Purification in refolded form

The proteins were purified by nickel affinity chromatography. The cell pellet ( ~ 1 g) of each clone was solubilized in 5 ml ofbuffer A (6 M guanidine hydrochloride, 0.1 M NaH2P04, 0.01 M Tris, pH 8.0). The suspension was centrifuged at 8000 X g for 15 min at 4°C and the supernatant containing the recombinant protein was mixed with Ni-NT A resin (Nickel-Nitrilotriacetic acid equilibrated with buffer A) and kept for gentle end-to-end shaking for 1 hat RT. The resin was loaded on a column and washed with 10 bed-volumes of buffer A. The column was subsequently washed with 5 bed-volumes each of buffers B, and C, which contained 8 M urea, 0.1 M NaH2P04 and 0.01 M Tris and had successively reducing pH values of 8.0 and 6.3 respectively. The protein was eluted with buffers D and E (composition same as buffer B) in which the pH was further reduced to 5.9 and 4.5 respectively. Five fractions of 4 ml each were collected during elution with buffer D and buffer E respectively. The eluted proteins were analysed by 0.1% SDS-1 0% PAGE (gels stained with Coomassie blue) and Western blot. The fractions showing the purified recombinant protein were pooled and concentrated in an Amicon concentrator using a YM30 membrane and dialyzed against 100 mM phosphate buffer, pH 7.4, containing 4 M urea. The concentration of each purified protein was estimated by bicinchoninic acid (BCA).

Purification in denatured form

PURIFICATION OF r-bmZPl, r-dZP3 AND r-rG EXPRESSED IN E. coli

reached a value of 0.5-0.6. The cultures were then induced with 1 mM IPTG for 2 h at 37°C. Cells were pelleted at 4000 X g for 30 min at 4°C and stored at -70°C until used.

For use in enzyme linked immunosorbant assay (ELISA), r-bmZP1, r-dZP3 and r-rG, expressed in E. coli were purified under denaturing conditions. For purification of r-bmZP1, as described previously, the pRSET-bmZP1 clone, encoding bmZPl, excluding the SS and the TD (22-462 aa) was used (Govind et al., 2001). Similarly, the pQE30-dZP3 and pQE30-rG clones encoding dZP3 and rG, excluding the SS and the TD were used for purification of r-dZP3 (26-352 aa) (Santhanam et al., 1998) and r-rG (20-457 aa) (unpublished. observations) respectively. For T cell proliferation assays, the above recombinant proteins were purified from inclusion bodies in the absence of chaotropic agents in refolded form as described below. The above clones were inoculated in 10 ml of LB containing appropriate antibiotics and grown 0/N at 3 7°C. Following day, the cells were subcultured (I: 100 dilution) in I liter of LB (250 mllflask) containing appropriate antibiotics and grown at 37°C until the A600

incubations were carried out for I h at RT and each incubation was followed by three washings with PBS containing 0.1% Tween-20 (PBST). Post-blocking, the membranes were incubated with 1:1000 dilution ofMA-813 ascites (for detection ofr-bmZP1), MA-451 ascites (for detection of r-dZP3) or rabbit polyclonal anti-r-rG antibodies (for detection of r-rG), followed by an incubation with 1:5000 dilution of goat anti-mouse or goat anti-rabbit immunoglobulins conjugated to horseradish peroxidase (HRPO) (Pierce) respectively. The blots were developed with 0.6% (w/v) 4-chloro-1-naphthol in 50 mM PBS containing 25% methanol and 0.06% H202• The reaction was stopped by extensive washing with double distilled water

The cells (2 - 4 x 1 06) transfected with plasmid DNA were resuspended in minimum volume of 2X sample buffer (0.0625 M Tris, pH 6.8, 2% SDS, 10% glycerol, 5% P-mercaptoethanol, and 0.001% bromophenol blue). The samples were boiled for 10 min and resolved on a 0.1% SDS-1 0% PAGE (Laemmli, 1970). The expression of recombinant proteins was analyzed by Western Blot. The proteins were electrophoretically transferred to 0.45 J.lm nitrocellulose membrane 0/N at a constant current of 30 rnA (milliampere) in Tris-Giycine buffer (25 mM of Tris-HCl and 200 mM glycine) containing 20% methanol (Towbin et al., 1979). Post-transfer, the membranes were washed once with PBS and non-specific sites were blocked with 3% BSA in PBS for 90 min at RT. All the subsequent

Analysis of expressed recombinant protein by immunoblot

COS-I cells were seeded at a density of 2.5 x 105 cells per well in a 6-well tissue culture plate and transfected with plasmid DNA essentially as described above. After 48 h incubation, cells Were trypsinized and counted in a hemocytometer. Cells ( ~ 1 06) were washed twice with PBS and fixed with 0.4% paraformaldehyde in PBS followed by all washings and incubations with respective primary and secondary antibodies in presence of 0.1% Saponin. Antibody concentrations used were same as in indirect immunofluorescence assay. After the final wash, cells were resuspended in PBS and samples were run on an Elite ESP flow cytometer (Coulter Electronics, Hialeh, FL, USA) and data analyzed using WinMDI (version 2.8) software. Cells stained with just secondary antibody were used to account for the background fluorescence. Cells tranfected with VR 1020 vector and probed with primary antibody were used as negative control.

Analysis of mammalian cells, transfected in vitro with the plasmid DNA, by flow cytometry

To investigate if the expressed protein was membrane bound or cytosolic, cells were fixed in 3. 7% paraformaldehyde followed by all washings and incubations with primary and secondary antibodies either in presence or absence of 0.1% Saponin and processed for indirect immunofluorescence as described above.

Localization of the expressed recombinant protein in COS-1 cells

albumin (BSA) in PBS for 2 hat 4°C. For detection of r-bmZPI, a murine monoclonal antibody (MAb), MA-813, generated against E. coli expressed r-bmZP1 (Govind et al., 2000), was used as the primary antibody. The cells were incubated with 1 :500 dilution of MA-813 ascites fluid for 2 hat 4°C. Cells were washed 5 times with PBS and incubated for 1 h with a 1:800 dilution of goat anti-mouse Ig-fluorescein isothiocyanate (FITC) conjugate (Sigma) at 4°C. After washing with PBS, coverslips with the cells were mounted in glycerol : PBS (9 : 1 ), and examined under an Optiphot fluorescent microscope (Nikon, Chiyoda-Ku, Tokyo, Japan). For detecting r-dZP3, MAb, MA-451 (1 :500 dilution of ascites fluid), generated against porcine ZP3f3 (a homologue of dZP3) and immunlogically cross-reactive with dZP3 (Santhanam et al., 1998) was used. For detecting r-rG, rabbit polyclonal antibodies (1:1000 dilution) against E. coli expressed r-rG, was used as primary antibody. The polyclonal antibody was provided by Dr. Sangeeta Choudhury, Project Associate, Gamete Antigen Laboratory, National Institute of Immunology, New Delhi. Goat anti-mouse immunoglobulins-FITC conjugate (1 :800) and goat anti-rabbit immunoglobulins-FITC conjugate (1 :2000; Pierce) were used for detecting anti-dZP3 and anti-rG antibodies respectively

Initial standardization of transfection conditions was done using VRbmZPl plasmid DNA and COS-I mammalian cell line. In brief, cells were cultured in T-25 tissue culture flasks in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal calf serum (FCS) at 37°C with 5% C02. For subculturing, cells were trypsinized (0.5% trypsin + 0.2% EDTA in DMEM without FCS), centrifuged at 250 X g for 10 min, resuspended in DMEM supplemented with 10% FCS and aliquoted into T-25 flasks. For transfection, cells were seeded on coverslips in a 24-well tissue culture plate at a density of 5x 104 cells/well, a day prior to transfection. To standardize in vitro transfection conditions for optimum expression of bmZP1, varying amount of plasmid DNA was mixed with lipofectamine in DMEM devoid ofFCS (final reaction volume 200 f.!l) and incubated at RT for 45 min. The cells on the coverslips were washed twice with plain DMEM devoid of FCS. DNA-Iipofectamine complex was added dropwise to the cells and the plate incubated for 8 h at 3 7°C in humidified atmosphere of 5% C02• Subsequently, 1 ml of DMEM containing 10% FCS was added per well and cells allowed to grow for 48 h. After incubation, cells were processed for visualization of r-bmZPl by indirect immunofluorescence assay. Cells were washed twice with phosphate buffer saline (PBS; 50 mM Phosphate and 150 mM NaCI, pH 7.4), fixed in chilled methanol (-20°C) for 3 min and blocked with 3% bovine serum

Detection of the expressed recombinant protein following i11 vitro transfection of mammalian cells with the plasmid DNA.

6000 X g for 15 min at 4°C. Plasmid DNA was purified from the pellet using QIAGEN DNA purification kit according to the manufacturer's instructions. The purified plasmid DNA (1.5 -2.0 mg/ml) was dissolved in autoclaved double distilled water and stored in aliquots (500 f.!l each) at -20°C until further use.

A single colony of the respective clones was picked up from a freshly streaked LB + Kan (50 f.!g/ml) plate, inoculated into 5 ml of LB + Kan medium and incubated for 8 hat 37°C with vigorous shaking (-250 rpm). Subsequently, 500 fll of this primary culture was inoculated into 500 ml LB+ Kan and grown at 37°C 0/N. The culture was centrifuged at

Purification of plasmid DNA in large amount

N-VITRO TRANSFECTION OF MAMMALIAN CELLS WITH V ARlO US PLASMID DNA CONSTRUCTS AND CHARACTERIZATION OF EXPRESSED RECOMBINANT PROTEINS

stranded DNA. The reaction was carried out at 37°C for 1 h. The reaction mixture contained 100 ng Bgl II digested VR1020 vector, SAP (0.5 U) and 1 fll lOX SAP buffer (20 mM Tris-HCl, pH 8.0, 10 mM MgCh) in 10 f.!l oftotal reaction volume. The reaction was stopped by inactivating the enzyme at 65°C for 15 min. The digested bmZP1 eDNA was ligated with SAP treated VR1 020 at vector : insert ratio of 1:10 in a 10 fll reaction volume for 16 h at l6°C. The reaction mixture contained 10 ng VR1020 vector, 26 ng bmZPl insert, 1 fll lOX ligase quffer (30 mM Tris-HCl, pH 7.8, 10 mM MgCh, 10 mM DTT and 1 mM ATP), lfll T4 DNA ligase (20 U) in a total reaction volume of 10 fll. The ligation product was used for transformation of DH5a competent cells as described previously. Transformants were selected on LB plates containing 50 f.!g/ml Kanamycin (Kan). Similarly, the inserts corresponding to dZP3, rG and dZP3-rG fusion were digested with Bgl II restriction enzyme, gel purified and cloned in VR1020 vector, except that the ligation product of dZP3-rG fusion with VR1020 was transformed into JM109 competent cells

