9,467 Matching Annotations
- May 2019
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
Plasmid Construction
-
vector, under the phage T7 promoter, in BL21 (DE3) cells, and under the T5 phage promoter, in the pQE30 vector for expression in SG13009[pREP4] and M15[pREP4] cell strains. For cloning in pRSET B, the full length bZP3 initially subcloned in the pBacPAK8 vector at the Kpn I and Sac I sites was released after digestion with Kpn I and EcoR I and cloned in a similarly restricted pRSETB vector inframe with an N-terminal His6 tag. For cloning in the pQE30 vector, the pBacPAK8 carrying the full length bZP3 was initially digested with Not I, filled in with Klenow and then digested with Kpn I. The purified bZP3 fragment was then cloned in the vector digested with Kpn I and Sma I in frame with an N-terminal His6 tag. Though transformants positive for the bZP3 insert in the right reading frame were recovered, no expression could be detected by SDS-PAGE or immunoblots in either case. An alternate strategy was then devised in which an internal fragment of the gene, excluding the signal sequence and the transmembrane-like domain, following the putative furin cleavage site, was amplified by PCR using the forward primer 5'-CGGGATCCCAACCCTTCTGGCTCTTG-3' incorporating a BamH I site and the reverse primer 5'-CCGAGCTCAGAAGCAGACCTGGACCA-3' incorporating a Sac I site. The PCR was done in a 50 J!l volume using 50 pM of each primer and Vent polymerase for extension. The pBluescript-bZP3 (1 0 ng) having a full length bZP3 insert was used as the template and was initially denatured at 95°C for 10 min. Amplification was carried out for 35 cycles of denaturation at 95°C for 2 min, primer annealing at 600C for 2 min and extension at 72°C for 3 min followed by a final extension at 72oc .for 15 min. The amplified bZP3 fragment was digested with BamH I and Sac I and cloned in frame downstream of a His6 tag under the T5 promoter-lac operator control in the pQE30 vector. The authenticity of the construct was confirmed by N-terminal sequencing using an upstream sequencing primer GGCGT ATCACGAGGCCCTTTCG.
-
Our initial attempts to express the full length gene in E. coli as a His6 fusion protein failed. Attempts were initially made to express the His6-bZP3 protein in the pRSET B
-
PCR Amplification and Cloning in pQE30 Vector
-
The bZP3 sequence was analyzed using PCgene and Lasergene DNA and protein analysis softwares. The alignment of the bZP3 aa sequence with the homologous sequences from other species was carried out using the Cluster V Multiple Alignment Programme (Higgins and Sharp, 1989).
-
Analysis of Sequence
-
Double stranded plasmid pBluescript-bZP3 DNA was sequenced using Sanger's dideoxy chain termination method (Sanger et al., 1977) using the Sequenase version 2.0 kit according to the protocols recommended by the manufacturer. Purified plasmid DNA (5 J..Lg) and 2 pM of the sequencing primer was used in the sequencing reaction. Table 2 gives a list of the primers used for sequencing of the bZP3 eDNA clones. bZP3 sequence was confirmed by sequencing three independent clones 401, 403 and 404.
-
Sequencing of bZP3
-
centrifuged at 10,000 rpm for 10 min, washed with 70% ethanol and dried. DNA was resuspended in 500 J..Ll of TE containing 20 J..Lg/ml RNAase, incubated at RT for 30 min and analyzed by agarose gel electrophoresis. DNA for transfection was prepared using the Plasmid midi kit DNA purification system using protocols described in the manual.
-
A 1000 ml culture of cells harboring the plasmid were grown 0/N in LB Amp· Next morning the culture was chilled and cells pelleted at 4,500 rpm in a Sorvall SS34 rotor for 20 min. The supernatant was discarded and cells were washed with 100 ml of STE buffer (0.1 M NaCI, 10 mM Tris HCl and 1 mM EDT A, pH 8.0). The pellet obtained after centrifugation was resuspended in I 0 ml of GTE solution containing I mg/ml lysozyme and the mixture was incubated at RT for 20 min at 4oc. Alkaline SDS (20 ml) was added and the mixture was incubated at RT for 10 min after mixing gently by inverting the tube. Ice cold potassium acetate solution ( 15 ml) was added and the tube was chilled on ice for 15 min and then centrifuged at 18,000 rpm at 40C in a SS34 rotor. The supernatant was carefully transferred to a fresh tube, DNA was precipitated by adding 0.6 volume isopropanol and incubating at RT for 10 min and then recovered by centrifugation at 5000 rpm at RT for 30 min. DNA was rinsed with 70% ethanol, dried and dissolved in 3 ml of TE. To the nucleic acid solution 3 ml of chilled LiCI (5 M) was added, mixed and the precipitate removed after spinning at 10,000 rpm for 10 min at 40 C. DNA was precipitated from the supernatant using an equal volume of isopropanol,
-
Large Scale Plasmid DNA Isolation
-
mixed by inverting tubes. Following an incubation on ice for 5 min, 150 J.tl of ice cold potassium acetate solution (prepared by mixing 60 ml of 5 M potassium acetate, II.5 ml of glacial acetic acid and 28.5 ml of water) was added. The mixture was incubated on ice for 5 min and centrifuged at I2,000 g for 5 min at 4°C. The supernatant was decanted into a fresh tube and extracted once with an equal volume of phenol equilibrated with 10 mM Tris, pH 8 and 1 mM EDT A (TE) followed by extraction with chloroform:isoamyl alcohol (24: 1 ). DNA was precipitated by adding 2 volumes of chilled ethanol, contents mixed and tube incubated on ice for 30 min. The pellet collected after centrifugation at 12,000 g for 15 min was washed once with 70% alcohol, dried and resuspended in 50 J!l TE. To remove RNA contamination contents of the tube were treated with 20 J.tg/ml RNAase for I5 min at RT. DNA was checked and analyzed after restriction digestion by agarose gel electrophoresis.
-
Colonies obtained after transformation were inoculated in 5 ml LB and grown 0/N in the presence of 100 Jlg/ml ampicillin (LB Amp). Next morning 1.5 ml of the culture was centrifuged for I min at I 0,000 rpm in a microfuge. The supernatant was discarded and the pellet was resuspended in 100 Jll of chilled GTE (50 mM Glucose, 25 mM Tris HCI and 10 mM EDT A). After an incubation at room temperature (RT) for 5 min, 200 Jll of freshly prepared alkaline SDS (0.2 N NaOH, 1% SDS) was added and the contents
-
Small Scale Plasmid DNA Isolation
-
E. coli DH5a cells were grown overnight (0/N) in LB at 37oc and subcultured in 100 ml of fresh LB. The culture was maintained at 37°C with shaking till absorbance at 600 nm (A6oO) reached 0.3. The culture was chilled and centrifuged at 4,500 rpm iil a Sorvall SS34 rotor for .15 min. Cells were resuspended in 50 ml of freshly prepared sterile ice cold CaCl2 (100 mM) solution and incubated on ice for 1 h. Cells were pelleted at 2,500 rpm and very gently resuspended in I 0 ml of chilled 100 mM CaCl2 having 15% glycerol. 200 Jll of competent cells were aliquoted into sterile, chilled 1.5 rn1 tubes and stored at -7ooc. The ligation mix was added to competent cells thawed on ice, tubes were gently mixed and incubated on ice for 1 h. Cells were subjected to a heat shock at 42oc for 90 sec and then revived in 1 ml of LB at 37°C for 1 h with gentle shaking. Aliquots were plated on LB plates containing the appropriate antibiotics and incubated at 37oc 0/N.
-
Preparation of Competent Cells and Transformation
-
All bacterial cultures were grown in Luria Bertani (LB) medium (NaCl 1%, Yeast extract 0.5%, and tryptone I%, pH 7.0) at 37oc with shaking. The medium was sterilized by autoclaving at 15 lbs/inch2 for 20 min. Solid growth medium was prepared by adding 1.5% agar to LB prior to autoclaving. Antibiotics were added after cooling the medium to 50°C.
-
Media Composition and Bacterial Culture
-
ligation reactions were carried out usmg conditions and buffers specified by the manufacturer.
-
The PCR amplified eDNA fragment corresponding to bZP3 was resolved on a 0.8% agarose gel run using IX TAE buffer (0.04 M Tris-acetate, O.OOI M EDTA) and purified using the Geneclean® II kit. The PCR amplified bZP3 was digested with Kpn I and Sac I and ligated into the pBluescriptll SK(+) vector at the same sites. The digestion and
-
Agarose Gel Electrophoresis, Digestion and Ligation
-
Total RNA was isolated in the laboratory from frozen bonnet monkey ovaries and the poly (A)+ fraction purified using PolyAT tract® mRNA isolation system and used for eDNA synthesis using Riboclone eDNA synthesis system®. The bonnet monkey ovarian eDNA was used as a template for the amplification by PCR of the region of bZP3, corresponding to hZP3 exons 1-6 using forward pnmer 5'-TGCAGGTACCATGGAGCTGAGCTATAGGC-3' (corresponding to exon 1 and incorporating a Kpn I site shown m bold) and reverse primer 5'-CAGGTGGCAGGTGATGTA-3' (corresponding to exon 6), involving an initial melt at 94oc for 2 min and 35 cycles of 94oc for I min, 6QOC for 2 min and 72oc for 3 min followed by a final extension at 720C for I5 min. Similarly, the region corresponding to exons 4-8 of hZP3 was amplified using forward primer 5'-ATCACACCATCGTGGAC-3' (corresponding to ex on 4) and reverse pnmer 5'-AGATCTGAGCTCATTGCTTTCTTCTTTTATTCGGA-3' (corresponding to the exon 8 and incorporating a Sac I site) with the same conditions of the PCR as above except using an annealing temperature of 55°C. The PCR amplifications were carried out using Taq DNA polymerase in a 50 J.ll volume using 20 ng of eDNA. The full length bZP3 eDNA was assembled using the above purified fragments by second PCR involving i) one cycle of 94oc for 3 min, 55oc for 2 min, 72oc for 4 min; ii) addition of forward and reverse primers corresponding to exons I and 8 respectively; iii) 35 cycles of 94oc for I min, 55°C for 2 min, 72°C for 3 min; and iv) final extension at 720C for I5 min.
-
PCR Amplification of bZP3
-
CLONING AND SEQUENCING OF bZP3
-
Radioisotopes: dCTP[a-32p] (3000 Ci/mM), dATP[a_35s] (1250 Ci/ mM) and 35s Met (I 000 Ci/ mM), were procured from NEN Life Sciences Products, Boston, MA, USA Others: Ni-nitrilo-tri-acetic acid (NTA) affinity resin from Qiagen; Membranes for Western blotting were obtained from BioRad; Hybond N and X-ray films were from Amersham; DNA and protein analysis softwares, PCgene from IntelliGenetics, Inc., Mountain View, CA, USA and Lasergene from DNASTAR Inc., Madison, Wisconsin, USA; Ultrafilteration assembly and YM5 membranes from Amicon Corp., Lexington, MA, USA.
-
from Gibco BRL; ampicillin, kanamycin and neutral red were from Sigma; FCS, was obtained from Biological Industries, Hibbutz Beit, Haemek, Israel. Bacterial Strains and Plasmids: M15[pREP4] and SG13009[pREP4] from Qiagen GmbH, Hilden, Germany, DH5a, BL21 (DE3) and BL21(pLysS) from Stratagene, La Jolla, USA, DF5 cells were kindly provided by Prof. K. Dharmalingam, Madurai Kamraj University, Madurai, Tamil Nadu, India. pBluescriptll SK( +) vector from Stratagene, pQE30 from Qiagen, pBacPAK8 vector from Clonetech Laboratories Inc., Palo Alto, CA, USA and pAcSecG2T vector, from Pharmingen, San Diego, CA, USA were obtained. Kits: Poly AT® tract mRNA isolation system and Riboclone® eDNA synthesis system from Promega Inc.; Geneclean® II kit from Bio 101 Inc., La Jolla, USA;Plasmid Midi kit and QIAexpress™ from Qiagen GmbH, Hilden, Germany; Sequenase version 2.0 DNA sequencing kit and Multiprime DNA labeling system from Amersham, Little Chalfont, Buckinghamshire, UK; BacPAK™ baculovirus expression system from Clonetech and Baculogold™ transfection kit from Pharmingen. Primers: Various oligonucleotide primers used were custom made by Rama Biotechnologies India Pvt. Ltd., Secunderab_ad, AP, India. Enzymes: Various restriction enzymes used and Vent DNA polymerase were procured from New England Biolabs, Beverly, MA, USA. Taq DNA polymerase was obtained from Stratagene. Antibodies and Conjugates: Goat anti-GST Ab was obtained from Pharmacia Biotech, Uppsala, Sweden. The following secondary revealing Abs were used: i) goat anti-mouse immunoglobulin G (lgG)-horse radish peroxidase (HRPO) from BioRad; ii) goat anti-rabbit IgG-HRPO (Pierce Chemical Co.); iii) goat anti-monkey IgG-HRPO (Sigma); iv) anti-rabbit-FITC and v) anti-goat-HRPO (Reagent Bank, Nil, New Delhi) vi) anti-mouse FITC (Dakopatts a/s, Glostrup, Denmark).
