5,296 Matching Annotations
  1. Last 7 days
    1. make

      The bare make command does nothing.

      On Ubuntu 18.04, yarn install tells me:

      error puppeteer@3.2.0: The engine "node" is incompatible with this module. Expected version ">=10.18.1". Got "10.15.3"

      A workaround for upgrading node appears to be:

      yarn install --ignore-engines

  2. Apr 2020
    1. examples

      Text of the test annotation.

    2. <table> <thead><tr> <th>Tables</th> <th style="text-align:center">Are</th> <th style="text-align:right">Cool</th> </tr> </thead> <tbody> <tr> <td>col 3 is</td> <td style="text-align:center">right-aligned</td> <td style="text-align:right">$1600</td> </tr> <tr> <td>col 2 is</td> <td style="text-align:center">centered</td> <td style="text-align:right">$12</td> </tr> <tr> <td>zebra stripes</td> <td style="text-align:center"><del>are neat</del></td> <td style="text-align:right">$1</td> </tr> </tbody> </table>
  3. Mar 2020
    1. SciScore for 10.1101/782409: 4 (What is this?)

      Table 1: Rigor

      <table><tr"><td style="margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="border-bottom:1px solid lightgray">The experimental protocol was reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) at Loyola University Chicago (IACUC#: 2016-029).</td></tr><tr"><td style="margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="border-bottom:1px solid lightgray">C57BL/6 female mice were purchased from The Jackson Laboratory and maintained in the Comparative Medicine Facility of Loyola University Chicago.</td></tr><tr"><td style="margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><td style="text-align:center; padding-top:4px;" colspan="2">Antibodies</td></tr><tr><td style="text=align:center">Sentences</td><td style="text-align:center">Resources</td></tr><tr><td style="vertical-align:top;border-bottom:1px solid lightgray">The membrane was incubated with either polyclonal rabbit anti-GFP antibody ( A11122 , Life Technologies ) for the protease assay , or mouse anti-flag ( F3165 , Sigma ) for the DUB assay .</td><td style="border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>anti-GFP</div> <div>suggested: (Molecular Probes Cat# A-11122, AB_221569)</div> </div> <div style="margin-bottom:8px"> <div>anti-flag ( F3165</div> <div>suggested: None</div> </div> </td></tr><tr><td style="vertical-align:top;border-bottom:1px solid lightgray">The membrane was then washed three times for 15 minutes in TBST buffer followed by incubation with either secondary donkey anti-rabbit-HRP antibody ( 711-035-152 , Jackson ImmunoResearch ) or goat anti-mouse-HRP antibody ( 1010-05 , SouthernBiotech) .</td><td style="border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>anti-rabbit-HRP</div> <div>suggested: (Kindle Biosciences Cat# R1006, AB_2800464)</div> </div> <div style="margin-bottom:8px"> <div>anti-mouse-HRP</div> <div>suggested: (Kindle Biosciences Cat# R1005, AB_2800463)</div> </div> </td></tr><tr><td style="vertical-align:top;border-bottom:1px solid lightgray">The expression of PLP2 , β-actin , and calnexin were probed with mouse anti-V5 antibody ( R960 , ThermoFisher) , mouse anti–β-actin ( A00702 , Genscript) , or mouse anti-calnexin antibody ( 2433S , Cell Signaling) , respectively .</td><td style="border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>PLP2</div> <div>suggested: None</div> </div> <div style="margin-bottom:8px"> <div>β-actin</div> <div>suggested: None</div> </div> <div style="margin-bottom:8px"> <div>anti-V5</div> <div>suggested: (Thermo Fisher Scientific Cat# R960-25, AB_2556564)</div> </div> <div style="margin-bottom:8px"> <div>mouse anti-calnexin antibody</div> <div>suggested: None</div> </div> <div style="margin-bottom:8px"> <div>anti-calnexin</div> <div>suggested: (Cell Signaling Technology Cat# 2433, AB_2243887)</div> </div> </td></tr><tr><td style="text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</td></tr><tr><td style="text=align:center">Sentences</td><td style="text-align:center">Resources</td></tr><tr><td style="vertical-align:top;border-bottom:1px solid lightgray">Cells Human embryonic kidney ( HEK ) 293T cells were purchased the from American Type Culture Collection ( ATCC , # CRL-11268 ) and maintained in DMEM ( #10-017-CV , Corning ) containing 10 % fetal calf serum ( FCS ) and supplemented with 1 % nonessential amino acids , 1 % HEPES , 2 % L-glutamine , 1 % sodium pyruvate , and 1 % penicillin/streptomycin .</td><td style="border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>HEK</div> <div>suggested: None</div> </div> <div style="margin-bottom:8px"> <div>293T</div> <div>suggested: ATCC Cat# CRL-11268, CVCL_1926</div> </div> </td></tr><tr><td style="vertical-align:top;border-bottom:1px solid lightgray">Protease and deubiquitinating activity assays To determine the protease activity of PLP2 , HEK293T cells grown to 70 % confluency in 24-well plates ( Corning ) were transfected using TransIT-LT1 ( MIR2300 , Mirus ) according to the manufacturer’s protocol .</td><td style="border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>HEK293T</div> <div>suggested: None</div> </div> </td></tr><tr><td style="text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</td></tr><tr><td style="text=align:center">Sentences</td><td style="text-align:center">Resources</td></tr><tr><td style="vertical-align:top;border-bottom:1px solid lightgray">C57BL/6 female mice were purchased from The Jackson Laboratory and maintained in the Comparative Medicine Facility of Loyola University Chicago.</td><td style="border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>C57BL/6</div> <div>suggested: None</div> </div> </td></tr><tr><td style="text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</td></tr><tr><td style="text=align:center">Sentences</td><td style="text-align:center">Resources</td></tr><tr><td style="vertical-align:top;border-bottom:1px solid lightgray">Graphs of virus kinetics were generated using Prism software ( GraphPad Software ) .</td><td style="border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>Prism</div> <div>suggested: (PRISM, SCR_005375)</div> </div> <div style="margin-bottom:8px"> <div>GraphPad</div> <div>suggested: (GraphPad Prism, SCR_002798)</div> </div> </td></tr></table>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore is not a substitute for expert review. SciScore checks for the presence and correctness of RRIDs (research resource identifiers) in the manuscript, and detects sentences that appear to be missing RRIDs. SciScore also checks to make sure that rigor criteria are addressed by authors. It does this by detecting sentences that discuss criteria such as blinding or power analysis. SciScore does not guarantee that the rigor criteria that it detects are appropriate for the particular study. Instead it assists authors, editors, and reviewers by drawing attention to sections of the manuscript that contain or should contain various rigor criteria and key resources. For details on the results shown here, please follow this link.

    1. <html xmlns:v="urn:schemas-microsoft-com:vml" xmlns:o="urn:schemas-microsoft-com:office:office" xmlns:w="urn:schemas-microsoft-com:office:word" xmlns:m="http://schemas.microsoft.com/office/2004/12/omml" xmlns="http://www.w3.org/TR/REC-html40">

      <head> <meta http-equiv=Content-Type content="text/html; charset=windows-1252"> <meta name=ProgId content=Word.Document> <meta name=Generator content="Microsoft Word 15"> <meta name=Originator content="Microsoft Word 15"> <link rel=File-List href="covid_files/filelist.xml"> <link rel=themeData href="covid_files/themedata.thmx"> <link rel=colorSchemeMapping href="covid_files/colorschememapping.xml"> <style> </style> </head><body lang=EN-US style='tab-interval:.5in'> <div class=WordSection1>

      <span class=SpellE><span style='font-size:14.0pt;mso-bidi-font-size:11.0pt;line-height:108%'>SciScore</span></span><span style='font-size:14.0pt;mso-bidi-font-size:11.0pt;line-height:108%'>: 6 </span><span style='color:blue'>What's this?</span>

      Document Identifier: 3879

      Below you will find two tables showing the results of <span class=SpellE>SciScore</span>. Your score is calculated based on adherence to guidelines for scientific rigor (Table 1) and identification of key biological resources (Table 2). Points are given when <span class=SpellE>SciScore</span> detects appropriate information in the text. Details on each criteria and recommendations on how to improve the score are appended to the bottom of this report.

