5 Matching Annotations
  1. Last 7 days
    1. Bacteria-specific primer pairs used were 27F (AGAGTTTGATCMTGGCTCAG) and 1492R (TACGGYTACCTTGTTACGACTT) [26] and 63F (CAGGCCTAACACATGCAAGTC) and M1387R (GGGCGGWGTGTACAAGRC)
  2. Aug 2020
    1. Guo, L., Boocock, J., Tome, J. M., Chandrasekaran, S., Hilt, E. E., Zhang, Y., Sathe, L., Li, X., Luo, C., Kosuri, S., Shendure, J. A., Arboleda, V. A., Flint, J., Eskin, E., Garner, O. B., Yang, S., Bloom, J. S., Kruglyak, L., & Yin, Y. (2020). Rapid cost-effective viral genome sequencing by V-seq. BioRxiv, 2020.08.15.252510. https://doi.org/10.1101/2020.08.15.252510

  3. Jun 2020
    1. We recommend the following changes to the default settings when designing ddPCR assays:

      Primer3 : designing primers and probes for ddPCR

  4. Nov 2018
    1. One instructor's use of Slack, comparing and contrasting other LMS (but he used Canvas); good basic breakdown of the conversational tools and samples of how hey can be used; This is a great primer of Slack's use in the classroom (5/5)