-
Chemicals: Tris, glycine, acrylamide, N', N'-methylene bisacrylamide, sodium dodecyl sulfate (SDS), N', N', N', N'-tetramethylethylene diamine (TEMED), ammonium persulfate (APS), ~-mercaptoethanol (BME), 4-chloronaphthol, urea, guanidine HCl, guanidine isothiocyanate (GITC), sarcosyl, sodium citrate, phenol, ficoll, polyvinylpyrrolidone (PVP), agarose, bromophenol blue, Coomassie brilliant blue, ethidium bromide, calcium chloride and bicinchoninic acid (BCA) were obtained from Sigma Chemical Co., St. Louis, MO, USA. LMP agarose and isopropyl ~-D thiogalactopyranoside (IPTG) were from Amresco, Solon, USA. Molecular weight standards were obtained from Gibco-BRL, Grand Island, NY, USA, or Bio-Rad Laboratories, Hercules, CA, USA. Reagents for enzyme immunoassays viz., bovine serum albumin (BSA), orthophenylene diamine (OPD) were procured from Sigma, while Tween-20 was obtained from Amresco. Reagents for conjugation and immunization, viz. diphtheria toxoid (DT) and tetanus toxoid (TT) were from Serum Institute, Pune, India while glutaraldehyde, L-lysine, 2, 6, 10, 15, 19, 23-hexamethyl-2, 6, 10, 14, 18, 22-tetracosa-hexane (Squalene) and mannide monooleate (Arlacel A) were procured from Sigma; Pergonal® was obtained from Laboratoires Serono S.A., Aubonne, Switzerland; Sodium phthalyl derivative of lipopolysaccharide (SPLPS) was kindly provided by the lmmunoendocrinology Laboratory, National Institute of Immunology (Nil), New Delhi. Reagents used in the estimation of progesterone such as gelatin, charcoal, dextran, 3H-progesterone and anti-progesterone Ab were provided by the WHO Matched Reagent Assay Programme while diphenoxazole (PPO), 1-4 bis (5-phenyl-2-oxazolyl) benzene (POPOP), and mercury-[(o-carboxyphenyl)thio]ethyl sodium salt (Thimerosal) were obtained from Sigma. Media and Antibiotics: Bacto-tryptone, bacto yeast extract and bacto agar were from Difco Laboratories, Detroit, USA; Grace's insect cell medium and antibiotic-antimycotic
-
REAGENTS
Tags
- Method-3-Method-1
- Material-1-detail
- Material-1
- Method-1-Method-5-detail
- Method-1-Method-6
- Method-1-Method-4-detail
- Method-2-Method-1-detail
- Method-1-Method-5
- Method-1-Method-3
- Method-1-Method-2
- Method-1-Method-7
- Method-1-Method-4
- Method-1-Method-2-detail
- Method-1-Method-8
- Method-1
- Method-1-Method-3-detail
- Method-1-Method-1-detail
- Method-2-Method-1
- Method-1-Method-8-detail
- Method-1-Method-7-detail
- Method-1-Method-6-detail
- Method-1-Method-1
Annotators
URL
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
added and the sample vortexed thoroughly. The sample was then centrifuged for 10 minutes at 1000 x g. The supernate was carefully decanted, the rims of the tube wiped to absorb all residual supernate, and the precipitate counted on a gamma counter set for the detection of 125I. A standard curve was plotted with each assay by using different concentrations of purified hCG, starting from 0 miU 1 ml. The percent binding of the sample was estimated as a fraction of the zero standard and the hCG activity of the sample calculated from the standard curve of the known concentrations. The other RIA procedure used has been described previously by Salahuddin et al., ( 1976 ) . This procedure employed a monoclonal antibody shown to be specific to phcG (Gupta et al., 1982 ). The use of this antibody made this assay much more sensitive compared to the commercial assay described above.
-
J3hCG was estimated using either a commercial RIA kit ( Micromedic ~hCG RIA kit, ICN Biomedicals, Inc., USA ) or by the procedure developed at Nil, the basic principle of estimation being the same in both assays, i.e., competitive inhibition. The Micromedic kit was used as detailed by the manufacturer. Briefly, 200 ul of the sample was incubated with 100 ul of the given antiserum solution for 30 minutes at room temperature. 100 ul of the tracer 125r hCG solution was then added and incubation continued for another 3 0 minutes. Subsequently, 1. 0 ml of the precipitating solution containing anti -rabbit serum with PEG was
-
PBS and then replenished with the complete medium. Two days following transfection, the cells were subcultured into the appropriate selective medium for selection of stable clones as described below.
-
Calcium phosphate mediated stable transfections were performed by the method of Graham and Van der Eb ( 1973 with modifications as described by Gorman ( 1986 ). For each plasmid, two petri dishes each containing 0. 5 x 106 CHO-K1 cells were used, with 10 ug of cesium purified DNA for each transfection. A mock transfection which did not contain any DNA, was performed simultaneously as negative control. Precipitation of the DNA was done with great care to ensure the obtention of a fine, translucent precipitate rather than a dense and opaque precipitate. The calcium phosphate I DNA precipitate was added in 4 ml medium to the cells and the cells incubated for 3 hours at 37°C. At this stage, the cells were examined under the microscope and a fine precipitate appeared as small grains all over the cells. The cells were washed once with serum free medium and a glycerol shock given for 3 minutes at 37°C. The cells were washed twice again with
-
Using calcium phosphate.
-
rinsed twice with serum free medium and replenished with 4 ml of DMEM containing 10 % FCS and 100 uM chloroquine. The incubation was continued for another 3 hours at the cells were washed and fed with the normal growth medium containing 10 % FCS. As in the case of FWIL cells, the supernate was collected after 72 hours of transfection and assayed for BhCG activity by RIA.
-
ayed for BhCG activity by RIA. In case of the other five monolayer forming cell lines, a slightly different protocol was used. Only 1.8 ug plasmid DNA was used for each transfection using 0.5 x 106 cells, and 70 uM chloroquine was included in the DNA 1 DEAE-dextran mixture. Cells were fed 3 hours prior to transfection and washed twice with serum free medium just before exposure to DNA. Cells were exposed to DNA 1 DEAE-dextran mix for approximately 3 hours at 37°C. Following this, the cells were
-
1 - 5 ug of plasmid DNA using the DEAE -dextran procedure. DEAE dextran M.Wt. 500,000 was used to perform transient transfection by the method of Luthman and Magnusson 1983 ) , with modifications as described by Gorman ( 1986 ) . Six cell lines ( described above ) with two petri dishes ( 60 mm ) for each cell line were used. In case of FWIL, 5. 4 ug plasmid DNA was used to transfect approximately 5 x 106 cells. No exposure to chloroquine was given. The cells were treated with the DNA 1 DEAE -dextran mixture for 20 minutes at 37°C in a tightly capped tube, mixed gently and reincubated at 37°C for 10 minutes. The sample was then diluted with 3 ml of IMDM supplemented with 10 % FCS, centrifuged and the pellet washed once with normal growth medium. Finally, the pellet was resuspended in 4 ml of growth medium and transferred to a T-25 flask. After incubating for 24 hours at 37°C, 3 ml of fresh medium was added to the cells. The cells were harvested after 72 hours post transfection and the culture supernate was ass
-
Transient expression of the cloned gene product was studied by transfection performed with
-
Transient expression.
-
hours. The NC filters having bound DNA liberated from bacterial colonies, were set up for hybridisation with radioactive probes as described by Maniatis et al., ( 1982 ). The filters were washed thoroughly with a solution containing 50 mM Tris.Cl, pH 8.0, 1 M NaCl, 1 mM EDTA, 1 % SDS, at 42°C, for 1 hour, to wash off any residual bacterial debris and agar etc. Prehybridisation and hybridisation was performed in aqueous solution without formamide in 5 X SSPE. The filters were washed up to a stringency of 0.2 X sse at 65°e.
-
Colonies bound to nitrocellulose filter ( NC ) were lysed to liberate the DNA which was hybridised as described by Maniatis et al., 1982 ) . To obtain sharper autoradiography signals, the nitrocellulose filter bearing colonies was first overlaid on a 3 MM Whatman paper impregnated with 10 % SDS till the NC wetted evenly. The NC was peeled off and overlaid on another 3 MM paper impregnated with the denaturing solution. In this manner, the NC was successively treated with denaturing and neutralising solutions. Finally, the NC filter was air dried, sandwiched between two sheets of 3 MM paper and baked at 80°C for two
-
Colony hybridisation.
-
400 ci 1 mmole to 3000 ci 1 mmole. The nick translation reaction was set up as recommended by the manufacturer of the kit, using about 0.5 ug DNA. The reaction was incubated at 12 -14 °C for 90 minutes, except in the case of small fragments ( 500 bp ) when the reaction was incubated for 45 minutes only. The reaction was terminated by the addition of stop buffer supplied with the kit.
-
DNA was labelled using the nick translation kits supplied by BRL or NEN, USA, or Amersham, UK. The 32P-deTP was from either NEN or Amersham, UK, at a concentration of 10 mei I ml. The specific activity of the label ranged from
-
Nick translation.
-
bands seen in the DNA size marker, were marked with a ball -point pen at the places where small holes had been pierced in the gel earlier ( see above ). Thus it was easy to monitor the size of the fragments showing hybridisation to the probe. The gel was then peeled off and the membrane w~shed in 6 X sse with gentle rocking for 10 minutes to wash away any residual agarose sticking to the membrane. After air drying at room temperature, the membrane was baked at so0e for two hours. The baked filter was stored at room temperature in a dessicator, if not used immediately. The dehydrated gel was restained in water containing 0.5 ug I ml ethidium bromide for 30 minutes and examined on a short wave UV transilluminator to check for the presence of any DNA fragments that escaped blotting. The absence of any residual bands indicated that the transfer was complete.
-
Restriction fragments of DNA resolved on agarose gel were transferred to nylon membrane ( GeneScreen or GeneScreen Plus by the capillary blotting procedure of Southern ( 1975 ) as described by Maniatis et al., ( 1982 ) . After the completion of electrophoresis, the gel was stained and photographed as described earlier. Position of the various bands obtained in the DNA size marker lane were marked by piercing small holes at the two ends of each band in the gel with a yellow tip. The gel was then denatured, neutralised and blotted essentially as described by Maniatis et al., ( 1982 ) . Locally available coarse absorbent paper was used to make the paper towels of the appropriate size. In case of genomic DNA from mammalian cells, the agarose gel was first treated with 0.25 M HCl for 10 minutes, followed by the rest of the procedure as mentioned above. The transfer buffer was 20 X SSPE in all cases. To prevent the absorption of fluid from the 3 MM paper under the gel directly to the blotting paper atop the nylon membrane, the gel was surrounded with polythene sheets to minimise the direct contact between the blotting paper and the 3 MM paper placed under the gel. The blotting was performed for 18 -24 hours. After the transfer was over, the paper towels and the 3 MM papers on top of the nylon filter were peeled off. The gel along with the attached membrane, was turned over and kept on a clean sheet of 3 MM paper with the gel side up. The position of the gel slots was marked with a ball -point pen. Also, the positions of the
-
southern blot.
-
Colony lifts were performed essentially as described by Maniatis et al. , 1982 ) . Recombinant colonies were grown 0/N at 37°C to have well separated colonies. The colonies were overlaid with 80 mm diameter nitrocellulose filter circles BA 85, S & S and after the filter became wet throughout, it was peeled off in a single, smooth motion, avoiding the smearing of the bacterial colonies. The plate was reincubated at 37°C for a few hours to regenerate the colonies. The colonies transferred to the filter were lysed to bind the liberated DNA to the nitrocellulose.
-
Colony lifts.
-
Transfer of DNA.
-
were stored at -70°C for at least six months without any significant loss in the competence.
-
A single ~.coli colony taken from an agar plate was used to inoculate 10 ml of LB and incubated 0/N at 37°C in an incubator-shaker. Next day, 0. 5 ml of this freshly grown culture was used to inoculate 100 ml of LB in a 500 ml flask. The culture was incubated at 37°C in an incubator -shaker and absorbance of the growing culture was monitored at 620 nm. When the A620 reached 0. 4 -0. 5 ( in about 120 -150 minutes), the flask was rapidly chilled by shaking in ice. The cells were harvested in sterile, chilled centrifuge bottles at 4, ooog for 10 minutes at 4 °c. The pellet was gently resuspended in 50 ml sterile, ice cold 100 mM cacl2 and the cells incubated in ice for 30 minutes. The cells were again centrifuged as above and the pellet resuspended in 6.5 ml of sterile, chilled, 100 mM cac12 containing 15 % glycerol. The cells were resuspended very gently, and a 200 ul aliquot was transformed with a standard plasmid DNA to check the competence of the cells. Meanwhile, the rest of the competent cells were incubated in ice for 16 -18 hours, to increase the competence of the cells a further few fold. After ascertaining high transformation efficiency of the competent cells, the cells were dispensed as 200 ul aliquots into prechilled, sterile 1.5 ml eppendorf tubes. These cells
-
Preparation of competent E.coli cells.
-
lectrophoresed on 0.7 % -1.2 % agarose gels in TAE or TBE buffer. Choice of the percentage of agarose and the electrophoresis buffer system was made following the guidelines of Maniatis et al., ( 1982 ). In general, upto 1 kb fragments were resolved on 1.2 % agarose gels using TBE buffer. For most other purposes, TAE buffer was used. Agarose gel electrophoresis was carried out as described by Maniatis et al., ( 1982 ) . The run was stopped when the bromophenol blue dye migrated to within 1 em -1.5 em from the edge of ' the gel, except when the sample had fragments smaller than 500 bp, in which case the elctrophoresis was terminated at an earlier stage. The gel was immersed in water containing 0.5 ug I ml ethidium bromide, for 30 minutes, to stain the DNA. When detecting very low amounts of DNA, the staining was done for 60 minutes followed by destaining in 1 mM Mgso4 for one hour at room temperature. The DNA bands were visualised on a short wavelength UV transilluminator ( Fotodyne, Inc., USA and photographed with a Polaroid MP-4 camera using Polaroid type 667 film.
-
DNA digested with restriction enzymes was
-
For rapid electrophoretic analysis of plasmid DNA prepared by miniprep protocol, or to monitor the progress of digestion during various cloning procedures, the DNA was resolved on short agarose gels, taking less than one hour for the run. The electrophoresis was carried out in TAE buffer using 8 em long gels with a comb of teeth size 0.4 x 0.2 em. The width of the gel was variable, depending on the number of samples to be analysed. Gels were run at 50 100 volts, till the bromophenol blue dye migrated to within 0.5 em of the edge of the gel.
-
Mini gel electrophoresis
-
Electrophoresis of DNA
-
Routinely, with sterile double 0.2 - 1 ug DNA was made up to 18 ul distilled water in an autoclaved eppendorf tube. 2 ul of 10 X buffer and 2 - 5 unitp of restriction endonuclease were added. The reaction components were mixed well and incubated in a 37°C water bath for 1 - 2 hours. The digestion reaction was terminated by the addition of 2 ul of 10 X tracking dye ( 0.25 % xylene cyanol, 0.25 % bromophenol blue, 0.1 M EDTA, pH 8.0, and 50 % glycerol followed by brief vortexing to mix, after which the sample was loaded on to the gel.
-
ecanted and the pellet dried briefly under vacuum. The final DNA pellet was resuspended in 500 ul of TE. A 1:50 dilution of the sample was used to measure the absorbance at 260 nm and at 280 nm. The A260 and A280 values were used to estimate the concentration and purity of the sample as described by Maniatis et al., ( 1982).
