Instruments used for the study

MATERIALS

Procedur

Reagents

Nitric oxide radical scavenging activity

Procedur

Reagents

Hydroxyl radical scavenging assay

Procedure

Reagent

Superoxide anion scavenging activit

Procedure

Reagent

Total antioxidant activit

Procedur

Reagen

Free radical scavenging activity

In VitroStudies

Chemicals

Materials

Material

Materials

Material

Total alkalinity

Dissolved oxygen and Biological oxygen demand

Total dissolved solids

Multi parameter analyzer

MATERIALS AND METHODS

PHYSICO-CHEMICAL PARAMETERS OF SEAWATER

Characterization of embelin isolated from E.ribes

. Extraction and isolation of embelin from E. ribes

High Performance Liquid Chromatography (HPLC) analysis

High Performance Thin Layer Chromatography (HPTLC) analysis

. Thin Layer Chromatography (TLC) analysis

Preliminary phytochemical screening (Ali, 1998; Evans, 2002)

Microbial Contamina

Foaming Index

pH values

Ash values

Extractive value

. Physico-chemical standardization

Standardization of ethanolic extract of E.ribes (WHO, 1998; IndianPharmacopoeia, 1996)

Preparation of ethanolic extract of E.ribes

PLANT MATERIAL

Estimation of Stevioside

Extraction from the plant material

Extraction from the plant material

Extraction from the plant material

Qmmtification of stevioside

Estimation of Steviol

Extraction from plant material

Quantification of steviol

Estimation of free aminoacids

Estimation of soluble proteins

Estimation of sugars

Estimation of total phenols

Determination of moisture

Analytical methods

The experimental part of the study was categorized into five sections for the convenience of reference viz. analytical, toxicological, molecular, biochemical and genomic quantitation.

Plant material

e5 tevia-the natural smeetenei

Mean Somatotypes:

Mean Somatotypes:

Mean Somatotypes:

Somatotype Categories:

Range of Component Ratings:

Somatocharts:

Mean Somatotypes:

SOMATOTYPE DISTRIBUTION OF URBAN SAMPLE

Per-cent Overlap

Compogram

F-and t-Ratios

Chi-Square

Somatotype Categories

Comparative Statistics

Somatotype Attitudinal Mean (SAM)

Somatotype Attitudinal Distance (SAD)

Somatotype Dispersion Mean (SDM)

Somatotype Dispersion Distances (SDD)

Somatoplot Coordinates

Mean Somatotypes (5)

Descriptive Statistics

Statistical Analysis

Central:

Mesomorphic ectomorph:

Endomorphic ectomorph:

Ectomorphic mesomo~ph:

Endomorphic mesomorph:

Ectomorphic endomorph:

Mesomorphic endomor~:

Endomorph-ectom9££E:

Mesomorph-endomorph:

Mesomorph-endomorph:

Balanced ectomorph:

Balanced mesomorph:

Balanced endomorph:

SOHATOCHART

Somatotyping Children

Limitations of the Rating Form

Third Component Rating

Second Component Rating

First Component Rating

SOMATOTYPING

Calf

Biceps

Femur

Humerus

Calf

Primary culture of E. coli was grown in LB medium containing either ampicillin (Amp) and/or kanamycin (Kan) to final concentration of 100 j..tg/ml and 25 J..tg/ml respectively. Depending on the vector construct, antibiotics were used for expression of different proteins as described in Table 3.1. Medium was inoculated with 1 ml glycerol stock of E. coli and incubated overnight at 37 oc at 200 rpm.

Preparation of primary culture of E. coli cells

Blood was drawn from appropriate source into heparinised tubes. The blood sample was centrifuged at 4000 rpm for 15 min ( 4 °C). The supernatant was discarded, and the erythrocytes (pellet) were subsequently washed thrice with chilled isotonic buffer [0.01 M PBS (pH 7.4)] by centrifugation at 4000 rpm and 4°C for 15 min. The washed erythrocytes were lysed in water. The resultant red cell lysate was then dialyzed extensively against PBS (pH 7.4) at 4°C to obtain stripped hemoglobin (hemoglobin devoid of bound allosteric modulators like BPG). The stripped hemoglobin was then loaded onto a pre-equilibrated DE52 column (30cm x 15cm) after extensive dialysis against 0.05 M tris acetate buffer (pH 8.5). The protein was eluted from the column employing a linear gradient of 500 ml each of 0.05 M tris acetate (pH 8.5) and 0.05 M tris acetate (pH 7) at a flow rate of 50 ml/hour. The purified hemoglobin was estimated spectrophotometrically at 540 nm (molar extinction coefficient= 53236 cm-1/M) and stored at -70°C till further use.

