5,344 Matching Annotations
  1. Last 7 days
    1. puzzling, intriguing, or ambiguous

      These are nice examples of recommended tags that could be signaled using inline hashtags or actual Hypothesis tags.

      Either way, it's effort to send those signals, so there needs to be feedback that shows they've been received and enables folks to observe the response matrix.

      A view of that matrix that doesn't require visiting crowdlaaers or facet might be helpful.

  2. Oct 2020
  3. Sep 2020
    1. A testing system built close to the web rendering system itself

      I've arrived at something like this, albeit for very simple web apps. It feels promising but I am not the person to advance the idea.

      It's highly congruent with puppeteer, but not joined at the hip.

  4. blog.cjeller.site blog.cjeller.site
    1. Just when I entered a PhD program for classical guitar, the path soured for me.

      Why?

    1. Meanwhile subjects are left to perform the "interpretive labor" as David Graeber calls it of understanding the system, what it allows or doesn't, and how it can be bent to accomplish their goals.

      Jack Ozzie's term for interpretive labor: context assembly.

    1. privatedichotomyinwhichtheworkofproductionwasassignedtothepublicsphereandtheworkofreproductiontotheprivatesphere
    2. Ihaveexploredelsewhere,themotherhoodmemoirreinscribesor,moreaccurately,naturalizesandnormalizes
    3. InmyearlierworkIusedtheterm“empoweredmothering”tosignifynon-patriarchalmaternityoroutlawmotherhood;
    4. DouglasandMichaelsgoontoexplain,“Thenewmomisminvolvesmorethanjustimpossibleidealsaboutwomen’schildrearing;itredefinesallwomen,firstandforemost,throughtheirrelationshipstochildren.
    5. ErikaHorwitz’sstudy-(2003)on empoweredmotheringrevealsthatthepracticeofoutlawmotherhoodmaybecharacterizedbyseventhemes:Theimportanceofmothersmeetingtheirownneeds;BeingaMotherdoesnotfulfillallofawoman’sneeds;Involvingothersintheirchil­dren’supbringing;Activelyquestioningtheexpectationsthatareplacedonmothersbysociety;
    6. ErikaHorwitz’sstudy-(2003)
    7. asapatriarchalinstitution
    8. WomanBorn:MotherhoodasExperienceandInstitution
    1. illustrative examples

      This annotation will be anchored using a standalone technique that works independently from the Hypothesis client.

  5. Aug 2020
    1. annotated eq3 in the presence of <link rel="canonical" href="https://jonudell.info/test/EQ">

    2. annotated eq4 in the presence of <link rel="canonical" href="https://jonudell.info/test/EQ">

    3. annotating eq3 in the presence of

      <link rel="canonical" href="https://jonudell.info/test/EQ">

    4. initial annotation of eq4

    5. initial annotation of eq3

    1. 2nd annotation of eq2.html in the presence of:

      <link rel="canonical" href="https://jonudell.info/test/eq">

    2. 2nd annotation in the presence of:

      <link rel="canonical" href="https://jonudell.info/test/eq">

    3. initial annotation of eq2

    4. initial annotation of eq1

  6. Jul 2020
    1. <iframe width="600" height="600" frameBorder="0" src="https://flipgrid.com/udell7350?embed=true" webkitallowfullscreen mozallowfullscreen allowfullscreen allow="microphone; camera"></iframe>
  7. Jun 2020
    1. When I need to trace behavior in the client, I build an alternate version of the official Hypothesis extension like so:

      1 In the client repo, set IS_PRODUCTION_BUILD false in the client's gulpfile.js (this turns off minify), then gulp build

      2 In the extension repo:

      make clean
      make SETTINGS_FILE=settings/chrome-prod.json
      

      3 Load the unpacked extension (in Chrome/Brave/Edge) from the build directory.

      Now you can debug in the unminified client.

      Note that because this extension shares a key with the production extension, any changes you make will soon be overwritten. If you want a persistent alternate client you need to use a different key. This technique is specifically for debugging an unminified client.

    1. make

      The bare make command does nothing.

      On Ubuntu 18.04, yarn install tells me:

      error puppeteer@3.2.0: The engine "node" is incompatible with this module. Expected version ">=10.18.1". Got "10.15.3"

      A workaround for upgrading node appears to be:

      yarn install --ignore-engines

  8. Apr 2020
    1. <table> <thead><tr> <th>Tables</th> <th style="text-align:center">Are</th> <th style="text-align:right">Cool</th> </tr> </thead> <tbody> <tr> <td>col 3 is</td> <td style="text-align:center">right-aligned</td> <td style="text-align:right">$1600</td> </tr> <tr> <td>col 2 is</td> <td style="text-align:center">centered</td> <td style="text-align:right">$12</td> </tr> <tr> <td>zebra stripes</td> <td style="text-align:center"><del>are neat</del></td> <td style="text-align:right">$1</td> </tr> </tbody> </table>
  9. Mar 2020
    1. SciScore for 10.1101/782409: 4 (What is this?)