The insert corresponding to bmZP1 was released from the pPCR-Script-bmZPl clone by Bgl II restriction and purified on the agarose gel. VR1020 vector was similarly digested and gel purified. To prevent self-ligation, the digested vector was treated with Shrimp Alkaline Phosphatase (SAP), which removes 5'-phosphate from the termini of double

Cloning in VRl 020 mammalian expression vector

Selected transformants were grown in 250 ml of LBamp 0/N. The cells from the 0/N cultures were harvested by centrifugation (4°C) at 4000 X g for 30 min. The cell pellet was resuspended in 5 ml of TEG solution containing lysozyme (2.0 mg/ml in 10 mM Tris-HCl, pH 8.0) and incubated at RT for 15 min. Alkaline-SDS (10 ml) was added to the mixture and again incubated at R T for 10 min after mixing the contents gently by inverting the tube. Post-incubation, chilled sodium acetate solution (7.5 ml) was added and the contents were incubated on ice for 15 min. After incubation, the mixture was centrifuged at 10,000 X g at 4°C and processed in the similar fashion as described above upto addition of isopropanol. The DNA pellet was resuspended in 500 Jll TE containing 20 Jlg/ml RNase and incubated for 1 h at 37°C. Plasmid DNA was then extracted as described above. The DNA pellet was air-dried and finally dissolved in 200 Jll ofTE

Large scale plasmid DNA isolation

collected by centrifugation at 12,000 X g for 15 min, and washed with 70% ethanol. The pellet was air-dried and resuspended in 20 Jll TE. The clones were checked for the pres~nce of the insert by restriction analysis. The digestion products were checked on 1% agarose gel for the release of the insert. One positive clone was selected from each set of transformations and the plasmid DNA was purified in large amount for the insert preparation.

Transformants picked following blue-white selection were inoculated in 5 ml LB medium containing 100 j...tg/ml ampicillin (LBamp) and grown 0/N. Following day, 1.5 ml aliquots of 0/N culture were harvested by centrifugation at 10,000 X g in a microfuge. The supernatant was discarded and the pellet was resuspended in 100 j...tl of chilled TEG (25 mM Tris-Cl, pH 8.0, 10 mM EDTA and 50 mM glucose) and incubated for 10 min at RT. After incubation, 200 j...tl of freshly prepared alkaline-SDS (0.2 N NaOH, 1% SDS; sodium dodecyl sulfate) was added and the contents were mixed gently by inversion. This was followed by incubation on ice for 10 min. Post-incubation, 150 j...tl of ice-cold sodium acetate solution (3 M, pH 5.2) was added to the mixture and incubated on ice for 15 min. After incubation, the contents were centrifuged at 12,000 X g for 15 min at 4°C and the supernatant was carefully transferred to a fresh tube. DNA was precipitated by adding 0.6 volumes of isopropanol and incubating at RT for 10 min. The DNA pellet was obtained by centrifugation at 12,000 X g at RT for 15 min, air-dried and dissolved in 200 j...tl of TE. To remove RNA contamination, 50 j.lg of DNase free RNase was added and incubated for 1 h at 37°C. Plasmid DNA was then extracted once with an equal volume of phenol equilibrated with TE (I 0 mM Tris, pH 8.0 and 1 mM EDT A) followed by extraction with phenol : chloroform : isoamyl alcohol (25 : 24 : 1) and then with chloroform : isoamyl alcohol (24 : 1 ). DNA was precipitated by addition of 2 volumes of chilled 100% ethanol to the aqueous phase and incubating the contents at -70°C for 30 min. The DNA pellet was

Small scale plasmid DNA isolation and restriction

separately on LB plates containing 100 j...tg/ml ampicillin, 80 j...tg/ml of X-gal and 20 mM of IPTG. The plates were incubated at 37°C for 12 h.

The DH5a strain of E. coli was grown overnight (0/N) in LB at 37°C and subcultured ( 1: 1 OO)in 100 ml of fresh LB. The culture was grown until absorbance at 600 nm (A6oo) reached 0.4. The culture was centrifuged at 2500 X g for 15 min at 4°C. The cell pellet was resuspended in 10 ml of freshly prepared sterile ice cold CaC}z (100 mM) solution and incubated for 30 min on ice. Cells were centrifuged at 1800 X g and the pellet was very gently resuspended in 2 ml of chilled CaCh (100 mM) containing 15% glycerol. Aliquots of 100 111 were dispensed into sterile, chilled 1.5 ml eppendorf tubes and stored at -70°C until further use. For transformation, the ligation products from the above reactions were added separately to a vial each of DH5a competent cells thawed on ice. The contents were gently mixed and incubated on ice for 30 min. The cells were then exposed to heat shock at 42°C for 90 sec and incubated on ice for another 2 min. The transformed cells were grown in 1 ml of LB medium for lh at 37°C with shaking for the expression of the ampicillin resistance marker gene W-lactamase). Aliquots from each transformation were plated

Preparation of competent cells and transformation

The Luria Bertani (LB; pH 7.5) medium was prepared in double distilled water by adding, NaCl 1%, Yeast extract 0.5%, and Tryptone 1% and sterilized by autoclaving under pressure (15 lbslinch2) for 20 min. Solid growth medium was prepared by adding 1.5% agar to LB prior to autoclaving. Appropriate antibiotics were added after cooling the medium to approximately 50-60°C. Bacterial cultures were grown in LB medium at 37°C in an orbital shaker set at 200 revolutions per minute (rpm).

Media composition and bacterial culture

The PCR products obtained by amplification were resolved on a 0.8% low melting point (LMP) agarose gel using IX TAE buffer (40 mM Tris, 20 mM acetic acid and 1 mM EDT A) and purified from the gel. The purified PCR products were first blunt-ended at 72°C for 30 min using 0.5 units (U) of cloned Pfu polymerase, 1 OmM dNTPs, 1 OX polishing buffer (Stratagene). These PCR products were ligated separately to pPCR-Script Amp SK ( +) cloning vector, using vector to insert ratio of 1 :20 in a 10 Jll reaction volume for 3 h at room temperature (RT). The reaction mixture contained 10 ng of pPCR-Script Amp SK(+) cloning vector, 4 U ofT4 DNA ligase, 0.5 Jll of 10 mM rATP, 1 Jll of lOX reaction buffer, 5 U of S1f I restriction enzyme. The buffers and enzymes used were supplied along with the PCR-Script™ Amp cloning kit (Stratagene). For dZP3-rG fusion, the PCR amplified product was ligated with pGEM-T Easy vector (Promega) without blunting. The reaction mixture contained 50 ng pGEM-T Easy vector, 130 ng of fusion PCR product, 3 U ofT4 DNA ligase and 5 fll of2X Rapid Ligation buffer (30 mM Tris-HCl, pH 7.8, 10 mM MgC}z, 10 mM DTT, 2 mM ATP and 10% polyethylene glycol). The reaction was carried out at 16°C for 16 h.

Agarose gel electrophoresis and ligation of PCR amplified fragments in pPCR-Script Amp SK (+)cloning vector

mm followed by the addition of forward and reverse primers and another round of amplification for 35 cycles involving denaturation at 94°C for 1 min, annealing at 55°C for 2 min and extension at 72°C for 2 min followed by a final extension at noc for 15 min. Rest of the PCR conditions were same as described for bmZPl.

The general strategy to assemble by PCR the eDNA encoding dZP3-rG fusion protein is schematically shown in Fig. 1. Two rounds ofPCR were carried out to assemble the dZP3-rG eDNA. Jn the first round, eDNA corresponding to dZP3 encompassing part of the N-terminal segment of rG and rG eDNA encompassing part of the C-terminal segment of dZP3 were PCR amplified using pQE30-dZP3 and pQE30-rG plasmids respectively as templates. The eDNA corresponding to dZP3 was PCR amplified using forward primer 5 '-GAAGATCTCAGACCATCTGGCCAACT-3' having Bgl II site and reverse primer 5'-CGTGTAAATAGGGAATTTAGTGTGGGAAACAGACTT-3', containing 12 nucleotides from the N-terminal end of rG eDNA at the 3 'end of the primer, using an annealing temperature of 49°C. The eDNA corresponding to rG was PCR amplified using forward primer 5'-AAGTCTGTTTCCCACACTAAATTCCCTATTTACACG-3' containing 12 nucleotides from the C-terminal end of dZP3 eDNA at the 5 'end of the primer and reverse primer 5'-GAAGATCTTTACCCCCAGTTCGGGAG-3' having Bgl II site using an annealing temperature of 45°C. The amplified fragments of dZP3 eDNA containing a part of N-terminal end of rG eDNA at its 3'end and rG eDNA containing a part of C-terminal end of dZP3 eDNA at its 5' end were gel purified and used as templates for the next round of PCR employing forward primer of dZP3 eDNA and reverse primer of rG eDNA to obtain amplified fusion product of dZP3 followed by rG eDNA ( dZP3-rG). The templates were denatured at 94 oc for 10 min. Initial amplification was carried out for 2 cycles of denaturation at 94°C for 2 min, annealing at 51 oc for 2 min and extension at 72°C for 2

Assembly of eDNA encoding dZP3-rG fusion protein by PCR

described for bmZP1 except that for rGVR, rGVRt and rGVRst an annealing temperature of 45°C and for rGVRs an annealing temperature of 50°C was used.

To obtain the optimum expression of rG in mammalian cells and to study the influence of the SS and the TD on the immune response generated by DNA vaccine, four different constructs of rG eDNA in VR1020 vector were made (Table 1). For cloning rG, BHK21 cells were infected with PMIO strain of rabies virus. Total RNA from the infected cells was prepared at various time period post-infection using TRIZOL reagent. Total RNA was directly used to amplify the eDNA corresponding to rG without the SS and the TD, by RT-PCR, following the manufacturers instruction provided in the kit (Promega). The RT-PCR resulted in amplification of a 1.314 kb fragment. The fragment was cloned in pPCR-Script Amp SK (+) cloning vector and from there into pQE30 expression vector. One of the positive clones (pQE30-rG) expressing rG in E. coli was used as a template to PCR amplify rG eDNA, without the SS and the TD, using BamH I restriction site in the forward primer and Bgl II restriction site in the reverse primer (Table 1 ). For amplification of rG eDNA to prepare rGVRt (-SS, + TD), rGVRs (+ SS,-TD) and rGVRst (+ SS, + TD) constructs, the pKB3-JE-13 clone {ATCC) encoding the full length rG from the Challenge Virus Standard (CVS) strain of the rabies virus was used as a template. The DH5a strain of E. coli was transformed with pKB3-JE-13 plasmid DNA and one of the positive clones was used to PCR amplify' different rG eDNA fragments (for rGVRt, rGVRs and rGVRst constructs) using respective forward and reverse primers as shown in Table 1. All the PCR reactions were carried out with Taq DNA polymerase using the same reaction conditions as

PCR amplification of rG cDNAs

GAAGATCTCAGACCATCTGGCCAACT-3' as the forward pnmer, and 5'-GAAGATCTT-TAAGTGTGGGAAACAGACTT-3' as the reverse primer as described for bmZPl except that primer annealing was performed at 53°C for 1 min.

