16,278 Matching Annotations
  1. Nov 2018
  2. Aug 2018
  3. Jul 2018
    1. On 2016 Aug 25, Theodore I Lidsky commented:

      Keller (1) comments on the paper “ Is the aluminum hypothesis dead?” (2) that “Lidsky points out that the clinical presentation of dementia caused by elevated aluminum levels in dialysis patients is clearly distinct from that of true Alzheimer-type dementia.” Keller continues, however viz: “ As a primary-care physician who must answer patients' questions about the risks of dietary aluminum, that distinction truly makes no difference to patients or to myself.”

      The kidneys are the primary route of elimination of aluminum. The aluminum-induced dementia described in my paper was observed, and is only observed, in patients with renal insufficiency. Brain concentrations of aluminum of the levels described in cases of dialysis encephalopathy (3) are not found in individuals with normal renal function exposed to dietary aluminum.

      1. Keller D. Dementia caused by elevated aluminum levels in dialysis is not Alzheimer's disease: a distinction without a difference. 2016 Aug 07.

      2. Lidsky TI. Is the aluminum hypothesis dead? J Occup Environ Med. 2014;56(5)(suppl): S73-S79.

      3. Alfrey AC, LeGengre GR, Kaehny WD. The dialysis encephalopathy syn-drome. New Eng J Med. 1976;294:184–188.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2015 Feb 11, Marco Ventura commented:

      I do not understand what is the novelty of this study. Very similar studies have been already published about the comparative genomics of the genus Bifidobacterium. Just as a remark for the authors and for the potential readers that are not from this field: see the following papers published in August 2014:

      • Milani, C., Lugli, G.A., Duranti, S., Turroni, F., Bottacini, F., Mangifesta, M., Sanchez, B., Viappiani, A., Mancabelli, L., Taminiau, B., Delcenserie, V., Barrangou, R., Margolles, A., van Sinderen, D., and Ventura, M. 2014. Genome encyclopaedia of type strains of the genus Bifidobacterium. Appl. Environ. Microbiol. 80(20):6290-302.

      • Lugli, G.A., Milani, C., Turroni, F., Duranti, S., Ferrario, C., Viappiani, A., Mancabelli, L., Mangifesta, M., Taminiau, B., Delcenserie, V., van Sinderen, D. and Ventura, M. 2014. Investigation of the evolutionary development of the genus Bifidobacterium by comparative genomics. Appl. Environ. Microbiol. 80(20):6383-94.

      Enjoy the reading


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2015 Sep 25, Kenneth Witwer commented:

      As stated in a letter to the editor (Witwer KW, 2015), monocot-specific MIR528 was the apparently most abundant and best-absorbed miRNA in this study, more abundant than all other detected plant miRNAs combined. Watermelon--the only material ingested by the study volunteers--is a dicot. No sequences identical to mature or precursor MIR528 are found in watermelon sequences in public databases, nor in any currently available dicot genomes. In response to this observation and as evidence for the existence of dicot MIR528, the authors refer to Lin Y, 2013, in which a putative MIR528 relative was identified in an RNA sequencing library prepared from the dicot Dimocarpus longan. This sequence, CTGGAAGTGGATGCAGAGGG, has no fewer than five nucleotide differences from monocot MIR528, gUGGAAGGGGCAUGCAGAGGAGc (lower case letters are precursor nts surrounding the mature miRNA). No such sequence appears to be found in the public genomes or transcriptomes of watermelon or other dicots. The putative longan sequence matches better to various sequences with a common 18-nt stretch found in dicots, but also in animals, than to MIR528. Even if the putative dicot MIR528 sequence were a microRNA, the two differences from monocot at the 3' end would interfere with stem-loop reverse transcription by the monocot-specific assay used by the authors. In any case, for a dicot plant to express an otherwise monocot-specific miRNA, the sequence would first have to be present in the genome of the dicot. Unless and until genomic evidence is provided, MIR528 detected in watermelon or watermelon-fed humans must be presumed to be a contaminant or other artifact.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Jan 22, Stefan Hofmann commented:

      Stefan G. Hofmann, Nora Esser, and Giovanbattista Andreoli:

      The study by Leichsenring and colleagues highlights the importance of considering the quality of the studies that are included in a meta-analysis when evaluating the results. The Cochrane Collaboration’s Tool (Higgins et al., 2011) is a commonly-used instrument to quantify the risk of bias using the following criteria: allocation sequence concealment, blinding of participants and personnel, blinding of outcome assessment, incomplete outcome data, and selective outcome reporting. We analyzed the 64 randomized controlled trials of manual-guided PDT for specific mental disorders that were used in the review by Leichsenring et al (see Table 1). Thirty studies showed risk biases in sequence generation, 54 in allocation concealment, and 31 in the blinding conditions. Only one of the studies showed no obvious biases. Our results suggest that the studies included in Leichsenring’s meta-analysis were of poor quality, essentially invalidating the authors’ results and making the findings meaningless. Table 1: http://issuu.com/gvand/docs/quality_ratings_of_studies_in_leich/1 Table 2: http://issuu.com/gvand/docs/description_and_results_of_studies/1 References: Higgins, J.P., Altman, D.G., Gøtzsche, P.C., Jüni, P., Moher, D., Oxman, A.D., Savovic, J., Schulz, K.F., Weeks, L., Sterne, A.C., Cochrane Bias Methods Group, Cochrane Statistical Methods Group (2011). The Cochrane Collaboration´s tool for assessing risk of bias in randomised trials. RESEARCH METHODS & REPORTING, 343.)


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Aug 23, David Keller commented:

      Results are misleadingly presented; mortality is reduced with moderate alcohol consumption

      The Results section of the above abstract misleadingly states:

      "The hazard ratio and 95% confidence interval in fully adjusted analyses was 1.02 (0.94-1.11) for <7 drinks/week, 1.14 (1.02-1.28) for 7 to <14 drinks/week, 1.13 (0.96-1.35) for 14 to <21 drinks/week, and 1.45 (1.16-1.81) for ≥ 21 drinks/week."

      The above quote falsely implies that all amounts of alcohol consumption increased mortality, either with statistical significance, or at least by trend (depending on whether the confidence interval for a Hazard Ratio crosses 1.0).

      These results are from line 5 of Table 2 of this paper, which gives the fully-adjusted results for all study participants. They are misleading, as presented, for two reasons. First, they are normalized by the Hazard Ratio of a newly-defined category called "occasional drinkers", which is a flawed and erroneously defined category of drinkers, for reasons I detail elsewhere [1]. Second, a very important data point has been omitted from these Results, namely the Hazard Ratio for non-drinkers, which is 1.19 (1.11-1.27). Why is the Hazard Ratio for non-drinkers elevated? Because it is normalized by the Hazard Ratio for "occasional drinkers", a statistical maneuver which introduces errors and obscures the true relationship of mortality with alcohol intake.

      Thus informed, we see that the non-drinker can lower his Hazard Ratio for all-cause mortality from 1.19 (1.11-1.27) to 1.02 (0.94-1.11) by starting the light consumption of alcohol, drinking <7 standard alcoholic beverages per week. The confidence intervals for the Hazard Ratios of non-drinkers and light drinkers touch at 1.11, but do not overlap, so this is a significant reduction of mortality.

      Again, an average non-drinker can significantly lower their risk of all-cause mortality by adding one standard 14 gram serving of ethanol per day, preferably in a dilute form such as beer (to avoid carcinogenic effects on the upper aerodigestive tracts [2]).

      References

      1: Keller DL, Goulden's data actually confirms that minimum mortality occurs with light-to-moderate alcohol intake, PubMed Commons, accessed on 8/22/2016 at the following URL:<br> http://www.ncbi.nlm.nih.gov/pubmed/27453387#cm27453387_26107

      2: Keller DL. Dose-response relationship observed between concentration of ingested alcohol and cancer rate. Comment on PMID 26386538. In PubMed Commons [Internet]. National Library of Medicine; 2015 Sept 26 [cited 2015 Oct 12] at: http://www.ncbi.nlm.nih.gov/pubmed/26386538#cm26386538_11980 The above comment is also posted on the following Annals of Internal Medicine web page: http://annals.org/article.aspx?articleid=2456121


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Dec 13, Evgenia V Dueva commented:

      Release active form of antibodies or other substances is not an accepted scientific concept and the term appears only in the articles involving the commercial products of «MATERIA MEDICA HOLDING». According to Avogadro's law, 12 or more centesimal dilutions of compound lead to a lack of any active substance in any amount of solution that a mouse can drink. It seems that commercial products of «MATERIA MEDICA HOLDING» (including Anaferon, Subetta etc.) is a disguised version of homeopathy and the authors have confused the reviewers and readers with their vague descriptions of their "drugs" and hiding concentrations of the initial compounds.

      Given the fact that there is no accepted mechanism of action for any treatment with such dilutions as in the case of Anaferon, Subetta, etc. the simpler explanation for the observed biological effects is bias introduced by lack of proper randomization and blinding.

      The critical comment on initial paper was published and can be found here: http://onlinelibrary.wiley.com/doi/10.1002/jmv.24761/full


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Dec 10, Kath Wright commented:

      Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2013 Jun 16, John Quackenbush commented:

      In my opinion, this is one of the foundational papers in modern systems biology and essential reading for anyone interested in the field. The goal of the authors is to create a logical circuit model in lambda phage, one of the most widely studied organisms that exists. The difficulties that are described, the role of stochastic events, and the failure of "rational" design principles in biological pathways lays out many problems that the systems biology community continues to wrestle with today.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Nov 16, EDWARD BERRY commented:

      This is beautiful work, and really answered the question about the Three Core Proteins. But it would have been nice to put it in context of previous work. Something like: ". . . as concluded by Berry et al. 1991 based on heme/protein ratio of the isolated complex, and contrary to the conclusion of Braun and Schmitz 1992 (Eur. J. Biochem. 208,761 -767) based on size estimated by gel filtration".


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Nov 23, Harri Hemila commented:

      The published version is available at DOI.

      A manuscript version of the paper is available at the Helsinki University institutional repository: https://helda.helsinki.fi/handle/10138/42358


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Oct 28, Harri Hemila commented:

      With the permission of the editor and the first author, a scanned version of the paper is available at: http://www.mv.helsinki.fi/home/hemila/CP/Hunt_1994_ch.pdf


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Dec 10, Kath Wright commented:

      Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2015 Dec 05, S A Ostroumov commented:

      Full text online free: Biological Filtering and Ecological Machinery for Self-Purification and Bioremediation in Aquatic Ecosystems: Towards a Holistic View: https://www.researchgate.net/publication/13429633


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2016 Jan 04, S A Ostroumov commented:

      Review, opinion paper. A new theory of ecological machinery, function of aquatic biological community toward water purification, improvement of water quality. Full text online: https://www.researchgate.net/publication/13429633


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2015 May 18, Salzman Lab Journal Club commented:

      This very provocative article provides one of the first explorations of the biological function of a circular RNA in vivo. Interestingly, the current annotation of the FMN1 gene does not include exon 4, which is included in their circle and is knocked out in their study. Circular RNAs containing exon 4 are reported as 70% of their detected transcripts. Despite claims that the protein levels are not grossly perturbed, a western blot would have been very useful to allow the reader to assess their claims. It is interesting to note that deleting exon 5 abolishes circular RNA, while maintaining the diagnostic circular junctional sequence and sequences flanking the circle-forming exons.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2015 Feb 01, Joe Newton commented:

      These findings are interesting as they are consistent with "increased action potential conduction velocity differentials" as defined in (Newton, Joe Ray Medical Hypotheses 1999 Manic -depression neural conduction speeds and action potential event dyscorrelation.) Many later additional genetic studies support this physiologpathology in a broad ranges of neuropsychiatric disorders. The 1999 hypothesis is testable by several different physical methods.<br> Best wishes, Joe Ray Newton


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Oct 31, Pierre Vabres commented:

      In hindsight, one of these children more likely had constitutional mismatch repair deficiency rather than neurofibromatosis type 1.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Feb 01, Jonathan Eisen commented:

      I note - the web site linked to in Figure 1 regarding data used for the trees - http://crab2.berkeley.edu/pacelab/176.htm is no longer available. However, it is available at the Internet Archive at https://web.archive.org/web/19990224012002/crab2.berkeley.edu/pacelab/176.htm.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2015 May 17, Prof.Dr.Jogenananda Pramanik commented:

      Invited co-authors: Dr.Myo Wint Zaw, Dr.Lwin Lwin Cho and Dato'Dr.Mahmood bin Abd Yusof, Universiti College Shahputra UCSA, Pahang, Malaysia and Dr. Samik Hazra, Brig.Dr.Soumitra Chatterjee, The Calcutta Medical Research Institute,Kolkata-27,India.

      Despite rigorous screening tests, early institution of DOT and individualized patient care, multi-drug resistant tuberculosis is emerging as a dreaded killer disease in developing and developed countries.(1) Diagnostic efficacy of real time PCR assay is widely accepted but it is not cost-effective.Therefore, we need to look for other inexpensive solid media culture methods and immunodiagnostic methods for screening and follow up for suspected cases ( 2-5 ). On the other hand, we may also look for fast acetylator status of isoniazid metabolism before deciding about drug resistance.In recent years a group of advanced research laboratories from several western universities are welcoming outsourcing of patients' samples for diagnostic purpose and willing to support physicians in South East Asian countries to detect various diseases at an early stage.

      1. Farmer P1, Kim JY. BMJ. 1998 Sep 5;317(7159):671-4. Community based approaches to the control of multidrug resistant tuberculosis: introducing "DOTS-plus". 2.Prof.Dr.J.Pramanik.BMJ.2003.http://www.bmj.com/rapid-response/2011/10/30/delays-diagnosis-tuberculosislet-us-use-thyroxine-supplemented-culture-med: Delays in diagnosis of tuberculosis? Let us use thyroxin supplemented culture medium for early lab-diagnosis. 3.Prof.Dr.J.Pramanik. BMJ: 2004.http://www.bmj.com/rapid-response/2011/10/30/early-diagnosis-tuberculosis-reported-third-world-country Early diagnosis of tuberculosis-reported from third world country:A research letter from India.
      2. Dr.J.Pramanik et al.,Ind. J. Tub.1997,44, 185-190. Increased yield of excretory-secretory antigen with thyroxine supplementation in in vitro culture of tubercle bacilli.
      3. Dr.J.Pramanik et al.,Ind.J.Clin.Bioch.2000.,5(1),22-28. Detection of tubercular antibody and antigen in sera of bone and joint tuberculosis.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 May 11, Daniel Haft commented:

      This crystallography paper, from 1998, reports a structure for an aminoglycoside-(3)-N-acetyltransferase whose sequence is shown in GenBank record AAB20441.1. It’s interesting to compare AAB20441.1 to a very different aminoglycoside-modifying enzyme, CAG34229.1, the nucleotidyltransferase ANT(2'')-Ia. These two translations are identical over the first twenty amino acids, MLRSSNDVTQQGSRPKTKLG, but are otherwise unrelated. As is readily apparent from examining AJ746361, the source nucleotide record for the latter protein, both these antibiotic resistance genes occur integrated into integrons of the same family, called class 1.

      The N-terminal sequence shared by otherwise unrelated antibiotic resistance genes, starting with a plausible-looking ATG-encoded Met in the appropriate reading frame, raises the question of whether this region might actually be translated, and what its contribution to protein structure might be. This crystallography paper is interesting because the extended region was included (along with an additional engineered N-terminal prefix that aided in protein purification) when the enzyme was expressed for the crystallography study, and therefore was studied experimentally. The authors found the N-terminal region to contain sites “that are exquisitely sensitive to trypsin (Arg-3, Arg-14, Lys-16, and Lys-18), suggesting that the N terminus of the enzyme is … disordered.” The N-terminal extension clearly did not participate in forming an ordered crystal structure, and seemed to neither help nor hinder enzymatic activity.