      Table 1: Rigor

      <table><tr"><td style="margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="border-bottom:1px solid lightgray">The experimental protocol was reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) at Loyola University Chicago (IACUC#: 2016-029).</td></tr><tr"><td style="margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="border-bottom:1px solid lightgray">not detected.</td></tr><tr"><td style="margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="border-bottom:1px solid lightgray">C57BL/6 female mice were purchased from The Jackson Laboratory and maintained in the Comparative Medicine Facility of Loyola University Chicago.</td></tr><tr"><td style="margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><td style="text-align:center; padding-top:4px;" colspan="2">Antibodies</td></tr><tr><td style="text=align:center">Sentences</td><td style="text-align:center">Resources</td></tr><tr><td style="vertical-align:top;border-bottom:1px solid lightgray">The membrane was incubated with either polyclonal rabbit anti-GFP antibody ( A11122 , Life Technologies ) for the protease assay , or mouse anti-flag ( F3165 , Sigma ) for the DUB assay .</td><td style="border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>anti-GFP</div> <div>suggested: (Molecular Probes Cat# A-11122, AB_221569)</div> </div> <div style="margin-bottom:8px"> <div>anti-flag ( F3165</div> <div>suggested: None</div> </div> </td></tr><tr><td style="vertical-align:top;border-bottom:1px solid lightgray">The membrane was then washed three times for 15 minutes in TBST buffer followed by incubation with either secondary donkey anti-rabbit-HRP antibody ( 711-035-152 , Jackson ImmunoResearch ) or goat anti-mouse-HRP antibody ( 1010-05 , SouthernBiotech) .</td><td style="border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>anti-rabbit-HRP</div> <div>suggested: (Kindle Biosciences Cat# R1006, AB_2800464)</div> </div> <div style="margin-bottom:8px"> <div>anti-mouse-HRP</div> <div>suggested: (Kindle Biosciences Cat# R1005, AB_2800463)</div> </div> </td></tr><tr><td style="vertical-align:top;border-bottom:1px solid lightgray">The expression of PLP2 , β-actin , and calnexin were probed with mouse anti-V5 antibody ( R960 , ThermoFisher) , mouse anti–β-actin ( A00702 , Genscript) , or mouse anti-calnexin antibody ( 2433S , Cell Signaling) , respectively .</td><td style="border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>PLP2</div> <div>suggested: None</div> </div> <div style="margin-bottom:8px"> <div>β-actin</div> <div>suggested: None</div> </div> <div style="margin-bottom:8px"> <div>anti-V5</div> <div>suggested: (Thermo Fisher Scientific Cat# R960-25, AB_2556564)</div> </div> <div style="margin-bottom:8px"> <div>mouse anti-calnexin antibody</div> <div>suggested: None</div> </div> <div style="margin-bottom:8px"> <div>anti-calnexin</div> <div>suggested: (Cell Signaling Technology Cat# 2433, AB_2243887)</div> </div> </td></tr><tr><td style="text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</td></tr><tr><td style="text=align:center">Sentences</td><td style="text-align:center">Resources</td></tr><tr><td style="vertical-align:top;border-bottom:1px solid lightgray">Cells Human embryonic kidney ( HEK ) 293T cells were purchased the from American Type Culture Collection ( ATCC , # CRL-11268 ) and maintained in DMEM ( #10-017-CV , Corning ) containing 10 % fetal calf serum ( FCS ) and supplemented with 1 % nonessential amino acids , 1 % HEPES , 2 % L-glutamine , 1 % sodium pyruvate , and 1 % penicillin/streptomycin .</td><td style="border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>HEK</div> <div>suggested: None</div> </div> <div style="margin-bottom:8px"> <div>293T</div> <div>suggested: ATCC Cat# CRL-11268, CVCL_1926</div> </div> </td></tr><tr><td style="vertical-align:top;border-bottom:1px solid lightgray">Protease and deubiquitinating activity assays To determine the protease activity of PLP2 , HEK293T cells grown to 70 % confluency in 24-well plates ( Corning ) were transfected using TransIT-LT1 ( MIR2300 , Mirus ) according to the manufacturer’s protocol .</td><td style="border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>HEK293T</div> <div>suggested: None</div> </div> </td></tr><tr><td style="text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</td></tr><tr><td style="text=align:center">Sentences</td><td style="text-align:center">Resources</td></tr><tr><td style="vertical-align:top;border-bottom:1px solid lightgray">C57BL/6 female mice were purchased from The Jackson Laboratory and maintained in the Comparative Medicine Facility of Loyola University Chicago.</td><td style="border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>C57BL/6</div> <div>suggested: None</div> </div> </td></tr><tr><td style="text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</td></tr><tr><td style="text=align:center">Sentences</td><td style="text-align:center">Resources</td></tr><tr><td style="vertical-align:top;border-bottom:1px solid lightgray">Graphs of virus kinetics were generated using Prism software ( GraphPad Software ) .</td><td style="border-bottom:1px solid lightgray"> <div style="margin-bottom:8px"> <div>Prism</div> <div>suggested: (PRISM, SCR_005375)</div> </div> <div style="margin-bottom:8px"> <div>GraphPad</div> <div>suggested: (GraphPad Prism, SCR_002798)</div> </div> </td></tr></table>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore is not a substitute for expert review. SciScore checks for the presence and correctness of RRIDs (research resource identifiers) in the manuscript, and detects sentences that appear to be missing RRIDs. SciScore also checks to make sure that rigor criteria are addressed by authors. It does this by detecting sentences that discuss criteria such as blinding or power analysis. SciScore does not guarantee that the rigor criteria that it detects are appropriate for the particular study. Instead it assists authors, editors, and reviewers by drawing attention to sections of the manuscript that contain or should contain various rigor criteria and key resources. For details on the results shown here, please follow this link.

    1. <html xmlns:v="urn:schemas-microsoft-com:vml" xmlns:o="urn:schemas-microsoft-com:office:office" xmlns:w="urn:schemas-microsoft-com:office:word" xmlns:m="http://schemas.microsoft.com/office/2004/12/omml" xmlns="http://www.w3.org/TR/REC-html40">

      <head> <meta http-equiv=Content-Type content="text/html; charset=windows-1252"> <meta name=ProgId content=Word.Document> <meta name=Generator content="Microsoft Word 15"> <meta name=Originator content="Microsoft Word 15"> <link rel=File-List href="covid_files/filelist.xml"> <link rel=themeData href="covid_files/themedata.thmx"> <link rel=colorSchemeMapping href="covid_files/colorschememapping.xml"> <style> </style> </head><body lang=EN-US style='tab-interval:.5in'> <div class=WordSection1>

      <span class=SpellE><span style='font-size:14.0pt;mso-bidi-font-size:11.0pt;line-height:108%'>SciScore</span></span><span style='font-size:14.0pt;mso-bidi-font-size:11.0pt;line-height:108%'>: 6 </span><span style='color:blue'>What's this?</span>

      Document Identifier: 3879

      Below you will find two tables showing the results of <span class=SpellE>SciScore</span>. Your score is calculated based on adherence to guidelines for scientific rigor (Table 1) and identification of key biological resources (Table 2). Points are given when <span class=SpellE>SciScore</span> detects appropriate information in the text. Details on each criteria and recommendations on how to improve the score are appended to the bottom of this report.

      Table 1: Rigor Adherence Table

      <table class=TableGrid border=0 cellspacing=0 cellpadding=0 width=661 style='width:496.05pt;border-collapse:collapse;mso-yfti-tbllook:1184; mso-padding-alt:0in 4.75pt 0in 6.15pt'> <tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes;height:26.75pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;mso-border-top-alt: 1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt; height:26.75pt'>

      <u style='text-underline:black'>Institutional Review Board Statement</u>

      </td> </tr> <tr style='mso-yfti-irow:1;height:38.75pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:38.75pt'>

      <span style='font-size:11.0pt;line-height:107%'>IRB: Ethics approval was obtained from the Ethics Committee of Guangzhou Women and Children’s Medical Center and written informed consents were obtained from the parents of the included children.</span>

      </td> </tr> <tr style='mso-yfti-irow:2;height:38.75pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:38.75pt'>

      <span style='font-size:11.0pt;line-height:107%'>Consent: Ethics approval was obtained from the Ethics Committee of Guangzhou Women and Children’s Medical Center and written informed consents were obtained from the parents of the included children.</span>

      </td> </tr> <tr style='mso-yfti-irow:3;height:26.75pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:26.75pt'>

      <u style='text-underline:black'>Randomization</u>

      </td> </tr> <tr style='mso-yfti-irow:4;height:25.55pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:25.55pt'>

      <span style='font-size:11.0pt;line-height:107%'>not detected.</span>

      </td> </tr> <tr style='mso-yfti-irow:5;height:26.75pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:26.75pt'>

      <u style='text-underline:black'>Blinding</u>

      </td> </tr> <tr style='mso-yfti-irow:6;height:25.55pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:25.55pt'>

      <span style='font-size:11.0pt;line-height:107%'>not detected.</span>

      </td> </tr> <tr style='mso-yfti-irow:7;height:26.75pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:26.75pt'>