The dog ZP3 ( dZP3) eDNA, excluding the SS and the TD, was cloned in prokaryotic expression v~ctor, pQE30 (QIAGEN) as described previously (Santhanam et al., 1998). To clone dZP3 eDNA in mammalian expression vector, VR1020, the pQE30-dZP3 clone was used as a template to PCR amplify dZP3 eDNA (79-1056 nt; 978 bp) using 5'-

PCR amplification of dZP3 eDNA

Expression of the recombinant bmZPl (r-bmZPl, excluding the N-terminal signal sequence [SS] and the C-terminus transmembrane-like domain [TD]) in E. coli using pRSET vector (Invitrogen) has been reported previously (Govind et al., 2001). The above pRSET-bmZPl clone was used as a template for amplification of the bmZPl eDNA (64-1389 nt; 1326 bp ), by polymerase chain reaction (PCR), usmg 5'-GAAGATCTAAGCCTGAGACACCAGGT-3' as the forward pnmer, and 5' -TCTAGATCTACTGAGATCAGG-3' as the reverse primer, for cloning in mammalian expression vector, VRI 020 (VICAL). Both forward and reverse primers were designed with Bgl II restriction sites (denoted in bold). The PCR was performed in a 50 ~1 of final reaction volume (10 mM Tris-HCl, pH 9.0, 50 mM KCl, 1.5 mM MgCb and 0.1% Triton X-100) using 50 pmol of each primer and Taq DNA polymerase for extension. The template was denatured at 94°C for 10 min. Amplification was carried out for 35 cycles of denaturation at 94°C for 1 min, primer annealing at 48°C for 2 min and extension at 72°C for 2 min, followed by a final extension at 72°C for 15 min.

PCR amplification of bmZPl eDNA

CLONING OF eDNA ENCODING bmZPl, dZP3, rG AND dZP3-rG GLYCOPROTEINS IN MAMMALIAN EXPRESSION VECTOR VR1020

EROD

ITALYusinga96wellmicrolitreplatereadbyELISAmicroplatereader(modelEL3/Sx,BioTeKInstrumentsINC).Thefinalsolutionwasreadatawavelengthof450nm.Theplasmacortisolconcentrationwascalculatedbasedonaseriesofstandards.

PlasmacortisolwasmeasuredbyadirectimmunoenzymaticdeterminationofcortisolkitmanufacturedbyEquiparSriviaG.Ferrari,21/N-21047,SARONNO

Plasmacortisol

Thecapabilityofheadkidneyneutrophilstomovewasassayedbyamigration-under-agarosetechniquemodifiedfromNelsonetal.(1975).ThemethodhasbeendescribedbySaloetal.(1998).Thedistance,thecellshadmigratedfromthemarginofthewelltowardsthewellcontainingcasein(directedmigration)andintheopposite direction(randommigration)weremeasuredunderthemicroscope.

Migration

Phagocytesfromtheheadkidneywerestimulatedwithphorbol12-myristate13 -acetate(PMA,SigmachemicalCo)andtherespiratoryburstwasdeterminedbytheluminol-enhancedCLmethod(ScottandKlesius,1981)

Theenzyme-linkedimmunospot(ELISPOT)assaywasusedfortheenumeration of totalimmunoglobulinsecretingcells(ISC)andantigen(BCG)-specificantibody-secretingcells(ASC)inthespleenandtheblood.TheELISPOTassayfollowedby Aaltonenetal.(1994)wasused.

EnumerationofsecretinglymphocyteswithELISPOTassay

TheamountoftotalIgMandspecificantibovineY-globulin(BGG)antibodyinthefishplasmawasmeasuredbyanenzyme-linkedimmunosorbentassay(ELISA)asgiven byAaltonenetal.(1994)

Serumimmunoglobulin

Theheadkidneywasusedasasourceofphagocytesforchemiluminescence (CL)andmigrationassays.Cellsfromthehomogenizedheadkidneywereseparatedwithatwo-stepPercollgradient.Granulocyteswerecollectedatthe1.070-1.090g/cm3interfaceandafterwashingwithrHBSSresuspendedinphenolred-freerRPMl.

Headkidney

Thespleenswereremovedandhomogenisedindividuallythroughanylonnet(80mesh).Forisolationoflymphocytes,thetissuehomogenatewaslayeredonatwo-stepPercolldensitygradientandcentrifugedfor30minat400xg.Thelymphocyteswerecollectedatthe1.040-1.080g/cm3interface,washedtwice(400xg,10min)withrHbss,andresuspendedin2mlrRPMl.Cellswerecountedbytrypanblueexclusioninahaemocytometer(viability>95%)andthenumberoflymphocytesfrombloodandspleenwereadjustedto2x106/ml

Spleen

Abloodsamplewastakenfromthecaudalveinofeachfishwitha1mlheparinisedsyringeand24-gaugeneedle.Thebloodwascentrifuged(400xg,5min)fortheseparationofplasma.Plasmawasstoredfrozen(-70°C)forthedeterminationoftheimmunologicalparameters

Collectionofplasma

Immunologicalanalysis

ultrapureHNO3andtissuesamplesweredissolvedin70%HNO3;microwavedfor5minat90W,180W,270Wand360W,untiltotaldigestionhadoccurredandthendilutedwithMilli-Qgradewater(Millipore,Acton,Massachusetts,U.S.A)

Totalsodium,potassiumandcalciumconcentrationsweredeterminedwithatomicabsorptionspectrophotometry.Tothispurpose,plasmasamplesweredilutedwith1%

Ionconcentrations

Plasmaosmolalitywasmeasuredin10pisampleswithavaporpressure osmometer(Wescor,5500,Utah,U.S.A)andexpressedasmmol/kg

Plasmaosmolality

Forclinicalanalysis,thecontrolandexperimentalfishesweregentlyandrapidly anaesthetizedusingMS222(ethyl-m-aminobenzoatemethanesulphonate)atthedoseof60mgl'1.Thefisheswereimmobilizedwithin1minofapplication.Bloodwascollected fromthecaudalarteryusing1mlsyringefilledwith24Gneedleandinsomefishesbycaudalpedunclecut.Heparinwasusedastheanticoagulant.Immediatelyaftercollection,bloodwascentrifugedfor5minat3000rpmandtheplasmawasseparatedoutandeither usedforanalysisimmediatelyorstoredat20°Cforanalysislater.Samplingprocedureofnetting,anesthesiaandplasmastoringwascompletedwithin10mintoavoidinfluenceofnettingcombinedwithanesthesiaonthebasalcortisollevels(Tancketal.,2000).

Plasmaseparation

ClinicalAnalyses

phosphoricacidformedisreducedbytheadditionof1-amino2napthol~4-sulphonicacid(ANSA)reagenttoproducethebluecolor.Theactivityofthebluecolorwasreadat680nmagainstreagentblankusingaU.V.Spectrophotometer.Suitablestandardswererunthrougheachbatchofassays.Theenzymeactivitywasexpressedintermsofpgofinorganicphosphorusformedhr'1mg'1protein.

Aftereffluentexposure,thecontrolandeffluentexposedfishtissueswereremovedandplacedinabeakercontainingice-coldSEIbuffer(300mMsucrose,200mMNa2EDTA,50mMimidazole,pH7.23)foranalysisofNa+-K+ATPaseactivity.ThetissueswereimmediatelyfrozeninliquidN2andstoredat-80°Cuntilanalyzed. Thespecificactivitiesofsodium,potassium,magnesiumandcalciumdependentATPaseswereassayedaccordingtothemethodsdescribedbyWatsonandBeamish(1980)and Boeseetal.(1982).AdenosinetriphosphatasecatalysestheconversionofATPandADP.Duringthisconversion,onemolecule ofphosphorusisliberated.ATPaseAdenosinetriphosphate^...^Adenosinediphosphate+PTheinorganicphosphorusliberatedwasassayedaccordingtothemethodofFiskeandSubbarow(1925).Inthismethodtheproteinisprecipitatedwithtrichloroaceticacid.Theproteinfreefiltrateistreatedwithaceticacidmolybdatesolutionandthe

Na+K+ATPase,Mg2+ATPaseandCa2+ATPase

Thereactionproduction,p-nitrophenolinacidphosphatewasmeasuredspectrophotometricallyat415nmagainstreagentblank.Theenzymeactivitywascalculatedfromthestandardcurveandexpressedasmicromolesofp-nitrophenolformedperhourpermilligramprotein.Therateofhydrolysisofp-nitrophenolphophateisproportionaltotheenzymepresentinthetissue.p-nitrophenylphosphate+NaoH—phosphat?-—>p -nitrophenol+phosphateThecolordevelopedinalkalinephosphataseactivitywasreadat410nmagainstreagentblankspectrophotometrically.Theactivityoftheenzymewasexpressedaspmolphenolformedmin'1mg'1protein

ThealkalinephosphataseactivitywasestimatedbythemethodofMorton(1955)usingp-nitrophenylphosphatesocolorlessinsolutionbutuponhydrolysis,thephosphategroupliberatesp-nitrophenylwhichishighlycoloredinalkalinesolution

Alkalinephosphatase(AKP:ortho-phosphoricmonoester-phosphohydrolase;E.C.3.1.3.1)

AcidphosphatasewasassayedfollowingtheprocedureofMorton(1955).Theactivityoftheenzymewasexpressedaspmolphenolformedmin'1mg'1protein.