-
further purified by centrifugation to equilibrium in a 30 ml cesium chloride -ethidium bromide density gradient, as described by Maniatis et al., ( 1982 ) . The band corresponding to closed circular plasmid DNA was collected and further purified by a second centrifugation to equilibrium in a 6. 5 ml cesium chloride -ethidium bromide density gradient. The final DNA band collected from the gradient was extracted with an equal volume of isopropanol which had been previously saturated with TE and cesium chloride. This extraction was repeated twice to completely remove the ethidium bromide from the DNA sample. The DNA was then dialysed against one liter of TE for at least 8 hours, at 4 °c, with several changes of TE. To the dialysed sample, one tenth volume of 3 M sodium acetate, pH 5.2, was added and the DNA precipitated with two volumes of chilled ethanol. The precipitation was carried out 0/N at 0 -20 c. The precipitated centrifugation at 10, 000 rpm, DNA was collected by for 10 minutes. The supernate was carefully d
-
resuspended in 20 ml of Tris -Glucose solution ( 25 mM Tris. HCl, pH 8. 0; 50 mM Glucose ) . The cells were vortexed followed by repeated pipetting to obtain a uniform cell suspension. To this, 6.0 ml of a freshly prepared lysozyme solution ( 10 mg 1 ml, prepared freshly in sterile distilled water ) was added. The cell suspension was swirled to mix thoroughly and incubated for 5 minutes at room temperature. Next, 0.5 M EDTA was added to a final concentration of 10 mM, the contents swirled to mix and incubated in ice for 20 minutes. Next, 40 ml of a lytic mix containing 0. 1 % SDS and 0. 2 N NaOH was added. This was prepared freshly by mixing 4 ml of 10 % SDS solution into 36 ml of 0.22 N NaOH solution. The solution was mixed by vigorous but brief shaking till the cell lysate became clear, followed by incubation on ice for 5 minutes. Finally, 20 ml of 5 M potassium acetate solution, pH 4.8 was added. Again the contents were swirled to mix, followed by incubation in ice for at least 1 - 2 hours. The lysate was centrifuged at 10,000 rpm for 30 minutes at 4°c. The supernate was filtered through sterilised glass wool kept in a funnel, and collected in a graduated cylinder. The measured volume of the cell lysate was transferred into another centrifuge bottle and two volumes of 95 % ethanol added to precipitate the DNA, at 0 -20 c, 0/N. The DNA was pelleted by centrifugation at 10,000 rpm at 4 °c for 30 minutes. The supernate was carefully poured off and the pellet res~spended in 25 ml of TE ( 10 mM Tris.HCl, pH 8.0; 1 mM EDTA ). The plasmid DNA was
-
Plasmid DNA was isolated using the alkaline lysis method of Birnboim ( 1979 ) with slight modifications. One liter of TB supplemented with ampicillin @ 50 ug 1 ml was inoculated with 10 ml of a freshly grown primary culture and the culture incubated 0/N at 37°c, in an incubator -shaker. The cells were pelleted by centrifugation at 4000g for 10 minutes at 4 °c. The supernate was discarded and the pellet
-
Isolation of plasmid DNA.
-
yeast extract, and 10 g NaCl in distilled water, pH adjusted to 7.5 with NaOH and final volume made up to one liter (Maniatis et al., 1982). Cultures of ~.coli cells transformed with plasmid DNA were grown in media supplemented with 50 ug/ml of ampicillin. For large scale plasmid DNA isolation, ~.coli cells were grown in an enriched medium, Terrific Broth ( TB ) . One liter of TB was prepared by adding 100 ml of a sterile solution of 0.17 M KH2Po4 and 0.72 M K2HPo4 to a sterile solution containing 12 g Bacto -tryptone, 24 g Bacto -yeast extract, 4.0 ml glycerol and water to a final volume of 900 ml ( Tartof and Hobbs, 1987 ) . The media were sterilised by autoclaving at 15 psi for 20 minutes. Heat labile compounds and antibiotics were sterilised by filtration through a 0.45 u nitrocellulose membrane and added to autoclaved media after cooling the same to 55°C. Solid media was prepared by adding 1. 5 % bacto -agar prior to autoclaving. Storage of ~.coli was carried out essentially as described by Maniatis et al., ( 1982).
-
Composition of growth media used for culturing ~. coli is given in Table 3. For routine propagation, ~.coli cells were grown in Luria Bertani medium LB ) . LB was prepared by dissolving 10 g Bacto -tryptone, 5 g Bacto -
-
Growth and storage of bacteria.
-
The bacterial strains used in this study were ~.coli Kl2 strains, HBlOl ( F-, hsd S20 ( rB-, mB-) , supE44, ara14, ~-, galK2, lacYl, proA2, rpsL20, xyl-5, mtl-1, recA13 ] (Boyer et al., 1969 ), and JM105 ( thi, rpsL, endA, sbcB15, hsdR4, ( lac-proAB ), {F1, traD36, proAB, laciqZ M15 } ]. The mammalian cell lines used are listed in Table 1. Rat-2 is an established rat fibroblast cell line. FWIL (Larrick et al., unpublished) is a human myeloma cell line derived from the fusion of U266 IgE myeloma cells with WIL-2 lymphoblastoid cells. Rat - 2 and FWIL cell lines were kindly provided by Dr. J.W. Larrick, Cetus Corporation, USA. The other four cell lines were obtained from American Type Culture Collection ( ATCC ). The plasmids used in this study are described in Table 2.
-
Bacterial strains, cell lines and plasrnids.
Tags
- Material-1-detail
- Material-1
- Method-5-Method-1-Method-2-detail
- Method-5-Method-1-Method-1-detail
- Method-15-Method-1
- Method-18-Method-1-detail
- Method-8-Method-1-detail
- Method-8-Method-1
- Method-15-Method-2-Method-1
- Method-2-Method-1-detail
- Method-13-Method-1-detail
- Method-11-Method-1
- Method-5-Method-1
- Method-11-Method-1-Method-1-detail
- Method-11-Method-1-Method-2
- Method-15-Method-2-Method-1-detail
- Method-5-Method-1-Method-1
- Method-1
- Method-12-Method-1-detail
- Method-11-Method-1-Method-2-detail
- Method-2-Method-1
- method-4-method-1-detail
- Method-11-Method-1-Method-1
- Method-1-detail
- Method-15-Method-1-detail
- Method-13-Method-1
- Method-12-Method-1
Annotators
URL
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
The membranes were suspended (1.4 x 108 cell equivalent) in 250 III of incorporation buffer (50 mM HEPES, pH = 7.4, 25 mM KCI, 5 mM MgCb, 5 mM MnCI2, 0.1 mM TlCK, 1 Ilg/ml leupeptin, 1 mM ATP, 0.5 mM dithiothreitol and 0.4 Ilg/ml tunicamycin). Each assay tube was prepared by adding 12.5 III of 1 % Chaps, 2.8 III of 200 IlM GOP-Man, 10 III of GOP-[3H]-Man (1IlCi) and 25 nmol of synthetic substrate (49). The contents were lyophilized and 250 III of membrane suspension (1 .4 x 108 cell equivalent in incorporation buffer) were added to each tube. The tubes were incubated at 28°C for 20 minutes, cooled to 0 °C and the membranes were pelleted at 4 °C for 10 minutes in a microcentrifuge. The eH] mannosylated products, that were recovered in the supernatant, were mixed with 0.5 ml 100 mM ammonium acetate and applied to a C18 Sep-pak cartridge that had been washed with 5 ml 80% propan-1-01 and 5 ml 100 mM ammonium acetate. The cartridge was washed with 1.5 ml of 100 mM ammonium acetate and then the eluate was reapplied to the same cartridge. The cartridge was subsequently washed with 5 ml of 100 mM ammonium acetate, after which the bound material was eluted with 5 ml of 60% propan-1-01. The final eluate was concentrated and redissolved in 100 III of 60% propan-1-01. One tenth of this volume was taken for scintillation counting. The above assay was then carried out with a range of concentrations of OMJ to assess it's effect on the activity of eMPT enzyme parse.
-
eMPT inhibition assay
-
mixture). These samples were lyophilized and 125 III of the reaction mixture was added to each tube. The tubes were then incubated at 25°C for 1 h and the biosynthetic LPG was extracted as described above. 10 III of the solvent E extract was taken for scintillation counting.
-
1. Mild acid hydrolysis: 0.6 ml of the pooled solvent E soluble fractions was dried with a stream of nitrogen and then suspended in 0.02 N HGI (200 Ill). The mixture was then placed in a 100 °G water bath for 5 minutes. After hydrolysis, the sample was again dried under nitrogen and codried thrice with toluene (0.5 ml). The residue was suspended in 0.6 ml of 0.1 M NaGI in 0.1 M glacial acetic acid, loaded onto phenyl sepharose column and elution done in the same manner as described before. Fractions of 0.6 ml each were collected and assayed for radioactivity. 2. Nitrous acid deamination: 0.6 ml of the pooled solvent E soluble fractions was dried with a stream of nitrogen and then suspended in 0.2 ml of 0.125 M sodium acetate (pH = 4.0) and 0.25 M sodium nitrite. The mixture was incubated at 25 °G for 40 h. The sample was dried under nitrogen, suspended in 0.6 ml of 0.1 M NaGI in 0.1 M glacial acetic acid, loaded onto phenyl sepharose column and elution done in the same manner as described before. Fractions of 0.6 ml each were collected and assayed for radioactivity. 3. PI-PLC treatment: 0.6 ml of the pooled solvent E soluble fractions was dried with a stream of nitrogen and suspended in 0.4 ml of PI-PlG buffer (0.1 M Tris chloride, pH = 7.4 with 0.1 % deoxycholate) and 0.2 ml of PI-PlG concentrate (B.subtifis culture supernatant) was added. The mixture was then incubated at 37 °G for 16 h. The sample was dried under nitrogen, suspended in 0.6 ml of 0.1 M NaGI in 0.1 M glacial acetic acid, loaded onto phenyl sepharose column and elution done in the same manner as described before. Fractions of 0.6 ml each were collected and assayed for radioactivity. The effect of deoxymannojirimycin (Sigma, Gat. no. 0-9160) on the cell free biosynthesis was carried out. OMJ (5 mg) was dissolved in 1 ml of MQ water and 2.5, 5, 25 and 50 III were transferred to eppendorf tubes separately (which corresponded to 0.5, 1, 5 and 10 IlM concentrations of OMJ in 125 III ofthe reaction
-
Characterization of biosynthetic LPG
-
NaGI in 0.1 M glacial acetic acid, 1.2 ml of 0.1 M glacial acetic acid, 0.6 ml of water and 3.6 ml of solvent E. Fractions of 0.6 ml each were collected and assayed for radioactivity.
-
Parasites (6 X 109) were harvested, pelleted at 3000 g for 10 min, washed with PBS, repelleted and suspended in 10 mL of HEPES buffer (100 mM HEPES-NaOH, pH = 7.4, 50 mM KCI, 10 mM MnCI2, 10 mM MgCI2, 0.1 mM TLCK, 1 Jlg/mL leupeptin) containing 10% glycerol. The cells were disrupted in a Parr nitrogen cavitation bomb (1500 psi, 25 min, 4°C, 3 cycles). The debris was removed by centrifugation at 3000 g for 5 min and the supernatant was centrifuged at 100,000 g for 1 h at 4°C. The resulting membrane pellet was resuspended in 10 mL of HEPES buffer without glycerol and centrifuged again at 100,000 g for 1 h at 4°C. The membranes were finally suspended in 1 mL (13 mg/mL) of HEPES buffer without glycerol. The incubation mixture per reaction contained membrane protein (2 mg) in 125 JlL of 50 mM HEPES-NaOH buffer, pH = 7.2 containing supplements (25 mM KCI, 5 mM MgCI2, 5 mM MnCI2, 0.1 mM TLCK, 1 JlglmL leupeptin, 0.8 mM ATP, 0.4 mM On) with 2 JlM UOP-[3H]-galactose (2 JlCi) and 10 JlM GOP-mannose. The mixture was incubated at 25°C for 1 h, terminated by the addition of CHCI~CH30H (3:2) to give a final ratio of CHCI~CH30H/H20 (3:2:1) and sonicated. The layers were then allowed to separate out after which the lower layer was removed with the aid of a micropipette. The tube containing the upper and intermediate layer was centrifuged (10,000 rpm, 4°C, 5 minutes). The supernatant was discarded and the resultant pellet (membranes) was suspended in 1 mL of CHCI~CH30H/H20 (1:1 :0.3). The solution was again centrifuged (10,000 rpm, 4°C, 5 minutes) and the pellet was extracted with 1 mL of solvent E (H20/ethanol/diethylether/pyridine/NH40H 15:15:5:1 :0.017) thrice. The solvent E extracts were pooled and dried under a stream of nitrogen, suspended in 0.6 mL of 0.1 M NaCI in 0.1 M glacial acetic acid and chromatographed over a 1 mL column of phenyl sepharose. Phenyl Sepharose Column of Biosynthetic LPG. The solvent E extract suspended in 0.6 mL of 0.1 M NaCI in 0.1 M glacial acetic acid was applied to a column (0.5 x 2 cm) of phenyl sepharose (Pharmacia BioteCh), preequilibrated with 0.1 M NaCI in 0.1 M glacial acetic acid. The column was then washed sequentially with 3 mL of 0.1 M
-
Cell-free Biosynthesis42 of LPG using Leishmania membranes
-
Water was added and the mixture was concentrated under reduced pressure to afford 89; ESMS (mlz): 604.1 (M-Hr.
-
ixture was stirred under argon atmosphere for 2 days.
-
were diluted with ice cold water. The mixture was extracted with CH2CI2. The organic layer was thoroughly washed with water, dried over Na2S04 and concentrated to yield 84. 2,3,4,6-Tetra-O-acetyl-a-L-manno-di-O-benzyl phosphate (86). Compound 84 (50 mg, 0.128 mmol) was dissolved in anhydrous CH3CN saturated with dimethylamine (5 ml ) at -20 DC and stirred for 3h after which TlC confirmed the disappearance of starting material. Excess of dimethylamine was removed under reduced pressure at 30 DC and the reaction mixture was concentrated to afford 2,3,4,6-tetra-O-acetyl-a-l-mannose (85). To a stirred solution of compound 85 and 1 H-tetrazole (9.5 mg, 0.138 mmol) in anhydrous CH2CI2 (400 Ill) was added dibenzyl-N,N'-diisopropyl phosphoramidite (56.5 Ill, 59.4 mg, 0.172 mmol) and the mixture was stirred under argon atmosphere for 2 h at rt. Subsequently, the reaction mixture was cooled to-40 DC and m-CPBA (40 mg, 0.23 mmol) was added and stirring was continued for another 30 minutes at rt. The reaction was quenched by the addition of a solution of saturated bicarbonate. The mixture was extracted with CH2CI2. The organic phase was thoroughly washed with water, dried over Na2S04 and concentrated to afford 86, which was purified by running a silica coated preparative TlC plate; Rf = 0.16 in 50% ethyl acetate in hexane; 1H NMR: 8 3.9-4.22 (m, 4H), 5.02-5.06 (m, 4H), 5.21-5.28 (m, 2H), 5.59 (1 H, dd, JHP = 6.3 Hz, JHH = 1.8 Hz, H-1); 13C NMR: 8 20.49, 20.60, 61.68,65.19,68.14,68.68,69.75,69.92,70.31, 95.09, 127.89-128.72, 169.43; 31p NMR 8 -3.2; ESMS (mlz): 631.2 (M+Nat. a-L-mannosyl phosphate (88). To a solution of 86 (25 mg, 0.04 mmol) in CH30H (1 ml) was added palladium on charcoal (10%, 200 mg) and formic acid (100 Ill). The mixture was stirred at 50 DC for 3 h to afford compound 87. The catalyst was filtered off and the solvent was evaporated. The residue was taken in a mixture of CH30H:H20:triethylamine (5:3:2, 1.6 ml) and stirred for 2 days at rt. The reaction mixture was concentrated and the residue was repeatedly lyophilized to yield 88; ESMS (mlz): 259.19 (M-H)". Guanosine 5'-diphospho-a-L-mannose ( mono triethylamine salt) 89. A mixture of 4-morpholine-N,N'-dicyclohexylcarboxaminidium guanosine 5'-monophospho morpholidate (56 mg, 0.071 mmol) and 88 (16 mg, 0.034 mmol) was coevaporated with dry pyridine (3x500 Ill). 1 H-tetrazole (10 mg, 0.137 mmol) and dry pyridine (1.2 ml) were added and the m
-
Penta-O-acetyl-a-L-Mannose (84): To a solution of l-mannose (30 mg, 0.16 mmol) in pyridine (300 Ill) was added acetic anhydride (500 Ill) at 0 °C. The flask was left at 4 °C for 12 h. The mixture was then stirred at rt for 1 h, following which the contents
-
Synthesis of L-Mannose analogue of GOP Mannose (Scheme 18 of Results and Discussion)
-
(1 ml) was added palladium on charcoal (10%, 176 mg) and formic acid (100 Ill). The mixture was stirred at 50°C for 3h after which the catalyst was filtered off and the solvent was evaporated. The residue was taken in a mixture of CH30H:water:triethylamine (5:3:2, 1.6 ml) and stirred for 2 days at rt. The reaction mixture was concentrated and the residue was repeatedly lyophilized to yield 82; ESMS (mlz): 387.34 (M-H)'. Guanosine 5'-diphospho-6-deoxy-6-fluoro-a-D-mannose (mono-triethylamine salt) 83. Mixture of 4-morpholine-N,N'-dicyclohexylcarboxaminidium guanosine 5'-monophosphomorpholidate (43 mg, 0.054 mmol ) and 82 (16 mg, 0.034 mmol) was coevaporated with dry pyridine (3 x 500 Ill). 1 H-tetrazole (8 mg, 0.108 mmol ) and dry pyridine (1 ml) were added and the mixture was stirred under argon atmosphere for 2 days. Water was added and the mixture was concentrated under reduced pressure to yield 83; ESMS (mlz): 606.11 (M-Hr.
