on the synthesis and characterization of a class of small molecules, the tanshinone mimics (TMs), which interfere with binding of the RNA binding protein (RBP) HuR to its mRNA targets. HuR is an important regulator of mRNA stability and translation of genes involved in key homeostatic (cell cycle, stress response) and pathologic process (inflammation, carcinogenesis). In particular, the first part of the study describes the compounds' chemical synthesis and some pharmacokinetic parameters (i.e., definition of molecular binding, solubility, bioavailability, prodrug generation etc). The second part undertakes, in in vitro and ex-vivo model of LPS-induced mouse macrophage activation, the identification of HuR-bound mRNA targets, which is then evaluated within the global LPS-induced transcriptome; finally, the study evaluates the ability of TMs to inhibit HuR-mediated proinflammatory gene regulation, indicating their use and potential value as therapeutic anti-inflammatory strategy.<br /> Major comments:<br /> The manuscript contains a wealth of data generated from different experimental systems, spanning from synthetic chemistry to preclinical models of gene regulation, requiring cultural backgrounds in chemistry and biology as well. The key conclusions are well supported by the data, but it takes a great effort to get to the core results and thus critically read and evaluate their interpretation. Although the complexity and sheer size of data sets generated lends itself to a hard read, this is further complicated by data presentation, which especially in the second part needs to be significantly improved to gain clarity and focus. For ease of referral, specific comments will be addressed related to Figures whenever possible.<br /> 1.1 • Page 15: To measure TM7nox disrupting ability of HuR:mRNA complex for the HTRF assay (Figure 2G) and for biotin pull down assay (Figure 5C), it was chosen a biotinylated probe containing the AU rich elements of the TNFα, as known HuR target. Please comment on the rationale, and whether could it be relevant reevaluate these parameters post-hoc, based on the sequences identified in HuR targets more susceptible of modulation by TM compound (listed in table 1, Figure 5 A/B) and based on the absence of regulation of TNFa (Figures 3D, 4D, 7A) found in the tested systems.

      R1.1 - We thank the reviewer for this observation. We have been using the biotinylated probe containing the AU-rich elements of TNFα as a representative probe for HuR for biochemical assays in several articles (PMID: 29313684, PMID: 26553968, PMID: 23951323). As the reviewer suggests, a posteriori, it is worth reevaluating the representative probe to be used for evaluating the disrupting ability of TMs based on the data we present here. Indeed, we will tackle this problem in our following efforts, as it is a meaningful although time-consuming task which is outside of the scope of this manuscript.

      1.2 • Page 16-18: Description of the RNAseq data shown in Figure 3 should be more centered around the main findings regarding the effect of TMnox that are further pursued in the study: that is, (Figure 3B), the 249 downregulated DEGs found modulated by TM7nox in presence of LPS, where was observed a strong enrichment of categories related to the inflammatory response: cytokines (Il1b, Cxcl10, Il10, Il19, Il33), immune cell chemotaxis (Ccl12, Ccl22, Ccl17, Ccl6) and innate immune response.

      The description of the GO for the remaining data should be shortened to main points, perhaps reporting what described in the results with each section of the Venn in a table, while referring to the whole list in the supplements as already done. This could replace Figures 3D, E which do not add substantially to what provided in the supplementary table 2 and to which they can be added as further visualization.

      R1.2 - We thank the reviewer for this suggestion, accordingly, we simplified the text keeping only the description of the genes modulated by TM7nox during LPS treatment. The other information originally there was moved to Supplementary table 2. Revised figures 3E and 3F now focus only on the 249 downregulated genes of this group.

      1.3 • Page 18-19: Description of the results of the RIP-seq shown in Figure 4 set is very confusing: onward from the line "477 HuR-bound transcripts (log2 FC > 3) were also upregulated by LPS at the transcriptional level..." the numbers do not match or reconcile with those shown in the Venn diagram (Fig. 4B) nor with those listed in the figure legend of Figure S8.

      R1.3 - We agree with the reviewer, we apologize for having reported the wrong numbers, and we clarified this point in general by deeply revising the text. A more precise explanation of the selection procedure for the genes of interest is now reported and better explained also by adding a scheme (Fig 4D in the revised manuscript).

      1.4 Moreover, as previously remarked for Figure 3 (and even more for this dataset in which initial description of Venn in 4B is unclear), panel 4E does not add as much to the info provided in Table 1/supplementary Table 1, where they can eventually be added as further data visualization; Instead, Figure S8 displays very informative data merging together the results obtained in RNAseq (Fig. 3) and RIP-Seq (Fig.4) and should be displayed in Figure 4, as in the result section they are indeed presented together.

      R1.4 - We agree with this remark, thus we have removed the old panels 3E in S8C and 4E in S9B, and we now provide the information previously contained in old S8 in the main figure 4E of the revised manuscript.

      1.5 • Page 19-20: Description of the modulation by TM7nox of HuR binding to specific consensus sequences is summarized at the end of the relative paragraph as follows: "TM7nox reshapes HuR binding to target genes in presence of LPS by disrupting the binding of HuR towards target genes containing a lower number of HuR consensus sequences than the average observed in the HuR-bound transcripts". Understanding of these data through the provided text and the Supplementary Figure 9 is very laborious and referring of an entire dataset to a supplementary figure makes it even harder. It would be best to show this as main figure, not supplemental, either adding a Venn diagram as in 3B/4B showing to which dataset each part of the analysis refers, or even more efficaciously, extrapolate a representative gene set for the main analyses showing TM7nox activity in target genes with higher vs lower consensus sequences; same approach for the analysis in Figure 9B, where the effect on a gene with sequence #1 or #10 could be compared with one bearing sequence #3 for example.

      R1.5 - We agree with the reviewer, thus we moved the information of old S9 in figure 4C of the revised manuscript. We deeply revised the information provided also by taking into account the request to compare this experiment to the one in Lal et al. NAR 2017 (please see also R2.4). We made an effort to identify a subset of genes that follow a coherent modulation, identifying 82 genes highlighted in Supplementary Table 1. All such genes show increased expression during LPS or LPS/TMnox vs DMSO conditions, and decreased association to HuR during LPS/TMnox vs LPS. As 47 of these, i.e. more that 50%, contain less AU rich sequences than the average (highlighted in Supplementary Table 1), we can consider them as a representative gene ensemble modulated in accordance with the presence of AU rich sequences.

      1.6 • Page 21: Description of the effect of three TMs (TM6, TM7nox and TM7nred) on LPS response in macrophages at the single gene level (Figure 5 and Figure 6): TM6 and TM7nox were used in exps in Fig. 5 A and E, while only TM7nred was used for CXCL10 secretion analysis (fig.5 D and F): please describe the compound choices' rationale (as done for experiments in Figure 6).

      R1.6 – Following the reviewer suggestion, we now explain our rationale in choosing the small molecules, that is the use of the ones bearing the active quinone species. We have performed additional experiments, and now we report TM6n, TM7nox, and the control DHTS activity in decreasing the secretion of Cxcl10 (figure 5E in the revised manuscript). All compounds behave similarly in this experiment. TM7nred is now used to show its equivalence to TM7nox in figure 5E and in figure 6 of the revised manuscript.

      1.7 • Page 21-22: The effect on HuR expression of siRNA silencing and, more importantly, of TMs shown in Figure 6A, first panel, should be visualized at protein level by western blot. This is an important point as for CXCL10 and iL1b there seems to be an additive effect between decreased HuR levels and pharmacological blocking.

      R1.7 - Following the reviewer suggestion, we now show the protein level as measured by intracellular Elisa; as we were not able to detect the proteins by western blot. The protein level is in general agreement with the gene expression level. We do not observe an additive effect by pharmacological inhibition during HuR silencing, but we rather observe a slight increase in the protein level during HuR silencing. We do not have an explanation for this effect, which may depend on several reasons - for example, an aspecific effect of the TMs when their molecular target HuR is absent.

      1.8 • Page 24: please rephrase the statement 'These observations suggest the utilization of TMs in autoinflammatory and autoimmune diseases' as 'These observations suggest the evaluation of TMs in specific preclinical models for autoinflammatory and autoimmune diseases'.

      R1.8 - We fully agree with the reviewer, and we changed the text in the revised manuscript accordingly.

      1.9 • In the discussion, please include a paragraph with study limitation and possible biases (for example, the choice of RNP-IP without crosslinking has pros and cons).

      R1.9 – Thank you for the good suggestion, we added a paragraph in the discussion which describes study limitations due to the utilization of RNP-IP vs crosslinking.

      The data and the methods are correctly presented for reproducibility, replicates and statistical analysis are adequate. Minor comments: 1.10 • At least in the single gene validation experiments (Fig.5), a negative control (such as recombinant HuR with mutated RRMs in trans-, or ARE-less/non-HuR targetable sequence in cis, or inactive TM) would be advisable.

      R1.10- We thank the reviewer for the suggestion. Accordingly, we used an ARE-less/non-HuR targetable gene as RPLP0 for validation.

      1.11 • Figure 6B/C: for immunofluorescence panels, zooming on a smaller number of cells will render more visible HuR and NFkB nucleocytoplasmic shuttling, given that quantification and statistics are provided by imaging software. Negative control stainings (secondary Abs only) should be included.

      R1.11 – In accordance with this suggestion, we now report a higher magnification of the immunofluorescence images. We also report the standard DHTS effect, showing a difference vs TMnox activity which may suggest its impact on NFkB shuttling.

      1.12 • Figure 7A: in the X axis LPS+8n is indicated: is it a typo for LPD+6n or was compound TM8n indeed used?

      R1.12 – Thanks for your spotting our mistake, the prodrug 8 described in figure 1 was used.

      1.13 • In the Methods section please include protocols and materials for immunofluorescence (results shown in Fig. 6B/C).

      R1.13 – As for your suggestion, protocols and materials for immunofluorescence were added to the methods.

      1.14 • There are some typos and repetition in figure legends (legend Figure S9).

      R1.14- Thank you for this, we revised all the figure legends.

      Prior studies are referenced appropriately. Review Cross-commenting I fully agree with the Reviewer's remarks. I would add that a general concern expressed is that this manuscript in its present form has a readership issue: the first part is for chemistry/pharmacology audience, the second is biology-based. Splitting the work has been suggested; or, the Authors may decide which part is more impactful and present the other in a streamlined version.

      Reviewer #1 (Significance):

      This is a large study reporting progress in the development of synthetic antagonists of HuR function, which is the Authors' well-established line of research. The TM compounds are small molecules with anti-inflammatory effects with strong potential for therapeutic use due to selected inhibition of HuR-mediated upregulation of proinflammatory molecules. The physicochemical and early biological characterization done in this study will allow further testing of their efficacy and of the overall role of HuR-mediated regulation as targetable mechanism in several preclinical human disease models. Targeting of the RNA-binding protein HuR has been tackled as therapeutic approach in cancer, less in chronic immune and inflammatory diseases despite many common mechanisms and mediators. This study could be well received by researchers involved in basic science and drug development (chemistry, biochemistry/biophysics, pharmacology, computational modeling) and biologists/physician scientists interested in testing these compounds in translational research settings where HuR-driven functions can be relevant (cancer, chronic inflammation), though the chemical part would be less accessible to the latter audience. Reviewer's background is in preclinical human models of chronic inflammation with interest in posttranscriptional gene regulation with familiarity with RNAseq and RIPseq dataset and analysis. For the part of the manuscript regarding the synthesis and physicochemical characterization of the TN compound I requested assistance to a faculty from the chemistry department with expertise in that field, who did not request any specific clarification or addendum.

      Reviewer #2 (Evidence, reproducibility and clarity):

      In the manuscript entitled "HuR modulation with tanshinone mimics impairs LPS response in murine macrophages" the authors have described the synthesis and application of small molecule mimics of the naturally occurring compound tanshinone, which is known to inhibit the binding of the RBP HuR to a class of its mRNA targets. The authors have shown that the tanshinone mimics (TMs) used by them block the binding of RRM1-2 of HuR to ARE-containing RNA in vitro, and reduce the interaction of HuR with a set of ARE-containing mRNAs in LPS-treated mouse macrophage cells. This reduction of interaction of HuR with some of these mRNAs correlates with the reduction in their level in the cells treated with the TMs, and in the secreted level of their proteins in the serum of animals with LPS-induced peritonitis. Together, the study demonstrates the role of these TMs as modulators of the LPS-induced inflammatory response by blocking the binding of HuR to a subset of LPS-induced inflammatory mRNAs and thereby downregulating their mRNA and protein levels in inflammatory cells. The manuscript describes a comprehensive study, ranging from chemical synthesis of TMs, MD simulations to demonstrate the binding site of the TMs to the cleft formed by the RRM1-linker-RRM2 domains of HuR, which has been shown in crystal structure to be the main binding site of A/U-rich RNA molecules, in vitro studies showing the ability of the TMs to hinder ARE-containing RNA binding to HuR RRM1-2, whole transcriptome analysis to show the effect of the TMs on LPS-induced differential gene expression in murine macrophages, and on HuR binding to target mRNAs, and animal studies to show the effect of the TMs on the level of some inflammatory mediators in the serum of mice with LPS-induced peritonitis. The results are quite convincing and is in line with what is generally known about the effect of HuR on the expression of a large number of genes encoding pro-inflammatory proteins, and the ability of tanshinone derivatives/mimics in inhibiting HuR binding to target mRNAs. The authors put these two information together in this study and the results are on expected lines. While the results are convincing and quite comprehensive, I would suggest the following in order to substantiate and strengthen the results: 2.1. The experiments do not have any "positive control", such that the performance of the TMs can be compared with that of a molecule with known HuR binding inhibition activity, such as DHTS. It would be good to have such a comparison, to understand whether the TMs work similar to DHTS or differently, both qualitatively in terms of the mRNA targets which they affect and the extent of their anti-inflammatory activity.

      R2.1- We added DHTS as a comparison to TMs, following the reviewer’s comment. In this model, the net effect of DHTS is partially overlapping with TMs, at least for the parameters that we checked (see Figure 5, 6 and 7), showing some differences in the modulation of NF-kB shuttling upon LPS stimulation. Therefore, we suggest that DHTS and TMs show partially different effects on mRNA targets and in terms of anti-inflammatory activities.

      2.2. It is not clear to me whether the mRNAs which show differential expression in the RNAseq analysis of cells treated with LPS and TMs are exactly the ones which show difference in binding with HuR in the RIPseq analysis in presence of the TMs. This analysis is important for a number of reasons: all the mRNA binding targets of HuR are not affected by HuR at the level of mRNA stability, many are affected at the level of translation, without change in mRNA level. These mRNAs should therefore show change in binding of HuR in the RIPseq assay in presence of TM, but not show change in expression. Secondly, there may be mRNAs which show a change in expression in presence of TMs, but do not show binding of HuR, suggesting pleiotropic roles of the TMs. Therefore, instead of an overall correlation between differential expression and change in HuR binding of mRNAs, a table comparing the RIPseq status of individual mRNAs with that of their differential expression status, in presence and absence of LPS/TMs would be useful, further designating the different groups of mRNAs based on these differential status (change in HuR binding/change in expression, change in HuR binding/no change in expression etc.).

      R2.2 – We tried to rationalize the data following the reviewer’ suggestion, however, we could not fully adopt this strategy due to the complexity of the experiment design. Indeed, we have focused our attention on the effect of TMs during LPS stimulus, which induces a strong transcriptional response, rather than in steady state conditions. This is why we reported the overall correlation of LPS vs DMSO and TM7nox/LPS vs DMSO. Then, we evaluated whether the observed difference in the correlation may be reflected on a change of HuR binding, and we checked the RIPseq status during co-treatment vs LPS. This was the case for a subset of genes that are reported in Supplementary Table 1. Nevertheless, to be fully compliant with the reviewer’s request we now report a Supplementary Table 1 containing the entire gene list, so that the reader can immediately filter out the subsets according only to the comparison TM7nox/LPS vs LPS.

      2.3. Nuclear/cytoplasmic localization of HuR and NFkb is impossible to discern at the magnification of the immunofluorescence images in Fig 6 B and C. Higher magnification images are required to understand changes in localization.

      R2.3 – In accordance with this suggestion, we now report higher magnification, please see also R1.11. We do not observe any change in nuclear/cytoplasmic localization of HuR and NFkb due to TMs treatment. We rather observe LPS-induced NFkB nuclear accumulation, ActD-induced HuR cytoplasmic shuttling and inhibition of NFkB translocation, during LPS and DHTS treatment.

      2.4. It has been shown that DHTS-I increases the binding of HuR to the mRNAs with longer 3'UTR and with higher density of U/AU-rich elements, whereas it reduces the interaction of HuR with the mRNAs having shorter 3'UTR and with low density of U/AU-rich elements (Lal et al., NAR, 2017). It is not clear if the same is observed in case of the TMs or not, and such a comparative analysis would be useful to address this point.

      R2.4 – We re-analysed the data, checking the density of U/AU rich elements and the length of the 3’UTR of the displaced mRNA as in Lal et al. NAR 2017. Although we could not compare DHTS and TMs within the same biological system, it appears that the rules dictating their mechanism of action are similar.

      I think that the above suggested points are feasible as most of them really involve re-analysis of existing data. Only the suggestion to add DHTS or tanshinone as a positive/comparison control will require experimentation and addition of new data.

      Review Cross-commenting

      I think most of the reviewers' comments coincide in the evaluation of the manuscript. I would especially like to draw attention to the fact that all three reviewers found that the content and form of data presented in the paper is very dense and bogs down the reader and distracts from the overall focus of the manuscript.

      Reviewer #2 (Significance):

      The work described in the manuscript is comprehensive as it ranges from chemical synthesis and in vitro evaluation of the TMs to the characterization of their effects in vivo. Although the effect of tanshinone derivatives on HuR mRNA target binding is known, and the effect of HuR on inflammatory gene expression is also known, the manuscript is significant as it brings these two information together and tests the effect of these TMs on HuR-mediated regulation of inflammatory gene expression.<br /> However the extensiveness of the work also makes it quite dense, and I feel that the focus of the paper is often lost in the details. Also, the text of the manuscript is dense and verbose and uses many irregular grammatical and phraseological usages, for eg "their<br /> modulation or mis-localization lead to the insurgence of complex phenotypes and diseases". It appears to me that it would be ideal if the chemical synthesis, MD simulation studies and in vitro studies are presented in an independent manuscript. Also, that would allow a more exhaustive referencing of the known studies in literature where tanshinone derivatives, and other small molecules, have been used to modulate HuR binding to mRNA targets.<br /> This work would be of interest to molecular cell biologists in general and RNA biologists in particular, especially those who are studying RNA-protein interactions, and scientists who are interested in drug development using RNA-protein interactions as drug targets.<br /> My interest in the work lies in my expertise in studying RNA-protein interactions, especially of RNA-binding proteins such as HuR involved in regulating the translation of mRNAs encoded by inflammatory genes. I do not have expertise in chemical synthesis and am therefore not qualified to evaluate the first set of results describing the chemical synthesis of TMs.

      Reviewer #3 (Evidence, reproducibility and clarity):

      In this study, the authors investigated the modulation of HuR by tanshinone mimics and how it mitigates LPS response in murine macrophages. This represents a nice integration of synthetic chemistry, molecular simulations, and in vitro as well as in vivo experimental validations. Overall, this is an interesting study, and will add to the growing interest in HuR in inflammatory-mediated disease. The paper contains a lot of data (actually several papers in one) which may bog down the reader and distract from the overall message. it is suggested that they condense the data and simplify the figures and use more supplemental figures.<br /> Major Comments:<br /> 3.1. The authors have shown the dose response and cytotoxicity effect of tanshinone mimics; The authors show that TMs affect the overall HuR mRNA but they don't show protein levels.

      R3.1 – In accordance with the reviewer’s comment, we now show also protein levels, as we performed intracellular ELISA (Figure 6 in the revised manuscript); please see also R1.7.

      3.2. It is unclear the timing of certain experiments for LPS vs TMs (whether macrophages were pre-treated with TMs before LPS)-e.g fig 5. The authors should clarify for all experiments as the long-term clinical paradigm would be treatment after inflammation has been established.

      R3.2 – In most experiments TMs are co-administered with LPS. Only in one of the two protocols used for Actinomycin D chase experiment TMs are added after LPS with Act D, as we wanted to discriminate between transcriptional and post-transcriptional effects of TMs (see also R3.3).

      3.3. They have also identified differentially expressed genes which are RNA binding ligands of HuR by RIP-Seq. However, it would be necessary to check whether TM7nox affects the stability of those targets before conclusions can be made that TMs don't inhibit the primary transcriptional response (as mentioned in the Discussion section). Transcriptional effects of HUR chemical inhibition or genetic silencing has been reported previously in other cell systems.

      R3.3 – The reviewer is entirely correct, and we accordingly amended our conclusions. Indeed, TMs have an impact on gene transcription during co-administration with LPS as now suggested by Actinomycin D chase experiments reported in Figure 6C in the revised data and discussion in the manuscript.

      3.4. HuR competes with many RBPs (e.g. TTP and KSRP) as well as microRNAs (including miR-21 and miR-122) to regulate the stability/translational efficiency of several AU-rich transcripts. Does TM binding to HuR lead to increase access of these RBPs/microRNA to the transcripts? This could be addressed by RNA IP with antibodies to TTP or KSRP.

      R3.4 – The reviewer is suggesting an important experiment that requires multiple controls and significant efforts. Indeed, we are planning to study the specificity of TMs, and we prefer to tackle and report this point in a later publication.

      3.5. Another aspect of HuR functioning is the dimerization of HuR. HuR dimerization has been linked with many pathophysiologic conditions. The authors should show the effect of TM7nox on HuR dimerization. In figure 2, for example, there is a suggestion of this in the representative EMSAs where an intermediate shifted band is seen with the addition of TMs. Also, the legend should make clear which ligand is being tested in the modeling (purple structure) versus the RNA probe in the EMSAs. It would help the reader to identify the RNA probe used-e.g. "5′-DY681-labeled ARE RNA probe.

      R3.5 – We agree with the reviewer’s suggestion, and we investigated whether TM7nox influences HuR dimerization in the absence of RNA as performed in PMID 17632515 (Meisner et al 2007). We used MS-444 as a positive control, and we did not observe inhibition of dimerization by TMs at least at the used dosages. Data are reported in Supplementary Figure S6B of the revised manuscript.

      3.6. HuR does alter M2-associated targets like IL-10 and this should be addressed more directly. Fig. 3 suggests that IL-10 is reduced by TM7nox but the variance is so high that the statistics show NS. HuR regulates IL-10 in other cellular contexts and this would be important to determine for TM7 in the long run.

      R3.6 – Although we acknowledge its relevance, however, we did not investigate this gene directly. The variance becomes significant in the RIP-seq experiment (Supplementary Figure 9D). Therefore, we confirm that Il10 is among the 47/82 genes that show the same behavior as Cxcl10, Il1b and many other cytokines as Ccl12, Ccl7, Fas, Il1a, Il33; in conclusion, it is among the restricted list of genes modulated by TM7nox according to the presence of less AU rich sequences than average.

      3.7. Fig. 5-10 um of the TM used here produces significant toxicity to BMDM according to fig. S7. This may distort the ELISA/qPCR results as the RNA levels may be lower due to toxicity. The authors should address this or use a lower dose that is not toxic.

      R3.7 – The viability curves mentioned by the reviewer are run at 24-48 hours, and no toxic effects have been observed using TMs after 6 hours of treatment.

      3.8. In Fig 6 the immunocytochemistry is difficult to interpret as the magnification is too small to appreciate the N/C ratio. The investigators should provide higher magnification. A nuclear/cytoplasmic western blot is recommended as well to confirm that TM does not impair HuR shuttling (or NFkb shifts). This is an important area as there is a suggestion that TM blocks dimerization (Fig. 2) which does impair shuttling. Also, the modeling data suggest that TMs appear to sit in a similar groove between RRM1 and 2 as other HuR inhbitors that block shuttling.

      R3.8 – This point has also been raised by other reviewers, and we replied in R2.3 and R1.11. We understand the reviewer’s points, and we agree with the observation. However, we do not observe a change in HuR nuclear/cytoplasmic shuttling by immunofluorescence, neither we see an effect on HuR dimerization.

      3.9. IL-6 does not appear to be affected by TM treatment after LPS stimulation in vivo or in vitro -either mRNA or protein. However, DHTS did suppress this cytokine. The authors should address this discrepancy. Likewise, TNFa data here show no change and possibly a trend upward (Fig 3,4 and 7). This is in contrast to the effect of DHTS on TNF-a reported by the authors in a prior publication (D'Agnistino et al). The authors should address this discrepancy. There are reports suggesting that HuR is a translational inhibitor of TNFa in macrophages--Katsanou V, Papadaki O, Milatos S, Blackshear PJ, Anderson P, Kollias G, Kontoyiannis DL. HuR as a negative posttranscriptional modulator in inflammation (PMID 16168373)

      R3.9 – The reviewer’s comments are correct, but we do not have an explanation for this. In theory, there could be several possibilities such as 1) a DHTS effect on NFkB, 2) the fact that previously mentioned experiments with DHTS are not run with the same cells-at the same doses and timing as our current TM experiments, and 3) that HuR silencing is only partially overlapping with TMs treatment also in our recent experiments. Irrespective of specific transcripts, we think we have shown that TMs’ mechanism of action involves the modulation of HuR binding at the transcriptional level in our experimental condition.

      Review Cross-commenting

      I think the other reviewers' comments are pertinent and well thought out. I have no further suggestions.

      Reviewer #3 (Significance):

      The characterization of novel HuR inhibitors derived from tanshinones is an important advancement to the field which is rapidly growing. This complements other work with small molecule inhibitors and will allow the field to better understand the role of HuR in different disease contexts (cancer, neuroinflammatory etc) and cell types (e.g. macrophages, microglia, astrocytes). The ultimate significance is the clinical application of the inhibitors and the more options the better, particularly if there are toxic effects of some. My expertise is in post-trasnscriptional regulation of cytokines and we have already characterized some potent effects in cancer.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      In this study, the authors investigated the modulation of HuR by tanshinone mimics and how it mitigates LPS response in murine macrophages. This represents a nice integration of synthetic chemistry, molecular simulations, and in vitro as well as in vivo experimental validations. Overall, this is an interesting study, and will add to the growing interest in HuR in inflammatory-mediated disease. The paper contains a lot of data (actually several papers in one) which may bog down the reader and distract from the overall message. it is suggested that they condense the data and simplify the figures and use more supplemental figures.