      Table 1: Rigor Adherence Table

      <table class=TableGrid border=0 cellspacing=0 cellpadding=0 width=661 style='width:496.05pt;border-collapse:collapse;mso-yfti-tbllook:1184; mso-padding-alt:0in 4.75pt 0in 6.15pt'> <tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes;height:26.75pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;mso-border-top-alt: 1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt; height:26.75pt'>

      <u style='text-underline:black'>Institutional Review Board Statement</u>

      </td> </tr> <tr style='mso-yfti-irow:1;height:38.75pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:38.75pt'>

      <span style='font-size:11.0pt;line-height:107%'>IRB: Ethics approval was obtained from the Ethics Committee of Guangzhou Women and Children’s Medical Center and written informed consents were obtained from the parents of the included children.</span>

      </td> </tr> <tr style='mso-yfti-irow:2;height:38.75pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:38.75pt'>

      <span style='font-size:11.0pt;line-height:107%'>Consent: Ethics approval was obtained from the Ethics Committee of Guangzhou Women and Children’s Medical Center and written informed consents were obtained from the parents of the included children.</span>

      </td> </tr> <tr style='mso-yfti-irow:3;height:26.75pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:26.75pt'>

      <u style='text-underline:black'>Randomization</u>

      </td> </tr> <tr style='mso-yfti-irow:4;height:25.55pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:25.55pt'>

      <span style='font-size:11.0pt;line-height:107%'>not detected.</span>

      </td> </tr> <tr style='mso-yfti-irow:5;height:26.75pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:26.75pt'>

      <u style='text-underline:black'>Blinding</u>

      </td> </tr> <tr style='mso-yfti-irow:6;height:25.55pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:25.55pt'>

      <span style='font-size:11.0pt;line-height:107%'>not detected.</span>

      </td> </tr> <tr style='mso-yfti-irow:7;height:26.75pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:26.75pt'>

      <u style='text-underline:black'>Power Analysis</u>

      </td> </tr> <tr style='mso-yfti-irow:8;height:25.55pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:25.55pt'>

      <span style='font-size:11.0pt;line-height:107%'>not detected.</span>

      </td> </tr> <tr style='mso-yfti-irow:9;height:26.75pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:26.75pt'>

      <u style='text-underline:black'>Sex as a biological variable</u>

      </td> </tr> <tr style='mso-yfti-irow:10;mso-yfti-lastrow:yes;height:25.55pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:25.55pt'>

      <span style='font-size:11.0pt;line-height:107%'>not detected.</span>

      </td> </tr> </table>

      Table 2: Key Resources Table

      <table class=TableGrid border=0 cellspacing=0 cellpadding=0 width=661 style='width:496.05pt;border-collapse:collapse;mso-yfti-tbllook:1184; mso-padding-alt:2.15pt 5.75pt 2.15pt .5pt'> <tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes;height:29.8pt'> <td width=227 valign=top style='width:170.1pt;border:solid black 1.0pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 5.75pt 2.15pt .5pt;height:29.8pt'>

      Your Sentences

      </td> <td width=113 valign=top style='width:85.05pt;border:solid black 1.0pt; border-left:none;mso-border-left-alt:solid black .25pt;mso-border-top-alt: 1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 5.75pt 2.15pt .5pt; height:29.8pt'>

      REAGENT or

      RESOURCE

      </td> <td width=94 valign=top style='width:70.85pt;border:solid black 1.0pt; border-left:none;mso-border-left-alt:solid black .25pt;mso-border-top-alt: 1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 5.75pt 2.15pt .5pt; height:29.8pt'>

      SOURCE

      </td> <td width=227 valign=top style='width:170.1pt;border:solid black 1.0pt; border-left:none;mso-border-left-alt:solid black .25pt;mso-border-top-alt: 1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 5.75pt 2.15pt .5pt; height:29.8pt'>

      IDENTIFIER

      </td> </tr> <tr style='mso-yfti-irow:1;height:26.75pt'> <td width=227 valign=top style='width:170.1pt;border-top:none;border-left: solid black 1.0pt;border-bottom:solid black 1.0pt;border-right:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:solid black 1.0pt; mso-border-left-alt:solid black .25pt;mso-border-bottom-alt:solid black 1.0pt; padding:2.15pt 5.75pt 2.15pt .5pt;height:26.75pt'>

      <o:p> </o:p>

      </td> <td width=208 colspan=2 style='width:155.9pt;border:none;border-bottom:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;padding:2.15pt 5.75pt 2.15pt .5pt; height:26.75pt'>

      <u style='text-underline:black'>Software and Algorithms</u>

      </td> <td width=227 valign=top style='width:170.1pt;border-top:none;border-left: none;border-bottom:solid black 1.0pt;border-right:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:solid black 1.0pt; mso-border-bottom-alt:solid black 1.0pt;mso-border-right-alt:solid black .25pt; padding:2.15pt 5.75pt 2.15pt .5pt;height:26.75pt'>

      <o:p> </o:p>

      </td> </tr> <tr style='mso-yfti-irow:2;mso-yfti-lastrow:yes;height:53.8pt'> <td width=227 valign=top style='width:170.1pt;border:solid black 1.0pt; border-top:none;mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt; mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 5.75pt 2.15pt .5pt; height:53.8pt'>

      <span style='font-size:11.0pt;line-height:107%'>Microsoft Excel <span class=GramE>( MS</span> Excel 2013 ,</span>

      <span class=GramE><span style='font-size:11.0pt;line-height: 107%'>v.15.0 )</span></span><span style='font-size:11.0pt;line-height:107%'> was used for data collection of the epidemiological and clinical information .</span>

      </td> <td width=113 valign=bottom style='width:85.05pt;border-top:none;border-left: none;border-bottom:solid black 1.0pt;border-right:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;mso-border-left-alt:solid black .25pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 5.75pt 2.15pt .5pt;height:53.8pt'>

      <span style='font-size:11.0pt;line-height:107%'>Microsoft Excel</span>

      </td> <td width=94 valign=top style='width:70.85pt;border-top:none;border-left: none;border-bottom:solid black 1.0pt;border-right:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;mso-border-left-alt:solid black .25pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 5.75pt 2.15pt .5pt;height:53.8pt'>

      <o:p> </o:p>

      </td> <td width=227 valign=bottom style='width:170.1pt;border-top:none;border-left: none;border-bottom:solid black 1.0pt;border-right:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;mso-border-left-alt:solid black .25pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 5.75pt 2.15pt .5pt;height:53.8pt'>

      <span style='font-size:11.0pt;line-height:107%;color:gray'>Suggestion: (Microsoft Excel,</span>

      <span style='font-size:11.0pt;line-height:107%;color:gray'>RRID:SCR_016137)</span><span style='font-size:11.0pt;line-height:107%;color:black;text-decoration:none; text-underline:none'>(</span><span style='font-size:11.0pt;line-height:107%;color:blue'> link</span><span style='font-size:11.0pt;line-height:107%'>)</span>

      </td> </tr> </table> <span style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:105%; font-family:"Times New Roman",serif;mso-fareast-font-family:"Times New Roman"; color:black;mso-ansi-language:EN-US;mso-fareast-language:EN-US;mso-bidi-language: AR-SA'><br clear=all style='mso-special-character:line-break;page-break-before: always'> </span>

      <o:p> </o:p>

      Other Entities Detected

      <table class=TableGrid border=0 cellspacing=0 cellpadding=0 width=661 style='width:496.05pt;border-collapse:collapse;mso-yfti-tbllook:1184; mso-padding-alt:2.15pt 2.7pt 2.15pt .5pt'> <tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes;height:15.4pt'> <td width=265 valign=top style='width:198.45pt;border:solid black 1.0pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 2.7pt 2.15pt .5pt;height:15.4pt'>

      Your Sentences

      </td> <td width=397 valign=top style='width:297.65pt;border:solid black 1.0pt; border-left:none;mso-border-left-alt:solid black .25pt;mso-border-top-alt: 1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 2.7pt 2.15pt .5pt; height:15.4pt'>

      Recognized Entity

      </td> </tr> <tr style='mso-yfti-irow:1;height:15.4pt'> <td width=661 colspan=2 valign=top style='width:496.05pt;border:solid black 1.0pt; border-top:none;mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt; mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 2.7pt 2.15pt .5pt; height:15.4pt'>

      Oligonucleotides

      </td> </tr> <tr style='mso-yfti-irow:2;height:40.6pt'> <td width=265 valign=top style='width:198.45pt;border:solid black 1.0pt; border-top:none;mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt; mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 2.7pt 2.15pt .5pt; height:40.6pt'>

      <span style='font-size:11.0pt;line-height:107%'>Forward primer</span>

      <span style='font-size:11.0pt;line-height:107%'>CCCTGTGGGTTTTACACTTAA; Reverse primer ACGATTGTGCATCAGCTGA;</span>

      </td> <td width=397 valign=bottom style='width:297.65pt;border-top:none;border-left: none;border-bottom:solid black 1.0pt;border-right:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;mso-border-left-alt:solid black .25pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 2.7pt 2.15pt .5pt;height:40.6pt'>

      <span style='font-size:11.0pt;line-height:107%'>CCCTGTGGGTTTTACACTTAA</span>

      </td> </tr> <tr style='mso-yfti-irow:3;height:40.6pt'> <td width=265 valign=top style='width:198.45pt;border:solid black 1.0pt; border-top:none;mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt; mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 2.7pt 2.15pt .5pt; height:40.6pt'>