-
solution of compound 80 and 1 H-tetrazole (7 mg, 0.102 mmol) in anhydrous CH2CI2 was added dibenzyl-N,N'-diisopropylphosphoramidite (42 Ill, 43.8 mg, 0.127 mmol) and the mixture was stirred under argon atmosphere for 2 h at rt. Subsequently, the reaction mixture was cooled to -40°C and m-CPBA (30 mg, 0.17 mmol) was added and stirring was continued for another 30 minutes at rt. The reaction was quenched by the addition of a solution of saturated sodium bicarbonate. The mixture was extracted with CH2CI2. The organic phase was thoroughly washed with water, dried over Na2S04 and concentrated to afford 81, which was purified by running a silica coated preparative TlC plate; R, = 0.12 (twice run in 30% ethyl acetate in hexane); 1H NMR: characterstic () 5.6 (1 H, dd, JHP = 6.3 Hz and JHH = 1.8 Hz); 13C NMR: () 20.50, 20.53, 20.60, 64.75, 68.11, 68.58, 69.86, 70.67, 70.93, 81.87, 95.01, 128-128.72, 169.38, 169.50, 169.67; 31 P NMR () -3.11; ESMS (m/z): 591.34 (M+Nat. 6-Deoxy-6-fluoro-a-D-mannosyl phosphate (82). To a solution of 81 (20 mg, 0.035 mmol) in CH30H
-
Methyl-S-deoxy-S-difluoro-a-D-mannopyranoside (78). DAST (134 Ill, 1 mmol) was added with stirring at -40 °c, to a suspension of methyl-a-D-mannopyranoside S2 (200 mg, 1 mmol) in anhydrous CH2Cb (4 ml). The mixture was stirred at -40 °c for another 30 minutes and then at rt for 3h. After cooling to -20°C, the excess of reagent was destroyed by addition of CH30H (600 Ill) and sodium bicarbonate (200 mg). The cooling bath was removed, and the mixture was filtered once effervescence ceased. The filtrate was concentrated and purified by silica column chromatography (3% CH30H in CH2CI2) to yield 78; Rf = 0.21 in 12.5% CH30H in CH2CI2• 1 ,2,3,4-Tetra-O-acetyl-S-deoxy-S-fluoro-a-D-mannopyranoside (79). To compound 78 (100 mg, 0.51 mmol) was added 2% sulfuric acid solution in acetic anhydride (1.2 ml). The mixture was stirred at rt for 90 minutes. The contents were diluted with saturated sodium bicarbonate solution. The mixture was extracted with ethyl acetate. The organic phase was thoroughly washed with water, dried over Na2S04and concentrated to afford 79; Rf = 0.35 in 50% ethyl acetate in hexane. 2,3,4-Tri-O-acetyl-S-deoxY-S-fluoro-a-D-manno-di-O-benzyl phosphate (81). Compound 79 ( 30 mg, 0.085 mmol) was dissolved in anhydrous acetonitrile saturated with dimethylamine (5 ml ) at -20°C and stirred for 3 h after which TlC confirmed the disappearance of starting material. Excess of dimethylamine was removed under reduced pressure at 30°C and the reaction mixture was concentrated to afford 2,3,4-tri-O-acetyl-6-deoxY-6-floro-a-D-mannopyranoside (80). To a stirred
-
Synthesis of [6-Deoxy-6-fluoro]-GDP Mannose95 (Scheme 17 of Results and Discussion)
-
mixture was concentrated and the residue was repeatedly lyophilized to yield 7S; ESMS (mlz): 263.1 (M-Hr. Guanosine 5'-diphospho-4,S-di-deoxy-4,S-difluoro-a-D-talose mono triethyl amine salt) 77. A mixture of 4-morpholine-N,N'-dicyclohexylcarboxaminidium guanosine 5'-monophosphomorpholidate (27 mg, 34.4 Ilmol) and 7S (10 mg, 21.5 Ilmol) was coevaporated with anhydrous pyridine (3 x 500 Ill). 1 H-tetrazole (5 mg, 68.7 Ilmol) and anhydrous pyridine (1 ml) were added and the mixture was stirred under argon atmosphere for 2 days. Water was added and the mixture was concentrated under reduced pressure to afford 77; ESMS (mlz): 608.3 (M-Hr.
-
6 Hz), 4.85 (1H, s); 13C NMR 853.28,65.12 (15 Hz, C3), 67.3 (24 Hz, C5), 69.72 (C2), 81.1 (JCF = 168 Hz, C4), 89.9 (JCF = 171 Hz, C4), 101.47 (C1). 1 ,2,3-Tri-O-acetyl-4,6-di-deoxy-4,6-difluoro-a-D-talopyranoside (73). To compound 72 (100 mg, 0.543 mmol) was added 2% sulfuric acid solution in acetic anhydride (1.2 ml). The mixture was stirred at rt for 90 minutes. The contents were diluted with saturated sodium bicarbonate solution. The mixture was extracted with ethyl acetate. The organic phase was thoroughly washed with water, dried over sodium sulfate and concentrated to afford 73. 2,3-Di-O-acetyl-4,6-di-deoxY-4,6-difluoro-a-D-talo-di-O-benzyl phosphate (75) : Compound 73 ( 70 mg, 0.225 mmol) was dissolved in anhydrous CH3CN saturated with dimethylamine (5 ml ) at -20°C and stirred for 3h after which TlC confirmed the disappearance of starting material. Excess of dimethylamine was removed under reduced pressure at 30°C and the reaction mixture was concentrated to afford 2,3, di-O-acetyl-4,6-di-deoxy-4,6-difloro-a-D-talopyranoside (74). To a stirred solution of compound 74 and 1 H-tetrazole (21 mg, 0.3 mmol) in anhydrous CH2CI2 (400 Ill) was added dibenzyl-N,N-diisopropylphosphoramidite (99.4 Ill, 104.3 mg, 0.3 mmol) and the mixture was stirred under argon atmosphere for 2 h at rt. Subsequently, the reaction mixture was cooled to -40°C and m-CPBA (87 mg, 0.504 mmol) was added and stirring was continued for another 30 minutes at rt. The reaction was quenched by the addition of a solution of saturated sodium bicarbonate. The mixture was extracted with CH2CI2. The organic phase was thoroughly washed with water, dried over Na2S04 and concentrated to afford 75, which was purified by running a silica coated preparative TlC plate; Rf = 0.24 (50% ethyl acetate in hexane); 1H NMR characterstic ¢ 5.67 (1 H, dd, J = 6.3 Hz and 1.8 Hz, H-1); 13C NMR: ~ 20.5-20.6 (OAc), 64.77, 64.99, 66.28, 66.43, 69.9 (24 Hz, C5), 79.96 (JCF = 169 Hz, JCH = 7.1 Hz, C6), 84.08 (JCF= 180, JCH = 5.4 Hz, C4), 95.68,126.85-128.7,169.50,169.77; 31p NMR 8 -3.03; ESMS (mlz): 551.2 (M+Nat. 4,6-Di-deoxy-4,6-difluoro-a-D-talosyl phosphate (76). To a solution of 75 (30 mg, 0.056 mmol) in CH30H (1 ml) was added palladium on charcoal (10%, 280 mg) and formic acid (100 Ill). The mixture was stirred at 50°C for 3h. The catalyst was filtered off and the solvent was evaporated. The residue was taken in a mixture of CH30H:water:triethylamine (5:3:2, 1.6 ml) and stirred for 2 days at rt. The reaction
-
Methyl-4,6-di-deoxy-4,6-difluoro-a-D-talopyranoside (72). DAST (750 j.!L, 5.6 mmol) was added with stirring at -40 °c, to a suspension of methyl-a-D-mannopyranoside 62 (200 mg, 1 mmol) in anhyd CH2CI2 (4 mL). The mixture was stirred at -40 °c for another 30 minutes and then at rt for 3 h. After cooling to -200C, the excess of reagent was destroyed by addition of CH30H (600 j.!L) and sodium bicarbonate (200 mg). The cooling bath was removed, and the mixture was filtered once effervescence ceased. The filtrate was concentrated, loaded onto a silica column and eluted out with CH2CI2 to yield 72; Rf= 0.7 in 12.5% CH30H in CH2CI2; 1H NMR (CDCI3) 83.40 (3H, s, OCH3), 4.19 (1 H, m), 4.52 (1 H, d, 6 Hz), 4.68 (1 H, d,
-
Synthesis of [4,6-Dideoxy-4,6-difluoro]-GDP Talose (Scheme 16 of Results and Discussion)
-
(34 mg, 0.198 mmol) was added and stirring was continued for another 30 minutes at rt. The reaction was quenched by the addition of a solution of saturated bicarbonate. The mixture was extracted with CH2CI2. The organic phase was thoroughly washed with water, dried over Na2S04 and concentrated to afford 69, which was purified by running a silica coated preparative TLC plate; Rf = 0.23 in 50% ethyl acetate in hexane; 1H NMR characterstic.8 5.72 (1 H, dd, JHP = 6.9 Hz, JHH = 1.8 Hz, H-1), 5.83 (1 H, t, JHF = 53.4 Hz, H-6); 31p NMR 8 -2.81; ESMS (mlz): 753.36 (M+Nat. 6-Deoxy-6,6-difluoro-a-D-mannosyl phosphate (70). To a solution of 69 (25 mg, 0.034 mmol) in CH30H (1 mL) was added palladium on charcoal (10%, 170 mg) and formic acid (100 j.!L). The mixture was stirred at 50°C overnight. The catalyst was removed by passing the mixture through a pad of celite. A few drops of triethylamine were added and the solution was stirred for 15 minutes. The solvent was evaporated and the product was repeatedly lyophilized to afford 70; ESMS (mlz): 279.22 (M-H)". Guanosine 5'-diphospho-6-deoxy-6,6-difluoro-a-D-mannose (mono-triethyl amine salt) 71. A mixture of 4-morpholine-N,N'-dicyclohexylcarboxaminidium guanosine 5'-monophosphomorpholidate (29 mg, 0.037 mmol) and 70 (11 mg, 0.023 mmol) was coevaporated with dry pyridine (3 x 200 j.!L). 1 H-tetrazole (5.5 mg, 0.074 mmol) and anhydrous pyridine (900 j.!L) were added and the mixture was stirred under argon atmosphere for 2 days. Water was added and the mixture was concentrated under reduced pressure to afford 71; ESMS (mlz): 624.15 (M-H)"
-
Methyl-6-deoxy-6,6-difluoro-2,3,4-tri-O-benzyl-a-D-mannopyranoside (66). A solution of oxalyl chloride (54.62 mg, 37.6 Ill, 0.43 mmol) in anhydrous CH2CI2 (15 ml) was cooled to -78°C and DMSO (67.2 mg, 62 Ill, 0.86 mmol) was added dropwise, followed by the addition of a solution of 65 (500 mg, 1.07 mmol) in CH2CI2 (5 ml) over a period of 5 minutes. The mixture was stirred for another 30 minutes and then triethylamine (1.2 ml) was added. The solution was brought to room temperature, water was added and the mixture was extracted with CH2CI2. The organic layer was dried over Na2S04 to give the intermediate aldehyde. A solution of DAST (112.8 mg, 92.5 Ill, 0.7 mmol) in anhydrous CH2CI2 (1.5 ml) was cooled to -78°C. To this was added a solution of the aldehyde (325 mg, 0.7mmol) in anhydrous CH2CI2 (1.5 ml) dropwise. The mixture was stirred at rt for 90 minutes. After cooling to -20°C, excess of reagent was destroyed by the addition of CH30H and sodium bicarbonate. The mixture was filtered once effervescence ceased. The filtrate was concentrated and the residue was purified by silica column chromatography (5% ethyl acetate in hexane) to afford 66; Rt = 0.34 in 25% ethyl acetate in hexane; 1H NMR characterstic 8 5.97 (1 H, t, JHF = 52.6 Hz, H-6); 19F NMR &-132.65 (dd, J = 57 and 10.9 Hz), -132.90 (d
-
d, J = 57 and 16.4 Hz); ESMS (mlz): 507.2 (M+Nat. Acetyl-2,3,4-tri-O-benzyl-6-deoxY-6,6-difluoro-a-D-mannopyranoside (67). To compound 66 (70 mg, 0.144 mmol) was added 1 % sulfuric acid solution in acetic anhydride (1 ml). The mixture was stirred at rt for 1 h. The contents were diluted with saturated sodium bicarbonate solution. The mixture was extracted with ethyl acetate. The organic phase was thoroughly washed with water, dried over Na2S04 and concentrated to afford 67 which was purified by silica column chromatography (5% ethyl acetate in hexane); Rt = 0.34 (30% ethyl acetate in hexane). 2,3,4-Tri-O-benzyl-6-deoxy-6,6-difluoro-a-D-manno-di-O-benzyI phosphate (69). Compound 67 (50 mg, 0.105 mmol) was dissolved in anhydrous CH3CN saturated with dimethylamine (5 ml) at -20°C and stirred for 3h after which TlC confirmed the disappearance of starting material. Excess of dimethylamine was removed under reduced pressure at 30°C and the reaction mixture was concentrated to afford 2,3,4-tri-O-benzyl-6,6-difluoro-a-D-mannopyranoside (68). To a stirred solution of compound 68 (46 mg, 0.097 mmol) and 1 H-tetrazole (8.5 mg, 0.118 mmol) in anhydrous CH2CI2 (400 Ill) was added dibenzyl-N,N-diisopropylphosphoramidite (39 Ill, 40.9 mg, 0.118 mmoL) and the mixture was stirred under argon atmosphere for 2 h at rt. Subsequently, the reaction mixture was cooled to -40 °C and m-CPBA
-
Methyl-6-0-(triphenylmethyl)-a-D-rnannopyranoside (63). Methyl-a-D-manno pyranoside (62, 5g, 25.7 mmol) was dissolved in DMF (17 mL). Trityl chloride (7.9 g, 28.3 mmol), DMAP (515 mg, 2.06 mmol) and triethylamine (3.9 mL, 28.3 mmol) were added, and the mixture was stirred at room temperature overnight. The reaction mixture was concentrated and the residue was purified by silica column chromatography (5% CH30H in CH2CI2) to give 63 (8 g, 71.4%); R, = 0.14 in 5% CH30H in CH2CI2; ESMS (mlz): 459 (M+Nat. Methyl 2,3,4-tri-O-benzyl-6-0-(triphenylmethyl)-a-D-mannopyranoside (64). Compound 63 (5.8 g, 13.3 mmol) was dissolved in DMF (80 mL), followed by addition of sodium hydride (60% dispersion, 2.12 g, 53.2 mmol) and benzyl bromide (6.3 mL, 53.2 mmol) dropwise at 0 °C. The reaction mixture was stirred overnight at rt and the excess of sodium hydride was destroyed by addition of CH30H and water. The mixture was extracted with CH2CI2. The organic phase was washed thoroughly with saturated NaHC03 solution and water, dried over Na2S04 and concentrated to give 64; R,= 0.45 in 20% ethyl acetate in hexane; 1H NMR: 83.25 (dd, 1 H, H-2), 3.39 (s, 3H), 3.7-4.0 (m, 5H), 4.29-4.82 (7H, m, 3 x PhCH2 and H-1), 6.9-7.54 (m, 30H, Ph). Methyl 2,3,4-tri-O-benzyl-a-D-mannopyranoside (65). To a solution of compound 64 (1 g, 1.415 mmol) in CH2CI2 : CH30H (1 :2, 9 mL) was added p-toluene sulfonic acid (14 mg) and the mixture was stirred at rt for 2 h. Excess of acid was neutralized by the addition of triethylamine. The mixture was concentrated and purified by silica column chromatography (40% ethyl acetate in hexane) to yield 65 (4.5 g, 72.5%); R, = 0.13 in 30% ethyl acetate in hexane; 1H NMR: 8 3.29 (s, 3H, OMe), 3.61-3.96 (m, 5H), 3.93 (dd, J = 9 and 7.5 Hz, 1 H, H-3), 4.69 (d, J = 3 Hz, H-1), 4.63-4.95 (m, 6H, 3 x Ph CH2) , 7.25-7.34 (m, 15H, Ph); 13C NMR: 8 54.68, 62.34, 71.95, 72.89, 74.67, 74.79,75.10,80.13,99.27,127.50-128.30; ESMS (mlz): 487.3 (M+Nat.