      Major Comments:

      1. The authors have shown the dose response and cytotoxicity effect of tanshinone mimics; The authors show that TMs affect the overall HuR mRNA but they don't show protein levels.
      2. It is unclear the timing of certain experiments for LPS vs TMs (whether macrophages were pre-treated with TMs before LPS)-e.g fig 5. The authors should clarify for all experiments as the long-term clinical paradigm would be treatment after inflammation has been established.
      3. They have also identified differentially expressed genes which are RNA binding ligands of HuR by RIP-Seq. However, it would be necessary to check whether TM7nox affects the stability of those targets before conclusions can be made that TMs don't inhibit the primary transcriptional response (as mentioned in the Discussion section). Transcriptional effects of HUR chemical inhbiition or genetic silencing has been reported previously inother cell systems.
      4. HuR competes with many RBPs (e.g. TTP and KSRP) as well as microRNAs (including miR-21 and miR-122) to regulate the stability/translational efficiency of several AU-rich transcripts. Does TM binding to HuR lead to increase access of these RBPs/microRNA to the transcripts? This could be addressed by RNA IP with antibodies to TTP or KSRP.
      5. Another aspect of HuR functioning is the dimerization of HuR. HuR dimerization has been linked with many pathophysiologic conditions. The authors should show the effect of TM7nox on HuR dimerization. In figure 2, for example, there is a suggestion of this in the representative EMSAs where an intermediate shifted band is seen with the addition of TMs. Also, the legend should make clear which ligand is being tested in the modeling (purple structure) versus the RNA probe in the EMSAs. It would help the reader to identify the RNA probe used-e.g. "5′-DY681-labeled ARE RNA probe.
      6. HuR does alter M2-associated targets like IL-10 and this should be addressed more directly. Fig. 3 suggests that IL-10 is reduced by TM7nox but the variance is so high that the statistics show NS. HuR regulates IL-10 in other cellular contexts and this would be important to determine for TM7 in the long run.
      7. Fig. 5-10 um of the TM used here produces significant toxicity to BMDM according to fig. S7. This may distort the ELISA/qPCR results as the RNA levels may be lower due to toxicity.The authors should address this or use a lower dose that is not toxic.
      8. In Fig 6 the immunocytochemistry is difficult to interpret as the magnification is too small to appreciate the N/C ratio. The investigators should provide higher magnification and provide examples of ActD, LPS and LPS + drug. A nuclear/cytoplasmic western blot is recommended as well to confirm that TM does not impair HuR shuttling (or NFkb shifts). This is an important area as there is a suggestion that TM blocks dimerization (Fig. 2) which does impair shuttling. Also, the modeling data suggest that TMs appear to sit in a similar groove between RRM1 and 2 as other HuR inhbitors that block shuttling.
      9. IL-6 does not appear to be affected by TM treatment after LPS stimulation in vivo or in vitro -either mRNA or protein. However, DHTS did suppress this cytokine. The authors should address this discrepancy. Llikewise, TNFa data here show no change and possibly a trend upward (Fig 3,4 and 7). This is in contrast to the effect of DHTS on TNF-a reported by the authors in a prior publication (D'Agnistino et al). The authors should address this discrepancy. There are reports suggesting that HuR is a translational inhbitor of TNFa in macrophages--Katsanou V, Papadaki O, Milatos S, Blackshear PJ, Anderson P, Kollias G, Kontoyiannis DL. HuR as a negative posttranscriptional modulator in inflammation (PMID 16168373)

      Review Cross-commenting

      I think the other reviewers' comments are pertinent and well thought out. I have no further suggestions.

      Significance

      The characterization of novel HuR inhibitors derived from tanshinones is an important advancement to the field which is rapidly growing. This complements other work with small molecule inhibitors and will allow the field to better understand the role of HuR in different disease contexts (cancer, neuroinflammatory etc) and cell types (e.g. macrophages, microglia, astrocytes). The ultimate significance is the clinical application of the inhibitors and the more options the better, particularly if there are toxic effects of some. My expertise is in post-trasnscriptional regulation of cytokines and we have already characterized some potent effects in cancer.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      In the manuscript entitled "HuR modulation with tanshinone mimics impairs LPS response in murine<br /> macrophages" the authors have described the synthesis and application of small molecule mimics of the naturally occurring compound tanshinone, which is known to inhibit the binding of the RBP HuR to a class of its mRNA targets. The authors have shown that the tanshinone mimics (TMs) used by them block the binding of RRM1-2 of HuR to ARE-containing RNA in vitro, and reduce the interaction of HuR with a set of ARE-containing mRNAs in LPS-treated mouse macrophage cells. This reduction of interaction of HuR with some of these mRNAs correlates with the reduction in their level in the cells treated with the TMs, and in the secreted level of their proteins in the serum of animals with LPS-induced peritonitis. Together, the study demonstrates the role of these TMs as modulators of the LPS-induced inflammatory response by blocking the binding of HuR to a subset of LPS-induced inflammatory mRNAs and thereby downregulating their mRNA and protein levels in inflammatory cells.

      The manuscript describes a comprehensive study, ranging from chemical synthesis of TMs, MD simulations to demonstrate the binding site of the TMs to the cleft formed by the RRM1-linker-RRM2 domains of HuR, which has been shown in crystal structure to be the main binding site of A/U-rich RNA molecules, in vitro studies showing the ability of the TMs to hinder ARE-containing RNA binding to HuR RRM1-2, whole transcriptome analysis to show the effect of the TMs on LPS-induced differential gene expression in murine macrophages, and on HuR binding to target mRNAs, and animal studies to show the effect of the TMs on the level of some inflammatory mediators in the serum of mice with LPS-induced peritonitis. The results are quite convincing and is in line with what is generally known about the effect of HuR on the expression of a large number of genes encoding pro-inflammatory proteins, and the ability of tanshinone derivatives/mimics in inhibiting HuR binding to target mRNAs. The authors put these two information together in this study and the results are on expected lines. While the results are convincing and quite comprehensive, I would suggest the following in order to substantiate and strengthen the results:

      1. The experiments do not have any "positive control", such that the performance of the TMs can be compared with that of a molecule with known HuR binding inhibition activity, such as DHTS. It would be good to have such a comparison, to understand whether the TMs work similar to DHTS or differently, both qualitatively in terms of the mRNA targets which they affect and the extent of their anti-inflammatory activity.
      2. It is not clear to me whether the mRNAs which show differential expression in the RNAseq analysis of cells treated with LPS and TMs are exactly the ones which show difference in binding with HuR in the RIPseq analysis in presence of the TMs. This analysis is important for a number of reasons: all the mRNA binding targets of HuR are not affected by HuR at the level of mRNA stability, many are affected at the level of translation, without change in mRNA level. These mRNAs should therefore show change in binding of HuR in the RIPseq assay in presence of TM, but not show change in expression. Secondly, there may be mRNAs which show a change in expression in presence of TMs, but do not show binding of HuR, suggesting pleiotropic roles of the TMs. Therefore, instead of an overall correlation between differential expression and change in HuR binding of mRNAs, a table comparing the RIPseq status of individual mRNAs with that of their differential expression status, in presence and absence of LPS/TMs would be useful, further designating the different groups of mRNAs based on these differential status (change in HuR binding/change in expression, change in HuR binding/no change in expression etc.).
      3. Nuclear/cytoplasmic localization of HuR and NFkb is impossible to discern at the magnification of the immunofluorescence images in Fig 6 B and C. Higher magnification images are required to understand changes in localization.
      4. It has been shown that DHTS-I increases the binding of HuR to the mRNAs with longer 3'UTR and with higher density of U/AU-rich elements, whereas it reduces the interaction of HuR with the mRNAs having shorter 3'UTR and with low density of U/AU-rich elements (Lal et al., NAR, 2017). It is not clear if the same is observed in case of the TMs or not, and such a comparative analysis would be useful to address this point.

      I think that the above suggested points are feasible as most of them really involve re-analysis of existing data. Only the suggestion to add DHTS or tanshinone as a positive/comparison control will require experimentation and addition of new data.

      Review Cross-commenting

      I think most of the reviewers' comments coincide in the evaluation of the manuscript. I would especially like to draw attention to the fact that all three reviewers found that the content and form of data presented in the paper is very dense and bogs down the reader and distracts from the overall focus of the manuscript.

      Significance

      The work described in the manuscript is comprehensive as it ranges from chemical synthesis and in vitro evaluation of the TMs to the characterization of their effects in vivo. Although the effect of tanshinone derivatives on HuR mRNA target binding is known, and the effect of HuR on inflammatory gene expression is also known, the manuscript is significant as it brings these two information together and tests the effect of these TMs on HuR-mediated regulation of inflammatory gene expression.<br /> However the extensiveness of the work also makes it quite dense, and I feel that the focus of the paper is often lost in the details. Also, the text of the manuscript is dense and verbose and uses many irregular grammatical and phraseological usages, for eg "their<br /> modulation or mis-localization lead to the insurgence of complex phenotypes and diseases". It appears to me that it would be ideal if the chemical synthesis, MD simulation studies and in vitro studies are presented in an independent manuscript. Also, that would allow a more exhaustive referencing of the known studies in literature where tanshinone derivatives, and other small molecules, have been used to modulate HuR binding to mRNA targets.<br /> This work would be of interest to molecular cell biologists in general and RNA biologists in particular, especially those who are studying RNA-protein interactions, and scientists who are interested in drug development using RNA-protein interactions as drug targets.<br /> My interest in the work lies in my expertise in studying RNA-protein interactions, especially of RNA-binding proteins such as HuR involved in regulating the translation of mRNAs encoded by inflammatory genes. I do not have expertise in chemical synthesis and am therefore not qualified to evaluate the first set of results describing the chemical synthesis of TMs.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary:

      The Authors report on the synthesis and characterization of a class of small molecules, the tanshinone mimics (TMs), which interfere with binding of the RNA binding protein (RBP) HuR to its mRNA targets. HuR is an important regulator of mRNA stability and translation of genes involved in key homeostatic (cell cycle, stress response) and pathologic process (inflammation, carcinogenesis). In particular, the first part of the study describes the compounds' chemical synthesis and some pharmacokinetic parameters (i.e., definition of molecular binding, solubility, bioavailability, prodrug generation etc). The second part undertakes, in in vitro and ex-vivo model of LPS-induced mouse macrophage activation, the identification of HuR-bound mRNA targets, which is then evaluated within the global LPS-induced transcriptome; finally, the study evaluates the ability of TMs to inhibit HuR-mediated proinflammatory gene regulation, indicating their use and potential value as therapeutic anti-inflammatory strategy.

      Major comments:

      The manuscript contains a wealth of data generated from different experimental systems, spanning from synthetic chemistry to preclinical models of gene regulation, requiring cultural backgrounds in chemistry and biology as well. The key conclusions are well supported by the data, but it takes a great effort to get to the core results and thus critically read and evaluate their interpretation. Although the complexity and sheer size of data sets generated lends itself to a hard read, this is further complicated by data presentation, which especially in the second part needs to be significantly improved to gain clarity and focus. For ease of referral, specific comments will be addressed related to Figures whenever possible.

      • Page 15: To measure TM7nox disrupting ability of HuR:mRNA complex for the HTRF assay (Figure 2G) and for biotin pull down assay (Figure 5C), it was chosen a biotinylated probe containing the AU rich elements of the TNFα, as known HuR target. Please comment on the rationale, and whether could it be relevant reevaluate these parameters post-hoc, based on the sequences identified in HuR targets more susceptible of modulation by TM compound (listed in table 1, Figure 5 A/B) and based on the absence of regulation of TNF (Figures 3D, 4D, 7A) found in the tested systems.
      • Page 16-18: Description of the RNAseq data shown in Figure 3 should be more centered around the main findings regarding the effect of TMnox that are further pursued in the study: that is, (Figure 3B), the 249 downregulated DEGs found modulated by TM7nox in presence of LPS, where was observed a strong enrichment of categories related to the inflammatory response: cytokines (Il1b, Cxcl10, Il10, Il19, Il33), immune cell chemotaxis (Ccl12, Ccl22, Ccl17, Ccl6) and innate immune response. The description of the GO for the remaining data should be shortened to main points, perhaps reporting what described in the results with each section of the Venn in a table, while referring to the whole list in the supplements as already done. This could replace Figures 3D, E which do not add substantially to what provided in the supplementary table 2 and to which they can be added as further visualization.
      • Page 18-19: Description of the results of the RIP-seq shown in Figure 4 set is very confusing: onward from the line "477 HuR-bound transcripts (log2 FC > 3) were also upregulated by LPS at the transcriptional level..." the numbers do not match or reconcile with those shown in the Venn diagram (Fig. 4B) nor with those listed in the figure legend of Figure S8. Moreover, as previously remarked for Figure 3 (and even more for this dataset in which initial description of Venn in 4B is unclear), panel 4E does not add as much to the info provided in Table 1/supplementary Table 1, where they can eventually be added as further data visualization; Instead, Figure S8 displays very informative data merging together the results obtained in RNAseq (Fig. 3) and RIP-Seq (Fig.4) and should be displayed in Figure 4, as in the result section they are indeed presented together.
      • Page 19-20: Description of the modulation by TM7nox of HuR binding to specific consensus sequences is summarized at the end of the relative paragraph as follows: "TM7nox reshapes HuR binding to target genes in presence of LPS by disrupting the binding of HuR towards target genes containing a lower number of HuR consensus sequences than the average observed in the HuR-bound transcripts". Understanding of these data through the provided text and the Supplementary Figure 9 is very laborious and referring of an entire dataset to a supplementary figure makes it even harder. It would be best to show this as main figure, not supplemental, either adding a Venn diagram as in 3B/4B showing to which dataset each part of the analysis refers, or even more efficaciously, extrapolate a representative gene set for the main analyses showing TM7nox activity in target genes with higher vs lower consensus sequences; same approach for the analysis in Figure 9B, where the effect on a gene with sequence #1 or #10 could be compared with one bearing sequence #3 for example.
      • Page 21: Description of the effect of three TMs (TM6, TM7nox and TM7nred) on LPS response in macrophages at the single gene level (Figure 5 and Figure 6): TM6 and TM7nox were used in exps in Fig. 5 A and E, while only TM7nred was used for CXCL10 secretion analysis (fig.5 D and F): please describe the compound choices' rationale (as done for experiments in Figure 6).
      • Page 21-22: The effect on HuR expression of siRNA silencing and, more importantly, of TMs shown in Figure 6A, first panel, should be visualized at protein level by western blot. This is an important point as for CXCL10 and iL1there seems to be an additive effect between decreased HuR levels and pharmacological blocking.
      • Page 24: please rephrase the statement 'These observations suggest the utilization of TMs in autoinflammatory and autoimmune diseases' as 'These observations suggest the evaluation of TMs in specific preclinical models for autoinflammatory and autoimmune diseases'.
      • In the discussion, please include a paragraph with study limitation and possible biases (for example, the choice of RNP-IP without crosslinking has pros and cons).
      • The data and the methods are correctly presented for reproducibility, replicates and statistical analysis are adequate.

      Minor comments:

      • At least in the single gene validation experiments (Fig.5), a negative control (such as recombinant HuR with mutated RRMs in trans-, or ARE-less/non-HuR targetable sequence in cis, or inactive TM) would be advisable.
      • Figure 6B/C: for immunofluorescence panels, zooming on a smaller number of cells will render more visible HuR and NFB nucleocytoplasmic shuttling, given that quantification and statistics are provided by imaging software. Negative control stainings (secondary Abs only) should be included.
      • Figure 7A: in the X axis LPS+8n is indicated: is it a typo for LPD+6n or was compound TM8n indeed used?
      • In the Methods section please include protocols and materials for immunofluorescence (results shown in Fig. 6B/C).
      • There are some typos and repetition in figure legends (legend Figure S9).
      • Prior studies are referenced appropriately.

      Review Cross-commenting

      I fully agree with the Reviewer's remarks. I would add that a general concern expressed is that this manuscript in its present form has a readership issue: the first part is for chemistry/pharmacology audience, the second is biology-based. Splitting the work has been suggested; or, the Authors may decide which part is more impactful and present the other in a streamlined version.

      Significance

      This is a large study reporting progress in the development of synthetic antagonists of HuR function, which is the Authors' well-established line of research. The TM compounds are small molecules with anti-inflammatory effects with strong potential for therapeutic use due to selected inhibition of HuR-mediated upregulation of proinflammatory molecules. The physicochemical and early biological characterization done in this study will allow further testing of their efficacy and of the overall role of HuR-mediated regulation as targetable mechanism in several preclinical human disease models.

      Targeting of the RNA-binding protein HuR has been tackled as therapeutic approach in cancer, less in chronic immune and inflammatory diseases despite many common mechanisms and mediators.

      This study could be well received by researchers involved in basic science and drug development (chemistry, biochemistry/biophysics, pharmacology, computational modeling) and biologists/physician scientists interested in testing these compounds in translational research settings where HuR-driven functions can be relevant (cancer, chronic inflammation), though the chemical part would be less accessible to the latter audience.

      Reviewer's background is in preclinical human models of chronic inflammation with interest in posttranscriptional gene regulation with familiarity with RNAseq and RIPseq dataset and analysis. For the part of the manuscript regarding the synthesis and physicochemical characterization of the TN compound I requested assistance to a faculty from the chemistry department with expertise in that field, who did not request any specific clarification or addendum.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      1. General Statements

      Imbalance in gut-derived AhR ligands has been shown to be involved in inflammatory bowel disease and in neuro-inflammation. The aim of our study was to address the role of dietary AhR ligands in a context that had not been previously explored. We decided to focus on allergy because AhR has broad functions in barrier tissues homeostasis, which is directly relevant to allergy.

      2. Description of the planned revisions

      Additional experiments in response to Reviewer 2

      "The authors make a strong claim that the epidermal barrier function is not affected by AhR poor diet conditions (claim made in abstract and last paragraph of the discussion). This should be experimentally validated."

      We already performed footpad histology and observed that the stratum corneum is not affected by the diet (fig1A and figS1E). We will provide a quantitative analysis by measuring stratum corneum thickness on the images, and add this data to figure 1. To strengthen this point, we will also perform ultra-structural analysis of the epidermis in the two diet groups using electron microscopy of the skin. This will provide a deeper characterization of the epidermal structure, including cornified layers and intercellular tight junctions.

      "Injection into the footpad as a route of administration is also physiologically distinct from epicutaneous sensitization given the natural barriers are artificially breached via needle puncture. Did the authors consider epicutaneous sensitization via the skin without additional barrier disruption? Does this yield the same response?"

      We will perform skin sensitization without barrier disruption by applying papain (or vehicle) on shaved flank skin. To minimize skin abrasion, mice will be shaved the day before the application. We will analyze dendritic cells migration to the draining lymph nodes after 48h by flow cytometry, and helper T cell responses in the draining lymph nodes after 6 days by measuring cytokine secretion.

      Text edits

      Comments from Reviewer 1

      • We will add appropriate references in response to comments from reviewer 1: " in several places they cited review articles instead of original articles for key findings. Ex. For the expression of Mucin 5 and CLCA1 a review is cited." and " the role of AHR in ILC2 (PMID: 30446384) and alveolar epithelial cells (PMID: 35935956) has been documented. The authors should add these references."
      • We will modify the figures legends according to reviewer 1's suggestions: " Although the authors mentioned treatment schedule and stimulants used in the method, a short description in the figure legend will be helpful for the readers".
      • We will address other comments from reviewer 1 by modifying the text where appropriate:

      "1. In the introduction section, the authors should explain adequately why they thought that AHR signaling is important for allergy.<br /> 2. Since IL-5, IL-13 production by skin draining lymph nodes and pulmonary lymph nodes was different, is this difference due to difference in AHR expression?<br /> 3. In Fig.3, the authors showed that intra-nasal stimulation does not induce eosinophil migration or IL-5, IL-13 induction in I3C diet group. These data and the data shown in figure-2 are in contrast. The authors should discuss this discrepancy."

      Comments from Reviewer 2

      • "How to explain the difference between IL4 (no effect between the two diets/or absence/presence LCs in Fig. 4D) and IL5/IL13 (small effect in Fig 1D and 4D). "

      This is an interesting point. It has been shown that IL4 is produced in lymph nodes by T cells distinct from those producing IL5 and IL13 (https://doi.org/10.1038/ni.2182). In addition, IL4 expression is regulated at the transcriptional level by distinct mechanisms from IL5 and IL13 expression (https://doi.org/10.1016/S1074-7613(00)80073-4, https://doi.org/10.1038/ni.1966).<br /> We speculate that IL4-producing T cells are not affected by Langerhans cells presence in the lymph nodes. We will add a point in the discussion section to discuss this. - We will tune down our conclusion regarding the different effects of diet-derived and microbiota-derived AhR ligands according to the comments of the reviewer: "This part seemed far-fetched. There are many more differences between germ free and specific pathogen free mice than only the presence/absence of AhR ligands. Hence, it seemed like a very big step to compare both conditions and draw the conclusion that microbiota-derived AhR ligands activate different sets of genes. It would also make more sense if Fig. 5 would be immediately followed by Fig. 7". We also propose to move Fig6 to the supplementary data.

      3. Description of the revisions that have already been incorporated in the transferred manuscript

      4. Description of analyses that authors prefer not to carry out

      Comments from Reviewer 1

      "In Fig.4, the authors show there is no difference in total number, but difference in migration, was there a difference in expression of migratory markers?"

      We assume the reviewer is referring to the number of Langerhans cells in the epidermis in steady-state, which is not different between diets (fig4A). We actually already show in supplementary figure S3E classical cell surface markers that are upregulated upon dendritic cells migration (MHC class II and CD40). We found no difference in the expression of these markers between diet groups.

      Comments from Reviewer 2

      "Fig. 1D Cytokine production<br /> In AhR poor diet the spread between the individual data points is much larger and the difference between presence/absence of dietary ligands in IL5 and IL13 seems to be based merely on a few outliers (which especially in the case of IL13 appear to be completely out of range). Most other datapoints do not seem to be highly different from the ones in the AhR rich diet.<br /> Where does this high variation come from in AhR poor diet (and what is the reason for these high outliers)? Would the data have been significantly different without the outliers? "

      Throughout the manuscript, we have represented raw data and individual data points for transparency. We observed some variability between biological replicates, not just for cytokine secretion (fig1D) but in most assays (for instance cell counts in lymph nodes in fig1C or inflammatory cell counts in fig2A and fig3A or antibody production in fig2E), yet the reviewer focuses their comments on fig1D. In the case of fig1D, we have performed Kruskal-Wallis statistical tests to account for this variation, and the difference between diet groups was statistically significant. We do not understand how we could remove the so-called ‘outliers’ without data manipulation to perform an alternative statistical test. We also disagree with the reviewer that 4 out of 11 points can be considered ‘outliers’.

      "In general, increases of all canonical T-helper cytokine responses (except for IL4) can be noted in the LN and the difference in IL10, IL17 or IFNg production between AhR poor and rich diet appears even more pronounced than the difference in IL5/IL13 (Fig. S1F). Still the authors decide to focus the entire story on the allergic response after stating that a 'lack of dietary AhR ligands amplifies allergic responses'. Why was this choice made?"

      Imbalance in gut-derived AhR ligands has been shown to be involved in inflammatory bowel disease and in neuro-inflammation. The aim of the project was to address the role of dietary AhR ligands in a context that had not been previously explored. We decided to focus on allergy because AhR has broad functions in barrier tissues homeostasis, which is directly relevant to allergy. We will better explain this point in the introduction. In the course of the study, we analyzed IL10, IL17 and IFNg production by lymph node T cells to get a complete view of helper responses, and we provided this data in supplementary information for transparency. We believe this information might be useful for other groups studying other types of skin inflammation.

      "Would the authors expect other inflammatory models via the skin (e.g. bacterial, viral infection) to confer better/worse outcomes under an AhR poor diet?"

      This is an interesting question. Unfortunately, we do not have the means to analyze bacterial or viral skin infections for lack of adequate facilities (i.e. BSL2 animal facility) or ethics approval for this kind of experiments. We believe that our work may prompt in the future other groups to analyze the impact of dietary AhR ligands in other inflammatory skin contexts.

      "At a mechanistic level, how do LC suppress the activation of T cells in the LN, and how would this impact secretion of certain cytokines but not others?"

      "it remains a bit speculative how migration of LCs to the dLNs of the skin contributes to suppressing Th2 immunity in the airways. Several hypotheses have been put forward in the discussion. What is their thought about this and how to validate experimentally?"

      This is an important question. A regulatory role for Langerhans cells has been evidenced by other studies, but the molecular mechanisms involved remain elusive. This point is discussed in the discussion part of the manuscript. We believe that deciphering the mechanism of action of Langerhans cells is beyond the scope of the present study (and is unrelated to the direct effect of the diet), and would represent an entire project in itself.

      “Fig. 3 - Why would the alteration of diet pose a confounding factor to the model? Did the authors determine that such diet-associated changes are only important at the sensitization phase? The footpad (Fig. 1) and pulmonary (Fig 2) models were performed with the altered diets throughout the entire length of the experiment. If anything, wouldn't changing the diet after sensitization also provide an additional variable here? Is it known what happens (e.g. inflammatory state, genetic changes) when a normal diet is resumed after a period of adaptation? This reviewer does not understand the reason for all-of-a-sudden changing the diet after the sensitization phase.”

      Our goal with this experiment was to address the effect of the dietary AhR ligands during the skin sensitization phase only. This is why diets are different only in this phase of the protocol. We want to emphasize that the IC3 diet and the AhR-poor diet only differ in the presence of one molecule, which is I3C. The composition of the food is otherwise exactly the same, therefore we do not believe that a change between AhR-poor and I3C would represent a confounding factor. This is different to the adaptation period when we place the mice on I3C or AhR-poor diets instead of normal chow diet (which has a completely different formulation). We will make this point clearer in the text.

      "Fig. 7 Role of TGFb<br /> At first site, it seems counterintuitive that TGFb, which is a molecule generally associated with homeostasis and dampening of inflammation, is associated here with more profound inflammation. How to reconcile? At this point the data on TGFb are merely correlative. Did the authors directly test the contribution of TGFb to LC migration? In addition, did they check whether they could restore defects in LC migration in absence of AhR ligands by blocking the formation of active TGFb? "

      We agree with the reviewer that the role of TGFb seems counter-intuitive. However, multiple studies have shown that TGFb produced by keratinocytes retains Langerhans cells in the epidermis, using a variety of experimental approaches including genetic tools (https://doi.org/10.1073/pnas.1119178109, https://doi.org/10.1038/ni.3396,

      https://doi.org/10.4049/jimmunol.1000981, https://doi.org/10.1016/j.xjidi.2021.100028). We do not have any reason to doubt the validity of these studies. Therefore, we believe that demonstrating again the role of TGFb in Langerhans cells migration is not necessary.

      Using blocking antibodies against TGFb or its receptor, as suggested by the reviewer, would most probably not allow us to address whether it restores the defect in Langerhans cells migration. Indeed, results from the literature (cited above) indicate that such blocking would increase Langerhans cells migration in both diet groups, therefore it will most likely be impossible to conclude.

      In addition, we have provided several lines of evidence that AhR activation regulates the expression of Integrin-beta8 in keratinocytes and the release of bioactive TGFb, at transcriptomic and protein levels, in both mouse and human keratinocytes (fig7). Therefore, we believe that additional experiments to support the link between AhR ligands and TGFb are not necessary within the scope of the revision.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      In this paper Cros et al describe how the absence of dietary ligands of AhR exacerbate cutaneous papain-induced allergy. This was only observed when papain was applied topically, but not intranasally. However, lack of dietary AhR ligands also worsened allergic airway inflammation after cutaneous sensitization. At a mechanistic level, the authors found that the absence of dietary AhR ligands hampered migration of Langerhans cells (LC) to the lymph nodes, where they are claimed to be needed to suppress T cell activation. Complementary models that lead to loss of LCs gave a similar phenotype. The authors performed RNA-sequencing on epidermal cells derived from mice that were either fed an AhR ligand rich or poor diet to define differences in transcriptome signature. They uncovered increased expression of the integrin Itgb8 in absence of AhR ligands, which is needed for production of active TGF, a factor known from literature to contribute to LC retention in the skin.

      In general, the study is well done, and the different experimental conditions are well controlled for. The experiments are built up in a logical fashion, and most of the times, the interpretation is appropriate (except for a few claims, see further). The paper reads very fluently, and the key points are interesting.

      Major comments:

      • Fig. 1D Cytokine production
      • In AhR poor diet the spread between the individual data points is much larger and the difference between presence/absence of dietary ligands in IL5 and IL13 seems to be based merely on a few outliers (which especially in the case of IL13 appear to be completely out of range). Most other datapoints do not seem to be highly different from the ones in the AhR rich diet.<br /> Where does this high variation come from in AhR poor diet (and what is the reason for these high outliers)? Would the data have been significantly different without the outliers?<br /> How to explain the difference between IL4 (no effect between the two diets/or absence/presence LCs in Fig. 4D) and IL5/IL13 (small effect in Fig 1D and 4D).
      • In general, increases of all canonical T-helper cytokine responses (except for IL4) can be noted in the LN and the difference in IL10, IL17 or IFNg production between AhR poor and rich diet appears even more pronounced than the difference in IL5/IL13 (Fig. S1F). Still the authors decide to focus the entire story on the allergic response after stating that a 'lack of dietary AhR ligands amplifies allergic responses'. Why was this choice made?<br /> Would the authors expect other inflammatory models via the skin (e.g. bacterial, viral infection) to confer better/worse outcomes under an AhR poor diet?<br /> At a mechanistic level, how do LC suppress the activation of T cells in the LN, and how would this impact secretion of certain cytokines but not others?