      A number of additional unrelated antibiotic resistance genes occur in class 1 integrons and appear in public sequence databases with (probably faulty) translations that start from the same integron-derived candidate start site, resulting in similar N-terminal sequence extensions. Examples include a class A beta-lactamase (BAE71359.1), a trimethoprim-resistant dihydrofolate reductase (BAD07295.1), and a rifampin ADP-ribosyltransferase (CAR63501.1). Readers of this paper may enjoy knowing that the N-terminal sequence extensions shared by these translations reflect integration of unrelated genes at equivalent sites, not conservation of some structural element that would be visible in solved crystal structures.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2015 Jun 04, Andrea Messori commented:

      Gains in life expectancy from medical interventions: a bibliography of 6 references on this topic published between 1998 and 2014

      Andrea Messori, HTA Unit, Tuscany Region, 50100 Firenze (Italy)

      The main merit of the paper published by Wright and Weinstein (“Gains in life expectancy from medical interventions--standardizing data on outcomes”. N Engl J Med. 1998 Aug 6;339:380-6) is that, for the first time, the study of gains in life expectancy has been proposed as a method to systematically quantify health-care benefits. One interesting question is how often this method has been used thereafter. According to an empirical literature search, we have identified the following 6 studies published between 1998 and 2014 in which the approach described by Wright and Weinstein has been employed to determine health-care benefits:

      1. Messori A, Trippoli S, Tendi E. Gains in life expectancy from medical interventions. N Engl J Med. 1998 Dec 24;339(26):1943-4
      2. Messori A, Santarlasci B, Trippoli S. Guadagno di sopravvivenza dei nuovi farmaci. Pharmacoeconomics – Italian Research Articles 2004;6:95-104. http://www.osservatorioinnovazione.net/papers/guadagnios.pdf
      3. Fojo T, Grady C. How much is life worth: cetuximab, non-small cell lung cancer, and the $440 billion question. J Natl Cancer Inst. 2009 Aug 5;101(15):1044-8. doi: 10.1093/jnci/djp177. Epub 2009 Jun 29.
      4. Fadda V, Maratea D, Trippoli S, Messori A. Comparison between real prices and value-based prices of innovative drugs eBMJ, Part1 and Part2 published 6 December 2010, http://www.bmj.com/rapid-response/2011/11/03/comparison-between-real-prices-and-value-based-prices-innovative-drugs-0 and http://www.bmj.com/rapid-response/2011/11/03/comparison-between-real-prices-and-value-based-prices-innovative-drugs-par
      5. Messori A, Fadda V, Trippoli S. A uniform procedure for reimbursing theoff-label use of antineoplastic drugs according to the value-for-money approach. J Chemother. 2011 Apr;23(2):67-70. Review. PubMed PMID: 21571620.
      6. Martone N, Lucioni C, Mazzi S, Fadda V. New oncological drugs: analysis of survival gain. GRHTA 2014; 1(1): 3 – 15. DOI: 10.5301/GRHTA.2014.12359


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Dec 16, Mohammed AlJasser commented:

      Labelled as "Free full text" but it does not seem to be the case.

      Any advises?


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2013 Nov 24, John Sotos commented:

      Because it emphasized a bedside approach rather than millisecond dissections of electronic catheter tracings, I found Drs. Zimetbaum and Josephson’s discussion of symptoms and circumstances associated with palpitations refreshing (1). They did not mention, however, the tachycardia-polyuria syndrome.

      As described in the 1960s, polyuria occurs in approximately half of patients with paroxysmal supraventricular arrhythmias faster than 110 beats per minute lasting for 20 or more minutes when left ventricular failure and stenotic valvular lesions are absent (2,3). Why the syndrome is so underreported to physicians is unclear. Diuresis typically begins 20 to 60 minutes after the onset of the arrhythmia, is most intense in the first 1 to 2 hours, and may last as long as 8 hours if the arrhythmia lasts that long (2,3,4). It is unusual for polyuria to occur before the palpitation or with ventricular arrhythmias.

      The syndrome’s physiology is incompletely known, but seems, in part, to depend on a rise in atrial pressure causing release of atrial natriuretic peptides. Of note, in a recent series of 13 patients with atrioventricular nodal reentrant tachycardia (AVNRT), 12 had associated diuresis (5). Compared to other atrial arrhythmias, the rise in atrial pressure was greatest in AVNRT, as might be expected from symptoms typical of this disorder: cannon A waves and a sensation of pounding in the neck (1).

      Thus, the tachycardia-polyuria syndrome is probably a useful indicator of a supraventricular tachycardia, and perhaps AVNRT in particular.

      (1) Zimetbaum P, Josephson ME. Evaluation of patients with palpitations. N Engl J Med. 1998;338:1369-73.

      (2) Wood P. Polyuria in paroxysmal tachycardia and paroxysmal atrial flutter and fibrillation. Br Heart J. 1963;25:273-82.

      (3) Luria MH, Adelson EI, Lochaya S. Paroxysmal tachycardia with polyuria. Ann Int Med. 1966;65:461-70.

      (4) Zullo MA. Atrial regulation of intravascular volume: observations on the tachycardia-polyuria syndrome. Am Heart J. 1991;122:188-194.

      (5) Abe H, Nagamoto T, Kobayashi H, Miura Y, Araki M, Kuroiwa A, Nakashima Y. Neurohumoral and hemodynamic mechanisms during atrioventricular nodal reentrant tachycardia. Pacing Clin Electrophysiol. 1997;20:2783-2788.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Jan 07, Brett Snodgrass commented:

      Dear Reader,

      Dr. Grollman's excellent article helped me recognize the ambiguous nomenclature of the myocardial vasculature with reference to the Thebesian veins.

      The Thebesian veins are distinct from the "vessels of Wearn." Dr. Grollman sagaciously reported this. Unfortunately, there was no pronoun applied to the vessels. Thus, the term "Thebesian veins" was frequently applied to the vessels.

      For more information, please see https://twitter.com/BrettSnodgrass1/status/417294264343601152

      Comments and suggestions welcome.

      Thank you kindly.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2013 Oct 28, DAVID SANDERS commented:

      From Science 30 October 1998: Vol. 282 no. 5390 p. 843 DOI: 10.1126/science.282.5390.843a TECHNICAL COMMENTS "Ebola Virus, Neutrophils, and Antibody Specificity" "Thus, we conclude that Ebola sGP does not bind FcγRIIIb (CD16) or any other receptor on neutrophils and that the rabbit IgG against sGP used for detection bound to FcγRIIIb through its Fc moiety as an immune complex with sGP."


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Oct 18, Morten Oksvold commented:

      This review is citing Bezwoda WR et al., J Clinical Oncology, 1995, a study which was retracted in 2001 due to fraud. The retracted JCO article represented one of the worst cases of research fraud ever The review article is highlighting the fraudulent research data, and it is therefore surprising that the article is still not retracted.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Nov 26, Harri Hemila commented:

      The paper which is commented on is available at DOI.

      The comments and reply are available at DOI


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Nov 26, Harri Hemila commented:

      The paper which is commented on is available at DOI.

      The comments and reply are available at DOI


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Nov 16, Anne Niknejad commented:

      Figure 2 ' GenBank accession no. Z46796x5'

      should be

      ' GenBank accession no. Z46796'


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Nov 23, Harri Hemila commented:

      The paper is available at the University of Helsinki institutional repository: http://hdl.handle.net/10250/7980


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2013 Oct 27, David Basanta commented:

      In a way I am just testing the Pubmed commons system but this paper is the first one I am aware of that explore the idea of using game theory in order to understand the dynamics between different subpopulations of tumour cells. A couple of very simple game theoretical models highlight how even a very simple mathematical formulation can shed light on the evolutionary mechanisms behind tumour progression toward increasingly more malignant phenotypes.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Feb 05, James Murray commented:

      The superoxide dependent nitrogenase described in this (Ribbe M, 1997) paper is extremely unlikely to exist.

      The paper describes the purification of the components of an oxygen-tolerant nitrogenase, not homologous to the known nif,vnf, or anf-type, from Streptomyces thermoautotrophicus UBT1, a thermophilic carboxydotroph.

      Results published in February 2016 (MacKellar D, 2016) show that three independent isolates of S. thermoautotrophicus, including the original UBT1 strain, do not grow in the absence of combined nitrogen and are incapable of incorporating isotopically labelled dinitrogen into biomass, nor do they contain the claimed superoxide dependent nitrogenase genes. The N-terminal sequences assigned to nitrogenase components in Ribbe M, 1997, and the full DNA gene sequences in the PhD thesis of Carla Hofmann-Findeklee (2000, KF951061.1, KF951060.1, KF951059.1, KF956113.1) are found at near-identity in Bacillus schlegelii DSM9132 (recently renamed to Hydrogenibacillus schlegelii, "SdnMSL-like" sequences in KT861421.1), a non-diazotrophic thermophilic carboxydotrophic organism isolated in the Meyer lab (Krüger & Meyer, 1984) and known to be cultured in the Meyer laboratory in 1994 (Hänzelmann, 1994). The independently isolated B. schlegelii DSM2000 strain also has these sequences at near-identity. The closest relatives to these sequences are to Firmicutes and not Actinomycetes like S. thermoautotrophiucs. The four "nitrogenase" sequences are easily identified as encoding a superoxide dismutase ("st2", sdnO), and a three-subunit aerobic carbon monoxide dehydrogenase ("st1", sdnMSL).

      Ribbe M, 1997 relies on an ammonia production assay to determine the nitrogenase activity. This assay is known to have a high background due to environmental ammonia and protein deamination. Incorporation of isotopically labelled dinitrogen is usually considered the gold standard for the identification of a nitrogenase enzyme. No incorporation of isotopically labelled nitrogen into ammonia is shown using the claimed biochemical nitrogenase preparation. The cells were grown in media with 1.5 g/l ammonium chloride, so there was no selection for diazotrophy. No published demonstration of the superoxide dependent nitrogenase has occurred outside the Meyer laboratory.

      The nitrogenase scheme described in Ribbe M, 1997 is chemically and biologically implausible. There is no known ATPase domain, as required by the proposed reaction scheme, in any of the described proteins. The known nitrogenase types require the highly reducing ferredoxin or flavodoxin as reductants. Superoxide is an unlikely electron donor for a nitrogenase, as it is not as reducing as even NADPH or NADH, and is reactive and toxic. No other biologically productive use of superoxide as an electron donor is known. An aerobic reduction of nitrogen to ammonia is unknown, and unlikely, as under the highly reducing conditions, oxygen would most probably be reduced in preference to nitrogen. The rate of activity described is too low to be that of a biological enzyme supporting diazotrophic growth, as it would take the proposed nitrogenase over 100 hours just to replace the nitrogen in the enzyme itself, which is also incompatible with the claimed rate of diazotrophic growth of S. thermoautotrophicus (Gadkari D, 1992).

      To summarize:

      • Recent evidence suggests that three independently isolated strains of S. thermoautotrophicus are not diazotrophic.

      • If the Meyer laboratory did contaminate their S. thermoautotrophicus culture with a strain of B. schlegelii (such as the DSM9132 strain), we would observe the N-terminal sequences presented here and the DNA gene sequences also produced in the Meyer laboratory.

      • The extremely low activity "nitrogenase" was described based on a problematic ammonia production assay.

      • A superoxide-dependent aerobic nitrogenase is chemically and biologically implausible.

      Declaration: I am an author on the MacKellar D, 2016 paper, but this comment is entirely my own.

      References:

      Bernd Krüger and Ortwin Meyer. Thermophilic bacilli growing with carbon monoxide. Archives of Microbiology, 139(4):402–408, 1984.

      Petra Hänzelmann. Isolierung und Charakterisierung von Kohlenmonoxid-Dehydrogenase aus dem obligat thermophilen Bakterium Bacillus schlegelii. Diplomarbeit thesis, University of Bayreuth, 1994.

      Carla Hofmann-Findeklee. Molekularbiologische Untersuchung der Strukturgene des aeroben N2-fixierenden Systems von Streptomyces thermoautotrophicus sowie funktionelle Charakterisierung von rekombinantem SdnO. PhD thesis, University of Bayreuth, 2000.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 24, Jean-Michel Claverie commented:

      A brand new version of the above statistical test is now available: ACD 2.0

      When the initial version of this test was published, transcriptome data was painfully obtained from "Expressed sequenced tags (EST)" library sequencing, resulting in low counts for each detected transcript. Thanks to the evolution in sequencing technologies ("NGS"), transcriptomes are now investigated using several hundred millions of reads, with every transcripts been detected up to several thousands of times.

      A new (free) web service is now available that can handle all levels of counts, from a handful to millions, without approximation and without loosing the mathematical simplicity and universality of the original Audic-Claverie Distribution (ACD) test.

      ACD 2.0 now proposes three tools:

      1) the simple "one item /2 counts" --> p-value of the null hypothesis (i.e. no change in proportions)

      2) "an array of items/ 2 or more counts" --> generate a ranked list of the most discriminant items

      3) "an array of items /2 or more counts" --> generate a pairwise distance matrix of the whole samples

      A full documentation describes the mathematical details and the computational algorithms used in ACD 2.0. It also explains how the above tools can be used in many more contexts than just transcriptome analysis. These include the comparison of metagenomic/barcoding or ChIP-Seq experiments, or non-biological applications simply involving arrays of items and their cognate counts. A formal publication will follow soon. Keep posted in PubMed!

      Without further delay you can start using ACD 2.0 (beta) from the following the link:

      http://www.igs.cnrs-mrs.fr/acdtool


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2013 Jun 23, Hilda Bastian commented:

      This trial bears the predominant weight for safety concerns about single-session debriefing in a subsequent influential systematic review (Rose S, 2002, of which the lead trialist here is an author). Its results are potentially affected by multiple serious biases.

      The trial had a high attrition rate (>22%): 23 lost to follow-up (p78 - participants) and 7 who left hospital before intervention (p78 - results). The number of events was low.

      This trial report does not include an intention-to-treat analysis (ITT). ITT was imputed in the systematic review (Rose S, 2002), without description of the additional data or reporting the methods used, and whether or not sensitivity analyses were conducted.

      The intervention group was at higher risk of the event at baseline (25% of the intervention arm had others involved in the trauma vs 4% in the control arm, p=0.01; percentage of the body burned, life threat and past significant trauma were also higher, although not significantly so).

      There was a disproportionately large number in the intervention group (64 vs 46), due to the method of randomization and having stopped the trial early.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Nov 23, Harri Hemila commented:

      A manuscript version of the paper is available at the University of Helsinki institutional repository: http://hdl.handle.net/10250/8159. The analysis of the same studies was extended in Cochrane review Hemilä H, 2007 and Hemilä H, 2013.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2013 Oct 23, Pedro Mendes commented:

      Gepasi is now hosted at http://www.gepasi.org . However this software has been succeeded by COPASI Hoops S, 2006 which is at http://www.copasi.org


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Feb 16, Bernard Baars commented:

      This article is one of the most important neuroscience contributions in recent history.

      Mircea Steriade published brain recording studies, in both single-cell and population oscillations in cortex. (The cortico-thalamic system).

      Because animal researchers were able to perform direct intracranial recordings long before similar human studies appeared, they published many discoveries that other neuroscientists and psychologists are now seeing in their own data.

      Steriade's central finding is that "The cerebral cortex and thalamus constitute a unified oscillatory machine displaying different spontaneous rhythms that are dependent on the behavioral state of vigilance."

      This was at a time of extreme skepticism about human scalp EEG, which suffers a thousand-fold loss of voltage due to the attenuating effects of the cranium, scalp muscles, and other protective tissue layers. Direct brain recordings are measured in millivolts, while scalp recordings show up in microvolts, with corresponding vulnerability to electrical noise from the eyes, scalp muscles, and stray EM fields.