Purification of hemoglobin from bloo

Vancouver-based Contextual Genomics has launched two molecular hotspot assays for detecting genomic mutations in blood and solid tumors. <!--//--><![CDATA[// ><!-- document.addEventListener("googletagEvent", function () { let hideOnMobile = "0"; let isMobileQuery = false; if (typeof window.dataLayerValues === "undefined" || !window.dataLayerValues.hasOwnProperty('isMobileQuery') || window.dataLayerValues.isMobileQuery) { isMobileQuery = window.dataLayerValues.isMobileQuery; } // Don't display the ad unit if this is a mobile browser and we're supposed to hide the unit in mobile view. if (isMobileQuery && hideOnMobile === '1') { return; } let hideOnDesktop = "0"; // Don't display this ad unit if this is a desktop broser and we're supposed to hide the mobile ad unit if(!isMobileQuery && hideOnDesktop === '1') { return; } googletag.cmd.push(function () { googletag.display('content-embed-one'); }); }); //--><!]]> The new version of the company’s Find It solid tumor panel now screens for 146 somatic genome alterations, and 23 exons in 30 cancer-associated genes, to help identify precision cancer treatments and recognize drug-resistant mutations. New additions to the panel include tests for mutations in the POLE gene, which have been associated with colorectal cancer as well as immunodeficiency.

After breakfast they made ready to say farewell, as nearly heavy of heart3 as was possible on such a morning; cool, bright, and clean under a washed autumn sky of thin blue. The air came fresh from the North-West.They rode off along a path and looked out from the hill-top over lands under the morning. It was now as clear and far-seen as it had been veiled and misty when they stood upon the knoll in the Forest. They took a deep draught of the air.4Their way wound along the floor of the hollow, and round the green feet of a steep hill into another deeper and broader valley. As they journeyed the sun mounted, and grew hot. Each time they climbed a ridge the breeze seemed to have grown less. When they caught a glimpse of the country westward the distant Forest seemed to be smoking, as if the fallen rain was steaming up again. A shadow now lay round the edge of sight, a dark haze above which the sky was like a blue cap.5 On that side the hills were higher and looked down upon them; and all those hills were crowned with green mounds, and on some were standing stones, pointing upwards like jagged teeth out of green gums. The view was somehow disquieting; so they turned from the sight and went down into the hollow circle. In the midst of it there stood a single stone, standing tall under the sun above, and at this hour casting no shadow. They set their backs6 against the east side of the stone. It was cool, as if the sun had had no power to warm it. There they took food and drink.Riding over the hills, and eating their fill,7 lying a little too long; these things are, perhaps, enough to explain what happened. How­ever, that may be: they woke suddenly from a sleep they had never meant to take. The standing stone was cold, and it cast a long pale shadow. The sun was gleaming through the mist; north, south, and east, the fog was thick, cold and white. The air was silent, heavy and chill.

Humanities faculty, unlike their STEM counterparts, do not have labs. We do not have a place for our work and no one sees our process.

However, that work (and it is intellectual labor) is invisible and largely undervalued.

Academics are constantly being told that they need to make their work more relevant and accessible to the public. Blogging about your work hits both of those marks. It also means that you have to translate your work from academese to language that non-academics will understand (i.e. jargon) and also foreground the relevance of your work. You have to tell people why your work is important and what it adds to the world.

As a result, I suggest that one thing that all humanities scholars can do to take a baby step in the direction of digital humanities is to maintain a blog about their research.

“People will use this data in ways we can’t even imagine yet,” Mr. Stowell said, “and I think that is one of the most exciting developments in the humanities.”

Mr. Edelstein said that many of his senior colleagues view his work as whimsical, the result of playing with technological toys. But he argues such play can lead to discoveries.

“You would think if England was this fountainhead of freedom and religious tolerance,” he said, “there would have been greater continuing interest there than what our correspondence map shows us.”

Even historians, who have used databases before, have been slow to embrace the trend. Just one of the nearly 300 main panels scheduled for next year’s annual meeting of the American Historical Association covers digital matters.

Mr. Bobley said the emerging field of digital humanities is probably best understood as an umbrella term covering a wide range of activities, from online preservation and digital mapping to data mining and the use of geographic information systems.

This alliance of geeks and poets has generated exhilaration and also anxiety. The humanities, after all, deal with elusive questions of aesthetics, existence and meaning, the words that bring tears or the melody that raises goose bumps. Are these elements that can be measured? Advertisement Continue reading the main story “The digital humanities do fantastic things,” said the eminent Princeton historian Anthony Grafton. “I’m a believer in quantification. But I don’t believe quantification can do everything. So much of humanistic scholarship is about interpretation.”

I can see how the drama of this moment is enticing. It offers a grandeur, a sweeping purity to our possibly flawed and fumbling and ambivalent selves. It justifies all our failings and setbacks and mediocrities; it wasn’t us, it was men, or the patriarchy, holding us back, objectifying us. It is easier to think, for instance, that we were discriminated against than that our story wasn’t good enough or original enough to be published in The Paris Review, or even that it did not meet the editor’s highly idiosyncratic yet widely revered tastes. Or that a man said something awful and sexual to us while we were working on a television show, and we got depressed and could never again achieve what we might have. And yet do we really in our hearts believe that is the whole story? Is this a complete and satisfying explanation? There is, of course, sexism, which looms and shadows us in all kinds of complicated and unmappable ways, but is it the totalizing force, the central organizing narrative, of our lives? This is where the movement veers from important and exhilarating correction into implausibility and rationalization. (One of the deeply anonymous says, “This seems like such a boring way to look at your life.”)