      Fig. 3 - Why would the alteration of diet pose a confounding factor to the model? Did the authors determine that such diet-associated changes are only important at the sensitization phase? The footpad (Fig. 1) and pulmonary (Fig 2) models were performed with the altered diets throughout the entire length of the experiment. If anything, wouldn't changing the diet after sensitization also provide an additional variable here? Is it known what happens (e.g. inflammatory state, genetic changes) when a normal diet is resumed after a period of adaptation? This reviewer does not understand the reason for all-of-a-sudden changing the diet after the sensitization phase.<br /> - Fig. 6: Microbiota-derived and diet-derived AhR ligands modulate different sets of epidermal genes.<br /> This part seemed far-fetched. There are many more differences between germ free and specific pathogen free mice than only the presence/absence of AhR ligands. Hence, it seemed like a very big step to compare both conditions and draw the conclusion that microbiota-derived AhR ligands activate different sets of genes.<br /> It would also make more sense if Fig. 5 would be immediately followed by Fig. 7<br /> - The authors make a strong claim that the epidermal barrier function is not affected by AhR poor diet conditions (claim made in abstract and last paragraph of the discussion). This should be experimentally validated. Injection into the footpad as a route of administration is also physiologically distinct from epicutaneous sensitization given the natural barriers are artificially breached via needle puncture. Did the authors consider epicutaneous sensitization via the skin without additional barrier disruption? Does this yield the same response?

      Fig. 7 Role of TGFb<br /> - At first site, it seems counterintuitive that TGFb, which is a molecule generally associated with homeostasis and dampening of inflammation, is associated here with more profound inflammation. How to reconcile? At this point the data on TGFb are merely correlative. Did the authors directly test the contribution of TGFb to LC migration? In addition, did they check whether they could restore defects in LC migration in absence of AhR ligands by blocking the formation of active TGFb?

      Finally, also other steps of the proposed model by the authors are based on literature rather than direct experiments. In this regard, it remains a bit speculative how migration of LCs to the dLNs of the skin contributes to suppressing Th2 immunity in the airways. Several hypotheses have been put forward in the discussion. What is their thought about this and how to validate experimentally?

      Significance

      The major strength of the paper (and the most interesting finding) is the explanation of why the effect of the diet is only detectable after cutaneous but not intranasal sensitisation and the causal link to the LCs present in the skin.

      The major limitations of the paper is that many parts of the proposed model are not experimentally validated but based on literature suggestions (eg the claim that TGFb would prevent LC migration to LN, that LC would suppress T cell responses in the LN, that the suppression of T cell cytokines (with very limited effects on IL5 and IL13 but no effect on IL4) would be sufficient to explain improved allergy symptoms in the lung...). It is also unclear why the authors studied allergic symptoms while effects on other T cell cytokines appeared more prominent. There are a few questions on the change in model from figure 1-2 to figure 3.

      The key findings are interesting and the paper is nice to read.<br /> The findings will be interesting to specialised audience: LC biology, allergy and Th2 immunity people<br /> Own research field, dendritic cell biology and papain-induced models of allergy

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      The manuscript is well written. The authors mostly cited appropriate papers but in several places they cited review articles instead of original articles for key findings. Ex. For the expression of Mucin 5 and CLCA1 a review is cited.

      General comments

      1. the role of AHR in ILC2 (PMID: 30446384) and alveolar epithelial cells (PMID: 35935956) has been documented. The authors should add these references.
      2. Although the authors mentioned treatment schedule and stimulants used in the method, a short description in the figure legend will be helpful for the readers.

      Specific comments

      1. In the introduction section, the authors should explain adequately why they thought that AHR signaling is important for allergy.
      2. Since IL-5, IL-13 production by skin draining lymph nodes and pulmonary lymph nodes was different, is this difference due to difference in AHR expression?
      3. In Fig.3, the authors showed that intra-nasal stimulation does not induce eosinophil migration or IL-5, IL-13 induction in I3C diet group. These data and the data shown in figure-2 are in contrast. The authors should discuss this discrepancy.
      4. In Fig.4, the authors show there is no difference in total number, but difference in migration, was there a difference in expression of migratory markers?

      Minor points

      1. TGF-β, TCR-β and cytokine names should be written consistently across the manuscript.
      2. The authors should use "β" instead of beta

      Significance

      The work is significant and will impact the field

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      Summary:

      The submitted manuscript is comparing the effect of individual chaperones and heat-resistant obscure (Hero) proteins on the overall folding of the TDP-43 LCD-domain and its relation to aggregation propensity. Therefore, the authors apply smFRET in order to deduce eventual morphological changes of the LCD-domain from FRET efficiencies. The authors observe that the LCD domain extends its structure upon binding of chaperone/Hero proteins whereas it is collapsed in the absence of those. Furthermore, immunoblotting of filter trap assays indicate that overexpression of chaperones and Hero proteins reduce aggregation of TDP-43 in vivo. Both, the morphological effects on the LCD-domain and the aggregation propensity are significantly enhanced for the TDP-43 A315T mutant. Moreover, the authors tested a charge depleted Hero protein version with reduced "chaperone-like" behaviour. Therefore, the authors conclude that the binding or chaperone activity of the Hero protein is based on its residue specific charges. Finally, the authors conclude that Hero proteins can act similar to chaperones in order to keep protein homeostasis under stress conditions.

      We thank the Reviewer for their insightful evaluation of our study.

      Major comments:

      The similar effect of chaperones and Hero proteins on the morphology of TDP-43 found by the authors is intriguing and the applied experimental procedures seem well described and conducted.

      However, the assumption of the authors that a change in morphology of the LCD-domain by the chaperones and Hero proteins is directly connected to the reduction of TDP-43 aggregation is not entirely clear. Whether an overexpression of individual chaperones and Hero proteins has a direct effect on TDP-43 aggregation cannot be tested in vivo, only. It cannot be excluded that inside the cell the here tested chaperones and Hero proteins control intermediate processes or work as co-factors for other proteins involved in protein homeostasis rather directly influencing the aggregation of TDP-43. Therefore, I recommend in vitro aggregation experiments, using ThT signal as a readout. By adding chaperones, Hero proteins and a negative (BSA or others) control individually, a direct effect on TDP-43 aggregation could be concluded. Those experiments have been extensively used in the field and are quick and straightforward to handle.

      As the Reviewer explains, indirect effects on TDP-43 aggregation in cells may be accounted for by conducting aggregation experiments in vitro, with recombinant proteins. We are currently designing such experiments based on a previously described full-length recombinant TDP-43 with a TEV-cleavable MBP tag (Wang 2018 EMBO J). This can be incubated with Hero/DNAJA2/Control, and aggregation induced by cleavage of the tag, after which aggregation can be measured via filter trap similar to the method described in our work. We will include these results in our revised manuscript.

      We thank the Reviewer for their advice. While we note that it is controversial whether ThT binds to aggregates formed from full-length TDP-43 (used in all our assays in the current manuscript), it is reasonable to apply this assay to the LCD fragment as in the paper referenced by the Reviewer below (Lu 2022 Nat Cell Biol). Such an assay is also a reasonable method for confirming effects of Hero protein and DNAJA2 in vitro, and we can conduct this assay as a back-up if the above does not work.

      In addition, focusing on the LCD-domain as a main driver for TDP-43 aggregation is limiting this study. In particular, recent studies [1] indicate that the RRM1 and RRM2 sites of TDP-43 have a major impact on TDP-43 gelation and maturation to solid aggregates. Unfortunately, those sites have not been studied in this manuscript.

      We thank the Reviewer for their insight. While we are keen to investigate the impact of other regions on the aggregation of TDP-43 in the future, we chose to focus on the LCD in our current study because our smFRET assay is particularly suitable to monitor the dynamic conformational nature of this flexible, unfolded region.

      However, we agree with the Reviewer that it is possible the RRMs have an effect on the activities of Hero11 and DNAJA2. We will create constructs for the RRM-depleted variant, TDP43ΔRRM1&2, and RNA-binding deficient variant, TDP435FL for use in our cell-based assay. This will allow us to investigate how this domain influences the effects of Hero and DNAJA2, and we will include this in our revised manuscript.

      As an optional alternative for using Hero11KR->G could be the alteration of buffer conditions and using higher number of salts to promote charge screening. It would be of interest whether the results with the Hero11KR->G could be reproduced with wild type Hero11.

      We will perform our assays with Hero11 in high salt conditions for charge screening. While we agree that it may be a great alternative experiment, we note that changing the salt concentration may directly affect the LCD conformation, possibly complicating interpretation of results.

      [1] Lu et al. Nat Cell Biol;24(9):1378-1393 (2022)

      Minor comments:

      Overall, the text is clearly written, and the figures are appropriate.

      Whether the activity of individual chaperones or Hero proteins on TDP-43 aggregation "may result in the overall fitness of the cell" or "reinforcing the conformational health of the proteome" is disputable without knowing how the overexpression of certain chaperones or Hero proteins alter the formation of toxic TDP-43 oligomers.

      We thank the Reviewer for their balanced critique. We will remove or weaken this point regarding how Hero proteins "may result in the overall fitness of the cell" or may be "reinforcing the conformational health of the proteome" from the discussion.

      Reviewer #1 (Significance (Required)):

      Studying the mechanistic effects of chaperones on aggregating proteins is of major interest for the field in order to understand aging related disbalance of protein homeostasis and the progression of neurological decline, such as seen for amyotrophic lateral sclerosis (ALS). Furthermore, finding homolog proteins, also being able to inhibit protein aggregation, can help to understand overall mechanisms of protein aggregation and processes preventing such fatal behaviour. However, the technique used in this manuscript are not very novel and have been used numerously times before. smFRET is a common technique to look at protein folding/unfolding and is used frequently as a molecular ruler. The manuscript is of interest for the field of protein aggregation and folding, smFRET and neurodegeneration.

      My expertise lies in the field of protein aggregation and inhibition due to chaperones, measuring molecular interactions and neurodegenerative diseases.

      We greatly appreciate the Reviewer’s expert opinion on our work. As the Reviewer explains, we believe our work will contribute to the fields of protein aggregation and folding, smFRET and neurodegeneration. While the smFRET method may not be novel on its own, to our knowledge this is the first observation of the TDP-43 LCD, with the effect of a pathogenic mutation, at the single-molecule level. In fact, the production, dye-labeling and isolation of individual molecules is extremely challenging for TDP-43. This was made possible by our technical advances using genetic code expansion to site-specifically introduce an unnatural amino acid in TDP-43, purifying and labeling the TDP-43 from HEK cells, and isolation on glass slides.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      In this manuscript, the authors build on their findings (Tsuboyama 2020) that electrostatically charged IDPs (Heros) can protect proteins from denaturation and aggregation. In their previous work, they demonstrate that these Hero proteins could decrease the fraction of insoluble GFP-TDP43∆NLS in mammalian cell lines and that this mode of action was related to the electrostatic charge of the proteins and not sequence dependent. Although this protective mode of action appears to be similar to that of canonical chaperones, it is unclear how the Hero proteins compare. In this study, the authors compare Hero11 to a panel of canonical chaperones in their cell-based assays and show that it prevents aggregation in a comparable way to DNJA2. It appears that Hero11 decreases the GFP-TDP43∆NLS aggregates better than some other chaperones. They then utilise their expertise in smFRET analysis (Tsuboyama, 2018) to compare what effect DNJA2 and Hero11 (along with Hero11KR-->G (non-charged control)) have on the dynamic structures of the GFP-TDP43∆NLS (labelled with complementary fluorophores in the LCD domain). Based on analysis of the WT GFP-TDP43∆NLS and the A315T GFP-TDP43∆NLS, the authors suggest that the presence of Hero11 and DNJA2 maintain the LCD-domain of TDP43 in an extended conformation and that by doing so, aggregation can be prevented (as assessed in the cell-based assay).

      Despite finding the results very interesting, I feel that the study is preliminary and the conclusions drawn are not fully substantiated by the presented experimental work. Many questions need addressing to validate these findings and conclusions (please see more in the "Significance" section). I have tried to list the main concerns below.

      We thank the Reviewer for their detailed and critical assessment of our current study.

      Questions/concerns:

      Authors used double transient transfections but have not shown quantification of protein levels of the chaperones versus TDP43 - western blots to confirm proper expression (and levels) of the chaperones/Hero protein is crucial without it, we cannot assume that the differences in TDP-43 aggregation are a result of effective chaperoning or due to a lack of expression of any of the chaperone proteins, or high expression of others.

      We agree with the Reviewer that this is an important and straightforward validation experiment. We will perform the Western Blotting to confirm the proper and comparable expression of the chaperones/Hero proteins.

      Authors used quite a high BSA concentration in the smFRET work; it would be useful to see what the TDP43 smFRET trace looks like without BSA incubation (to ensure it is not causing some effect). Also, is there a concentration dependence? The Authors mention they are unable to identify a Hero/TDP43 complex; but if the amount of Hero protein is high (given that it is single molecules tethered), the change in compaction may not relate to the levels/ratios found in the cells (where changes to aggregation are occurring). have the authors considered whether positively charged polymers (poly-Lys) have any impact on the TDP-43 smFRET distribution? Given that the smFRET trace is so heterogeneous, to understand what is happening here would require the comparison of more than 2 variants.

      As the Reviewer suggests, we will include additional smFRET experiments in our revision.

      First, we will perform the smFRET experiment of the TDP-43 alone in the PBS buffer. However, we would like to clarify the reason we used BSA incubation for comparison in the current experiment is to account for the possibility of non-specific macromolecular crowding effects on the conformation of the LCD (an effect reported for IDPs in general, for example in Banks 2018 Biophys. J.); we expected that it would be fair to compare Hero11 against another protein, rather than buffer alone. As the Reviewer suggested, we can also perform the same experiments at lower concentrations of Hero11 and DNAJA2, including equimolar concentrations (as suggested below). Moreover, we can also test poly-K peptides for comparison.

      Although the A315T variant has a very distinct smFRET profile, it is clear that the effects of Hero11KR-->G (that is proposed to have no effect on aggregation or on the smFRET of WT TDP43) has a clear impact on A315T. Why is this?

      We thank the Reviewer for raising this interesting point. We envision that the observed effect is due to weak interactions between the LCD domain of TDP-43 and Hero11KR->G; even without K and R, there many other functional amino acids that are fully accessible due to the extremely disordered nature of the protein. The effect is easier to be observed with the A315T mutant, compared to the WT TDP-43, presumably because the mutant tends to take more compact conformations on its own. Nonetheless, unlike WT Hero11, Hero11KR->G fails to accumulate the very extended form of the LCD (FRET signal of ~0; please see below for the explanation of this value), which appears to be associated with suppression of aggregation. We will include these in our discussion.

      The LCD region is prone to PMTs - as the tethered protein is taken from expression in mammalian cells, how can the authors be sure that it has no PMTs? Although a clear difference is observed between WT and A315T in terms of "compactness" of the LCD domain, we cannot assume that the effect of DNAJ2 and Hero11 are the same - in fact, the Hero11 KR-->G control for the A315T is clearly different from the negative control (BSA) and the effect that was seen in WT. As the LCD domain is well-known to be the site of post-translational modifications (ie. Phosphorylation - this would have an effect on an electrostatic Hero11), could the effects be related to changes in PMTs as well?

      We thank the Reviewer for their insight. We would like to clarify that we make no assumption that our dye-labeled TDP-43 is free of post-translational modifications. Indeed, the fact that it is derived from HEK293 cells suggests it should have post-translational modifications relevant to humans and may be even considered an advantage of our method. (Most structural methods require purification of a large amount of protein, often only possible through recombinant expression in E. coli, thus lacking human-relevant PTMs.) As the Reviewer points out, the LCD is known to have many phosphorylation sites, which may help explain how the positively charged Hero11 interacts with it. Thus, we will perform mass spectrometry of TDP-43 and the A315T variant expressed in HEK cells to identify what post-translational modifications are present.

      The authors mention other studies on DNJA proteins on TDP-43; is the mechanism by which they suppress aggregation known? If the authors want to compare the unknown effects of Hero11, it would be useful to know what DNJ2A is doing, otherwise, the results are still not conclusive, only that "change is similar" in two experiments. What is known about DNJ2A interactions with TDP-43? Did the authors do any pulldown assays to detect a complex in cellulo?

      While previous studies have identified various DNAJ (specifically J-domain protein B-subfamily) proteins that suppress aggregation of overexpressed TDP-43, not much is known of this specific interaction (Udan-Johns 2014 Hum Mol Genet, Chen 2016 Brain, Park 2017 PLOS Genet). To address the Reviewer’s questions, we will include experiments characterizing the effects of DNAJA2 on TDP-43. We will perform colocalization experiments, explaining effects of DNAJA2 and Hero11 on TDP-43 in the cell. As explained below, we will also perform Pulse Shape Analysis (PulSA), a flow cytometry-based method that can be used to study protein localization patterns in cell, which will also provide insight into the effects on the distribution of TDP-43 in cells. We can also perform co-IP of TDP-43 to detect if there is a detectable, stable complex with DNAJA2 and/or Hero11. Together, these will clarify the similarities and differences between DNAJA2 and Hero11.

      It is unclear how the findings of the smFRET relate to structural understanding of the LCD-domain of TDP43 (i.e. NMR studies?); is it known whether PTMs are more prominent with the A315T variant as this may explain it's more compact nature? As well, putative helical structure in the LCD domain may lend to the changes in compaction.

      The Reviewer brings up an interesting and careful discussion. Currently, it is unknown if PTMs actually cause more compaction, or if they are more prominent in the A315T variant, but we will perform mass spectrometry to detect PTMs.

      As the Reviewer mentions, it would be very interesting to compare our smFRET results to other studies of specific LCD structures. However, it is not trivial to deduce lengths (and structure) from smFRET data as various other factors, for example, dye orientation and local chemical environment, may affect FRET efficiency. Nonetheless, we can still cautiously provide a discussion of how our FRET results compare with previous studies.

      For the dye pair used in our study, Cy3 and ATTO647N, the low/no FRET signals promoted by DNAJA2 and Hero11 correspond to a range of end-to-end distances of 6.9 nm to 10.2 nm (FRET signals of 0.1 to 0.01, respectively). Assuming that the LCD behaves like a ~140 amino acid worm-like chain (WLC) with persistence length (Lp) = 0.8 nm, we expect a mean end-to-end distance of 7.35 nm. Thus, the low FRET peak can be well explained by promotion of an extended WLC behavior of the LCD by DNAJA2 and Hero11. On the other hand, the FRET peaks of WT LCD and the A315T mutant (in the absence of Hero11 or DNAJA2) correspond to ~4 and ~3.3 nm, respectively. We will include a careful discussion of how our results relate to known structural understanding of the LCD in the revised discussion.

      It is unclear how there can be such a prominent FRET ~0 peak and in fact negative values.

      We regret that we did not clearly explain this in the manuscript. Negative values arise when applying correction factors from the alternating laser scheme (ALEX) to FRET signals. FRET efficiency, E, is the ratio of acceptor signal intensity, IA, over the total signal intensity, ID+IA, (with the application of a correction factor, γ, but this doesn’t affect the negative values and won’t be discussed further here) and is given by the equation: E=IA/(γ×ID+IA). However, due to leakage of the donor signal into the acceptor channel and direct excitation of the acceptor dye by the donor laser, raw IA values, IA,raw, are erroneously higher than in reality. For example, the ~0 FRET peaks in question appear to be around 0.1–0.2 before correction. These are accounted for by applying the respective correction factors, Dleakage and Adirect, through the equation: IA=IA,rawDleakage×IDAdirect×IAA. (IAA is the acceptor signal during excitation of the acceptor dye.) These two correction factors are determined by observing the traces and choosing the mean values using iSMS software (2015 Preus Nat Methods) and applied uniformly to all traces in an experiment. When IA is especially low, such as when FRET is almost 0, the magnitude of the correction factor terms may be larger than IA,raw, resulting in negative values. This does not mean that values less than 0 are invalid, but merely that they have been overcompensated in the error application. For the dye pair in our study, FRET efficiencies less than 0.1 correspond to distances greater than 6.9 nm, meaning peaks around zero represent LCD behaviors with end-to-end distances greater than around 7 nm. Please also note that kernel density estimation often gives distributions with values beyond the (0,1) range just because of how these plots are constructed. This will be added to the methods in the revised manuscript.

      Conclusion is that Hero11 and DNJA2 maintain the TDP43 LCD-domain (soluble protein) in an extended form and that this is linked with the decrease in aggregates found in the cell; however, with the cell-based assay, no analysis to quantify the expression levels of the TDP43 and the chaperones/Hero are presented, and more importantly, no analysis on the complementary soluble fraction (to the filter assay) has been done to show that indeed, these biomolecules maintain the proteins in a soluble form. It is possible that the TDP-43 is being degraded?

      As described above, we plan to perform Western Blotting to examine the expression levels of these proteins. To address the concerns about solubility, we will perform Pulse Shape Analysis (PulSA) to quantitatively measure the expression and soluble/aggregated distribution GFP-tagged TDP43 in HEK293T cells. Measuring the soluble diffuse signals and the punctate aggregate signals will also tell us if there are differences in how GFP-TDP43 is aggregated between Hero11, DNAJA2 and controls. In addition, to support results from the FTA, we will provide sedimentation assays, where the soluble and aggregate fraction from cells is separated by centrifugation and analyzed (Krobitsch 2000 PNAS). These will provide information on TDP-43 in the soluble fraction.

      Reviewer #2 (Significance (Required)):

      Contextually, this study has novelty and potential value for basic research. Firstly, understanding the underlying mechanisms by which Hero protein prevent aggregation would be valuable towards understanding the players in protein homeostasis which can be imbalanced with respect to disease. Secondly, the use of smFRET as a tool in understanding the dynamics of TDP-43 and mutational variants can be powerful in defining structural attributes with pathological consequences in ALS. Although this work shows comparisons between the effect of a canonical chaperone (DNJA2) and Hero11 on the dynamics of monomeric protein and the effect on cellular aggregation, proposing a general mechanism on the data from two TDP-43 variants and a cell-based aggregation assay is premature and more experimental evidence is needed to define the critical link that prevents aggregation of TDP-43 within the cell. Mechanistically, the study does not give a lot of additional insight into the mode of action of Hero11 in the process of preventing aggregation (nor does it explain what DNJA2 is doing and therefore how Hero11 compares and contrasts). The proposed "extended versus collapsed" switch is simplistic and doesn't account for the complexity of TDP-43 structural dynamics. To support their proposed mechanism of action, the authors needs to examine TDP-43 mutational variants (specifically disease-related ones) using their smFRET to understand exactly what the "collapsed" and "extended" data is defining before making the leap that this effect is what is preventing aggregation. There are some structural studies about residual structure in this region (via NMR) that should be considered (https://doi.org/10.1016/j.str.2016.07.007). Although the A315T variant has a very distinct smFRET profile, it is clear that the effects of Hero11KR-->G (that is proposed to have no effect on aggregation or on the smFRET of WT TDP43) has a clear impact on A315T. Why is this? Have the authors considered that the LCD domain of TDP43 is prone to post-translational modifications? Is this variant more phosphorylated - a PMT like phosphorylation is surely to have an impact on interactions with Hero proteins as they are positively charged. Given that the protein is expressed in mammalian cells, it is likely that PMTs have occurred (but the authors should analyse for this).

      With regards to the cell-based aggregation assays, the authors again present a simplified relationship - however, a number of control experiments and additional questions arise. It appears that there is less aggregation with co-expression of some chaperones and the Hero11, but what about the soluble fraction? What is the impact of these biomolecules? Is this that it is maintaining soluble protein, enhancing degradation, propagating soluble oligomers? Equally, how do we know that the levels of the chaperones/Heros and the TDP-43 is the same in each cell - these are transient transfections, and no western blots are shown to confirm the levels of the proteins. In fact, the authors state that "co-transfection of HSP70 (HSPA8), HSP90 (HSP90AB1) or HOP all failed to suppress TDP-43 aggregation compared to GST" and mention that this is in contrast to other studies, but could this be a failure to express these in the cell models? Some western blot/lysate analysis is needed. Chaperones often form complexes with their client proteins, is there any evidence of complexes in these cell models (i.e. using immunoprecipitation)?

      We thank the Reviewer for their detailed evaluation and interest in our work. As the Reviewer describes, smFRET is a powerful tool for studying the conformational dynamics of TDP-43, and we hope that this study will contribute to our understanding of how Hero proteins and chaperones prevent aggregation.

      We are also grateful to the Reviewer for their constructive criticism of our current model, and we will revise it accordingly. We completely agree with the Reviewer that there are complex structural dynamics within the LCD that determine aggregation and phase separation behaviors. Our simple model was intended to explain how external factors that suppress aggregation, DNAJA2 and Hero11, could affect the conformation of LCD at the single-molecule level. As discussed above, we were cautious to over-interpret how our FRET observations correlate to specific conformations, leading to this simplistic model. We do not intend for our explanation of “extended versus collapsed” in the model to explain all structural dynamics of the LCD; rather, we wanted to highlight the characteristic low FRET state promoted by DNAJA2 and Hero11. We believe that the experiment plan explained above will address the Reviewer’s concerns in full, and we thank the Reviewer again for helping us to significantly improve our manuscript.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      - In a recent study (PLosBiol, 2020) the same authors described an interesting class of proteins they call 'Hero'. Based on their analyses in cultured cells and transgenic Drosophila models the authors concluded that 'Hero' proteins protect against protein instability and aggregation. So far, this class of proteins has not been analyzed by independent groups.

      In the current manuscript, they mainly confirm their own previous finding that Hero 11 prevents There are several concerns about the presented data:

      We thank the Reviewer for their critical comments on our current manuscript.

      - Based on the filter trap assays shown in figure 1 and 3 the authors conclude that DNAJB8 and Hero11 specifically interfere with the aggregation of TDP-43. However, they do not show that the expression levels of TDP-43 are not altered by the co-expression of the different proteins and are comparable in the different samples. In order to make a relevant statement about the anti-aggregation activity of the analyzed proteins, the ratio between soluble and aggregated TDP-43 has to be analyzed.

      We would like to clarify that the Reviewer means DNAJA2, not DNAJB8. Following the Reviewer’s advice, we will perform Western Blotting combined with sedimentation assays, where the soluble and aggregate fraction from cells is separated by centrifugation and analyzed to examine the expression levels. We will also perform colocalization experiments and Pulse Shape Analysis (PulSA), a flow cytometry-based method that can be used to study protein localization patterns in cell, which will provide insight into the anti-aggregation activities.

      - The FRET assays shown in figures 2 and 4 indicate a slightly higher FRET efficiency in the presence of Hero11 and DNAJA2 and Hero11. The authors postulate that is phenomenon is causally linked to the activity of Hero11 to prevent aggregation of TDP-43. First, it remains unclear whether the slight increase is really significant. Second, I could not find any experimental evidence to support the assumption that a more collapse conformation of the TDP-43 LCD measured in single molecule FRET assays, correlates with an increased aggregation tendency of TDP-43.

      We apologize that we are not sure what the Reviewer refers to by “a slightly higher FRET efficiency in the presence of Hero11 and DNAJA2 (and Hero11).” We would like to clarify that, in the presence of Hero11 and DNAJA2, what we observed was a very low (not slightly higher) FRET efficiency of ~0 (Figure 2g and h), suggesting an extended conformation. In contrast, the aggregation-prone A315T variant of TDP-43 shows a very high FRET efficiency of ~0.9 (Figure 4a), which indicates a collapsed conformation.

      A minor comment, if the authors would like to compare the specific activity of different proteins, they should use equal molarities of the different proteins and not equal amounts.

      As the Reviewer suggests, we will include experiments at equal molarities in the revision.

      - For a one-way ANOVA, the response variable residuals have to be normally distributed. With an n = 3 this cannot be tested. Thus, the quantifications of the results shown in figure 1 and 3 are not reliable.

      We thank the Reviewer for their critical comment on the statistical analysis. We would like to clarify that statistically significant differences in aggregation between conditions compared to a control are based on Dunnett’s test. While ANOVA is typically first performed to test for any significant difference in means before performing a post-hoc test, Dunnett’s test is independent and can be performed without ANOVA.