      <u style='text-underline:black'>Power Analysis</u>

      </td> </tr> <tr style='mso-yfti-irow:8;height:25.55pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:25.55pt'>

      <span style='font-size:11.0pt;line-height:107%'>not detected.</span>

      </td> </tr> <tr style='mso-yfti-irow:9;height:26.75pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:26.75pt'>

      <u style='text-underline:black'>Sex as a biological variable</u>

      </td> </tr> <tr style='mso-yfti-irow:10;mso-yfti-lastrow:yes;height:25.55pt'> <td width=661 style='width:496.05pt;border:solid black 1.0pt;border-top:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt;mso-border-left-alt: .25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt: black;mso-border-style-alt:solid;padding:0in 4.75pt 0in 6.15pt;height:25.55pt'>

      <span style='font-size:11.0pt;line-height:107%'>not detected.</span>

      </td> </tr> </table>

      Table 2: Key Resources Table

      <table class=TableGrid border=0 cellspacing=0 cellpadding=0 width=661 style='width:496.05pt;border-collapse:collapse;mso-yfti-tbllook:1184; mso-padding-alt:2.15pt 5.75pt 2.15pt .5pt'> <tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes;height:29.8pt'> <td width=227 valign=top style='width:170.1pt;border:solid black 1.0pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 5.75pt 2.15pt .5pt;height:29.8pt'>

      Your Sentences

      </td> <td width=113 valign=top style='width:85.05pt;border:solid black 1.0pt; border-left:none;mso-border-left-alt:solid black .25pt;mso-border-top-alt: 1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 5.75pt 2.15pt .5pt; height:29.8pt'>

      REAGENT or

      RESOURCE

      </td> <td width=94 valign=top style='width:70.85pt;border:solid black 1.0pt; border-left:none;mso-border-left-alt:solid black .25pt;mso-border-top-alt: 1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 5.75pt 2.15pt .5pt; height:29.8pt'>

      SOURCE

      </td> <td width=227 valign=top style='width:170.1pt;border:solid black 1.0pt; border-left:none;mso-border-left-alt:solid black .25pt;mso-border-top-alt: 1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 5.75pt 2.15pt .5pt; height:29.8pt'>

      IDENTIFIER

      </td> </tr> <tr style='mso-yfti-irow:1;height:26.75pt'> <td width=227 valign=top style='width:170.1pt;border-top:none;border-left: solid black 1.0pt;border-bottom:solid black 1.0pt;border-right:none; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:solid black 1.0pt; mso-border-left-alt:solid black .25pt;mso-border-bottom-alt:solid black 1.0pt; padding:2.15pt 5.75pt 2.15pt .5pt;height:26.75pt'>

      <o:p> </o:p>

      </td> <td width=208 colspan=2 style='width:155.9pt;border:none;border-bottom:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;padding:2.15pt 5.75pt 2.15pt .5pt; height:26.75pt'>

      <u style='text-underline:black'>Software and Algorithms</u>

      </td> <td width=227 valign=top style='width:170.1pt;border-top:none;border-left: none;border-bottom:solid black 1.0pt;border-right:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:solid black 1.0pt; mso-border-bottom-alt:solid black 1.0pt;mso-border-right-alt:solid black .25pt; padding:2.15pt 5.75pt 2.15pt .5pt;height:26.75pt'>

      <o:p> </o:p>

      </td> </tr> <tr style='mso-yfti-irow:2;mso-yfti-lastrow:yes;height:53.8pt'> <td width=227 valign=top style='width:170.1pt;border:solid black 1.0pt; border-top:none;mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt; mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 5.75pt 2.15pt .5pt; height:53.8pt'>

      <span style='font-size:11.0pt;line-height:107%'>Microsoft Excel <span class=GramE>( MS</span> Excel 2013 ,</span>

      <span class=GramE><span style='font-size:11.0pt;line-height: 107%'>v.15.0 )</span></span><span style='font-size:11.0pt;line-height:107%'> was used for data collection of the epidemiological and clinical information .</span>

      </td> <td width=113 valign=bottom style='width:85.05pt;border-top:none;border-left: none;border-bottom:solid black 1.0pt;border-right:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;mso-border-left-alt:solid black .25pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 5.75pt 2.15pt .5pt;height:53.8pt'>

      <span style='font-size:11.0pt;line-height:107%'>Microsoft Excel</span>

      </td> <td width=94 valign=top style='width:70.85pt;border-top:none;border-left: none;border-bottom:solid black 1.0pt;border-right:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;mso-border-left-alt:solid black .25pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 5.75pt 2.15pt .5pt;height:53.8pt'>

      <o:p> </o:p>

      </td> <td width=227 valign=bottom style='width:170.1pt;border-top:none;border-left: none;border-bottom:solid black 1.0pt;border-right:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;mso-border-left-alt:solid black .25pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 5.75pt 2.15pt .5pt;height:53.8pt'>

      <span style='font-size:11.0pt;line-height:107%;color:gray'>Suggestion: (Microsoft Excel,</span>

      <span style='font-size:11.0pt;line-height:107%;color:gray'>RRID:SCR_016137)</span><span style='font-size:11.0pt;line-height:107%;color:black;text-decoration:none; text-underline:none'>(</span><span style='font-size:11.0pt;line-height:107%;color:blue'> link</span><span style='font-size:11.0pt;line-height:107%'>)</span>

      </td> </tr> </table> <span style='font-size:12.0pt;mso-bidi-font-size:11.0pt;line-height:105%; font-family:"Times New Roman",serif;mso-fareast-font-family:"Times New Roman"; color:black;mso-ansi-language:EN-US;mso-fareast-language:EN-US;mso-bidi-language: AR-SA'><br clear=all style='mso-special-character:line-break;page-break-before: always'> </span>

      <o:p> </o:p>

      Other Entities Detected

      <table class=TableGrid border=0 cellspacing=0 cellpadding=0 width=661 style='width:496.05pt;border-collapse:collapse;mso-yfti-tbllook:1184; mso-padding-alt:2.15pt 2.7pt 2.15pt .5pt'> <tr style='mso-yfti-irow:0;mso-yfti-firstrow:yes;height:15.4pt'> <td width=265 valign=top style='width:198.45pt;border:solid black 1.0pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 2.7pt 2.15pt .5pt;height:15.4pt'>

      Your Sentences

      </td> <td width=397 valign=top style='width:297.65pt;border:solid black 1.0pt; border-left:none;mso-border-left-alt:solid black .25pt;mso-border-top-alt: 1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 2.7pt 2.15pt .5pt; height:15.4pt'>

      Recognized Entity

      </td> </tr> <tr style='mso-yfti-irow:1;height:15.4pt'> <td width=661 colspan=2 valign=top style='width:496.05pt;border:solid black 1.0pt; border-top:none;mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt; mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 2.7pt 2.15pt .5pt; height:15.4pt'>