I have a feeling that if one met @yoloethics or the rest of her Twitter cohort in person, they would seem normal, funny, smart, well read. But the vicious energy and ugliness is there beneath the fervor of our new reckoning, adeptly disguised as exhilarating social change. It feels as if the feminist moment is, at times, providing cover for vindictiveness and personal vendettas and office politics and garden-variety disappointment, that what we think of as purely positive social change is also, for some, blood sport.

It can be hard to disentangle one man and the things he may or may not have done from hundreds of years of sexist oppression.

“I like Lorin,” she told me. “I don’t have a personal stake in this.” She then informed me that he had sexually harassed two interns at Farrar, Straus and Giroux, where he had worked before his Paris Review tenure, leading to hushed-up, sealed settlements. She delivered this piece of highly specific information so confidently that I did not stop and think, even though I teach in a journalism department: Is this factually correct?

The night the New York Times broke the news of Stein’s resignation, I was with one of the deeply anonymous women in a coffee shop, and after I left she ran out and caught up to me on the dark street to tell me about it. When I got home, I saw that @MegaMoira had tweeted a photo of the piece with the words, “champagne anyone.” I thought of the email Lorin had sent me when my book on writers’ deaths, The Violet Hour, came out. It was such a strange, private project, but in a few lines he made it vivid again to me, renewed and energized me on a long winter afternoon to sit down and start something new. However one feels about the end of an era at The Paris Review, it doesn’t seem like a time for celebration.

However, after the list came out but before Lorin Stein resigned as editor of The Paris Review, she tweeted: “every profile of Lorin Stein calls him ‘skinny and bespectacled’ but here’s the thing: he’s not that skinny.” She added: “I guess ‘bespectacled, bald, and busting out [of] the bespoke shirts he’s still having made with 15 year old measurements’ doesn’t have the same ring to it.” Later, these tweets were deleted. But if we could think in less gendered terms for a moment, one could reasonably ask: Who is harassing whom?

I feel blessed to live in a society where you are free to walk through the city at night. I just don’t think those of us who are privileged white women with careers are really that afraid.

Here is what the last few days have reminded me: white men, even those on the left, are so safe, so insulated from the policies of a reactionary presidency, that many of them view politics as entertainment, a distraction without consequences, in which they get to indulge their vanity by fantasizing that they are on the side of good. . . . The morning after the election, I found the penis-shaped shot glass in my kitchen and threw it against the wall. I am not proud of this, but it felt good to destroy something a white man loved.

Every woman, every day, when she leaves her house, starts to think about safety. Can I go here? Should I go out there?. . . Do I need to find a taxi? Is the taxi driver going to rape me? You know, women are so hemmed in by fear of men, it profoundly limits our lives.

In 1996, a six-year-old boy with Coke-bottle glasses, Johnathan Prevette, was suspended from school for sexual harassment after kissing a little girl on the cheek.

Can this possibly be a good thing?

For years, women confined their complaints about sexual harassment to whisper networks for fear of reprisal from men.

Before the piece was even finished, let alone published, people were calling me “pro-rape,” “human scum,” a “harridan,” a “monster out of Stephen King’s ‘IT,’?” a “ghoul,” a “bitch,” and a “garbage person”—all because of a rumor that I was planning to name the creator of the so-called Shitty Media Men list.

No one would talk to me for this piece. Or rather, more than twenty women talked to me, sometimes for hours at a time, but only after I promised to leave out their names, and give them what I began to call deep anonymity.

I am not trying to suggest that the list makers don’t understand the difference in scale between leering and assault, but rather that the blurring of common (if a little sleazy) behavior and serious sexual harassment reveals a lot about how they think. For them, the world is overrun with leering monsters you have to steer around, as if in a video game.

To do a close reading of the list: some of the offenses on the spreadsheet (“creepy DMs,” “weird lunch ‘dates,’” “leering,” “flirting,” “violent language,” and “leading on multiple women online”) seem not quite substantial or rare enough to put into the category of sexual misconduct. I am not even sure they merit a warning to a hopeful young employee. I have graduate students who go on to work for these sorts of publications, and I am very mother-hen-ish about them. But I can’t imagine sitting with one of my smart, ambitious students in my office, lined with shelves of books like The Second Sex and A Room of One’s Own and I Love Dick and The Argonauts, saying, “Before you go work there, I just want to warn you, that guy might leer at you.” I would worry I was being condescending, treating her like a child who doesn’t know how to handle herself in the world

(“It feels Maoist,” says one of the deeply anonymous, while others question whether the list was ever designed to remain clandestine in the first place.)

