3,382 Matching Annotations
  1. Apr 2021
    1. selected text (i.e. the quote)

      body of annotation, can include markup

    2. selected text (i.e. the quote)

      body of annotation, can include markup

    3. selected text (i.e. the quote)

      body of annotation, can include markup

    4. selected text (i.e. the quote)

      body of annotation, can include markup

    Tags

    Annotators

    URL

  2. Mar 2021
  3. Feb 2021
    1. Chances are, if you're like me, that you pick up your phone and use a biometric authentication method (e.g. FaceId) to open it. Then you select the app and the biometrics play again to make sure it's you, and you're in.

      I just had a hilariously opposite experience with Exchange Bank. I'd never tried their mobile app, was happy with the web app which, since having an iPhone, works with Touch ID. But you inspired me to get the app. To which I could not authenticate, not with Touch ID, not with repeated and careful efforts to input the password that works in the web app. Here is how it ended:

      "ATTENTION: We are unable to validate your information Please try again or check that your login credentials are set up correctly in online banking. If problems continue please call us at 1-844-ddd-dddd for assistance."

      Well, not quite. Here's how it ended, after many rings:

      "Thank you for call, we are unavailable to help at this time, please leave a message."

      Wait, there's more. The Touch ID story is more complex than I realized. When I went back and checked, I found it didn't work with my bank. This led to a futile detour during which I connected AutoFill to my password manager (StrongBox, on the iPhone, Keepass elsewhere), and then disconnected it because I didn't want to have to authenticate to the password manager in order to AutoFill. Turning back to the bank auth, I finally figured it out. The Touch ID -> AutoFill connection is based on Safari, but I mainly use a Chromium browser on the iPhone. I had to visit the bank in Safari, and have it remember my bank password, in order for the Touch ID -> AutoFill connection to work. Despite all this, the mobile app still doesn't accept same Touch-ID-acquired credential as the web app does. And it's Saturday, so nobody is answering the phone.

      Now, I am new to the iPhone so I'm sure I'm missing plenty. Also my bad for using the non-default browser I guess. And maybe Exchange Bank's mobile app is an outlier. But still, I'm puzzled. I want to experience this passwordless nirvana of which you speak. How do I get there?

  4. Jan 2021
    1. Yet the pausing of donations announced by many companies – including Marriott, American Express, AT&T, JPMorgan Chase, Dow, American Airlines, and others – was unlikely to deliver a serious blow to Republicans in Congress who voted to overturn Mr. Biden’s win.“These are symbolic pledges,” said Sheila Krumholz, executive director of the Center for Responsive Politics, a nonpartisan group that traces the role money plays in politics. “This is just one source of revenue and for some it’s vanishingly small, particularly in the Senate.”
  5. Nov 2020
  6. Oct 2020
    1. His undercut haircut, known in the alt-right as the fashy (short for fascist), and his fit, thick, soldier-like frame give him a Teutonic air.
    1. puzzling, intriguing, or ambiguous

      These are nice examples of recommended tags that could be signaled using inline hashtags or actual Hypothesis tags.

      Either way, it's effort to send those signals, so there needs to be feedback that shows they've been received and enables folks to observe the response matrix.

      A view of that matrix that doesn't require visiting crowdlaaers or facet might be helpful.

  7. Sep 2020
    1. A testing system built close to the web rendering system itself

      I've arrived at something like this, albeit for very simple web apps. It feels promising but I am not the person to advance the idea.

      It's highly congruent with puppeteer, but not joined at the hip.

  8. blog.cjeller.site blog.cjeller.site
    1. Just when I entered a PhD program for classical guitar, the path soured for me.

      Why?

    1. Meanwhile subjects are left to perform the "interpretive labor" as David Graeber calls it of understanding the system, what it allows or doesn't, and how it can be bent to accomplish their goals.

      Jack Ozzie's term for interpretive labor: context assembly.

    1. privatedichotomyinwhichtheworkofproductionwasassignedtothepublicsphereandtheworkofreproductiontotheprivatesphere
    2. Ihaveexploredelsewhere,themotherhoodmemoirreinscribesor,moreaccurately,naturalizesandnormalizes
    3. InmyearlierworkIusedtheterm“empoweredmothering”tosignifynon-patriarchalmaternityoroutlawmotherhood;
    4. DouglasandMichaelsgoontoexplain,“Thenewmomisminvolvesmorethanjustimpossibleidealsaboutwomen’schildrearing;itredefinesallwomen,firstandforemost,throughtheirrelationshipstochildren.
    5. ErikaHorwitz’sstudy-(2003)on empoweredmotheringrevealsthatthepracticeofoutlawmotherhoodmaybecharacterizedbyseventhemes:Theimportanceofmothersmeetingtheirownneeds;BeingaMotherdoesnotfulfillallofawoman’sneeds;Involvingothersintheirchil­dren’supbringing;Activelyquestioningtheexpectationsthatareplacedonmothersbysociety;
    6. ErikaHorwitz’sstudy-(2003)
    7. asapatriarchalinstitution
    8. WomanBorn:MotherhoodasExperienceandInstitution
    1. illustrative examples

      This annotation will be anchored using a standalone technique that works independently from the Hypothesis client.