Acidphosphatase(ACP:acidorthophosphoricphosphohydrolase)(EC3.1.3.2)

LDHisthekeyenzymeinvolvedinglycolysis,andisresponsiblefortheanaerobicconversionofpyruvicacidtolacticacid,theterminalstageintheEmbden-Meyerhofpathway.Theenzymeactivitywasdeterminedinthecontrolandeffluentexposedfishbrain,gill,muscle,liver,heart,kidneyandair-breathingorgansfollowingSrikantanandKrishnamurthi(1955).TheopticaldensitiesweremeasuredinaUVSpectrophotometerusing340 nmfilterandtheresultsare expressedaspmolesofformazanmg'1proteinhr’1

Lactatedehydrogenase(LDH)(L-LactateNADoxidoreductase)(EC1.1.1.27)

Thesupernatant(0.5mlcontaining50mgtissue)wasassayedforSDH.Thereactionwasinitiatedbytheadditionof0.5mlofthesupernatant.Controlsreceived0.5mlsucroseinplaceoftheenzymeextract.Afterincubationfor30minat37°C,thereactionwasstoppedbytheadditionof5mlglacialaceticacidandthederivedformazanwasextractedinto5mloftoluene.Afterkeepingitovernightincold,thecolorwasmeasuredinUV-Spectrophotometerat495mMusingsilicacuvettes.Enzymeactivitieswereexpressedaspmolesofformazanmg'1proteinhr'1

Thisisanimportantenzymeinvolvedinthecitricacidcycle.Thehomogenatesofcontrolandeffluentexposedtissueswerepreparedin0.25MicecoldsucroseusingPotterElvehjemtypeglasshomogenizerandcentrifugedat3000rpmfor15min

Succinicdehydrogenase(SDH)(E.C.1.3.99.1

Theacetylcholineconcentrationinthetissueswasestimatedspectrophotometricallyat540nmbythemethodofHestrin(1949)usingformicacid-acetonemixture(0.15mformicacidacetone,3:17V/V)astheextractionmediumAchconcentrationwascalculatedintermsofnmolAch/mgtissue

Acetylcholine(Ach)

Aftereffluentexposure,thetissuesweredissectedout,weighedandhomogenizedin0.25Msucrose.Thehomogenateswerecentrifugedat10,000rev/minatatemperaturebelow8°C.AcetylcholinesteraseactivityofthesampleswasdeterminedatpH7.0usingafinalhomogenateconcentrationof25mgmf1at10°CwithmMacetylcholineiodideassubstrate and0.001or0.002NsodiumhydroxideastitrantfollowingHestron’smethodasgivenbyMetcalf(1951).ProteindeterminationsforalltheChEanalyseswereconductedonaliquotsofthehomogenatesusingamodificationoftheLowryetal.(1951)method.AchEactivityisexpressedinpmolesofacetylcholinechloridehydrolysedmgtissue'1hr'1

Acetylcholinesterase(AchE

0.89%salinesolutioninaTejElon-glasshomogenizerat4°C.Thehomogenatewascentrifugedat4000rpm(3500xg)at4°Cfor20minutes.Theclearsupernatant(organextract)wasusedforestimationofenzymes

Aftereffluentexposure,thecontrolandexperimentalfisheswerekilledbyhammeringonheadanddissectedimmediately.Excisedbrain,gill,muscle,liver,heart,kidneyandair-breathingorganswereweighed(about20mg)andhomogenizedin2mlof

Collectionoftissues

Enzymologicalanalyses

Immediatelyafterisolation,thetissueswereweighedandsubjectedtolipidextractionthatwascarriedoutinduplicateaccordingtoFolchetal.(1957)

Totallipids

Salineextracts(0.89%)oftissueswerepreparedinTeflonglasshomogenizer.ThecarbohydratecontentoftheextractwasdoneaccordingtothemethodofShibkoetal.(1967)

Carbohydrates

TotalproteincontentwasdeterminedbytheFolin-CiocalteaumethodofLowryetal.(1951)asmodifiedbyZakandCohen(1961).Bovinecrystallinealbuminwasusedasa referencestandard

Totalproteins

Aftereffluentexposure,thecontrolandexperimentalfisheswerekilledbyhammeringonheadanddissectedimmediately.Excisedbrain,liver,muscle,gill,kidneyandair-breathingorgans werepooled incoldcondition andusedforbiochemicalestimations.

BiochemicalAnalysis

Thegillandmuscleswereisolatedfromcontrolandeffluentexposed(7%)fishes.Physiologicalsalinesolution(0.75%NaCl)wasusedtorinseandcleanthetissues.Theywerethenimmediatelystudiedandphotographed.

Aftertheperiodofexposure,thecaudalfinwasseveredtogetthebloodforsmearing.BufferedLeishman'sstainofpH6.8gaveexcellentresults.Theworkreportedhereisbasedontheanalysisofslidesoffishestreatedwith7%effluentconcentrationsastheobservedchangesaremaximuminthesefishes.

Bloodandorganstudies

Bloodsampleswereobtainedbycuttingthecaudalpeduncleandanalysedforlacticacidusinganenzymatictechnique(SigmaCo,1974)MeasurementsweremadeinQuartzcuvettesat340nmwithaBeckmanAVSpectrophotometer.Standardcurvesweremadeonthedaythebloodlacticaciddeterminationsweremade.

Bloodlacticacid

BloodglucosewasestimatedbyFolin-Wumethod(KlontzandSmith,1968).Glucoseonboilingwithalkalinecoppersolution,reducescopperfromthecuprictothecuprousstate(cuprousoxide).Thecuprousoxidesoformedreducesphosphomolybdicacidtothebluecoloredmolybdenumblue,whichismeasuredcolorimeterically.TheintensityofthebluecolorisproportionaltoglucoseconcentrationanditiscolorimetricallydeterminedinaBoschandLombSpectrophotometerat620nm

Bloodglucose

TheO2carryingcapacity(Vol%)ofbloodwascalculatedby multiplyingtheHbcontentwith1.25O2combiningpowerofHb/g(Johansen,1970).

TheO2carryingcapacity

ThebloodbicarbonatewasestimatedbythemanometricmethodofVanslykeandCullen(1969).

StandardBicarbonates

Meancorpuscularhaemoglobinconcentration(MCHC)istheaverageHbconcentrationperunitvolume(100)ofpackedredcells(W/V).Henceitisexpresseding/1whichisthesameaspercent(%).ItiscalculatedbythefollowingformulaHbMCHC=—......x100(g/dl)PCV

MCHC

MeancellVolume(MCV).Itisexpressedinfentolitres(1fentolitreorflisequivalentto10'151)andcalculatedby thefollowingformula:PCVMCV=.....................x10(fl)RBC8.10.6.2.MCHMeancellhaemoglobin(MCH)=AverageweightofHbinanerythrocyte.Itisexpressedinpicograms(pg)whichisequivalentto10"12g.Itiscalculatedbythefollowingformula:HbMCH=-----------------x10(ppg)RBC

MCV

RedBloodcellsindices

micro-haematocrittubewasfilledto100mmwithanticoagulatedblood.Oneendofthetubewassealedwithsealingwaxandthetubewasthenkeptinaverticalpositioninaglassbeakerstuffedwithcotton.Afteronehour,lengthoftheplasmacolumnwasmeasuredwitha rulergraduatedin0.5mm.

ESRwasdeterminedbythemicromethodbecausethequantityofbloodavailablefromindividualfishwasinsufficienttoadoptanymacromethod.Anon-heparinised

ErythrocytesedimentationRate(ESR)

BloodwascollectedfromtheheartbycardiacpunctureusinganRBCpipette.ItwasdilutedwithHayem’sfluidintheratioof1:200.Thecontentswereshakenwell.AdropofthedilutedbloodwasplacedinaNeubauerdoublehaemocytometer(Germany)countingchamberandtheredbloodcellcountpercubicmmwascalculated

Redbloodcellcount(RBC

Thepackedcellvolumeorhaematocritisthevolumeoccupiedbythepackedredcells,afteravolumeofanticoagulatedvenousbloodisfullycentrifuged.Thevolumeofpackedcellisexpressedasapercentageoftheoriginalvolumeoftheblood.ThePCVisusedtoestimatehaematologicalindices,includingthemeancellhaemoglobinconcentration(MCHC)andmeancorpuscularvolume(MCV).PCVdetermination followedthemethodsofBlaxhallandDaisley(1973).Thehaematocritvaluewasdeterminedbycentrifuging(3000rpm)aknownvolume ofincoagulantbloodkeptinWintrobe’stubes

PackedCellVolume(PCV)orHaematocrit(Ht)

HaemoglobinwasdeterminedbySahlimethod.HaemoglobinisconvertedtoacidhaematinbytheactionofHC1.Theacidhaematinsolutionisfurtherdilutedwiththeaciduntilitscolormatchesexactlythatofthepermanentstandardofthecomparatorblock.TheHbconcentrationisreaddirectlyfromthecalibrationcurve.

Haemoglobin(Hb)determination

BloodwastakenbyheartpunctureusingMS222astheanaesthetic.Nofishwasusedmorethanonce.

CollectionofBlood

HaematologicalAnalysis

TheO2consumptionofthetissueswasmeasuredbymanometrictechniquesinaWarburgconstantvolumerespirometer(Gallenkemp,England)aspertheproceduresgivenbyUmbreitetal.(1959).Thecontrolandeffluentexposedfisheswerekilledandthebrain,gill,muscle,liver,heart,kidneyandair-breathingorganswereisolated.ThetissueswereslicedandplacedinWarburgflasks(60-80mgtissuesflask)containing2.5mloffishringersolutionwithphosphatebufferatpH7.5asthesuspensionmediumforthetissuesand0.2ml15%KOH.Temperaturewas28°CduringO2uptakedetermination.Inordertocomparedatafromthedifferentseriesoftreatment,arespiratoryindexwascalculatedusingthefollowingformula:KO2treated-KO2controlr=100-------------------------------------x100KO2controlWhere,K=O2consumptioninpi/100mgwettissue/hrThisindexindicatespercentrespirationoftreatedtissuesrelatedtothecontrolvalues ofthesameseries.

TissueRespiration

ThecircadianrhythmofbimodalO2uptakeofcontrolandeffluenttreatedfisheswerestudiedseparatelyat28°±1°C.TheamountsofO2extractedfromwaterandairwereseparatelydeterminedforadayatregularintervalsof3hreach.TotalO2uptakeateachtimewasobtainedbysummingupthevaluesforaquaticandaerialrespirationobtainedatthecorrespondingtime.Throughoutthepresentstudy,theinitialO2contentofthewaterwaskeptconstant(6±0.5mgF1)

CircadianrhythmofbimodalO2uptake

Forstudyingtheaerialrespirationoffishesinair,respirometersweredesignedinvolvingtheprinciplesofmonometrictechniques.Thesetup(Figure10and11)consistsofarespiratorychamberconnectedtoagraduated‘U’tubecontainingBrodie’sfluid.KOHisusedasCO2absorbent.Thedifferenceinthelevelofthefluidinthemanometerforagiventimeisusedinthefollowingequationandthegasutilizediscalculated.VixhV=-...........-10,000Where,‘V’isthevolumeofthegasutilized‘Vi’isthevolume ofgasintherespiratorychamber‘h’isthedifferenceintheleveloftheBrodie’sfluidinthemanometerand10,000isthepressureofmanometricfluid(Brodie’sfluid)inmm