      Oligonucleotides

      </td> </tr> <tr style='mso-yfti-irow:2;height:40.6pt'> <td width=265 valign=top style='width:198.45pt;border:solid black 1.0pt; border-top:none;mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt; mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 2.7pt 2.15pt .5pt; height:40.6pt'>

      <span style='font-size:11.0pt;line-height:107%'>Forward primer</span>

      <span style='font-size:11.0pt;line-height:107%'>CCCTGTGGGTTTTACACTTAA; Reverse primer ACGATTGTGCATCAGCTGA;</span>

      </td> <td width=397 valign=bottom style='width:297.65pt;border-top:none;border-left: none;border-bottom:solid black 1.0pt;border-right:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;mso-border-left-alt:solid black .25pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 2.7pt 2.15pt .5pt;height:40.6pt'>

      <span style='font-size:11.0pt;line-height:107%'>CCCTGTGGGTTTTACACTTAA</span>

      </td> </tr> <tr style='mso-yfti-irow:3;height:40.6pt'> <td width=265 valign=top style='width:198.45pt;border:solid black 1.0pt; border-top:none;mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt; mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 2.7pt 2.15pt .5pt; height:40.6pt'>

      <span style='font-size:11.0pt;line-height:107%'>The probe 5#-VIC-</span>

      <span style='font-size:11.0pt;line-height:107%'>CCGTCTGCGGTATGTGG</span>

      <span style='font-size:11.0pt;line-height:107%'>AAAGGTTATGG-BHQ1-3# Target 2 <span class=GramE>( N</span>):</span>

      </td> <td width=397 valign=bottom style='width:297.65pt;border-top:none;border-left: none;border-bottom:solid black 1.0pt;border-right:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;mso-border-left-alt:solid black .25pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 2.7pt 2.15pt .5pt;height:40.6pt'>

      <span style='font-size:11.0pt;line-height:107%'>5#-VIC-CCGTCTGCGGTATGTGG AAAGGTTATGG-</span>

      <span style='font-size:11.0pt;line-height:107%'>BHQ1-3#</span>

      </td> </tr> <tr style='mso-yfti-irow:4;height:53.8pt'> <td width=265 valign=top style='width:198.45pt;border:solid black 1.0pt; border-top:none;mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt; mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 2.7pt 2.15pt .5pt; height:53.8pt'>

      <span style='font-size:11.0pt;line-height:107%'>Forward primer</span>

      <span class=GramE><span style='font-size:11.0pt;line-height: 107%'>GGGGAACTTCTCCTGCTAGAAT;</span></span>

      <span style='font-size:11.0pt;line-height:107%'>Reverse primer</span>

      <span style='font-size:11.0pt;line-height:107%'>CAGACATTTTGCTCTCAAGCTG;</span>

      </td> <td width=397 valign=bottom style='width:297.65pt;border-top:none;border-left: none;border-bottom:solid black 1.0pt;border-right:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;mso-border-left-alt:solid black .25pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 2.7pt 2.15pt .5pt;height:53.8pt'>

      <span style='font-size:11.0pt;line-height:107%'>GGGGAACTTCTCCTGCTAGAAT</span>

      </td> </tr> <tr style='mso-yfti-irow:5;mso-yfti-lastrow:yes;height:40.6pt'> <td width=265 valign=top style='width:198.45pt;border:solid black 1.0pt; border-top:none;mso-border-top-alt:solid black 1.0pt;mso-border-top-alt:1.0pt; mso-border-left-alt:.25pt;mso-border-bottom-alt:1.0pt;mso-border-right-alt: .25pt;mso-border-color-alt:black;mso-border-style-alt:solid;padding:2.15pt 2.7pt 2.15pt .5pt; height:40.6pt'>

      <span style='font-size:11.0pt;line-height:107%'>The probe 5#-FAM-</span>

      <span style='font-size:11.0pt;line-height:107%'>TTGCTGCTGCTTGACAGATT-TAM</span>

      <span style='font-size:11.0pt;line-height:107%'>RA-3<span class=GramE># .</span></span>

      </td> <td width=397 valign=bottom style='width:297.65pt;border-top:none;border-left: none;border-bottom:solid black 1.0pt;border-right:solid black 1.0pt; mso-border-top-alt:solid black 1.0pt;mso-border-left-alt:solid black .25pt; mso-border-top-alt:1.0pt;mso-border-left-alt:.25pt;mso-border-bottom-alt: 1.0pt;mso-border-right-alt:.25pt;mso-border-color-alt:black;mso-border-style-alt: solid;padding:2.15pt 2.7pt 2.15pt .5pt;height:40.6pt'>

      <span style='font-size:11.0pt;line-height:107%'>5#-FAM- TTGCTGCTGCTTGACAGATT-TAM RA-3#</span>

      </td> </tr> </table>

      <span class=SpellE>SciScore</span> is an <u style='text-underline:black'>automated tool</u> that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. <span class=SpellE>SciScore</span> is not a substitute for expert review. <span class=SpellE>SciScore</span> checks for the presence and correctness of RRIDs (research resource identifiers) in the <span class=GramE>manuscript, and</span> detects sentences that appear to be missing RRIDs. <span class=SpellE>SciScore</span> also checks to make sure that rigor criteria are addressed by authors. It does this by detecting sentences that discuss criteria such as blinding or power analysis. <span class=SpellE>SciScore</span> does not guarantee that the rigor criteria that it detects are appropriate for the <span class=GramE>particular study</span>. Instead it assists authors, editors, and reviewers by drawing attention to sections of the manuscript that contain or should contain various rigor criteria and key resources.

      <u style='text-underline: black'>Rigor Table:</u>

      In the rigor table (table 1 of this report), <span class=SpellE>SciScore</span> highlights sentences that include various elements of rigor as described by <span class=SpellE>Hackam</span> and <span class=SpellE>Redelmeier</span> in <span style='color:blue'>2006</span>, and by van der Warp and colleagues in <span style='color:blue'>2010</span>. <span class=SpellE>SciScore</span> was trained using sentences from thousands of published papers that were tagged by expert curators to indicate that the sentence described blinding (either during the experiment or during data analysis), group selection criteria such as how subjects were randomized, power analysis (statistical test), or sex as a biological variable. If a cell line is detected then <span class=SpellE>SciScore</span> ‘expects’ that cell line authentication criteria are described, a cell line is not detected this section of the table will not be visible or scored. When a criterion is expected, but a sentence that addresses the criterion is not detected by <span class=SpellE>SciScore</span>, the statement “Not Detected” is given. It is possible that a criterion is not necessary for a <span class=GramE>particular manuscript</span> or that <span class=SpellE>SciScore</span>, an automated tool, makes a mistake. If <span class=SpellE>SciScore</span> makes substantial mistakes with your manuscript, please <span style='color: blue'>contact us </span><span style='mso-spacerun:yes'> </span>to help us learn from our mistakes. Please see the <span style='color:blue'>FAQ </span><span style='mso-spacerun:yes'> </span>for more details.