  9. Aug 2020
    1. annotated eq3 in the presence of <link rel="canonical" href="https://jonudell.info/test/EQ">

    2. annotated eq4 in the presence of <link rel="canonical" href="https://jonudell.info/test/EQ">

    3. annotating eq3 in the presence of

      <link rel="canonical" href="https://jonudell.info/test/EQ">

    4. initial annotation of eq4

    5. initial annotation of eq3

    1. 2nd annotation of eq2.html in the presence of:

      <link rel="canonical" href="https://jonudell.info/test/eq">

    2. 2nd annotation in the presence of:

      <link rel="canonical" href="https://jonudell.info/test/eq">

    3. initial annotation of eq2

    4. initial annotation of eq1

  10. Jul 2020
    1. <iframe width="600" height="600" frameBorder="0" src="https://flipgrid.com/udell7350?embed=true" webkitallowfullscreen mozallowfullscreen allowfullscreen allow="microphone; camera"></iframe>
  11. Jun 2020
    1. When I need to trace behavior in the client, I build an alternate version of the official Hypothesis extension like so:

      1 In the client repo, set IS_PRODUCTION_BUILD false in the client's gulpfile.js (this turns off minify), then gulp build

      2 In the extension repo:

      make clean
      make SETTINGS_FILE=settings/chrome-prod.json
      

      3 Load the unpacked extension (in Chrome/Brave/Edge) from the build directory.

      Now you can debug in the unminified client.

      Note that because this extension shares a key with the production extension, any changes you make will soon be overwritten. If you want a persistent alternate client you need to use a different key. This technique is specifically for debugging an unminified client.

    1. make

      The bare make command does nothing.

      On Ubuntu 18.04, yarn install tells me:

      error puppeteer@3.2.0: The engine "node" is incompatible with this module. Expected version ">=10.18.1". Got "10.15.3"

      A workaround for upgrading node appears to be:

      yarn install --ignore-engines

  12. Apr 2020
    1. <table> <thead><tr> <th>Tables</th> <th style="text-align:center">Are</th> <th style="text-align:right">Cool</th> </tr> </thead> <tbody> <tr> <td>col 3 is</td> <td style="text-align:center">right-aligned</td> <td style="text-align:right">$1600</td> </tr> <tr> <td>col 2 is</td> <td style="text-align:center">centered</td> <td style="text-align:right">$12</td> </tr> <tr> <td>zebra stripes</td> <td style="text-align:center"><del>are neat</del></td> <td style="text-align:right">$1</td> </tr> </tbody> </table>
  13. Mar 2020
    1. SciScore for 10.1101/782409: 4 (What is this?)