The Shitty Media Men list, the anonymously crowd-sourced spreadsheet chronicling sexual misconduct in the publishing world, is a good example. If we think of how we would feel about a secretly circulating, anonymously crowd-sourced list of Muslims who might blow up planes, the strangeness of the document snaps into focus.

(One of the editors of n+1, Dayna Tortorici, tweets: “I get the queasiness of no due process. But . . . losing your job isn’t death or prison.”)

Can you see why some of us are whispering? It is the sense of viciousness lying in wait, of violent hate just waiting to be unfurled, that leads people to keep their opinions to themselves, or to share them only with close friends. I recently saw a startling reminder of this when Wesley Yang published an insightful and conflicted piece in Tablet called “Farewell to a Scoundrel,” about former Paris Review editor Lorin Stein and the feminist moment.

Sonicated cells of E. coli having recombinant vector was centrifuged. Supernatant was dispensed into 0.2 % v/v xylan agar plate and incubated for 4 h. The plates were then flooded with Congo red solution (0.2 % w/v) for 30 min and destained with 1M NaCl solution till a clear zone of xylan hydrolysis was visible. The plates were gently shaken on a shaker to accelerate the process of staining/destaining

Qualitative detection of xylanolytic activity by plate assay

Preparation of electrocompetent cells (E. coli cells) A protocol was employed. The procedure was carried out in cold under sterile conditions as follows: •A single colony of E. coli DH10B/ DH5α/XL1blue was inoculated in 20 mL of LB medium and grown overnight at 30 °C. •500 mL LB medium was inoculated with 5mL of this overnight grown culture of the E. coli and incubated with vigorous shaking (250 rpm) at 30 °C until an A600of 0.5 - 0.8 was achieved. •The cells were chilled in ice for 10-15 min and transferred to prechilled Sorvall® centrifuge tubes and sedimented at 4,000 rpm for 20 min at 4 °C. •The supernatant was decanted and cells were resuspended in 500 mL of sterile ice-cold water, mixed well and centrifuged as described above. •The washing of the cells described above was repeated with 250 mL of sterile ice-cold water, following which cells were washed with 40 mL of ice-cold 10 % (v/v) glycerol and centrifuged at 4,000 rpm for 10 min. •The glycerol solution was decanted and the cell volume was recorded. The cells were resuspended in an equal volume of ice-cold 10 % glycerol. •Cells were then dispensed in 40 μL volumes and stored at -80 °C until required.

Electrotransformation

The metagenomic DNA extracted from above defined protocol was digested with Sau3A1 at conditions optimized to generate maximum fragment in the size range of 2-6 kb. Different concentration (0.05 to 1 unit) of enzyme was used to optimize the digestion of 1 μg of DNA. Reactions were carried out in a final volume of 30 μl each in an Eppendorf of 1.5 mL. Reaction mixture (1 μg DNA having 3 μL NEB buffer 3 and 0.3 μL of 10X BSA) were kept at 37 °C for 10 min and stopped by heat inactivation at 80 °C for 20 min. Different digested reactions were checked for the desired fragments using 0.8 % (w/v) agarose gel electrophoresis. After optimization of DNA fragments for the appropriate size, a large scale digestion was carried out and the fragments (2-8 kb) were purified from low melting agarose gel using gel extraction method according to the manufacturer’s protocol (Qiagen gel extraction kit, Germany)

Insert DNA preparation

Purity of the DNA extracted from various environmental samples was confirmed by subjecting the extracted DNA to restriction digestion. DNA was digested with Sau3AI (New England Biolabs). One μg of metagenomic DNA in 20 μL reaction mixture was treated with 0.5 U of Sau3AI and incubated at 37 °Cfor 10 min. The reaction was terminated at 80 °C for 20 min and the digested DNA was fractionated on 1.2 % (w/v) agarose gel.

Restriction digestion

The isolated DNA was diluted (1:100) with MQ. The concentration (mg mL-1) of the DNA [N] was determined spectrophotometrically by recording absorbance at 260 nm (A260) as: A260 = ε 260[N]where ε 260 is the extinction coefficient of DNA (50 for ds DNA) [N] = concentration (mg mL-1) of DNA The concentration of ds DNA [N] was calculated as [DNA] (mg mL-1) = A260/ε 260 [DNA] (μg mL-1) = A260 × 50 × dilution factor Purity of DNA was checked by measuring absorbance at 260 and 280 nm and calculating the A260/A280 ratio (Sambrook et al., 1989). A DNA sample was considered pure when A260/A280 ranged between 1.8-1.9. An A260/A280 < 1.7 indicated contamination of the DNA preparation with protein or aromatic substances such as phenol, while an A260/A230 < 2.0 indicated possible contamination of high molecular weight polyphenolic compounds like humic substances.

Determination of DNA quantity and purity

as well as commercial methods (MN kit, Germany; Mo-Bio kit, CA, USA; Zymo soil DNA kit, CA, USA) according to the manufacturer’s protocols and compared in terms of DNA yield and purity.