      <span style='font-size:11.0pt;line-height:107%'>The probe 5#-VIC-</span>

      <span style='font-size:11.0pt;line-height:107%'>CCGTCTGCGGTATGTGG</span>

      <span style='font-size:11.0pt;line-height:107%'>AAAGGTTATGG-BHQ1-3# Target 2 <span class=GramE>( N</span>):</span>

      </td> <td width=397 valign=bottom style='width:297.65pt;border-top:none;border-left: none;border-bottom:solid black 1.0pt;border-right:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;mso-border-left-alt:solid black .25pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 2.7pt 2.15pt .5pt;height:40.6pt'>

      <span style='font-size:11.0pt;line-height:107%'>5#-VIC-CCGTCTGCGGTATGTGG AAAGGTTATGG-</span>

      <span style='font-size:11.0pt;line-height:107%'>BHQ1-3#</span>

      </td> </tr> <tr style='mso-yfti-irow:4;height:53.8pt'> <td width=265 valign=top style='width:198.45pt;border:solid black 1.0pt; border-top:none;mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt; mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 2.7pt 2.15pt .5pt; height:53.8pt'>

      <span style='font-size:11.0pt;line-height:107%'>Forward primer</span>

      <span class=GramE><span style='font-size:11.0pt;line-height: 107%'>GGGGAACTTCTCCTGCTAGAAT;</span></span>

      <span style='font-size:11.0pt;line-height:107%'>Reverse primer</span>

      <span style='font-size:11.0pt;line-height:107%'>CAGACATTTTGCTCTCAAGCTG;</span>

      </td> <td width=397 valign=bottom style='width:297.65pt;border-top:none;border-left: none;border-bottom:solid black 1.0pt;border-right:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;mso-border-left-alt:solid black .25pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 2.7pt 2.15pt .5pt;height:53.8pt'>

      <span style='font-size:11.0pt;line-height:107%'>GGGGAACTTCTCCTGCTAGAAT</span>

      </td> </tr> <tr style='mso-yfti-irow:5;mso-yfti-lastrow:yes;height:40.6pt'> <td width=265 valign=top style='width:198.45pt;border:solid black 1.0pt; border-top:none;mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt; mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 2.7pt 2.15pt .5pt; height:40.6pt'>

      <span style='font-size:11.0pt;line-height:107%'>The probe 5#-FAM-</span>

      <span style='font-size:11.0pt;line-height:107%'>TTGCTGCTGCTTGACAGATT-TAM</span>

      <span style='font-size:11.0pt;line-height:107%'>RA-3<span class=GramE># .</span></span>

      </td> <td width=397 valign=bottom style='width:297.65pt;border-top:none;border-left: none;border-bottom:solid black 1.0pt;border-right:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;mso-border-left-alt:solid black .25pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 2.7pt 2.15pt .5pt;height:40.6pt'>

      <span style='font-size:11.0pt;line-height:107%'>5#-FAM- TTGCTGCTGCTTGACAGATT-TAM RA-3#</span>

      </td> </tr> </table>

      <span class=SpellE>SciScore</span> is an <u style='text-underline:black'>automated tool</u> that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. <span class=SpellE>SciScore</span> is not a substitute for expert review. <span class=SpellE>SciScore</span> checks for the presence and correctness of RRIDs (research resource identifiers) in the <span class=GramE>manuscript, and</span> detects sentences that appear to be missing RRIDs. <span class=SpellE>SciScore</span> also checks to make sure that rigor criteria are addressed by authors. It does this by detecting sentences that discuss criteria such as blinding or power analysis. <span class=SpellE>SciScore</span> does not guarantee that the rigor criteria that it detects are appropriate for the <span class=GramE>particular study</span>. Instead it assists authors, editors, and reviewers by drawing attention to sections of the manuscript that contain or should contain various rigor criteria and key resources.

      <u style='text-underline: black'>Rigor Table:</u>

      In the rigor table (table 1 of this report), <span class=SpellE>SciScore</span> highlights sentences that include various elements of rigor as described by <span class=SpellE>Hackam</span> and <span class=SpellE>Redelmeier</span> in <span style='color:blue'>2006</span>, and by van der Warp and colleagues in <span style='color:blue'>2010</span>. <span class=SpellE>SciScore</span> was trained using sentences from thousands of published papers that were tagged by expert curators to indicate that the sentence described blinding (either during the experiment or during data analysis), group selection criteria such as how subjects were randomized, power analysis (statistical test), or sex as a biological variable. If a cell line is detected then <span class=SpellE>SciScore</span> ‘expects’ that cell line authentication criteria are described, a cell line is not detected this section of the table will not be visible or scored. When a criterion is expected, but a sentence that addresses the criterion is not detected by <span class=SpellE>SciScore</span>, the statement “Not Detected” is given. It is possible that a criterion is not necessary for a <span class=GramE>particular manuscript</span> or that <span class=SpellE>SciScore</span>, an automated tool, makes a mistake. If <span class=SpellE>SciScore</span> makes substantial mistakes with your manuscript, please <span style='color: blue'>contact us </span><span style='mso-spacerun:yes'> </span>to help us learn from our mistakes. Please see the <span style='color:blue'>FAQ </span><span style='mso-spacerun:yes'> </span>for more details.

      <u style='text-underline: black'>Scoring for Rigor Table (total 5 points):</u>

      The rigor table makes up 5 points of the total score. Those five points are split evenly among the expected rigor criteria, each criterion being worth five divided by the number of rows in the table points. Scores are rounded to the nearest whole number. For each sentence that describes an expected rigor criterion, such as blinding, <span class=SpellE>SciScore</span> adds the fractional number of points for that criterion, and if it is unable to find a statement on blinding then this section is labeled "Not Detected" and receives a score of 0. To improve detection, please make sure that your language is clear and written in standard English.

      <u style='text-underline: black'>Key Resources Table</u>

      The key resources table (table 2 of this report), contains two types of things that are detected automatically by <span class=SpellE>SciScore</span>:

      <span style='mso-bidi-font-size:12.0pt;line-height:105%'><span style='mso-list:Ignore'>1.<span style='font:7.0pt "Times New Roman"'>  </span></span></span>RRIDs, research resource identifiers

      <span style='mso-bidi-font-size:12.0pt;line-height:105%'><span style='mso-list:Ignore'>2.<span style='font:7.0pt "Times New Roman"'>  </span></span></span>Sentences that “should” have RRIDs

      RRIDs, are unique identifiers for reagents and other resources that largely overlap those resources that have been labeled as particularly problematic by the National Institutes of Health in recent changes to grant review criteria, please see <span style='color:blue'>"key biological resources"</span>, e.g., antibodies, cell lines and transgenic organisms. The RRID initiative is led by community repositories that provide persistent unique identifiers to their resources, such as transgenic mice, salamanders, antibodies, cell lines, plasmids and software projects such as statistical software. RRIDs are described in a primer by Bandrowski and Martone in<span style='color:blue'>2016</span>.

      RRIDs are unique numbers that resolve to a particular database record, for example the <span class=GramE>RRID:CVCL</span>_0063 resolves to this record for a cell line:

      <span style='color:blue'>https://web.expasy.org/cellosaurus/CVCL_0063</span>

      The information in that database is structured and curated by <span class=SpellE>Cellosaurus</span> staff, the authority for cell lines. If authors use this RRID then <span class=SpellE>SciScore</span> will ask the database about the number. Once an RRID is found in the database, <span class=SpellE>SciScore</span> attempts to match text in the sentence with the database record, most often it attempts to find the name of the resource, in this case HEK293T, and information about the company or catalog number to verify that authors have put the right RRID in the sentence. If a typo is made by authors, that renders the RRID not valid, the RRID column will be blank (table 3 will contain the RRID in the unresolved RRID column in red). If an RRID was submitted to the authority by authors, it often takes a week or more to become available in the resolver database, thus exercise caution in the interpretation of the <span class=SpellE>SciScore</span> report in cases of newly minted RRIDs.

      Sentences that should have RRIDs are detected by <span class=SpellE>SciScore</span>, by looking for patterns in a sentence that are <span class=GramE>similar to</span> how cell lines or antibodies are described in published papers. A sentence that describes one or more antibodies may be detected by <span class=SpellE>SciScore</span> and this will be placed into the table without a corresponding RRID. <span class=SpellE>SciScore</span> will attempt to find the name(s) and catalog numbers of the resource. In cases where the tool is relatively confident, it will suggest an RRID. The suggested RRID appears in gray with a link to the RRID website where authors must confirm that the RRID found by <span class=SpellE>SciScore</span> is the correct RRID.