      Animal researchers solved those problems by learning how to insert electrodes directly into the brain, in species where it was ethically allowable to do so.

      Today we are now seeing similar results in humans, using surgical implants prior to epileptic surgery. (See about 200 articles in PubMed under "iEEG" or "ECog". Surprisingly, iEEG has the highest temporal and spatial resolution of any brain imaging technique today.)


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Nov 26, Matthew Katz commented:

      Both this EORTC trial and the RTOG trials 85-31 and 86-10 established the role of androgen deprivation for improved prostate cancer outcomes with radiation therapy. Long-term followup has confirmed the survival benefit in locally advanced patients Bolla M, 2002.

      We are still trying to find the optimal balance of hormone therapy with radiation for both intermediate and locally advanced prostate cancer. Higher radiation doses are now given than in these trials, but there still appears to be a role for androgen deprivation (ADT) for many men with prostate cancer that is higher in stage, grade or PSA. ADT isn't without side effects but worth discussion if considering radiation therapy.

      http://www.ncbi.nlm.nih.gov/pubmed/12126818


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Dec 10, Kath Wright commented:

      Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Dec 10, Kath Wright commented:

      Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2015 Jun 06, thomas samaras commented:

      Since this paper was published, a lot of research relating anthropomorphic characteristics to longevity has been published. See below:

      Samaras TT. Evidence from eight different types of studies showing that smaller body size is related to greater longevity. Journal of Scientific Research & Reports. 2014: 3 (16): 2150-2160, 2014; article no. JSRR.2014.16.003.

      Samaras TT. Human Scaling and Body Mass Index. In: Samaras TT (ed): Human Body Size and the Laws of Scaling: Physiological Performance, Growth, Longevity and Ecological Ramifications. New York: Nova Science Pub; 2007: pp 17-32.

      He Q, Morris BJ, Grove JS, Petrovitch H, Ross W, Masaki KH, et al. Shorter men live longer: Association of height with longevity and FOXO3 genotype in American men of Japanese ancestry. Plos ONE 9(5): e94385. doi:10.1371/journal.pone.0094385.

      Salaris L, Poulain M, Samaras TT. Height and survival at older ages among men born in an inland village in Sardinia (Italy), 1866-2006. Biodemography and Social Biology, 58:1, 1-13.

      Bartke A. Healthy Aging: Is Smaller better? A mini-review. Gerontology 2012; 58:337-43.

      Samaras TT. Shorter height is related to lower cardiovascular disease risk—A narrative review. Indian Heart Journal 2013; 65: 66-71.

      Samaras, TT. Is short height really a risk factor for coronary heart disease and stroke mortality? A review. Med Sci Monit 2004; 10(4): RA63-76.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Jan 23, Gerhard Nebe-von-Caron commented:

      Sytox green is not suitable for the detection of membrane integrity as it can label cells negative to propidium iodide that are verified as being able to form colonies.

      See figure 2 and 3 in http://onlinelibrary.wiley.com/doi/10.1111/j.1574-6976.2010.00214.x/full

      The characterisation of functional cell stains works best in competitive labeling situations were they can be directly compared in their interaction. This is similar to the experience with Bis-oxonol which was also described as a staining for cell death but dis-proven by showing those cells to be culturable.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2015 Mar 16, Donald Forsdyke commented:

      NEUTRAL THEORY NOT SUPPORTED. As a reviewer of this paper I recommended acceptance but was unhappy with the conclusion that it supported neutral theory explanations. On the advice of reviewers, my subsequent Letter to the Editor was declined by the Editor (see http://post.queensu.ca/~forsdyke/bioinfor.htm ). The abstract of the letter read:

      "Galtier and Lobry compared the optimum growth temperatures of various prokaryotes with the G+C content of their genomic DNA and of various non-mRNA RNA species (e.g. ribosomal RNAs). Since GC bonds confer greater stability on nucleic acid secondary structure than AT bonds, their data strongly suggest that an increase of G+C content is needed for the stabilization at high temperature of rRNA secondary structure (stem-loops), but not of DNA secondary structures.

      The authors propose that "any secondary structure that must endure at high temperatures requires a high G+C content", so that "a high proportion" of stem-loop "secondary structures in bacterial genomes is unlikely". Thus, the fact that Chargaff's parity rule (%A=%T, %G=%C) applies to single-stranded DNA (as to single-stranded RNA), is held to be "poorly explained" on the basis of an evolutionary pressure on DNA to form stem-loops (as proposed by Forsdyke 1995; J Mol Evol 41:573-581). Rather the parity rule would be explained by "neutral directional mutational pressure" (Lobry, 1995; J Mol Evol 40:326-330).

      However, "any secondary structure" includes the classical duplex DNA secondary structure. This is likely to exist at high temperatures, and presumably requires "other physiological adaptations" than an increase in G+C content. Such adaptations might also apply to DNA stem-loop secondary structure. Thus, in this context selectionist arguments are no less probable than neutralist arguments."

      Subsequently the Editor himself (2000; Gene 241: 3-17) came to agree:

      "The low GC levels of some thermophilic bacteria do not contradict, as claimed (Galtier and Lobry, 1997), the selectionist interpretation ... . Indeed, different strategies were apparently developed by different organisms to cope with long-term high body temperatures. It is now known that the DNAs of such thermophilic bacteria are very strongly stabilized by particular DNA-binding proteins (Robinson et al., 1998) and that, in turn, their proteins can be stabilized by thermostable chaperoninins (Taguchi et al., 1991)."

      For more please see my textbook Evolutionary Bioinformatics (2nd edition 2011, Springer, New York).


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Jan 08, Brett Snodgrass commented:

      Thank you for an excellent article.

      The fistula between the right ventricle and right coronary artery is probably consistent with a vessel of Wearn.

      http://bit.ly/JTWearn

      http://www.ncbi.nlm.nih.gov/pubmed/23332812

      If you disagree or agree, please share and why. Comments or suggestions are welcome.

      For additional commentary, please see the following link:

      https://twitter.com/BrettSnodgrass1/status/412943028790124544

      Thank you kindly.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Nov 25, Harri Hemila commented:

      A secondary analysis of this study has been published in Hemilä H, 2013, DOI. The secondary analysis calculated that vitamin C reduced the proportion of participants suffering from exercise-induced bronchoconstriction by 50 percentage points (95% CI 23 to 68), from 100% (20/20) on the placebo day to 50% (10/20) on the vitamin C day.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Nov 23, Harri Hemila commented:

      The paper is available at DOI and at handle and homepg. The comments and reply are available at DOI and at handle and homepg


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Feb 03, Daniel Schwartz commented:

      The Vasculitis Damage Index can be easily calculated using an online tool or mobile app:

      https://qxmd.com/calculate/vasculitis-damage-index-vdi

      Conflict of interest: Medical Director, QxMD


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Mar 11, Daniel Haft commented:

      This paper reports an N-terminal sequence of ASEPAVIYDTAGKYDKSFNEAVFYNGD for the carbapenem-hydrolying metallo-beta-lactamase AsbM1, and notes the very low similarity of this sequence fragment to a known metallo-beta-lactamase with similar properties, CphA. Inspection of several genomic sequences that have since become available from closely related strains of Aeromonas showed each has a subclass B2 metallo-beta-lactamases closely related to CphA. In each of those same genomes there is a full-length protein that aligns to the sequence fragment with just one or two mismatches, and that is related to the lipoprotein PnrA (purine nucleoside receptor A) described in PMID:16418175 rather than to any known beta-lactamase. This observation suggests that the carbapenemase AsbM1 studied in this article is an allele of the CphA family, but that a PnrA family protein was the source of the N-terminal sequence shown.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Dec 10, Kath Wright commented:

      Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2015 Jun 22, MARQUIS VAWTER commented:

      As first author of this 1996 paper, I wanted to clarify that we were growing olfactory ensheathing cells and other cell types.

      "Our immunocytochemistry findings can be partially explained by the presence of ONEC (olfactory nerve ensheathing cells). This interpretation is supported by the finding that 33–66% of ONC are CD401 by flow cytometry. Low-affinity nerve growth factor receptor is used as a marker for ONEC (23, 54, 57) and is also localized to olfactory neurons (4) and olfactory basalcells."

      Further in this paper,we concluded that: "Based on expression of CD40, NCAM, and intermediate filaments, the composition of ONC cultures is likely a combination of ONEC, basal cells, and immature olfactory receptor neurons."

      The ONEC was defined as olfactory nerve ensheathing cells.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Nov 23, Harri Hemila commented:

      A manuscript version is available at handle. The paper was commented on by Thomas Chalmers http://dx.doi.org/10.1016/0895-4356(96)00190-4 to which a response was published http://dx.doi.org/10.1016/0895-4356(96)00191-6, which is also available at handle


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2014 Nov 23, Harri Hemila commented:

      None


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Aug 10, Matthew Katz commented:

      Organ preservation as a treatment strategy effectively demonstrated chemoradiation as the standard of care for anal canal cancer. RTOG proved the point in 83-14 [Sischy B, 1989]. The RTOG phase III trial above confirmed the importance of mitomycin-C as part of the treatment regimen, which remains the standard in 2014.

      With the rising incidence of HPV+ anal cancer, which may have a better prognosis, an important question will be whether we should lessen treatment intensity. Further trials will be needed to see if it's possible to lessen treatment toxicity without compromising cancer control.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2013 Jun 13, Karl Broman commented:

      This is the first paper to consider interval mapping for binary traits in experimental crosses. Somewhat surprisingly, genetic mapping in humans focused on binary traits and not quantitative ones, while mapping in experimental crosses focused on quantitative traits and not binary ones. The method is developed in the context of marker covariates, and so it is a bit more technically challenging to understand than it might be, but this paper had a lot of influence on my understanding of QTL mapping.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Jan 07, Brett Snodgrass commented:

      Dear Reader,

      The myocardial sinusoids are not a phantom regardless of whether knowledge about them is.

      Arteriosinusoidal vessels described by Wearn connect to myocardial sinusoids. The myocardial sinusoids are often pathologically altered and readily apparent on microscopy in pulmonary atresia with intact ventricular septum.

      Dr. Wearn's work: http://bit.ly/JTWearn The myocardial sinusoids are not phantom as they connect to the arteriosinusoidal vessels. The vessels of Wearn include the arteriosinusoidal and the arterioluminal vessels of the heart. Wearn's distinguished Harvey lecture of 1940 describes the difference between the "Thebesian veins" and the "AL & AS" vessels (vessels of Wearn). Related references: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1933738/ http://www.ncbi.nlm.nih.gov/pubmed/22704295 http://www.ncbi.nlm.nih.gov/pubmed/23332812 https://twitter.com/BrettSnodgrass1/status/419324443068874752


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2015 Aug 21, Robert P O'Shea commented:

      The PubMed title of this paper is incorrect. It should be "The extraordinarily rapid disappearance of entoptic images" with two ts in "entropic", as in the paper itself. Entopic is a medical term meaning in the usual place, as opposed to ectopic, which means in the wrong place (e.g., ectopic pregnancy). "Entoptic" means in the eye, requiring the Greek root "optic".


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2015 Sep 11, Bill Cayley commented:

      More evidence that "less-medical" primary care can actually be MORE cost-effective (and perhaps better in other ways: https://lessismoreebm.wordpress.com/?s=primary


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Dec 10, Kath Wright commented:

      Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2013 Nov 24, John Sotos commented:

      [Written in 1996] Speculations regarding Creutzfeldt-Jakob disease (CJD) acquired from beef containing the infectious agent that causes bovine spongiform encephalopathy [1] have resulted in dramatic health policy measures and serious concerns in the lay public about dietary beef intake in Britain. We believe these concerns are out of proportion to the actual risk of CJD, especially when compared to other established risks of beef consumption, such as the development of coronary heart disease (CHD). We therefore sought to estimate a beef-eater’s risk of CJD and CHD based on currently available data.

      The ten cases of CJD became manifest over a 20 month span in 1994-1995 [1]. If we suppose a uniform incubation period of 10 years for CJD, then all 10 cases were infected during a 20 month period in 1984-1985, when the mean beef intake among the 56 million Britons was 181.5 g/person/week [2] (roughly equivalent to two hamburgers per week). Assuming the attack rate remains constant, an average Briton would have a 1 in 933,000 chance of developing CJD from 10 years of beef-eating. The risk per hamburger is roughly 1 in one billion.

      To determine the beef-attributable risk of CHD, we first calculate the change in serum cholesterol that results when the fat and cholesterol in lean beef [3] are consumed in place of isocaloric carbohydrate or protein. Using the average daily caloric intake in Britons (2040 kcal) [2], the Hegsted equation [4] predicts a 2.1 mg/dl increase in serum cholesterol when 181.5 g beef/week are consumed. For a 30 year-old non-smoking, non-diabetic man with a total cholesterol of 150 mg/dl, an HDL cholesterol of 45 mg/dl, and a systolic blood pressure of 120 mmHg, the Framingham equation [5] predicts that a 2.1 mg/dl increase in serum cholesterol sustained over 10 years raises the risk of CHD during this period by 1 chance in 5300. Thus the CHD/CJD relative risk is approximately 175!

      Although our calculations are approximations at best, they clearly show that the risk from fat and cholesterol in beef is, for most of the adult population, orders of magnitude greater than the risk from neurotropic particles contained therein. Other diseases linked to fat intake, such as stroke and colon cancer, have not been considered here. Based on these data we believe that beef-eaters should care for their coronaries, rather thsn perseverate on prions.

      [1] Will RG, Ironside JW, Zeidler, et al. A new variant of Creutzfeldt-Jakob disease in the UK. Lancet. 1996;347:921-925.

      [2] Ministry of Agriculture, Fisheries and Food. National Food Survey 1994. London: Her Majesty’s Stationery Office, 1995.

      [3] American Heart Association Cookbook. Ballantine Books. New York, NY, 1986.

      [4] Hegsted OM. Serum-cholesterol response to dietary cholesterol: a re-evaluation. Am J Clin Nutr. 1986;44:299-305.

      [5] Anderson KM, Wilson PWF, Odell PM, et al. An updated coronary risk profile: a statement for health professionals. Circulation. 1991; 83:356-362.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Jul 23, Jonathan Eisen commented:

      I am posting some materials associated with this paper on Figshare (alignments, trees, color figures, etc).

      See https://figshare.com/projects/1995_Eisen_RecA_Evolution_JME/15035

      Jonathan Eisen


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Dec 02, Robert Eibl commented:

      I worked at that time in that lab and I completed the very first isogenic SV129 K.O. constructs for the planned partial K.O of the CD44 gene. Part of my work contributed to the paper above and was acknowledged within the article: "The sizes of the PCR products derived from the phage clones allows an estimate of the intron sizes. These results have been indepentently confirmed by mapping the restriction sites for more than twenty restriction enzymes on (lambda) phage inserts(R.Eibl, unpublished results)."


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2014 Nov 16, Robert Eibl commented:

      None


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 21, Tom Kindlon commented:

      References:

      1 Chalder T, Berelowitz G, Pawlikowska T, Watts L, Wessely S, Wright D, Wallace EP: Development of a Fatigue Scale. J Psychosom Res 1993, 37:147-153.

      2 Neu D, Hoffmann G, Moutrier R, Verbanck P, Linkowski P, Le Bon O. Are patients with chronic fatigue syndrome just 'tired' or also 'sleepy'? J Sleep Res. 2008 Dec;17(4):427-31. doi: 10.1111/j.1365-2869.2008.00679.x.