The soil DNA from Pantnagar and Lonar soil samples were also extracted by various manual (Desai and Madamwar, 2007; Agarwal et al., 2001; Yamamoto et al., 1998

Alternatively metagenomic DNA was extracted from the alkaline soil samples by using different commercial kits (UltraClean™, PowerSoil™ [Mo Bio Laboratories Inc., Carlsbad, CA, USA], Nucleospin kit [Macherey-Nagal, Germany] and Zymo soil DNA isolation kit [CA, USA]). The DNA was finally suspended in 100 μL of sterile Milli Q water for further analysis.

Commercial kits

Comparison of yield and purity of crude DNA

Soil (1 gm) was suspended with 0.4 gm (w/w) polyactivated charcoal (Datta and Madamwar, 2006) and 20 μL proteinase K (10 mg mL-1) in 2 mL of modified extraction buffer [N,N,N,N cetyltrimethylammonium bromide (CTAB) 1% w/v, polyvinylpolypyrrolidone (PVPP) 2% w/v, 1.5 M NaCl, 100mM EDTA, 0.1 M TE buffer (pH 8.0), 0.1M sodium phosphate buffer (pH 8.0) and 100 μL RNaseA] [Zhou et al., 1996] in 20 mL centrifuge tubes to homogenize the sample and incubated at 37 °C for 15 min in an incubator shaker at 200 rpm. Subsequently, 200 μL of 10% SDS was added to the homogenate and kept at 60 °C for 2 h with intermittent shaking. DNA was precipitated by adding 0.5 V PEG 8000 (30 % in 1.6 M NaCl) and left at room temperature for an hour (Yeates et al., 1998). The precipitated DNA was collected by centrifugation at 8000 x g at 4 °C. The supernatant was discarded and pellet was dissolved in 1 mL of TE buffer (pH 8.0) and then100 μL of 5 M potassium acetate (pH 4.5) was added and incubated at 4 °C for 15 min. The supernatant was collected after centrifugation at 8000 x g and treated with equal volumes of phenol: chloroform (1:1) followed by chloroform: isoamylalcohol (24:1) at 8000 x g for 15 min

PROTOCOL FOR OPTIMIZATION OF HUMIC ACID-FREE DNA FROM ALKALINE SOILS

Various strains of Escherchia coli (DH5α, XL1Blue, DH10B) were used as hosts for the propagation of recombinant vectors. In addition, Bacillus subtilis was used as a host for the expression of xylanase gene from the recombinant vector pWHMxyl. Different vectors used in this investigation are listed in

BACTERIAL STRAINS

Soil, sediment, effluent, and water samples have been collected from various hot and alkaline regions of India and Japan in sterile polyethylene bags/bottles. The samples were transported to the laboratory and preserved at 4 °C. Temperature and pH of the samples was recorded.

COLLECTION OF SAMPLES

or DNA isolationJrom P. Jalciparum, genomic DNA kit from Qiagen (Germany) was used. Isolation was done following manufacturer's instructions. Briefly, infected erythrocytes (5 ml at 10% parasitemia) were centrifuged at 3,000 g for 2 min. The cells were washed once in cold PBS and resuspended in 1 ml. Following which, 10 ilL of 5% saponin (final concentration 0.05%) was added and' mixed gently. After lysis, the mix was immediately centrifuged at 6,000 g for' 5min. Further steps were, carried out according to the manufacturer's instructions to isolate genomic DNA. DNA was quantified by measuring absorbance at 260 nm I using a UV -spectrophotometer

Genomic DNA Isolation from Parasite Culture

lasmodium Jalciparum strain 3D7 (MR4, American Type Culture Collection) was i used for all the experiments except where gametocyte rich culture was required. I For generating gametocytes, 3D7 A a variant of 3D7 was used. The parasite was cultured as describerl below:

lasmodiumfalciparum culture

~PL mutants were generated using QuickChange site-directed mutagenesis kit (Stratagene). Mutagenesis reactions were performed in accordance with the manufacturer's protocol using pAC28 (wild type ~PL gene fragment cloned in pET28c, section 2.3.3.1) as template. The details of oligonucleotides used for generating the mutant clones are given in table 3.1. Translationally silent restriction sites were engineered in the oligonucleotides whenever possible, in order to facilitate preliminary screening of mutant clones. Mutant clones were screened by restriction endonuclease analysis and confirmed by automated DNA sequencing

Site directed mutagenesis to generate RGPL mutant clones

Bilateral oophorectomy, the surgical removal of both the ovaries, was performed in mice to simulate a condition of estrogen depletion. All procedures in mice were performed after obtaining approval from the Institutional Animal Ethics Committee (National Institute of Immunology, New Delhi). Female BALB/c mice were used in the study