      <u style='text-underline: black'>Note of caution:</u>

      Please verify all RRID suggestions, only the author can know whether suggestions are correct.

      <u style='text-underline: black'>Scoring for Resources Table (total 5 points):</u>

      Each resource that is detected is scored, and the total is 5 points, with scores rounded to the nearest whole number. For each RRID detected, points are awarded, but for each sentence that is detected that does not contain an RRID, points are not awarded. If <span class=SpellE>SciScore</span> detects catalog numbers or relatively unambiguous resources, partial points are awarded. For each RRID that does not resolve properly only partial points are also awarded. Therefore, the way to maximize the points from this section is to add RRIDs, and proper citations that include vendor names, catalog numbers, lot and version numbers into the methods section of the manuscript.

      <u style='text-underline: black'>Incorrect sentences:</u>

      <span class=SpellE>SciScore</span> is a text analysis tool, and it is therefore susceptible to making two types of errors, false positives or false negatives.

      False <span class=SpellE><span class=GramE>negatives:<span style='font-weight:normal'>The</span></span></span> most common error occurs when the algorithm fails to detect a sentence that contains an antibody or another resource. False negatives generally occur either because the sentence is complex or in a less common syntax pattern. Generally simple sentences in clear standard English are simpler to process and result in few false negatives. If a truly complex sentence structure is required to describe reagents, a table may help not only <span class=SpellE>SciScore</span>, but also human readers. If an RRID is detected in a sentence, <span class=SpellE>SciScore</span> will be triggered to <span class=GramE>take a look</span> at the sentence, which may have been skipped otherwise.

      False positives: This type of error includes cases where a sentence does not contain an antibody, but the algorithm asserts that this sentence does have an antibody. If many resources are used and all have RRIDs, a single false positive will not reduce the score substantially. But if only 1-2 resources are used, then a false positive can reduce your <span class=SpellE>SciScore</span> needlessly. False positives are most often seen in the tools portion of table 2, as the algorithm detects company names, where it should not. We try to minimize these false positives using several strategies. If this impacts your score, please contact our team (http:// sciscore.com) and include the sentence where <span class=SpellE>SciScore</span> made the error. While we can't fix the score, we can learn from our mistakes.

      </div> </body>

      </html>

  4. Feb 2020
    1. Chrome extension

      Works with Chrome and other Chromium-based browsers including Brave and Edge.

  5. Jan 2020
    1. In 2013 to 2014, Nature made a significant push with authors to address rigor criteria. We plotted the average SciScore along with its components over this period (Fig 3) and found that the average score rose by nearly 2 points over just a few years.

      This is what progress on reproducibility looks like.

    2. Google Sheets

      RRID? 😂

    3. for

      delete

    1. is the “Prelude in C Major” by J. S. Bach. There is no real tune,
    2. 110Hz) and the note an octave above it, A3 (220Hz).
    3. The same is true, to a lesser extent, for notes a tone apart, so any consecutive notes from a scale will clash if they are played at the same time. For this reason, a chord made up of the notes A, B, and C, for example, would sound very anguished indeed, as the B would clash with both the A and the C. This sort of chord would not be of much use in accompanying a melody, but it would be right at home in something very tense like “The Devil’s Staircase.

    1. RRID:AB_1281337

      DOI: 10.1016/j.molcel.2019.02.024

      Resource: (Cell Signaling Technology Cat# 9728, RRID:AB_1281338)

      Curator: @evieth

      SciCrunch record: RRID:AB_1281337

      Curator comments: Cell Signaling Technology Cat# 9728, Di-Methyl-Histone H3 (Lys27) (D18C8) XP Rabbit mAb antibody


      What is this?

    1. Single quotes return text strings.  Double quotes return (if you can really think of them as “returning” anything) identifiers, but with the case preserved.
  6. Dec 2019
    1. target

      Omitting the target creates an annotation that the Hypothesis client will classify as a pagenote and display in the pagenotes tab.

    1. permissions

      cf https://github.com/FrankensteinVariorum/fv-data/issues/20:

      "All annotations belong to one group. They cannot currently be moved to another group after creation.

      Annotations have a boolean flag indicating whether they are visible only to the creator or shared with other members of the group."

      The permissions structure in API responses exists only for backwards compatibility, but you can't actually make use of the full flexibility implied by it.

  7. Nov 2019
    1. Search for annotations

      If you are searching a private group you will need to make an authenticated API call using a token representing a member of the group.

      The https://h.readthedocs.io/en/latest/api-reference/v2/#section/Authentication/ApiKey method is the easiest and most popular way for standalone API-based scripts to authenticate.

      To generate a token, log in to Hypothesis, go to https://hypothes.is/account/developer, click the button, and copy the token.

      To use it in a REST API call, add the header:

      Authorization: Bearer {your token}

      An example in JavaScript: https://github.com/judell/hlib/blob/master/hlib.ts#L480

      In Python: https://github.com/judell/Hypothesis/blob/master/hypothesis.py#L143

    1. If the final system is completely different than the prototype, users may be confused about how it operates.

      That's one reason not to invest in design polish. An ugly-but-functional prototype doesn't pretend to be a polished product or invite confusion with it.

    1. you need to see and feel the interactions rendered by software to know if you’ve nailed the experience.

      And if at all possible, you need to the interaction to be infused with your data.

    2. Regardless of the method you use, prototyping is no longer just a nice-to-have. Aligning a multi-disciplined team and ensuring that everyone comes away with a completely clear picture of the intended interaction design is key to successful product development, and building experiences that customers will ultimately love.
  8. Oct 2019
    1. With pywb 2.3.0, the client-side rewriting system exists in a separate module at https://github.com/webrecorder/wombat`
    1. The Wikimedia Foundation says it is seriously concerned about the idea that cisgender women and transgender editors could be repelled from Wikipedia by online abuse.

      This is also, to myself, indicative of the main problem with Wikipedia: most editors are white men in a certain age span.

      When abuse is added like this, non-men are more likely to stay away, and watch Wikipedia wither into a reason for staying with professionally edited encyclopedias.

    1. But at least one person was able to record the livestream of the video before the company could remove it. Someone posted the video to 8chan, a social message board website that hosts offensive content banned on many mainstream platforms like Facebook, YouTube and Instagram. From there, the video spread quickly, and millions of people began trying to re-upload the video to Facebook to further fan the viral flames.

      This passage really reflects how much our generation and communities are tied to our electronic devices and our online personas. People livestream and record many different events all the time, even ones that they shouldn't be. This is a problem that comes with social media and the online age.

    2. disrepute

      I was unsure what this meant, but I looked it up and I realize that it has to do with being held in low esteem by the public.

    3. “Much — I would say even most — extreme-right content is easily accessible in open online spaces so that it can be consumed by as many people as possible,” said Maura Conway, a senior lecturer in international security at Dublin City University in Ireland.

      This is an important highlight

    4. “Some intended to promote the killer’s actions, others were curious and others actually intended to highlight and denounce the violence. Distribution was further propelled by broad reporting of the existence of a video, which may have prompted people to seek it out and to then share it further with their friends.”

      This is basically showing how although there is not everyone on board with the actions of others there is more people getting the idea to engage in this behavior and will seek out ideaologies that will encapture that

    5. white supremacist forums

      Defined as a white supremacist thread of ideas and comments on a social platform

    6. They are the publisher, not just the postman.”

      I think this is a very powerful and important quote. Social media needs to be held accountable and not let things that are harmful spread. They have a responsibility to monitor what is being published, they do have control so they should not idly sit by.

    7. And no users reported the post to Facebook’s content moderators during the live stream, an important signal for the company to catch and take down harmful content before it spreads virally across the site.

      I find this highly concerning. I am actually shocked that this happened.

    8. “It is clear that this video was ‘pushed’ to many innocent New Zealanders by various apps,” he said. “We have had reports that it also ‘auto-played’ to some people who did not even know what it was.”

      This relates to how the video talks about the push of ISIS propaganda and how that different accounts are used to push out information. People are coming across it even when they are not seeking it out.

    9. New Zealand’s Department of Internal Affairs includes a chief censor, an official who has the authority to determine what material is forbidden.

      Although I am all for freedom of speech, I feel like in some cases having certain material be forbidden on the internet is not the worst thing in the world.

    10. One man, Philip Neville Arps, appeared in court in Christchurch on Wednesday on two charges related to reposting the killer’s video. Mr. Arps was denied bail and is facing almost a month in custody until his next court appearance.

      Although it is an awful act, to hold someone without bail and holding them in jail until heir next court hearing over sharing a post seems some what extreme however there should be a middle ground for punishment.

    11. freedom

      Free speech is an especially tricky concept, especially when one has to determine what is protected as free speech and what isn't. This is often battled out in court in the US and is decided by a judge. The only type of speech the US really doesn't protect is if that speech is directly insighting violence. This means that hate speech is protected.