      3 Goudsmit, EM., Stouten, B and Howes, S. Fatigue in myalgic encephalomyelitis. Bulletin of the IACFS/ME, 2008, 16, 3, 3-10. https://web.archive.org/web/20140719090603/http://www.iacfsme.org/BULLETINFALL2008/Fall08GoudsmitFatigueinMyalgicEnceph/tabid/292/Default.aspx

      4 Goldsmith LP, Dunn G, Bentall RP, Lewis SW, Wearden AJ. Correction: Therapist Effects and the Impact of Early Therapeutic Alliance on Symptomatic Outcome in Chronic Fatigue Syndrome. PLoS One. 2016 Jun 1;11(6):e0157199. doi: 10.1371/journal.pone.0157199. eCollection 2016. https://doi.org/10.1371/journal.pone.0157199.s001 (CSV form: https://www.mediafire.com/file/rvh3brmgoaznude/Goldsmith+2015+FINE+data+journal.csv )

      5 A dataset from the PACE trial. Released following a freedom of information request. https://sites.google.com/site/pacefoir/pace-ipd_foia-qmul-2014-f73.xlsx Readme file: https://sites.google.com/site/pacefoir/pace-ipd-readme.txt.

      6 Morriss RK, Wearden AJ, Mullis R. Exploring the validity of the Chalder Fatigue scale in chronic fatigue syndrome. J Psychosom Res. 1998 Nov;45(5):411-7.

      7 Loge JH, Ekeberg O, Kaasa S. Fatigue in the general Norwegian population: normative data and associations. J Psychosom Res 1998; 45: 53-65. CrossRef | PubMed

      8 Van Kessel K, Moss-Morris R, Willoughby, Chalder T, Johnson MH, Robinson E, A randomized controlled trial of cognitive behavior therapy for multiple sclerosis fatigue, Psychosom. Med. 2008; 70:205-213.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2018 Jan 21, Tom Kindlon commented:

      My feedback on content of Common Data Elements (Fatigue) - Myalgic Encephalomyelitis/Chronic Fatigue Syndrome (ME/CFS) CDE Public Review

      I submitted this to the NIH and thought I would also post it here.

      Suggested Change: Don't use the Chalder fatigue questionnaire

      Rationale: The Chalder Fatigue questionnaire has two separate scoring systems, bimodal (0-11) and Likert (0-33) [1]. Some of the issues raised below are more significant with one system rather than the other.

      (i) Doubts about the validity of two of the items in the questionnaire as means to measure fatigue:

      The item “Do you have problems starting things” seems as though it could relate more to motivation or some other issue rather than fatigue specifically.

      The item “Do you feel sleepy or drowsy” relates more to sleepiness than fatigue. Sleepiness and fatigue are not necessarily the same thing [2].

      Most studies that used the Chalder fatigue scale do not give details of scores on individual items but one study [3] reported the following in participants with ME: “Focusing on the individual items revealed that 86.8% of the questions making up the physical fatigue subscale received near maximal or maximum scores. The items which received the greatest number of low scores were question 3 (‘do you feel sleepy or drowsy’) and question 4 (‘do you have problems starting things’).”

      (ii) Ceiling effects are a significant issue when the Chalder fatigue questionnaire is used with patients with ME and CFS score, particularly with bimodal scoring:

      A study of those with ME [3] found that “Fifty per cent of the patients recorded the maximum score using the bimodal method and 77% recorded the two highest scores [i.e. either 10 or 11].” In the FINE and PACE trials, 76% (147/193) and 65% (417/640) respectively of CFS participants reported the highest score [11] at baseline using bimodal scoring [4,5].

      With regards to Likert scoring, a study of those with ME found that there was some evidence of a ceiling effect in those who were severely affected (more details were not reported but the average score for those severely affected was 30.55 (SD: 2.66)). In the FINE and PACE trials 29.1% (57/196) and 14.5% (93/640) of the participants with CFS respectively scored the maximum score of 33 at baseline.

      There is also a 14-item version of the instrument with three extra items. A study of 136 individuals with CFS looking at Likert scoring found there was near-maximal scoring on 6 of the 8 physical fatigue items [6].

      The authors of the ME study [3] noted with regards to bimodal scoring that there was a “marked overlap between those who rated themselves as moderately or severely ill. These findings are indications of a low ceiling.” This could lead to the questionnaire failing to detect patients moving from being severely to moderately affected and vice versa.

      Furthermore, if patients are already at a ceiling score at the start of the intervention, the questionnaire cannot detect their getting worse. This could mean that evidence of harm would not be recorded. Also, this phenomenon could affect measures of efficacy: if a certain percentage of patients improved and the same percentage worsened to a similar level, this could show up as an average improvement because the scores for those who got worse would not change if they were already at the ceiling level.

      This could also make interventions that caused a significant number of deteriorations seem better than those that caused fewer. For example, consider a scenario in which one intervention caused a certain percentage of patients to improve while the same percentage, who began at the maximum score, worsened by the same amount. If another intervention caused half the number of patients to both improve and worsen, the average numerical improvement for the first intervention would be twice that of the second, even though rationally the scores should be the same.

      (iii) Discussion of the ability of respondents to mark symptoms as occurring “less than usual”:

      The fact that participants can rate their fatigue symptoms as occurring “less than usual” can lead to some odd results with Likert scoring of the Chalder scale (it is not an issue with its bimodal scoring). People who have no fatigue problems should generally score 11/33, indicating that they had problems ‘no more than usual’. And, indeed, a study in Norway found that those in the category “No disease/current health problem” had a mean score of 11.2 [7].

      However, a study found that people with "multiple sclerosis fatigue" after an intervention reported an average fatigue score of 7.80 – that is, lower than 11; this score also showed lower fatigue than that of a healthy, nonfatigued comparison group in the study [8]. It is very unlikely to be true that patients with multiple sclerosis fatigue at baseline ended the study with lower fatigue than healthy people. Scores of less than 11 were also reported by those with CFS in the FINE and PACE trial [4,5].

      I will explore further now how pooling the scores of people who give scores of less than 11 with other scores can give odd results. Say 75% of participants gave a Likert score of 4 and 25% gave a score of 24. This would be an average score of 9 which is a better score than the score of 11 that healthy people report. However, it is likely that people who scored 4 on the scale were confused by the peculiar option on the Chalder questionnaire that allows them to rate themselves as having fewer problems with fatigue than when they were last well (choosing that option is the only way to get a score below 11). If they really meant to say that they had no more fatigue than when they were last well, then their score should really have been similar to that of the average healthy person, at 11.2. Substituting this score instead of 4 in this example would give an average score for the group of 14.4, a worse score than what healthy people score. The latter is, I believe, a better representation of what the average fatigue score for the group would be: that is, if a significant percentage still had significant fatigue, than the overall fatigue level should be worse on average than a healthy group, not better. This shows that the ability to have better scores than healthy people doesn’t just affect the validity of individual scores, it also affects the validity of overall mean scores.

      [The references for this comment are in my reply below]


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Nov 23, Harri Hemila commented:

      A manuscript version of the paper is available at the Helsinki University institutional repository: http://hdl.handle.net/10250/8076


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Aug 20, Daniel Weiss commented:

      This is a paper which is often cited to tout the robust sensitivity of the Western blot for diagnosis of Lyme disease. However, a careful, critical reading of this paper reveals major flaws. The Western blot is, on the contrary quite insensitive for the diagnosis.

      I will limit my comments to study patients without recent erythema migrans. Most workers agree that an erythema migrans rash is diagnostic on its own, and that serologic tests are unnecessary as well as unreliable at this stage of the disease. Dressler performed both a prospective and retrospective study to evaluate two-tier testing. Study subjects were recruited from the authors’ Lyme disease clinic from 1990-1991. To participate they had to live in “an area endemic for Lyme disease”. The G39/40 strain of B. burgdorferi was used to generate antigens for the ELISA assay.

      Dressler’s prospective study included 54 highly-selected patients with Lyme disease. The prospective group included patients with Lyme arthritis and those with “inactive” Lyme disease. Many patients had a history of the EM rash. Neuroborreliosis was diagnosed in 39 patients; these patients had CSF pleocytosis, increased CSF protein or EMG evidence of an axonal polyneuropathy not caused by other known disease. Ten of the 39 with neuroborreliosis were declared to be “inactive” although this term was not clearly defined. Importantly, only 21 of the 39 were positive by ELISA—a sensitivity of 54%. Of those cases of “active Lyme disease” who had neuroborreliosis, the sensitivity was 58%.

      There were 57 patients with an indeterminate ELISA. One third of those who were thought by the investigators to have “active Lyme disease” had a negative Western blot. Thus, the two-tier test performed poorly even in patients whom expert physicians (Dr. Steere and colleagues) were sure had “active Lyme disease”.

      In the retrospective study of Dressler et. two-tiered testing was performed on a highly-selected patient cohort. ELISA was negative in two of 25 with Lyme encephalopathy or polyneuropathy; two more patients’ ELISAs were read as indeterminate. Western blot testing in four of the 25 showed a minimal or absent response. Thus, the sensitivity of the test in these patients chosen because the authors were convinced they had Lyme disease reached only 84%.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Jan 08, Brett Snodgrass commented:

      Dear Reader,

      This excellent study of quail embryos by Poelmann et al. also identified the vessels of Wearn.

      The impression was that the vessels of Wearn are only connected to the right ventricle. However, Wearn identified the arteriosinusoidal and arterioluminal connecting to each of the four heart chambers. http://bit.ly/JTWearn

      The vessels of Wearn may be appear less significant in healthy individuals, but in disease states such has PAIVS, or AA/MS, they appear more significant.

      For additional commentary, please see.

      https://twitter.com/BrettSnodgrass1/status/404941362908241920/

      My interest is in accurate medical terminology, and I ask that others collaborate towards this end.

      Comments and suggestions are welcome.

      Thank you kindly.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 May 21, Kay Dickersin commented:

      We need to make sure this article and others are archived properly so that they can be accessed by others. This journal was ahead of its time, and contains important articles.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2013 Oct 23, Pedro Mendes commented:

      Gepasi is now hosted at http://www.gepasi.org . However this software has been succeeded by COPASI Hoops S, 2006 which is at http://www.copasi.org


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2013 Nov 21, Gary Ward commented:

      This report describes a simple yet elegant series of experiments demonstrating that the T. gondii parasitophorous vacuole membrane (PVM) acts as a sieve, allowing small molecules (up to ~1300 Da) to pass from the cytosol into the vacuolar space. The researchers microinjected a panel of fluorescent probes either into the cytosol of infected cells or into the parasitophorous vacuole and observed bi-directional, passive transport across the PVM. These experiments provided an important new insight into the interface between the intracellular parasite and the host cell. The likely presence of nonselective membrane channels in the PVM is analogous to the outer membrane of Gram-negative bacteria, in which membrane porins allow passive transport of nutrients and metabolites into the bacterial periplasmic space.

      These results from these experiments are consistent with characterization of the vacuole membrane in host cells infected with the related apicomplexan parasites, Plasmodium falciparum [Desai et al, Nature 362 (1993); Desai and Rosenberg, PNAS 94 (1997)] and Eimeria nieschulzi [Werner-Meier and Entzeroth, Parasitol Res 83 (1997)]. The obligate intracellular microsporidian Encephalitozoon cuniculi also resides within an intracellular vacuole capable of passive transport of fluorescent peptides up to 1100 Da while 10 kDa fluorescently-labeled dextrans are excluded [Rönnebäumer et al, Eukaryot Cell 7 (2008)]. The presence of non-selective membrane channels and the non-fusogenic nature of the parasitic vacuoles established by these phylogenetically distant organisms point to a similar adaptation to an intracellular parasitic lifestyle.

      Posted by Gary Ward on behalf of the University of Vermont Toxoplasma Journal Club (UVM ToxoJC); members include Jenna Foderaro, Anne Kelsen, Shruthi Krishnamurthy, Jacqueline Leung, Pramod Rompikuntal, Luke Tilley & Gary Ward


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Mar 03, Md. Shahidul Islam commented:

      An extensively updated review on this topic is available: M. S. Islam. Calcium signaling in the islets. In: Islets of Langerhans, edited by M. S. Islam, Dordrecht, Heidelberg, New York, London:Springer, 2014, p. 605-632. ISBN 978-9400766853


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 May 26, Israel Hanukoglu commented:

      Originally we had named this protein as LL5.

      This protein has been named as Pleckstrin homology-like domain family B member 1 (Phldb1).

      The Uniprot link for this protein is http://www.uniprot.org/uniprot/Q63312


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Aug 17, Lydia Maniatis commented:

      Short version:

      The authors say: "We hypothesize that how our stimuli are perceived depends on spatial frequency. Our hypothesis is confirmed. (P.S. The effect is size invariant.)"

      Translation: "We hypothesize that how our stimuli are perceived depends on spatial frequency. How our stimuli are perceived DOES NOT depend on spatial frequency. Our spatial frequency hypothesis is falsified."

      a + (-a) = 0

      (The discrete addition of the phrase "at one size" into the abstract, as though this did not upend the entire position, is really quite extraordinary.)


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2016 Apr 11, Lydia Maniatis commented:

      It is worth asking why, on the one hand, Solomon and Pelli (1994) seem to be asking questions about initial steps in vision - asking about "visual filters," and, on the other, referring, not to "perception" of letters, but to "identification" or "recognition." In order to identify or recognise, we have to first perceive, but this step is skipped over not only by these researchers but by those contemporary investigators who consider themselves "psychophysicists" in general.

      The reason is this: These investigators insist on treating perception as a problem of detection, such that they can recycle the signal detection models first developed by radar researchers.

      Thus, they assume that identification/recognition would be perfect if it were not for “internal noise” in the system, which produces uncertainty in the outcome. This noise is the random firing of neurons, base rates etc. This claim about internal noise and perception has never been tested, nor (to my knowledge) have these researchers proposed a way to test or measure the claim, but it is assumed.

      It is also assumed that we can add “external noise” to a stimulus and thus counterbalance the “internal noise.” This “external noise” can take the form of variance of the stimulus pool, splotches superimposed on the stimulus (as here), etc. Anything that can be described as “unpredictable.”

      If we do this, then there is an equation that we can use that allows us to measure “performance” regardless of the task, as long as we have a value to plug in for our “noise” term.

      If we can assume that the “external noise” is much bigger than the “internal noise” then we can use this equation whose output is labelled “E” for efficiency, by plugging in our “external noise” value.

      Clear so far?

      What is wrong with this story is also the reason researchers adopting it don't refer to “perception.”

      The stimulus, which consists of retinal photoreceptors excited by disconnected photons pouring in from the environment does not contain “letters” or any other objects to be “detected.” Only photons are detected by the system. It is the response of the nervous system that organizes these points, based on rules (instantiated in the system) that have been selected for over evolutionary time to produce a good enough match between the objects out there and the objects we perceive. We can understand the importance of sophisticated rules if we consider how easy it is for humans to read the letters of “captchas” used by websites to ensure you're not a robot, but which programmers have a hard time beating. (This is actually a crude and somewhat misleading example, because even seeing the entire captcha without being able to recognize the letters it “contains” is a feat of perceptual organization). So the visual system creates a percept by adding structure to structureless data, and the number of these potential structurings is infinite. The limiting factors are the rules.

      So to see a letter, even as a physical shape, implies an enormously complicated process of perceptual organization, based on inferences that constitute the output of the system. What we “identify” or “recognize” is the product of these processes. We are not “detecting” something that is there a priori, in the stimulus, the disconnected photons. Seeing splotches, or any other feature of the percept, is also the result of the same organizing processes. There's no principle justifying calling part of the percept “noise” and another part “signal” if what we are interested in are basic perceptual processes. It is relatedly a problem to overlook that some kinds of “noise” will, for organizational reasons, interfere more with the “signal” that we have in mind than other kinds, something that the makers of “captchas” know well.