      Following the Reviewer’s advice, we carefully re-examined our assumption of normality for this data. It is reasonable to perform Dunnett’s test on a sample size of n = 3, and it is generally safe to assume that data from three independent experiments will be reasonably normally distributed. In support of this, performing Kolmogorov-Smirnov test on our data in Figure 1 showed none of the groups differ significantly from normal distributions with the respective mean and standard deviation (p-values greater than 0.05). Thus, we believe it is reasonable to assume the data are normally distributed, the residuals normally distributed, and our statistical analyses reliable. This analysis will be included in the revision to support the normality assumption.

      However, even if we did not assume a normal distribution of our data in Figure 1, we still would have obtained statistically significant differences; If we had relied on a Kruskal-Wallis test as a non-parametric equivalent of ANOVA, thus making no assumption of normality, we would have seen p = 0.005176, a value much lower than our significance level of α = 0.05, indicating sufficient evidence that there is a difference in aggregation among these groups.

      - The title is imprecise and overstate the presented data:

      'canonical chaperone' suggest that their results are valid for chaperones in general. However, they only tested DNAJA2 in the single -molecule FRET assay. Moreover, HAPA8, another canonical chaperone, obviously had an opposite effect on TDP-43 aggregation (Fig.1). Similarly, they only tested Hero11. Thus, 'canonical chaperone' has to be replaced by 'DNAJA2' and 'a heat-resistant obscure (Hero) protein' by 'Hero11'. Similarly, the term 'conformational modulation' is not as concise one would one expect for the title of a research paper.

      We would like to clarify that the Reviewer means HSPA8 (not HAPA8). According to the Reviewer’s suggestion, we will change the title to “DNAJA2 and Hero11 mediate similar conformational extension and aggregation suppression of TDP-43”.

      Reviewer #3 (Significance (Required)):

      In a recent study (PLosBiol, 2020) the same authors described an interesting class of proteins they call 'Hero'. Based on their analyses in cultured cells and transgenic Drosophila models the authors concluded that 'Hero' proteins protect against protein instability and aggregation. So far, this class of proteins has not been analyzed by independent groups.

      In the current manuscript, they mainly confirm their own previous finding that Hero 11 prevents aggregation of TDP-43 and present very few new data that would provide new insights. Specifically, only the FRET assays shown in figure 2 and 4 are really new, which, by the way, could easily be shown in one figure.

      We thank the Reviewer for their critical evaluation of our current study. As the Reviewer suggests, we believe our smFRET results provide new insights into how Hero11 and DNAJA2 function. We would like to emphasize that, rather than confirming our previous findings, our current manuscript mainly addresses a critical point that remained unknown in our previous study by investigating the mechanism of how Hero proteins prevent aggregation. Moreover, to our knowledge, this is the first observation of the TDP-43 LCD, with the effect of a pathogenic mutation, at the single-molecule level.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      • In a recent study (PLosBiol, 2020) the same authors described an interesting class of proteins they call 'Hero'. Based on their analyses in cultured cells and transgenic Drosophila models the authors concluded that 'Hero' proteins protect against protein instability and aggregation. So far, this class of proteins has not been analyzed by independent groups.

      In the current manuscript, they mainly confirm their own previous finding that Hero 11 prevents There are several concerns about the presented data: - Based on the filter trap assays shown in figure 1 and 3 the authors conclude that DNAJB8 and Hero11 specifically interfere with the aggregation of TDP-43. However, they do not show that the expression levels of TDP-43 are not altered by the co-expression of the different proteins and are comparable in the different samples. In order to make a relevant statement about the anti-aggregation activity of the analyzed proteins, the ratio between soluble and aggregated TDP-43 has to be analyzed. - The FRET assays shown in figures 2 and 4 indicate a slightly higher FRET efficiency in the presence of Hero11 and DNAJA2 and Hero11. The authors postulate that is phenomenon is causally linked to the activity of Hero11 to prevent aggregation of TDP-43. First, it remains unclear whether the slight increase is really significant. Second, I could not find any experimental evidence to support the assumption that a more collapse conformation of the TDP-43 LCD measured in single molecule FRET assays, correlates with an increased aggregation tendency of TDP-43. A minor comment, if the authors would like to compare the specific activity of different proteins, they should use equal molarities of the different proteins and not equal amounts. - For a one-way ANOVA, the response variable residuals have to be normally distributed. With an n = 3 this cannot be tested. Thus, the quantifications of the results shown in figure 1 and 3 are not reliable. - The title is imprecise and overstate the presented data: 'canonical chaperone' suggest that their results are valid for chaperones in general. However, they only tested DNAJA2 in the single -molecule FRET assay. Moreover, HAPA8, another canonical chaperone, obviously had an opposite effect on TDP-43 aggregation (Fig.1). Similarly, they only tested Hero11. Thus, 'canonical chaperone' has to be replaced by 'DNAJA2' and 'a heat-resistant obscure (Hero) protein' by 'Hero11'. Similarly, the term 'conformational modulation' is not as concise one would one expect for the title of a research paper.

      Significance

      In a recent study (PLosBiol, 2020) the same authors described an interesting class of proteins they call 'Hero'. Based on their analyses in cultured cells and transgenic Drosophila models the authors concluded that 'Hero' proteins protect against protein instability and aggregation. So far, this class of proteins has not been analyzed by independent groups.

      In the current manuscript, they mainly confirm their own previous finding that Hero 11 prevents aggregation of TDP-43 and present very few new data that would provide new insights. Specifically, only the FRET assays shown in figure 2 and 4 are really new, which, by the way, could easily be shown in one figure.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      In this manuscript, the authors build on their findings (Tsuboyama 2020) that electrostatically charged IDPs (Heros) can protect proteins from denaturation and aggregation. In their previous work, they demonstrate that these Hero proteins could decrease the fraction of insoluble GFP-TDP43∆NLS in mammalian cell lines and that this mode of action was related to the electrostatic charge of the proteins and not sequence dependent. Although this protective mode of action appears to be similar to that of canonical chaperones, it is unclear how the Hero proteins compare. In this study, the authors compare Hero11 to a panel of canonical chaperones in their cell-based assays and show that it prevents aggregation in a comparable way to DNJA2. It appears that Hero11 decreases the GFP-TDP43∆NLS aggregates better than some other chaperones. They then utilise their expertise in smFRET analysis (Tsuboyama, 2018) to compare what effect DNJA2 and Hero11 (along with Hero11KR-->G (non-charged control)) have on the dynamic structures of the GFP-TDP43∆NLS (labelled with complementary fluorophores in the LCD domain). Based on analysis of the WT GFP-TDP43∆NLS and the A315T GFP-TDP43∆NLS, the authors suggest that the presence of Hero11 and DNJA2 maintain the LCD-domain of TDP43 in an extended conformation and that by doing so, aggregation can be prevented (as assessed in the cell-based assay).

      Despite finding the results very interesting, I feel that the study is preliminary and the conclusions drawn are not fully substantiated by the presented experimental work. Many questions need addressing to validate these findings and conclusions (please see more in the "Significance" section). I have tried to list the main concerns below.

      Questions/concerns:

      Authors used double transient transfections but have not shown quantification of protein levels of the chaperones versus TDP43 - western blots to confirm proper expression (and levels) of the chaperones/Hero protein is crucial without it, we cannot assume that the differences in TDP-43 aggregation are a result of effective chaperoning or due to a lack of expression of any of the chaperone proteins, or high expression of others.

      Authors used quite a high BSA concentration in the smFRET work; it would be useful to see what the TDP43 smFRET trace looks like without BSA incubation (to ensure it is not causing some effect). Also, is there a concentration dependence? The Authors mention they are unable to identify a Hero/TDP43 complex; but if the amount of Hero protein is high (given that it is single molecules tethered), the change in compaction may not relate to the levels/ratios found in the cells (where changes to aggregation are occurring). have the authors considered whether positively charged polymers (poly-Lys) have any impact on the TDP-43 smFRET distribution? Given that the smFRET trace is so heterogeneous, to understand what is happening here would require the comparison of more than 2 variants.

      Although the A315T variant has a very distinct smFRET profile, it is clear that the effects of Hero11KR-->G (that is proposed to have no effect on aggregation or on the smFRET of WT TDP43) has a clear impact on A315T. Why is this?

      The LCD region is prone to PMTs - as the tethered protein is taken from expression in mammalian cells, how can the authors be sure that it has no PMTs? Although a clear difference is observed between WT and A315T in terms of "compactness" of the LCD domain, we cannot assume that the effect of DNAJ2 and Hero11 are the same - in fact, the Hero11 KR-->G control for the A315T is clearly different from the negative control (BSA) and the effect that was seen in WT. As the LCD domain is well-known to be the site of post-translational modifications (ie. Phosphorylation - this would have an effect on an electrostatic Hero11), could the effects be related to changes in PMTs as well?

      The authors mention other studies on DNJA proteins on TDP-43; is the mechanism by which they suppress aggregation known? If the authors want to compare the unknown effects of Hero11, it would be useful to know what DNJ2A is doing, otherwise, the results are still not conclusive, only that "change is similar" in two experiments. What is known about DNJ2A interactions with TDP-43? Did the authors do any pulldown assays to detect a complex in cellulo?

      It is unclear how the findings of the smFRET relate to structural understanding of the LCD-domain of TDP43 (i.e. NMR studies?); is it known whether PTMs are more prominent with the A315T variant as this may explain it's more compact nature? As well, putative helical structure in the LCD domain may lend to the changes in compaction.

      It is unclear how there can be such a prominent FRET ~0 peak and in fact negative values.

      Conclusion is that Hero11 and DNJA2 maintain the TDP43 LCD-domain (soluble protein) in an extended form and that this is linked with the decrease in aggregates found in the cell; however, with the cell-based assay, no analysis to quantify the expression levels of the TDP43 and the chaperones/Hero are presented, and more importantly, no analysis on the complementary soluble fraction (to the filter assay) has been done to show that indeed, these biomolecules maintain the proteins in a soluble form. It is possible that the TDP-43 is being degraded?

      Significance

      Contextually, this study has novelty and potential value for basic research. Firstly, understanding the underlying mechanisms by which Hero protein prevent aggregation would be valuable towards understanding the players in protein homeostasis which can be imbalanced with respect to disease. Secondly, the use of smFRET as a tool in understanding the dynamics of TDP-43 and mutational variants can be powerful in defining structural attributes with pathological consequences in ALS. Although this work shows comparisons between the effect of a canonical chaperone (DNJA2) and Hero11 on the dynamics of monomeric protein and the effect on cellular aggregation, proposing a general mechanism on the data from two TDP-43 variants and a cell-based aggregation assay is premature and more experimental evidence is needed to define the critical link that prevents aggregation of TDP-43 within the cell. Mechanistically, the study does not give a lot of additional insight into the mode of action of Hero11 in the process of preventing aggregation (nor does it explain what DNJA2 is doing and therefore how Hero11 compares and contrasts). The proposed "extended versus collapsed" switch is simplistic and doesn't account for the complexity of TDP-43 structural dynamics. To support their proposed mechanism of action, the authors needs to examine TDP-43 mutational variants (specifically disease-related ones) using their smFRET to understand exactly what the "collapsed" and "extended" data is defining before making the leap that this effect is what is preventing aggregation. There are some structural studies about residual structure in this region (via NMR) that should be considered (https://doi.org/10.1016/j.str.2016.07.007). Although the A315T variant has a very distinct smFRET profile, it is clear that the effects of Hero11KR-->G (that is proposed to have no effect on aggregation or on the smFRET of WT TDP43) has a clear impact on A315T. Why is this? Have the authors considered that the LCD domain of TDP43 is prone to post-translational modifications? Is this variant more phosphorylated - a PMT like phosphorylation is surely to have an impact on interactions with Hero proteins as they are positively charged. Given that the protein is expressed in mammalian cells, it is likely that PMTs have occurred (but the authors should analyse for this).

      With regards to the cell-based aggregation assays, the authors again present a simplified relationship - however, a number of control experiments and additional questions arise. It appears that there is less aggregation with co-expression of some chaperones and the Hero11, but what about the soluble fraction? What is the impact of these biomolecules? Is this that it is maintaining soluble protein, enhancing degradation, propagating soluble oligomers? Equally, how do we know that the levels of the chaperones/Heros and the TDP-43 is the same in each cell - these are transient transfections, and no western blots are shown to confirm the levels of the proteins. In fact, the authors state that "co-transfection of HSP70 (HSPA8), HSP90 (HSP90AB1) or HOP all failed to suppress TDP-43 aggregation compared to GST" and mention that this is in contrast to other studies, but could this be a failure to express these in the cell models? Some western blot/lysate analysis is needed. Chaperones often form complexes with their client proteins, is there any evidence of complexes in these cell models (i.e. using immunoprecipitation)?

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary:

      The submitted manuscript is comparing the effect of individual chaperones and heat-resistant obscure (Hero) proteins on the overall folding of the TDP-43 LCD-domain and its relation to aggregation propensity. Therefore, the authors apply smFRET in order to deduce eventual morphological changes of the LCD-domain from FRET efficiencies. The authors observe that the LCD domain extends its structure upon binding of chaperone/Hero proteins whereas it is collapsed in the absence of those. Furthermore, immunoblotting of filter trap assays indicate that overexpression of chaperones and Hero proteins reduce aggregation of TDP-43 in vivo. Both, the morphological effects on the LCD-domain and the aggregation propensity are significantly enhanced for the TDP-43 A315T mutant. Moreover, the authors tested a charge depleted Hero protein version with reduced "chaperone-like" behaviour. Therefore, the authors conclude that the binding or chaperone activity of the Hero protein is based on its residue specific charges. Finally, the authors conclude that Hero proteins can act similar to chaperones in order to keep protein homeostasis under stress conditions.

      Major comments:

      The similar effect of chaperones and Hero proteins on the morphology of TDP-43 found by the authors is intriguing and the applied experimental procedures seem well described and conducted.

      However, the assumption of the authors that a change in morphology of the LCD-domain by the chaperones and Hero proteins is directly connected to the reduction of TDP-43 aggregation is not entirely clear. Whether an overexpression of individual chaperones and Hero proteins has a direct effect on TDP-43 aggregation cannot be tested in vivo, only. It cannot be excluded that inside the cell the here tested chaperones and Hero proteins control intermediate processes or work as co-factors for other proteins involved in protein homeostasis rather directly influencing the aggregation of TDP-43. Therefore, I recommend in vitro aggregation experiments, using ThT signal as a readout. By adding chaperones, Hero proteins and a negative (BSA or others) control individually, a direct effect on TDP-43 aggregation could be concluded. Those experiments have been extensively used in the field and are quick and straightforward to handle.

      In addition, focusing on the LCD-domain as a main driver for TDP-43 aggregation is limiting this study. In particular, recent studies [1] indicate that the RRM1 and RRM2 sites of TDP-43 have a major impact on TDP-43 gelation and maturation to solid aggregates. Unfortunately, those sites have not been studied in this manuscript.

      As an optional alternative for using Hero11KR->G could be the alteration of buffer conditions and using higher number of salts to promote charge screening. It would be of interest whether the results with the Hero11KR->G could be reproduced with wild type Hero11.

      [1] Lu et al. Nat Cell Biol;24(9):1378-1393 (2022)

      Minor comments:

      Overall, the text is clearly written, and the figures are appropriate.<br /> Whether the activity of individual chaperones or Hero proteins on TDP-43 aggregation "may result in the overall fitness of the cell" or "reinforcing the conformational health of the proteome" is disputable without knowing how the overexpression of certain chaperones or Hero proteins alter the formation of toxic TDP-43 oligomers.

      Significance

      Studying the mechanistic effects of chaperones on aggregating proteins is of major interest for the field in order to understand aging related disbalance of protein homeostasis and the progression of neurological decline, such as seen for amyotrophic lateral sclerosis (ALS). Furthermore, finding homolog proteins, also being able to inhibit protein aggregation, can help to understand overall mechanisms of protein aggregation and processes preventing such fatal behaviour. However, the technique used in this manuscript are not very novel and have been used numerously times before. smFRET is a common technique to look at protein folding/unfolding and is used frequently as a molecular ruler. The manuscript is of interest for the field of protein aggregation and folding, smFRET and neurodegeneration.

      My expertise lies in the field of protein aggregation and inhibition due to chaperones, measuring molecular interactions and neurodegenerative diseases.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      We are obviously very pleased with the general support expressed by the referees, and appreciate their critical comments. We detail below how we propose to respond to their suggestions and queries.

      In view of the fact that my lab is no longer in existence, I will have to rely on the kind generosity of my colleagues at EMBL to host former team members (the two first authors) for a limited period to come back to Heidelberg to carry out any further experimental work that may be needed. This means we will have to limit the work we can do to those experiments with the highest priority. However, we are optimistic that we will be able to obtain indicative results.

      We will also follow most of the referees’ other suggestions and requests for additional data and quantifications, as outlined (or already included) below.

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      Summary: ASC is the Pyrin/CARD-containing adapter protein that functions as a core component of inflammasome signaling complexes. ASC functions downstream of various NLR- and ALR-inflammasome initiator proteins and upstream of the inflammatory caspases that function as inflammasome effector enzymes. This study uses a novel chimeric construct (Opto-ASC) comprising the Arabidopsis photo-oligomerizable cryptochrome 2 (Cry2-olig) protein with zebrafish ASC to generate transgenic zebrafish larvae wherein ASC oligomerization can be rapidly, dynamically and spatially induced by blue light illumination of either the entire larva or single cells within discrete tissues of an intact larva. Induction of these "opto-inflammasome" complexes is coupled with state-of-the-art, live-cell optical imaging of multiple single cell and integrative tissue parameters to assay various modes of regulated cell death within the peridermal and basal cellular layers of the larval skin. This experimental model was further combined with genetic manipulation of the expression of various zebrafish inflammatory or apoptotic caspases, as well as the two zebrafish members of the gasdermin family of pore-forming proteins which can mediate disruption of plasma membrane permeability without (pre-lytic) or with (pyroptosis) progression to lytic cell death.

      The main results of the study are: 1) introduction of a novel experimental system for dynamic and spatially resolved ASC oligomerization and speck formation within the cells of intact epithelial tissues of a living organism; 2) the ability of these optically induced ASC oligomers/specks to drive multiple modes of regulated cell death which exhibit some (but not all) features of lytic pyroptosis or non-lytic apoptosis depending on cell type and tissue location; 3) the ability of the dying epithelial cells containing optically-induced ASC specks to coordinate rapid adaptive responses in adjacent non-dying cells to maintain integrity/ continuity of skin epithelial barrier; and 4) unexpectedly, no obvious role for either of the two zebrafish gasdermins in the regulated cell death responses.

      Major Comments:

      1. Are the claims and the conclusions supported by the data or do they require additional experiments or analyses to support them? The major goal of this MS is to present a new experimental model (optogenetic activation of ASC oligomerization in transgenic zebrafish) that has the potential to provide new insights regarding the multiple mechanisms by which ASC can regulate inflammasome/ cell death signaling responses in the context of an intact organism. As noted above, some of the observed results are unexpected (e.g., lytic cell death independent of the zebrafish gasdermins in particular epithelial cells) and may reflect mechanisms unique to zebrafish as a non-mammalian vertebrate model versus the mammalian experimental systems (murine and human) that have informed most of our current understanding of how ASC coordinates inflammasome and cell death responses. However, the authors have used rigorous genetic approaches to rule out trivial explanations for the unexpected observations. Thus, no major additional experiments are required to support the claims and conclusions presented in the MS.

      2. Are the suggested experiments realistic in terms of time and resources? Yes. It would help if you could add an estimated time investment for substantial experiments: A few weeks.

      3. Are the data and the methods presented in such a way that they can be reproduced? Are the experiments adequately replicated and statistical analysis adequate? Yes.

      4. Are the experiments adequately replicated and statistical analysis adequate? Yes.

      Minor comments

      1. Specific experimental issues that are easily addressable:

      There's a significant concern with the use of LDC7559 (line 387) as a putative small molecule inhibitor of gasdermin D function to test roles (or lack thereof) of the zebrafish gasdermins in the ASC-triggered lytic cell death responses. A recent study (Amara et al. 2021. Cell. PMID34320407) has reported that LDC7559 does not inhibit gasdermin D (and possibly other gasdermins) but rather acts as an allosteric activator of PFKL (phosphofructosekinase-1 liver type) in neutrophils and thereby suppress generation of the NADPH required for the phagocytic oxidative burst and consequent NETosis. Thus, use of LDC7559 as a presumed gasdermin inhibitor in the current MS is problematic and should be deleted. As an alternative pharmacological approach to suppress gasdermin function, the authors might consider the use of either disulfiram (Hu et al. 2020. Nature Immunology. PMID32367036) and/or dimethylfumarate (Humphries et al. Science. 2020. PMID32820063). These would be straightforward additional experiments.

      We have ordered the reagents to do these experiments. We are optimistic that we will obtain data that will strengthen this part of the ms and be a pointer for future studies by others.

      We propose to keep the information on LDC7559 included, but to discuss the reservations the referee lists above - otherwise, others might ask why we did not even try this inhibitor. .

      Are prior studies referenced appropriately? there are some problems; see below. 2a. One paper is cited twice in lines 724-726 and 727-729. 2b. Another paper is cited twice in lines 790-792 and 793-795. 2c. No journal is included for the referenced study by Shkarina et al in lines 827-828. 2d. No journal is included for the referenced study by Stein et al in lines 831-832. 2e. No journal is included for the referenced study by Masumoto et al in lines 793-795. 2f. No journal is included for the referenced study by Kuri et al in lines 774-775.

      We are embarrassed about these omissions and mistakes and have corrected them..

      Are the text and figures clear and accurate? Generally, yes but with a few exceptions noted below: 3a. line 28: "morphological distinct" should read "morphologically distinct" 3b. line 161: this sentence contains in parentheses "for how long?" I think this was a comment by one author that wasn't removed from the final submitted MS 3c. line 945: spelling "balck" > "black" 3d. line 268: "whereas showed a delayed speck formation": the authors need to specify what model/ condition showed a delayed speck formation 3e. line 262: spelling "egnerated" > "generated"

      Thank you, all corrected.

      CROSS-CONSULTATION COMMENTS I also agree with the comments of the other 2 reviewers. Between the 3 sets of comments and suggestions, the aggregate review will provide the authors with a suitable range of feasible recommendations that will improve an already strong MS.

      Reviewer #1 (Significance (Required)):

      1. General assessment: As noted above, this the major goal of this MS is to present a new experimental model (optogenetic activation of ASC oligomerization in transgenic zebrafish) that has the potential to provide new insights regarding the multiple mechanisms by which ASC can regulate inflammasome/ cell death signaling responses in the context of an intact organism. The authors have used rigorous genetic approaches to rule out trivial explanations for the unexpected observations. In general, the MS describes an elegant model system that will provide a platform for identifying new mechanisms of ASC-dependent inflammasome signaling and regulated cell death.

      2. Advance: This MS describes a highly novel experimental model. Zebrafish are increasingly being used as a genetically tractable model for inflammasome signaling within integrated tissues of intact organism. As noted above, the advances are technical but also conceptual. Future application of this novel model is likely to yield identification of new mechanisms for ASC function in innate immunity and regulated cell death within the context of tissue homeostasis and host defense.

      3. Audience: Basic research and discovery.

      4. Please define your field of expertise with a few keywords to help the authors contextualize your point of view: My group investigates multiple aspects of inflammasome signaling biology at the cellular level with an emphasis on cell-type specific roles for gasdermins in coordinating downstream innate immune responses to inflammasome activation in various myeloid leukocytes (macrophages, dendritic cells, neutrophils, eosinophils, mast cells).

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      Programmed cell death is critical for host defense and tissue homeostasis. How dead cells initiate cellular responses in the microenvironment with neighbouring cells in vivo is still largely unknown. The authors have chosen a Zebrafish model to tackle this question, given that this model shows advantages for imaging and addresses these pathways in a complex in vivo setting. Their recent development of light-induced activation of caspases (published in JEM) enabled them to investigate cellular responses to a specific type of cell death in vivo at a single cell resolution. In this study, the author further developed a light-induced activation of ASC to specifically look at inflammasome activation-mediated cell death in vivo. The authors have successfully established this system in zebrafish and also observed that Opto-Asc-induced cell death showed different phenotypes as compared to Opto-caspase-a/b-induced cell death. However, it is not really clear why. I have a few specific comments to be addressed or discussed.

      1. In Fig.3 and Fig.4, the majority of Opto-Asc localizes to the plasma membrane but not endogenous Asc. It seems that tagging affects its localization, which could potentially explain its slow kinetics in oligomerization.

      That is an interesting suggestion. The membrane enrichment is indeed reproducible and we have no full explanation for it. However, ASC itself seems to have some affinity for the cell cortex as seen by its association with the apical actin ridges in keratinocytes in the resting state (see e.g. figure 3A). Affinity of ASC for actin is also documented in the literature:(F-actin dampens NLRP3 inflammasome activity via flightless-1 and LRRFIP2 OPEN; https://doi.org/10.1038/srep29834).

      Perhaps the fusion to the optogenetic module somehow enhances the affinity through the initial dimerization. But we can only speculate and have no further evidence that would allow reliable conclusions.

      In Fig.7, the authors showed that deletion of Caspb, but not Caspa, affected the apical extrusion, without affecting cell death. This may indicate that other caspases, like Caspase-8 or/and caspase-3 were involved. This could be addressed through deletion of Caspase-8 or/and caspase-3.

      These are experiments we had in fact done. Unfortunately, they did not allow us to address the question, because the deletions resulted in embryonic lethality. We have added this information to the text.

      It is very surprising that Opto-Asc-mediated cell death is not dependent on Gasdermins, at least in Caspb-dependent apically extruded dead cells.

      Indeed – but see comment by and our response to reviewer 1. We hope to be able to provide additional data.

      CROSS-CONSULTATION COMMENTS I agree with the other two reviewers and don't have further comments.

      Reviewer #2 (Significance (Required)):

      The Opto-Asc zebrafish model developed in this study will enable us to specifically look at inflammasome-mediated cell death in vivo. This model is more physiologically relevant compared to Opto-caspase1 model.

      Audience interested in physiological function of inflammasome activation, but it is questionable whether such a tool will address mechanisms in mammalian cells. Eventually, more evidence for the latter could be provided.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      In this article, de Carvahlo and colleagues describe a novel optogenetic tool allowing single cell and temporally controlled induction of ASC clusters in vivo (in zebrafish), a central adaptator protein of the inflammasome complex which is involved in the induction of pyroptosis. This alternative mode of programmed cell death is involved in pathogen response and promote cell swelling and the release of pro-inflammatory factors. Previous works have shown that the inflammasome activation is associated with the formation of a large cluster of ASC protein (called speck) which promotes then the recruitment and the activation of caspase 1. Specks were previously characterised by the same group in vivo (in zebrafish larvae) and could be induced by the overexpression of ASC protein. This however was not compatible with fine spatio-temporal control of speck formation, thus preventing very refined characterisation of the dynamics and the distinction of the cell autonomous and non-cell autonomous effects.

      By fusing ASC to the blue-light sensitive oligomerising protein Cry2-olig under the control of a heat shock promoter, they could induce time controlled induction of speck at the single cell level, which is then followed by cell extrusion and cell death both in the periderm and the basal cell of the skin of zebrafish larvae. Doing so, they could characterise the dynamics of speck formation as well as key paramters affecting its dynamics and the subsequent extrusion. While ASC activation led to apical or basal extrusion in the periderm layer followed by non-apoptotic cell death, it triggers basal extrusion and apoptosis in the basal layer. Importantly, periderm cell elimination does not seem to strictly follow all the features of pyroptosis as it does not require GSDM, and relies on Caspb (not Caspa). It is also associated with strong Calcium release both in the dying and neighbouring cells.

      The authors performed a very careful characterisation of the tools and the optimisation of the condition to form speck and eliminate cells. The experiments are very well performed with all the necessary controls. The results, while to some extend still hard to fully interpret for some aspects, illustrate the plasticity of cell death and cell extrusion, which include several very interesting observations on the direction of extrusion, putative compensatory modes of cell death upon Caspase1 perturbation and the difference of response to ASC clustering depending on the tissue layer. While it is not the main point of this study, the observation that the direction of extrusion can vary very significantly in different genetic backgrounds is also extremely interesting.