AerialRespiration

Theexperimentalsetup(Figure8and9)forthedeterminationofO2uptakesimultaneouslyfromairandwaterwassimilartothatusedearlierbyNatarajan(1972),Rani(1994)andVijayalakshmi(1996).Aclosedglassrespirometerof5litrecapacitywasfilledwith3.5litrefreshtapwater.Athermocolfloatwithasemicircularholeatitsperipherywasplacedoverthewater,whichseparatedtheair-waterinterphaseoftherespirometer.Theair-phaseoftherespirometerwasattachedtoafluidmanometer.Asthefishcomestothewatersurfaceandtakesair-gulp,thereisapressurechangeintheair-phasecausinganimbalanceinthemanometricfluid.AgraduatedsyringefilledwithpureO2(takenfrommedicalO2cylinder)isusedtorestoretheimbalanceofthemanometricfluid.TheamountthusneededshowstheaerialO2uptakeofthefish.TheexpiredCO2wasabsorbedbythepelletsofKOHinthepetridishoverthemanometricfluid.Theconcentrationofdissolvedoxygenoftheambientwaterwasestimatedbefore andaftertheexperimenttomeasuretheaquaticO2uptakebythefish.ThedifferenceintheDOandtheamountofwaterindicatestheactualaquaticO2uptake.Winkler’svolumetricmethod(Welch,1948)wasusedtoestimatetoDOofthewatersamples.Darkenedrespiratorychamberswereusedwithdimensionsthatwereclosetothoseofthefishinorderthatthefishshouldremaininmoreorlessthesamepositionbut havesufficientroomtomoveitsopercula.Theflowofwaterthroughtherespirometer wasregulatedandmeasuredbymeansofaflowmeter.APhilipsO2electrode(PI1056)waskeptinawaterjacketmaintainedatthesametemperatureastheclosedcirculation.SamplesoftheinflowandoverflowwatercouldalsobeledovertheO2electrode

Bimodalrespiration

Theexperimentalfishwasacclimatedtoglassrespirometersforabout24hrandtheywerenotgivenanyfoodduringthisperiod.TheeffluentexposedfishesalongwiththecontrolsweresubjectedtoO2consumptionseparately.Theexperimentswereperformedinaninsulatedroombetween8to10AMwithlightson.TherateoftotalO2uptakethroughgillsfromflowingwaters(DO=7.2mg021'1)wasmeasuredinfishesofdifferent body weights.Forthis,acylindricalglassrespirometerof2litrecapacitywasused.Thefishwasintroducedintherespirometerwhichwasconnectedtoalargeconstantlevelwatertanktomaintaintheflowofwaterunderconstanthydrostaticpressure.Thewaterenteredtherespirometeratonesideanditsflowperminutewasmeasuredasitlefttheotherside.Theflowwasadjustedaccordingtothesizeofthefish.Thefishwasacclimatizedtotherespirometeratleast12hrbeforereadingswere taken.ConcentrationofdissolvedoxygeninthesampleswasmeasuredbyWinkler’svolumetricmethod(Welch,1948).ThedifferenceinO?levelsbetweentheambientwaterandthatsuppliedtotherespirometeraswellaswiththerateofwaterflowandtheweightofthefishwasusedtocalculatetherateof O2uptakeintermsoftime(ml02hr'1)withthehelpoftheequation:V02=Vw(Ci02CE02)Where,VO2=02uptake(ml02hr'1)Vw=water(mlm'1)andCi02-CE02respectivelythe02concentrationofinletandoutletwaters.Arespirometercontainingnoanimalsservedasacontrolforadjustingcalculationsfor02uptakeinthewater.Uponremoval,fisheswereblottedwithpapertoweling, andweighed

Aquaticrespiration

Theeffectof2%,5%and7%effluentexposureontheoxygenuptakewasmeasuredatexperimentalconditions,viz.,(a)whenaccesstoairwasprevented(aquaticconsumption),(b)whenitwasallowed(bimodalrespiration)and(c)underaerialconditions(aerialrespiration)

Effectofeffluentexposureontheoxygenconsumption

Respirationstudies

SamplesofC.punctataweretakenfromtheacclimationtanksandslightlyblottedonpapertowelstoremoveexcesswater.TheywereplacedindividuallyonaWhatmanfilterpaperinaonelitreglassbeaker.Theindividualswereimmediatelytransferredtobigglassdesiccatorscontaining250mlofthefollowingsolutionsfordesiredhumiditylevelsusinggradedsolutionsofKOHasdescribedbySolomon(1951).Watergiving95to97%relativehumidity(RH),mean95%;sodiumchloridegiving72to76%relativehumidity,mean75%;calciumchloridegiving28to31%relativehumidity,mean35%.Thedesiccatorswereplacedinanincubatorataconstanttemperatureof28°±1°Cwithdeterminationsofsurvivalandbodyweightatregularintervals.Thecontainerswereweighedatintervalstothenearest0.1mgandweightlosswasassumedtoequalwater loss

Survivaloutofwater

Thefishessurvivedwithoutanymortalityintheeffluentconcentration ofnominalvalues2%,5%and7%.The30,60,90and120dayschronicexposurewith20fishaddedrandomlytoeachof60by40by240cmplastictankswasbegunwithfishfromthesameoriginastheseandintheinitialacutebioassays.Flowratesmaintainedtothetanksallowedfor twovolumesturnovers24hr.

Thefisheswereexposedtodifferentconcentrationsofeffluentandthenumberoffishineachconcentrationwasrecorded.Thedataweresubjectedtoprobitanalysis(Finney,1964)andDragstedtandBehven’sequation(Carpenter,1975)todetermineLC50values.Apresumableharmlessconcentration(C)oftheeffluentwasalsocalculatedbyusingthesafefactororapplicationfactor(Sprague,1971)employingtheformulaC=Where,48hrLC50xAS24 hrLC50S= -------------------48hr LC50A=0.3(constant)Thesafeconcentrationisausefulunitofmeasurementofacceptableamountoftheeffluent,whichhasnolethalityandstresstotheanimalexposed.Approximately1/3ofLCsoofvalueofeffluentwasselectedassublethalconcentrationinthepresentstudy.Fishesweredividedinto4groupsandkeptin401glassaquariacontaining wellwaterofpH7.2.GroupI,IIandIDwerekeptin2%,5%and7%ofeffluents(Figure7)respectivelyandexposedto24,48and72(short-term)periods.Allacutelethalitytestswereconductedaccordingtothe methodsofthe AmericanPublicHealthAssociation(1985).GroupIVservedascontrol.

Bioassay

experiments.Chemicalcharacterizationoftheeffluent(Table1)wascarriedoutbyusingstandardmethods(APHA,1985)

ThecementfactoryeffluentobtainedfromtheACCcementfactory,Madukkarai(Figure6)in101blackpolyethylenecontainerswerekeptinarefrigeratoruntilusedfor

EffluentCollection

Thetapwaterusedforacclimationandexperimentationhadthefollowingaveragecharacteristics:temperature(28°-30°C),pH(7.2-7.4),dissolvedoxygen(7.8-8.0ppm),CO2(2.08mll'1),salinity(0.190gF1)hardness(154ppmasCaCCF?),alkalinity(68ppmasCaC03)andconductivity(0.56mMhos).

Physico-chemicalcharacteristicsoftapwater

Thefisheswerefedadlibitumwithboiledhen’seggsontwodaysinaweekandearthwormsontheremainingdays.Feedingwasstopped24hrpriortoexperimentation.Noprophylactictreatmentforanydiseaseproblemwasnecessaryatanytimeduring acclimationandtest

Feeding

Theywereheld(28°±0.5°C;naturalphotoperiod)in240litretapwatertanks(1x1x0.3m)andacclimatedtothelaboratoryconditionsforaweekbeforeexperimentation.Agentlecontinuouswaterflowwasmaintainedthroughtheaquariaforconstantwaterrenewal.

Holdingtanks

Channapunctata(Family:Channidae)(15-20g;10-15cm)usedinthisinvestigationwerewildcaughtandbroughttothelaboratoryinplasticbuckets.

Collectionoffish

54Primer NameGenome Co-ordinatesSequence (5’-3’)Brk_RE_FchrX:7200547-7200702AAACCTCTGTGTTCGTCTGGCBrk_RE_RTCCGTAGAAACCGCGCAACBrk_RC_FchrX:7200789-7200926CCGATGTGGAAGGGGTATGGBrk_RC_RGGCTCTGCCAGTTGCTCATAC15_RE_Fchr3R:17325974-17326067GCCAAAATGTCCAGCCACGAC15_RE_RTGACATCCGCGAGTCCGAC15_RC_Fchr3R:17325763-17325861CCGTAGACCGTAATCCGTGAAC15_RC_RCCGCGAAGCACACACTAATCTable 2.4. | Primer sequences to determine DpnII digestion efficiency. Digestion efficiency was calculated using the following formula (Hagège et al., 2007):Digestion Efficiency %= 100-1002CtRE-CtRCDigested-CtRE-CtRCUndigestedSequencing Library Preparation:Prior to preparation of sequencing libraries, 5-6μg 3C libraries were sonicated using a S220 Focussed Ultrasonicator (Covaris) aiming for a peak size of 200bp. Libraries were sonicated with the following settings: Duty Cycle: 10%, Intensity: 5, Cycles per burst: 200 and Mode set as Frequency Sweeping with 6 cycles each of 60s. Following sonication, samples underwent clean-up using AMPure XP SPRI beads (Beckmann Coulter), with sonication quality assessed using a TapeStation 2200 (Agilent). Sequencing libraries were prepared using the NEBNext DNA Prep Reagent set and the NEBNext Multiplex Oligos for Illumina (NEB), following the manufacturers instructions with the following modifications. Firstly, AMPure bead clean up steps were performed x1.8 volume to avoid skewing for larger fragments. Secondly, library PCR amplification was performed using Herculase II Fusion DNA Polymerase kit (Agilent) to a total of 50μl using: 1x Herculase II Buffer, 250μM dNTPs, 0.5μM of both the NEB Universal and NEB Index Primer, and Units Herculase II Polymerase. Libraries were assessed after adaptor ligation and post indexing PCR on a TapeStation 2200 (Agilent)