    12. accept

      This reminds me of the debate that i happening in the US about sensationalizing gun violence and the way that the news often reports on school shootings. In most cases, they report on a sensationalized background of the shooter's life and history which is the proven wrong thing to do, as is inspires further shootings. Why do we let this happen?

    13. Facebook

      Reminds be of a point made in the previous article about what kind of violence can we show and the mentioning of the horrible Philando Castlie shooting... What if some things need to be seen?

    14. Facebook and other social media platforms also could face new legal issues because of the video, and not only in New Zealand. Prime Minister Jacinda Ardern of New Zealand has vowed to investigate the role that social media played in the attack and to take action, possibly alongside other countries, against the sites that broadcast it.

      I can understand how Facebook and other social media platforms could face legal issues. This actually might be beneficially towards the victims and the victims family.

    15. And no users reported the post to Facebook’s content moderators during the live stream, an important signal for the company to catch and take down harmful content before it spreads virally across the site

      No one reported the video because they must have thought it was fake. This reminds me of the facebook live video of a man in the U.S who claimed he was going on a killing spree and killed an innocent elderly man on the street. Most of the comments where shocked that it happened because they did not think something like that could happen. Sometimes it happens so fast you are unable to report it until it is too late.

    16. Facebook said that during the 24 hours after the shooting, the company blocked more than 1.2 million attempts to upload the video. It took down more than 300,000 copies of the video that had been uploaded.

      I know that Facebook or other social media platforms are able to remove content, however I wonder how they are able to attempt to block it from being downloaded?

    17. A Christchurch teenager, whose name has not been released, was denied bail on Monday over charges that he had posted a photograph of Al Noor Mosque, one of the two that were attacked, a week before the shootings, with the caption “target acquired.” He was also charged with reposting the video.Each could spend as much as 14 years in jail if found guilty.

      I believe we have to continue to monitor these events closely and continue to punish extremely harsh for things on the internet. There needs to be a way to see this post and stop these people before they act.

    18. purport

      "Appear or claim to be or do something"

    19. How can people be charged for simply sharing content on social media? Is it because it is considered terrorism content and that spreading it would make you a terrorist?

    20. denied bail and is facing almost a month in custody until his next court appearance.

      It is crazy to see how different laws are around the world. I do not believe that this would happen in America. In this country, people are very quick to bring up our "freedom of speech." However, I think that what New Zealand is doing is beneficial to society, because I do not believe that content like this terrorism video should be shared online, especially when it depicts the real killings of people.

    21. company blocked more than 1.2 million attempts to upload the video. It took down more than 300,000 copies of the video that had been uploaded.

      This is shocking to me because I don't understand why people would want to upload and share a video of people being murdered in a terrorist attack to their Facebook accounts. It is disheartening to see how desensitized our society has become to this type of violence.

    22. Facebook, the platform used by the Christchurch killer to broadcast the attack on one of its marquee products, Facebook Live, has been under pressure to explain its role in how the video proliferated.

      I do agree that they play some part in it, but how much control do they actually have?

    23. But at least one person was able to record the livestream of the video before the company could remove it

      This always happens. As soon as it is on the internet, no matter how fast you remove it, it can still be found. That bein said, the companies have a big issue in hand.

    24. And no users reported the post to Facebook’s content moderators during the live stream, an important signal for the company to catch and take down harmful content before it spreads virally across the site.

      I am blown away and in disgust that no person reported the killer's livestream. Facebook Live moderators really need to get their act together to help catch these things.

    25. “We cannot simply sit back and accept that these platforms just exist and that what is said on them is not the responsibility of the place where they are published,” she told Parliament on Tuesday. “They are the publisher, not just the postman.”

      Well put. We need to hold social media outlets accountable for the service they provide. They simply can't sit idly by allowing for their medium to be a catalyst for hate.

    26. said mainstream social media companies had generally succeeded in suppressing content from groups like the Islamic State on their platforms, but that far-right groups had not received the same treatment.

      Good, but not good enough. White-supremacists have incited just as much if not more acts of violence on domestic soil than the Islamic State. When is it finally enough?

    27. “It’s hard to know where the line is drawn,”

      this is a very deep statement as the line between laws on social media are so undefined and so new that they are hard to enforce

    28. Fewer than 200 people watched the killer’s shooting spree live as it occurred

      This is appalling that anyone would actually watch the killer's shooting spree live as it occurred.

    29. Mr. Elley said, with algorithms on websites like YouTube constantly offering viewers more and more “extreme and strange” videos to keep them watching,

      Why is the essence of 'strange' videos build a high viewer point for our society?

    30. The restrictions mean New Zealanders could face legal consequences for intentionally looking at the Christchurch killer’s video, which may have been seen millions of times around the world.

      This is an interesting passage. Only because I think this is an important step forward for humanity, and it should be more enforced. I don't think anyone would disagree that intentionally watching and sharing a video about terrorist killing is morally wrong and reprehensible. But, as human (or at least Americans for sure), we have a strange primal need to look at disasters. When there is a car accident on the freeway, for instance, traffic forms as cars slowly roll by so that they can take in the damage. Even the saying from Tony Danza, which is now often repeated in different words, "Sometimes it's like watching a train wreck. You're uncomfortable, but you just can't help yourself" is an example of how people have an impulse to watch terrible, tragic things. I think society needs an enforceable guideline to deter watching this kind of tragedy.

    31. parameters

      Parameters- "a limit or boundary that defines the scope of a particular process or activity" In this case it is explaining that New Zealanders have the freedom of expression, but that there are lines that should not be crossed. I think that is something that the U.S. should adopt.

    1. In their absence, some airports have had to close checkpoints, as Baltimore-Washington International did over the weekend

      Low staffing has caused airports to close certain checkpoints which jeopardizes the safety of air travelers.

    1. unrepresentative

      Feel that most people don't realize that this is true

    2. junkies

      People are getting their information form online biased media sources when they should be getting information on their prefered candidate from verified new sources or their own websites on their policies

    3. specifics

      Personally believe it was a very accurate observation based on my own experience on twitter

    1. he student had grown up in a household with little money and where college had never been discussed.

      i think this is pretty typical for first generation students. Their parents do not talk about college so they do not talk about college because they do not know what to say or what questions to ask

    2. most first-generation students come from families with low incomes and minimal exposure to college.

      their parents could not afford to go to college and they can barley send their kids to college because they were not able to get a degree to give them a well paying job

    3. died when his son was a toddler

      maybe they should go into the fact that his dad dying when he was young had an effect on him rather than looking at the lack of an effect he had on him

    4. Colleges have always viewed their mission as promoting social mobility, but given rising income inequality and the skills needed to get high-paying jobs, they have intensified their efforts to enroll and lift disadvantaged students.

      not really how colleges do it anymore, the huge monetary barrier(in america at least) kicks the poor down and keeps the wealthy up. despite the many programs promoting lower class and minorities representation in college.

    1. Google to provide information on all devices it recorded

      Google can provide any informations about devices which can help police in his investigation.

    2. They used new techniques for murder investigation.

    3. This year, one Google employee said, the company received as many as 180 requests in one week

      Investigators are using this tracking technology increasingly because it is very useful to find the criminals all around the world by tracking their device.

    4. dragnet

      a system in which the police look for criminals, using very thorough methods.

    5. Technology companies have for years responded to court orders for specific users’ information.

      Technology companies help in the investigation of crime.

    6. This year, one Google employee said, the company received as many as 180 requests in one week.

      Google receive several requests.

    1. One of the biggest questions of the past two years — something that fueled the news coverage, the federal investigation and congressional scrutiny — is why so many people around Mr. Trump lied, misled and changed their stories
    1. Too many boys are trapped in the same suffocating, outdated model of masculinity, where manhood is measured in strength, where there is no way to be vulnerable without being emasculated, where manliness is about having power over others.

      I agree with this statement. Society is moving towards more gender equality, which challenges male privilege and forces men, conditioned to equate power with masculinity, to feel there manhood is threatened. As supported in this article: https://www.apa.org/monitor/2017/02/men-left-behind

    2. It’s no longer enough to “be a man” — we no longer even know what that means

      Agreed, as discussed in class, gender roles constantly evolving, they are no longer binary. There is no longer a clear definition of what a "man" is nor his place within the workplace or home.

    3. Girls today are told that they can do anything, be anyone.

      As discussed in class, gender roles have shifted to where the role of women in the home is no longer that of the housewife. In many instances, they are the main breadwinner.

    4. They’re outperforming boys in school at every level.

      According to an article in"The Atlantic", in 2017 56% of college students were female.

    5. I used to have this one-liner: “If you want to emasculate a guy friend, when you’re at a restaurant, ask him everything that he’s going to order, and then when the waitress comes … order for him.” It’s funny because it shouldn’t be that easy to rob a man of his masculinity — but it is.