      The atypical cell elimination revealed in the system may require further characterisation in the future and suggest that the tools may not be the best to study bona fide pyroptosis. However, I don't believe there is always such strict separation between the modes of cell death and I am sure that it could lead to very interesting insights on inflammasome formation, extrusion and charcaterisation of downstream signalling in vivo, so overall this will be a very interesting resource for the community working on inflammasome, cell death and extrusion.

      I have some suggestions that could help to better characterise the mode of elimination as well as the mechanism of speck formation. I have also some suggestions for comparison with other published results as well as some text editing.

      Main points :

      1. So far, it remains a bit unclear how the authors define precisely speck versus any aggregate and the light induced clusters of Cry2 olig. Is it related to the timescale of formation and/or the lifetime of the aggregates? Is it related to their size?

      There Is no ‘formal’ definition of an inflammatory speck apart from it being the unusually large aggregates that ASC forms once it is activated. Light-induced clusters of Cry2Olig alone, or of Cry2olig fusions with proteins that do not normally oligomerize are much smaller (extensive documentation in the literature).

      A speck is thus a stable aggregate of ASC which is usually around 1 µm in size and is able to activate downstream caspases. But neither of these aspects alone are unique to ASC: prion-like structures can also be large aggregates (indeed ASC-specks have been compared to prions), and much smaller molecular assemblies can activate caspases. Thus ‘speck’ is more an operational definition, and ‘natural’ specks do have both of these properties, but as our experiments show, the properties can actually be separated. I would rather not try to narrow or change the definition, but leave any further discussion to the experts in the field.

      Figure 4E shows a number of variants of ‘speck’-like and other multimers: ASC-mKate and Opto-ASC form large single specks in the presence of endogenous ASC. Opto-ASC specks are only slightly smaller than those formed by endogenously tagged ASC-GFP (see also Supplementary Figure 2E.. Opto-PYD recruits endogenous ASC and becomes incorporated into a speck of approximately the same size, while Opto-CARD does so less efficiently. All of these kill cells. In the absence of endogenous ASC, Opto-ASC forms much smaller specks, and very many in each cell, but these are still functional as seen by the fact that they still kill cells (not the large spot at t = 60 min in the right half of Fig. 4E is not a speck, but the contracted dying cell). Both Opto-PYD and Opto-CARD also form only the small aggregates (quantification will be included), with Opto-PYD still killing the cell by virtue of its ability to recruit caspases via their PYD, whereas Opto-CARD does not.

      Since the authors use most of the time constant blue light illumination, could they also assess how long the speck remains after stopping blue light exposure and quantify their lifetime (relative to the CRY2olig cluster lifetime)?

      Briefly, any speck that contains a functional ASC moiety remains stable and does not disassemble once the blue light is turned off. In skin cells it is not possible to make quantitative measurements because they are killed by the speck. Opto-ASC specks remain stable until they are taken up by macrophages, as originally reported for ASC-GFP specks in Kuri et al. 2017.

      Stability can best be assessed in muscle cells, which do not die upon speck formation. The figure below shows that specks begin to form within minutes of a short pulse of illumination and remain stable (and indeed grow further) for at least 60 min.

      Here is an example:

      Revisions Figure A:

      __Stability of __Opto-ASC specks in muscle cells after exposure to a single pulse of blue light

      Specks in muscle cells expressing Opto-AscTg(mCherry-Cry2olig-asc) are induced by a single illumination with blue light (488nm) at t = 0 for 32 seconds. Multiple oligomers begin to form within 6 minutes, continue to gradually increase in number and, and remain until the end of the movie (60 mins).

      Cell outlines in the overlying epithelium labeled by AKT-PH-GFP are faintly visible in the first frame. Scale bar is 20 mm.

      Similarly could they provide some comparison of the size and localisation of CRY2 olig clusters compared to the speck.

      For size, see above. In addition, the size of the Cry2 oligomers as well as of Opto-ASC specks can vary with expression levels.

      For location, Cry2olig clusters are usually distributed throughout the cell, as seen in most of the right panels in Fig 4E, and in earlier work in cultured cells (e.g. Taslimi et al 2014). ASC specks can form anywhere in the cell, while Cry2olig-ASC has a preference for the cell cortex, but this is not absolute. In keratinocytes, but not in basal cells, the speck usually forms close to the lateral membrane. In the absence of endogenous ASC no real speck is formed but Opto-ASC in this case shows no clear localisation of Opto-ASC to the membrane.

      In view of the variation we see, a strict quantification is difficult: what would be the ‘correct’ definition of classes to look at? To make statistically significant statements, we would need an enormous number of examples in which we could control for all of the variation of expression levels, cell size, day to day variation etc, and we currently don’t have these. We hope the qualitative evidence in the micrographs we show represents the differences well, and we will be happy to provide a larger number of images, if the referees feel this would be helpful.

      With the non functional CRY2olig Asc fusion (Cter fusion), do they still see transient olig2 clustering which then reverse when blue light illumination is gone? I think it might be useful to clarify these points in the main text since most of the quantifications are based on speck localisation/numbering, so their characteristics have to be very well defined.

      That would be interesting to work out, but after our initial experiments with this construct, we did not pursue this further, since it was not a pressing issue at the time. If we can fit this into our planned experimental time table, we will re-assess it. However, while of interest, we feel these data would not add substantially to what we know at this point.

      1. In all the snapshots of speck formation, there seems to be a relative enrichment of the ASC signal at the cytoplasmic membrane (relative to the cytoplasm) prior to strong speck formation. This seems specific of optoASC as it does not seem to happen for the endogeneous ASC or upon overexpression of ASC-mKate (both in this study and in the previous study published by the same group). Is this apparent membrane enrichment something reproducible? (I see that on pretty much every example of this manuscript). If so what could be the explanation? Is there an actual recruitment at the membrane or is it because the membrane/cortical pool takes longer to be recruited in the speck (hence looking relatively more enriched at intermediate time points).

      See our speculations in response to point 1 of the first referee.

      We too would really like to understand this, but see no easy and efficient way of testing it at this point.

      1. There is also a very distinctive ring accumulation that seems to match with apical constriction and/or a putative actomyosin ring (since this is perfectly round, it could match with a structure with high line tension) (see Figure 1E, Figure 3B, Figure 4D...). Is it something already known? Could the authors comment a bit more on this? This could suggest that ASC accumulates in actomyosin cortex, which would be a very interesting property.

      We see that we had failed to be clear about this.

      There are two types of actin-labelled rings that appear around dying cells. One is formed by the epithelial cells that surround the dying cell. This structure becomes visible as soon as the cell begins to shrink. That it is formed by the surrounding cells is clear from mosaics where the dying cell does not express the actin marker (e.g. suppl. Figure 4A) and the parts of the ring are seen only in the subset of surrounding cells that do express the marker. This ring is also not circular, but follows the polygonal shape of the shrinking cell. We believe that this is the contractile structure that closes the wound, as observed in many other cases of wound healing.

      The other is the one the referee describes here. It is formed within the dying cell, as shown by the fact that it is visible in labelled cells when all the surrounding cells are negative for the marker. The other difference is that it appears only once the dying cell has already contracted considerably and begins to round up and be extruded (most clearly seen in Fig. 1E). The third referee had raised a similar point in relation to the same structure seen in Fig. 6C, and we provide below the requested analysis. It relies on resolution in the y-axis, which is unsatisfactory, but nevertheless, it is clear that this ring is in a plane above the apical surface of the epithelium (marked by the red membrane marker, i.e is present in the detaching cell. It may well simply be actin appearing in the entire cortex of the cell as it rounds up and looking like a ring when seen from above. A completely different method for imaging would have to be set up to document this reliably, but we hope that these explanations help to clarify the confusion we may have created.

      We do not see this accumulation in cells that leave the epithelium towards the interior (see figure in the response to ‘minor points’ below).

      In the end, since cell death can also occur without visible speck formation, I am wondering if they are eventually the most relevant structure to be quantified. Is it because speck can be dissolved upon caspase activation and could it relates to the speed at which caspase are activated (which may not leave enough time for strong aggregation and visible speck formation)? I believe it would help to get more explanation/discussion on this point.

      As already mentioned above, it is indeed not obvious what the significance of the large speck is (and it is extremely puzzling why it is that normally one a single one forms in each cell). We agree that it is not necessarily functionally relevant for the signalling outcome to quantify this property – but nor was this the purpose of this work. Regardless of what kind of aggregate is formed, the optogenetic tool allows the induction of ASC-dependent cell death, and therefore the study of the ensuing cellular events.

      The compensatory mechanisms that lead to cell death/extrusion despite depletion of caspb is very interesting. Could the authors use some pan caspase inhibitor (like zvad FMK) to confirm that this block opto-ASC cell death also in this context? Alternatively could they check the status of effector caspase activation using live probe (nucview) or immunostaining in the context of caspb depletion?

      Those would be interesting avenues to pursue. However, for the reason stated above (Leptin lab closing down, members of fish group no longer at EMBL), we are forced to restrict ourselves to the most important experiments, and think we should prioritize the ones mentioned above.

      1. If I understand well, Figure 7C on the right side suggest that the double KO cells don't extrude (if indeed "no change" mean no extrusion, by the way this nomenclature may deserve some clarification in the legend). I don't think these results are mentioned at any point in the main text, but it would be important to include them (since this is an important control).

      This interpretation is in fact correct, and we have changed the labelling in the figure to ‘no immediate death’

      1. Waves of calcium following cell death and cell extrusion have been previously characterised (Takeushi et al. Curr Biol 2020, Y Fujita group). Interestingly, in this previous article they observed waves of calcium near Caspase8 induced death (in MDCK) as well as near laser induced death in zebrafish, while apparently the authors don't see such Calcium waves upon Caspase8 activation in the zebrafish here. I think it would be important to include a comparison of the authors results with this previous paper in the discussion

      We have included this in our discussion.

      There is also a previous study which characterised the impact of caspase1 on cell extrusion (Bonfim Melo et al. Cell Report 2022, A. Yap lab) which promotes apical extrusion in Caco2 cells. I think it would also be important to include this work in the discussion and to compare with the results obtain here in vivo.

      We have included this in our discussion.

      Other minor points:

      1. Line 439: are the numbers given in percentage? if these are absolute numbers, it is out of how many cells ? Same remark line 445: what are the number of cases representing? (percentage?)

      We have rephrased this to make it unambiguous.

      Figure 5: could the authors show periderm and basal cell extrusion with the same type of markers? (membrane or actin or ZO1)? This would help to really compare accurately the morphology and the remodellings associated.

      We used Utr-mNeonGreen to lable actin both in periderm and basal cells. Actin labeling of extruded periderm cells is shown in figure 6C, actin labeling of a dying basal cells and the overlying periderm cells is shown in supplementary figure 5A.

      Is there any obvious differences in cell size or characteristic cell shape between the classic lab strains (golden, AB, AB2B2) and the WIK and experiment strain used here? I do acknowledge that this is clearly not the focus of this study, but given this striking difference (which is related to an important question in the field of extrusion), it would interesting to mention this if there is anything obvious.

      We will make these measurements and include the data.

      1. Figure 6C: what is exactly the localisation in Z of this strong actin accumulation observed during apical extrusion? Is it apical or is it rather on the basal side of the cell? A lateral view of actin could be useful in this figure for all the different conditions described.

      See response to ‘main point 3’ above.

      The images that show this are below. However, even from these images it is hard to appreciate the locations. They are in fact much easier to see by following the movies over time, and through the z-sections at any given time point. We will of course submit the movies with the manuscript.

      Revisions figure B:

      Localization of actin in the yz and xz planes in Opto-Asc-induced cell death and Opto-caspase-8-induced apoptosis

      Orthogonal projections of images of apically (A) and basally (B, C) extruded cells at four time points from time lapse recordings. Each time point shows the x-z plane and the orthogonal yz and and xz planes, in which the apical sides of the epithelium faces the x-z image.

      Actin is labeled with mNeonGreen-UtrCH (cyan), plasma membranes and internal membranes by lyn-tagRFP (magenta). Actin is initially concentrated in the apical cortical ridges of periderm cells.

      1. Apically extruded cell after death is induced by Opto-Asc. As the cell dies actin is lost from the apical ridges and accumulates in the cell cortex in a plane above the original apical surface of the epithelium
      2. Basally extruded cell after death is induced by Opto-Asc. Actin is retained in the apical ridges as the cell shrinks and moves below the epithelium within the dying cell.
      3. Basally extruded cell after death is induced by Opto-Caspase 8. The apical surfaces forms a transient dome in which the actin ridges remain intact before the dying cell is internalized. .

      Figure S3B: could the authors show the utrophin-neonGreen channel separatly? Is there a ring of actin in the dying cell? Also are the membrane protrusion formed more basally? (I suspect this is a z projection, but this would need to be specified in the legend).

      1. Figure 4A legend: I guess the authors meant red arrowheads rather than frame ? This has been corrected

      2. I list below a number of typos I could find in the main text

      Thanks for noticing these, we have corrected all of these, as well as further typos we found.

      Line 29: in Line 30: but Line 151 : from the ...[...] (tissue ?) Line 161: there is most likely a text commenting that was not removed (for how long?) Line 262: generated (egnrtd) Line 268: whereas showed a delay (the subject is missing) Line 269: a point is missing Line 362: which the lack Line 368: a point is missing Line 400: a space is lacking "cellsdepending" Line 438: shrinkwe (space) Line 459 : or I infections Line 525: there is a point missing.

      CROSS-CONSULTATION COMMENTS I generally agree with all the comments raised by the other reviewers which partially overlap with comments I had (see for instance referee two for the role of other caspases and the membrane localisation of the probe).

      Reviewer #3 (Significance (Required)):

      In this article, de Carvahlo and colleagues describe a novel optogenetic tool allowing single cell and temporally controlled induction of ASC clusters in vivo (in zebrafish), a central adaptator protein of the inflammasome complex which is involved in the induction of pyroptosis. This alternative mode of programmed cell death is involved in pathogen response and promote cell swelling and the release of pro-inflammatory factors. Previous works have shown that the inflammasome activation is associated with the formation of a large cluster of ASC protein (called speck) which promotes then the recruitment and the activation of caspase 1. Specks were previously characterised by the same group in vivo (in zebrafish larvae) and could be induced by the overexpression of ASC protein. This however was not compatible with fine spatio-temporal control of speck formation, thus preventing very refined characterisation of the dynamics and the distinction of the cell autonomous and non-cell autonomous effects.

      By fusing ASC to the blue-light sensitive oligomerising protein Cry2-olig under the control of a heat shock promoter, they could induce time controlled induction of speck at the single cell level, which is then followed by cell extrusion and cell death both in the periderm and the basal cell of the skin of zebrafish larvae. Doing so, they could characterise the dynamics of speck formation as well as key paramters affecting its dynamics and the subsequent extrusion. While ASC activation led to apical or basal extrusion in the periderm layer followed by non-apoptotic cell death, it triggers basal extrusion and apoptosis in the basal layer. Importantly, periderm cell elimination does not seem to strictly follow all the features of pyroptosis as it does not require GSDM, and relies on Caspb (not Caspa). It is also associated with strong Calcium release both in the dying and neighbouring cells.

      The authors performed a very careful characterisation of the tools and the optimisation of the condition to form speck and eliminate cells. The experiments are very well performed with all the necessary controls. The results, while to some extend still hard to fully interpret for some aspect, illustrate the plasticity of cell death and cell extrusion, which include several very interesting observations on the direction of extrusion, putative compensatory modes of cell death upon Caspase1 perturbation and the difference of response to ASC clustering depending on the tissue layer. While it is not the main point of this study, the observation that the direction of extrusion can vary very significantly in different genetic backgrounds is also extremely interesting.

      The atypical cell elimination revealed in the system may require further characterisation in the future and suggest that the tools may not be the best to study bona fide pyroptosis. However, I don't believe there is always such strict separation between the modes of cell death and I am sure that it could lead to very interesting insights on inflammasome formation, extrusion and charcaterisation of downstream signalling in vivo, so overall this will be a very interesting resource for the community working on inflammasome, cell death and extrusion.

      My expertise are in cell extrusion, optogenetics, apoptosis and epithelial mechanics. I am not a specialist of the inflammasome and pyroptosis.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      In this article, de Carvahlo and colleagues describe a novel optogenetic tool allowing single cell and temporally controlled induction of ASC clusters in vivo (in zebrafish), a central adaptator protein of the inflammasome complex which is involved in the induction of pyroptosis. This alternative mode of programmed cell death is involved in pathogen response and promote cell swelling and the release of pro-inflammatory factors. Previous works have shown that the inflammasome activation is associated with the formation of a large cluster of ASC protein (called speck) which promotes then the recruitment and the activation of caspase 1. Specks were previously characterised by the same group in vivo (in zebrafish larvae) and could be induced by the overexpression of ASC protein. This however was not compatible with fine spatio-temporal control of speck formation, thus preventing very refined characterisation of the dynamics and the distinction of the cell autonomous and non-cell autonomous effects.

      • By fusing ASC to the blue-light sensitive oligomerising protein Cry2-olig under the control of a heat shock promoter, they could induce time controlled induction of speck at the single cell level, which is then followed by cell extrusion and cell death both in the periderm and the basal cell of the skin of zebrafish larvae. Doing so, they could characterise the dynamics of speck formation as well as key paramters affecting its dynamics and the subsequent extrusion. While ASC activation led to apical or basal extrusion in the periderm layer followed by non-apoptotic cell death, it triggers basal extrusion and apoptosis in the basal layer. Importantly, periderm cell elimination does not seem to strictly follow all the features of pyroptosis as it does not require GSDM, and relies on Caspb (not Caspa). It is also associated with strong Calcium release both in the dying and neighbouring cells.

      • The authors performed a very careful characterisation of the tools and the optimisation of the condition to form speck and eliminate cells. The experiments are very well performed with all the necessary controls. The results, while to some extend still hard to fully interpret for some aspects, illustrate the plasticity of cell death and cell extrusion, which include several very interesting observations on the direction of extrusion, putative compensatory modes of cell death upon Caspase1 perturbation and the difference of response to ASC clustering depending on the tissue layer. While it is not the main point of this study, the observation that the direction of extrusion can vary very significantly in different genetic backgrounds is also extremely interesting.

      • The atypical cell elimination revealed in the system may require further characterisation in the future and suggest that the tools may not be the best to study bona fide pyroptosis. However, I don't believe there is always such strict separation between the modes of cell death and I am sure that it could lead to very interesting insights on inflammasome formation, extrusion and charcaterisation of downstream signalling in vivo, so overall this will be a very interesting resource for the community working on inflammasome, cell death and extrusion.

      I have some suggestions that could help to better characterise the mode of elimination as well as the mechanism of speck formation. I have also some suggestions for comparison with other published results as well as some text editing.

      Main points:

      1. So far, it remains a bit unclear how the authors define precisely speck versus any aggregate and the light induced clusters of Cry2 olig. Is it related to the timescale of formation and/or the lifetime of the aggregates ? Is it related to their size ? Since the authors use most of the time constant blue light illumination, could they also assess how long the speck remains after stoping blue light exposure and quantify their lifetime (relative to the CRY2olig cluster lifetime) ? Similarly could they provide some comparison of the size and localisation of CRY2 olig clusters compared to the speck. With the non functional CRY2olig Asc fusion (Cter fusion), do they still see transient olig2 clustering which then reverse when blue light illumination is gone ? I think it might be useful to clarify these points in the main text since most of the quantifications are based on speck localisation/numbering, so their characteristics have to be very well defined.

      2. In all the snapshots of speck formation, there seems to be a relative enrichment of the ASC signal at the cytoplasmic membrane (relative to the cytoplasm) prior to strong speck formation. This seems specific of optoASC as it does not seem to happen for the endogeneous ASC or upon overexpression of ASC-mKate (both in this study and in the previous study published by the same group). Is this apparent membrane enrichment something reproducible ? (I see that on pretty much every example of this manuscript). If so what could be the explanation ? Is there an actual recruitment at the membrane or is it because the membrane/cortical pool takes longer to be recruited in the speck (hence looking relatively more enriched at intermediate time points).

      3. There is also a very distinctive ring accumulation that seems to match with apical constriction and/or a putative actomyosin ring (since this is perfectly round, it could match with a structure with high line tension) (see Figure 1E, Figure 3B, Figure 4D...). Is it something already known ? Could the authors comment a bit more on this ? This could suggest that ASC accumulates in actomyosin cortex, which would be a very interesting property.

      4. In the end, since cell death can also occur without visible speck formation, I am wondering if they are eventually the most relevant structure to be quantified. Is it because speck can be dissolved upon caspase activation and could it relates to the speed at which caspase are activated (which may not leave enough time for strong aggregation and visible speck formation) ? I believe it would help to get more explanation/discussion on this point.

      5. The compensatory mechanisms that lead to cell death/extrusion despite depletion of caspb is very interesting. Could the authors use some pan caspase inhibitor ( like zvad FMK) to confirm that this block opto-ASC cell death also in this context ? Alternatively could they check the status of effector caspase activation using live probe (nucview) or immunostaining in the context of caspb depletion ?

      6. If I understand well, Figure 7C on the right side suggest that the double KO cells don't extrude (if indeed "no change" mean no extrusion, by the way this nomenclature may deserve some clarification in the legend). I don't think these results are mentioned at any point in the main text, but it would be important to include them (since this is an important control).

      7. Waves of calcium following cell death and cell extrusion have been previously characterised (Takeushui et al. Curr Biol 2020, Y Fujita group). Interestingly, in this previous article they observed waves of calcium near Caspase8 induced death (in MDCK) as well as near laser induced death in zebrafish, while apparently the authors don't see such Calcium waves upon Caspase8 activation in the zebrafish here. I think it would be important to include a comparison of the authors results with this previous paper in the discussion

      8. There is also a previous study which characterised the impact of caspase1 on cell extrusion (Bonfim Melo et al. Cell Report 2022, A. Yap lab) which promotes apical extrusion in Caco2 cells. I think it would also be important to include this work in the discussion and to compare with the results obtain here in vivo.

      Other minor points:

      1. Line 439: are the numbers given in percentage ? if these are absolute numbers, it is out of how many cells ? Same remark line 445 : what are the number of cases representing ? (percentage ?)

      2. Figure 5: could the authors show periderm and basal cell extrusion with the same type of markers ? (membrane or actin or ZO1) ? This would help to really compare accurately the morphology and the remodellings associated.

      3. Is there any obvious differences in cell size or characteristic cell shape between the classic lab strains (golden, AB, AB2B2) and the WIK and experiment strain used here ? I do acknowledge that this is clearly not the focus of this study, but given this striking difference (which is related to an important question in the field of extrusion), it would interesting to mention this if there is anything obvious.

      4. Figure 6C: what is exactly the localisation in Z of this strong actin accumulation observed during apical extrusion ? Is it apical or is it rather on the basal side of the cell ? A lateral view of actin could be useful in this figure for all the different conditions described.

      5. Figure S3B: could the authors show the utrophin-neonGreen channel separatly ? Is there a ring of actin in the dying cell ? Also are the membrane protrusion formed more basally ? (I suspect this is a z projection, but this would need to be specified in the legend).

      6. Figure 4A legend : I guess the authors meant red arrowheads rather than frame ?

      7. I list below a number of typos I could find in the main text

      Line 29: in

      Line 30: but

      Line 151 : from the ...[...] (tissue ?)

      Line 161: there is most likely a text commenting that was not removed (for how long?)

      Line 262: generated (egnrtd)

      Line 268: whereas showed a delay (the subject is missing)

      Line 269: a point is missing

      Line 362: which the lack

      Line 368: a point is missing

      Line 400: a space is lacking "cellsdepending"

      Line 438: shrinkwe (space)

      Line 459 : or I infections

      Line 525: there is a point missing.

      CROSS-CONSULTATION COMMENTS

      I generally agree with all the comments raised by the other reviewers which partially overlap with comments I had (see for instance referee two for the role of other caspases and the membrane localisation of the probe).

      Significance

      In this article, de Carvahlo and colleagues describe a novel optogenetic tool allowing single cell and temporally controlled induction of ASC clusters in vivo (in zebrafish), a central adaptator protein of the inflammasome complex which is involved in the induction of pyroptosis. This alternative mode of programmed cell death is involved in pathogen response and promote cell swelling and the release of pro-inflammatory factors. Previous works have shown that the inflammasome activation is associated with the formation of a large cluster of ASC protein (called speck) which promotes then the recruitment and the activation of caspase 1. Specks were previously characterised by the same group in vivo (in zebrafish larvae) and could be induced by the overexpression of ASC protein. This however was not compatible with fine spatio-temporal control of speck formation, thus preventing very refined characterisation of the dynamics and the distinction of the cell autonomous and non-cell autonomous effects.

      • By fusing ASC to the blue-light sensitive oligomerising protein Cry2-olig under the control of a heat shock promoter, they could induce time controlled induction of speck at the single cell level, which is then followed by cell extrusion and cell death both in the periderm and the basal cell of the skin of zebrafish larvae. Doing so, they could characterise the dynamics of speck formation as well as key paramters affecting its dynamics and the subsequent extrusion. While ASC activation led to apical or basal extrusion in the periderm layer followed by non-apoptotic cell death, it triggers basal extrusion and apoptosis in the basal layer. Importantly, periderm cell elimination does not seem to strictly follow all the features of pyroptosis as it does not require GSDM, and relies on Caspb (not Caspa). It is also associated with strong Calcium release both in the dying and neighbouring cells.

      • The authors performed a very careful characterisation of the tools and the optimisation of the condition to form speck and eliminate cells. The experiments are very well performed with all the necessary controls. The results, while to some extend still hard to fully interpret for some aspect, illustrate the plasticity of cell death and cell extrusion, which include several very interesting observations on the direction of extrusion, putative compensatory modes of cell death upon Caspase1 perturbation and the difference of response to ASC clustering depending on the tissue layer. While it is not the main point of this study, the observation that the direction of extrusion can vary very significantly in different genetic backgrounds is also extremely interesting.

      • The atypical cell elimination revealed in the system may require further characterisation in the future and suggest that the tools may not be the best to study bona fide pyroptosis. However, I don't believe there is always such strict separation between the modes of cell death and I am sure that it could lead to very interesting insights on inflammasome formation, extrusion and charcaterisation of downstream signalling in vivo, so overall this will be a very interesting resource for the community working on inflammasome, cell death and extrusion.

      • My expertise are in cell extrusion, optogenetics, apoptosis and epithelial mechanics. I am not a specialist of the inflammasome and pyroptosis.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Programmed cell death is critical for host defense and tissue homeostasis. How dead cells initiate cellular responses in the microenvironment with neighbouring cells in vivo is still largely unknown. The authors have chosen a Zebrafish model to tackle this question, given that this model shows advantages for imaging and addresses these pathways in a complex in vivo setting. Their recent development of light-induced activation of caspases (published in JEM) enabled them to investigate cellular responses to a specific type of cell death in vivo at a single cell resolution. In this study, the author further developed a light-induced activation of ASC to specifically look at inflammasome activation-mediated cell death in vivo. The authors have successfully established this system in zebrafish and also observed that Opto-Asc-induced cell death showed different phenotypes as compared to Opto-caspase-a/b-induced cell death. However, it is not really clear why. I have a few specific comments to be addressed or discussed.

      1. In Fig.3 and Fig.4, the majority of Opto-Asc localizes to the plasma membrane but not endogenous Asc. It seems that tagging affects its localization, which could potentially explain its slow kinetics in oligomerization.

      2. In Fig.7, the authors showed that deletion of Caspb, but not Caspa, affected the apical extrusion, without affecting cell death. This may indicate that other caspases, like Caspase-8 or/and caspase-3 were involved. This could be addressed through deletion of Caspase-8 or/and caspase-3.

      3. It is very surprising that Opto-Asc-mediated cell death is not dependent on Gasdermins, at least in Caspb-dependent apically extruded dead cells.

      CROSS-CONSULTATION COMMENTS

      I agree with the other two reviewers and don't have further comments.

      Significance

      The Opto-Asc zebrafish model developed in this study will enable us to specifically look at inflammasome-mediated cell death in vivo. This model is more physiologically relevant compared to Opto-caspase1 model.