-
Synthesis of [6-0eoxy-6,6-difluoro]-GOP Mannose94 (Scheme 15 of Results and Discussion)
-
Synthesis of GOP Mannose analogues
-
incubated at 23°C in a cooling incubator (CI-12S; Remi). Fresh passaging was done weekly in a similar fashion. After about 15 passages, a fresh cryostock from liquid nitrogen was expanded and passaging done as mentioned before. Random samples from culture flasks free from any visible microbial contamination and full of all healthy, motile parasites under microscopic examinations formed the basis of selection of the culture suitable for further use. After culturing, used flasks, pipettes, glassware etc were decontaminated by immersing them in 5% formaldehyde solution and then discarded. All other routine standard cell culture practices were observed.
-
For both routine as well as bulk culture of L.donovani 008 strain promastigotes, medium dMEM was used. This media was prepared by dissolving one sachet of powdered media dMEM (GIBCO BRl) in 800 ml of distilled water. To this was added 25 mM HEPES and other supplements (0.05 mM adenosine, 0.05 mM xanthine, 1 mg biotin, 0.04% tween 80, 5 mg hemin, 0.5% triethanolamine, 0.3% bovine serum albumin, 50 mg gentamycin sulfate). pH of the media was adjusted to 7.2 , volume made upto one litre and the media was sterilized using bell filter (0.22 Il, Sterivex GV; Millipore). The media was used within two months of preparation. To this media, as per requirement of routine culture, heat inactivated fetal bovine serum (HI-FBS) was added @ 10%. In the present study Leishmania donovani, 008 strain, promastigotes were used throughout obtained from Prof. K.P.Chang, Chicago Medical Centre, USA. These were initially isolated from patients native to central Bihar. Upon arrival these promastigotes were expanded in medium 199 and cell bank was raised where -107 viable parasites were taken in 1 ml of complete medium 199 containing 10% glycerol. These were stored in liquid nitrogen. The revival capacity of these frozen cells was checked after one week storage by snap thawing the contents of one vial at 37°C, inoculating 50 ml of dMEM media with the entire contents and incubation at 23°C for one week. A luxuriant growth with healthy viable parasites was observed under the microscope. Routinely, L.donovani promastigotes were cultured in T-125 culture flasks having 50 ml of dMEM media each supplemented with 10% FBS. Media was inoculated with 100 III of a previous culture containing _106 promastigotes. These flasks were
-
Maintenance and revival of L.donovani culture
-
mg, 0.03 mmol) in 95% aqueous pyridine (1 ml) was added. After 30 min CH2Cb was added and the solution was washed successively with cold 1 M Na2S203 (2 x 5 ml) and cold 1 M TEA hydrogen carbonate (2 x 5 ml), dried over Na2S04 and concentrated. The residue was purified by silica column chromatography (1.5% CH30H in CH2Cb with 0.1 % Et3N); Rf = 0.54 in 20% CH30H in CH2CI2; 1 H NMR: 8 -0.01 (s, 6H, Me~iCMe3), 0.84 (s, 9H, Me2SiCMe3), 1.95-2.11 (m, 18H, OAc), 3.62 (m), 3.88 (m), 4.2 (m), 4.5 (m), 4.9 (m, 2H, H-2', 3'), 5.28 (m, 3H, H-1, 2, 3), 5.44 (m, 1 H, CH=CH2); 31 P NMR .8-2.68; ESMS (mlz) : 925.3 (M-Et3N-H)". Dec-9-enyl-6-dihydroxyl-4-~-D-galactopyranosyl-a-D-mannopyranosyl phospha te triethylammonium salt (55). A solution of aqueous HF (48%) in CH3CN (5:95, 400 Ill) was added to compound 54 (10 mg, 0.009 mmol) at 0 aC. The solution was stirred at 0 aC for 2 h. The reaction was quenched by the addition of the aqueous NaHC03 solution until effervescence ceased and diluted with CH2CI2. The organic layer was extracted with water and TEAS solution thoroughly, dried over Na2S04 and concentrated to give dec-9-enyl-2,3,4-tri-O-acetyl-4-~-D-galactopyranosyl-a-Dmannopyranosyl phosphate triethylammonium salt; ESMS (m/z): 811.4 (M-EtsN-H)". A solution of oxalyl chloride (0.38 mg, 1.5 Ill, 0.003 mmol) in anhydrous CH2CI2 (50 Ill) was cooled to -78 aC and DMSO (0.47 mg, 1.7 Ill, 0.006 mmol) was added, followed by the addition of a solution of dec-9-enyl-2,3,4-tri-O-acetyl-4-~-Dgalactopyranosyl-a-D-mannopyranosyl phosphate (7 mg, 0.007 mmol) in CH2CI2 (100 Ill). The mixture was stirred for another 30 minutes and then triethylamine (10 Ill) was added. The solution was brought to rt, water was added and the mixture was extracted with CH2Cb. The organic layer was dried over Na2S04 to give the aldehyde 55. Dec-9-enyl-6-dihydroxyl-4-~-D-galactopyranosyl-a-D-mannopyranosyl phosphate triethylammonium salt (56). The residue was taken in a mixture of CH30H:water:triethylamine (5:3:2, 1.6 ml) and stirred for 2 days at rt. The reaction mixture was concentrated and the residue was repeatedly lyophilized to yield 56.
-
Dec-9-enyl-2,3,4-tri-O-acetYI-[6-0-(t-butYldimethYlsilyl)-4-~-D-galactopyranosyl] -a-D-mannopyranosyl phosphate tri ethylammonium salt (54). A mixture of H-phosphonate 6 (from scheme 1, 50 mg, 0.057 mmol) and dec-9-en-1-01 (30 Ill, 0.172 mmol) was dried by evaporation of pyridine (2 x 0.5 ml). The residue was dissolved in anhydrous pyridine (1 ml), pivaloyl chloride (22 Ill, 0.172 mmol) was added, and the mixture was stirred at rt for 1 h whereafter a freshly prepared solution of iodine (6
-
(Scheme 13 of Results and Discussion)
-
Synthesis of S'-hemiacetal analogue90 of Gal 1,4~-Man-aphosphate acceptor
-
was diluted with water and the aqueous layer was thoroughly extracted with ethyl acetate (15 ml x 2). The organic layer was dried over Na2S04, concentrated and dried to yield C4C] labelled stearyl alcohol 51. [14C]-Stearyl-2,3,6-tetra-O-acetyl-4-0-(2,3,4 ,6-tretra-O-acetyl-~-D-gal actopyrano syl)-a-D-mannopyranosyl phosphate triethylammonium salt (52). A mixture of H-phosphonate 47 (296 mg, 0.37 mmol) and [14C] stearyl alcohol (51,100 mg, 0.37 mmol) was dried by evaporation of pyridine (2 x 3 ml). The residue was dissolved in anhydrous pyridine (5 ml), adamantane carbonyl chloride (160 mg, 0.8 mmol) was added, and the mixture was stirred at rt for 1 h whereafter a freshly prepared solution of iodine (160 mg, 0.63 mmol) in 95% aqueous pyridine (5 ml) was added. After 30 min CH2Cb was added and the solution was washed successively with cold 1 M Na2S203 (2 x 10 ml) and cold 1 M TEA hydrogen carbonate (2 x 10 ml), dried over Na2S04 and concentrated. The residue was purified by silica column chromatography (2.5% CH30H in CH2CI2 with 1 % Et3N) to afford 52. [14C]-Stearyl-4-~-D-galactopyranosyl-a-D-mannopyranosyI phosphate triethyl ammonium salt (53). To a solution of compound 4 (75 mg, 0.07 mmol) in anhydrous CH30H (12.5 ml) was added anhydrous sodium carbonate (80 mg, 0.75 mmol). The mixture was stirred at rt for 2 h, whereafter sodium carbonate was removed by filtration. The solvent was evaporated and residue concentrated to yield 53; R,= 0.55 in 10: 1 0:3 CH30H:CH2CI2:O.25% KC!.