      But all of these facts are silently overlooked by investigators who choose to treat perception as a detection problem involving imaginary spatial filters and arbitrarily defined “noise”. Which is truly extraordinary.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    3. On 2016 Mar 12, Lydia Maniatis commented:

      Continuation of previous:

      Translation: Forget everything we've assumed so far about spatial filters. We don't have special detectors sensitive to the frequency of light bands falling across the retina! Visual angle doesn't matter. The visual system has special detectors for detecting the number of light/dark cycles per (familiar) "letter" - (about 3), actually a range of cycles, since some letters are quite wide (e.g. m's) and others quite narrow (e.g. l's). The processes implicit in organizing points of light into letter shapes so that we can recruit the relevant letter-sensitive channels are not relevant. Our data plus assumptions prove it.

      I think this front-page Nature article has zero credible content or face-validity.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    4. On 2016 Mar 12, Lydia Maniatis commented:

      The claims the authors make in this publication lack both empirical and logical support. To make what is perhaps the most clear point, the very tenuous assumptions underlying the project are themselves contradicted by the authors own statements. This is represented as a refinement of the fundamental assumption, but in fact it pulls the rug out from under it. Each step of the way, definite assertions are made which citations provided do not support.

      The train of thought (with comments) is this:

      Authors: “We hear periodic sounds, or tones, by means of parallel auditory filters, each tuned to a band of temporal frequency (Fletcher, 1940)”

      From MIT online Encyclopedia of Cognitive Sciences: To account for the obtained data, Fletcher proposed a “critical band” that likened the ear to a bandpass filter (or, to encompass the entire frequency range, a set of contiguous, overlapping bandpass filters). The proposed “auditory filter” is a theoretical construct that reflects frequency selectivity present in the auditory system...”

      Translation: The auditory system exhibits frequency selectivity. We could find no more convincing citations with respect to auditory filters between 1940 and 1994.

      Authors: “...and we see periodic patterns, or gratings, by means of parallel visual filters (Campbell and Robson, 1968).”

      From Robson and Campbell, 1968: “Thus, it seems that we cannot satisfactorily model the over-all visual system by a simple peak detector following a spatial filter...As a modification of this theory, we may assume...Thus, we may suppose that the visual system behaves not as a single detector mechanism preceded by a single broadband spatial filter but as a number of independent detector mechanisms each preceded by a relatively narrowband filter 'tuned' to a different frequency...Such a model could account for our findings...”

      Translation: Robson and Cambell's (1968) results did not bear out their original predictions, and they speculated as to possible alternative accounts. Between 1968 and 1994, no firmer conclusions were apparently available.

      Note also that the analogy between frequency of pressure waves and the “frequency of periodic patterns (gratings)” is very loose. What is being claimed, specifically, is that there is a class of visual neurons that are excited by stimuli with a specific, sine-wave-type luminance structure across a region of space (more specifically, across a region of the retina), and that they are sensitive to the frequency of these spatial luminance alterations. But frequency of pressure waves is a fundamental feature of the energy that interacts with our sensory system to initiate perception. Grating patterns, on the other hand, are just one of an infinite number of possible patterns of light impinging on our retinas. If assumptions about vision are to rest on analogy, then frequency of light waves would seem more appropriate.

      Authors: “Do these visual filters participate in everyday tasks such as reading and object recognition?”

      Translation: We assume the existence of special, “low-level” mechanisms for detecting grating patterns of light on the retina. (Campbell and Robson, 1968 specified visual angle, i.e. extent on the retina, in defining their patterns). We wonder if these exist exclusively to detect grating patterns, or whether they are engaged in seeing other things as well. We're particularly interested in the perception of familiar objects that we can name upon seeing. The possibility that the visual system may possess “low-level” neurons interested only in ecologically irrelevant grating patterns but not in objects seems to us to be not only credible but testable and worth testing...

      Authors: “After all, grating visibility only requires the distinguishing of pattern from blank, whereas object recognition, for example letter identification, requires classification by the observer into one of many learned categories.”

      Translation: It's possible that letter identification doesn't implicate mechanisms used for seeing “pattern from blank,” or for seeing unfamiliar letters. To the extent that such mechanisms might, in fact, be implicated in letter recognition, we presume they consist of spatial filters.

      Authors: “Here, we make use of results from hearing research (Patterson, 1974).”

      Translation: An ad hoc model constructed on the basis of hearing experiments is an appropriate model for testing our conceptually confused variant of an assumption about the visual system based on another analogy to audition. (From Patterson, 1974: From Patterson (1974): “Threshold for a pulsed tone was measured as a function of its distance in frequency from the edge of a broad band of noise with very sharp skirts. Tone frequency was held constant at 0.5, 1.0, 2.0, 4.0, or 8.0 kHz while the position of the noise edge was varied about the frequency of the tone. The spectrum level of the noise was 40 dB. As expected, tone threshold decreased as the distance between the tone and the noise edge increased, and the rate of decrease was inversely related to tone frequency. The data were used in conjunction with a simple model of masking to derive an estimate of the shape of the auditory filter. A mathematical expression was found to describe the filter, and subsequently, this expression was used to predict the results reported by several other investigators.”)

      Authors: We find that letter-identification and grating detection filters are identical, showing that the recognition of these objects at one size is mediated and constrained by a single visual filter, or 'channel.'

      Translation: Our “single visual filter” conclusions contradict the speculations of Campbell and Robson (1968) (the authors we cited as support for the existence of filters to begin with) i.e. that “we may suppose that the visual system behaves not as a single detector mechanism preceded by a single broadband spatial filter but as a number of independent detector mechanisms each preceded by a relatively narrowband filter 'tuned' to a different frequency.” We don't know if our results on "letters" apply to other shapes. The varied shapes and proportions of "letters" have no bearing on the issue. For the visual system, "letters" is a special category of its own.

      Authors: Surprisingly, our noise-masking paradigm shows that the same channel performs both low-level detection of narrow-band gratings and high-level identification of broad-band letters.

      Translation: Uncorroborated assumptions inspired by analogies to electrical circuits and sound systems, which ignore the fact of neural inhibition and the principles of perceptual organisation, allowed us to show that hypothetical grating-detectors are responsible for the processes involved not only in perceiving, but also in recognizing letters. (Clearly a breakthrough for memory research as well as perception.) Also, we are arbitrarily splitting the part of the pattern we are showing observers into “noise” and “signal” terms, and assume that the visual system agrees with our analysis and segregates letters from splotches, without recourse to any organizing constraints (e.g. figure-ground rules). (Also, see again comment above re: single channel.)

      Authors: (Blurb to Figure 1): Note that changes in viewing distance, from 3 to 60cm, hardly affect the visibility of any given letter, indicating that the channel scales with letter size. (cont'd in next comment).


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Nov 23, Harri Hemila commented:

      A manuscript version of the paper is available at the Helsinki University institutional repository: http://hdl.handle.net/10250/8077


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 May 03, Hugues BEDOUELLE commented:

      For an unknown reason, this article is absent from the archives of "Protein Engineering Design and Selection". A pdf file of the article can be found at URL: http://hugues.bedouelle.free.fr


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Nov 30, Harri Hemila commented:

      Believing that the 2% average effect of vitamin E on mortality is valid for all ATBC participants is an example of ecological fallacy.

      The ATBC Study, Alpha-Tocopherol, Beta Carotene Cancer Prevention Study Group., 1994 reported that the average mortality in participants administered vitamin E was not different from the non-vitamin E group with RR = 1.02 (95% CI 0.95, 1.09).

      However, a subsequent subgroup analysis found that the effect of vitamin E was not uniform over all the ATBC Study participants. The combination of age and dietary vitamin C modified the effect of vitamin E so that there was strong evidence of heterogeneity in the effect of vitamin E over 6 subgroups (P = 0.0005) Hemilä H, 2009. Furthermore, given that baseline age modified the effect of vitamin E, a further analysis by the participants’ follow-up age was done and a significant difference in the effect of vitamin E on mortality was observed before and after the age of 71 years (P = 0.03) Hemilä H, 2011.

      Ecological fallacy occurs where data about a group is used to conclude information about an individual. Thus, assuming that the +2% average effect of vitamin E on mortality in the ATBC Study is valid for all ATBC participants is an example of ecological fallacy. A substantial proportion of the ATBC Study participants are inconsistent with the average effect.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Jul 23, Jonathan Eisen commented:

      I am posting some notes and other materials relating to this paper on Figshare. See https://figshare.com/account/home#/projects/15032.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Oct 26, EDWARD BERRY commented:

      The potato hinge protein has a perfect CX9CX3C----CX3CX9C motif which by homology with vertebrate structures should form a helix hairpin with disulfides holding the two arms together. This is the motif recognized by the MIA40/CHCHD4 disulfide relay import system. And like other MIA40 substrates, the hinge protein ends up in the inter-membrane space (attached to cyt c1 of the bc1 complex). I wonder if anyone has checked whether Hinge is imported by the MIA40 system.

      In vertebrates one of the middle cysteines is lost, some residues are inserted, spoiling the perfect cannonical MIA40 import sequence. Only two disulfides are formed, and there is a short leader sequence although it is not a typical mitochondrial targeting sequence.

      In Saccharomyces, all but two of the cysteines are lost, and the hairpin is clamped by a single disulfide. Could this represent a switch from one import mechanism to another over the course of evolution?


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Dec 10, Kath Wright commented:

      Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Sep 20, Dr Yasmin Momin commented:

      mucoepidermoid carcinoma of ovary arising in dermoid is a rare case we reported


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Mar 23, Misha Koksharov commented:

      There is a later paper on this topic with important critical comments: Dworak M, 2011


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 May 30, Thomas Heston commented:

      The data presented in this study do not support ageism but rather illustrate a primary feature of statistics: as the sample size increases, you are more likely to find a statistically significant p-value. First of all, look at admission rates to the coronary care unit (CCU). If there was a gender bias, then a greater proportion of men (or women) without acute myocardial infarction would be admitted to the CCU compared to the other sex. This study shows clearly that sexism in CCU admission rates is not present. In 1990, 53% of men admitted to the CCU did not have an infarction compared to 52% of women, i.e. over half of the people admitted to the CCU did not have a myocardial infarction yet received CCU level care. This difference is not statistically significant. Then, in 1992 it was found that 48% of men admitted to the CCU did not have infarction compared to 54% of women. This difference was statistically significant, indicating that a greater proportion of women vs men admitted for suspected myocardial infarction received CCU level care. If anything, this represents sexism against men, not against women. But if we look at the data closer, we find that quite a few more people were admitted for suspected infarction in 1992 compared to 1990. This larger sample size means that we are more likely to find statistically significant differences. So while no statistically significant difference was found with the lower sample size (n=1473) in 1990, the higher sample size in 1992 (n=1967) resulted in a statistically significant difference. This is not surprising, this is just how statistical analysis works: large sample sizes are much more likely than small sample sizes to show statistically significant differences. To highlight this further, look at when the authors broke down their data by age (see Table 4). When broken down by age, no significant differences were found, but when all ages were combined, a statistically significant gender difference was found in 1990 and in 1992 in terms of thrombolytic therapy. This does not indicate that the differences are explained by age, but rather indicates that small sample sizes are less likely to show statistically significant differences compared to large sample sizes. The data does show a difference in rate of thrombolysis that is interesting, with an associated difference in mortality rates. My interpretation of this data is that a higher percentage of men vs women with confirmed infarction received thrombolytic therapy, and a lower percentage of men vs women with confirmed infarction died. Unlike the CCU admission rates which are not very illuminating and do clear show gender or age bias, the rate of thrombolysis suggests a bias towards more aggressive treatment of men with infarction (likely starting with differences in their emergency room care Heston TF, 1992). Furthermore, the data also suggest that thrombolysis works, as a lower in-hospital mortality rate was seen for men vs women. However, mortality was not broken down by whether or not the patient had received thrombolysis, so a meaningful analysis of mortality by gender and thrombolytic therapy is not possible.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2013 Jun 13, Karl Broman commented:

      The idea is obvious in retrospect, but it wasn't at the time; this paper made a big difference.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Aug 31, Santosh Kondekar commented:

      I request the authors to comment on the link below: https://www.ncbi.nlm.nih.gov/pubmed/511337#cm511337_73741 Please share your experience if you had come across any accidental single heavy dose of amikacin. Thank you.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2013 Jun 14, Michael Schatz commented:

      This is a seminal paper in genome assembly, precisely defining the unitigging algorithm that forms the basis of all overlap-layout-consensus assemblers since.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Jan 04, S A Ostroumov commented:

      New theory is formulated: the role of membrane potential as a multi-functional regulator of membrane proteins, in biomembranes of various types.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Nov 25, Harri Hemila commented:

      A secondary analysis of this study has been published in Hemilä H, 2013, DOI. The secondary analysis calculated that the incidence of all asthma attacks was reduced by RR = 0.22 (95% CI 0.06 to 0.81), and the incidence of severe and moderate asthma attacks was reduced by RR = 0.11 (95% CI 0.02 to 0.48).


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Jan 08, Brett Snodgrass commented:

      Thank you for the excellent article. Please provide your kind attention to the distinction between the Thebesian veins and the vessels of Wearn.

      http://bit.ly/Thebesius http://bit.ly/JTWearn

      The Thebesian veins may indeed be involved in drainage of the "dye/contrast" into the ventricles. The authors report what is presumably the vessels of Wearn “direct pathways of drainage into the right ventricle from the septal artery.” That depends on the definition of the term “direct.” If it means before the capillary beds, then it is the vessels of Wearn. If it means all connections excluding the coronary sinus, then it may include both the vessels of Wearn and the Thebesian veins.

      For additional commentary on the subject, please see the subsequent link. https://twitter.com/BrettSnodgrass1/status/419196829339639808

      http://bit.ly/vasaThebesii

      Comments or suggestions are welcome.

      Thank you very much.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Nov 23, Harri Hemila commented:

      A manuscript version of the paper is available at the Helsinki University institutional repository: http://hdl.handle.net/10250/135149


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Nov 25, Harri Hemila commented:

      A secondary analysis of this study has been published in Hemilä H, 2013. In the tetanus patients aged 1 to 12 years, vitamin C treatment was associated with a 100% reduction in case fatality rate (95% CI from -100% to -94%). In tetanus patients aged 13 to 30 years, vitamin C treatment was associated with a 45% reduction in case fatality rate (95% CI from -69% to -5%).


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Feb 16, Lydia Maniatis commented:

      Another example of the problem discussed by Teller can be found in Pelli (1990), who is proposing a model of perception:

      "In order to make the model as general as possible, yet still be able to measure its parameters, we need threeassumptions,or constraints. First we assume that the observer's level of performance increases monotonically with the contrast of the signal (when everything else is fixed). This guarantees that there will be a unique threshold. Secondly, as indicated on the diagram by the prefix contrast-invariant we assume that the calculation performed is independent of the contrast of the effective stimulus, which is its immedi- ate input. Together, assumptions 1 and 2 are a linking hypothesis. They imply that the observer's squared contrast threshold (which we can measure) is pro- portional to the effective noise level (which is inaccessible). Thirdly, we assume that the equivalent input noise is independent of the amplitude of the input noise and signal, or at least that it too is contrast- invariant, independent of the contrast of the effective image. These assumptions allow us to use two threshold measurements at different external noise levels to estimate the equivalent noise level. In effect, the assumptions state that the proportionality con- stant and the equivalent noise Neq are indeed constant, independent of the contrast of the effective image. These three assumptions are just enough to allow us to make psychophysical measurements that uniquely determine the parameters of our black-box model. Our model makes several testable predictions, as will be discussed below."

      It's worth noting that the main function of the rationale seems to be one of practical convenience.

      Theoretically, Pelli (1990) is proposing to make the case that: "the idea of equivalent input noise and a simplify- ing assumption called 'contrast invariance' allow the observer's overall quantum efficiency (as defined by Barlow, 1962a) to be factored into two components: transduction efficiency (called 'quantum efficiency of the eye' by Rose, 1948) and calculation efficiency..."