      <u style='text-underline: black'>Scoring for Rigor Table (total 5 points):</u>

      The rigor table makes up 5 points of the total score. Those five points are split evenly among the expected rigor criteria, each criterion being worth five divided by the number of rows in the table points. Scores are rounded to the nearest whole number. For each sentence that describes an expected rigor criterion, such as blinding, <span class=SpellE>SciScore</span> adds the fractional number of points for that criterion, and if it is unable to find a statement on blinding then this section is labeled "Not Detected" and receives a score of 0. To improve detection, please make sure that your language is clear and written in standard English.

      <u style='text-underline: black'>Key Resources Table</u>

      The key resources table (table 2 of this report), contains two types of things that are detected automatically by <span class=SpellE>SciScore</span>:

      <span style='mso-bidi-font-size:12.0pt;line-height:105%'><span style='mso-list:Ignore'>1.<span style='font:7.0pt "Times New Roman"'>  </span></span></span>RRIDs, research resource identifiers

      <span style='mso-bidi-font-size:12.0pt;line-height:105%'><span style='mso-list:Ignore'>2.<span style='font:7.0pt "Times New Roman"'>  </span></span></span>Sentences that “should” have RRIDs

      RRIDs, are unique identifiers for reagents and other resources that largely overlap those resources that have been labeled as particularly problematic by the National Institutes of Health in recent changes to grant review criteria, please see <span style='color:blue'>"key biological resources"</span>, e.g., antibodies, cell lines and transgenic organisms. The RRID initiative is led by community repositories that provide persistent unique identifiers to their resources, such as transgenic mice, salamanders, antibodies, cell lines, plasmids and software projects such as statistical software. RRIDs are described in a primer by Bandrowski and Martone in<span style='color:blue'>2016</span>.

      RRIDs are unique numbers that resolve to a particular database record, for example the <span class=GramE>RRID:CVCL</span>_0063 resolves to this record for a cell line:

      <span style='color:blue'>https://web.expasy.org/cellosaurus/CVCL_0063</span>

      The information in that database is structured and curated by <span class=SpellE>Cellosaurus</span> staff, the authority for cell lines. If authors use this RRID then <span class=SpellE>SciScore</span> will ask the database about the number. Once an RRID is found in the database, <span class=SpellE>SciScore</span> attempts to match text in the sentence with the database record, most often it attempts to find the name of the resource, in this case HEK293T, and information about the company or catalog number to verify that authors have put the right RRID in the sentence. If a typo is made by authors, that renders the RRID not valid, the RRID column will be blank (table 3 will contain the RRID in the unresolved RRID column in red). If an RRID was submitted to the authority by authors, it often takes a week or more to become available in the resolver database, thus exercise caution in the interpretation of the <span class=SpellE>SciScore</span> report in cases of newly minted RRIDs.

      Sentences that should have RRIDs are detected by <span class=SpellE>SciScore</span>, by looking for patterns in a sentence that are <span class=GramE>similar to</span> how cell lines or antibodies are described in published papers. A sentence that describes one or more antibodies may be detected by <span class=SpellE>SciScore</span> and this will be placed into the table without a corresponding RRID. <span class=SpellE>SciScore</span> will attempt to find the name(s) and catalog numbers of the resource. In cases where the tool is relatively confident, it will suggest an RRID. The suggested RRID appears in gray with a link to the RRID website where authors must confirm that the RRID found by <span class=SpellE>SciScore</span> is the correct RRID.

      <u style='text-underline: black'>Note of caution:</u>

      Please verify all RRID suggestions, only the author can know whether suggestions are correct.

      <u style='text-underline: black'>Scoring for Resources Table (total 5 points):</u>

      Each resource that is detected is scored, and the total is 5 points, with scores rounded to the nearest whole number. For each RRID detected, points are awarded, but for each sentence that is detected that does not contain an RRID, points are not awarded. If <span class=SpellE>SciScore</span> detects catalog numbers or relatively unambiguous resources, partial points are awarded. For each RRID that does not resolve properly only partial points are also awarded. Therefore, the way to maximize the points from this section is to add RRIDs, and proper citations that include vendor names, catalog numbers, lot and version numbers into the methods section of the manuscript.

      <u style='text-underline: black'>Incorrect sentences:</u>

      <span class=SpellE>SciScore</span> is a text analysis tool, and it is therefore susceptible to making two types of errors, false positives or false negatives.

      False <span class=SpellE><span class=GramE>negatives:<span style='font-weight:normal'>The</span></span></span> most common error occurs when the algorithm fails to detect a sentence that contains an antibody or another resource. False negatives generally occur either because the sentence is complex or in a less common syntax pattern. Generally simple sentences in clear standard English are simpler to process and result in few false negatives. If a truly complex sentence structure is required to describe reagents, a table may help not only <span class=SpellE>SciScore</span>, but also human readers. If an RRID is detected in a sentence, <span class=SpellE>SciScore</span> will be triggered to <span class=GramE>take a look</span> at the sentence, which may have been skipped otherwise.

      False positives: This type of error includes cases where a sentence does not contain an antibody, but the algorithm asserts that this sentence does have an antibody. If many resources are used and all have RRIDs, a single false positive will not reduce the score substantially. But if only 1-2 resources are used, then a false positive can reduce your <span class=SpellE>SciScore</span> needlessly. False positives are most often seen in the tools portion of table 2, as the algorithm detects company names, where it should not. We try to minimize these false positives using several strategies. If this impacts your score, please contact our team (http:// sciscore.com) and include the sentence where <span class=SpellE>SciScore</span> made the error. While we can't fix the score, we can learn from our mistakes.

      </div> </body>

      </html>

  10. Feb 2020
    1. Chrome extension

      Works with Chrome and other Chromium-based browsers including Brave and Edge.

  11. Jan 2020
    1. In 2013 to 2014, Nature made a significant push with authors to address rigor criteria. We plotted the average SciScore along with its components over this period (Fig 3) and found that the average score rose by nearly 2 points over just a few years.

      This is what progress on reproducibility looks like.

    2. Google Sheets

      RRID? 😂

    3. for

      delete

    1. is the “Prelude in C Major” by J. S. Bach. There is no real tune,
    2. 110Hz) and the note an octave above it, A3 (220Hz).
    3. The same is true, to a lesser extent, for notes a tone apart, so any consecutive notes from a scale will clash if they are played at the same time. For this reason, a chord made up of the notes A, B, and C, for example, would sound very anguished indeed, as the B would clash with both the A and the C. This sort of chord would not be of much use in accompanying a melody, but it would be right at home in something very tense like “The Devil’s Staircase.

    1. RRID:AB_1281337

      DOI: 10.1016/j.molcel.2019.02.024

      Resource: (Cell Signaling Technology Cat# 9728, RRID:AB_1281338)

      Curator: @evieth

      SciCrunch record: RRID:AB_1281337

      Curator comments: Cell Signaling Technology Cat# 9728, Di-Methyl-Histone H3 (Lys27) (D18C8) XP Rabbit mAb antibody


      What is this?

    1. Single quotes return text strings.  Double quotes return (if you can really think of them as “returning” anything) identifiers, but with the case preserved.
  12. Dec 2019
    1. target

      Omitting the target creates an annotation that the Hypothesis client will classify as a pagenote and display in the pagenotes tab.