until 2-4h AEL. Collected embryos were dechorionated in cold 50% Bleach (Sodium Hydrochlorate) for 3mins and rinsed thoroughly in cold dH20 and cold Triton-NaCl (previously described). The subsequent steps for both cross-linking and nuclei isolation were based on a ChIP protocol for Drosophilaembryos (Sandmann et al., 2006).Covalent Cross-linking: Collected embryos were blotted dry then rinsed in 100% isopropanol, to remove the excess water. Covalent cross-linking was performed using 2% methanol-free formaldehyde (ThermoFisher Scientific) for 20mins with 50% Heptane and Cross-linking Buffer (1mM EDTA, 0.5mM EGTA, 50mM HEPES pH 8.0, 100mM NaCl) and quenched using 125mM Glycine in 1x PBS, 0.1% Triton X-100 for 1min. Embryos were subsequently washed in 1x PBS, 0.1% Triton X-100, flash frozen andthen stored at -80°C. Replicates were obtained through collections of two independent sets of cages.Isolating Nuclei: 1.2 ml of embryos were resuspended in cold 1x PBS with 0.1% Triton X-100 and dounced 5 times in 4ml aliquots in a 7ml Wheaton Dounce Homogenizer. The homogenate was centrifuged at 400g for 1min at 4°C and transferred to a new tube and centrifuged at 1100g for 10mins at 4°C. The cell pellet was resuspended in 5ml of cold cell lysis buffer (85mM KCl, 0.5% (v/v) IGEPAL CA-630, 5mM HEPES pH 8.0, 1mM PMSF and 1x Protease and Phosphatase inhibitors (Roche)) and dounced 20 times. Nuclei were pelleted by centrifugation at 2000g for 4min at 4°C. 3C Library Preparation: Preparation of Capture-C libraries were performed according to the Next-Generation (NG) Capture-C Protocol (Davies et al., 2015). Briefly, nuclei were resuspended to a total volume of 650μl and digested overnight at 37°C whilst agitating at 1400rpm on an Eppendorf Thermomixer. Digestion was performed using 1500 Units DpnII (NEB High Concentration 50,000 U/ml), 1x NEBuffer DpnII, 0.25% SDS and 1.65% Triton X-100, including a non-digested control. Digested 3C libraries were ligated using 240 Units T4 DNA HC Ligase (ThermoFisher Scientific) and 1x Ligation Buffer overnight at 16°C whilst agitating. Following ligation, all 3C libraries including controls were de-crosslinked overnight at 65°C with 3 Units Proteinase K (ThermoFisher Scientific). Ligated 3C libraries were digested with 15μg/μl RNAse (Roche) and DNA subsequently extracted with phenol-chloroform followed by ethanol precipitation. Digestion efficiency: Digestion efficiency was determined using primers pairs designed against DpnII digestion sites and genomic controls at two independent regions comparing the digested and undigested controls for both replicates. Efficiency was determined through qPCR on a StepOnePlus Real-Time PCR System (ThermoFisher Scientific) using the SYBR Select Master Mix (ThermoFisher Scientific) as per the manufacturers instructions. Primers used to determine restriction efficiency are shown in Table 2.4

Embryo Collection: Embryo collections were carried out as described above with the following modifications. Prior to collections, plates from the first 2hrs were discarded to prevent inclusion of older embryonic stages. After pre-clearing, collections were carried out as above with ageing

Capture-C

smiFISH: The smiFISH protocol was performed as described by Tsanov et al., 2016with modifications for use in the Drosophila embryo. Briefly, a minimum of 50μl of embryos were transferred to Glass V-vials (Wheaton) and transitioned from 100% Methanol to PBT in 50% increments, followed by several 10min PBT washes. Subsequently, embryos were washed at 37°C in stellaris wash buffer(1x SSC (150 mM NaCl and Sodium Citrate at pH 7.0), 10% deionised formamide) pre-warmed to 37°C. Hybridisation was performed using 4uM of labelled probes mixtures, as described above, incubated in stellaris hybridisation buffer (1x SSC, 100mg dextran sulphate, 10% deionised formamide) for a minimum of 14 hours at 37°C. Following hybridisation excess probes are removed with washes in stellaris wash buffer, pre-warmed to 37°C and subsequently washed with PBT. During the pen-ultimate PBT wash DNA and the nuclear membrane were stained using 1:1000 of DAPI (5mg/ml) and 1:1000 of wheat germ agglutinin (WGA) conjugated to Alexa 555 (5mg/ml, ThermoFisher Scientific), respectively. Embryos were subsequently mounted with ProLong Gold AntiFade (ThermoScientific).Alkaline Phosphatase Immunostaining: For immunostaining, a minimum of 50μl of embryos were gradually transferred from methanol to PBT and washed in PBT for 30mins with repeated changes of PBT. Embryos were blocked for 2hrs in 10% BSA in PBT and subsequently washed in PBT. Following this, embryos were incubated with monoclonal mouse anti-Hindsight-IgG1 (1:20, DSHB) primary in 1% BSA in PBT overnight at 4°C. To remove excess antibody, embryos were washed for 2hrs in 1% BSA in PBT. Next, polyclonal goat anti-mouse-IgG (H+L) AP Conjugate (1:500, Promega) was added in 0.1% BSA in PBT and incubated for 2hrs at room temperature. This was followed by washes with PBT and staining solution (defined above). Following staining, washing and mounting was performed as above. Image Acquisition: Images from alkaline phosphatase staining were acquired on a Leica DMR. Fluorescent images were acquired using a Leica TCS SP5 AOBS inverted confocal. Whole embryos were viewed using a20x 0.70 HXC PL APO Lambda Blue Immersion objective and embryo sections viewed with a 63x 1.40 HCX PL APO Lambda Blue Oil objective, with a maximum of 3x confocal zoom. Additional confocal settings were as follows: pinhole diameter of 1 airy unit, 400Hz unidirectional scan speedwith all images collected at 1024 x 1024. Images were collected sequentially usingPMTdetectors with the following mirror detection settings:DAPI (420-470nm), Alexa 488 (490-525nm), Alexa 555 (570-620nm) and Alexa 647 (650-780nm). The respective fluorophores were detected using the blue diode (20%) and the following laser lines: 488nm (50%), 555nm (50%) and 633nm (40%). When acquiring 3D optical stacks the confocal software was used to determine the optimal number of Z sections based on a Z section depth of 1μm at 20x and 0.3μm at 63x. Only themaximumintensity projections of these 3D stacks are shown in the results

fluorescently conjugated secondary antibodies, also at a ratio of 1:400. Secondaries used included: donkey anti-mouse-IgG-Alexa 488, donkey anti-sheep-IgG-Alexa 555 and donkey anti-rabbit-IgG-Alexa 647 (all from ThermoFisher Scientific). Following incubation, excess secondaries were removed with PBT washes over 2hrs, including a 40 min incubation with 1:1000 wash with DAPI (5mg/ml, ThermoFisher Scientific). Finally embryos were resuspended in ProLong Gold AntiFade (ThermoScientific) and mounted. smiFISH Probe Design: CustomsmiFISH probes were designed using the Biosearch Technologies Stellaris RNA FISH Probe Designer ver 4.2 (Biosearch Technologies, Inc., Petaluma, CA), (available online at www.biosearchtech.com/stellarisdesigner(last accessed: 18/05/2017)) against the Drosophila genome. Probes were designed with the following parameters; masking level of >=3, oligo length between 18bp to 22bp, a minimum of 2bp spacing between probes with a minimum of 24 probes per gene. Sequences complementary to the Y and Z flaps based onTsanov et al., 2016were added to the 5’ end of the probes. 250pmoles of labelled flap sequences were hybridised to 200pmoles of smiFISH probes in 1x NEB Buffer 3 (NEB) and incubated in a thermocycler at a final concentration of 4uM in the following conditions: 85°C for 3min, 65°C for 3min and 25°C for 5min.Details of target regions, number of probes and flap sequence are shown below in Table 2.2with details of fluorescent-labelled flap sequences shown in Table 2.3. Individual probe sequences for Ance, peb and ush are available in the following supplementary tables: Table S1.1, Table S1.2 and Table S1.3, respectively. ProbeProbe TargetTarget Region(s)FlapNumber of ProbesAnceExon 1;Intron 1;Exon 2chr2L:13905733-13906413;chr2L:13906591-13907163;chr2L:13907608-13907958Y48PebIntron 1;Intron 2chrX:4512107-4513998;chrX:4514915-4515168Z48UshIntron 3;Intron 4chr2L:524083-525382;chr2L:525516-535905Z48Table 2.2. | smiFISH target probes target regions, including: flap sequence and total number of probes per regionsFlapSequenceFluorophore (nm)YAATGCATGTCGACGAGGTCCGAGTGTAAAlexa 488ZCTTATAGGGCATGGATGCTAGAAGCTGGAlexa 647Table 2.3. | Fluorescently labelled Flap sequences complementary to probes flaps, including fluorophore for smiFISH

GenePrimer DirectionSequence (5’-3’)Intronic or ExonicAnceForwardAAACAAGTCATTCGCTTTAGGGCIntronicReverseCGCATTTTCGGATGACTCTGGKek1ForwardGCAGATTCGCACGGATGAACIntronicReverseTTTGCGTGGCAAAATGTGCTNetForwardATTCACCCAATTCCAACGACExonicReverseGTGGCAATGGACGGTACGGATupForwardCGGGAAAAGCAGCCTTGGATIntronicReverseTAGCTACAGCGAGTGCGAAATable 2.1. | Primer sequences for FISH.Alkaline Phosphatase RNA In-situ Hybridisation: For in situ hybridisations, a minimum of 50μl of embryos were washed with 100% ethanol, transitioned to 100% methanol, and then to PBT (1x PBS, 0.1% Tween-80). Embryos were then transferred to hybridisation buffer (previously described) and incubated at 55°C for 1hr, followed by overnight incubation in 0.5-2μl of the RNA probe in 50μl of hybridisation buffer. Sequential washes were then performed with hybridisation buffer and PBT, after which the embryos were incubated overnight at 4°C with anti-Digoxigenin-AP Fab fragments (1:250, Roche), pre-absorbed prior use against fixed embryos, in 500μl PBT. Excess primary antibody was removed with sequential several PBT washes, followed by two 5min washes in staining buffer (100mM NaCl, 50mM MgCl2, 100mM Tris pH 9.5, 0.1% Tween 80). The antibody bound RNA probe was visualised using 0.27mg Nitro-Blue tetrazolium and 0.14mg 5-Bromo-4-Chloro-3-indolyphosphate in 400ul. Staining was stopped by washing with PBT, followed by repeated washes with 100% ethanol over 1hr. Lastly embryos are briefly treated with 100% xylenes prior being mounted in Permount mounting medium (bioPLUS).Fluorescent RNA In-situ Hybridisation: For FISH, a minimum of 50μl of embryos were transferred from 100% methanol to 100% ethanol, as above. Embryos were washed for 1hr in 90% xylenes with 10% ethanol, followed by ethanol washes until complete removal of xylenes. Subsequently, embryos were washed with methanol and underwent post-fixation for 25mins using PBT with 5% formaldehyde. Following this embryos were pre-hybridised using hybridisation buffer (previously described) for 1hr at 55°C. Hybridisation was performed in 100ul of hybridisation buffer overnight at 55°C with 2μl of denatured RNA probe. Excess probes were removed through washes with hybridisation buffer and PBT. Prior to addition of primary antibodies, embryos were blocked for 30mins in 1x Blocking Reagent in PBT (Western Blocking Reagent, Roche). For detection of labelled RNA probes, the following primary antibodies were used: mouse monoclonal anti-Biotin-IgG (1:400, Roche), sheep polyclonal anti-DIG-IgG (1:400, Roche), rabbit polyclonal anti-DNP-IgG (1:400, ThermoFisher Scientific). Primary detection was performed overnight at 4°C in 400μl of 1x Blocking Buffer in PBT. Following incubation, excess primaries were removed with PBT washes and embryo re-blocked with 1x Blocking Reagent for 30mins. Subsequently, embryos were incubated for 1hr 30mins at room temperatur