      Table 1: Rigor

      <table><tr"><td style="margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="border-bottom:1px solid lightgray">The experimental protocol was reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) at Loyola University Chicago (IACUC#: 2016-029).</td></tr><tr"><td style="margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="border-bottom:1px solid lightgray">C57BL/6 female mice were purchased from The Jackson Laboratory and maintained in the Comparative Medicine Facility of Loyola University Chicago.</td></tr><tr"><td style="margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><td style="text-align:center; padding-top:4px;" colspan="2">Antibodies</td></tr><tr><td style="text=align:center">Sentences</td><td style="text-align:center">Resources</td></tr><tr><td style="vertical-align:top;border-bottom:1px solid lightgray">The membrane was incubated with either polyclonal rabbit anti-GFP antibody ( A11122 , Life Technologies ) for the protease assay , or mouse anti-flag ( F3165 , Sigma ) for the DUB assay .</td><td style="border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>anti-GFP</div> <div>suggested: (Molecular Probes Cat# A-11122, AB_221569)</div> </div> <div style="margin-bottom:8px"> <div>anti-flag ( F3165</div> <div>suggested: None</div> </div> </td></tr><tr><td style="vertical-align:top;border-bottom:1px solid lightgray">The membrane was then washed three times for 15 minutes in TBST buffer followed by incubation with either secondary donkey anti-rabbit-HRP antibody ( 711-035-152 , Jackson ImmunoResearch ) or goat anti-mouse-HRP antibody ( 1010-05 , SouthernBiotech) .</td><td style="border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>anti-rabbit-HRP</div> <div>suggested: (Kindle Biosciences Cat# R1006, AB_2800464)</div> </div> <div style="margin-bottom:8px"> <div>anti-mouse-HRP</div> <div>suggested: (Kindle Biosciences Cat# R1005, AB_2800463)</div> </div> </td></tr><tr><td style="vertical-align:top;border-bottom:1px solid lightgray">The expression of PLP2 , β-actin , and calnexin were probed with mouse anti-V5 antibody ( R960 , ThermoFisher) , mouse anti–β-actin ( A00702 , Genscript) , or mouse anti-calnexin antibody ( 2433S , Cell Signaling) , respectively .</td><td style="border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>PLP2</div> <div>suggested: None</div> </div> <div style="margin-bottom:8px"> <div>β-actin</div> <div>suggested: None</div> </div> <div style="margin-bottom:8px"> <div>anti-V5</div> <div>suggested: (Thermo Fisher Scientific Cat# R960-25, AB_2556564)</div> </div> <div style="margin-bottom:8px"> <div>mouse anti-calnexin antibody</div> <div>suggested: None</div> </div> <div style="margin-bottom:8px"> <div>anti-calnexin</div> <div>suggested: (Cell Signaling Technology Cat# 2433, AB_2243887)</div> </div> </td></tr><tr><td style="text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</td></tr><tr><td style="text=align:center">Sentences</td><td style="text-align:center">Resources</td></tr><tr><td style="vertical-align:top;border-bottom:1px solid lightgray">Cells Human embryonic kidney ( HEK ) 293T cells were purchased the from American Type Culture Collection ( ATCC , # CRL-11268 ) and maintained in DMEM ( #10-017-CV , Corning ) containing 10 % fetal calf serum ( FCS ) and supplemented with 1 % nonessential amino acids , 1 % HEPES , 2 % L-glutamine , 1 % sodium pyruvate , and 1 % penicillin/streptomycin .</td><td style="border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>HEK</div> <div>suggested: None</div> </div> <div style="margin-bottom:8px"> <div>293T</div> <div>suggested: ATCC Cat# CRL-11268, CVCL_1926</div> </div> </td></tr><tr><td style="vertical-align:top;border-bottom:1px solid lightgray">Protease and deubiquitinating activity assays To determine the protease activity of PLP2 , HEK293T cells grown to 70 % confluency in 24-well plates ( Corning ) were transfected using TransIT-LT1 ( MIR2300 , Mirus ) according to the manufacturer’s protocol .</td><td style="border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>HEK293T</div> <div>suggested: None</div> </div> </td></tr><tr><td style="text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</td></tr><tr><td style="text=align:center">Sentences</td><td style="text-align:center">Resources</td></tr><tr><td style="vertical-align:top;border-bottom:1px solid lightgray">C57BL/6 female mice were purchased from The Jackson Laboratory and maintained in the Comparative Medicine Facility of Loyola University Chicago.</td><td style="border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>C57BL/6</div> <div>suggested: None</div> </div> </td></tr><tr><td style="text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</td></tr><tr><td style="text=align:center">Sentences</td><td style="text-align:center">Resources</td></tr><tr><td style="vertical-align:top;border-bottom:1px solid lightgray">Graphs of virus kinetics were generated using Prism software ( GraphPad Software ) .</td><td style="border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>Prism</div> <div>suggested: (PRISM, SCR_005375)</div> </div> <div style="margin-bottom:8px"> <div>GraphPad</div> <div>suggested: (GraphPad Prism, SCR_002798)</div> </div> </td></tr></table>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore is not a substitute for expert review. SciScore checks for the presence and correctness of RRIDs (research resource identifiers) in the manuscript, and detects sentences that appear to be missing RRIDs. SciScore also checks to make sure that rigor criteria are addressed by authors. It does this by detecting sentences that discuss criteria such as blinding or power analysis. SciScore does not guarantee that the rigor criteria that it detects are appropriate for the particular study. Instead it assists authors, editors, and reviewers by drawing attention to sections of the manuscript that contain or should contain various rigor criteria and key resources. For details on the results shown here, please follow this link.

    1. <html xmlns:v="urn:schemas-microsoft-com:vml" xmlns:o="urn:schemas-microsoft-com:office:office" xmlns:w="urn:schemas-microsoft-com:office:word" xmlns:m="http://schemas.microsoft.com/office/2004/12/omml" xmlns="http://www.w3.org/TR/REC-html40">

      <head> <meta http-equiv=Content-Type content="text/html; charset=windows-1252"> <meta name=ProgId content=Word.Document> <meta name=Generator content="Microsoft Word 15"> <meta name=Originator content="Microsoft Word 15"> <link rel=File-List href="covid_files/filelist.xml"> <link rel=themeData href="covid_files/themedata.thmx"> <link rel=colorSchemeMapping href="covid_files/colorschememapping.xml"> <style> </style> </head><body lang=EN-US style='tab-interval:.5in'> <div class=WordSection1>

      <span class=SpellE><span style='font-size:14.0pt;mso-bidi-font-size:11.0pt;line-height:108%'>SciScore</span></span><span style='font-size:14.0pt;mso-bidi-font-size:11.0pt;line-height:108%'>: 6 </span><span style='color:blue'>What's this?</span>

      Document Identifier: 3879

      Below you will find two tables showing the results of <span class=SpellE>SciScore</span>. Your score is calculated based on adherence to guidelines for scientific rigor (Table 1) and identification of key biological resources (Table 2). Points are given when <span class=SpellE>SciScore</span> detects appropriate information in the text. Details on each criteria and recommendations on how to improve the score are appended to the bottom of this report.