      If this statement is implying all guys has the same level of sensitivity and pride, then that is clearly wrong. I, for example, this situation won't strip my masculinity away as well as many guys. But if the author is implying that a man's masculinity is sensitive, then yes, I agree that is true. But each man have a certain degree of masculinity, and how they respond varies. (This is just an introductory to their point of their article, I will continue reading)

    6. Last week, 17 people, most of them teenagers, were shot dead at a Florida school. Marjory Stoneman Douglas High School now joins the ranks of Sandy Hook, Virginia Tech, Columbine and too many other sites of American carnage. What do these shootings have in common? Guns, yes. But also, boys. Girls aren’t pulling the triggers. It’s boys. It’s almost always boys.

      Yes and No...It is true that these horrific events happened. The articles are all over the web with a simple search. So the facts are true. But the last few statement contradict each other. It is true that the events she specifically provided all involves a male culprit. But by saying "Girls aren't pulling the trigger"..."many other sites of American Carnage"..."its boys. It's almost always boys" is contradicting, thus false. There are female shooters too. Here's some examples. 1) A women shooter at YouTube Headquarters in California, a very recent event. 2) A women who shot up a elementary school in the lates 1900s: Brenda Spencer. So far of what I have read, I believe that gender has nothing to do with shooting and crimes. The causation is more related to gun laws, federal/city laws, and mental illness, but that is another argument.

      But what I agree on is that there are more male shooters/criminals that male. But why is that? What I believe is that is has to do with biological, psychological, and social factors, which I will answer a bit more as I get through the reading.

    7. The past 50 years have redefined what it means to be female in America. Girls today are told that they can do anything, be anyone. They’ve absorbed the message: They’re outperforming boys in school at every level. But it isn’t just about performance. To be a girl today is to be the beneficiary of decades of conversation about the complexities of womanhood, its many forms and expressions.

      Agree...feminist has been around for quite some time with roots connecting to 14th century France, Christine de Pizan (based on my knowledge).

    8. It’s no longer enough to “be a man” — we no longer even know what that means.

      In today modern society, especially western culture, gender roles changes rapidly especially from environmental and social factors. As learned in class, a male can be assertive (masculinity trait) with his children and his wife, but if he's in the workplace. He becomes obedient, submissive, and docile to his boss. And if his boss is a female, then what is gender role?

    9. They are trapped, and they don’t even have the language to talk about how they feel about being trapped, because the language that exists to discuss the full range of human emotion is still viewed as sensitive and feminine.

      Toxic masculinity as we learned in class does play a role.Yes because of this, most girls are more "social, seeks support", emotional and more open about their problems to people.. Boys on the other hands, are taught to be a fighter and strong. It can be embarrassing to them if a guy were to cry about their problems around their peers.This can play a role to why more male are more vulnerable to corrupted thinking and actions. From childhood to now, the people they associate with, the movies/films they watch, books they read, etc, toxic masculinity is already programmed into many men's mind. Many factor plays a role into why there are more male shooters, and I agree that toxic masculinity is one of them.

      https://www.nytimes.com/2019/01/22/us/toxic-masculinity.html

    10. And so the man who feels lost but wishes to preserve his fully masculine self has only two choices: withdrawal or rage

      Those capable - rage/violence (either self or to others) those not capable - withdrawal

    11. To be clear, most men will never turn violent. Most men will turn out fine. Most will learn to navigate the deep waters of their feelings without ever engaging in any form of destruction. Most will grow up to be kind. But many will not.

      Yes, that makes things much clearer. Not generalizing, just specifying.

    12. But we can see at least one pattern and that pattern is glaringly obvious. It’s boys.

      Yes. Refer back to my annotations/my thoughts on the previous paragraphs

    13. Men feel isolated, confused and conflicted about their natures. Many feel that the very qualities that used to define them — their strength, aggression and competitiveness — are no longer wanted or needed; many others never felt strong or aggressive or competitive to begin with. We don’t know how to be, and we’re terrified.

      I believe that this is related to something called hyper-masculinity I believe that the testosterone in males are also responsible for why there are more male shooters. This shows that it is a biological thing and has happened throughout history. Every violent things all involves mostly men no matter what setting it takes place, dating/love, war, competitive games/sports, money, fame, and survival. Only if it involves some sort of loss, hurt, or hurting their pride. However, ALL men are not like this. ONLY those who are incapable of handling the mental/emotional stress, those who are delusional, those that have "guts" and sinister courage JUST to defend their pride from being attacked, which can be summed up as mentally ill. I will refer back to toxic masculinity, most boys with a certain level of mentally illness tends to not get help and are are not as open. This tend to make things worse, and their aggression can turn to physical violence. Girls on the other hand as mentioned are more open and more capable of achieving this help, and will often have other ways other than alcohol/drug abuse to help distract them.

      There are many many many many factors, and it's nearly impossible to list them all. But the general reasons to why there are more men shooter or just male criminals then females is as mentioned biological, psychological, and social factors.

    14. I believe in boys. I believe in my son. Sometimes, though, I see him, 16 years old, swallowing his frustration, burying his worry, stomping up the stairs without telling us what’s wrong, and I want to show him what it looks like to be vulnerable and open but I can’t. Because I was a boy once, too.

      toxic masculinity in the work?????Was the boy taught that he should keep his feelings locked away?

    15. I would like men to use feminism as an inspiration, in the same way that feminists used the civil rights movement as theirs. I’m not advocating a quick fix. There isn’t one. But we have to start the conversation. Boys are broken, and I want to help.Sign Up for Jamelle Bouie's NewsletterJoin Jamelle Bouie as he shines a light on overlooked writing, culture and ideas from around the internet.

      so a movement to make male vulnerability normal?

    16. I used to have this one-liner: “If you want to emasculate a guy friend, when you’re at a restaurant, ask him everything that he’s going to order, and then when the waitress comes … order for him.” It’s funny because it shouldn’t be that easy to rob a man of his masculinity — but it is.

      I'm skeptical from the outset. It's not unusual to buy a round of drinks, or a couple burgers for a friend. I've never seen anyone affected by another person ordering for them but I'll admit it's likely for some people out there.

      I acknowledge that the implication is that treating a man as you would a woman, by ordering on her behalf (or other implications), could be taken as offense. There's probably a case where this is exactly what happened, but I can't imagine it being a plurality or the norm.

    17. Last week, 17 people, most of them teenagers, were shot dead at a Florida school. Marjory Stoneman Douglas High School now joins the ranks of Sandy Hook, Virginia Tech, Columbine and too many other sites of American carnage. What do these shootings have in common? Guns, yes. But also, boys. Girls aren’t pulling the triggers. It’s boys. It’s almost always boys.

      Though it is rare for women to be shooters, it is not unheard of. One of the earliest school shootings) was perpetrated by a woman.

    18. America’s boys are broken. And it’s killing us.

      Some of its boys are broken.

    19. The brokenness of the country’s boys stands in contrast to its girls, who still face an abundance of obstacles but go into the world increasingly well equipped to take them on.

      I dislike this comparison. Are the underlying causes of this brokenness warranting (if possible) the outcomes? Is there any pathology to these school shootings or domestic terrorism?

      In a sense, an archetype of male is facing extinction pressure based on changing societal norms and expectations. Can these individuals adapt? Will they choose to? Is this worth considering at all?

    20. Girls today are told that they can do anything, be anyone. They’ve absorbed the message:

      I don't think this is limited to girls. I can't imagine this as an issue for Americans. Compared to many of my friends in Europe, Africa, and Asia; I don't think Americans have a confidence problem.

    21. They’re outperforming boys in school at every level. But it isn’t just about performance. To be a girl today is to be the beneficiary of decades of conversation about the complexities of womanhood, its many forms and expressions.

      I don't get the sense that male sexuality, gender, and its forms and expressions are something that doesn't have decades of conversation about. I remember the likes of American Pie, the Wonder Years, and tons of coming of age films and tv shows that featured the male perspective. It was a foregone conclusion, a baseline. I don't think most men are disadvantaged at all as far as "blue prints" are concerned. I do think there are pressures to "be different" regarding how we reminisce on past sexual encounters or the types of jokes we shouldn't tell due to a widening number of people who's offense we now take more seriously.

      As far as test scores and performance go, I don't know what to make of it. I'm going into a profession that is over 60% women. I go to a school that is more than 60% women. As long as I can remember being in school, I can recall being outnumbered by women. I never felt outperformed though.

    22. Boys, though, have been left behind. No commensurate movement has emerged to help them navigate toward a full expression of their gender. It’s no longer enough to “be a man” — we no longer even know what that means.