-
[14C]-Stearyl alcohol (51). Stearic acid (50,100 mg) in anhydrous THF (1 mL) was diluted with C4C] stearic acid (1.2 mL, 120 !lCi). To this was added THF-borane complex (4 mL). The mixture was refluxed at 90°C for 36 h. The contents were then poured onto CH3COOH:H20 (8 mL, 1:1), taken in a separating funnel. The mixture
-
Synthesis of [14C] labeled Stearyl linked Gal 1,4 f3 Man phosphate (Scheme 12 of Results and Discussion)
-
5.2 (m, 3H, H-1, 4, 3), 5.28 (dd, J = 2.1 and 3.6 Hz, 1 H, H-2), 7.95 (d, JHP=637 Hz, 1 H); 31 P NMR f> 0.129; ESMS (mlz) 699.27 (M-Et3N-H)" Stearyl-2,3,6-tetra-O-acetyl-4-0-(2,3,4,6-tetra-O-acetyl-~-D-galactopyranosyl)-aD-mannopyranosyl phosphate triethylammonium salt (48). A mixture of H-phosphonate 47 (25 mg, 0.031 mmol) and stearyl alcohol (11 mg, 0.04 mmol) was dried by evaporation of pyridine (2 x 0.5 mL). The residue was dissolved in anhydrous pyridine (1 mL), adamantane carbonyl chloride (16 mg, 0.08 mmol) was added, and the mixture was stirred at rt for 1 h whereafter a freshly prepared solution of iodine (16 mg, 0.063 mmol) in 95% aqueous pyridine (3 mL) was added. After 30 min CH2CI2 was added and the solution was washed successively with cold 1 M Na2S203 (2 x 5 mL) and cold 1 M TEA hydrogen carbonate (2 x 5 mL), dried over Na2S04 and concentrated .The residue was purified by silica column chromatography (2.5% CH30H in CH2CI2 with 1 % Et3N) to afford 48; Rt = 0.46 in 20% CH30H in CH2CI2; 1H NMR: 8 0.84 (t, 3H, CH3), 1.23-1.45 (lipid protons), 1.85-2.12 (m, 21 H, OAc), 3.84-4.16 (m), 4.51 (d, J = 7.8 Hz, 1H, H-1'), 4.85-5.01 (m, 2H, H-2', 3'), 5.25 (m, 3H, H-1, 4, 3), 5.52 (dd, J = 2.1 and 3.6 Hz, 1 H, H-2), 5.69 (dd, 1 H, JHP = 6.8 and J1,2 =1.9 Hz, H-1); 13C NMR: 8 13.99, 20.48-20.77, 22.56, 27.8-29.59, 31.80, 36.44, 38.78, 52.82, 60.69, 68.99, 69.48, 70.23, 70.91, 76.52, 93.26, 100.93, 168.99-170.42; 31p NMR: 8 -2.90; ESMS (mlz): 967 (M-Et3N-H)' Stearyl-4-~-D-galactopyranosyl-a-D-mannopyranosylphosphate triethylammo nium salt (49). To a solution of compound 48 (15 mg, 0.014 mmol) in anhydrous CH30H (2.5 mL) was added anhydrous sodium carbonate (16 mg, 0.15 mmol). The mixture was stirred at rt for 2 h, whereafter sodium carbonate was removed by filtration. The solvent was evaporated and residue concentrated to yield 49 in quantitative yield; Rt= 0.55 in 10:10:3 CH30H:CH2CI2:O.25% KCI; 31p NMR.8 -1.72; ESMS (mlz): 673 (M-Et3N-H)'
-
1 ,2,3,6-Tetra-O-acetyl-4-0-(2,3,4,6-tetra-O-acetyl-~-D-galactopyranosyl)-a.-Dmannopyranose (46). Acetic anhydride (4 ml) was added dropwise to a stirring solution of Gal (1-4)~ Man (45, 700 mg, 2.04 mmol) in anhydrous pyridine (6 ml) at 0 °C. The reaction mixture was gradually brought to room temperature and stirred for 16 h. After completion of the reaction, the mixture was poured over ice and the product crystallized out to afford 46 in quantitative yield. Triethylammonium 2,3,6-tri-O-acetyl-4-0-[2,3,4,6-tetra-O-acetyl-~-D-galacto pyranosyl]-a.-D-mannopyranosyl hydrogen phosphonate (47). Compound 46 (600 mg, 0.89 mmol) was dissolved in anhydrous CH3CN saturated with dimethylamine (40 mL) at -20°C and stirred for 3 h after which TLC confirmed disappearance of the starting material. Excess of dimethylamine was removed under reduced pressure at 30°C and the reaction mixture was concentrated to provide 2,3,6-tri-O-acetyl-4-0-(2,3,4,6-tetra-O-acetyl-~-D-galactopyranosyl)-a.-D-mannopyra nose. To a stirred solution of imidazole (1 g, 14.68 mmol) in anhydrous CH3CN (20 mL) at 0 °C was added phosphorus trichloride (0.8 ml, 9.14 mmol) and triethylamine (2.4 mL, 0.86 mmol). The mixture was stirred for 20 min, after which a solution of the above anomeric deprotected compound (500 mg, 0.786 mmol) in anhydrous CH3CN (20 mL) was added dropwise. The mixture was stirred at 0 °C for 2 h and quenched with 1 M triethylammonium (TEA) hydrogen carbonate solution (pH=7.2, 10 mL). The clear solution was stirred for 15 min. CH2CI2 was added and the organic layer was washed with ice cold water (2 x 10 ml) and cold 1 M TEA hydrogen carbonate solution (2 x 10 ml), dried over Na2S04 and concentrated to yield 47 (500 mg, 86.2%); Rt = 0.35 in 20% CH30H in CH2CI2; 1H NMR: 8 1.9-2.08 (m, 21 H, 7 x OAc), 3.84-4.13 (m, 6H, H-5, 5', 6, 6'), 4.35 (d, J = 4.5 Hz, 1 H, H-4), 4.47 (d, J = 7.8 Hz, 1 H, H-1 '), 4.9 (dd, J =3.3 and 7.8 Hz, 1 H, H-3'), 5.05 (dd, J = 2.1 and 7.8 Hz, 1 H, H-2'),
-
Synthesis of Stearyl linked Gal 1,4 ~ Man phosphate (synthetic substrate for elongating-MPT activity)
-
Synthesis of Radiolabeled Exogenous Precursor of Phosphoglycan Biosynthesis
-
Polycondensation. Compound 26 (25 mg, 0.033 mmol) was dried by evaporation of pyridine (500 III x 3) therefrom. The residue was dissolved in 10:1 pyridine:triethylamine (40 Ill), and pivaloyl chloride (9 Ill, 0.073 mmol) was added. Another lot of pivaloyl chloride (6 Ill, 0.04B mmol) was added in 45 min. After 3 h, the mixture became viscous, and a freshly prepared solution of iodine (220 Ill, 35 mg, 0.137 mmol in pyridine-water, 95:5) was added. After 2 h, CHCI3 was added and the organic layer was successively washed with cold 1 M aqueous Na2S203 solution and 1 Mice-cold TEAB buffer, dried over Na2S04 and concentrated to dryness to afford 27. For final deprotection, above residue was dissolved in 0.1 M NaOMe solution in CH30H (440 Ill), 1,4-dioxane (BOO Ill), and CHCI3 (BOO Ill). The mixture was stirred at rt for 7 h and left at 4 °C for 16 h, then diluted with CH30H, deionized with Dowex 50W-X4 (H+) resin, filtered and immediately neutralized with drops of triethylamine. The mixture was concentrated to dryness to afford fully deprotected phosphoglycans (28). 31 P (D~O): 8 -1.73, O.BB. Preliminary CD analysis of Phosphoglycans. The above polycondensation product (28) was lyophilized repeatedly and then redissolved in H20 (400 Jll). This solution was taken in a glass cuvette (300 Ill, 1 mm pathlength). It's CD spectra was recorded on a spectropolarimeter (JASCO, J-710) between 175-250 nm at 25°C. For reference, the CD spectra of agarose (15% W/V)87 was also recorded under the same conditions as mentioned above.
-
Triethylammonium 2,3,6-tri-o.acetyl-4-o.(2,3,4-tri-o.acetyl-~-D-galactopyrana syl)-a-D-manno pyranosyl hydrogen phosphonate (26). Compound 6 (30 mg, 0.034 mmol) was dissolved in a mixture of acetic acid-water-THF (3:1:1,2.5 ml). The mixture was stirred at 40°C for 9 h, after which the solvent was evaporated off under vacuo at rt. To remove excess of acid, water (1 ml) was added and evaporated off twice to afford 26 in quantitative yield; 1H NMR (CDCI3, 300 MHz) 0 1.95-2.09 (m, 21 H), 3.49-3.68 (m, 4H), 3.88 (m, 1 H), 4.14 (m, 1 H), 4.36 (d, J = 4.5 Hz, 1 H), 4.47 (d, J = 7.8 Hz, 1 H), 4.95 (dd, J = 3_3 and 7_8 Hz, 1 H), 5.05 (dd, J = 2_1 and 7.8 Hz, 1 H), 5.21 (dd, J = 2.1 and 3.6 Hz, 1 H), 5.41 (d, J = 3.3 Hz, 1 H), 5.48 (dd, J = 2.1 and 7.8 Hz, 1 H), 7.99 ( d, JH,p = 637_0 Hz, 1 H); 13C NMR (CDCI3, 75 MHz) 0 20.48-20.76, 60.10, 62.42, 66.57, 69.36, 69.53, 69.69, 71.20, 73.30, 73.86, 91.59, 92.54, 101_09, 169.13-170.49; 31p (CDCI3): 00.22; ESMS mlz657.3 (M-EhN-Hr.
-
Synthesis of phosphoglycans by polycondensation
-
Selective cleavage of phosphoglycans from the resin. This was accomplished by taking the PG loaded resin (3 mg) and Wilkinson's catalyst (1 mg) in argon-purged solvent mixture (300 Ill, toluene-PrOH-H20, 2:1 :0.08 containing 0.01 N HCI) and shaking it for 7 h at rt. The cleavage after first cycle of coupling provided 2,3,6-tri-0-acetyl-4-0-[2,3,4-tri-O-acetyl-6-0-(t-butyldimethylsilyl)-~-D-galacto pyranosyl]-a-D-mannopyranosyl-phosphate. This intermediate was subjected to full deprotection to provide ~-D-galactopyranosyl-a-D-mannopyranosyl phosphate (25) and compared with authentic sample earlier reported86 by our laboratory; [a]D = +10° (c 0.1, H20); lH NMR (D20, assignments by 2D COSY and TOCSY experiments) 0 3.45 (dd, J = 6.67 and 1.5 Hz, 1 H, H-2'), 3.46 (m, 1 H, H-5), 3.60 (m, 1 H, H-5'), 3.53-3.56 (m, 2H, H-2,3'), 3.68 (m, 2H, H-6), 3.76 (t, J = 7.11 and 2.64 Hz, 1 H, H-3), 3.83 (m, 2H, H-6'), 3.83 (m, 1 H, H-4'), 3.94 (m, 1 H, H-2), 4.38 (d, J = 9.65 Hz, 1 H, H-4), 4.38 (d, J = 7.6 Hz, 1 H, H-1'), 5.27 (dd, J1H-P = 6.8 Hz and J1•2 = 1.9 Hz, 1 H, H-1); 31p NMR 0 -2.07; ESMS, 421.2 [M-1 Ht; HRMS (ESMS): calcd for [M-Hr C12H22014P 421.2720 found 421.2718. Similar procedure was used to cleave phosphotetrasaccharide 22 from resin followed by complete deprotection, which provided compound 23 that was characterized by its comparison with standard prepared by solution method.
-
opyranosyl phosphate] triethylammonium salt (22). The butenediol-linker functionalized Merrifield resin (19, 50 mg, 0.43 mmol/g, 0.021 mmol) was swollen in anhydrous pyridine (100 Ill) for 15 min, followed by addition of phosphoglycan H-phosphonate donor 6 (26 mg, 0.03 mmol) dissolved in anhydrous pyridine (500 Ill). Now pivaloyl chloride (20 Ill) was added and the resin mixture was shaken for 2 h. Thereafter a 200 III solution of iodine (4 mg) in 95% aqueous pyridine was added and stirring continued for another hour. The resin was then thoroughly washed with CH30H (700 III x 3) and dried over P20S overnight to afford acceptor-functionalized resin (20, 50 mg). ~ The coupled intermediate was characterized by positive ion ESMS after cleaving it off from the resin (2 mg) by treatment with 0.1 N HCI (100 Ill) at 100°C for 1 min. The product that got cleaved under this condition was characterized as 2,3,6-tri-0-acetyl-4-0-[2,3,4-tri-O-acetyl-6-0-(t-butyldimethylsilyl)-~-D-galactopyranosyl-a-Dmannopyranose which was identical to compound 5, already synthesized by solution method described earlier; ESMS m/z 731.3 (M+Nat. This compound on full deprotection with 48% aqueous HF-CH3CN (5:95) and CH30H-H20-EhN (5:2:1) provided disaccharide Gal1 ,4~Man (24); lH NMR 8 5.12 (d, J = 1.67 Hz, 1 H, H-1 a), 4.85 (d, 1 H, J = 0.98 Hz, 1 H, H-1 ~), 4.40-4.36 (m, 2H, H-1' and H-4), 3.75 (dd, 1 H, H-2'),3.94-3.92 (m, 2H, H-4' and H-2), 3.89-3.83 (m, 2H, H-6'), 3.81-3.79 (dd, 1H, J= 6 and 2 Hz, 1 H, H-3), 3.75-3.71 (m, 2H, H-6), 3.63-3.59 (dd, 1 H, H-3'), 3.51-3.46 (m, 2H, H-5, H-5'); ESMS: m/z 341.0 [M-Hr. To a part of the PG loaded resin 20 (15 mg), 48% aqueous HF-CH3CN (5:95,500 Ill) was added at 0 °C and the mixture was stirred on a orbital shaker for 3 h. The resin was then washed with CH30H (500 III x 2) and dried under vacuum to afford acceptor bound resin (21) with free 6' hydroxyl groups. This intermediate was again characterized by ESMS after cleaving it off from a small part of the resin (2 mg) by treatment with 0.1 N HCI (100 Ill) at 100°C for 1 min. The product that got cleaved under this condition was characterized as 2,3,6-tri-O-acetyl-4-0-(2,3,4-tri-O-acetyl-~D-galactopyranosyl)-a-D-mannopyranose. Authenticity of this compound was confirmed by its comparison (TlC, NMR, ESMS) with standard separately prepared via solution synthesis by deprotection (HF-CH3CN) of TBDMS group from compound 5 (Scheme-1). A second cycle of PG coupling was carried out with identical procedure given above to afford phosphotetrasaccharide (22).
-
and water (150 mL). The organic layer was dried (Na2S04) and concentrated. The crude product was purified by silica column chromatography (20% ethyl acetate in hexane with 1% EhN) to afford 17 (4.2 g, 80%); Rf = 0.3 in 50% ethyl acetate in hexane; 1H NMR (CDCI3, 300 MHz): <52.03 (s, 1 H), 3.68 (d, J = 4.8 Hz, 2H), 3.78 (s, 6H), 4.03 (d, J = 5.4 Hz, 2H), 5.73-5.75 (m, 2H), 6.82 (tt, J = 1.2 and 9.0 Hz, 4H), 7.25-7.44 (m, 9H); 13C NMR (CDCb, 75 MHz): 55.12, 55.13, 58.75, 59.93, 113.05, 126.68,127.76,127.99,128.95,129.87,130.92, 136.07,144.79,158.37; ESMS m/z 413.39 (M+Nat Preparation of functionalized resin by coupling of linker (19). 4-(4,4'-Dimethoxytrityl)-2-cis-butenol (17, 1 g, 2.56 mmol) was dissolved in anhydrous DMF (8 mL). Upon cooling to 0 °C, sodium hydride (60% dispersion in mineral oil, 150 mg, 3.75 mmol) was added and the solution was stirred for 1 h. Merrifield's resin (18, 650 mg, chloromethylated polystyrene cross-linked with 1 % divinylbenzene, Fluka-63865) was added along with tetra-butylammonium iodide (95 mg, 0.256 mmol) and shaking was continued for an additional hour at 0 °C after which the reaction mixture was brought to rt and shaken for another 12 h. The capping of unreacted sites on resin was accomplished by addition of CH30H (100 ilL) and sodium hydride (100 mg) and shaking the contents for another 4 h, after which more CH30H (5 mL) was added and the resin was washed sequentially with 1:1 CH30H: DMF (10 mL), THF (10 mL x 3) and CH2CI2 (10 mL x 3). The resin was dried over P20s under vacuum to afford 836 mg of the linker-attached resin (19). To quantify loading8S of linker onto the solid support, a stock solution of 3% TFA in CH2CI2 (10 ml) was prepared which contained effectively 0.167 mg of the protected resin. The resulting orange colour liberated by the release of dimethoxytrityl (DMTr) cation was measured by UV at 503 nm, and the loading of the linker onto the resin was calculated to be 0.43 mmol/g of resin. The deprotection of the entire DMTr-linker functionalized resin was then carried out by treating the resin with 1 % TFA in CH2CI2 (10 mL). Further washing with CH2CI2 (20 mL x 3), 1% EhN in CH2CI2 (10 mL) and CH2CI2 (10 mL) and drying under vacuum afforded 640 mg of deprotected resin ready for coupling with phosphoglycan donors. Solid Phase Synthesis of 2,3,4-Tri-O-acetyl-~-D-galactopyranosyl-(1 ~4)-2,3,6-tri-O-acetyl-a.-D-mannopyranosyl phosphate 6-[2,3,4-tri-O-acetyl-6-0-(t-butyldi methylsi lyl)-~-D-galactopyranosyl-(1 ~4 )-1 ,2,3,6-tetra-O-acetyl-a.-D-mann
-
Synthesis of SOlid-phase linker, 4-(4,4'-Dimethoxytrityl)-cis-2-butenol (17). To a solution of cis-butene-1,4-diol (16, 4.7 mL, 5 g, 56.7 mmol) in anhydrous pyridine (100 mL) at 0 °C was added 4,4'-dimethoxytrityl chloride (6.4 g, 18.9 mmol). The reaction mixture was gradually brought to rt over 3 h and stirred for additional 12 h. Ethyl acetate (200 mL) was added and the organic phase was washed with water (150 mL), saturated aqueous NaHC03 (200 mL), saturated aqueous NaCI (200 mL)
-
Solid phase phosphoglycan synthesis
-
(250 ~L) was added dropwise. The mixture was stirred at 0 °C for 2 h and quenched with 1 M TEAS solution (pH=7, 1 mL). The clear solution was stirred for 15 min. after which CH2CI2 was added and the organic layer was washed with ice cold water (1 mL x 2), cold 1 M TEAS buffer (1 mL x 2), dried over Na2S04, and concentrated to yield compound 13 (5.1 mg, 86%); ESMS m/z 1'427.9 (M-Et3N-H): 2,3,4-Tri-O-acetyl-~-D-galactopyranosyl-(1 ~4 )-1 ,2,3,6-tetra-O-acetyl-a-D-manno pyranoside 6-{2,3,4-tri-O-acetyl-6-0-(t-butyldimethylsilyl)-~-D-galactopyranosyl -(1~4)-2,3,6-tri-O-acetyl-a-D-mannopyranosyl phosphate 6-[2,3,4-tri-O-acetyl-~D-galactopyranosyl-(1~4)-2,3,6-tri-O-acetyl-a-D-mannopyranosyl phosphate] } bistriethylammonium salt (14). Mixture of compounds 13 (5.1 mg, 0.003 mmol) and 6 (5 mg, 0.007 mmol) was dried by evaporation of pyridine (500 ~L x 2). The residue was dissolved in anhydrous pyridine (200 ~L) and pivaloyl chloride (2.4 ~L, 0.02 mmol) was added. The mixture was stirred at rt for 1 h and a freshly prepared iodine solution (200 ~L, 4 mg, 0.015 mmol in pyridine-water, 95:5) was added. After 30 min CH2CI2 was added and the solution was washed successively with cold 1 M aqueous Na2S203 solution (2 mL x 2), ice-cold 1 M TEAS buffer (2 mL x 2), dried over Na2S04 and concentrated to afford 14 (4.5 mg, 61%); Rf = 0.11 in 10% CH30H in CH2CI2; ESMS m/z2061.44 (M-2EhN-H), 2062.35 (M-2EhN). ~-D-Galactopyranosyl-(1~4)-a-D-mannopyranoside {6-~-D-galactopyranosyl(1~4)-a-D-mannopyranosyl phosphate 6-[ ~-D-galactopyranosyl-(1~4)-a-Dmannopyranosyl phosphate]} bis-triethylammonium salt (15). The global deprotection of fully protected phosphohexasaccharide 14 was carried out by same method as given for preparation of compound 9, and this compound was identical to PG oligomer 12 prepared by upstream extension described earlier.