      Table 1: Rigor Adherence Table

      <table class=TableGrid border=0 cellspacing=0 cellpadding=0 width=661 style='width:496.05pt;border-collapse:collapse;mso-yfti-tbllook:1184; mso-padding-alt:0in 4.75pt 0in 6.15pt'> <tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes;height:26.75pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;mso-border-top-alt: 1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt; height:26.75pt'>

      <u style='text-underline:black'>Institutional Review Board Statement</u>

      </td> </tr> <tr style='mso-yfti-irow:1;height:38.75pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:38.75pt'>

      <span style='font-size:11.0pt;line-height:107%'>IRB: Ethics approval was obtained from the Ethics Committee of Guangzhou Women and Children’s Medical Center and written informed consents were obtained from the parents of the included children.</span>

      </td> </tr> <tr style='mso-yfti-irow:2;height:38.75pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:38.75pt'>

      <span style='font-size:11.0pt;line-height:107%'>Consent: Ethics approval was obtained from the Ethics Committee of Guangzhou Women and Children’s Medical Center and written informed consents were obtained from the parents of the included children.</span>

      </td> </tr> <tr style='mso-yfti-irow:3;height:26.75pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:26.75pt'>

      <u style='text-underline:black'>Randomization</u>

      </td> </tr> <tr style='mso-yfti-irow:4;height:25.55pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:25.55pt'>

      <span style='font-size:11.0pt;line-height:107%'>not detected.</span>

      </td> </tr> <tr style='mso-yfti-irow:5;height:26.75pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:26.75pt'>

      <u style='text-underline:black'>Blinding</u>

      </td> </tr> <tr style='mso-yfti-irow:6;height:25.55pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:25.55pt'>

      <span style='font-size:11.0pt;line-height:107%'>not detected.</span>

      </td> </tr> <tr style='mso-yfti-irow:7;height:26.75pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:26.75pt'>

      <u style='text-underline:black'>Power Analysis</u>

      </td> </tr> <tr style='mso-yfti-irow:8;height:25.55pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:25.55pt'>

      <span style='font-size:11.0pt;line-height:107%'>not detected.</span>

      </td> </tr> <tr style='mso-yfti-irow:9;height:26.75pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:26.75pt'>

      <u style='text-underline:black'>Sex as a biological variable</u>

      </td> </tr> <tr style='mso-yfti-irow:10;mso-yfti-lastrow:yes;height:25.55pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:25.55pt'>

      <span style='font-size:11.0pt;line-height:107%'>not detected.</span>

      </td> </tr> </table>

      Table 2: Key Resources Table

      <table class=TableGrid border=0 cellspacing=0 cellpadding=0 width=661 style='width:496.05pt;border-collapse:collapse;mso-yfti-tbllook:1184; mso-padding-alt:2.15pt 5.75pt 2.15pt .5pt'> <tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes;height:29.8pt'> <td width=227 valign=top style='width:170.1pt;border:solid black 1.0pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 5.75pt 2.15pt .5pt;height:29.8pt'>

      Your Sentences

      </td> <td width=113 valign=top style='width:85.05pt;border:solid black 1.0pt; border-left:none;mso-border-left-alt:solid black .25pt;mso-border-top-alt: 1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 5.75pt 2.15pt .5pt; height:29.8pt'>

      REAGENT or

      RESOURCE

      </td> <td width=94 valign=top style='width:70.85pt;border:solid black 1.0pt; border-left:none;mso-border-left-alt:solid black .25pt;mso-border-top-alt: 1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 5.75pt 2.15pt .5pt; height:29.8pt'>

      SOURCE

      </td> <td width=227 valign=top style='width:170.1pt;border:solid black 1.0pt; border-left:none;mso-border-left-alt:solid black .25pt;mso-border-top-alt: 1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 5.75pt 2.15pt .5pt; height:29.8pt'>

      IDENTIFIER

      </td> </tr> <tr style='mso-yfti-irow:1;height:26.75pt'> <td width=227 valign=top style='width:170.1pt;border-top:none;border-left: solid black 1.0pt;border-bottom:solid black 1.0pt;border-right:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:solid black 1.0pt; mso-border-left-alt:solid black .25pt;mso-border-bottom-alt:solid black 1.0pt; padding:2.15pt 5.75pt 2.15pt .5pt;height:26.75pt'>

      <o:p> </o:p>

      </td> <td width=208 colspan=2 style='width:155.9pt;border:none;border-bottom:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;padding:2.15pt 5.75pt 2.15pt .5pt; height:26.75pt'>

      <u style='text-underline:black'>Software and Algorithms</u>

      </td> <td width=227 valign=top style='width:170.1pt;border-top:none;border-left: none;border-bottom:solid black 1.0pt;border-right:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:solid black 1.0pt; mso-border-bottom-alt:solid black 1.0pt;mso-border-right-alt:solid black .25pt; padding:2.15pt 5.75pt 2.15pt .5pt;height:26.75pt'>