      Although he claims his model makes testable predictions, he also states that they had not, as of publication been tested.

      Pelli and Farrell (1999) seem to be referencing the untested, two-component model when they state that: "it is not widely appreciated that visual sensitivity is a product of two factors. By measuring an additional threshold, on a background of visual noise, one can partition visual sensitivity into two compo- nents representing the observer鳠efficiency and equivalent noise. Although they require an extra threshold measurement, these factors turn out to be invariant with respect to many visual parameters and are thus more easily characterized and understood than their product, the traditional contrast threshold."

      No references are provided to suggest the proposal has been corroborated. This problem is not remedied by the subsequent statement that: "Previous authors have presented compelling theoreti- cal reasons for isolating these two quantities in order to understand particular aspects of visual function (refs. 3 㠱3)," since all of the references predate the Pelli (1990) claims. Conveniently, the authors "ignore theory, to focus on the empirical properties of the two factors, especially their remarkable invari- ances, which make them more useful than sensitivity"). Ignoring theory unfortunately seems to be a hallmark of modern vision science.

      In this way, Pelli papers over a theoretical vacuum via technical elaboration of an untested model.

      Both Pelli (1990) and Pelli and Farrell (1999) are referenced by more recent papers as a support for the use of the "Equivalent noise" model.

      Pelli (1990) is cited by Solomon, May & Tyler (2016), without a further rationale for adopting the model (I've commented on that article here: https://pubpeer.com/publications/62E7CB814BC0299FBD4726BE07EA69).

      Dakin, Bex, Cass and Watt (2009) cite Pelli and Farrell (1999), their rationale being that the model "has been widely used elsewhere."

      I feel inclined to describe that what is going on here (it is not uncommon) as a kind of "theory-laundering," where ideas are proposed uncritically, then uncritically repeated, then become popular, and their popularity acts as a substitute for the missing rationale. Is this science?


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2016 Feb 15, Lydia Maniatis commented:

      In reading a number of papers in visual perception, I repeatedly noticed authors using the term "linking hypothesis." "Linking hypotheses" - or assertions about how some experimental effect was linked to some cause -would be "introduced" without any ado, i.e. casually, without a rationale. It seemed as though we were supposed to take these "hypotheses" as givens in the interpretation of data, which didn't seem right. I googled the term "linking hypothesis" looking for some kind of formal definition, but didn't find anything of that kind. I did, however, find this article, which confirmed all my worst suspicions. I've only looked over as yet, but here is the final, jaw-dropping paragraph:

      "Perhaps we should include more often in our publications a paragraph or two making our linking propositions explicit. It will be important to define the ranges of intended applicability of individual linking propositions, the kinds of support they receive from prior experiments, their consistency with other broadly accepted linking propositions, the constraints they place on the composite map, the ancil- lary assumptions involved and the overall fit of the linking propositions into the current theoretical net- work of visual science. Within a few years, enough such descriptions should become available that it would be possible to refer to and build upon earlier explications, rather than starting from scratch each time. Similarly, perhaps reviewers could be encouraged to use the explicitness and potential values of linking propositions as one of the criteria of excellence for papers in which arguments containing link- ing propositions are explicitly or implicitly made."

      Essentially, this paragraph reveals that, at least as of the time the article was written, vision "scientists" were basing research on arbitrary claims for which they did NOT define ranges of intended applicability; defend with respect to previous research findings; ensure that they were consistent with accepted ideas (or at least how they challenged these); explain their general implications and connection to the current theoretical framework. They were, rather, "starting from scratch" on the basis of arbitrary assertions. This is not a recognisable picture of the scientific method.

      It doesn't appear that Teller's hopes for correction of these problems were realised. As I read the literature, the culture of "linking hypotheses" and all that that entails has become normalised. In fact, it may have gotten worse, as it has combined with the fashion for model-fitting in vision science. Thus, data collected is arbitrarily assumed to be "linked" to underlying processes, and the data are fitted to an algorithm, which, due to the high degree of predictability of the general outcomes (e.g. that attention will limit performance) and large number of free parameters, will always be achieved "more or less," without, of course, having general applicability.

      I've criticised a number of articles from this unfortunate new (maybe not so new) tradition (a few examples below):

      https://pubpeer.com/publications/90941136CC181AFE4896477BF5BB44

      https://pubpeer.com/publications/62E7CB814BC0299FBD4726BE07EA69

      https://pubpeer.com/publications/F0FDE1805AE5BDE583E3883A8AF39C

      A particularly devilish aspect of this approach is that the absence of intellectual/theoretical rigor is masked not only by incoherence but also by mathematics, which may confuse or scare off potential critics. But the same thing applies to math as to computing: Garbage in, garbage out. The rationale is the thing.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Oct 20, David Mage commented:

      This is an excellent review. However, it seems to have overlooked the paper "Neonatal mortality, the male disadvantage" by Naeye RL, Burt LS, Wright DL, Blanc WA, Tatter D, in Pediatrics. 1971 Dec;48(6):902-6, PMID: 5129451, that concluded that the male excess in infant mortality "must" be X-linked. Naeye et al.'s conclusion that an X-linkage is involved has been supported by work following this 1983 paper as shown in the following:

      Is excess male infant mortality from sudden infant death syndrome and other respiratory diseases X-linked? Mage DT, Donner EM. Acta Paediatr. 2014 Feb;103(2):188-93. doi: 10.1111/apa.12482. Epub 2013 Dec 20. PMID: 24164639

      The X-linkage hypotheses for SIDS and the male excess in infant mortality. Mage DT, Donner M. Med Hypotheses. 2004;62(4):564-7. PMID: 15050108

      The fifty percent male excess of infant respiratory mortality. Mage DT, Donner EM. Acta Paediatr. 2004 Sep;93(9):1210-5. PMID: 15384886

      A genetic basis for the sudden infant death syndrome sex ratio. Mage DT, Donner M. Med Hypotheses. 1997 Feb;48(2):137-42.PMID: 9076695

      Female resistance to hypoxia: does it explain the sex difference in mortality rates? Mage DT, Donner M. J Womens Health (Larchmt). 2006 Jul-Aug;15(6):786-94. Review. PMID: 16910910


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2015 Jun 15, Salzman Lab Journal Club commented:

      This of course is a landmark paper, clearly and concisely demonstrating that RNA alone can catalyze reactions. A finding that is a bit obscure here is that nicked circle IVS has mobility similar to linear IVS minus 15 nt. A later paper by the Cech group showed that this is because the autocyclization reaction cleaves off the 5'-most 15 nt of the linear IVS; they posit that this may limit the reversibility of the splicing reaction. This paper introduced the term "ribozyme", which the authors used in distinction to "enzyme" since the RNA reaction was not multiple-turnover; however these days it has expanded to include any RNA catalysts.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2015 Dec 05, S A Ostroumov commented:

      Full text online free: Reconstitution of biological molecular generators of electric current. J Biol Chem 251: 7059-7065. https://www.researchgate.net/publication/23071084


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2013 Oct 29, Jamie Horder commented:

      This 1981 report of 5 cases was the first published description of the syndrome that was soon to be known as AIDS. It concluded:

      "The above observations suggest the possibility of a cellular-immune dysfunction related to a common exposure that predisposes individuals to opportunistic infections."


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Jul 25, Richard Sauerheber commented:

      We now know that both calcium and magnesium ions at millimolar concentrations decrease the fluidity of biologic membranes. Inside cells, where calcium is at only micromolar concentrations and magnesium at millimolar concentrations, magnesium ion would be involved, particularly since the inner half bilayer phospholipids have negatively charged groups even at slightly acidic pH (6.9) inside cells. The outer half of the bilayer is also susceptible to effects of both calcium and magnesium at millimolar concentrations in extracellular fluid, where phosphate groups on phospholipids would be negatively charged at alkaline pH (7.3) of extracelluluar fluid. The detailed control of the lipid fluidity of membranes in vivo appears to be quite sophisticated.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Jun 09, Israel Hanukoglu commented:

      This article is the second in the series of first keratin sequences. The first one, https://www.ncbi.nlm.nih.gov/pubmed/6186381 reported the first sequence of a type I keratin.

      This second article reported for the first time the sequence of a type II keratin and predicted the secondary structural domains of the protein by computerized analysis. These predictions were confirmed by an analysis of the crystal structure of a segment of this keratin in coiled-coil form (Lee et al., PMID:22705788).

      The coiled-coiled structure of keratins is presented in an article (http://dx.doi.org/10.1002/bmb.20746 ) that also presents a model that can be viewed in Proteopedia.

      http://proteopedia.org/wiki/index.php/Keratin


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Jan 11, Brett Snodgrass commented:

      Dear Reader,

      Please provide your kind consideration to the following reasons that some of the described "lymphatic structures" may be "myocardial sinusoids."

      Quoted from the article: “The subepicardial and subendocardial systems in dogs and pigs communicate via transmyocardial channels” … "in humans these communications have not been identified with certainty." The subendocardial network of lymphatics described in both animals and humans in this study have many similarities to the myocardial sinusoids described by Wearn.

      http://bit.ly/JTWearn

      Tracing to subepicardial lymphatics was possible in dogs/pigs, but not in humans. This may be explained by the hypothesis that some of the observed “lymphatics” in both animals and humans were “myocardial sinusoids.” Caution should be exercised before assuming that all the irregular subendocardial channels reported in this study were lymphatics. Presumably, many of them were myocardial sinusoids and not lymphatics.

      Whether these myocardial sinusoids communicate with subendocardial lymphatics may be a reasonable area for further study.

      My opinion is that accurate anatomic terminology is a basic principle underlying good medical science, and I ask others to consider whether the aforementioned definitions are appropriate. If this comment is not helpful, please let me know how it might be improved. Comments and suggestions are welcome.

      Thank you very much.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Jan 07, Brett Snodgrass commented:

      Dear Reader,

      Please see an annotated image from the article. https://twitter.com/BrettSnodgrass1/status/419272033118085120

      Comments and suggestions are welcome.

      Thank you kindly.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Jan 08, Brett Snodgrass commented:

      Thank you for the excellent article.

      The authors write “intramyocardial channels normally joining the coronary arteries to the ventricular chambers.” Wearn described these ventriculocoronary arterial connections in addition to atriocoronary arterial connections. The eponym and only pronoun applied to these connections is the vessels of Wearn.

      http://bit.ly/JTWearn

      Finegold et al. astutely acknowledged the vessels of Wearn (connections) as a possible etiology for their findings. For further information related to PAIVS and the connections, please see:

      http://www.ncbi.nlm.nih.gov/pubmed/23332812 https://twitter.com/BrettSnodgrass1/status/419317173689909248

      Comments or suggestions are welcome.

      Thank you kindly.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Aug 31, Santosh Kondekar commented:

      Though amikacin is known to be toxic at non therapeutic doses; I feel the toxicity with single high dose is questionable.

      A fourteen month old child of a hospital staff nurse had presented to us with loose motions. Injection amikacin was advised along with routine supportive therapy for hydration. The dose of amikacin was advised as 7.5mg/kg/dose. The child had oliguria since last 12 hours. The amikacin injection was supposed to be kept on hold in view of same. Due to some miscommunication and advise being followed by a junior staff nurse and being unsuperwised; the child received an accidental overdose of intravenous amikacin bolus as 750 mg instead of 75.0 mg. The mishap was immediately noted by the mother. Mother being a staff nurse alerted the consultant and nephrologist. Immediately, blood was collected for renal profile, blood gas and amikacin levels. There was no acidosis on ABG and BUN was 24g/dl and Cr was 0.9. The child showed no worsening of symptoms nor any new symptoms like irritability,cry or seizures. A collective decision of consultant and parents was made to wait and watch. parents were informed all toxicities of amikacin in details. Child passed urine in subsequent hour. A repeat renal profile was sent after 6 hours and 24 hours. BUN was 22 and Serum Creatinine was 0.8. An audiometry was done after three months. A decision to perform dialysis was averted. Serum amikacin levels couldnot be done.

      I do feel that; in normal renal profile, an accidental overdose upto ten times therapeutic dose in a child should not be a reason to panic and an apprehensive decision to perform hemodialysis can be avoided.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2015 Dec 05, S A Ostroumov commented:

      Full text online free : Electrogenesis by bacteriorhodopsin incorporated in a planar phospholipid membrane. https://www.researchgate.net/publication/18316493


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Nov 25, Harri Hemila commented:

      A secondary analysis of this study has been published in Hemilä H, 2008, which is available also as a manuscript version, Handle. There is statistically highly significant interaction between gender and vitamin C effect on common cold incidence (P = 0.0001), so that vitamin C reduced cold incidence in males with RR = 0.63 (95% CI 0.50 to 0.78), but not in females (95% CI 0.95 to 1.61).


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Mar 19, Nigam Shah commented:

      The first paper to propose the idea of building a cohort of 'patients like mine'.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2015 Jun 02, thomas samaras commented:

      Additional information on height, CHD, and longevity is available from these recent publications.

      Samaras TT. Shorter height is related to lower cardiovascular disease risk—A narrative review. Indian Heart Journal 2013; 65: 66-71.

      Samaras, TT. Is short height really a risk factor for coronary heart disease and stroke mortality? A review. Med Sci Monit 2004; 10(4): RA63-76.

      Samaras TT. Evidence from eight different types of studies showing that smaller body size is related to greater longevity. Journal of Scientific Research & Reports. 2014: 3 (16): 2150-2160, 2014; article no. JSRR.2014.16.003.

      Samaras TT. Human Scaling and Body Mass Index. In: Samaras TT (ed): Human Body Size and the Laws of Scaling: Physiological Performance, Growth, Longevity and Ecological Ramifications. New York: Nova Science Pub; 2007: pp 17-32.

      He Q, Morris BJ, Grove JS, Petrovitch H, Ross W, Masaki KH, et al. Shorter men live longer: Association of height with longevity and FOXO3 genotype in American men of Japanese ancestry. Plos ONE 9(5): e94385. doi:10.1371/journal.pone.0094385.

      Salaris L, Poulain M, Samaras TT. Height and survival at older ages among men born in an inland village in Sardinia (Italy), 1866-2006. Biodemography and Social Biology, 58:1, 1-13.

      Bartke A. Healthy Aging: Is Smaller better? A mini-review. Gerontology 2012; 58:337-43.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 31, Denise N Slenter commented:

      The pathway outlined in Figure 1, is available as free machine readable data in WP4210 in WikiPathways: https://www.wikipathways.org/index.php/Pathway:WP4210 . This pathway can be used for data analysis with e.g. Pathvisio and Cytoscape!


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Jun 25, Jacques Barbet commented:

      This is an incredibly useful paper to calculate multiple equilibria in solution based on the mass action law.