Embryo Collection: Embryos were collected at 25°C on apple juice agar plates from cages withapproximately 5ml of well-fed young flies. Collections were performed every 2hrs with plates aged at 18°C or 25°C After Egg Laying (AEL), as appropriate, resulting in a pool of embryos between 2-4hrs (Stage 5 to 9), unless otherwise stated.After ageing, collected embryos were washed with 1x NaCl/Triton X (68nM NaCl, 0.03% (w/v) Triton X-100) and loosened from plates with a brush. Embryos were subsequently dechorionated in 50% bleach for 2min and thoroughly washed, alternating between dH20 and 1x NaCl/Triton X. For RNA In-situ hybridisations, embryos were fixed with 4.625% formaldehyde for 20mins with 50% heptane and Fixing Buffer (0.5x PBS, 25mM EGTA pH 8.0). Following fixation, embryos are devitellinised using methanol, transferred to 100% ethanol and stored at -20°C. For Immunostaining, overnight plates with a maximum 12hrs of ageing were collected and dechorionated as above. Fixing was performed for 12mins with 1.85% formaldehyde, 50% heptane, and Buffer B (4.5mM KPO4, 6.75mM NaCl, 20.25mM MgCl2, 4.5mM NaP). Embryos were devitellinised as previously described, but stored in 100% methanol at 4°C.RNA Probe Synthesis: RNA probes for RNA in-situ hybridisation were synthesized using gene specific primers, flanked by the T3 and T7 promoters to transcribe sense or anti-sense probes respectively, except for the AncecDNA probes. All probes were designed against approximately 1kb of the target RNA unless otherwise constrained by sequence or target limits. All primers used to generate RNA probes are described in Table 2.1, including intronic or exonic position of probes. Anti-sense probes for Ancewere derived from Ance cDNA cloned between T3 and T7 promoters within pBluescript KS plasmid. Template is produced through PCR of the plasmid template using primers against the T3 and T7 promoters. Approximately 1ug of DNA template was used to generate labelled anti-sense RNA in a transcription reaction. Probes were either labelled with Biotin, Digoxigenin (DIG) or Dinitrophenol (DNP) labelled UTP in a mix with other nucleotides. The transcription reaction was carried out for 2 hrs at 37°Cusing, 1x transcription buffer (0.06M MgCl2, 0.1M NaCl, 0.02M Spermidine-HCl, 0.4M Tris pH 7.5), 10 Units RNAse inhibitor (Roche), 20 Units T3/T7 polymerase (Roche), 1x nucleotide mix (10mM ATP, 10mM GTP, 10mM CTP, 6mM UTP and 4mM Biotin, DIG or DNP labelled UTP (Roche)) and dH2O. The probes were then hydrolysed in 1x carbonate buffer (60mM Na2CO3, 40mM NaHCO3, pH 10.2) and incubated for 5mins at 65°C. Following hydrolysis, the reaction was stopped by the addition of 40μl dH2O, 50μl STOP solution (0.2M NaAc, pH6.0) for 5min and precipitated overnight at -20°C with 2μg of tRNA in 0.1M LiCl, and 100% ethanol. The sample was then centrifuged for 20mins at 13,000g and the pellet resuspended in 150ul of hybridisationbuffer (50% formamide, 750mM NaCl, 75mM sodium citrate, 100μg/ml ssDNA, 50μg/ml heparin, 0.1% Tween-80).

Expression analysis of Drosophila Embryos

Percentage lethality was calculated as:100×((number of non-CyO/ number CyO)×100)

Flies were maintained at 18°C or 25°C as appropriate. Through out this thesis, flies defined as wild-type were yellow white of the genotype: y67c23w118. BEAF32 null lines BEAF32AB-KO/CyOGFP, kindly provided by Craig Hart, University of Illinois (Roy et al., 2007a). Homozygous BEAF32AB-KOlines were obtained by selection against the CyOGFPmarker at the 3rdinstar larvae stage, using a Leica M165 FC with a GFP filter. Lethality of the BEAF32AB-KOallele was assessed against the dppHr27hypersensitive allele (genotype: dppHr27,cn1,bw1/CyO P{dpp-P23}). For this embryos were collected from the following crosses as set up by Catherine Sutcliffe:BEAF32AB-KO/+ ×dppHr27,cn1,bw1/CyO P{dpp-P23}and+/+ ×dppHr27,cn1,bw1/CyO P{dpp-P23}

Fly Stocks and Crosses

Genomic DNA Preparation: Genomic DNA, used as a template for PCR, was isolated from approximately 20 wild-type flies. Flies were added to 125ul Homogenisation buffer (200mM sucrose, 100mM Tris-HCl pH 8.0, 50mM EDTA, 0.5% SDS) and ground using a pestle. The mixture wasthen incubated at 67°C for 10mins. Subsequently, 1.5M KAc was added and incubated on ice for 10mins, followed by DNA extraction using an equal volume of phenol chloroform. The mixture was centrifuged at 16,000g and the DNA precipitated using 0.3M NaAc andethanol. The DNA pellet was then resuspended in 25μl of TE with 25ug RNaseA. PCR:Unless otherwise stated, all PCR reactions were performed using Phusion High Fidelity DNA Polymerase (NEB). PCR reactions were carried out at either 20μl or 50μl with the following reaction setup: 1x GC or HF Buffer, 200μM dNTPs, 0.5 μM of both primers, 1 Unit of Phusion and a maximum of 200ng of DNA. Thermocycling conditions used were as per the manufacturers instructions with a minimum of 35 PCR cycles at an elongation rate of 30s/kb at 72°C. Elongation time was adjusted as appropriate for the PCR product. Where necessary Tm was optimised using gradient PCR. All PCR reactions were performed on a BIO-RAD T100 Thermal Cycler. Both PCR purification and Gel extraction were performed using the NucleoSpin Gel & PCR Clean up kit (Macherey-Nagel), as per the manufacturers instructions. Unless otherwise specified, all primers used in this thesis were designed using NCBI’s Primer-BLAST, selecting against any primers or primer pairs that would produce unspecific products (Ye et al., 2012).

Molecular Biology Protocols

otal RNA was isolated from cell lines after 48 hrs of transfection using trizol (Invitrogen, U.S.A.). 32p labeled antisense HBx mRNA was in vitro transcribed using T7 RNA Polymerase and Riboprobe kit (Promega, U.S.A.), as described earlier. For generating antisense HBx probe, plasmid DNA was linearized with Bam HI and subjected to transcription. Total RNA was quantitated and equal concentration (15-20 pg) was loaded after adding loading dye (50%glycerol, 1 mM EDTA, 0.25% bromophenol blue, 0.25% xylene cyanol FF) on 1% formaldehyde-agarose gel and 1X MOPS was used as the running buffer. The gel was then run at 5 V /em length of the gel. The gel was then treated with 2.5% HCl for 15 min for depurination, 0.4N NaOH for another 15 min and then in 3 M sodium acetate for 15 min, before the transfer was set. Also the nylon membrane prior to transfer was first treated with distilled water for 5 min and then in 0.4 N NaOH for 20 min. The overnight transfer was set up using 20X sse buffer as the transfer buffer at room temperature. Thereafter, the membrane was cross-linked by uv and then dipped in 2X sse for 20 min. For pre-hybridization the membrane was soaked in Rapid hybridization buffer (Amersham Biosciences, U.K.) for 2 hr at 65oC in the hybridizing oven. The probe was then added and further incubation for 4 hrs was carried out. Post hybridization the membrane was washed thrice with 6X sse at 37oC on a shaker. The membrane was then dried on a filter paper and wrapped in a saran wrap. The membrane was then analyzed by autoradiography. For ensuring the equal loading, the formaldehyde-agarose gel was also stained with EtBr for 23s and 18s rRNA

Northern Blot Analysis

ubjected to three washes with PBST and two washes with PBS. The blot was developed using the substrate DAB (Sigma, U.S.A.) or with ECL (Amersham Biosciences, U.K.)

he protein samples were diluted with 4X sample buffer which is essentially SDS-reducing buffer (O.SM Tris-Cl, pH 6.8, Glycerol, 10% (w /v) SDS, 2-J3-mercaptoethanol, 0.05% (w /v) bromophenol blue). The samples were denatured at 1000C for 10 min and the proteins were resolved on 12-15% SDS-polyacrylamide gel at 25-30mA. For detection, the proteins were transferred on to nitrocellulose (NC) membrane (Hybond-C extra, Amersham, U.K.) at 200mA, for either 1 hr or at 12 rnA, 40C for overnight. After the transfer was over, the NC membrane was washed thrice with PBST (1X PBS with 0.1% Tween 20) and blocked with 2% BSA for 2hrs (in PBST) at room temperature. Primary antibody to HBx/Vif/ APOBEC3G-NT raised in rabbit and were diluted to 1:1,000 in PBST. One hour incubation with the primary antibody was followed by three washes with PBST (10 min each) and then 1 hr incubation with 1:1,000 dilution of the secondary antibody (Anti-rabbit IgG (Fe) HRP conjugate) was carried out. The blot was further

Westem blot analysis

After transfection the cells were harvested and protein was isolated from the celllysates. The cells from each well were pelleted at 2000 rpm for 10 min at 40C. The supernatant was carefully removed and the pellet was incubated on ice for 1 hr after adding 50pl of lysis buffer (1% triton X100, 0.1mM EDTA, 0.1mM EGTA, 1mM DTT, 1X PI, all in 1X PBS) with intermittent vortexing. The tubes were centrifuged at maximum rpm for 10 min at 40C and the supernatant, containing the proteins, was collected and stored at -700C. The purified protein fractions were quantitated using the BCA protein assay kit and the O.D. was taken at 562nm

rotein isolation from celllysate

annealing at 25°C for 5 minutes, the reaction was incubated at 42°C for one hour.

series of primers were designed to detect the levels of intact gene of interest or Rz in the cell lysate. The levels of RNA were quantitated by carrying out reverse transcriptase based-PCR using the Im.Prom-11™ Reverse Transcriptase system (Promega, U.S.A.). 1}lg of template RNA and 1}lM terminal primers were combined in 5pl reaction volume and the primer I template mix was thermally denatured at 70°C for 5 minutes and chilled on ice. A reverse transcription reaction mix of volume 15 pl was assembled on ice to contain nuclease-free water, 1X reaction buffer, 1pl reverse transcriptase, 6 mM magnesium chloride, 0.5 mM dNTPs and 1 U ribonuclease inhibitor RNasin. As a final step, the template-primer combination was added to the reaction mix on ice. Following an initia

Reverse transcri.ptase polymerase chain reaction (RT-PCR)

After transfection the cells were harvested and RNA was isolated from the celllysates using Trizol reagent (Invitrogen) and purified according to the manufacturer's directions. Briefly, the cells were lysed directly in the culture dish by adding 1ml of Trizol reagent to each well. The homogenized sample was incubated at room temperature for 5 min to permit complete dissociation of the nucleoprotein complexes. For purifying the RNA, 200pl of chloroform was added, the tubes were shaken vigorously for 15 seconds and incubated at room temperature for 2-3 min. Tubes were centrifuged at 12,000 ref for 15 min at 40C. The aqueous phase was collected, mixed with 500pl isopropanol and incubated at room temperature for 10 min. Centrifugation was carried out at 12,000 ref for 10 min at 40C. The supernatant was carefully removed and the RNA pellet was washed with 1ml of 70% ethanol by vortexing and then centrifuging at 7500 ref for 5 min. The pellet was air dried and dissolved in 20pl of NFW.