    1. permissions

      cf https://github.com/FrankensteinVariorum/fv-data/issues/20:

      "All annotations belong to one group. They cannot currently be moved to another group after creation.

      Annotations have a boolean flag indicating whether they are visible only to the creator or shared with other members of the group."

      The permissions structure in API responses exists only for backwards compatibility, but you can't actually make use of the full flexibility implied by it.

  13. Nov 2019
    1. Search for annotations

      If you are searching a private group you will need to make an authenticated API call using a token representing a member of the group.

      The https://h.readthedocs.io/en/latest/api-reference/v2/#section/Authentication/ApiKey method is the easiest and most popular way for standalone API-based scripts to authenticate.

      To generate a token, log in to Hypothesis, go to https://hypothes.is/account/developer, click the button, and copy the token.

      To use it in a REST API call, add the header:

      Authorization: Bearer {your token}

      An example in JavaScript: https://github.com/judell/hlib/blob/master/hlib.ts#L480

      In Python: https://github.com/judell/Hypothesis/blob/master/hypothesis.py#L143

    1. If the final system is completely different than the prototype, users may be confused about how it operates.

      That's one reason not to invest in design polish. An ugly-but-functional prototype doesn't pretend to be a polished product or invite confusion with it.

    1. you need to see and feel the interactions rendered by software to know if you’ve nailed the experience.

      And if at all possible, you need to the interaction to be infused with your data.

    2. Regardless of the method you use, prototyping is no longer just a nice-to-have. Aligning a multi-disciplined team and ensuring that everyone comes away with a completely clear picture of the intended interaction design is key to successful product development, and building experiences that customers will ultimately love.
  14. Oct 2019
    1. With pywb 2.3.0, the client-side rewriting system exists in a separate module at https://github.com/webrecorder/wombat`
    1. The Wikimedia Foundation says it is seriously concerned about the idea that cisgender women and transgender editors could be repelled from Wikipedia by online abuse.

      This is also, to myself, indicative of the main problem with Wikipedia: most editors are white men in a certain age span.

      When abuse is added like this, non-men are more likely to stay away, and watch Wikipedia wither into a reason for staying with professionally edited encyclopedias.

    1. But at least one person was able to record the livestream of the video before the company could remove it. Someone posted the video to 8chan, a social message board website that hosts offensive content banned on many mainstream platforms like Facebook, YouTube and Instagram. From there, the video spread quickly, and millions of people began trying to re-upload the video to Facebook to further fan the viral flames.

      This passage really reflects how much our generation and communities are tied to our electronic devices and our online personas. People livestream and record many different events all the time, even ones that they shouldn't be. This is a problem that comes with social media and the online age.

    2. disrepute

      I was unsure what this meant, but I looked it up and I realize that it has to do with being held in low esteem by the public.

    3. “Much — I would say even most — extreme-right content is easily accessible in open online spaces so that it can be consumed by as many people as possible,” said Maura Conway, a senior lecturer in international security at Dublin City University in Ireland.

      This is an important highlight

    4. “Some intended to promote the killer’s actions, others were curious and others actually intended to highlight and denounce the violence. Distribution was further propelled by broad reporting of the existence of a video, which may have prompted people to seek it out and to then share it further with their friends.”

      This is basically showing how although there is not everyone on board with the actions of others there is more people getting the idea to engage in this behavior and will seek out ideaologies that will encapture that

    5. white supremacist forums

      Defined as a white supremacist thread of ideas and comments on a social platform

    6. They are the publisher, not just the postman.”

      I think this is a very powerful and important quote. Social media needs to be held accountable and not let things that are harmful spread. They have a responsibility to monitor what is being published, they do have control so they should not idly sit by.

    7. And no users reported the post to Facebook’s content moderators during the live stream, an important signal for the company to catch and take down harmful content before it spreads virally across the site.

      I find this highly concerning. I am actually shocked that this happened.

    8. “It is clear that this video was ‘pushed’ to many innocent New Zealanders by various apps,” he said. “We have had reports that it also ‘auto-played’ to some people who did not even know what it was.”

      This relates to how the video talks about the push of ISIS propaganda and how that different accounts are used to push out information. People are coming across it even when they are not seeking it out.

    9. New Zealand’s Department of Internal Affairs includes a chief censor, an official who has the authority to determine what material is forbidden.

      Although I am all for freedom of speech, I feel like in some cases having certain material be forbidden on the internet is not the worst thing in the world.

    10. One man, Philip Neville Arps, appeared in court in Christchurch on Wednesday on two charges related to reposting the killer’s video. Mr. Arps was denied bail and is facing almost a month in custody until his next court appearance.

      Although it is an awful act, to hold someone without bail and holding them in jail until heir next court hearing over sharing a post seems some what extreme however there should be a middle ground for punishment.

    11. freedom

      Free speech is an especially tricky concept, especially when one has to determine what is protected as free speech and what isn't. This is often battled out in court in the US and is decided by a judge. The only type of speech the US really doesn't protect is if that speech is directly insighting violence. This means that hate speech is protected.

    12. accept

      This reminds me of the debate that i happening in the US about sensationalizing gun violence and the way that the news often reports on school shootings. In most cases, they report on a sensationalized background of the shooter's life and history which is the proven wrong thing to do, as is inspires further shootings. Why do we let this happen?

    13. Facebook

      Reminds be of a point made in the previous article about what kind of violence can we show and the mentioning of the horrible Philando Castlie shooting... What if some things need to be seen?

    14. Facebook and other social media platforms also could face new legal issues because of the video, and not only in New Zealand. Prime Minister Jacinda Ardern of New Zealand has vowed to investigate the role that social media played in the attack and to take action, possibly alongside other countries, against the sites that broadcast it.

      I can understand how Facebook and other social media platforms could face legal issues. This actually might be beneficially towards the victims and the victims family.

    15. And no users reported the post to Facebook’s content moderators during the live stream, an important signal for the company to catch and take down harmful content before it spreads virally across the site

      No one reported the video because they must have thought it was fake. This reminds me of the facebook live video of a man in the U.S who claimed he was going on a killing spree and killed an innocent elderly man on the street. Most of the comments where shocked that it happened because they did not think something like that could happen. Sometimes it happens so fast you are unable to report it until it is too late.

    16. Facebook said that during the 24 hours after the shooting, the company blocked more than 1.2 million attempts to upload the video. It took down more than 300,000 copies of the video that had been uploaded.

      I know that Facebook or other social media platforms are able to remove content, however I wonder how they are able to attempt to block it from being downloaded?

    17. A Christchurch teenager, whose name has not been released, was denied bail on Monday over charges that he had posted a photograph of Al Noor Mosque, one of the two that were attacked, a week before the shootings, with the caption “target acquired.” He was also charged with reposting the video.Each could spend as much as 14 years in jail if found guilty.

      I believe we have to continue to monitor these events closely and continue to punish extremely harsh for things on the internet. There needs to be a way to see this post and stop these people before they act.