      <o:p> </o:p>

      </td> </tr> <tr style='mso-yfti-irow:2;mso-yfti-lastrow:yes;height:53.8pt'> <td width=227 valign=top style='width:170.1pt;border:solid black 1.0pt; border-top:none;mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt; mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 5.75pt 2.15pt .5pt; height:53.8pt'>

      <span style='font-size:11.0pt;line-height:107%'>Microsoft Excel <span class=GramE>( MS</span> Excel 2013 ,</span>

      <span class=GramE><span style='font-size:11.0pt;line-height: 107%'>v.15.0 )</span></span><span style='font-size:11.0pt;line-height:107%'> was used for data collection of the epidemiological and clinical information .</span>

      </td> <td width=113 valign=bottom style='width:85.05pt;border-top:none;border-left: none;border-bottom:solid black 1.0pt;border-right:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;mso-border-left-alt:solid black .25pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 5.75pt 2.15pt .5pt;height:53.8pt'>

      <span style='font-size:11.0pt;line-height:107%'>Microsoft Excel</span>

      </td> <td width=94 valign=top style='width:70.85pt;border-top:none;border-left: none;border-bottom:solid black 1.0pt;border-right:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;mso-border-left-alt:solid black .25pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 5.75pt 2.15pt .5pt;height:53.8pt'>

      <o:p> </o:p>

      </td> <td width=227 valign=bottom style='width:170.1pt;border-top:none;border-left: none;border-bottom:solid black 1.0pt;border-right:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;mso-border-left-alt:solid black .25pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 5.75pt 2.15pt .5pt;height:53.8pt'>

      <span style='font-size:11.0pt;line-height:107%;color:gray'>Suggestion: (Microsoft Excel,</span>

      <span style='font-size:11.0pt;line-height:107%;color:gray'>RRID:SCR_016137)</span><span style='font-size:11.0pt;line-height:107%;color:black;text-decoration:none; text-underline:none'>(</span><span style='font-size:11.0pt;line-height:107%;color:blue'> link</span><span style='font-size:11.0pt;line-height:107%'>)</span>

      </td> </tr> </table> <span style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:105%; font-family:"Times New Roman",serif;mso-fareast-font-family:"Times New Roman"; color:black;mso-ansi-language:EN-US;mso-fareast-language:EN-US;mso-bidi-language: AR-SA'><br clear=all style='mso-special-character:line-break;page-break-before: always'> </span>

      <o:p> </o:p>

      Other Entities Detected

      <table class=TableGrid border=0 cellspacing=0 cellpadding=0 width=661 style='width:496.05pt;border-collapse:collapse;mso-yfti-tbllook:1184; mso-padding-alt:2.15pt 2.7pt 2.15pt .5pt'> <tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes;height:15.4pt'> <td width=265 valign=top style='width:198.45pt;border:solid black 1.0pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 2.7pt 2.15pt .5pt;height:15.4pt'>

      Your Sentences

      </td> <td width=397 valign=top style='width:297.65pt;border:solid black 1.0pt; border-left:none;mso-border-left-alt:solid black .25pt;mso-border-top-alt: 1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 2.7pt 2.15pt .5pt; height:15.4pt'>

      Recognized Entity

      </td> </tr> <tr style='mso-yfti-irow:1;height:15.4pt'> <td width=661 colspan=2 valign=top style='width:496.05pt;border:solid black 1.0pt; border-top:none;mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt; mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 2.7pt 2.15pt .5pt; height:15.4pt'>

      Oligonucleotides

      </td> </tr> <tr style='mso-yfti-irow:2;height:40.6pt'> <td width=265 valign=top style='width:198.45pt;border:solid black 1.0pt; border-top:none;mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt; mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 2.7pt 2.15pt .5pt; height:40.6pt'>

      <span style='font-size:11.0pt;line-height:107%'>Forward primer</span>

      <span style='font-size:11.0pt;line-height:107%'>CCCTGTGGGTTTTACACTTAA; Reverse primer ACGATTGTGCATCAGCTGA;</span>

      </td> <td width=397 valign=bottom style='width:297.65pt;border-top:none;border-left: none;border-bottom:solid black 1.0pt;border-right:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;mso-border-left-alt:solid black .25pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 2.7pt 2.15pt .5pt;height:40.6pt'>

      <span style='font-size:11.0pt;line-height:107%'>CCCTGTGGGTTTTACACTTAA</span>

      </td> </tr> <tr style='mso-yfti-irow:3;height:40.6pt'> <td width=265 valign=top style='width:198.45pt;border:solid black 1.0pt; border-top:none;mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt; mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 2.7pt 2.15pt .5pt; height:40.6pt'>