      Audience interested in physiological function of inflammasome activation, but it is questionable whether such a tool will address mechanisms in mammalian cells. Eventually, more evidence for the latter could be provided.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary:

      ASC is the Pyrin/CARD-containing adapter protein that functions as a core component of inflammasome signaling complexes. ASC functions downstream of various NLR- and ALR-inflammasome initiator proteins and upstream of the inflammatory caspases that function as inflammasome effector enzymes. This study uses a novel chimeric construct (Opto-ASC) comprising the Arabidopsis photo-oligomerizable cryptochrome 2 (Cry2-olig) protein with zebrafish ASC to generate transgenic zebrafish larvae wherein ASC oligomerization can be rapidly, dynamically and spatially induced by blue light illumination of either the entire larva or single cells within discrete tissues of an intact larva. Induction of these "opto-inflammasome" complexes is coupled with state-of-the-art, live-cell optical imaging of multiple single cell and integrative tissue parameters to assay various modes of regulated cell death within the peridermal and basal cellular layers of the larval skin. This experimental model was further combined with genetic manipulation of the expression of various zebrafish inflammatory or apoptotic caspases, as well as the two zebrafish members of the gasdermin family of pore-forming proteins which can mediate disruption of plasma membrane permeability without (pre-lytic) or with (pyroptosis) progression to lytic cell death.

      The main results of the study are:

      1) introduction of a novel experimental system for dynamic and spatially resolved ASC oligomerization and speck formation within the cells of intact epithelial tissues of a living organism;

      2) the ability of these optically induced ASC oligomers/specks to drive multiple modes of regulated cell death which exhibit some (but not all) features of lytic pyroptosis or non-lytic apoptosis depending on cell type and tissue location;

      3) the ability of the dying epithelial cells containing optically-induced ASC specks to coordinate rapid adaptive responses in adjacent non-dying cells to maintain integrity/ continuity of skin epithelial barrier; and

      4) unexpectedly, no obvious role for either of the two zebrafish gasdermins in the regulated cell death responses.

      Major Comments:

      1. Are the claims and the conclusions supported by the data or do they require additional experiments or analyses to support them? The major goal of this MS is to present a new experimental model (optogenetic activation of ASC oligomerization in transgenic zebrafish) that has the potential to provide new insights regarding the multiple mechanisms by which ASC can regulate inflammasome/ cell death signaling responses in the context of an intact organism. As noted above, some of the observed results are unexpected (e.g., lytic cell death independent of the zebrafish gasdermins in particular epithelial cells) and may reflect mechanisms unique to zebrafish as a non-mammalian vertebrate model versus the mammalian experimental systems (murine and human) that have informed most of our current understanding of how ASC coordinates inflammasome and cell death responses. However, the authors have used rigorous genetic approaches to rule out trivial explanations for the unexpected observations. Thus, no major additional experiments are required to support the claims and conclusions presented in the MS.

      2. Are the suggested experiments realistic in terms of time and resources? Yes. It would help if you could add an estimated time investment for substantial experiments: A few weeks.

      3. Are the data and the methods presented in such a way that they can be reproduced? Are the experiments adequately replicated and statistical analysis adequate? Yes.

      4. Are the experiments adequately replicated and statistical analysis adequate? Yes.

      Minor comments:

      1. Specific experimental issues that are easily addressable:

      There's a significant concern with the use of LDC7559 (line 387) as a putative small molecule inhibitor of gasdermin D function to test roles (or lack thereof) of the zebrafish gasdermins in the ASC-triggered lytic cell death responses. A recent study (Amara et al. 2021. Cell. PMID34320407) has reported that LDC7559 does not inhibit gasdermin D (and possibly other gasdermins) but rather acts as an allosteric activator of PFKL (phosphofructosekinase-1 liver type) in neutrophils and thereby suppress generation of the NADPH required for the phagocytic oxidative burst and consequent NETosis. Thus, use of LDC7559 as a presumed gasdermin inhibitor in the current MS is problematic and should be deleted. As an alternative pharmacological approach to suppress gasdermin function, the authors might consider the use of either disulfiram (Hu et al. 2020. Nature Immunology. PMID32367036) and/or dimethylfumarate (Humphries et al. Science. 2020. PMID32820063). These would be straightforward additional experiments.

      1. Are prior studies referenced appropriately? there are some problems; see below.

      2a. One paper is cited twice in lines 724-726 and 727-729.

      2b. Another paper is cited twice in lines 790-792 and 793-795.

      2c. No journal is included for the referenced study by Shkarina et al in lines 827-828.

      2d. No journal is included for the referenced study by Stein et al in lines 831-832.

      2e. No journal is included for the referenced study by Masumoto et al in lines 793-795.

      2f. No journal is included for the referenced study by Kuri et al in lines 774-775.

      1. Are the text and figures clear and accurate? Generally, yes but with a few exceptions noted below:

      3a. line 28: "morphological distinct" should read "morphologically distinct"

      3b. line 161: this sentence contains in parentheses "for how long?" I think this was a comment by one author that wasn't removed from the final submitted MS

      3c. line 945: spelling "balck" > "black"

      3d. line 268: "whereas showed a delayed speck formation": the authors need to specify what model/ condition showed a delayed speck formation

      3e. line 262: spelling "egnerated" > "generated"

      CROSS-CONSULTATION COMMENTS

      I also agree with the comments of the other 2 reviewers. Between the 3 sets of comments and suggestions, the aggregate review will provide the authors with a suitable range of feasible recommendations that will improve an already strong MS.

      Significance

      1. General assessment:

      As noted above, this the major goal of this MS is to present a new experimental model (optogenetic activation of ASC oligomerization in transgenic zebrafish) that has the potential to provide new insights regarding the multiple mechanisms by which ASC can regulate inflammasome/ cell death signaling responses in the context of an intact organism. The authors have used rigorous genetic approaches to rule out trivial explanations for the unexpected observations. In general, the MS describes an elegant model system that will provide a platform for identifying new mechanisms of ASC-dependent inflammasome signaling and regulated cell death.

      1. Advance:

      This MS describes a highly novel experimental model. Zebrafish are increasingly being used as a genetically tractable model for inflammasome signaling within integrated tissues of intact organism. As noted above, the advances are technical but also conceptual. Future application of this novel model is likely to yield identification of new mechanisms for ASC function in innate immunity and regulated cell death within the context of tissue homeostasis and host defense.

      1. Audience:

      Basic research and discovery.

      1. Please define your field of expertise with a few keywords to help the authors contextualize your point of view:

      My group investigates multiple aspects of inflammasome signaling biology at the cellular level with an emphasis on cell-type specific roles for gasdermins in coordinating downstream innate immune responses to inflammasome activation in various myeloid leukocytes (macrophages, dendritic cells, neutrophils, eosinophils, mast cells).

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Response to reviewers

      Reviewer #1

      Reviewer #1 (evidence, reproducibility and clarity (required)):

      Winter et al. present a study of Ebola virus fusion in the acidic environment of the late endosome. Based on cryo-ET of Ebola virions undergoing entry into cells, they note that the VP40 matrix is disassembled and dissociated from the viral membrane in virions seen in the endosome. Subsequent in vitro and computational analyses suggest that protons diffuse across the viral membrane and neutralize anionic lipids on the inner leaflet. They argue that this loss of negative charge reduces the affinity of VP40 for the viral membrane. They further suggest that VP40 dissociation from the viral membrane precedes GP-mediated membrane fusion and contributes to reduction in the energy barrier for membrane stalk formation. Whereas most studies have focused on the importance of acidic pH in triggering GP conformational changes during fusion, the present work contributes new appreciation for VP40-membrane interactions.

      We would like to thank the reviewer for all the insightful comments and appreciation of the novelty.

      In the cryo-ET experiments aimed at visualizing Ebola entry, do the authors see evidence of viral membrane fusion? There is no mention of this in the text. Knowing that the virions that show disassembly of the VP40 matrix are in fact the virions that productively enter cells would support the conclusions of the study. As is stands, one is forced to wonder whether the virions that show VP40 disassembly prior to fusion ultimately fuse.

      *We first note that the EBOV virions shown in Figure 1 entering host cells were captured by cryo-ET at 48 hours post infection and resulted from 2-3 rounds of infection, thus the virions can productively enter the cells by micropinocytosis. Virions that are not able to undergo membrane fusion would be processed in the lysosomes and would not be detectable by cryo-ET at 48 hours post infection. In addition, the virions captured in late endosomes contain nucleocapsids, hence these virions are likely infectious. Together, this is good evidence that we really see events after successful membrane fusion. *

      *We fully agree with the reviewer that capturing a fusion event would provide further proof that fusion depends on prior disassembly of the VP40 matrix layer. To address this, we acquired additional data on cells infected at different time-points post-infection (15 cells imaged); regrettably, we have not been successful in capturing a membrane fusion event, presumably due its fast kinetics. In this study we are technically limited with the amount of the virus we can use for infection in BSL4. The current dataset was generated at an MOI of 0.1 and this makes capturing entry events difficult as we would need an MOI of at least 100-1000 to increase the chances of capturing such a rare event. *

      *Considering the technical difficulties to perform the experiment under BSL4 conditions, we have in addition performed a similar experiment using EBOV VLPs at high concentration (estimated MOI > 100) composed of VP40 and GP (Fig. S5). Despite the high VLP concentration, we could only find 2 tomograms out of 18 tomograms showing VLP entry events. These clearly show that the VP40 matrix is disassembled in VLPs residing in endosomes. The same lamellae displayed sites of viral fusion as evident from enlarged endosomal membrane surfaces studded with GPs facing endosomal lumina. Hence, this new data supports our results that VLPs that undergo VP40 disassembly are able to fuse. We have included the new supplementary figure S5 and added the following sentence to the main text: *

      Lines 96-102: “We were not able to capture virions residing in endosomes in the process of fusing with the endosomal membrane, presumably because virus membrane fusion is a rapid event. However, in a similar experiment using EBOV VLPs composed of VP40 and GP, we could confirm the absence of ordered VP40 matrix layers in VLPs inside endosomal compartments. Moreover, we were able to capture one fusion event and several intracellular membranes studded with luminal GPs, indicating that fusion had taken place (Fig. S5).”

      In the cryo-ET experiments that evaluate VP40 disassembly in vitro, why do the authors leave out NP from their VLP preparations? There is some evidence in the literature (Li et al., JVI 2016) that NP is necessary to form particles with native morphology. If the authors feel that NP is not necessary for their experiment, perhaps this could be noted.

      *Thank you very much for this important comment. Throughout this study, we mainly focused on the fate of the VP40 matrix during entry and thus reduced the complexity of the VLPs used to the minimum – VP40 and GP, so indeed NP was left out before. To address the role of the nucleocapsid in Ebola VLPs uncoating, we have now also included data on VLPs prepared by expression of nucleocapsid components (NP, VP24 and VP35) in addition to GP and VP40. Cryo-ET analysis of these VLPs showed that VLPs mainly contain loosely coiled nucleocapsid. This is consistent with a study by Bharat et al 2012, which shows that compared to virions, VLPs displayed heterogeneous nucleocapsid assembly states and reduced incorporation of nucleocapsids. It is important to note that VLPs containing nucleocapsid also displayed disassembled VP40 matrices at low pH (Fig. S7). Hence, nucleocapsid proteins do not influence the VP40 disassembly driven by low pH and GP-VP40 VLPs can be used as model to study VP40 uncoating. *

      *We included a statement shown on lines 150-153: “We further repeated the experiment using VLPs composed of VP40, GP and the nucleocapsid proteins NP, VP24 and VP35, and observed the same low pH-phenotype described above. These results show that nucleocapsid proteins do not influence the VP40 disassembly driven by low pH.” *

      The authors argue that acidic pH neutralizes the charge of PS phospholipids, thereby removing the electrostatic interactions of basic residues in VP40 and PS. They also note in the Methods section that 7 amino acids in VP40 are predicted by PROPKA to be protonated at pH 4.5. If the authors feel that protonation of these 7 amino acids is not involved in the loss of affinity for PS, this could be stated explicitly and justified. Could the protonation of these 7 amino acids contribute to disassembly of the VP40 lattice, rather than dissociation from the membrane?

      Thank you for this interesting comment. We note that the amino acids predicted to be protonated (*E76, E325, H61, H124, H210, H269, H315, see below) are far away from the interaction interface with the membrane and also away from the intra-dimerization domain. Hence, they do not likely contribute to the loss of affinity for PS but may contribute to conformational changes that facilitate the disassembly of the VP40 matrix. For clarification, we have added the following statement to the methods section: *

      Lines 541-544: “Importantly, these residues are located away from the interaction interface of VP40 with the membrane and their protonation accordingly does not influence membrane-binding. However, protonation of these residues may contribute to conformational changes that facilitate the VP40 matrix disassembly.

      Minor: Figure S5C is difficult to interpret. The red frame on the bars that indicates data acquired at low pH is nearly invisible. Better might be to indicate explicitly (ie, with words) the pH at which data were acquired.

      Thank you very much for this comment. We have changed the design of the graph accordingly. Please note that the figure numbering has changed and that Figure S5C is now Figure S6C.* * Reviewer #1 (significance (required)): The significance of the study stems from the idea that the VP40 lattice and its interaction with the viral membrane plays a direct role in facilitating viral fusion. To my knowledge, this has not been previously addressed. The significance would be considerably increased if the authors were able to demonstrate by cryo-ET that the virions with disassembled VP40 were in fact the virions that productively fused. Nonetheless, this work should be of broad interest to researchers studying viral fusion as it may represent a phenomenon relevant to numerous viruses that enter cells via the endocytic route.

      Reviewer #2 Reviewer #2 (evidence, reproducibility and clarity (required)):

      The manuscript by Winter et al., entitled "The Ebola virus VP40 matrix undergoes endosomal disassembly essential for membrane fusion" describes the structural aspects of the events that precede Ebola virus (EBOV) membrane fusion in late endosome and virion uncoating in the cytosol. By combining state-of-the-art cryo-electron tomography (cryo-ET) with biophysical and computational techniques, they have elucidated the pivotal role of the ebolaviral matrix virion protein 40 (VP40) in modulating the fusion process, in particular discovering that disassembly of the VP40 ordered lattice is low pH-driven, occurs despite the absence of a viral ion channel within the filovirus envelope and takes place through the weakening of VP40 interactions with lipids at the interface between the ebolaviral envelope and matrix. Overall, the manuscript is well written and the research work is very well conceived, with solid orthogonal experimental approaches that mutually validate their respective results. It is opinion of this reviewer that the paper contributes to the elucidation of a key step in the EBOV infection cycle and that it will be of great interest for the readership of Review Commons and for the community of structural biologists. Therefore, I recommend the publication of this paper, however after some minor revision to the text, the figures and the figure legends, which show inconsistencies in the terminology used, the acronyms and could be easily improved by some little graphical editing.

      Thank you very much for your positive feedback and your comments.

      Comments:

      • By starting their abstract and introduction sessions with the term "Ebola viruses" the authors are (on purpose?) preparing the reader to the implicit statement that their findings could be a paradigm model for the other members of the Ebolavirus genus. This is an exciting picture, especially in perspective of VP40-targeting drugs development. Therefore, although conclusions in this sense would probably require further studies, I encourage the authors to implement their figure 3 (or related supplementary figure) with a multiple-sequence alignment, and the relative text in the manuscript, by showing if and how much the basic patch at the C-terminus of VP40 is conserved within the Ebolavirus genus, especially the residues Lys224, Lys225, Lys274 and Lys275.

      Thank you very much for this comment. We have added a corresponding sequence alignment highlighting the high conservation of the basic patch of amino acids across all Ebola virus species (Suppl. Fig. S6). In the text, we refer to the sequence conservation as follows:

      Lines 213-215: “These interactions are driven by basic patches of amino acids which are highly conserved across all EBOV species (Fig. S8 H), further emphasizing their importance in adaptable membrane binding.”

      • It is a bit inconvenient for the reader to follow how a story unfolds while jumping back and forth between figures, and this is why I would recommend to move the period of the sentence at lines 88-91 to the session where figure 5 is discussed.

      *We refer in fact to Figure 1 and fixed the reference accordingly (line 95). *

      • Please, avoid the use of the slang "Ebola" without the apposition "virus", and make the text consistent throughout the manuscript by only using the acronym of each term after it was introduced for the first time.

      Thank you for this comment. We have thoroughly revised the use of technical terms.

      Minor revisions: Line 1: "matrix protein undergoes" We refer here to the entire VP40 matrix layer composed of many VP40 proteins and not to single VP40 proteins (as the individual proteins do not disassemble, but their macromolecular assembly does). For clarification, we changed the title to “matrix layer undergoes”.

      Line 19: "the matrix viral protein 40 (VP40)" We have corrected the statement.

      Line 18: considering that a virus "exists" in the form of a virion while temporarily located outside the cell, and as a "molecular entity" consisting of viral proteins and nucleic acids organised in macromolecular complexes during its life cycle inside the infected cell, this reviewer encourages the authors to rephrase as follows: " Ebola viruses (EBOVs) virions are filamentous particles, ..." Thank you for your suggestion. We have rephrased it to: „Ebola viruses (EBOVs) assemble into filamentous virions“ (line 18).

      Lines 35-36 and line 40: "that is determined by the matrix made up by the viral protein 40 (VP40), which drives ..." And then, directly use the acronym VP24 at line 40

      We have corrected the statement.

      Line 40: as VP24 and VP35 interact with NP but do not interact with the ssRNA genome, please rephrase as follows "the nucleoprotein (NP) which encapsidates the ssRNA genome, and the viral proteins VP24 and VP35 which, together with NP, form the nucleocapsid"

      We have corrected the statement.

      Lines 47-48: "...fusion glycoprotein (GP)...[...] the ebolaviral envelope"

      We have corrected the statement.

      Line 51: "...remarkably long virion of EBOVs undergoes..."

      We have rephrased the statement: line 55: “…remarkably long EBOV virions undergo…”

      Line 63: "... in vitro, and in endo-lysosomal compartments in situ, by cryo-electron..."

      We have corrected the statement.

      Lines 70-71: " to shed light on EBOVs ... [...] with EBOV (Zaire ebolavirus species, Mayinga strain) in biosafety level 4 (BSL4) containment"

      We have corrected the statement.

      Line 72: chemically fixed by? (PFA and GA acronyms have been annotated in figure 1, but should be first mentioned in their explicit form in the text)

      We have now mentioned annotations for GA and PFA both in the main text and in the figure legend in their explicit forms.

      Line 73 (cryo-FIB)

      We have corrected the acronym.

      Line 80: EBOV virions

      We have corrected the statement.

      Figure 1A and line 97: for consistency with the terminology used in the main text, should be perhaps in the second step preferred the term "vitrification" instead of cryofixation? Readers not familiar with the field could be confused by the use of the two synonyms

      We have replaced the term as suggested.

      Lines 92-93: "...these data indicate [...] and suggest..."

      We have corrected the statement.

      Figure 1C and line 100: in the color legend EBOV is annotated as dark teal, however in the segmentation of the reconstructed tomogram there are three objects, one of which in dark teal is evidently a portion of EBOV virion inside the endosome, and other two are in different shades of green. What are those? Please, could author specify their identity in the figure legend with their corresponding color code? The same applies to supplementary figure S2 (see comment below).

      Thank you very much for this comment. All three green objects are EBOV virions. For clarification, we have added numbers 1-3 to the figure and legend and adjusted the text in the legend accordingly (lines 109-110).

      Line 95: "...tomography of EBOV virions..."

      We have corrected the statement.

      Line 98: "...showing EBOV virions..." (This reviewer refers to the use of the term 'EBOVs' as for different species within the genus rather than for different EBOV particles within a dataset)

      We have corrected the statement.

      Line 105: "... a purified EBOV before..." *We realized a mistake in our phrasing: the virion shown in Fig. 1 H is not purified, but a virion found adjacent to the plasma membrane of an infected cell. We have changed the phrasing accordingly (lines 117-118). *

      Line 110 and 113: "...EBOV matrix..." And "EBOV virus-like particles (VLP)"

      We have corrected the statement.

      Line 140, 141, 145 and 147: "EBOV VLPs" and "EBOV VLP"; idem at lines 188-189, 209 and anywhere else in the manuscript (including figure 4A) We have corrected the use of “EBOV VLP(s)” as suggested.

      Line 235: "influenza virus ion channel..."

      We have corrected the statement.

      Line 249: please, use directly the above-introduced acronym for the detergent

      We have revised the use of acronyms.

      Figure 5F: in plot's X axis label: thermolysin (T)?

      Yes, this is correct and stated in the figure legend.* * Line 342: "EBOV have remarkably long..."

      We have corrected the statement.

      Line 420 "...matrix-specific"

      We have corrected the spelling error.

      Line 464: "grids"

      We have corrected the spelling error.

      Line 465: "for cryo-FIB milling"

      We have corrected the statement.

      Line 611: "influenza virus M2 ..." (Please, from which influenza virus strain does the gene come from? Alternatively, which is the NCBI Protein and/or UniProt database code?)

      We have added the information to the Methods (line 648): “….A/Udorn/307/1972 (subtype H3N2))…”

      Line 623: please, use the above-designated acronym for the detergent

      *We have used the acronym as suggested. *

      Line 716: "...based on cryo-ET..." We have corrected the statement.

      Line 718: "influenza virus" We have corrected the term.

      Line 734: "cryo-ET data" We have corrected the term.

      Fig. S8: for consistency with the main text, "thermolysin" We have corrected the spelling of thermolysin throughout the manuscript.

      Fig. S2, C and F: are these EBOV virions (as mentioned in the figure title) or EBOV VLPs (as the legends in the two panels of this figure seem to suggest)? Please, the authors should clarify

      Thank you very much for spotting this mistake! These are indeed EBOV virions and we have changed the legends within the figure accordingly.

      Line 1046: "malleable lipid envelope of the EBOV"; this adjective sounds confusing; the reviewer encourages the authors to rephrase for more clarity.

      We have removed the adjective „malleable”.

      Reviewer #2 (significance (required)): see above.

      __Reviewer #3__Reviewer #3 (evidence, reproducibility and clarity (required)):

      Winter and colleagues describe the molecular architecture of Ebola virus during entry into host cells. The main claims of the paper are that VP40 is disassembled prior to fusion. Disassembly is driven by the low pH environment in the endosomes. PH-induced uncoating works via "passive equilibration" because the Ebola virus envelope does not contain an ion channel. The authors conclude that structural remodeling of VP40 acts as a molecular switch coupling uncoating to fusion. The main novel results of the manuscript are: In situ cryo-ET of endosomal compartments shows EBOV particles with intact condensed nucleocapsids and disordered protein densities that may relate to detached VP40. Five EBOV particles were imaged in the endosome and all had detached VP40 layers. Controls, budding virions and extracellular virions showed intact VP40 layers. Incubation of VP40-Gp VLPs with a pH 4.5 buffer leads to the disorder of the VP40 matrix in vitro, which is independent of Gp presence in the VLPs. MD simulation showed VP40 dimer binding to model membranes containing 30 % PS at pH7 and reduced binding at pH 4.5. Lipidomics revealed the lipid composition of VP40-Gp VLPs demonstrating 9% PS.

      VP40-PHluorin fusions were used to determine acidification of VLPs in vitro and to calculate a permeability coefficient of 1.2 Å sec-1, which is quite low compared to the permeability of the plasma membrane (345 Å sec-1). Next they modeled membrane fusion showing that fusion is more favorable after VP40 disassembly, especially favoring stalk formation. The authors propose further that fusion pore opening is more favorable in the presence of VP40. The authors claim that strong interactions of lipids with VP40 stabilizes the hemifusion intermediate. VP40 Gp VLPs can enter host cells independent of pH once Gp has been activated by thermolysin.

      We thank the reviewer for these interesting comments and valuable suggestions.

      Some of the results are over interpreted and require appropriate modifications.

      Main points that need to be addressed: Imperfections of the membrane could be induced by proteins. Does acidification of the virion depend on GP and its transmembrane region? This can be tested with chimeric GP replacing its TM by unrelated trimeric TMs.

      We agree that this is important to consider. We have addressed this question in Fig. 2 K using VLPs composed of VP40 alone. These VLPs lack GP and still display luminal acidification as evident from the disassembled VP40 matrix when incubated at low pH. Therefore, acidification does not depend on GP. For clarification, we have adjusted the following sentence in the discussion:

      Lines 410-413: “Using VLPs of minimal protein composition (VP40 and GP, and VP40 alone), we show that VP40‑disassembly, i.e. the detachment of the matrix from the viral envelope is triggered by low endosomal pH (Fig. 2). This indicates that VP40 disassembly does not depend on structural changes of other viral proteins, including GP, and is driven solely by the acidic environment.*” *

      Virus entry assays, line 292. The low pH is not only used for Gp cleavage, but induces the conformational changes leading to the post fusion conformation of Gp2. The authors need to check what happens to Gp once it is cleaved by thermolysin. Is this sufficient to induce the conformational changes in Gp? And if so how does entry of such VLPs work, because once the conformational change is triggered, GP2 will adopt the post fusion conformation which is inactive in fusion. This requires further clarification.

      To our knowledge, there is only one study showing that EBOV GP2 changes conformation at low pH in the form of a re-arrangement of the fusion peptide from an extended loop to a kinked conformation (Gregory et al 2011). Importantly, low pH alone is not sufficient to trigger GP mediated membrane fusion and NPC1 is needed as a trigger for membrane fusion process (Das et al, 2020). Hence proteolytically processed GP requires NPC1 binding to change its conformation to post-fusion state. We addressed this question by using pre-cleaved (= GP2) and low pH- treated VLPs in our entry assay (Fig. 5 F). Since low pH-treated VLPs enter host cells as efficiently as VLPs incubated at neutral pH, and low pH-treated and additionally pre-cleaved VLPs enter even more efficiently, it is highly unlikely that low pH triggers the post-fusion conformation as this should inhibit virus entry (as the reviewer pointed out). In conclusion, low pH does not induce the post-conformation in GP2 and we have included a respective sentence for clarification:

      Lines 339-343: * Since thermolysin-treated EBOV VLPs efficiently enter untreated host cells at neutral and low pH, we further conclude that low pH alone does not induce the GP2 post-fusion conformation, which would inhibit virus entry. Together, this suggests a role of low endosomal pH beyond proteolytic processing of EBOV GP, likely for the disassembly of the VP40 matrix.”*

      In the fusion model, the authors claim that VP40 disassembly is more favorable for stalk formation, which is likely true. However, they also claim that strong VP40 interaction, which I would interpret as VP40 filaments interacting with the membrane, favor fusion pore opening. The tomograms and the in vitro experiments with VLPs indicate that the complete VP40 matrix is detached from the membrane under low pH conditions.

      We would like to stress that the modelling results for hemifusion formation and pore opening are independently calculated but have to be interpreted together because they occur sequentially. Hemifusion precedes formation of the pore and hence even though the model shows that the fusion pore opening is favored in the presence of VP40 interaction, membrane fusion cannot proceed to this stage because hemifusion is blocked until the VP40 matrix layer disassembles from the membrane. We apologize for lack of clarity, and we have added the sentences:

      Lines 315-318: “However, it is important to note that hemifusion precedes pore formation in the membrane fusion pathway. Since the disassembly of the VP40 matrix is required for hemifusion and hence for the initiation of membrane fusion, it determines the outcome of the membrane fusion pathway.*” *

      VLPs are purified. Can the authors exclude the possibility that the purification protocol does not damage the VLP membrane leading to in vitro acidification in a low pH environment? Can some of the assays be repeated with non-purified VLPs?

      *Thank you very much for this important comment. To address this question, we had performed the cryo-ET experiments using purified and unpurified VLPs and found that they are virtually indistinguishable. Importantly, unpurified VLPs also undergo VP40 disassembly. We now show images from unpurified VLPs in a supplementary figure (Fig. S7). Thereby, the manuscript contains data of purified VLPs while we also provide proof that the purification protocol does not influence the disassembly of the VP40 matrix. We added the following explanatory sentence to the main text: *

      Lines 151-156: “*We further repeated the experiment using VLPs composed of VP40, GP and the nucleocapsid proteins NP, VP24 and VP35, and observed the same low pH-phenotype described above (Fig. S5 C). Performing the experiments on unpurified VLPs harvested from the supernatant of transfected cells confirmed that the purification protocol applied did not influence the disassembly of the VP40 matrix (Fig. S7). “ *

      Does acidification only work at pH 4.5?