    18. purport

      "Appear or claim to be or do something"

    19. How can people be charged for simply sharing content on social media? Is it because it is considered terrorism content and that spreading it would make you a terrorist?

    20. denied bail and is facing almost a month in custody until his next court appearance.

      It is crazy to see how different laws are around the world. I do not believe that this would happen in America. In this country, people are very quick to bring up our "freedom of speech." However, I think that what New Zealand is doing is beneficial to society, because I do not believe that content like this terrorism video should be shared online, especially when it depicts the real killings of people.

    21. company blocked more than 1.2 million attempts to upload the video. It took down more than 300,000 copies of the video that had been uploaded.

      This is shocking to me because I don't understand why people would want to upload and share a video of people being murdered in a terrorist attack to their Facebook accounts. It is disheartening to see how desensitized our society has become to this type of violence.

    22. Facebook, the platform used by the Christchurch killer to broadcast the attack on one of its marquee products, Facebook Live, has been under pressure to explain its role in how the video proliferated.

      I do agree that they play some part in it, but how much control do they actually have?

    23. But at least one person was able to record the livestream of the video before the company could remove it

      This always happens. As soon as it is on the internet, no matter how fast you remove it, it can still be found. That bein said, the companies have a big issue in hand.

    24. And no users reported the post to Facebook’s content moderators during the live stream, an important signal for the company to catch and take down harmful content before it spreads virally across the site.

      I am blown away and in disgust that no person reported the killer's livestream. Facebook Live moderators really need to get their act together to help catch these things.

    25. “We cannot simply sit back and accept that these platforms just exist and that what is said on them is not the responsibility of the place where they are published,” she told Parliament on Tuesday. “They are the publisher, not just the postman.”

      Well put. We need to hold social media outlets accountable for the service they provide. They simply can't sit idly by allowing for their medium to be a catalyst for hate.

    26. said mainstream social media companies had generally succeeded in suppressing content from groups like the Islamic State on their platforms, but that far-right groups had not received the same treatment.

      Good, but not good enough. White-supremacists have incited just as much if not more acts of violence on domestic soil than the Islamic State. When is it finally enough?

    27. “It’s hard to know where the line is drawn,”

      this is a very deep statement as the line between laws on social media are so undefined and so new that they are hard to enforce

    28. Fewer than 200 people watched the killer’s shooting spree live as it occurred

      This is appalling that anyone would actually watch the killer's shooting spree live as it occurred.

    29. Mr. Elley said, with algorithms on websites like YouTube constantly offering viewers more and more “extreme and strange” videos to keep them watching,

      Why is the essence of 'strange' videos build a high viewer point for our society?

    30. The restrictions mean New Zealanders could face legal consequences for intentionally looking at the Christchurch killer’s video, which may have been seen millions of times around the world.

      This is an interesting passage. Only because I think this is an important step forward for humanity, and it should be more enforced. I don't think anyone would disagree that intentionally watching and sharing a video about terrorist killing is morally wrong and reprehensible. But, as human (or at least Americans for sure), we have a strange primal need to look at disasters. When there is a car accident on the freeway, for instance, traffic forms as cars slowly roll by so that they can take in the damage. Even the saying from Tony Danza, which is now often repeated in different words, "Sometimes it's like watching a train wreck. You're uncomfortable, but you just can't help yourself" is an example of how people have an impulse to watch terrible, tragic things. I think society needs an enforceable guideline to deter watching this kind of tragedy.

    1. In their absence, some airports have had to close checkpoints, as Baltimore-Washington International did over the weekend

      Low staffing has caused airports to close certain checkpoints which jeopardizes the safety of air travelers.

    1. unrepresentative

      Feel that most people don't realize that this is true

    2. junkies

      People are getting their information form online biased media sources when they should be getting information on their prefered candidate from verified new sources or their own websites on their policies

    3. specifics

      Personally believe it was a very accurate observation based on my own experience on twitter

    1. he student had grown up in a household with little money and where college had never been discussed.

      i think this is pretty typical for first generation students. Their parents do not talk about college so they do not talk about college because they do not know what to say or what questions to ask

    2. most first-generation students come from families with low incomes and minimal exposure to college.

      their parents could not afford to go to college and they can barley send their kids to college because they were not able to get a degree to give them a well paying job

    3. died when his son was a toddler

      maybe they should go into the fact that his dad dying when he was young had an effect on him rather than looking at the lack of an effect he had on him

    4. Colleges have always viewed their mission as promoting social mobility, but given rising income inequality and the skills needed to get high-paying jobs, they have intensified their efforts to enroll and lift disadvantaged students.

      not really how colleges do it anymore, the huge monetary barrier(in america at least) kicks the poor down and keeps the wealthy up. despite the many programs promoting lower class and minorities representation in college.

    1. Google to provide information on all devices it recorded

      Google can provide any informations about devices which can help police in his investigation.

    2. They used new techniques for murder investigation.

    3. This year, one Google employee said, the company received as many as 180 requests in one week

      Investigators are using this tracking technology increasingly because it is very useful to find the criminals all around the world by tracking their device.

    4. dragnet

      a system in which the police look for criminals, using very thorough methods.

    5. Technology companies have for years responded to court orders for specific users’ information.

      Technology companies help in the investigation of crime.

    6. This year, one Google employee said, the company received as many as 180 requests in one week.

      Google receive several requests.

    1. One of the biggest questions of the past two years — something that fueled the news coverage, the federal investigation and congressional scrutiny — is why so many people around Mr. Trump lied, misled and changed their stories
    1. Too many boys are trapped in the same suffocating, outdated model of masculinity, where manhood is measured in strength, where there is no way to be vulnerable without being emasculated, where manliness is about having power over others.

      I agree with this statement. Society is moving towards more gender equality, which challenges male privilege and forces men, conditioned to equate power with masculinity, to feel there manhood is threatened. As supported in this article: https://www.apa.org/monitor/2017/02/men-left-behind

    2. It’s no longer enough to “be a man” — we no longer even know what that means

      Agreed, as discussed in class, gender roles constantly evolving, they are no longer binary. There is no longer a clear definition of what a "man" is nor his place within the workplace or home.

    1. The study specifically regards linemen and defensive backs as being the two primary groups, but running backs are not considered as heavily in the original paper due to the limited frequency of consecutive repetitive impacts.

    2. While 1300 players have died since the recent inception of the Brain Bank, how many more players have played the game and not had symptoms? Is there something more at play?

    3. I like how the prevalence of the position of linemen is included later, but for clarity and to limit the amount of bias before introducing a key fact like prevalence on the field after prevalence within the disease, it's imperative to restructure here.

    1. If they are denied, asylum seekers can be deported. But since many are released while their case is pending, some never return to court and evade deportation.

      the risk of not receiving asylum is deportation

    2. better shot at fending off deportation when they come with a child.

      Immigrants will strategize techniques in order to get into country easier

    3. More than 90 percent of the most recent migrants are from Guatemala,
      • not mexico (stereotype)
    1. “They can build as many walls as they want,” he said, referring to American officials. “They can send as many soldiers to the border as they want, but a people’s need and desire for a better life is stronger.”