Assay for cell viability by propidium iodide dye exclusion method

THP-1 acute monocytic leukemia cell line (TIB-202) was purchased from American type culture collection (ATCC) (Manassas, VA). These suspension cells were maintained in culture at 37°C in RPMI-1640 medium supplemented with 10% FCS. They were sub-cultured when the cell density reached ~1X106 per mL. To induce differentiation of these monocytic suspension cell cultures to adherent macrophage phenotype, they were subjected to treatment with PMA at a concentration of 10 ng/mL for 36 h. Forty eight hours prior to experimentation, the cells were transferred to phenol-red free RPMI-1640 medium supplemented with 10% dextran-coated charcoal stripped FCS. This was performed to remove all traces of exogenous estrogens as phenol red in culture medium is known to be a weak estrogen (1) and FCS contains multiple steroid hormones which are removed upon stripping with dextran-coated charcoal. MCF-7, a breast carcinoma cell line was obtained from ATCC (Manassas, VA). They were maintained in culture at 37°C in RPMI-1640 medium supplemented with 10% FCS and were routinely sub-cultured when the cells reached a confluency of around 80%

Cell lines and cell culture

Cell culture techniques

was subsequently used as a probe model to carry out molecular replacement for one of the Fab-peptide complex; remainmg three Fab-peptide complexes were solved by using Ppy-LH as search model. The structure of antigen bound 36-65 Fab (2A61) was used for molecular replacement of two Fab-peptide complexes of the same antibody. AMoRe (Navaza, 1994) and Phaser packages from CCP4 suite (Elizabeth Potterton, 2003) were used for structure determination of antigen free BBE6.12H3 Fab and its complexes with peptide, respectively. The solution for 36-65 complexes was determined by using MOLREP from CCP4 suite. Both for MOLREP and AMoRe, calculations for rotation/translation functions were carried out using structure factors from 8 to 4 A resolutions. The transformation matrices obtained from AMoRe for antigen free Fab was utilized to orient the models in the corresponding unit cell. However, both Phaser and MOLREP have a module which automatically does orientation. The packing function of Phaser also checks for possible clashes or voids between the symmetry related molecules. All the solutions were unambiguous. For outputs of AMoRe and MOLREP the crystal packing was examined using Coot (Emsley P, 2004) to ascertain the absence of steric clashes or large voids between symmetry related molecules. Calculations of the Matthews coefficient (Kantardjieff and Rupp, 2003) indicated presence of two molecules for antigen free Fab and a single Fab molecule for all Fab-peptide complexes within the asymmetric unit.

wavelength component in three dimensions inversely proportional to their values of h, k and /. The image of the object can be reconstructed by recombining the individual sine waves as occur in the objective lens of the microscope. Since it is not possible to focus the X-rays, only the intensities could be recorded with the loss of phases, well known as phase problem of crystallography. Macromolecular crystal structures are usually solved using one of the three techniques; multiple isomorphous replacement (MIR), multiple anomalous dispersion (MAD) or molecular replacement (MR). Of the three, MR is generally used in cases where a structural homolog is available. Since the structure of a number of antibodies is already known, MR is the method of choice for structure determination of antibody Fab. The molecular replacement method, involves orienting and positioning a model molecule in the experimental unit cell through rotations and translations. The rotation function developed by Rossman and Blow ( 1962), involves rotation of the Patterson function of one group or molecule with respect to the other in all possible ways and the ultimate superimposition of the two Patterson functions. The translation function deals with positioning the oriented molecule in the unit cell of the unknown structure. It utilizes the cross vectors between various symmetrically related molecules for positioning the probe in the target unit cell. The translation function is carried out by moving the oriented model in small increments along all three directions and calculating the correlation between observed and calculated intensities. From the solutions obtained, the one with the highest correlation and lowest R-factor was chosen for molecular replacement. The structure of the Fab of putative anti-NP germ line mAb Nl G9 was used for molecular replacement. The refined model of the native unliganded germline Fab

The goal of diffraction analysis is reconstruction of the detailed structure of the asymmetric unit from a diffraction pattern. The diffraction pattern breaks down the structure into discrete sine waves. Any shape can be presented in three dimensions as the sum of sine waves of varying amplitudes and phases. The individual reflections of a diffraction pattern represent such waves, which have

Structure determination using molecular replacement

a buffered protein solution in the form of a droplet in contact with the precipitant through the vapor phase. The precipitant slowly causes dehydration to occur in the protein droplet increasing the effective concentration of the protein. The hanging drop crystallization experiment is set up in 24 well tissue culture plates, with the drop of protein solution containing 50% of the precipitant in the mother liquor suspended over the precipitant solution from a siliconized cover slip. This setup is sealed with silicon grease to facilitate controlled vapor diffusion between the well and the drop. For setting up hanging drop crystallization, a pure preparation of Fab molecules in the crystallization buffer (50 mM Na-cacodylate pH 6.7, 0.05% sodium azide or 50mM Tris-Cl pH 7.1, 0.05% sodium azide) was concentrated to a final concentration of 10 mg/ml. For the antibody-peptide complexes, 50-fold molar excess of the peptide was added to the Fab solution. Hanging drops of 8 Jll volume containing 4 111 of the Fab so:ution and 4 111 of varying concentrations of the precipitant were set up in 24-well tissue culture plates (Nunc, Denmark). Initially, a variety of precipitants were used in the crystallization experiments. Conditions which gave indications of crystal formation were then further explored to improve the quality of the crystals. The crystallization plates were maintained at room temperature in insulated conditions so as to prevent rapid changes in temperature. For crystallization of BBE6.12H3Fab-peptide complexes, the crystallization plates were also maintained at 8°C in vibration free incubator (RUMED, Rubarth Apparate, GmbH, Germany). The plates were checked for the presence of crystals every two weeks.