      *We also attempted to verify the acidification of VLPs at higher pH (~5.5. and ~6.0) by cryo-ET, however, subtle structural differences were difficult to quantify. Considering the lower permeability of the VLP membrane compared to the plasma membrane, we think that acidification occurs indeed also at higher pH (as shown for cells), albeit at slower kinetics. *

      Minor points Line 37: Ruigrok et al. 2000 J Mol Biol showed first that Ebola VP40 requires negatively charged lipids for interaction.

      *Thank you for pointing out this reference. We have included it in the text. *

      Fig. 1f: Is VP40 detaching as a filament?

      We have not observed that VP40 detaches as a filament or a linear segment of multiple VP40 dimers. *Since the VP40 dimer is inherently flexible (Fig. 3, Fig. S8) and can rotate along the N- and C-terminal intra- and inter-dimer interfaces, we believe disassembly occurs in a non-ordered fashion (not as filaments, see also Figure 2 G-K). *

      References 8 and 28 are the same. We have corrected the reference duplication.

      Lipidomics: The authors find only 9% PS in the VLPs. How do these results compare to the composition of other enevloped viruses that have been reported to assemble on negatively charged lipids.

      *We compared the lipid composition of the EBOV VLPs to the lipid composition of influenza viruses and HIV, which both bud from the plasma membrane and require negatively charged lipids. When grown in eggs, the envelope of influenza viruses contains 22-25 % PS (Ivanova et al 2015, Li et al 2011), and approximately 12% when produced from MDCK cells (Gerl et al 2012). The envelope of HIV virions produced from HeLa or MT4 cells contains 10-15% PS. These numbers suggest that the producing cell line strongly influences the lipid composition of the virus particles. Besides differences in the producing cell line, the lower amount of PS found in EBOV VLPs could have multiple implications: first, apart from PS, PIP2 has also been shown to interact specifically with VP40 at budding sites in the plasma membrane (Jeevan et al 2017, Johnson et al 2018) and thus also contributes to virion assembly (potentially allowing for a lower PS concentration); second, as recently shown for paramyxoviruses (Norris et al 2022), binding of PS to viral proteins is not based on charge alone but may include specific binding – in which case a high affinity of viral proteins to PS may allow for a lower PS concentration in the target membrane. Overall, the rather low PS content in Ebola VLPs might be important for VP40 interaction and low pH-driven disassembly. *

      EBO virus was suggested to assemble at lipid rafts. Is this reflected by the lipid composition?

      *Yes, that is correct. A hallmark of lipid rafts is the enrichment of cholesterol and sphingomyelin (~32 mol% cholesterol, ~ 14 mol% sphingomyelin) in the microdomains (Pike et al 2002). The lipid composition of the EBOV VLPs determined in our study (~ 39% cholesterol and ~10 mol% sphingomyelin) is consistent with the assembly at lipid rafts. Minor differences stem from the different cell lines and lipidomic approaches used to determine the lipid species. *

      Reviewer #3 (significance (required)): In summary, the manuscript is of high technical quality and the observation that VP40 detaches from the viral membrane prior to membrane fusion is novel and interesting to the field of virus fusion. How acidification occurs in the absence of an ion channel remains to be determined. The authors provide little insight how this might work. The strong part of the manuscript is the EM part, which shows convincing detachement of the VP40 matrix. I cannot comment too much on the modelling part, which, however, sounds solid.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      Winter and colleagues describe the molecular architecture of Ebola virus during entry into host cells. The main claims of the paper are that VP40 is disassembled prior to fusion. Disassembly is driven by the low pH environment in the endosomes. PH-induced uncoating works via "passive equilibration" because the Ebola virus envelope does not contain an ion channel. The authors conclude that structural remodeling of VP40 acts as a molecular switch coupling uncoating to fusion.

      The main novel results of the manuscript are:

      • In situ cryo-ET of endosomal compartments shows EBOV particles with intact condensed nucleocapsids and disordered protein densities that may relate to detached VP40.

      • Five EBOV particles were imaged in the endosome and all had detached VP40 layers. Controls, budding virions and extracellular virions showed intact VP40 layers.

      • Incubation of VP40-Gp VLPs with a pH 4.5 buffer leads to the disorder of the VP40 matrix in vitro, which is independent of Gp presence in the VLPs.

      • MD simulation showed VP40 dimer binding to model membranes containing 30 % PS at pH7 and reduced binding at pH 4.5.

      • Lipidomics revealed the lipid composition of VP40-Gp VLPs demonstrating 9% PS.

      • VP40-PHluorin fusions were used to determine acidification of VLPs in vitro and to calculate a permeability coefficient of 1.2 Å sec-1, which is quite low compared to the permeability of the plasma membrane (345 Å sec-1).

      • Next they modeled membrane fusion showing that fusion is more favorable after VP40 disassembly, especially favoring stalk formation.

      • The authors propose further that fusion pore opening is more favorable in the presence of VP40.

      • The authors claim that strong interactions of lipids with VP40 stabilizes the hemifusion intermediate.

      • VP40 Gp VLPs can enter host cells independent of pH once Gp has been activated by thermolysin.

      • Some of the results are over interpreted and require appropriate modifications.

      Main points that need to be addressed:

      • Imperfections of the membrane could be induced by proteins. Does acidification of the virion depend on GP and its transmembrane region? This can be tested with chimeric GP replacing its TM by unrelated trimeric TMs.

      • Virus entry assays, line 292. The low pH is not only used for Gp cleavage, but induces the conformational changes leading to the post fusion conformation of Gp2. The authors need to check what happens to Gp once it is cleaved by thermolysin. Is this sufficient to induce the conformational changes in Gp? And if so how does entry of such VLPs work, because once the conformational change is triggered, GP2 will adopt the post fusion conformation which is inactive in fusion. This requires further clarification.

      • In the fusion model, the authors claim that VP40 disassembly is more favorable for stalk formation, which is likely true. However, they also claim that strong VP40 interaction, which I would interpret as VP40 filaments interacting with the membrane, favor fusion pore opening. The tomograms and the in vitro experiments with VLPs indicate that the complete VP40 matrix is detached from the membrane under low pH conditions. VLPs are purified. Can the authors exclude the possibility that the purification protocol does not damage the VLP membrane leading to in vitro acidification in a low pH environment?

      • Can some of the assays be repeated with non-purified VLPs?

      • Does acidification only work at pH 4.5?

      Minor points

      • Line 37: Ruigrok et al. 2000 J Mol Biol showed first that Ebola VP40 requires negatively charged lipids for interaction.

      • Fig. 1f: Is VP40 detaching as a filament?

      • References 8 and 28 are the same.

      • Lipidomics: The authors find only 9% PS in the VLPs. How do these results compare to the composition of other enevloped viruses that have been reported to assemble on negatively charged lipids.

      • EBO virus was suggested to assemble at lipid rafts. Is this reflected by the lipid composition?

      Significance

      In summary, the manuscript is of high technical quality and the observation that VP40 detaches from the viral membrane prior to membrane fusion is novel and interesting to the field of virus fusion. How acidification occurs in the absence of an ion channel remains to be determined. The authors provide little insight how this might work.

      The strong part of the manuscript is the EM part, which shows convincing detachement of the VP40 matrix. I cannot comment too much on the modelling part, which, however, sounds solid.

    3. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      The manuscript by Winter et al., entitled "The Ebola virus VP40 matrix undergoes endosomal disassembly essential for membrane fusion" describes the structural aspects of the events that precede Ebola virus (EBOV) membrane fusion in late endosome and virion uncoating in the cytosol. By combining state-of-the-art cryo-electron tomography (cryo-ET) with biophysical and computational techniques, they have elucidated the pivotal role of the ebolaviral matrix virion protein 40 (VP40) in modulating the fusion process, in particular discovering that disassembly of the VP40 ordered lattice is low pH-driven, occurs despite the absence of a viral ion channel within the filovirus envelope and takes place through the weakening of VP40 interactions with lipids at the interface between the ebolaviral envelope and matrix. Overall, the manuscript is well written and the research work is very well conceived, with solid orthogonal experimental approaches that mutually validate their respective results. It is opinion of this reviewer that the paper contributes to the elucidation of a key step in the EBOV infection cycle and that it will be of great interest for the readership of Review Commons and for the community of structural biologists. Therefore, I recommend the publication of this paper, however after some minor revision to the text, the figures and the figure legends, which show inconsistencies in the terminology used, the acronyms and could be easily improved by some little graphical editing.

      Comments:

      • By starting their abstract and introduction sessions with the term "Ebola viruses" the authors are (on purpose?) preparing the reader to the implicit statement that their findings could be a paradigm model for the other members of the Ebolavirus genus. This is an exciting picture, especially in perspective of VP40-targeting drugs development. Therefore, although conclusions in this sense would probably require further studies, I encourage the authors to implement their figure 3 (or related supplementary figure) with a multiple-sequence alignment, and the relative text in the manuscript, by showing if and how much the basic patch at the C-terminus of VP40 is conserved within the Ebolavirus genus, especially the residues Lys224, Lys225, Lys274 and Lys275.

      • It is a bit inconvenient for the reader to follow how a story unfolds while jumping back and forth between figures, and this is why I would recommend to move the period of the sentence at lines 88-91 to the session where figure 5 is discussed.

      • Please, avoid the use of the slang "Ebola" without the apposition "virus", and make the text consistent throughout the manuscript by only using the acronym of each term after it was introduced for the first time.

      Minor revisions:

      Line 1: "matrix protein undergoes"

      Line 19: "the matrix viral protein 40 (VP40)"

      Line 18: considering that a virus "exists" in the form of a virion while temporarily located outside the cell, and as a "molecular entity" consisting of viral proteins and nucleic acids organised in macromolecular complexes during its life cycle inside the infected cell, this reviewer encourages the authors to rephrase as follows: " Ebola viruses (EBOVs) virions are filamentous particles, ..."

      Lines 35-36 and line 40: "that is determined by the matrix made up by the viral protein 40 (VP40), which drives ..." And then, directly use the acronym VP24 at line 40

      Line 40: as VP24 and VP35 interact with NP but do not interact with the ssRNA genome, please rephrase as follows "the nucleoprotein (NP) which encapsidates the ssRNA genome, and the viral proteins VP24 and VP35 which, together with NP, form the nucleocapsid"

      Lines 47-48: "...fusion glycoprotein (GP)...[...] the ebolaviral envelope"

      Line 51: "...remarkably long virion of EBOVs undergoes..."

      Line 63: "... in vitro, and in endo-lysosomal compartments in situ, by cryo-electron..."

      Lines 70-71: " to shed light on EBOVs ... [...] with EBOV (Zaire ebolavirus species, Mayinga strain) in biosafety level 4 (BSL4) containment"

      Line 72: chemically fixed by? (PFA and GA acronyms have been annotated in figure 1, but should be first mentioned in their explicit form in the text)

      Line 73 (cryo-FIB)

      Line 80: EBOV virions

      Figure 1A and line 97: for consistency with the terminology used in the main text, should be perhaps in the second step preferred the term "vitrification" instead of cryofixation? Readers not familiar with the field could be confused by the use of the two synonyms

      Lines 92-93: "...these data indicate [...] and suggest..."

      Figure 1C and line 100: in the color legend EBOV is annotated as dark teal, however in the segmentation of the reconstructed tomogram there are three objects, one of which in dark teal is evidently a portion of EBOV virion inside the endosome, and other two are in different shades of green. What are those? Please, could author specify their identity in the figure legend with their corresponding color code? The same applies to supplementary figure S2 (see comment below).

      Line 95: "...tomography of EBOV virions..."

      Line 98: "...showing EBOV virions..." (This reviewer refers to the use of the term 'EBOVs' as for different species within the genus rather than for different EBOV particles within a dataset)

      Line 105: "... a purified EBOV before..."

      Line 110 and 113: "...EBOV matrix..." And "EBOV virus-like particles (VLP)"

      Line 140, 141, 145 and 147: "EBOV VLPs" and "EBOV VLP"; idem at lines 188-189, 209 and anywhere else in the manuscript (including figure 4A)

      Line 235: "influenza virus ion channel..."

      Line 249: please, use directly the above-introduced acronym for the detergent

      Figure 5F: in plot's X axis label: thermolysin (T)?

      Line 342: "EBOV have remarkably long..."

      Line 420 "...matrix-specific"

      Line 464: "grids"

      Line 465: "for cryo-FIB milling"

      Line 611: "influenza virus M2 ..." (Please, from which influenza virus strain does the gene come from? Alternatively, which is the NCBI Protein and/or UniProt database code?)

      Line 623: please, use the above-designated acronym for the detergent

      Line 716: "...based on cryo-ET..."

      Line 718: "influenza virus"

      Line 734: "cryo-ET data"

      Fig. S8: for consistency with the main text, "thermolysin"

      Fig. S2, C and F: are these EBOV virions (as mentioned in the figure title) or EBOV VLPs (as the legends in the two panels of this figure seem to suggest)? Please, the authors should clarify

      Line 1046: "malleable lipid envelope of the EBOV"; this adjective sounds confusing; the reviewer encourages the authors to rephrase for more clarity.

      Significance

      see above.

    4. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Winter et al. present a study of Ebola virus fusion in the acidic environment of the late endosome. Based on cryo-ET of Ebola virions undergoing entry into cells, they note that the VP40 matrix is disassembled and dissociated from the viral membrane in virions seen in the endosome. Subsequent in vitro and computational analyses suggest that protons diffuse across the viral membrane and neutralize anionic lipids on the inner leaflet. They argue that this loss of negative charge reduces the affinity of VP40 for the viral membrane. They further suggest that VP40 dissociation from the viral membrane precedes GP-mediated membrane fusion and contributes to reduction in the energy barrier for membrane stalk formation. Whereas most studies have focused on the importance of acidic pH in triggering GP conformational changes during fusion, the present work contributes new appreciation for VP40-membrane interactions.

      • In the cryo-ET experiments aimed at visualizing Ebola entry, do the authors see evidence of viral membrane fusion? There is no mention of this in the text. Knowing that the virions that show disassembly of the VP40 matrix are in fact the virions that productively enter cells would support the conclusions of the study. As is stands, one is forced to wonder whether the virions that show VP40 disassembly prior to fusion ultimately fuse.

      • In the cryo-ET experiments that evaluate VP40 disassembly in vitro, why do the authors leave out NP from their VLP preparations? There is some evidence in the literature (Li et al., JVI 2016) that NP is necessary to form particles with native morphology. If the authors feel that NP is not necessary for their experiment, perhaps this could be noted.

      • The authors argue that acidic pH neutralizes the charge of PS phospholipids, thereby removing the electrostatic interactions of basic residues in VP40 and PS. They also note in the Methods section that 7 amino acids in VP40 are predicted by PROPKA to be protonated at pH 4.5. If the authors feel that protonation of these 7 amino acids is not involved in the loss of affinity for PS, this could be stated explicitly and justified. Could the protonation of these 7 amino acids contribute to disassembly of the VP40 lattice, rather than dissociation from the membrane?

      • Minor: Figure S5C is difficult to interpret. The red frame on the bars that indicates data acquired at low pH is nearly invisible. Better might be to indicate explicitly (ie, with words) the pH at which data were acquired.

      Significance

      The significance of the study stems from the idea that the VP40 lattice and its interaction with the viral membrane plays a direct role in facilitating viral fusion. To my knowledge, this has not been previously addressed. The significance would be considerably increased if the authors were able to demonstrate by cryo-ET that the virions with disassembled VP40 were in fact the virions that productively fused. Nonetheless, this work should be of broad interest to researchers studying viral fusion as it may represent a phenomenon relevant to numerous viruses that enter cells via the endocytic route.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Manuscript number: RC-2022-01756

      Corresponding author(s): Wenya, Hou

      1. General Responses

      Dear Editors and Reviewers,

      We deeply appreciate all critical comments and constructive suggestion from all Reviewers, which have inspired us to conceive at least 8 new important experiments and mathematic analysis/modeling (shown in dark red). In addition, we will include more repeats with quantification for spot assays (with more HU doses) and biochemical experiments as well as language revision (shown in orange).

      Below we only list the general response to the Major Concerns raised by at least two Reviewers:

      • To perform mathematic analysis of the single-cell quantitative data (Fig 4, Fig 5 and Fig S4) (Analysis #1).

      50% Sic1 degradation time from Sic1peak

      WT SC

      7.62 min

      whi7 whi5 SC

      7.91 min

      WT HU

      36 min

      whi7 whi5 del HU

      7.49 min

      50% nuclear exit time of Whi5

      WT SC

      4.69 min

      rad53Δsml1Δ SC

      7.60 min

      WT HU

      22.33 min

      rad53Δsml1ΔHU

      13.41 min

      Table R1. 50% Sic1 degradation time calculated from Sic1peak and 50% nuclear exit time of Whi5 based on the experimental data shown in Fig 5 and Fig 4, respectively.

      (2) To reinterpret the HU-induced extension of G1/S transition with an updated model (Analysis #2).

      (3) predict that like WHI7/5 overexpression, CKS1 deletion (PMID: 7958905) or sic1 mutants with longer destruction timing (T2,5S-VLLPP or T2,5S-RXL reported in Fig. 6C, PMID: 32296067), can suppress the HU sensitivity of rad53 mutants according to our model. Moreover, their suppression effects should be epistatic to WHI7/5 overexpression. Alternatively, the dosage suppression of WHI7/5 might be reversed by CKS1 overexpression or sic1 mutants with shorter destruction timing (unfortunately no such mutant has been reported yet). We will perform this set of genetic experiment to test these predictions and thereby functionally reinforce the Whi7/5-Cks1-Sic1 axis (Experiment #1).

      (4) do DNA replication profiling to examine the number of origin firing or replication capacity (Experiment #2).

      (5) To address the suppression effect of phosphorylation in Fig 2E. We agree that the phenotypes of the A-mutants of Whi7 have a weak difference compared with WT, but become much stronger (5-fold difference between two dilutions) compared with the D-mutants. As shown lately in Fig 3, phosphorylation solely facilitates protein stabilization/total levels, which can be masked by ectopic overexpression from an extra plasmid. Moreover, phosphorylation does NOT enhance Whi7’s interaction with Cks1. We should tune down the contribution of phosphorylation and focus more on the stability/protein level. Furthermore, we will do competition assays using A-/D- mutants with GFP and RFP labels (Experiment #3), and add back whi7 13A or 13D in its endogenous locus in the whi7Δwhi5Δ double mutant to test the effect on Sic1 turnover (Experiment #4).

      (6) To add more repeats with quantification for spot assays (with more HU doses) and biochemical experiments (shown in orange).

      Besides reinforcing the current model, these experiments, analysis and re-interpretation may help to clarify two concepts which remain elusive in current version:

      • S-CDK activation can switch from an abrupt/all-or-none pattern under normal condition to a gradually flattened one under replication stress.
      • Consequently, the Whi7/5-Cks1-S-CDKs axis may determine replication capacity and/or number of origin firing. Thus, we did not include a preliminary revision this time due to significant changes. We plan to request at least 6 months for an extensive full revision (e.g., from a short letter to a regular article) to improve this study to a higher level with more general significance. Therefore, we request a revision opportunity from The EMBO Journal.

      2. Point-to-point responses

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      SUMMARY

      This work begins with a heterologous screen, introducing human genes in double mec1,sml1 yeast deletants, which are alive, but sensitive to hydroxyurea. The readout was mec1,sml1 proliferation in the presence of hydroxyurea. They found that mec1,sml1 yeast mutants carrying the human RB1 gene (a G1/S transcriptional repressor) proliferated on hydroxyurea. Then, they test if known yeast G1/S transcriptional repressors (Whi5 and Whi7) could have similar effects if provided at higher than normal levels (they did). With this initial result, followed up by a variety of experiments, the authors then go on to propose that replication stress, which activates Mec1 and Rad53, triggers the phosphorylation of Whi7 (by Mec1) and Whi5 (by both Rad53 and Mec1) blocking their eviction from the nucleus, allowing them instead to bind and inhibit Cks1, a Cdk processivity factor, needed for the complete phosphorylation and degradation of a Cdk inhibitor, Sic1. This is different from published work a decade earlier in mammalian cells (ref. 37; Bertoli et al.), which showed that upon replication stress, Chk1 phosphorylates G1/S transcriptional repressors to maintain G1/S transcription, which could help genome stability. Here, the authors propose that replication stress could block the G1/S transition. While the model and some of the experiments are interesting, the rationale for some experiments was shaky, and the data do not fully support the conclusions.

      MAJOR POINTS

        • Any cell that undergoes DNA replication must have already destroyed Sic1. It has been known for 25+ years that targeting Sic1 is the only necessary function of G1/Cdk to enable DNA replication (PMID: 8755551). Sic1 does not reappear until the M/G1 transition. Hence, in the authors' model, where cells are already in the S phase, how can multisite phosphorylation and degradation of Sic1 be the critical and final output of the pathway they propose when there shouldn't be any Sic1 around, to begin with? Why would a cell that has already completed Start and the G1/S transition, is in the S phase and experiencing replication stress, care about going through the G1/S? A: Yes, S-CDK activity is regarded as an abrupt or so-called “all-or-none transition” due to a relative short half-life of Sic1 controlled by a robust double-negative feedback loop (PMID: 24130459; 23230424). Sic1 degradation requires multi-phosphorylation events including prime phosphorylation by G1-CDKs, two opposing multi-phosphorylation by S-CDK complex (Clb5–Cdk1–Cks1), one to trigger phosphodegrons and the other to terminate the degron route (PMID: 32296067). The timing and speed (or “sharpness”) of Sic1 degradation is determined by G1-CDKs and S-CDKs, respectively (PMID: 24130459 and PMID: 32296067). Sic1 degradation is not an instantaneous “all-or-none” event even under the optimal growth conditions. The Sic1 destruction timing calculated from Start (defined as 50% nuclear exit of Whi5) is about 14.2 min, whereas the time between Start and Sic1peak is about 5 min from independent studies (Fig 4G, PMID: 24130459; Fig. 6C, PMID: 32296067; Fig. 7B, 32976810). Similarly, the 50% Sic1 degradation time calculated from Sic1peak (50% of Sic1peak) is about 8 min for WT and whi7, in agreement with the results in Figure 2E, PMID: 24130459. However, in the presence of HU, the 50% of Sic1peak time remains constant (7.49 min) in whi7Δwhi5Δ cells but becomes greater than 36 min in WT. Meanwhile, the 50% nuclear exit time of Whi5 (Start) is about 22 min in WT compared to 13 min in rad53Δsml1*Δ upon HU treatment.

      50% Sic1 degradation time from Sic1peak

      WT SC

      7.62 min

      whi7 whi5 SC

      7.91 min

      WT HU

      36 min

      whi7 whi5 del HU

      7.49 min

      50% nuclear exit time of Whi5

      WT SC

      4.69 min

      rad53Δsml1Δ SC

      7.60 min

      WT HU

      22.33 min

      rad53Δsml1ΔHU

      13.41 min

      Table R1. 50% Sic1 degradation time calculated from Sic1peak and 50% nuclear exit time of Whi5 based on the experimental data shown in Fig 5 and Fig 4, respectively.

      Therefore, G1/S transition is a “transition zone” (from Start to 50% of Sic1peak) rather than a single borderline. The key finding of this study is that in the presence of HU, Sic1 degradation speed/sharpness is significantly reduced (Figure 5), mechanistically due to the inhibition of S-CDK-Cks1 by Whi7/5. This eventually reflects a flattened S-CDK activity curve, no longer an “all-or-none activation” any more upon replication stress. S-CDKs phosphorylate the two essential targets (Sld2 and Sld3) to enable DNA replication. Therefore, the Sic1 levels determine the S-CDK activities, which in turn determine the DNA replication capacity (the maximal amount of DNA a cell can synthesize per unit time). In sum, under optimal conditions, the S-CDK activity appears an abrupt/sharp transition and cells replicate DNA in its maximum capacity (i.e., minimal S phase length). When cells encounter replication stress (HU), S-CDK is activated very slowly (very low Sic1 destruction speed) and replicate DNA with a low capacity (slow fork speed and/or few origin firing) to meet the limited resource. Recently, the de Bruin group demonstrates that replication capacity can be tuned by E2F-dependent transcription (includes S-Cyclin genes) in mammalian cells (PMID: 32665547).

      Inspired by these questions, we plan to

      (1) perform mathematic analysis of the single-cell quantitative data (Fig. 5 and S4) (Analysis #1).

      (2) reinterpret the HU-induced extension of G1/S transition with an updated model (Analysis #2).

      (3) predict that like WHI7/5 overexpression, CKS1 deletion (PMID: 7958905) or sic1 mutants with longer destruction timing (T2,5S-VLLPP or T2,5S-RXL reported in Fig. 6C, PMID: 32296067), can suppress the HU sensitivity of rad53 mutants according to our model. Moreover, their suppression effects should be epistatic to WHI7/5 overexpression. Alternatively, the dosage suppression of WHI7/5 might be reversed by CKS1 overexpression or sic1 mutants with shorter destruction timing (unfortunately no such mutant has been reported yet). We will perform this set of genetic experiment to test these predictions and thereby functionally reinforce the Whi7/5-Cks1-Sic1 axis (Experiment #1).

      (4) do DNA replication profiling to examine the number of origin firing or replication capacity (Experiment #2).

      • The results in Figure 2C are confusing and difficult to interpret. For example, comparing lane 8 (WT without hydroxyurea) to lane 7 (WT with hydroxyurea), it appears that there is more phosphorylated Whi7 in lane 7 (hydroxyurea treatment) than in lane 8 (no treatment). But, the ratio of phosphorylated/unphosphorylated Whi7 is not that different (there is very little unphosphorylated Whi7 in lane 8). Same problem when comparing lanes 3 and 4. I understand that they later show that Whi7 is stabilized by hydroxyurea, but from the data in this figure, what exactly can they conclude here?*

      A: Yes, phosphorylation is a bit confusing according to the current statement. Without HU, Whi7 is phosphorylated by G1-CDKs with a much less total protein level as well. With HU, whi7 is phosphorylated by Mec1 and Rad53, because Whi7-P largely disappeared in rad53 mutant (lane 1) and 13A (with all putative Mec1-Rad53 sites mutated, lane 5). Lanes 3 and 4 are biological repeats of Lanes 7-8 with less loading. We will clarify our statement.

      • Their data in Figure 2E show that phosphorylation of Whi7 is not required for suppressing the lethality of rad53,sml1 cells treated with hydroxyurea. Cells carrying Whi7-41A (lacking all possible phosphorylations) suppressed nearly as well as wild-type Whi7 did. The purported differences in the suppression are minuscule at best and not evident at the dilutions tested. It is not clear at all how they can conclude that phosphorylation of Whi7 has anything to do with the ability of Whi7 overexpression to suppress the lethality of rad53,sml1 cells.*

      A: Yes, we agree that the phenotypes of the A-mutants of Whi7 have a weak difference compared with WT, but become much stronger (5-fold difference between two dilutions) compared with the D-mutants. As shown lately in Fig 3, phosphorylation solely facilitates protein stabilization/total levels, which can be masked by ectopic overexpression from an extra plasmid. Moreover, phosphorylation does NOT enhance Whi7’s interaction with Cks1.

      Anyway, we should tune down the contribution of phosphorylation and focus more on the stability/protein level. Furthermore, we will do competition assays using A-/D- mutants with GFP and RFP labels __(Experiment #3) __and add back whi7 13A or 13D in its endogenous locus in the whi7

      • For all the arguments they make about this new role of Whi5 and Whi7 at Start, they do not examine size homeostasis or the kinetics of cell cycle progression in any of their experiments and their mutants, with or without hydroxyurea treatment.*

      A: Good suggestion. We will examine size homeostasis, budding index or the cell cycle progression in the related experiments (Experiment #5). In Fig. S5, we only showed the cell cycle progression profiles in wild-type cells carrying an extra copy of Whi7 WIQ or Whi7 WIQ ΔC. WIQ mutant (without Swi6 binding activity) significantly slowed the cell cycle progression under normal conditions.