      This is the main idea- not matter what desire for better life is stronger than walls and soldiers

    2. The smugglers almost hadn’t let him cross, because they worried that his coughing fits from a respiratory infection might give the group away.

      People left behind to not give away the group and risk being caught

    3. MS-13 became too dangerous there. His family relocated to Berlín, about an hour’s drive away, which had less of a gang problem than the big cities.

      Gangs and other reasons drive people to leave their homes to immigrant into U.S.

    4. MS-13 became too dangerous there. His family relocated to Berlín, about an hour’s drive away, which had less of a gang problem than the big cities.

      An example of why people move is gang problems and other dangers.

    5. The smugglers almost hadn’t let him cross, because they worried that his coughing fits from a respiratory infection might give the group away

      Sometimes people will be left behind if smugglers fear being caught. An example of this is a sick person coughing and border patrol may be able to hear.

    6. “They can build as many walls as they want,” he said, referring to American officials. “They can send as many soldiers to the border as they want, but a people’s need and desire for a better life is stronger.”

      No matter what There will always be people who attempt to illegally cross the border for a better life.

    1. July of last year, July of last year,

      Anaphora emphasizes the importance of the time period and just how unfortunate it is that Magante chose this time not to pitch well.

    2. Mags

      Revealing the metonymy for Magnante makes one feel cloer to the team and to the action. It's also a humorous tid-bit.

    3. Magnante made an almost perfect pitch to Lee Stevens, a fastball low and away.

      Consonance of "magnante made" and "perfect pitch" aids sentence flow. Note also the surprise: you'd expect a bad pitch based on the previous paragraphs.

    4. pop out

      metonymy/baseball slang for an out that occurs from a catch that results from a ball that goes high but not far.

    5. Ricardo Rincon's name is on that board

      Anaphora/ parallel structure serves to heighten the dynamic and contrast between Rincon and Mags.

    6. he knows every player on other teams that he wants, and every player in his own system that he doesn't want

      Hyperbole emphasizes Beane's understanding of what players he wants on his team

    7. Harvard statistics professors, research scientists, Wall Street analysts turned amateur baseball analysts -- and ignored by organized baseball.

      antithesis emphasizes whom the A's listen to.

    8. a fly ball hit by an Oakland A will clear the wall

      Implied metaphor. Tenor: Billy's offer. Vehicle: fly ball that might clear the wall . Ground: a long-shot, potentially big action that seems on the cusp of success.

    9. Coliseum

      humorous metonymy for the stadium

    10. he was paralyzed when the decision involved himself.

      ironic: Beane is so quick to decide for others (his "edge"), but he cannot do the same for himself. He is not rational now.

    11. ''I made one decision based on money in my life -- when I signed with the Mets rather than go to Stanford -- and I promised I'd never do it again.'' After that Beane confined himself to the usual blather about personal reasons. None of what he said was terribly rational or ''objective'' -- but then neither was he.

      Continuation of the irony: he is no longer scientific and rational. Further, we have a reference to the opening of chapter 2; the book is coming full circle and that quote is making sense.

    12. no one would know.

      anaphora emphasizes how futile his endeavor could be.

    13. Cleveland in the top of the seventh with two runners on

      Uses of metonymy in "seventh" (standing for seventh inning) and "runners" (standing for players at base) hastens the prose, creating an image of a quick game. The narration style is also similar to that of a traditional baseball announcer, a tone establishing setting and subject matter.

    14. a left-handed slugger

      Metonymy referring to Thome's brutish hitting style, paints a hulking character.

    15. ''for guys to be available to us, there usually has to be something wrong with them,'' and it wasn't hard to see what was wrong with Mags,

      Figure of repetition: conduplicatio in "wrong." The word wrong is repeated, the two separated by the phrase "with them,' and it wasn't hard to see what was..." The purpose of conduplicatio in this case is to amplify the point that The A's usually hired unconventional players and that Mags was no exception.

    16. low and outside

      Metonymy standing for the position of the catcher enforces the "detached announcer" tone of the prose

    17. bad count

      Antithesis of good pitch. Enforces the rhythm of the piece.

    18. It rose and rose

      the use of epizeuxis emphasizes the flight, and height of the ball

    19. you do the things you always did, but the results are somehow different.

      Antithesis in the change of results based on age alone. Reflects on the struggle of older players, or aging in general.

    20. The contrast cast Mags in unflattering light

      Use of personification shows just how little control Mags has over the situation. He is forced by the will of non-human entities

    21. The trick

      metonymy for Beane's method of money management. Connotation of "trick" implies a scheme on Billy's part.

    22. and have researched for 30 seconds.

      Hyperbole overstates the lack of research the Mets need to hypothetically do in order to entice Paul DePodesta

    23. His owners have told him only that they won't eat 508 grand; they've said nothing about eating 233 grand.

      Implied metaphor in "eat." Eating, in this case, stands for taking an offer. The ground is in acceptance and consumption

    24. pokes his head

      Implied metaphor. Tenor: Paul entering Billy's office Vehicle: "poking" Ground: small stature, barely noticeable presence.

    25. White Sox, who had abandoned all hope for their season

      Hyperbole humorously emphasizes the failures of the White Sox

    26. Now he has sights on Ricardo Rincon,

      Implied Metaphor. Tenor: Billy's attention. Vehicle: a marksman's scope. Ground: unwavering focus, military precision.

    1. Plenty has happened since then. The child is now a cryptic wizard and the cad has been broken down and rebuilt

      hi dear

    1. Harvesting Poverty; The Rigged Trade Game
    2. Despite widespread worries about their ability to compete, Filipinos bought the theory that their farmers' lack of good transportation and high technology would be balanced out by their cheap labor. The government predicted that access to world markets would create a net gain of a half-million farming jobs a year, and improve the country's trade balance.It didn't happen. Small-scale farmers across the Philippine archipelago have discovered that their competitors in places like the United States or Europe do not simply have better seeds, fertilizers and equipment. Their products are also often protected by high tariffs, or underwritten by massive farm subsidies that make them artificially cheap. No matter how small a wage Filipino workers are willing to accept, they cannot compete with agribusinesses afloat on billions of dollars in government welfare.
    1. Minutes later a second suicide blast shattered the Sunday brunch tranquillity at the Shangri-La Hotel’s Table One Restaurant, a favorite of foreign tourists.

      This is devastating!

    2. The death toll in the attacks rose to 290, with about 500 people wounded, a police spokesman, Ruwan Gunasekera, said, although he would not give a breakdown of where the fatalities occurred. The finance minister, Mangala Samaraweera, called the attacks “a well-coordinated attempt to create murder, mayhem and anarchy.”

      This is so incredibly sad!

    3. the exact moment when the first suicide bomber’s explosion ripped through the wooden pews as Easter Sunday worshipers were praying.

      How can someone do this especially on a holiday where families come together.

    4. Within a few hours on Sunday, suicide bombings hit three Christian churches and three upscale hotels in the Indian Ocean island nation of Sri Lanka, still recovering from a quarter-