      The method uses a partition function that should be used to teach students.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Jul 27, Richard Sauerheber commented:

      (from the author) Many have argued that insulin stimulates glucose transport in sensitive cells by recruiting already pre-synthesized glucose transport molecules that are inside the cell waiting to be inserted after insulin binds to cell surface receptors. This however would be an energy-requiring and relatively slow process, to insert water soluble transport protein sections through the hydrophobic lipid bilayer. The function of insulin is to conserve energy after eating a meal, storing glucose for future energy needs in the form of glycogen, as well as other foodstuffs, and to quickly react to meal eating, and then to quickly deactivate energy storage between meals. So energy use, such as that required to insert transporters into an already-formed membrane would be wasteful and a contradiction in function. Also, the insulin stimulation of glucose transport is very rapid, finished within a minute, and the reverse, the deactivation of the transport rate, occurs quickly after insulin washes away, as when insulin levels are miniscule between meals. Removal of transporters from a membrane, to be stored inside the cell for later use again when the next meal is consumed, is a cumbersome notion. The data here point to a much more sophisticated and efficient design, where allosteric conformational changes can cause rapid activation and deactivation cycles in transporter activity when insulin is present and then absent, as during and then between meals throughout the day in the in vivo setting. For all the published data suggesting to investigators this is not a proper view, understand that such presented evidence is not compelling or beyond reasonable doubt, including microscopic observations of what are thought to be widespread intracellular transporters waiting for repeated, rapid re-insertion into, and re-removal from, the plasma membrane. The view described here caused my NIH grant renewal in the 1980's to be rejected. My research position eventually was terminated and I went into teaching (which I fortunately dearly love). Meanwhile, I stand by these observations and continue to teach them.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Dec 10, Kath Wright commented:

      Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Aug 09, Matthew Katz commented:

      This is a seminal article in cancer care. NSABP B-06 demonstrated the safety of organ-preserving surgery in breast cancer and established a role for radiation therapy in early breast cancer. At the time there were questions about whether radiation was even necessary, but the segmental mastectomy alone arm fared worse. There results have held up at 20 years, also published the NEJM. Fisher B, 2002

      We still have more to refine on patient selection, treatment approach and other factors. But NSABP B-06 remains an example of how clinical trials can give patients treatment options without compromising cure rates.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2015 Jan 21, David Keller commented:

      Vitamin C was administered orally in this study

      When vitamin C is ingested orally, the serum concentration is regulated to a maximum of about 300 microM/L. Intravenous administration of vitamin C bypasses enteric control mechanisms, allowing plasma concentrations of up to 20,000 microM/L to be achieved. Alternative practitioners claim special benefits at the supra-physiologic concentrations which can only be achieved with IV administration. This comment is not meant to support or dispute their claims, it is placed here for the reference of researchers who do not have access to the NEJM archives, since the route of administration is not mentioned in the PubMed abstract.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Jan 04, S A Ostroumov commented:

      Keywords (additional): Halobacterium halobium, Rhodospirillum rubrum, membrane potential, bioenergetics, bacterial photosynthesis,


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2016 Jan 04, S A Ostroumov commented:

      ABSTRACT: A unique short review of innovative landmark articles that discovered and proved the membrane potential across the membranes of the bacteria that use light as a source of energy, namely, the bacteria with traditional type of photosynthesis with bacteriochlorophyll and the bacteria with a new type of energetics that is based on bacteriorhodopsin.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    3. On 2015 Dec 10, S A Ostroumov commented:

      Abstract is available, as well as the list of cited publications: https://www.researchgate.net/publication/22754808


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2013 Nov 24, John Sotos commented:

      In a recent letter to the Journal Guarino describes an apparently novel method of detecting ascites: the diaphragm of the stethoscope is placed just superior to the pubic crest of a patient who has been standing for three minutes or more, and the physician determines by auscultation the level where the timbre of the “finger-flicking” percussion note changes from dull to loud (1). A similar technique, alas, was described in the 1930s by two French physicians (2) (3). Without mentioning the three-minute caveat, they found that if the physician auscultated in the iliac fossa of a standing patient with ascites, and percussed the abdomen from superior to inferior, the percussion note had a brusque augmentation at the top of the zone liquidienne (2).

      More interestingly, however, the thrust of their articles is directed at a technique they considered far more sensitive and convenient in detecting ascites: listening with the stethoscope bell in one iliac fossa while percussing the contralateral fossa with a “finger pulled back like a hammer” (doigt recourbé en marteau) (3). The presence of ascites is indicated by a distinctive double note in response to percussion (le double bruit ascitique), whereas a single note is heard in normal patients. Abdominal distention due to large ovarian cysts (3) or “enormous urinary retention” (2), the authors say, yields a single sound, while, in cases of hydatidiform cyst, a second sound is present, but of a different character (l’echo hydatique) (2). The authors further claim that, with the patient standing, their method is capable of demonstrating ascites of volume small enough to have otherwise escaped clinical detection. We have ourselves heard the ascitic double note, which the French authors considered the sonic manifestation of a fluid wave (3).

      Two hundred years ago, Marie Antoinette’s milliner is reported to have said, “There is nothing new except what is forgotten” (4). The advent of computer-based bibliographic retrieval systems has dramatically improved mankind’s scientific “memory,” but has not perfected it. Thus, there still is (and, most likely, always will be) a vast corpus of pre-electronic knowledge, searchable only by means that are both painful and tedious. Unfortunately, when dealing with an art as ancient as the physical examination, the scrutiny of this literature demands added attention (5).

      John G. Sotos, MD

      Iredell W. Iglehart III, MD

      (1) Guarino JR. Auscultatory percussion to detect ascites. N Engl J Med. 1986 Dec 11;315(24):1555-6. Pubmed 3785320

      (2) Lian C, Odinet J. De l’existence d’un double bruit par la percussion abdominale dans l’ascite. Societé Medicale des Hospitaux de Paris. 1931; 55: 1402-1408.

      (3) Lian C, Odinet J. Le double bruit ascitique et le signe de la matité horizontale dans la station debout. Presse Medicale. 1934; 42: 1337-1338.

      (4) Bartlett J (comp.). Familiar Quotations. 13th ed. Boston: Little, Brown, 1955; 1002.

      (5) Sotos JG. Diagnosis of fractures of the hip and pelvis (continued). N Engl J Med. 1983 Apr 21;308(16):971. Pubmed 6835304


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2013 Jun 19, Robert Tibshirani commented:

      This paper, along with

      Kung-Yee Liang and Scott Zeger (1986). "Longitudinal data analysis using generalized linear models". Biometrika 73 (1): 13–22.

      introduced the Generalized Estimating equation (GEE) approach for modelling repeated or grouped observations. Full probability models for such data are often hard to specify, so GEEs finesse the issue by including a within subject or group correlation matrix in the usual score equations for a generalized linear model. The GEE is an important advance that has had much impact on statistical practice.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Jan 27, Guillaume Filion commented:

      This study reports that the sex-determining factor is the transcription factor ZFY. The claims were later shown to be erroneous and the sex-determining factor was identified as the transcription factor SRY (https://www.ncbi.nlm.nih.gov/pubmed/1695712). Expressing SRY in the XX mouse "Randy" made it develop as a phenotypic male (https://www.ncbi.nlm.nih.gov/pubmed/2030730), confirming that SRY is indeed the sex-determining factor. A historical summary of the events was published 25 years after the birth of Randy (https://www.ncbi.nlm.nih.gov/pubmed/27190031).


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Nov 23, Harri Hemila commented:

      A manuscript version of the paper is available at the Helsinki University institutional repository: http://hdl.handle.net/10250/135150


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Jan 08, Brett Snodgrass commented:

      Dear Reader,

      These diffuse (minute, aka fine) connections may be consistent with the vessels of Wearn. Since we cannot definitively exclude an arteriosinusoidal vessel, using the term "vessels of Wearn" is appropriate.

      It is also possible that some of the connections enter the capillary bed before entering the heart chamber. If that is the case, then it is possible that some of the connections are Thebesian connections.

      For serial histologic sections, Wearn studied the arteriosinusoidal and arterioluminal vessels utilizing cold celloidin that was too thick to enter the capillaries. Wearn did note that when India ink was injected into the coronary arteries it would enter the heart chambers through numerous minute connections. Since, the ink would not permit serial histologic sections with 3D reconstruction as was used for the arteriosinusoidal and arterioluminal vessels, we may not have sufficient information to specify whether the connections are Arterio-capillary-cameral, or Arterio-capillary-venule-cameral (The venule-cameral connection would be a Thebesian vein).

      Thus, when the diffuse connections are identified, we do not have sufficient data to determine whether they are arteriosinusoidal only, or whether some are arteriosinusoidal and some enter the capillary bed before entering the heart chamber. In addition, if some of the connections were arterioluminal vessels, then we would have an even more difficult time naming the radiographic finding. Thus, the term vessel of Wearn has been proposed. For additional commentary, please see. https://twitter.com/BrettSnodgrass1/status/404825015771619328 and https://twitter.com/BrettSnodgrass1/status/413860163033247744

      Comments, disagreements, and suggestions are welcome.

      Thank you kindly.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Dec 10, Kath Wright commented:

      Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Jan 08, Brett Snodgrass commented:

      Dear Reader,

      Please consider that approximately 37 years after Wearn's distinguished Harvey lecture, the arterioluminal and arteriosinusoidal vessels (vessels of Wearn), are reported as veins.

      Morphological and Functional Alterations of the Coronary Circulation. Harvey Lecture, 1940 - http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1933738/

      Annotations, commentary, and links to additional related references are found at the following Twitter link:

      https://twitter.com/BrettSnodgrass1/status/419530221927141376

      Comments and suggestions are welcome.

      Thank you kindly.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2013 Jun 18, Jill Barnholz-Sloan commented:

      One of the seminal papers in population stratification bias and admixture effects. This paper was one of the first to describe individual admixture testing and its potential effects and linkage disequilibrium.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Nov 24, Guillaume Filion commented:

      For a retrospective of the ideas behind BALST together with some comments by David Lipman, you can check out the blog post "Once upon a BLAST" at the following link. http://blog.thegrandlocus.com/2014/06/once-upon-a-blast


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Feb 02, Jim Woodgett commented:

      Probably shouldn't comment on a co-authored paper, but I regrettably missed this Drosophila homologue of ZesteWhite3/Shaggy that is involved in fruitfly male fertility and has the (great) name mojoless: https://www.ncbi.nlm.nih.gov/pubmed/17179138


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 31, Varshil Mehta commented:

      If there are any new treatment options available, please mail me on varshil91@gmail.com, since we are actively trying to find new therapies as the older ones are getting exhaustive. Regards, Varshil Mehta


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 30, Jim Woodgett commented:

      Characterization of a novel GSK3-like kinase (GlkA) in slime mold that is related to GskA and (similarly to GskA) acts downstream of cAMP in regulating chemotaxis. Rescue data show increased expression of GskA in glkA nulls is unable to complement (unlike re-expression of GlkA) and vice versa. Paper includes comparisons with mammalian isoforms (GSK-3 alpha and beta) and finds GskA target, Daydreamer, is also targeted by GlkA. A huge amount of data in this study including iTRAQ comparative proteomics. Would be good to know if lithium inhibits glkA.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 26, Jason Climer commented:

      Zutshi et al present an interesting framework that explains the phenomenon of grid cell phase precession as a code for movement direction to reduce path integration error in the grid cell circuit. While the hypothesis that precession stabilizes the grid cell code is an intriguing one, there are several caveats to their interpretations from extant data that should be considered.

      Phase precession in the open field has been characterized by several groups (Climer et al, 2013; Jeewajee et al, 2013; Reifenstein et al, 2014). Notably, all three groups demonstrated that precession relative to the distance traveled occurs faster as an animal’s path crosses further away from the center of the field. This causes sequences to sweep past each other in a way that would make decoding the distance traveled more complex. It may be possible to encode additional trajectory information in this family of sequences, but how the brain would read that out physiologically remains an open question.

      There are other minor concerns that are relevant to the field. Attractor network dynamics have yet to generate phase precession during open field movement. The claim that the slower spatial sequences in the absence of temporal sequences would be “adequate if travelling in a particular direction for distances that correspond to approximately the minimum grid spacing” may be misleading, as the ability of the brain to read out such long timescale dynamics has not been demonstrated.

      Altogether, it is an interesting idea, and it will be interesting to see what testable predictions fall out of it.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 19, Christopher Southan commented:

      The PubChem mappings (which have associated bioassay data, vendors and some patent matches) have been compiled at https://cdsouthan.blogspot.se/2018/01/new-year-new-antimalarial-mappings.html


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 14, Erick H Turner commented:

      We appreciate the authors' covering this important topic. However, the search method might have missed some relevant publications. It did cover this 2012 paper of ours...

      • Turner EH, Knoepflmacher D, Shapley L. Publication Bias in Antipsychotic Trials: An Analysis of Efficacy Comparing the Published Literature to the US Food and Drug Administration Database. PLoS Med 2012;9:e1001189. Available at https://doi.org/10.1371/journal.pmed.1001189

      ...but the following two papers of ours, which employed the same methodology, were not included:


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 11, Tony Buffington commented:

      Of all the comorbidities, was endometriosis the ONLY problem associated with an increased risk for IC?


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 11, Jim Woodgett commented:

      This is a comprehensive and up to date review of small molecule inhibitor classes of GSK-3 and is to be commended for recognizing the two isoform distinctions in the introduction. Some sections still refer to GSK-3beta specific effects (e.g tau phosphorylation where GSK-3alpha is essentially equally happy to phosphorylate this microtubule -associated protein that is implicated in Alzheimer pathology). All of the inhibitors listed in the review block both isoforms.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 16, Alessandro Rasman commented:

      I think that these two recent papers could be useful to understand better the reasons about the failure of the Brave Dreams trial:

      Factors influencing the hemodynamic response to balloon angioplasty in the treatment of outflow anomalies of internal jugular veins http://www.jvsvenous.org/article/S2213-333X(17)30336-0/pdf

      Optimism, enthusiasm, responsibility http://www.jvsvenous.org/article/S2213-333X(17)30335-9/pdf


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 26, Benjamin W Chaffee commented:

      We appreciate the detailed reading of our publication.

      In response, we note that a risk factor need not account for the majority of cases to be an important public health concern. Of all drivers involved in fatal traffic accidents in the United States, 79% were not impaired by alcohol.[1] Nonetheless, drinking and driving demands public health attention because of its indisputable and preventable contribution to traffic fatalities.

      All risk factors for youth smoking that can be addressed through effective public policy merit attention, particularly if those factors are increasing in prevalence.

      [1] National Highway Traffic Safety Administration. Traffic Safety Facts 2012 Data. DOT HS 811 870. https://crashstats.nhtsa.dot.gov Impaired by alcohol defined as blood alcohol concentration 0.08 or above.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2018 Jan 18, Brad Rodu commented:

      Using youth data from Waves 1 and 2 of the Population Assessment of Tobacco and Health (PATH) survey, Watkins et al. reported that “[a]ny use of e-cigarettes, hookah, noncigarette combustible tobacco, or smokeless tobacco was independently associated with cigarette smoking 1 year later. Use of more than 1 product [polyuse] increased the odds of progressing to cigarette use.”

      Watkins et al. focused almost exclusively on odds ratios, which is problematic because the size of the referent group of never tobacco users at Wave 1 (n= 9,058) is 36 to 97 times the size of the other tobacco use groups. This obscures the relative contributions of the groups to the outcomes, but they can be estimated using baseline numbers and adjusted odds ratios (Model 4) from eTable 10:

      219 = 9058x + 255(2.12x) + 189(2.15x) + 114(3.08x) + 93(1.53x)

      Of the 219 subjects reporting cigarette use in the past 30 days at follow-up, the numbers (percent) from each mutually exclusive tobacco-use group at baseline are: 175 never users (79.9%), 11 e-cigarette-only users (5.0%), 8 hookah-only users (3.7%), 7 other combustibles-only users (3.2%), 3 smokeless-only users (1.4%), and 15 polyusers (6.8%). These numbers are derived from the adjusted odds ratios and may vary slightly from the actual survey numbers, but the relative contributions of the groups will not change.

      While teens who try one tobacco product are more likely to try another, the dominant gateway to cigarettes in the PATH youth survey was from no previous tobacco use.