One of the most widely utilized methodologies of crystallization is hanging drop vapor diffusion technique (Wlodawer and Hodgson, 1975). The setup involves

Crystallization

secrete antibody which gets collected in the peritoneal fluid. Ascites is thus a good source of monoclonal antibody. The hybridoma cells, from two different hybridoma, which were secreting IgGs, 36-65 and BBE6.12H3, were injected into the peritoneal cavity of male Balb/c mice irradiated with a dose of 400 RAD and primed with Freund's incomplete adjuvant 72 hours prior to injecting the hybridoma cells suspended in 500 111 of Dulbecco's phosphate buffered saline (DPBS). Approximately 5 x 105 to 5 x 106 hybridoma cells were injected into each mouse. Ascitic fluid could be tapped from the peritoneal cavity of mice after approximately 4-5 days.

Ascites is the intra-peritoneal fluid collected from mice that have developed peritoneal tumor. Hybridoma cells, when injected into the peritoneal cavity of mice,

Generation of ascites from mice

All the peptides used in this study were synthesized by solid phase method on an automated peptide synthesizer (Applied Biosystems, Model 431A), using F-moc (9-fluorenylmethyloxycarbonyl) chemistry on a p-hydroxymethyl phenoxymethyl polystyrene resin (Nova Biochem). For the peptide synthesis, 0.1 mmol of the resin was used and deprotected using 20% piperidine in N-methyl-pyrrolidone (NMP). Subsequently 0.5nmol of the first amino acid was added and coupling was performed usmg DCC-HoBt (dicyclohexylcarbodiimide-hydroxybezotriazole) ester formation method. All other amino acids were coupled by DCC ester coupling. Amino acids and solutions required for peptide synthesis were procured from Nova Biochem and Applied Biosystems, respectively. After completion of synthesis, deprotection was carried out in 20% piperidine/DMF. Finally, the resin was shrunk using ether and dried under vacuum for a minimum of four hours. The cleavage was performed in dark using 94% TF A, 5% anisole, EDT and water accompanied by continuous stirring for two hours. The resin was then filtered and washed with DCM and the solution was evaporated on a rotary evaporator (Buchi, Switzerland) till only a small quantity of DCM/cleavage mixture is left. Cold anhydrous diethyl ether was added to the filtrate to aid in the separation of scavengers from the mixture. The peptides were then extracted with water using a separating funnel. Extraction was followed by evaporation of residual diethyl ether on the rotary evaporator. Total aqueous layer was then frozen as a thin film and lyophilized.

Procedure for peptide synthesis

The crystallographic analysis of the anti-( 4-hydroxy-3-nitrophenyl)-acetyl (anti-NP) and the anti-p-azophenylarsonate (anti-Ars) germline mAbs, BBE6.12H3 and 36-65 bound to various peptides derived from the screening of a random phage library would yield valuable information regarding their promiscuous binding abilities, associated with a primary immune response. The primary requirement for the crystallographic analysis was the preparation of adequate quantities of pure Fab (fragment antigen binding). Purified Fab fragment of both the mAbs was used for subsequent crystallization experiments with various peptide ligands. The X-ray intensity data for the crystals obtained were collected followed by structure determination, iterative steps of crystallographic refinement and model building. The refined models were structurally validated and then subjected to rigorous analysis. This chapter provides a brief background of the methods utilized and details of the experimental protocols followed.

Introduction

METHODS

Compositions of the different solutions used in this study are described in appendix.

acrylamide, TEMED were obtained from Bio-Rad laboratories (California, USA). Coomassie Plus protein assay reagent was purchased from Pierce (111inois, USA). All other chemicals were at least of analytical grade and were from Qualigens . laboratories (Bombay, India). HSA was from alpha therapeutic corporation (California, USA). Bacto-tryptone, yeast extract, and bacto-agar were obtained from Difco laboratories (Detroit, USA).