      <span style='font-size:11.0pt;line-height:107%'>The probe 5#-VIC-</span>

      <span style='font-size:11.0pt;line-height:107%'>CCGTCTGCGGTATGTGG</span>

      <span style='font-size:11.0pt;line-height:107%'>AAAGGTTATGG-BHQ1-3# Target 2 <span class=GramE>( N</span>):</span>

      </td> <td width=397 valign=bottom style='width:297.65pt;border-top:none;border-left: none;border-bottom:solid black 1.0pt;border-right:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;mso-border-left-alt:solid black .25pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 2.7pt 2.15pt .5pt;height:40.6pt'>

      <span style='font-size:11.0pt;line-height:107%'>5#-VIC-CCGTCTGCGGTATGTGG AAAGGTTATGG-</span>

      <span style='font-size:11.0pt;line-height:107%'>BHQ1-3#</span>

      </td> </tr> <tr style='mso-yfti-irow:4;height:53.8pt'> <td width=265 valign=top style='width:198.45pt;border:solid black 1.0pt; border-top:none;mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt; mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 2.7pt 2.15pt .5pt; height:53.8pt'>

      <span style='font-size:11.0pt;line-height:107%'>Forward primer</span>

      <span class=GramE><span style='font-size:11.0pt;line-height: 107%'>GGGGAACTTCTCCTGCTAGAAT;</span></span>

      <span style='font-size:11.0pt;line-height:107%'>Reverse primer</span>

      <span style='font-size:11.0pt;line-height:107%'>CAGACATTTTGCTCTCAAGCTG;</span>

      </td> <td width=397 valign=bottom style='width:297.65pt;border-top:none;border-left: none;border-bottom:solid black 1.0pt;border-right:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;mso-border-left-alt:solid black .25pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 2.7pt 2.15pt .5pt;height:53.8pt'>

      <span style='font-size:11.0pt;line-height:107%'>GGGGAACTTCTCCTGCTAGAAT</span>

      </td> </tr> <tr style='mso-yfti-irow:5;mso-yfti-lastrow:yes;height:40.6pt'> <td width=265 valign=top style='width:198.45pt;border:solid black 1.0pt; border-top:none;mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt; mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 2.7pt 2.15pt .5pt; height:40.6pt'>

      <span style='font-size:11.0pt;line-height:107%'>The probe 5#-FAM-</span>

      <span style='font-size:11.0pt;line-height:107%'>TTGCTGCTGCTTGACAGATT-TAM</span>

      <span style='font-size:11.0pt;line-height:107%'>RA-3<span class=GramE># .</span></span>

      </td> <td width=397 valign=bottom style='width:297.65pt;border-top:none;border-left: none;border-bottom:solid black 1.0pt;border-right:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;mso-border-left-alt:solid black .25pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 2.7pt 2.15pt .5pt;height:40.6pt'>

      <span style='font-size:11.0pt;line-height:107%'>5#-FAM- TTGCTGCTGCTTGACAGATT-TAM RA-3#</span>

      </td> </tr> </table>

      <span class=SpellE>SciScore</span> is an <u style='text-underline:black'>automated tool</u> that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. <span class=SpellE>SciScore</span> is not a substitute for expert review. <span class=SpellE>SciScore</span> checks for the presence and correctness of RRIDs (research resource identifiers) in the <span class=GramE>manuscript, and</span> detects sentences that appear to be missing RRIDs. <span class=SpellE>SciScore</span> also checks to make sure that rigor criteria are addressed by authors. It does this by detecting sentences that discuss criteria such as blinding or power analysis. <span class=SpellE>SciScore</span> does not guarantee that the rigor criteria that it detects are appropriate for the <span class=GramE>particular study</span>. Instead it assists authors, editors, and reviewers by drawing attention to sections of the manuscript that contain or should contain various rigor criteria and key resources.

      <u style='text-underline: black'>Rigor Table:</u>

      In the rigor table (table 1 of this report), <span class=SpellE>SciScore</span> highlights sentences that include various elements of rigor as described by <span class=SpellE>Hackam</span> and <span class=SpellE>Redelmeier</span> in <span style='color:blue'>2006</span>, and by van der Warp and colleagues in <span style='color:blue'>2010</span>. <span class=SpellE>SciScore</span> was trained using sentences from thousands of published papers that were tagged by expert curators to indicate that the sentence described blinding (either during the experiment or during data analysis), group selection criteria such as how subjects were randomized, power analysis (statistical test), or sex as a biological variable. If a cell line is detected then <span class=SpellE>SciScore</span> ‘expects’ that cell line authentication criteria are described, a cell line is not detected this section of the table will not be visible or scored. When a criterion is expected, but a sentence that addresses the criterion is not detected by <span class=SpellE>SciScore</span>, the statement “Not Detected” is given. It is possible that a criterion is not necessary for a <span class=GramE>particular manuscript</span> or that <span class=SpellE>SciScore</span>, an automated tool, makes a mistake. If <span class=SpellE>SciScore</span> makes substantial mistakes with your manuscript, please <span style='color: blue'>contact us </span><span style='mso-spacerun:yes'> </span>to help us learn from our mistakes. Please see the <span style='color:blue'>FAQ </span><span style='mso-spacerun:yes'> </span>for more details.