RNA isolation from celllysates

The cells were assayed for Luciferase gene expression using Luciferase Assay kit (Promega, U.S.A.). After transfection, the cells were washed twice with PBS and then lysed by adding reporter lysis buffer provided in the kit. The cell lysate was collected from individual wells in eppendorf tubes, the cells were twice freeze-thawed in liquid N2 and then centrifuged at 13,000 rpm for 10 min at 40C. The supernatant was transferred to a fresh tube. 20¢ of cell extract was mixed with lOOp! of luciferase assay reagent that was kept at room temparature. The activity was determined using a luminometer (Packard lumicount, U.S.A.

Luciferase assay

incubator until the cells were 60% confluent. For each transfection, 1-2pg of DNA was diluted in 100 pi serum free media. Also, lOpl of lipofectin reagent · was diluted in 100 pi of serum free media and allowed to stand at room temperature for 30-45 minutes. The two solutions were combined, mixed gently and incubated at room temperature for 15 minutes. The cells were washed once with 2ml of serum free medium. For each transfection, 0.8 ml of serum free medium was added to each tube containing lipofectin-DNA complexes. The complex was mixed gently and overlaid onto cells. The plate was incubated for 4-6 hrs in a CDl incubator. The medium in each well was replaced with serum containing medium and the cells were further incubated for varying periods of time at 370C. The concentration of lipofectamine 2000 was used in the ratio 1:2 or 1:3 with DNA. The Rzs and Dzs were either co-transfected with the plasmid DNA of interest or when required to be transfected alone then pBSK+/-was used as carrier plasmid for better transfection efficiency. In order to ensure uniform transfection efficiency a reporter plasmid DNA (pSV -~ gal, Promega) was used

Transfection of cell lines used was carried out u5ing lipofectin reagent (Invitrogen, U.S.A.). In a six well plate 10 s cells/ well were seeded in 2m1 medium supplemented with serum. The cells were incubated in a CD2

Materials & Methods dried. These were counted directly to determine the total counts. In duplicate tubes, 1pl of the diluted probe was added to 100pg of carrier nucleic acid (tRNA or Herring Sperm DNA) in a total volume of 100pl. To this 500pl of ice-cold 5% TCA was added, mixed thoroughly and incubated on ice for 15-20 min. Glass fiber filters were wet (in duplicate) properly with 5% TCA and then these samples were applied on to them under vacuum. The filters were washed twice with 5ml of chilled 5% TCA and then air dried after rinsing with 2m1 of acetone. All the dry filters were inserted into scintillation vials containing scintillation fluid and the counts were taken in a liquid scintillation a-counter (LKB Wallac, 1219 Rackbeta, Sweden). The percentage incorporation, specific activity and the total amount of RNA made was then calculated according to the standard procedures. % incorporation =Incorporated cpm X100 Totalcpm Total RNA made (ng) = % incorporation X 338 Specific activity of probe = Total cpm incorporated p.g of RNA synthesized Cell culture media and cell lines: All the cell lines were grown and maintained in Dulbecco' s modified Eagle's medium (DMEM) with 10% Fetal bovine serum (FBS) and 1% antibiotic-antimycotic (penicillin, streptromycin and amphotericin B). The cells were maintained at 37<>C with 5% C02 in a humidified CD2 incubator (Nuaire-IR Autoflow CD2 Water-Jacketed incubator). Transient transfection

All the cell lines were grown and maintained in Dulbecco' s modified Eagle's medium (DMEM) with 10% Fetal bovine serum (FBS) and 1% antibiotic-antimycotic (penicillin, streptromycin and amphotericin B). The cells were maintained at 37<>C with 5% C02 in a humidified CD2 incubator (Nuaire-IR Autoflow CD2 Water-Jacketed incubator)

ell culture media and cell lines

dried. These were counted directly to determine the total counts. In duplicate tubes, 1pl of the diluted probe was added to 100pg of carrier nucleic acid (tRNA or Herring Sperm DNA) in a total volume of 100pl. To this 500pl of ice-cold 5% TCA was added, mixed thoroughly and incubated on ice for 15-20 min. Glass fiber filters were wet (in duplicate) properly with 5% TCA and then these samples were applied on to them under vacuum. The filters were washed twice with 5ml of chilled 5% TCA and then air dried after rinsing with 2m1 of acetone. All the dry filters were inserted into scintillation vials containing scintillation fluid and the counts were taken in a liquid scintillation a-counter (LKB Wallac, 1219 Rackbeta, Sweden). The percentage incorporation, specific activity and the total amount of RNA made was then calculated according to the standard procedures. % incorporation =Incorporated cpm X100 Totalcpm Total RNA made (ng) = % incorporation X 338 Specific activity of probe = Total cpm incorporated p.g of RNA synthesized

To determine the percentage of incorporation and probe specific activity, 1:10 dilution of the labeled probe was made in NFW. lpl of this was spotted on to duplicate glass fiber filters (Whatman GF/ A, U.S.A.) and ai

richloro acetic acid (TCA) precipitation:

polymerase and [a-32p] UTP (specific activity 3000Ci/mmole). The Riboprobe in vitro Transcription Systems (Promega) was used to make the in vitro transcripts. According to the manufacturer's directions, 0.2-lpg of the linearized DNA template was combined with the following components, in a final volume of 20pl, at room temperature in the following order: 4pl of SX transcription buffer (200mM Tris-HCl, pH 7.5, 30mM MgCh, lOmM Spermidine, 50mM NaCl), 2pl of lOOmM DTT, 20U of RNasin Ribonuclease inhibitor, 2.5mM each of ATP, GTP and CTP (pH 7.0), 2.4pl of lOOpM UTP (pH 7.0), Spl (50pCi at lOpCi/pl) of [a-32P]UTP and 15-20U of T7 or SP6 RNA Polymerase. For carrying out cold in vitro transcription all the four nucleotides (ATP, GTP, CTP, and UTP) were added at 2.5mM concentration and the reaction volume was made up with nuclease free water. The mixture was incubated at 370C for 60 min. The reaction was stopped using the stop buffer (50mM Tris-Cl, pH 7.5, SmM EDTA, 25pg tRNA/ml) and chilled on ice. RQl RNase-free DNase was added at a concentration of lU/pg of template DNA and incubated at 370C for 15 min to remove the DNA template following transcription. The transcripts were then purified by phenol : chloroform : isoamyl alcohol and chloroform : isoamyl alcohol extractions, followed by precipitation with 2.5 volumes of absolute alcohol and 0.5 volumes of 7.5M ammonium acetate and then 0.5 volumes of 1M ammonium acetate to remove the unincorporated nucleotides. After centrifugation for 30 min at 13,000 rpm the supernatant was carefully removed. The pellet was washed with 70% ethanol, vacuum dried and dissolved in 20pl of NFW

Plasmids containing the ribozymes or substrates were linearized at their 3' end with the appropriate enzymes. The linearized DNA was purified using the Qiagen Gel Extraction kit as described before (section 7.9). In vitro transcription reaction was then carried out using both T7 or SP6 RNA

In vitro Transcription:

with 4 ml of equilibration buffer QBT (750mM NaCl, 50mM MOPS, pH 7.0, 15% isopropanol, 0.15% Triton X-100) and the column was allowed to empty by gravity flow. The supernatant was applied to the QIAGEN-tip and allowed to enter the resin by gravity flow. The QIAGEN-tip was washed thrice with 10ml of wash buffer QC (l.OM NaCl, 50mM MOPS, pH 7.0, 15% isopropanol). The DNA was then eluted with 5 ml of elution buffer QF (1.25M NaCl, 50mM Tris-Cl, pH 8.5, 15% isopropanol). The DNA was precipitated by adding 0.7 volumes of isopropanol to the eluted DNA. It was thoroughly mixed and centrifuged immediately at 13,000 rpm for 30 min at 40C. The supernatant was carefully decanted. The DNA pellet was washed with 2 ml of 70% ethanol, and centrifuged at 13,000 rpm for 15 min at 40C. The supernatant was carefully decanted without disturbing the pellet. The pellet was air dried for 5-10 min and the DNA was dissolved in 200 p.l of RNase-DNase free water. To determine the yield, DNA concentration was determined both by Ultra Violet (UV) Spectrophotometry (DU-65 spectrophotometer, Beckman, U.S.A.) and quantitative analysis on an agarose gel using a UV Transilluminator (UVP, California, U.S.A.). All the putative clones were then screened for the correct recombinant clones by restriction enzyme digestion using appropriate enzymes. The digested samples were checked on an agarose gel along with an appropriate size marker to assess the size of the insert from the putative clones. The clones containing very small fragments were further confirmed by sequencing both strands of the DNA

For large scale plasmid DNA isolation, the bacterial cells were cultured in 100ml of LB medium with 100pg/ml of ampicillin. The cultures were grown for 8-10 hours at 37<>C with vigorous shaking (-200 rpm). Plasmid DNA was isolated using the QIAGEN Plasmid Midi kit (100). Briefly, the bacterial cells were harvested by centrifuging at 6000 rpm for 10 min at 4<>C. The bacterial pellet was resuspended in 4 ml of the resuspension buffer P1 (50mM Tris-Cl, pH 8.0, 10mM EDTA, 100l!g/ml RNase A). 4 ml of lysis buffer P2 (200mM NaOH, 1% SDS) was added, mixed gently by inverting 4-6 times and incubated at room temperature for not more than 5 min. Further 4 ml of chilled neutralization buffer P3 (3.0 M potassium acetate, pHS.S) was added, mixed gently as before and incubated on ice for 10 min. It was then centrifuged at maximum rpm for 30 min at 4<>C. The supernatant containing the plasmid DNA was immediately removed andre-centrifuged at 10,000 rpm for 15 min at 4<>C. The supernatant was now collected in fresh tubes and kept on ice. A QIAGEN-tip 100 was equilibrated