      Disclosure: BR is supported by unrestricted grants from tobacco manufacturers to the University of Louisville and by the Kentucky Research Challenge Trust Fund.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 08, Massimiliano Tognolini commented:

      Compound 1 (2,5-dimethylpyrrolyl benzoic acid) has been used as an Eph/ephrin inhibitor to assess the role of Eph/ephrin system virus entry. Unfortunately, compound 1 is PAINS (Pan Assay INterference substance) giving positive results in a large number of biological assays (Baell JB, 2010). The compound is highly reactive and spontaneously forms a mixture of non-specifically reactive polymers (Zhu W, 2013). Discoverer of Compound 1 themselves retracted their observation by publishing: "...the newly synthesized compound 1 did not show detectable inhibition of ephrin-A5 binding to EphA4-Fc in ELISAs or EphA2 phosphorylation in cells stimulated with ephrin-A1 Fc. ...when left exposed to air at room temperature in dry form, compound 1 acquired a progressively darker brown color. Concomitantly, the compound became progressively more active in ELISAs measuring inhibition of ephrin-A5-EphA4 binding.” (Noberini R, 2011). Scientists were advised about the use of compound 1 by the writer and colleagues in 2014 (Tognolini M, ACS chem neuroscience and Lodola A, JVI). In conclusion compound 1 IS NOT a RELIABLE EPH/EPHRIN ANTAGONIST.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 03, Rajat Rohatgi commented:

      Hi Pete, You are absolutely correct-- Atthog is a tetraspan protein, but does not belong to the tetraspanin family. Atthog is related to the claudin-like group of tetraspan proteins, but the term "tetraspanin" is specific to a different family. Thank you for bringing this error in nomenclature to our attention so promptly. We apologize for any confusion this may have caused. A correction is forthcoming.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2018 Jan 02, Pete Monk commented:

      Atthog is not a tetraspanin protein. Tetraspanins (TSPAN) are a specific gene family (https://www.genenames.org/cgi-bin/genefamilies/set/768). Atthog is unrelated to the TSPAN family but has 4 putative transmembrane domains; such proteins are known generically as tetraspans.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 21, Peter Rogan commented:

      The results reported in Table S1 of the different bioinformatic methods were difficult for us to assess. For example, why were there no bioinformatic analyses for c.426+415_4780dup(insGATCGCAGTGA)? Our analysis includes this mutation. Model cutoffs for these bioinformatic methods are defined arbitrarily because they are based on underlying datasets with unpublished or unknown content; furthermore, the binding site models are not easily reproduced, in part because they are not actually based on binding site affinities (Rogan PK, 2013).

      The details of the methods and source data we use to derive our information weight matrices and the matrices themselves are available (Rogan PK, 2003). The information contents of splice recognition sites or exons are expressed in units of bits, which have been formally proven to be related to binding site affinity through the second law of thermodynamics (Schneider TD, 1997, Rogan PK, 1998). In fact, relative entropy used by maxEntscan, violates the triangle inequality which is a fundamental requirement of the second law (Schneider TD, 1999). These articles demonstrate the cutoff for true binding sites is very close to the theoretical minimum of zero bits (Delta G = 0). We have also demonstrated this thermodynamic threshold holds for other types of binding sites (Lu R, 2017).

      Our pipeline for NGS data analysis has been validated extensively (Shirley BC, 2013, Viner C, 2014, Dorman SN, 2014, Caminsky NG, 2016, Mucaki EJ, 2016, Yang XR, 2017, Dos Santos ES, 2017). The URL of the MutationForecaster pipeline is given in the document linked to our previous PubMed Commons post .


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2018 Jan 17, Kathleen B M Claes commented:

      Dear dr Rogan, thank you very much for your constructive comments. It is very interesting to learn that your exon definition-based mRNA splicing analyses are in agreement with our cDNA analyses for all variants we studied (an overview is provided in Suppl Table S1 of our paper - not S3). I read the detailed comments on the URL you referred to. How easy can this approach be implemented in an NGS data analysis pipeline? Can you define cut-offs in this program to indicate when cDNA analysis is warranted?

      I also would like to thank you for alerting us about the typing error for the Multi-exon duplication in BRCA2 - the correct nomenclature for this duplication is indeed c.426+415_4780dup{insGATCGCAGTGA}. We corrected this in the final proofs.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    3. On 2018 Jan 12, Peter Rogan commented:

      Twenty one BRCA1 and BRCA2 mRNA splice site variants were analyzed by semi-quantitative RT-PCR, with commercial software that scores putative splice sites by ad hoc methods, and with bioinformatic models based on Adaboost and Random Forest, which are general machine learning approaches. The authors cited our review on interpretation of splicing mutations (Caminsky N, 2014), however the analytic approach described in that paper was not evaluated. As an update to our previous BRCA mutation study (Mucaki EJ, 2011), we carried out information theory-based splicing analysis of all potential splicing mutations listed in Supplemental Table S3. The splicing consequences of all variants were accurately predicted by information analysis. We also report results of exon definition-based mRNA splicing mutation analysis (Mucaki EJ, 2013), which infers relative abundance of wild type and mutated splice isoforms from total splicing information content of each prospective exon. Due to length limitations in PubMed Commons commenting system, detailed results for each variant are described in: https://doi.org/10.5281/zenodo.1146708

      Also, during our analysis, some inconsistencies in mutation designation or interpretation were noted in the paper: (1) The complex BRCA2 duplication described in this article (c.425+415_4780dup[insGATCGCAGTGA]) is sometimes referred to as "c.426-415_4780dup[insGATCGCAGTGA]" (e.g. the title of Figure 5, and Suppl. Table S3), which are not congruent mutations. The true mutation is likely the former, as the Figure 5 legend describes an mRNA splice form that includes 293nt of intron 4. If the duplication was c.426-415_4780dup[insGATCGCAGTGA], the intron inclusion would only be 205nt long. (2) We report an additional inconsistency in regards to Figure 5: The legend of Figure 5E describes a splice form where a truncated exon 11 junctions with the aforementioned 11nt insertion. However, the diagram and the electropherogram in Figure 5e shows exon 11 (ending at c.2398) sharing a junction with the beginning of exon 5. The latter is most likely the correct isoform, as an acceptor is not predicted at the junction between c.4780 and the 11nt insertion.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 29, John-Olov Jansson commented:

      Response to Klaus: We thank Dr Klaus for her useful comment regarding possible sex differences in the response to increased loading. We have consistently found the effect of increased loading to be similar in female and male mice on high fat diet. However, we have not evaluated possible sex differences in the response to increased loading in non-obese rodents given standard diet. One possible explanation for previous inconsistent results could be that the effect of loading in these studies was not evaluated in obese mice on high fat diet, an often used model for clinical obesity.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2018 Jan 23, Susanne Klaus commented:

      I would like to comment on two points. (i) I feel that the discussion would have profited from comparing this study to previous studies using the same experimental approach, i.e. weight implantation to investigate the role of weight per se in body weight regulation (1-3). (ii) Since our previous study using the same experimental approach showed considerable sex differences in the reaction of mice to an implanted weight load it is unfortunate that in all except one experiment the sex of the animals used was not indicated and the question of possible sex differences not even mentioned. This makes it very hard to relate the presented data to previous investigations regarding the existence of a ponderostat (here termed “gravitostat”). In our study published in 2004 (1) we implanted weight loads both into male and female FVB mice resulting in drastical sex difference in long term body weight regulation observed over a period of 14 weeks. While male mice showed a partial long term compensatory decrease in body weight due to decrease of fat mass in response to an increased weight load, female mice regained biological body mass within 3 to 4 weeks after the initial weight loss due to surgery. Furthermore, contrary to males, female mice did not reduce food intake and body fat in response to an implanted weight load in the long term. These gender-specific differences in body mass regulation point to different strategies in males and females to cope with a situation affecting body mass and energy demands suggesting a higher efficiency of energy conservation in female compared to male mice.

      1. Wiedmer P, Boschmann M, & Klaus S (2004) Gender dimorphism of body mass perception and regulation in mice. J Exp Biol 207(Pt 16):2859-2866.
      2. Adams CS, Korytko AI, & Blank JL (2001) A novel mechanism of body mass regulation. J Exp Biol 204(Pt 10):1729-1734.
      3. Wiedmer P, Boschmann M, & Klaus S (2002) Weight per se influences body mass regulation differently in male and female mice. J Gravit Physiol 9(1):P189-190.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 13, Raphael Stricker commented:

      An Outdated View of Lyme Neuroborreliosis

      Raphael B. Stricker, MD. Union Square Medical Associates, San Francisco, CA, USA. rstricker@usmamed.com

      The article by Halperin entitled "Diagnosis and Management of Lyme Neuroborreliosis" attempts to address "widespread misconceptions" about the clinical phenomenology, diagnostic approach and response to treatment of neuroborreliosis. Unfortunately the article promotes these misconceptions by ignoring progress in Lyme disease research over the past 20 years. In fact, with the exception of some cosmetic details such as mention of CxCL13, a nonspecific marker of neuroborreliosis, and C6 peptide testing, a relatively insensitive test for Lyme disease, this article could have been written in 1997. It is equally inaccurate and simplistic now, as described below.

      The article uses an interesting approach to promote "Lyme denialism", the view that Lyme disease is a trivial illness that is easily diagnosed and treated as opposed to the worldwide epidemic of an often debilitating disease that affects more than 300,000 new cases annually in the USA alone (1). The discussion points to extensive uncertainties about various aspects of the neurological disease, and then concludes that, despite these worrisome unanswered questions, diagnosis and treatment of neuroborreliosis is relatively simple. There is no discussion of Borrelia cystic forms, biofilms or persister cells that complicate diagnosis and treatment. Relapsing fever Borrelia (RFB) and RFB-like strains such as B. miyamotoi and B. mayonii are brushed aside because "very few human infections" with these organisms have been identified, mainly because routine clinical testing for these Borrelia species does not exist. There is no mention of SPECT brain scans that may be useful in diagnosis of brain inflammation in neuroborreliosis patients (2), and tickborne coinfections such as Babesia microti, Babesia duncani, Anaplasma, Ehrlichia, Bartonella and Rickettsia that may cause significant neurological complications are completely ignored. Thus the article inhabits a simplistic world that was already obsolete 20 years ago.

      A good example of the misinformation contained in this document is the statement that the erythema migrans (EM) "bullseye" rash is found in "90% of infected children" with Lyme disease. This exaggerated EM prevalence is based on a study that defines Lyme disease according to CDC surveillance criteria, which rely heavily on the EM rash for diagnosis. Thus due to this circular reasoning, patients with an EM rash were significantly over-represented in the study. A more realistic contemporary clinical study of neuroborreliosis in children put the rate of EM rash at 27% (3). This more realistic EM prevalence indicates that diagnosis may not be that simple in children with neuroborreliosis.

      The article restates the myth that two-tier Lyme testing has "high sensitivity and specificity" for diagnosis. This statement ignores evidence for the dismal sensitivity of CDC-sanctioned two-tier testing (4,5). For patients with neuroborreliosis, the allegedly high test sensitivity is based on circular reasoning: to be included in this category, patients were required to have positive Lyme testing, and then they had positive Lyme testing! This type of faulty reasoning is presented uncritically throughout the article.

      The article relies heavily on information from the review by Steere et al. (6), which has an extensive critique in PubMed Commons. Many of those criticisms apply to this article as well.

      References

      (1) Stricker & Johnson, PLoS Pathog 10(1): e1003796.

      (2) Donta et al, Clin Nucl Med. 2012;37:e219.

      (3) Bingham et al, Pediatrics. 1995;96:1053.

      (4) Stricker et al, Expert Rev Anti Infect Ther. 2005;3:155.

      (5) Cook & Puri, Int J Gen Med. 2017;10:113.

      (6) Steere et al, Nature Rev Dis Primers. 2016;2:16090.

      Disclosure: RBS is a member of the International Lyme and Associated Diseases Society (ILADS) and a director of LymeDisease.org. He has no financial or other conflicts to declare.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 06, Ivan Buljan commented:

      Dear Hilda,

      Thank you for your comments. You have made several excellent observations and we are glad to clarify those issues.

      As it was addressed in the limitations, high dropout rate was present in trials with consumers and physicians, while there was none in student trials. Unlike the student’s trial, where we tested the efficacy of the formats, our intention was to test their effectiveness (the real world application). We believe that our results are representative because in the real world there will be a significant amount of patients and physicians who would not want to read the CSR. It is true that in the student trial there was no difference in reading experience between PLS and infographics, but although there was significant difference between infographic and PLS in consumer and physician trials, it has to be admitted (as we did in the article) that the difference was very small (only couple of points on reading experience scale, which poses the question whether that is a “clinical significance”).

      There were differences between infographics and PLS concerning the number of numerical expressions, but it cannot be claimed that that was the only reason for the dropout from the trials. Participants may have refused to participate in the trials even before reading the text, or before giving the answers about the summary. Also, even with different number of numerical expressions, numeracy was the predictor of results for all formats, meaning that participant with higher numeracy levels were better in understanding the results in a summary format even when fewer numerical expressions were used.

      Although there were differences in the formats with regard to the presentation of quality of the evidence between infographic and PLS. We accounted for that when scoring the results. In the scoring of the answers, we scored the answer as correct if the answer described the studies with terms like “low quality of evidence”, “the quality of studies differed greatly”, “the strength of the evidence from the studies differed”, “the studies were too small”, whereas the incorrect answers would be such as “the quality of evidence was very good”, “there was no differences in quality of studies” or “all studies produced equal strength of the evidence”. The result was that there was no difference between formats in number of correct answers on that question in any of the three trials.

      As for the metaanalysis, we had all individual level data from the three trials, so it was not necessary to use metaanalysis to estimate the effect. We presented the pooled results from all three trials.

      The ways of presentation of evidence to public using infographic are still not well explored. We do not know whether the symbols used in this research were appropriate to consumers for the purposes they are intended to. To explore that, we would need to ask participant their opinion about the symbols used in the infographic, which would require a qualitative approach, which is underway.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    2. On 2018 Jan 01, Hilda Bastian commented:

      It is great to see randomized trials to test the effects of an infographic. However, I have concerns with the interpretation of the results of this set of 3 trials. The abstract states that these were randomized trials of 171 students, 99 consumers, and 64 doctors. However, those are the numbers of people who completed the knowledge and reading experience questions, not the number randomized: 171 students, 212 consumers, and 108 doctors were randomized. The extremely high dropout rate (e.g. 53% for consumers) leaves only the trial in students as a reliable base for conclusions. And for them, there was no difference in knowledge or reported reading experience - they did not prefer the infographic.

      The authors point out that the high dropout rate may have affected the results for consumers and doctors, especially as they faced a numeracy test after being given the infographic or summary to read. That must have skewed the results. In particular, since the infographic (here) has such different content to the plain language summary (here), this seems inevitably related to the issue of numeracy: the plain language summary is almost number-free, while the infographic is number-heavy (an additional 16 numerical expressions).

      The knowledge test comprised 10 questions, one of which related to the quality of the evidence included in the systematic review. The infographic and plain language summary contained very different information on this. The article's appendix suggests that the correct answer expected was included in the infographic but not in the plain language summary. It would be helpful to know whether this affected the knowledge scores for readers of the plain language summary.

      Cohen's d effect sizes are not reported for the 3 trials separately, and given the heterogeneity in those results, it is not accurate to use the combined result to conclude that all 3 participant groups preferred the infographic and reading it. (In addition, the method for the meta-analysis of effect sizes of the 3 trials is not reported.)

      The specific summary and infographic, although high quality, also point to some of the underlying challenges in communicating with these media to consumers. For example, the infographic uses a coffin as pictograph for mortality, which I don't believe is appropriate in patient information. This highlights the risks inherent in using graphic elements where there aren't well-established conventions. Both the infographic and the plain language summary focus on information about the baby's wellbeing and the birth - but not the impact of the intervention on the pregnant woman, or their views of it. Whatever the format, issues remain with the process of determining the content of research summaries for consumers. (I have written more about the evidence on infographics and this study here.)

      Disclosure: The Cochrane (text) plain language summaries were an initiative of mine in the early days of the Cochrane Collaboration, when I was a consumer advocate. Although I wrote or edited most of those early Cochrane summaries, I had no involvement with the one studied here.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.