      <u style='text-underline: black'>Scoring for Rigor Table (total 5 points):</u>

      The rigor table makes up 5 points of the total score. Those five points are split evenly among the expected rigor criteria, each criterion being worth five divided by the number of rows in the table points. Scores are rounded to the nearest whole number. For each sentence that describes an expected rigor criterion, such as blinding, <span class=SpellE>SciScore</span> adds the fractional number of points for that criterion, and if it is unable to find a statement on blinding then this section is labeled "Not Detected" and receives a score of 0. To improve detection, please make sure that your language is clear and written in standard English.

      <u style='text-underline: black'>Key Resources Table</u>

      The key resources table (table 2 of this report), contains two types of things that are detected automatically by <span class=SpellE>SciScore</span>:

      <span style='mso-bidi-font-size:12.0pt;line-height:105%'><span style='mso-list:Ignore'>1.<span style='font:7.0pt "Times New Roman"'>  </span></span></span>RRIDs, research resource identifiers

      <span style='mso-bidi-font-size:12.0pt;line-height:105%'><span style='mso-list:Ignore'>2.<span style='font:7.0pt "Times New Roman"'>  </span></span></span>Sentences that “should” have RRIDs

      RRIDs, are unique identifiers for reagents and other resources that largely overlap those resources that have been labeled as particularly problematic by the National Institutes of Health in recent changes to grant review criteria, please see <span style='color:blue'>"key biological resources"</span>, e.g., antibodies, cell lines and transgenic organisms. The RRID initiative is led by community repositories that provide persistent unique identifiers to their resources, such as transgenic mice, salamanders, antibodies, cell lines, plasmids and software projects such as statistical software. RRIDs are described in a primer by Bandrowski and Martone in<span style='color:blue'>2016</span>.

      RRIDs are unique numbers that resolve to a particular database record, for example the <span class=GramE>RRID:CVCL</span>_0063 resolves to this record for a cell line:

      <span style='color:blue'>https://web.expasy.org/cellosaurus/CVCL_0063</span>

      The information in that database is structured and curated by <span class=SpellE>Cellosaurus</span> staff, the authority for cell lines. If authors use this RRID then <span class=SpellE>SciScore</span> will ask the database about the number. Once an RRID is found in the database, <span class=SpellE>SciScore</span> attempts to match text in the sentence with the database record, most often it attempts to find the name of the resource, in this case HEK293T, and information about the company or catalog number to verify that authors have put the right RRID in the sentence. If a typo is made by authors, that renders the RRID not valid, the RRID column will be blank (table 3 will contain the RRID in the unresolved RRID column in red). If an RRID was submitted to the authority by authors, it often takes a week or more to become available in the resolver database, thus exercise caution in the interpretation of the <span class=SpellE>SciScore</span> report in cases of newly minted RRIDs.

      Sentences that should have RRIDs are detected by <span class=SpellE>SciScore</span>, by looking for patterns in a sentence that are <span class=GramE>similar to</span> how cell lines or antibodies are described in published papers. A sentence that describes one or more antibodies may be detected by <span class=SpellE>SciScore</span> and this will be placed into the table without a corresponding RRID. <span class=SpellE>SciScore</span> will attempt to find the name(s) and catalog numbers of the resource. In cases where the tool is relatively confident, it will suggest an RRID. The suggested RRID appears in gray with a link to the RRID website where authors must confirm that the RRID found by <span class=SpellE>SciScore</span> is the correct RRID.

      <u style='text-underline: black'>Note of caution:</u>

      Please verify all RRID suggestions, only the author can know whether suggestions are correct.

      <u style='text-underline: black'>Scoring for Resources Table (total 5 points):</u>

      Each resource that is detected is scored, and the total is 5 points, with scores rounded to the nearest whole number. For each RRID detected, points are awarded, but for each sentence that is detected that does not contain an RRID, points are not awarded. If <span class=SpellE>SciScore</span> detects catalog numbers or relatively unambiguous resources, partial points are awarded. For each RRID that does not resolve properly only partial points are also awarded. Therefore, the way to maximize the points from this section is to add RRIDs, and proper citations that include vendor names, catalog numbers, lot and version numbers into the methods section of the manuscript.

      <u style='text-underline: black'>Incorrect sentences:</u>

      <span class=SpellE>SciScore</span> is a text analysis tool, and it is therefore susceptible to making two types of errors, false positives or false negatives.

      False <span class=SpellE><span class=GramE>negatives:<span style='font-weight:normal'>The</span></span></span> most common error occurs when the algorithm fails to detect a sentence that contains an antibody or another resource. False negatives generally occur either because the sentence is complex or in a less common syntax pattern. Generally simple sentences in clear standard English are simpler to process and result in few false negatives. If a truly complex sentence structure is required to describe reagents, a table may help not only <span class=SpellE>SciScore</span>, but also human readers. If an RRID is detected in a sentence, <span class=SpellE>SciScore</span> will be triggered to <span class=GramE>take a look</span> at the sentence, which may have been skipped otherwise.