      • The Sic1 stability experiments they show in Figure 5 are nice. They would need to be extended to their various mutants, including their Whi7 phosphomutants, to make a case for phosphorylation by Rad53 and Mec1 in this process.*

      A: Thanks, very good suggestion, we will add back whi7 13A or 13D in its endogenous locus in the whi7Δwhi5Δ double mutant (Experiment #4), to avoid the effects of overexpression.

      MINOR POINTS

        • The language is awkward. Editing for style will be necessary.* A: We will request language editing.
      1. They use different hydroxyurea doses in the experiments they show, making it difficult to conclude much when comparing different figures. Why aren't they consistent from experiment to experiment?*

      A: Sorry for the confusing. We used at least three HU concentration gradients in each experiment, but only showed one of them to save the space for a short article. Notably, S. cerevisiae has a much broader range of HU doses (up to 300 mM) than other species (less than 10 mM). We’ll add other Figures during revision.

      **Referees cross-commenting**

      Overall, all reviews are well-aligned. The points raised by the other reviewers are valid, and the reviews are thorough and detailed. I don't know whether the authors will be able to respond since the list is quite long. Even if they do, the manuscript will look very different. I do not have anything else to add.

      Reviewer #1 (Significance (Required)):

      The manuscript presents some interesting data, most notably the role of Whi7 and Whi5 in the stability of Sic1 in vivo and the various in vitro experiments the authors present. The advance is conceptual and mechanistic, offering a different and unanticipated model for the role of these proteins at Start, under replication stress. Unfortunately, the significance of the manuscript is limited. A convincing case for their model and its importance has not been made. For example, their data in Figure 2E, measuring the ability of phosphomutants to suppress the lethality of rad53,sml1 cells upon replication stress, is underwhelming and undermines the importance of the study, particularly to a wider audience.

      A: Thanks for the suggestion, we will improve the model as discussed above.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      Summary:

      Jin et al demonstrate a novel type of regulation of the G1/S transition in response to hydroxyurea stress. They approach this by first screening a library of human proteins (cDNA on yeast plasmids) for repressors of the mec1 or rad53 HU sensitivity. HU inhibits ribonucleotide reductase and thus lowers dNTP pools needed for S-phase. This slows replication and leads to stalled replication forks, triggering a "replication stress" response, which is executed by the kinases Mec1 and Rad53. Deletions of mec1 or rad53 are viable in unstressed conditions (with additional sml1 deletion), but are lethal on even low doses of HU. One main hit that rescued this lethality was the human G1/S inhibitor RB. They then went on to confirm that also the yeast analogs Whi5 and Whi7 can rescue mec1 or rad53 lethality when overexpressed. To track down the mechanism, the authors do a variety of genetic and biochemical assays. The resulting model is that Mec1 and Rad53 phosphorylate and stabilize Whi7, which binds to and inhibits the S-phase-CDK complex via the processivity factor Cks1. So on top of acting as a transcriptional repressor, Whi7 (and probably also Whi5) is also a direct interactor and inhibitor of CDK. The binding of Whi7 to Cks1-Clb5/6-CDK prevents the hyperphosphorylation and degradation of the inhibitor Sic1, and thus slows the G1/S transition in response to HU.

      Major comments:

      - Are the key conclusions convincing?

      ->Overall I think the sum of the evidence supports the suggested model, individual claims though are on somewhat shaky grounds based often on single replicates, see below.

      My main conceptual issue may be somewhat just a "semantic" problem. In my understanding "replication stress" refers to stalled replications forks and/or large stretches of single-strand DNA which then triggers a checkpoint response. So how would slowing the G1/S transition help to deal with "replication stress", if replication is not yet happening in these cells? I am assuming Mec1 senses dNTP depletion also in the absence of replication and that is how Mec1 and Rad53 become active in G1. But then maybe the model and the arguments can be phrased differently? What exactly is slowing down Sic1 degradation doing for the cell? Replenishing dNTP pools before the first origins fire? Or is maybe Sic1 not the most important target of this regulation? Maybe also during S-phase, partially inhibiting CDK is beneficial, maybe to stretch out origin firing... or?

      A: Thank you, very good suggestion. This also helps to address the Major Point 1 raised by Reviewer #1. This also reminds us about the work from Pasero’s group demonstrating that Mec1 is activated at the onset of normal S phase by low dNTPs (PMID: 32169162). We will revise the text, and do DNA replication profiling __(Experiment #2) __to examine the number of origin firing or replication speed. Also see response to Point 1 of Reviewer #1.

      - Should the authors qualify some of their claims as preliminary or speculative, or remove them altogether?

      ->Most of the work is done on Whi7 and then some Whi5 in the end, I would tone down on the Whi5 claims a bit.

      A: Very good suggestion. We have to include Whi5 in the story because it plays a redundant role with Whi7.

      - Would additional experiments be essential to support the claims of the paper? Request additional experiments only where necessary for the paper as it is, and do not ask authors to open new lines of experimentation.

      -> Since the authors are clearly able to do quantitative live cell imaging, I do not understand why they do not quantify Whi7 concentrations and localization in response to HU instead of using Western blots of synchronized cells. This would make the whole thing much more credible, especially given the current lack of replicates (see below). This would also allow correlating the timing and amount of the Whi7 response with the stabilizing of Sic1 in single cells.

      A: Yes, we tried but did not see Whi7-GFP clearly because of its very low protein abundance, which is also not shown in literature as far as we know. Only overexpressed Whi7 fluorescence detection(PMID: 33443080).

      ->The causality of phosphorylation being required for stabilization seems plausible from the genetics, but is far from clear in the western blots. Here, concentration increase seems to precede phosphorylation. Could this due to induced Whi7 transcription?

      A: Good suggestion. We will detect Whi7 mRNA levels through qPCR (Experiment #6).

      ->Many if not most claims are based on single replicates. See below.

      - Are the suggested experiments realistic in terms of time and resources? It would help if you could add an estimated cost and time investment for substantial experiments.

      -I am not suggesting any different types of experiments or new methods, so it should be doable within a few weeks.

      - Are the data and the methods presented in such a way that they can be reproduced?

      -I would suggest the authors spell out all of their experimental procedures instead of referring to "as described previously". I think everyone knows the pains of going on a wild goose chase of following references to the original method description.

      A: Good suggestion. I will described all experimental procedures to replace "as described previously".

      - Are the experiments adequately replicated and statistical analysis adequate?

      -The key weakness of this entire paper is imho that many claims are based on single experiments, that are neither replicated nor quantified. For example, all the co-IPs (such as 1E or 3F) should be replicated and the ratio of bait to target quantified and averaged.

      A: Good suggestion. We will show the biological repeats and quantification.

      -If a claim is made regarding increased phosphorylation in vivo, then again this should be replicated and the ratio of phosphorylated to unphosphorylated bands quantified. In many Whi7 gels it looks like it is mainly the total amount of the protein that is changing rather than the phosphorylation state. But again, by eye and from a single replicate, this is hard to tell.

      A: Good suggestion. We will add more repeats.

      -A similar thing holds true for the spot assays. Spot assays are great to show lethality and rescue as in the first figure. But making semi-quantitative claims of different degrees of "partial rescue" from a single spot assay is a bit speculative. This seems especially true since the authors are using different and seemingly random HU concentrations for every spot assay, which suggests that the effect is not very robust and can only be seen in very specific concentration ranges. If e.g. the degree of rescue between WT, A and D mutants or truncations matters for the model/the storyline, then more quantitative growth or competition assays should be added.

      A: Good suggestion. sorry for the confusing. We used at least three HU concentration gradients in each experiment, but only showed one of them to save the space for a short article. Notably, S. cerevisiae has a much broader range of HU doses (up to 300 mM) than other species (less than 10 mM). We’ll add other Figures during revision, and do competition assays using A-/D- mutants with GFP and RFP labels

      Minor comments:

      - Specific experimental issues that are easily addressable.

      ->At least some of the alpha-factor release experiments should contain infos on budding index and/or DNA content to understand see the delay in timing by HU addition.

      A: Good suggestion. We will examine size homeostasis, budding index or the cell cycle progression in the related experiments (Experiment #5).

      - Are prior studies referenced appropriately?

      ->Seems fine from the G1/S side, but I don't know the Mec1/Rad53 literature well enough to judge.

      - Are the text and figures clear and accurate?

      ->The authors could do another round of proofing figures and legends. For example, Fig 5C contains scale bars that are not defined, blot 3E has an asterix labeling that is not defined, the model in 5E has misspelled "degradation"...

      A: We will proofread and revise the full text again.

      - Do you have suggestions that would help the authors improve the presentation of their data and conclusions?

      -> The authors use a lot of different mutants (especially for Whi7). Even for someone who knows the proteins fairly well, it is hard to remember throughout the text which abbreviation is relating to which mutations and which function that is addressing. Maybe occasionally remind the reader of what the mutant is or use terms like Whi7non-binding rather than WIQ.

      A: Thank you for your suggestion. We will add (TF non-binding) after WIQ.

      ->The text could also use another round of proof-reading. The overall flow of the storyline is easily comprehensible, but sometimes there is a sudden switch of topics or new proteins come out of nowhere. Some expressions are used in a way that is not common English.

      A: We will request language editing.

      Reviewer #2 (Significance (Required)):

      - Describe the nature and significance of the advance (e.g. conceptual, technical, clinical) for the field.

      ->This study is a major conceptual contribution to understanding G1/S regulation in perturbed conditions (assuming the results can be replicated and quantified as detailed above). That Whi7 (and maybe Whi5) directly inhibit Clb5/Clb6-CDK through Cks1 binding is an important addition/modification to the current model and may well be important beyond genotoxic stress.

      A: Thanks and we’ll reinforce it with more repeats and quantification.

      - Place the work in the context of the existing literature (provide references, where appropriate).

      ->The authors do this reasonably well.

      - State what audience might be interested in and influenced by the reported findings.

      -> Anyone in the yeast cell cycle/replication field should find this interesting. It should also have important implications for the mammalian cell cycle/replication/DNA damage field.

      - Define your field of expertise with a few keywords to help the authors contextualize your point of view. Indicate if there are any parts of the paper that you do not have sufficient expertise to evaluate.

      ->I am well familiar with G1/S control and all the methods used in the study. I am not an expert on replication stress/DNA damage/ checkpoint signaling.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      Summary

      In their manuscript "Transcription-independent hold of the G1/S transition is exploited to cope with DNA replication stress", Jin et al. intend to show that Retinoblastoma-like G1/S transcriptional repressors can also work as S-CDK-Cks1 inhibitors in response to DNA replication stress, hence prolongating the G1/S transition to enable cells to deal with replication stress. In particular, they aim to identify the mechanism by which Whi7/Srl3 (Suppressor of Rad53 Lethality) rescues the lethality of rad53 yeast mutants. Even though their very first experiment is performed using human RB1, the remainder or the work is performed in the yeast model organism. Experimental methods used include mostly immunoprecipitation experiments (Western blots), spot assays, and some single cell microscopy (not specified if widefield or confocal).

      Major comments

      1) the authors refer to a cross-species screen where they aim to detect human proteins that rescue, upon overexpression, the yeast mec1Dsml1D and rad53Dsml1D lethality (of note, not mec1D/rad53D: why?). They identify hRB1 this way. But the entire screen data is missing, either is the analysis pipeline and "hit selection thresholds" (if applicable). Then no more experiments are performed on human cells or using human proteins. In my opinion this cross-specie approach is not necessary, or not developed enough.

      A: Yes, we have only performed a pilot screen based on the growing on 4 mM HU. We consider removing it. The reason to use mec1Dsml1D for genetic screen is that mec1D/rad53D cells are dead even without HU, whereas dissection assays do not fit for large-scale screening.

      2) Moreover, the interpretation of the data provided as a whole is strongly complicated by the variability in the HU doses used to trigger the Mec1/Rad53 response. While most immunoprecipitation experiments are performed with 200mM, spot assays are performed at various HU concentrations ranging from 3 to 21mM (and exploring the entire range). Sometimes HU concentrations differ on the same Figure panels. Downstream effects of such diverse HU concentrations might also be very diverse and due to this it is difficult to get an understanding of how the different experiments fit together.

      A: Sorry for the confusing. We used at least three HU concentration gradients in each experiment, but only showed one of them to save the space for a short article. Notably, S. cerevisiae has a much broader range of HU doses (up to 300 mM) than other species (less than 10 mM). Spot assays (HU are persistent) are mostly done in the mec1Dsml1D and rad53Dsml1D background (sensitive to 4 mM HU), whereas the IP experiments (only 2-3 h treatment and then removal) are mainly performed in WT or at least in comparison with WT background (resistant up to 250 mM HU). We’ll add other Figures during revision.

      3) Likewise, some experiments are performed only on rad53D backgrounds, or only on mec1D backgrounds (e.g. Fig1B and Fig1F, respectively), while results are claimed valid for the two gene deletion backgrounds.

      A: Thank you. We will add some “not shown data” and remove the invalid claims without data.

      4) Finally, the experiments performed in this study and/or their quantitative analysis are insufficient to support several of the claims, and results are often "over-interpreted". Below I have listed some of such insufficient experiments/analyses, in regard of the interpretation that the authors make of each piece of data.

      - Fig1B could indeed show that Whi7 could rescue rad53D lethality but it is hard to judge from just one tetrad. Many tetrads should be shown to exclude "random sampling" effects.

      A: Thank you. We will add more repeats and remove over-statements. Fig 1B was carried out for at least 12 tetrads but the original picture has been unintentionally lost. We can repeat it if necessary, but the result was validated by the plasmid shuffling experiment (Fig 1C).

      - Fig1F indeed shows that the rescue effect of Whi7 overexpression on mec1Dsml1D lethality in HU does not require its G1/S transcription factor-binding motif (GTB); however, it does not prove that it is independent on any putative effects that Whi7 could have on transcription (it could affect other transcription factors, or even the same ones via other domains).

      A: Good suggestion. As far as we know, there are no reports proving that Whi7 binds to other transcription factors. To rule out this possibility, we will detect whether overexpression of WHI7 affects the transcription of representative G1/S genes (Experiment #7).

      - FigS2A does not really support the authors' claim that Whi7 is hyperphosphorylated upon HU-treatment: the first lane before HU treatment already show the same hyperphosphorylated bands than the second lane (see "darker exposure"); however, the signal intensity is clearly lower so the overall levels of Whi7 are clearly increased by HU, rather than the relative fractions of phosphorylated species.

      A: Yes, we will modify the statement as suggested.

      - Fig2B shows that HU-dependent increase in Whi7 levels is partially abrogated in rad53Dsml1D and mec1Dsml1D mutant backgrounds, which demonstrates that Whi7 upregulation requires either Rad53 or Sml1, and Mec1 or Sml1, but not Rad53/Mec1 as claimed by the authors.

      A: Thank you, we will revise the statement. The only known function of Sml1 is a small unstructured protein inhibitor of Rnr1.

      - Likewise, Fig2B does not show any significant Whi7 phosphorylation following HU-treatment in the whi7-13AP mutant with all CDK consensus sites mutated to alanine. There is indeed a slightly slower migrating band appearing as acknowledge by the authors, which also appears in the mec1Dsml1D and rad53Dsml1D backgrounds. Again here, higher Whi7 levels in the WT background make the comparison with mec1Dsml1D and rad53Dsml1D backgrounds almost impossible. Quantification of the blots, including normalization of the signals of each phosphorylated band to the total signal, could help. But overall this figure does not demonstrate any Mec1/Rad53-dependent Whi7 phosphorylation following HU treatment. The phostag gel Fig2C might show the same result, as the differences in phosTag signals between different conditions might just simply reflect the differences in total amount of Whi7 between those same conditions. However, I acknowledge that Figs 2D and S2C shows Rad53- and Mec1-triggered Whi7 phosphorylation in vitro, but the conditions of this experiments likely differ a lot from in vivo context (kinase levels, competing substrates, presence of co-factors...).

      A: Thank you, we will quantify the blotting as suggested.

      - Along the same lines, Fig3E seems to show that truncation of Whi7 C terminus slightly reduces its efficiency in pulling down Cks1 (indicating reduced interaction). However, the total amount of WT Whi7 in the pull down seems to exceed the total amount of Whi7-DeltaC protein, which could in part explain the difference in Cks1 signal. Here again, quantification of the WB signals and adequate normalization would maybe make this figure more convincing.

      A: Good suggestion. We will show the biological repeats and quantification.

      - Fig4A-B (Whi5 GFP data): the cell representing the absence of HU shows Whi5 nuclear export and therefore likely passes through G1/S; the HU-treated cell shown as example does not export Whi5 from the nucleus, certainly because it does not pass G1/S. IMHO this demonstrates that the G1/S transition is delayed in HU-treated cells (as shown previously), irrespective of any role of Whi5 or Whi7 in this delay.

      - Likewise, Fig4C shows the absence of HU-induced delay in Whi5 nuclear export in rad53Dsml1D cells; however, while the authors claim this indicates "Rad53-dependent nuclear detention of Whi5", it is equally plausible that it indicates that rad53Dsml1D cells do not delay the G1/S transition under HU treatment.

      A: good comments. We should claim both possibilities at this stage. Previous studies mainly show delays in the Start stage (e.g., down-regulate SBF transcription). CLN1/2 deletion is known to delay DNA replication in a Sic1-dependent manner albeit with unknown mechanism in the S-CDK activation stage.

      - The same ambiguity holds for Fig5A,B (Sic1-GFP quantification in whi5Dwhi7D double deletion strain following release from alpha factor block): indeed Sic1 is degraded fast after release from alpha factor block both in presence of HU, while in WT cells Sic1 is not immediately degraded in presence of HU. While authors claim that "Whi7 and Whi5 significantly slow down the Sic1 degradation", this result could also likely reflect that whi5Dwhi7D cells pass G1/S even in this context, and therefore that whi5 or whi7 or both have a role in maintaining cells in G1, not showing any direct implication of Whi5/Whi7 in Sic1 degradation.

      A: good comments. It only provides some indirect hints. For instance, whi5Dwhi7D cells pass G1/S in a same timing as WT in the absence of HU (Fig. S4), indicating that the role of Whi5/7 in the G1/S delay is related to additional checkpoint function, not normal G1 maintaining function. Moreover, it should be combined with other results, for example, dosage suppression effects in the presence of HU and inhibitory effects in the absence of HU. Direct evidence of Whi5/Whi7 in Sic1 degradation and Cks1 inhibition comes only from the biochemical experiments shown in Fig 3E-3H.

      - FigS5: the authors show here that overexpression of Whi7-WIQ (that does not bind SBF) slows down the G1/S transition following release from alpha factor blockade, but this data does not demonstrate anything related to the role of Whi7 in the DNA replication stress response. Indeed, since Whi7 sequesters Cln3 in the ER (independent of any putative role on transcription regulation), its overexpression could simply reflect an increased sequestering of Cln3 pool. What does this result become in a cln3D background?

      A: Very good suggestion. We will check whether cln3Δ affects the suppression effect of Whi7 (Experiment #8).

      Due to the fundamental concerns raised above in the interpretation of the data, it is difficult to predict the outcome of more controlled experiments that would aim to prove the same statements. This makes the estimation of the time and resources required to complete the study almost impossible.

      Minor comments

      Owing to the major comments above, an important re-structuration of the study is required, and minor comments I may have on this version are likely to be irrelevant to the revised manuscript.

      Reviewer #3 (Significance (Required)):

      The study aims to establish a molecular link between the progression through the G1/S transition and the DNA damage and DNA replication stress responses. Establishing molecular links between different phases of the cell cycle is an important question in basic research, and might be of interest for a broad range of cell biologists, even though the study is conducted in a model organism (budding yeast). The link proposed involves G1/S inhibitors Whi5 and Whi7, that would bind and inhibit the Cks1 subunit of S-CDK complexes, downstream of Rad53 and Mec1 signaling. The authors confirm some known results (e.g., Whi7 overexpression bypasses rad53 lethality in presence of HU) and gather new pieces of data using well-established methods (immunoprecipitation, spot assays, fluorescence microscopy). However, many experiments reported in this study are not sufficient to support the authors' claims, and therefore the novel mechanistic insight that this study ambitions to provide is not established.

      My scientific background being more in bio-imaging than in biochemistry, it is possible that I missed some hands-on experience to correctly interpret artefacts on western blots, however I do not feel like I missed sufficient expertise to evaluate any section of the manuscript.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      Summary

      In their manuscript "Transcription-independent hold of the G1/S transition is exploited to cope with DNA replication stress", Jin et al. intend to show that Retinoblastoma-like G1/S transcriptional repressors can also work as S-CDK-Cks1 inhibitors in response to DNA replication stress, hence prolongating the G1/S transition to enable cells to deal with replication stress. In particular, they aim to identify the mechanism by which Whi7/Srl3 (Suppressor of Rad53 Lethality) rescues the lethality of rad53 yeast mutants. Even though their very first experiment is performed using human RB1, the remainder or the work is performed in the yeast model organism. Experimental methods used include mostly immunoprecipitation experiments (Western blots), spot assays, and some single cell microscopy (not specified if widefield or confocal).

      Major comments

      1. the authors refer to a cross-species screen where they aim to detect human proteins that rescue, upon overexpression, the yeast mec1Dsml1D and rad53Dsml1D lethality (of note, not mec1D/rad53D: why?). They identify hRB1 this way. But the entire screen data is missing, either is the analysis pipeline and "hit selection thresholds" (if applicable). Then no more experiments are performed on human cells or using human proteins. In my opinion this cross-specie approach is not necessary, or not developed enough.
      2. Moreover, the interpretation of the data provided as a whole is strongly complicated by the variability in the HU doses used to trigger the Mec1/Rad53 response. While most immunoprecipitation experiments are performed with 200mM, spot assays are performed at various HU concentrations ranging from 3 to 21mM (and exploring the entire range). Sometimes HU concentrations differ on the same Figure panels. Downstream effects of such diverse HU concentrations might also be very diverse and due to this it is difficult to get an understanding of how the different experiments fit together.
      3. Likewise, some experiments are performed only on rad53D backgrounds, or only on mec1D backgrounds (e.g. Fig1B and Fig1F, respectively), while results are claimed valid for the two gene deletion backgrounds.
      4. Finally, the experiments performed in this study and/or their quantitative analysis are insufficient to support several of the claims, and results are often "over-interpreted". Below I have listed some of such insufficient experiments/analyses, in regard of the interpretation that the authors make of each piece of data.

      5. Fig1B could indeed show that Whi7 could rescue rad53D lethality but it is hard to judge from just one tetrad. Many tetrads should be shown to exclude "random sampling" effects.

      6. Fig1F indeed shows that the rescue effect of Whi7 overexpression on mec1Dsml1D lethality in HU does not require its G1/S transcription factor-binding motif (GTB); however, it does not prove that it is independent on any putative effects that Whi7 could have on transcription (it could affect other transcription factors, or even the same ones via other domains).
      7. FigS2A does not really support the authors' claim that Whi7 is hyperphosphorylated upon HU-treatment: the first lane before HU treatment already show the same hyperphosphorylated bands than the second lane (see "darker exposure"); however, the signal intensity is clearly lower so the overall levels of Whi7 are clearly increased by HU, rather than the relative fractions of phosphorylated species.
      8. Fig2B shows that HU-dependent increase in Whi7 levels is partially abrogated in rad53Dsml1D and mec1Dsml1D mutant backgrounds, which demonstrates that Whi7 upregulation requires either Rad53 or Sml1, and Mec1 or Sml1, but not Rad53/Mec1 as claimed by the authors.
      9. Likewise, Fig2B does not show any significant Whi7 phosphorylation following HU-treatment in the whi7-13AP mutant with all CDK consensus sites mutated to alanine. There is indeed a slightly slower migrating band appearing as acknowledge by the authors, which also appears in the mec1Dsml1D and rad53Dsml1D backgrounds. Again here, higher Whi7 levels in the WT background make the comparison with mec1Dsml1D and rad53Dsml1D backgrounds almost impossible. Quantification of the blots, including normalization of the signals of each phosphorylated band to the total signal, could help. But overall this figure does not demonstrate any Mec1/Rad53-dependent Whi7 phosphorylation following HU treatment. The phostag gel Fig2C might show the same result, as the differences in phosTag signals between different conditions might just simply reflect the differences in total amount of Whi7 between those same conditions. However, I acknowledge that Figs 2D and S2C shows Rad53- and Mec1-triggered Whi7 phosphorylation in vitro, but the conditions of this experiments likely differ a lot from in vivo context (kinase levels, competing substrates, presence of co-factors...).
      10. Along the same lines, Fig3E seems to show that truncation of Whi7 C terminus slightly reduces its efficiency in pulling down Cks1 (indicating reduced interaction). However, the total amount of WT Whi7 in the pull down seems to exceed the total amount of Whi7-DeltaC protein, which could in part explain the difference in Cks1 signal. Here again, quantification of the WB signals and adequate normalization would maybe make this figure more convincing.
      11. Fig4A-B (Whi5 GFP data): the cell representing the absence of HU shows Whi5 nuclear export and therefore likely passes through G1/S; the HU-treated cell shown as example does not export Whi5 from the nucleus, certainly because it does not pass G1/S. IMHO this demonstrates that the G1/S transition is delayed in HU-treated cells (as shown previously), irrespective of any role of Whi5 or Whi7 in this delay.
      12. Likewise, Fig4C shows the absence of HU-induced delay in Whi5 nuclear export in rad53Dsml1D cells; however, while the authors claim this indicates "Rad53-dependent nuclear detention of Whi5", it is equally plausible that it indicates that rad53Dsml1D cells do not delay the G1/S transition under HU treatment.
      13. The same ambiguity holds for Fig5A,B (Sic1-GFP quantification in whi5Dwhi7D double deletion strain following release from alpha factor block): indeed Sic1 is degraded fast after release from alpha factor block both in presence of HU, while in WT cells Sic1 is not immediately degraded in presence of HU. While authors claim that "Whi7 and Whi5 significantly slow down the Sic1 degradation", this result could also likely reflect that whi5Dwhi7D cells pass G1/S even in this context, and therefore that whi5 or whi7 or both have a role in maintaining cells in G1, not showing any direct implication of Whi5/Whi7 in Sic1 degradation.
      14. FigS5: the authors show here that overexpression of Whi7-WIQ (that does not bind SBF) slows down the G1/S transition following release from alpha factor blockade, but this data does not demonstrate anything related to the role of Whi7 in the DNA replication stress response. Indeed, since Whi7 sequesters Cln3 in the ER (independent of any putative role on transcription regulation), its overexpression could simply reflect an increased sequestering of Cln3 pool. What does this result become in a cln3D background? Due to the fundamental concerns raised above in the interpretation of the data, it is difficult to predict the outcome of more controlled experiments that would aim to prove the same statements. This makes the estimation of the time and resources required to complete the study almost impossible.

      Minor comments

      Owing to the major comments above, an important re-structuration of the study is required, and minor comments I may have on this version are likely to be irrelevant to the revised manuscript.

      Significance

      The study aims to establish a molecular link between the progression through the G1/S transition and the DNA damage and DNA replication stress responses. Establishing molecular links between different phases of the cell cycle is an important question in basic research, and might be of interest for a broad range of cell biologists, even though the study is conducted in a model organism (budding yeast). The link proposed involves G1/S inhibitors Whi5 and Whi7, that would bind and inhibit the Cks1 subunit of S-CDK complexes, downstream of Rad53 and Mec1 signaling. The authors confirm some known results (e.g., Whi7 overexpression bypasses rad53 lethality in presence of HU) and gather new pieces of data using well-established methods (immunoprecipitation, spot assays, fluorescence microscopy). However, many experiments reported in this study are not sufficient to support the authors' claims, and therefore the novel mechanistic insight that this study ambitions to provide is not established.

      My scientific background being more in bio-imaging than in biochemistry, it is possible that I missed some hands-on experience to correctly interpret artefacts on western blots, however I do not feel like I missed sufficient expertise to evaluate any section of the manuscript.