-
(19 x OCOCH3), 3.50 (m, 6H, H2-6 Gal/Gal'/Gal"), 3.87-3.94 (m, 3H, H-5, Gal/Gal'/Gal"), 4.14-4.07 (m, 3H, 5-H, Man/Man'/Man"), 4.30-4.35 (m, 3H, 4-H, Man/Man'/Man"), 4.39 (m, 6H, H2-6, Man/Man'/Man"), 4.48 (m, 2H, 3-H, Man'/Man"), 4.52 (m, 1 H, 3-H, Man), 4.94 (d, J = 7.7 Hz, 3H, H-1, Gal/Gal'/Gal"), 5.28 (m, 6H, 2-H Man, H-4 Gal/Gal'/Gal", H-3 Gal'/Gal"), 5.29 (m, 1 H, H-3, Gal), 5.43 (m, 2H, H-2 Gal'/Gal"), 5.45 (dd, JHH = 1.9 and JHP = 7.0 Hz, 2H, H-1, Man'/Man"), 5.46 (m, 3H, H-2, Gal/Gal'/Gal"), 6.01 (d, J = 1.9 Hz, 1 H, 1-H, Man); 31p_NMR: 8 -1.94; ESMS m/z2061.44 (M-2Et3N-H), 2062.35 (M-2Et3N). ~-D-Galactopyranosyl-(1 ~4)-a-D-mannopyranoside {S-~-D-galactopyranosyl(1~4)-a-D-ma nnopyranosyl phosphate S-[ ~-D-galactopyranosyl-(1~4)-a-Dmannopyranosyl phosphate]) bis-triethylammonium salt (12). The global deprotection of fully protected phosphohexasaccharide 11 was carried out by same method as given for preparation of compound 9 earlier; 1 H-NMR (020), due to Oligomeric nature of the molecule (three identical PG repeats), all NMR peaks could not be assigned,: 3.45 (m, 3H, H-2, Gal/Gal'/Gal"), 3.46 (m, 2H, H-5, Man'/Man"), 3.55 (m, 1 H, H-5, Man), 3.56-3.53 (m, 3H, H-3, Gal/Gal'/Gal"), 3.60 (m, 3H, H-5, Gal/Gal'/Gal"), 3.68 (m, 6H, H2-6, Man/Man'/Man"), 3.76 (m, 3H, H-3, Man/Man'/Man"), 3.80 (m, 6H, H2-6, Gal/Gal'/Gal"), 3.83 (m, 3H, H-4, GaVGal'/Gal"), 3.85 (m, 1 H, H-2, Man), 3.94 (m, 2H, H-2, Man'/Man"), 4.32 (m, 1 H, H-4, Man), 4.37 (d, J= 7.6 Hz, 2H, H-1, Gal'/Gal"), 4.35 (d, J= 7.6, 1H, H-1, Gal), 5.09 (d, J= 1.8, 1 H, H-1, Man), 5.36 (dd, JHH = 1.9 and JHP = 6.8 Hz, 2H, H-1, Man'/Man"); 31p_NMR: -1.29; ESMS: m/z 574.12 ([M-2Et3N-2Hf 2,3,4-Tri-O-acetyl-~-D-galactopyranosyl-(1 ~4 )-1 ,2,3,S-tetra-O-acetyl-a-D-manno pyranoside S-[2,3,4-tri-O-acetyl-S-0-(t-butyldimethylsilyl)-~-D-galactopyrano syl-(1 ~4 )-2,3,S-tri-O-acetyl-a-D-mannopyranosyl-H-phosphonate] triethylamm onium salt (13). Compound 8 (5 mg, 0.003 mmol) was dissolved in saturated solution of Me2NH in anhydrous CH3CN (2 mL) at -20°C and the solution was stirred for 3 h during which TLC confirmed disappearance of the starting material. Excess of Me2NH was removed und
-
= 1.9 and JHP = 6.8 Hz, 2H, H-1, Man'/Man"); 31p_NMR: -1.29; ESMS: m/z 574.12 ([M-2Et3N-2Hf 2,3,4-Tri-O-acetyl-~-D-galactopyranosyl-(1 ~4 )-1 ,2,3,S-tetra-O-acetyl-a-D-manno pyranoside S-[2,3,4-tri-O-acetyl-S-0-(t-butyldimethylsilyl)-~-D-galactopyrano syl-(1 ~4 )-2,3,S-tri-O-acetyl-a-D-mannopyranosyl-H-phosphonate] triethylamm onium salt (13). Compound 8 (5 mg, 0.003 mmol) was dissolved in saturated solution of Me2NH in anhydrous CH3CN (2 mL) at -20°C and the solution was stirred for 3 h during which TLC confirmed disappearance of the starting material. Excess of Me2NH was removed under reduced pressure below 30°C and the reaction mixture was concentrated to give the anomeric deprotected product in quantitative yield. To a stirred solution of imidazole (6 mg, 0.87 mmol) in anhydrous CH3CN (250 J!L) at 0 °C was added PCI3 (10 J!L, 0.112 mmol) and EhN (30 J!L, 0.215 mmol). The mixture was stirred for 20 min, after which a solution of the above compound in anhydrous CH3CN
-
Man), 61.37 (C-6, Man'), 62.30 (C-6, Gal'), 65.53 (C-6, d, Jcp = 5.5 Hz, Gal), 69.28 (C-4, Gal), 69.83 (C-4, Gal' and C-3, Man'), 70.84 (C-3, Man and C-2, Man), 71.08 (C-2, d, Jcp = 7.4 Hz, Man'), 72.13 (C-2, Gal' and C-2, Gal), 72.34 (C-5, Man), 73.69 (C-3, Gal', C-3, Gal and C-5, Man'), 74.89 (C-5, d, JcP = 7.5 Hz, Gal), 76.52 (C-5, Gal'), 77.05 (C-4, Man'), 78.14 (C-4, Man), 97.03 (C-1, d, Jcp = 5.5 Hz, Man'), 100.76 (C-1, Man), 104.20 (C-1, Gal'), 104.42 (C-1, Gal); 31p-NMR: -1.29; ESMS m/z 745.38 (M-Et3N-H)"; HRMS (ESMS): calcd for (M-Et3N-H)" C24H42024P 745.1804, found 745.1830. 2,3,4-Tri-O-acetyl-(3-D-galactopyranosyl-(1 ~4)-1 ,2,3,6-tetra-O-acetyl-a-D-mann opyranoside 6-(2,3,4-tri-O-acetyl-(3-D-galactopyranosyl-(1~4)-2,3,6-tri-O-acetyla-D-mannopyranosylphosphate ) triethylammonium salt (10). A solution of 48% aqueous HF in CH3CN (5:95, 5 ml) was added to compound 8 (20 mg, 0.015 mmol) at 0 DC and stirred at 0 DC for 2 h. The reaction was quenched by the addition of the aqueous NaHC03 solution until effervescence ceased and diluted with CH2CI2 (5 ml). The organic layer was washed with water, dried over Na2S04 and concentrated to give compound 10 (15.6 mg, 85%); ESMS m/z 1290.4 (M-EhN-H)" 2,3,4-Tri-O-acetyl-(3-D-galactopyranosyl-(1 ~4 )-1 ,2,3,6-tetra-O-acetyl-a-D-manno pyranoside 6-{2,3,4-tri-O-acetyl-6-0-(t-butyldimethylsilyl)-(3-D-galactopyrano syl-(1~4)-2,3,6-tri-O-acetyl-a-D-mannopyranosyl phosphate 6-[2,3,4-tri-O-acetyl -(3-D-galactopyranosyl-(1 ~4)-2,3,6-tri-O-acetyl-a-D-mannopyranosyl phosphate ]) bis-triethylammonium salt (11). Mixture of phosphotetrasaccharide acceptor 10 (15.6 mg, 0.015 mmol) and H-phosphonate donor 6 (20.8 mg, 0.024 mmol) was dried by evaporation of pyridine (500 III x 3). The residue was dissolved in anhydrous pyridine (500 Ill), and pivaloyl chloride (10 Ill, 0.083 mmol) was added. The mixture was stirred for 1 h at rt after which a freshly prepared solution of iodine (500 Ill, 16 mg, 0.06 mmol in pyridine-water, 95:5) was added. After 30 min, CH2CI2 was added and the solution was washed successively with cold 1 M aq Na2S203 solution (5 ml x 2) and ice-cold 1 M TEAS buffer (5 ml x 2), dried over Na2S04 and concentrated. The silica column purification using 5% CH30H in CH2CI2 with 1 % EhN afforded compound 11 (16 mg, 63%); R, = 0.11 in 10% CH30H in CH2Cb; lH-NMR (CDCI3); assignments by 1 H_l H COSY and HMQC experiments. Due to repeating nature (three repeats of phosphoglycan) of the molecule, all NMR peaks could not be assigned:1H NMR 0 0.01 (s, 6H, OSiM~CMe3), 0.84 (s, 9H, OSiMe2CMe3), 2.15-1.96
-
2.15 (13 x OCOCH3), 3.50 (m, 4H, H2-6 Gal and Gal'), 3.87 (m, 1 H, H-5, Gal'), 3.94 (m, 1H, H-5, Gal), 4.07-4.10 (m, 1H, H-5, Man'), 4.07-4.14 (m, 1H, H-5, Man), 4.35 (m, 1 H, H-4, Man'), 4.39 (m, 4H, 4-H, H2-6, Man and H2-6, Man'), 4.40 (m, 1 H, H-4, Man), 4.48 (m, 1 H, H-3, Man'), 4.52 (m, 1 H, H-3, Man), 4.94 (d, J = 7.7 Hz, 2H, H-1 ,Gal and H-1, Gal'), 5.28 (m, 4H, H-2 Man, H-4 Gal, H-3 Gal' and H-4 Gal'), 5.29 (m, 1 H, H-3, Gal), 5.43 (m, 1 H, H-2 Gal'), 5.45 (dd, JHH= 1.9 and JHP = 7.0 Hz, 1 H, H-1, Man'), 5.46 (m, 1 H, H-2, Gal), 6.01 (d, J = 2.7 Hz, 1 H, H-1, Man); 13C NMR: 0 -5.75, 17.95 and 25.57 (for TBOMS group), 20.48-20.79 (CH~02 x 13), 60.06 (C-6, Gal'), 60.42 (d, Jcp = 8 Hz, C-6, Gal), 62.22 (C-6, Man), 62.63 (C-6, Man'), 66.55 (d, C-2, Man'), 67.46 (d, C-5, Gal), 68.27 (C-4, Gal), 68.64 (C-4, Gal'), 69.37 (C-3, Man'), 69.66 (C-5, Man), 69.84 (C-3, Man), 70.14 (C-5, Man'), 70.75 (C-2, Gal'), 70.88 (C-2, Gal), 71.20 (C-2, Man), 73.31 (C-3, Gal'), 73.76 (C-3, Gal), 74.24 (C-4, Man'), 77.15 (C-4, Man), 78.95 (C-5, Gal'), 90.41 (d, C-1, Man'), 91.69 (C-1, Gal), 101.08 (C-1, Man), 101.29 (C-1, Gal'), 168-171 (CH3CO x 13); 31p_NMR: 0 -2.90 (dt, JPH 7.5 and 10); ESMS m/z 1405.2 (M-EhN-Hf; HRMS (ESMS): calcd for (M-Et3N-Hf C56H82037PSi 1405.4042, found 1405.4105. J3-D-Galactopyranosyl-(1 ~4)-a-D-mannopyranoside 6-[J3-D-galactopyranosyl-(1~)-a-D-mannopyranosyl phosphate] triethylammonium salt (9). A solution of 48% aqueous HF in CH3CN (5:95, 1.5 ml) was added to compound 8 (15 mg, 0.01 mmol) at 0 °C. The solution was stirred at 0 °C for 2 h. The reaction was quenched by the addition of aqueous NaHC03 solution until effervescence ceased, and diluted with CH2CI2 (5 ml). The organic layer was washed with water, dried over Na2S04 and concentrated. The residue was dissolved in anhydrous CH30H (500 Ill) and NaOMe (15 mg) was added, the solution was stirred overnight at rt, deionized with AG-X8 resin (H+), filtered and immediately neutralized with Et3N. After concentration, water (500 III x 3) was evaporated off from the residue to afford tetrasaccharide phosphodiester 9 (7.9 mg, 94%); [a]o = 34° (c 0.15, H20); lH-NMR (020), lH_1H_ COSY assignments: 3.45 (m, 2H, H-2, GaVGal'), 3.46 (m, 1 H, H-5, Man'), 3.55 (m, 1 H, H-5, Man), 3.56-3.53 (m, 2H, H-3, Gal/Gal'), 3.60 (m, 2H, H-5, Gal/Gal'), 3.68 (m, 4H, H2-6, Man/Man'), 3.76 (m, 2H, H-3, Man/Man'), 3.80 (m, 4H, H2-6, Gal/Gal'), 3.83 (m, 2H, H-4, GaVGal'), 3.85 (m, 1 H, H-2, Man), 3.94 (m, 1 H, H-2, Man'), 4.32 (m, 1 H, H-4, Man), 4.37 (d, J = 7.6 Hz, 1 H, H-1, Gal'), 4.35 (d, J = 7.6 Hz, 1 H, H-1, Gal), 5.09 (d, J = 1.8 Hz, 1 H, H-1, Man), 5.36 (dd, JHH = 1.9 Hz and JHP = 6.8 Hz, 1 H, H-1, Man'); 13C-NMR, assignment made by 20 lH_13C HETCOR experiment, 61.37 (C-6,