      False positives: This type of error includes cases where a sentence does not contain an antibody, but the algorithm asserts that this sentence does have an antibody. If many resources are used and all have RRIDs, a single false positive will not reduce the score substantially. But if only 1-2 resources are used, then a false positive can reduce your <span class=SpellE>SciScore</span> needlessly. False positives are most often seen in the tools portion of table 2, as the algorithm detects company names, where it should not. We try to minimize these false positives using several strategies. If this impacts your score, please contact our team (http:// sciscore.com) and include the sentence where <span class=SpellE>SciScore</span> made the error. While we can't fix the score, we can learn from our mistakes.

      </div> </body>

      </html>

  14. Feb 2020
    1. Chrome extension

      Works with Chrome and other Chromium-based browsers including Brave and Edge.

  15. Jan 2020
    1. In 2013 to 2014, Nature made a significant push with authors to address rigor criteria. We plotted the average SciScore along with its components over this period (Fig 3) and found that the average score rose by nearly 2 points over just a few years.

      This is what progress on reproducibility looks like.

    2. Google Sheets

      RRID? 😂

    3. for

      delete

    1. is the “Prelude in C Major” by J. S. Bach. There is no real tune,
    2. 110Hz) and the note an octave above it, A3 (220Hz).
    3. The same is true, to a lesser extent, for notes a tone apart, so any consecutive notes from a scale will clash if they are played at the same time. For this reason, a chord made up of the notes A, B, and C, for example, would sound very anguished indeed, as the B would clash with both the A and the C. This sort of chord would not be of much use in accompanying a melody, but it would be right at home in something very tense like “The Devil’s Staircase.

    1. RRID:AB_1281337

      DOI: 10.1016/j.molcel.2019.02.024

      Resource: (Cell Signaling Technology Cat# 9728, RRID:AB_1281338)

      Curator: @evieth

      SciCrunch record: RRID:AB_1281337

      Curator comments: Cell Signaling Technology Cat# 9728, Di-Methyl-Histone H3 (Lys27) (D18C8) XP Rabbit mAb antibody


      What is this?

    1. Single quotes return text strings.  Double quotes return (if you can really think of them as “returning” anything) identifiers, but with the case preserved.
  16. Dec 2019
    1. target

      Omitting the target creates an annotation that the Hypothesis client will classify as a pagenote and display in the pagenotes tab.

    1. permissions

      cf https://github.com/FrankensteinVariorum/fv-data/issues/20:

      "All annotations belong to one group. They cannot currently be moved to another group after creation.

      Annotations have a boolean flag indicating whether they are visible only to the creator or shared with other members of the group."

      The permissions structure in API responses exists only for backwards compatibility, but you can't actually make use of the full flexibility implied by it.

  17. Nov 2019
    1. Search for annotations

      If you are searching a private group you will need to make an authenticated API call using a token representing a member of the group.

      The https://h.readthedocs.io/en/latest/api-reference/v2/#section/Authentication/ApiKey method is the easiest and most popular way for standalone API-based scripts to authenticate.

      To generate a token, log in to Hypothesis, go to https://hypothes.is/account/developer, click the button, and copy the token.

      To use it in a REST API call, add the header:

      Authorization: Bearer {your token}

      An example in JavaScript: https://github.com/judell/hlib/blob/master/hlib.ts#L480

      In Python: https://github.com/judell/Hypothesis/blob/master/hypothesis.py#L143

    1. If the final system is completely different than the prototype, users may be confused about how it operates.

      That's one reason not to invest in design polish. An ugly-but-functional prototype doesn't pretend to be a polished product or invite confusion with it.

    1. you need to see and feel the interactions rendered by software to know if you’ve nailed the experience.

      And if at all possible, you need to the interaction to be infused with your data.

    2. Regardless of the method you use, prototyping is no longer just a nice-to-have. Aligning a multi-disciplined team and ensuring that everyone comes away with a completely clear picture of the intended interaction design is key to successful product development, and building experiences that customers will ultimately love.
  18. Oct 2019
    1. With pywb 2.3.0, the client-side rewriting system exists in a separate module at https://github.com/webrecorder/wombat`
    1. query Parameters

      There is also an undocumented parameter, _separate_replies. When the value is "true" the response object has, instead of a rows key, a pair of keys: rows and replies.

      When the /api/search endpoint is invoked this way, the Hypothesis server ensures that all replies for each found annotation are included in the response. This enables the Hypothesis client to render complete threads for each API gulp of 200.

      As suggested by the underscore prefix, the _separate_replies was not intended to be a formal part of the API, and is expected to be made obsolete by a rethink of how the API deals with threaded conversations.

  19. Nov 2018
  20. github.com github.com