      The baseline has been literature about male sexuality and thought--gender intrinsically included. Boys have not been left behind. Generally, society shunned high variability in male behavior from established gender norms. At the same time, being manly left room for lots of variety over the years. Examples: The Fonz, Archie Bunker, rockstars, Bob Ross, rappers, Walt Whitman, boy pop bands, John Locke, James Bond, wrestlers, power rangers, Mr. Rogers.

      Lots of variety yet at the same time they're so similar in that most present as straight and male. Times are changing for everyone. I believe the trend is very positive for women and decidedly shaky for men. Still, I wouldn't call this left behind.

    23. Too many boys are trapped in the same suffocating, outdated model of masculinity, where manhood is measured in strength, where there is no way to be vulnerable without being emasculated,

      Most models of masculinity I don't imagine being compatible with homosexuality or deference to a woman (outside of a matriarchal culture/tradition which aren't as uncommon as we'd think).

    24. where manliness is about having power over others. They are trapped, and they don’t even have the language to talk about how they feel about being trapped, because the language that exists to discuss the full range of human emotion is still viewed as sensitive and feminine.

      It often does feel shameful to cry as boy as most are conditioned not to. I think confident vulnerability gets men points today, actually. I think being unshaken by the outside is what masculinity is becoming. If you can wear a skirt and not be affected, then you're "the man." If you can do whatever you want, then you're "the man."

      There's a quote that I recall from FX's Atlanta from the 7th Episode B.A.N. Paperboi says:

      "Man, here's the thing. Man, I... it's hard for me to care about this when nobody cares about me as a black human man, you feel me? Like, Caitlyn Jenner is just doing what rich white men been doing since the dawn of time, which is whatever the hell he want. So why should I care? What make him so special?"

    25. To be clear, most men will never turn violent. Most men will turn out fine. Most will learn to navigate the deep waters of their feelings without ever engaging in any form of destruction. Most will grow up to be kind. But many will not.

      The phrase, "Boys are broken," is more often incorrect than it is correct.

    26. o be clear, most men will never turn violent. Most men will turn out fine. Most will learn to navigate the deep waters of their feelings without ever engaging in any form of destruction. Most will grow up to be kind. But many will not.

      Although I do agree with this message, its important to not forget the patriarch society in which we live in, and how it affects the Gender norms. Although perhaps not physical violence, other types of violence or abuse can still hide in forms of patriarchy. Often times will show that today in 2019, we still fight this battle. It's terrifying to know that in the 21st century, this what we are still dealing with. Gender Roles play a large factor in this. Johnson's Ideology states "According to patriarchal culture, for example, men are aggressive, daring, rational, emotionally, inexpressive, strong, cool headed, in control of themselves, independent and active, self confident and unnurturing. Women are portrayed in opposite terms, such as shy, intuitive, emotionally expressive, nurturing, weak, hysterical and lacking in self control." These norms in which we see expressed in our everyday lives lead us into very narrow conceptions of ourselves, and pressure that we need to fulfill these roles. So this is true, not all men are violent, and when they do we have to look deeper into what those reasons are. The facts are in plain sight. Just this year alone 126 mass murders have been reported to the US, all of them being committed by men, so many that we don't even hear about each and every one of them. https://www.massshootingtracker.org/data It important for us in order for healing in these boys to occur, we need to be able to destroy these gender norms, and have the ability to express ourselves in whichever ways we feels at ease with ourselves.

    1. The study specifically regards linemen and defensive backs as being the two primary groups, but running backs are not considered as heavily in the original paper due to the limited frequency of consecutive repetitive impacts.

    2. While 1300 players have died since the recent inception of the Brain Bank, how many more players have played the game and not had symptoms? Is there something more at play?

    3. I like how the prevalence of the position of linemen is included later, but for clarity and to limit the amount of bias before introducing a key fact like prevalence on the field after prevalence within the disease, it's imperative to restructure here.

    1. If they are denied, asylum seekers can be deported. But since many are released while their case is pending, some never return to court and evade deportation.

      the risk of not receiving asylum is deportation

    2. better shot at fending off deportation when they come with a child.

      Immigrants will strategize techniques in order to get into country easier

    3. More than 90 percent of the most recent migrants are from Guatemala,
      • not mexico (stereotype)
    1. “They can build as many walls as they want,” he said, referring to American officials. “They can send as many soldiers to the border as they want, but a people’s need and desire for a better life is stronger.”

      This is the main idea- not matter what desire for better life is stronger than walls and soldiers

    2. The smugglers almost hadn’t let him cross, because they worried that his coughing fits from a respiratory infection might give the group away.

      People left behind to not give away the group and risk being caught

    3. MS-13 became too dangerous there. His family relocated to Berlín, about an hour’s drive away, which had less of a gang problem than the big cities.

      Gangs and other reasons drive people to leave their homes to immigrant into U.S.

    4. MS-13 became too dangerous there. His family relocated to Berlín, about an hour’s drive away, which had less of a gang problem than the big cities.

      An example of why people move is gang problems and other dangers.

    5. The smugglers almost hadn’t let him cross, because they worried that his coughing fits from a respiratory infection might give the group away

      Sometimes people will be left behind if smugglers fear being caught. An example of this is a sick person coughing and border patrol may be able to hear.

    6. “They can build as many walls as they want,” he said, referring to American officials. “They can send as many soldiers to the border as they want, but a people’s need and desire for a better life is stronger.”

      No matter what There will always be people who attempt to illegally cross the border for a better life.

    1. July of last year, July of last year,

      Anaphora emphasizes the importance of the time period and just how unfortunate it is that Magante chose this time not to pitch well.

    2. Mags

      Revealing the metonymy for Magnante makes one feel cloer to the team and to the action. It's also a humorous tid-bit.

    3. Magnante made an almost perfect pitch to Lee Stevens, a fastball low and away.

      Consonance of "magnante made" and "perfect pitch" aids sentence flow. Note also the surprise: you'd expect a bad pitch based on the previous paragraphs.

    4. pop out

      metonymy/baseball slang for an out that occurs from a catch that results from a ball that goes high but not far.

    5. Ricardo Rincon's name is on that board

      Anaphora/ parallel structure serves to heighten the dynamic and contrast between Rincon and Mags.

    6. he knows every player on other teams that he wants, and every player in his own system that he doesn't want

      Hyperbole emphasizes Beane's understanding of what players he wants on his team

    7. Harvard statistics professors, research scientists, Wall Street analysts turned amateur baseball analysts -- and ignored by organized baseball.

      antithesis emphasizes whom the A's listen to.

    8. a fly ball hit by an Oakland A will clear the wall

      Implied metaphor. Tenor: Billy's offer. Vehicle: fly ball that might clear the wall . Ground: a long-shot, potentially big action that seems on the cusp of success.

    9. Coliseum

      humorous metonymy for the stadium

    10. he was paralyzed when the decision involved himself.

      ironic: Beane is so quick to decide for others (his "edge"), but he cannot do the same for himself. He is not rational now.

    11. ''I made one decision based on money in my life -- when I signed with the Mets rather than go to Stanford -- and I promised I'd never do it again.'' After that Beane confined himself to the usual blather about personal reasons. None of what he said was terribly rational or ''objective'' -- but then neither was he.

      Continuation of the irony: he is no longer scientific and rational. Further, we have a reference to the opening of chapter 2; the book is coming full circle and that quote is making sense.

    12. no one would know.

      anaphora emphasizes how futile his endeavor could be.

    13. Cleveland in the top of the seventh with two runners on

      Uses of metonymy in "seventh" (standing for seventh inning) and "runners" (standing for players at base) hastens the prose, creating an image of a quick game. The narration style is also similar to that of a traditional baseball announcer, a tone establishing setting and subject matter.

    14. a left-handed slugger

      Metonymy referring to Thome's brutish hitting style, paints a hulking character.

    15. ''for guys to be available to us, there usually has to be something wrong with them,'' and it wasn't hard to see what was wrong with Mags,

      Figure of repetition: conduplicatio in "wrong." The word wrong is repeated, the two separated by the phrase "with them,' and it wasn't hard to see what was..." The purpose of conduplicatio in this case is to amplify the point that The A's usually hired unconventional players and that Mags was no exception.

    16. low and outside

      Metonymy standing for the position of the catcher enforces the "detached announcer" tone of the prose

    17. bad count

      Antithesis of good pitch. Enforces the rhythm of the piece.

    18. It rose and rose

      the use of epizeuxis emphasizes the flight, and height of the ball

    19. you do the things you always did, but the results are somehow different.

      Antithesis in the change of results based on age alone. Reflects on the struggle of older players, or aging in general.

    20. The contrast cast Mags in unflattering light

      Use of personification shows just how little control Mags has over the situation. He is forced by the will of non-human entities

    21. The trick

      metonymy for Beane's method of money management. Connotation of "trick" implies a scheme on Billy's part.

    22. and have researched for 30 seconds.