Agarose, ampici11in, ammonium acetate, ammonium persulfate, 1-acetyl 2-phenyl hydrazine, ~-mercaptuahanol, boric acid, calcium chloride, chloramphenicol, citric acid, coomassie blue 0250, creatine phosphate, creatine phosphokinase, DEPC, dialysis tubing, disodium hydrogen phosphate, dithioerythritol, dithiothreitol, DMPG, DOPG, DMPA, EDT A, ethidium bromide, glucose, glycerol, GSSG, guanidine hydrochloride, heparin, haemin., HEPES, IPTG, kanamycin, L-glycine, L-arginine, lithium chloride, magnesium acetate, magnesium sulfate, MES, PEG 8000, potassium acetate, potassium chloride, RNase free BSA, SDS, sucrose, sodium acetate, sodium dihydrogen phosphate, spermidine, sodium bicarbonate, sigmacote, Tris base, Triton X-100, urea and uridine were obtained from Sigma chemical Co. (St. Louis, USA). Trizol reagent, PCR buffer, magnesium chloride solution for PCR, RPMI-1640, leucine free RPMI, DMEM, trypsin, Fetal calf serum, antibiotic-antimycotic solution were purchased from Life Technologies (Maryland, USA). NTPs, dNTPs, cation exchange resins: S-sepharose and SP-sepharose were obtained from Pharmacia Biotech (Uppsala, Sweden). Bromophenol blue, xylene cyanol, acrylamide, bis

Chemicals

For purification, the His6-bZP3 fusion protein was expressed in SG 13009[pREP4] and BL2I (DE3) strains transformed with the pQE-bZP3 plasmid. Expression was scaled up to a 2000 ml (250 ml X 8) batch flask culture. Cells were pelleted down at 4,000 g for 20 min at 4oc and stored at -7ooc till used. The cell pellet (I g/5 ml) was solubilized in buffer A (6 M Guanidine hydrochloride, O.I M NaH2P04, O.OI M Tris, pH 8.0). The suspension was centrifuged at I 0,000 g for I5 min at 4°C and the supernatant containing the r-fusion protein was mixed with gentle end to end shaking for 1 hat RT with the Ni-NT A resin (Qiagen GmbH). The resin was loaded on a column and washed with I_O volumes of buffer A. The column was subsequently washed with 5 volumes each of buffers B and C which contained 8 M Urea, 0.1 M NaH2P04 and 0.01 M Tris and had successively reducing pH values of 8 and 6.3. The recombinant fusion protein was eluted with buffers D and E in which the pH was further reduced to 5.9 and 4.5 respectively. The eluted protein was concentrated in an Amicon concentrator using a YM5 membrane and then dialyzed against I 00 mM phosphate buffer pH 7.4 having 4 M urea. The purified protein was quantitated with bicinchoninic acid. Twenty milligrams of r-bZP3 was conjugated to 13 mg of diphtheria toxoid (DT; Serum Institute, Pune, India) or 19 mg of tetanus toxoid (TT) using a modification of the "one step" glutaraldehyde coupling procedure (Avrameas, 1969). Conjugation was done in I 00 mM phosphate buffer, pH 7.4 with 4 M urea using O.I% glutaraldehyde, 0/N at RT with gentle end to end mixing. Unreacted sites were blocked with 100 mM lysine for 3 h at RT. The conjugate was dialyzed against 10 mM PBS having 0.3 M urea.

Purification and Conjugation

(gp67) signal sequence in the pAcSecG2T vector. bZP3 was amplified using the VI transfer vector as a template in a PeR reaction using forward primer eGGGATCCeAAeeeTTeTGGeTeTTG incorporating a BamH I site and reverse primer GeGAATTCeAGAAGeAGAeeTGGAeeA incorporating an EcoR I site. Amplified DNA was digested and ligated with the digested pAcSecG2T vector. A dinucleotide deletion at nt position 239-240 resulted in premature termination of the protein after aa residue 76 and was used for expression of the V3 protein. DNAs from the transfer vector clones were purified using the Plasmid Midi kit DNA purification system.

Constructs were designed to express bZP3 in insect cells under the late polyhedrin promoter. The full length bZP3 I-424 aa residues (construct VI encoding a 47 kDa polypeptide) including the native eukaryotic N-terminal signal sequence (aa 1-22) and the C-terminal region after the furin cleavage site which includes the transmembrane-like domain (aa 349-424) was digested from pBluescript-bZP3 clone 401 using Kpn I and Sac I restriction enzymes and subcloned in the pBacPAK8 vector. A second construct V2 was designed containing a truncated version of the gene (aa 1-348), excluding the C-terminal transmembrane domain giving a protein with a calculated mass of 39.8 kDa. The insert was amplified by PCR using the forward primer TGCAGGTACCATGGAGCTGAGGC incorporating a Kpn I site (restriction site shown in bold) and the reverse primer CCGAGCTCAGAAGCAGACCTGGACCA incorporating a Sac I site using 10 ng of 401 template DNA. The amplified fragment was digested with Kpn I and Sac I, and ligated with a similarly restricted pBacPAK8 vector. Two more constructs were designed to express bZP3 aa 23-76 (V3 encoding a polypeptide 36.6 kDa) and aa 23-348 (V4, encoding a polypeptide 67.3 kDa) inframe as GST fusion proteins with a replacement of the native signal sequence with an insect