      Hyperbole overstates the lack of research the Mets need to hypothetically do in order to entice Paul DePodesta

    23. His owners have told him only that they won't eat 508 grand; they've said nothing about eating 233 grand.

      Implied metaphor in "eat." Eating, in this case, stands for taking an offer. The ground is in acceptance and consumption

    24. pokes his head

      Implied metaphor. Tenor: Paul entering Billy's office Vehicle: "poking" Ground: small stature, barely noticeable presence.

    25. White Sox, who had abandoned all hope for their season

      Hyperbole humorously emphasizes the failures of the White Sox

    26. Now he has sights on Ricardo Rincon,

      Implied Metaphor. Tenor: Billy's attention. Vehicle: a marksman's scope. Ground: unwavering focus, military precision.

    1. Plenty has happened since then. The child is now a cryptic wizard and the cad has been broken down and rebuilt

      hi dear

    1. Harvesting Poverty; The Rigged Trade Game
    2. Despite widespread worries about their ability to compete, Filipinos bought the theory that their farmers' lack of good transportation and high technology would be balanced out by their cheap labor. The government predicted that access to world markets would create a net gain of a half-million farming jobs a year, and improve the country's trade balance.It didn't happen. Small-scale farmers across the Philippine archipelago have discovered that their competitors in places like the United States or Europe do not simply have better seeds, fertilizers and equipment. Their products are also often protected by high tariffs, or underwritten by massive farm subsidies that make them artificially cheap. No matter how small a wage Filipino workers are willing to accept, they cannot compete with agribusinesses afloat on billions of dollars in government welfare.
    1. Minutes later a second suicide blast shattered the Sunday brunch tranquillity at the Shangri-La Hotel’s Table One Restaurant, a favorite of foreign tourists.

      This is devastating!

    2. The death toll in the attacks rose to 290, with about 500 people wounded, a police spokesman, Ruwan Gunasekera, said, although he would not give a breakdown of where the fatalities occurred. The finance minister, Mangala Samaraweera, called the attacks “a well-coordinated attempt to create murder, mayhem and anarchy.”

      This is so incredibly sad!

    3. the exact moment when the first suicide bomber’s explosion ripped through the wooden pews as Easter Sunday worshipers were praying.

      How can someone do this especially on a holiday where families come together.

    4. Within a few hours on Sunday, suicide bombings hit three Christian churches and three upscale hotels in the Indian Ocean island nation of Sri Lanka, still recovering from a quarter-century civil war in which the suicide bomb was pioneered.

      Its sad that it was even one church but three is very devastating.

    5. The clock hands on the steeple of St. Anthony’s Shrine were stuck at 8:45 a.m., the exact moment when the first suicide bomber’s explosion ripped through the wooden pews as Easter Sunday worshipers were praying.

      This is devastating

    6. the police said at least 13 people had been arrested in connection with the attacks in the capital

      The last article said 23?

    7. The death toll in the attacks rose to 290, with about 500 people wounded

      This is so sad

    8. For years, as Sri Lanka has climbed away from war, it has been building a robust tourism industry.

      It's sad to hear that they were trying to get away from it but just can't seem to.

    9. The clock hands on the steeple of St. Anthony’s Shrine were stuck at 8:45 a.m., the exact moment when the first suicide bomber’s explosion ripped through the wooden pews as Easter Sunday worshipers were praying.

      Horrible. For a religion that's about peace this is devastating.

    1. Facebook said on Wednesday that it expected to be fined up to $5 billion by the Federal Trade Commission for privacy violations. The penalty would be a record by the agency against a technology company and a sign that the United States was willing to punish big tech companies.

      This is where surveillance capitalism brings you.

      Sure, five billion American Dollars won't make much of a difference to Facebook, but it's notable.

    1. Being seen with a subsidized meal, he said, “lowers your status.” Advertisement Continue reading the main story

      students rather skip meals

    2. possibility of introducing cashless cafeterias where all students are offered the same food choices and use debit cards or punch in codes on a keypad so that all students check out at the cashier in the same manner.

      viable technical solution

    1. The proposed commitments are part of negotiations between the agency and Facebook to settle privacy violations. Both have been talking for months over claims that Facebook violated a 2011 privacy consent de

      test

    1. The furor over Sacco’s tweet had become not just an ideological crusade against her perceived bigotry but also a form of idle entertainment.

      here's an annotation

    1. The online network of maps is distinct from most scholarly endeavors in another respect: It is communal. The traditional model of the solitary humanities professor, toiling away in an archive or spending years composing a philosophical treatise or historical opus is replaced in this project with contributions from a global community of experts.

      With the ability to work online, simultaneously, and around the world, the amount of expertise and knowledge that can be applied to research or a project is incredible. New information can be gathered in a much faster and concise way, and new perspectives provide insight into perplexing topics and ideas that were overlooked or disregarded previously.

    2. These researchers are digitally mapping Civil War battlefields to understand what role topography played in victory, using databases of thousands of jam sessions to track how musical collaborations influenced jazz, searching through large numbers of scientific texts and books to track where concepts first appeared and how they spread, and combining animation, charts and primary documents about Thomas Jefferson’s travels to create new ways to teach history.

      The use of technology to apply historical information to digital forms offers a chance for new ways to learn and that is amazing. The ability to manipulate a topographical map could lead to new understandings of different wars thus leading to the new teachings of history. The use of databases allows musicians to explore the different cultural influences in music without having to travel to experience it. The use of technologies offers teachers the ability to teach students about the different aspects of the world without having to strictly rely on a textbook to supply the information.

    3. “It’s easy to forget the digital media are means and not ends,”

      The possibilities within the field of digital humanities seem endless, however few examples of how it has assisted with learning and understanding are actually noted in this article. The ability to share information and exchange ideas can advance so many fields. The idea that digital media are means to an end is a short-sighted view that does not fully encompass the full range of possibilities. Pushing towards new ideas is how research advances. In a digital age it only makes sense that other areas are beginning to digitize.

    4. He offered the human genome project as an example of how an area of study can be transformed: “Technology hasn’t just made astronomy, biology and physics more efficient. It has let scientists do research they simply couldn’t do before.”

      These advanced have progressed medicine and sciences so far it's incredible. Think of all of the treatments and research data we never would've had without these advancements and technologies. Hundreds of thousands of lives have been saved or qualities of life improved due to technology and it's only going to keep going.

    5. No one person could digest the work’s enormous amount of material, and no single printing could render it accurately, so Mr. Foys created a prize-winning digital version with commentary that scholars could scroll through.

      It is absolutely INSANE that they were able to digitally map a 224 feet long, 11th century tapestry so that scholars could scroll through it and study it. I cannot wrap my brain around this, it's just something I never thought people would do or even could do. This fact has opened my eyes quite a bit.

    6. “I’m a believer in quantification. But I don’t believe quantification can do everything. So much of humanistic scholarship is about interpretation.”

      It is cool that technology helps to quantify the elements of the humanities that can be quantified, while still letting it retain the interpretaition that makes conversations in the subject so diverse.

    7. We have a whole new set of tools not dominated by the written word

      It is amazing that you can have visual data to learn more about eras that we were never able to experiance with pictures, or quickly see a map of a world that we will never know.

    8. using powerful technologies and vast stores of digitized materials that previous humanities scholars did not have.

      Libraries will never go out of style, and there is nothing quite like curling up in your favourite cozy spot, be it the beach or a recliner by the fireplace, and escaping into a good book. However, having access to a multitude of peer reviewed research articles at the tips of your fingers makes a world of difference, especially to students. As a working single Mom, having the ability to tuck my kid in at night and sit down to look up resources has made education much more accessible. For young students juggling jobs and school, I am sure this is an invaluable tool as well.

    1. Ever since Simone de Beauvoir quipped in 1949 that one is not born a woman, but becomes one, feminists have been discussing the implications of understanding gender as a cultural construct.

      brings in some history

    2. Who counts as a woman? Is there some set of core experiences distinctive of womanhood, some shared set of adventures and exploits that every woman will encounter on her journey from diapers to the grave?

      Interesting how the start of the piece begins with a question.

    1. The two shootings were separated by seven days and more than 1,500 miles, but the details seemed eerily familiar: When a gunman charged into a classroom, a student went barreling toward him, preventing more bloodshed while sacrificing his life.

      This is interesting.

    1. push many Americans into the middle class and beyond

      Not really student loans are a giant anchor around the neck for people who can't pay out of pocket, and its only really the american colleges that do this basically the world over has either free college or colleges that cost 1/4 as much and still teach the same material

    2. The

      The graph above is extremely hard to read and i'm pretty sure they purposely make it hard to read

    1. interesting story about how this guy, who did play football professionally, would like math teachers to take a few points from football coaches.

      good for the overall sentiment and the individual interest & inspiration