-
66.57 (C-4'), 69.36 (C-3), 69.53 (C-5), 69.69 (C-2'), 71.20 (C-2). 73.30 (C-3'), 73.86 (C-5'), 91.59 (C-4), 92.54 (C-1), 101.09 (C-1'), 169.13-170.49 (COMe); 31p NMR: 8= 0.13; ESMS m/z 771.26 (M-Et3N-Hr; HRMS (ESMS): calcd for (M-EbN-Hr C30H48019PSi 771.2297, found 771.2276. 1 ,2,3,6-Tetra-O-acetyl-4-0-(2,3,4-tri-O-acetyl-j3-D-galactopyranosyl)-a-D-manno pyranose (7). A solution of 48% aqueous HF in CH3CN (5:95, 8 ml) was added to compound 4 (100 mg, 0.132 mmol) at 0 °C and the solution was stirred for 2 h. The reaction was quenched with aqueous NaHC03 solution until effervescence ceased, and diluted with CH2CI2. The organic layer was washed thoroughly with water, dried over Na2S04 and concentrated to give 7 (72 mg, 85.7%); Rt = 0.3 in 70% ethyl acetate in hexane; [a]o = +4.6° (c 0.3, CHCI3); 1H NMR (CDCI3, 300 MHz) 81.97-2.16 (m, 21 H, 7 x OAc), 3.67-3.74 (m, 3H, H-5',6), 4.08-4.14 (m, 3H, H-5,6'), 4.58 (d, J = 7.8 Hz, 1H, H-1'), 5.16 (dd, J = 2.1 and 7.8 Hz, 1H, H-2'), 5.23 (dd, J = 2.1 and 3.6 Hz, 1 H, H-2), 5.32 (d, J = 3.3 Hz, 1 H, H-4), 5.41 (dd, J = 3.6 and 4.5 Hz, 1 H, H-3), 6.01 (d, J = 2.1 Hz, 1 H, H-1); 13C NMR (CDCI3, 75 MHz) 8 20.42-20.77 (7 x COMe), 60.74 (C-6'), 62.25 (C-6), 67.56 (C-4'), 68.31 (C-3), 69.35 (C-5), 69.43 (C-2'), 70.77 (C-2), 70.83 (C-3'), 73.98 (C-5'), 74.32 (C-4), 90.45 (C-1), 101.30 (C-1'), 168.32-170.80 (7 x COMe),; ESMS m/z659.28 (M+Nar; HRMS (ESMS): calcd for (M+NH4r C26H40N018 654.2245, found 654.2272. 2,3,4-Tri-O-acetyl-j3-D-galactopyranosyl-(1-?4)-1 ,2,3,6-tetra-O-acetyl-a-D-manno pyranoside 6-[2,3,4-tri-O-acetyl-6-0-(t-butyldimethylsilyl)-j3-D-galactopyranosyl -(1 ~4)-1 ,2,3,6-tetra-O-acetyl-a-D-mannopyranosyl phosphate] triethyl ammonium salt (8). Mixture of H-phosphonate donor 6 (32 mg, 0.036 mmol) and acceptor 7 (23 mg, 0.036 mmol) was dried by evaporation of pyridine (500 III x 3). The residue was dissolved in anhydrous pyridine (600 Ill) and pivaloyl chloride (15 Ill, 0.123 mmol) was added. The reaction mixture was stirred for 1 h at rt and a freshly prepared iodine solution (600 Ill, 18 mg, 0.078 mmol in pyridine-water, 95:5) was added. After 30 min. CH2CI2 (10 ml) was added and the solution was washed successively with cold 1 M aqueous solution of Na2S203 (5 ml x 2) and ice-cold 1 M TEAS buffer (5 ml x 2), dried over Na2S04 and concentrated. Column chromatography on silica gel (3% CH30H in CH2CI2 with 1 % EbN) afforded product 8 (40 mg, 73.8%); Rt= 0.21 in 10% CH30H in CH2CI2; [a]o = -6.1° (c 0.18, CHCI3); 1H_ NMR (CDCI3, 300 MHz); assignments confirmed by 1H_1H COSY and HMQC experiments: 1 H NMR 8 0.01 (5, 6H, OSiM9:2CMe3), 0.84 (s, 9H, OSiMe2CMe3). 1.96-
-
2,3,6-Tri-O-acetyl-4-0-[2,3,4-tri-O-acetyl-6-0-(t-butyldimethylsilyl)-(3-D-galactop yranosyl]-a-D-mannopyranose (5). Compound 4 (100 mg, 0.132 mmol) was dissolved in saturated Me2NH solution in anhydrous CH3CN (20 ml) at -20°C and stirred for 3 h after which TlC confirmed disappearance of the starting material. Excess of Me2NH was removed under reduced pressure below 30°C and the reaction mixture was concentrated to give the desired anomeric deprotected compound 5 in quantitative yield; R, = 0.25 in 70% ethyl acetate in hexane; [a]D = +3.75° (c 0.16, CHCI3); 1H NMR (CDCI3, 300 MHz) 80.01 (s, 6H, M~SiCMe3), 0.84 (s, 9H, Me2SiCMSJ), 1.95-2.19 (m, 18H, 6 x OAc), 3.56-3.66 (m, 4H, H-6,6'), 3.91 (m, 1H, H-5), 4.12-4.16 (m, 2H, H-5', OH), 4.40 (d, J= 4.5 Hz, 1H, H-4), 4.40 (d, J= 7.8 Hz, 1 H, H-1'), 4.99 (dd, J = 3.3 and 7.8 Hz, H-3'), 5.09 (dd, J = 2.1 and 7.8 Hz, 1 H, H-2'), 5.17 (dd, J = 2.1 and 3.6 Hz, 1 H, H-2), 5.23 (dd, J = 3.6 and 4.5 Hz, 1 H, H-3), 5.43 (m, 2H, H-4',1); 13C NMR (CDCI3, 75 MHz) 8 -5.77 (M~SiCMe3), 17.98 , (Me2SiCMe3)" 20.40-21.38 (OAc), 25.58 (Me2SiCMe3), 60.06 (C-6'), 62.62 (C-6), 66.56 (C-4'), 68.78 (C-3), 69.30 (C-5), 69.51 (C-2'), 70.06 (C-2), 71.21 (C-3'), 73.37 (C-5'), 74.15 (C-4), 91.82 (C-1), 101.04 (C-1'), 169.10-170.52 (COMe); ESMS m/z 731.3 (M+Nat. Triethylammonium 2,3,6-tri-O-acetyl-4-0-[2,3,4-tri-O-acetyl-6-0-(t-butyldimethyl silyl)-(3-D-galactopyranosyl]-a-D-mannopyranosyl hydrogen phosphonate (6). To a stirred solution of imidazole (224 mg, 3.28 mmol) in anhydrous CH3CN (5 ml) at o °C was added PCI3 (160 Ill, 1.8 mmol) and EhN (480 Ill, 3.44 mmol). The mixture was stirred for 20 min, after which a solution of compound 5 dissolved in anhydrous CH3CN (5 ml) was added dropwise. The mixture was stirred at 0 °C for 3 hand quenched with 1 M triethylammonium bicarbonate (TEAS) buffer (pH 7, 2 ml). The clear solution was stirred for 15 min, diluted with CH2CI2 (20 ml), and the organic layer was washed with ice cold water (10 ml x 2) and cold 1 M TEAS solution (10 ml x 2) successively, dried over Na2S04 and concentrated to yield phosphoglycan donor 6 (100 mg, 86%); R, = 0.45 in 20% CH30H in CH2CI2; [a]D = -4.5° (c 0.27, CHCb); 1H NMR (CDCI3, 300 MHz) 8 0.01 (s, 6H, M~SiCMe3), 0.82 (s, 9H, M~SiCMSJ), 1.95-2.09 (m, 18H, 6 x OAc), 3.49-3.68 (m, 4H, H-6,6'), 3.88 (m, 1 H, H-5), 4.14 (m, 1 H, H-5'),4.36 (d, J = 4.5 Hz, 1 H, H-4), 4.47 (d, J = 7.8 Hz, 1 H, H-1'), 4.95 (dd, J = 3.3 and 7.8 Hz, 1H, H-3'), 5.05 (dd, J = 2.1 and 7.8 Hz, 1H, H-2'), 5.21 (dd, J = 2.1 and 3.6 Hz, 1 H, H-2), 5.41 (d, J = 3.3 Hz, 1 H, H-4'), 5.48 (dd, J = 1.8 and 8 Hz, 1 H, H-1), 6.92 (d, JH,p= 637.0 Hz, 1H, H-1); 13C NMR (CDCI3, 75 MHz) 8 -5.80, (M~SiCMe3), 17.98 (Me2SiCMe3), 20.48-20.76 (OAc), 25.57 (Me2SiCMSJ), 60.10 (C-6'), 62.42 (C-6),
-
chromatography (8% CH30H in CH2CI2) to provide compound 2 (10.8 g, 79.5%); Rf = 0.47 in 15% CH30H in CH2CI2; [a]o = +3.45° (c 0.29, CH30H); 1H NMR (020, 300 MHz) 00.01 (s, 6H, M~SiCMe3), 0.82 (s, 9H, Me2SiCM~), 3.48 (m, 1 H, H-2'), 3.58 (m, 1 H, H-3'), 3.65 (m, 1 H, H-5), 3.76 (m, 4H, H-6,6'), 3.82 (d, J = 3.1 Hz, 1 H, H-4'), 3.92 (m, 1 H, H-5'), 4.38 (m, 1 H, H-3), 4.31 (d, J = 5.7 Hz, 1 H, H-4), 4.46 (d, J = 7.8 Hz, 1 H, H-1'), 4.76 (dd, J = 3.6 and 6.3 Hz, 1 H, H-2), 6.37 (dd, J = 1.1 and 6.2 Hz, 1 H, H-1); 13C NMR (020, 75 MHz) 0 -4.84 (M~SiCMe3), 25.23 (Me2SiCM~), 59.57 (C-6'), 60.89 (C-6), 67.14 (C-4'), 68.45 (C-3), 70.87 (C-5), 72.52 (C-2'), 75.23 (C-2), 76.68 (C-3'), 77.43 (C-5'), 101.73 (C-4), 102.87 (C-1'), 143.88 (C-1); ESMS m/z 445.10 (M+Naf; HRMS (FAB): calcd for (M+Lif C18H3409SiLi 429.2132, found 429.2126. 1,2,3,6-Tetra-O-acetyl-4-0-[2,3,4-tri-O-acetyl-6-0-( t-butyldimethylsilyl)-~-D-gala ctopyranosyl]-a-D-mannopyranose (4). A solution of 2 (5 g, 11.8 mmol) in water (50 mL) was stirred, to which was added a solution of m-CPBA (6.5 g, 36 mmol) in diethyl ether (50 mL) dropwise at -10 °C. The reaction mixture was brought to 0 °C and stirred for 4 h, and aqueous layer was extracted thoroughly with ether, Iyoph iii zed to afford 4-0-[6-0-( t-butyldi methylsilyl)-f3-0-galactopyranosyl]-a-0-mannopyranose (3) . This was dissolved in anhydrous pyridine (25 mL) and acetic anhydride (25 mL) was added dropwise at 0 °C. The mixture was gradually brought to rt and stirred for 16 h, and after completion of the reaction it was quenched with ice and diluted with CH2CI2. The organic layer was washed with water, dried (Na2S04) and concentrated to give a syrup which was purified by silica column (20% ethyl acetate in hexane) to provide compound 4 as white amorphous solid (7.5 g, 84%); [a]o = +6.72° (c 0.55, CHCI3); Rf = 0.69 in 70% ethyl acetate in hexane; 1H NMR (COCI3, 300 MHz) 0 0.01 (s, 6H, M~SiCMe3)' 0.84 (s, 9H, Me2SiCMe3), 1.95-2.14 (m, 21 H, 7 x OAc), 3.56-3.64 (m, 4H, H-6,6'), 4.17-5.04 (m, 2H, H-5,5'), 4.53 (d, J = 7.8 Hz, 1H, H-1'), 5.01 (dd, J = 3.3 and 7.8 Hz, 2H, H-4), 5.12 (dd, J = 2.1 and 7.8 Hz, 1H, H-2'), 5.21 (dd, J = 2.1 and 3.6 Hz, 1H, H-2), 5.34 (dd, J = 3.6 and 4.5 Hz, 1H, H-3), 5.41 (d, J = 3.3 Hz, 1H, H-4'), 6.01 (d, J = 2.1 Hz, 1H, H-1); 13C NMR (COCI3, 75 MHz) 8 -5.85 (M~SiCMe3), 17.94 (Me2SiCMe3), 20.40-20.86 (OAc), 25.54 (Me2SiCMe3), 60.01 (C-6'), 62.14 (C-6), 66.45 (C-4'), 68.18 (C-3), 69.25 (C-5), 69.39 (C-2'), 70.58 (C-2), 70.79 (C-3'), 73.38 (C-5'), 73.62 (C-4), 90.25 (C-1), 101.14 (C-1'), 168.08-170.23 (7 x CO); ESMS m/z 773.24 (M+Naf; HRMS (ESMS): calcd for (M+NH4f C32Hs4 N018 Si 768.3110, found 768.3139
-
Lactal (1). A solution of cyanocobalamin83 (Vitamin B12, 1.5 g, 1.14 mmol) in anhydrous CH30H (400 mL) was thoroughly purged with nitrogen gas for 30 min and zinc powder (87.5 g, 1.338 mol) and ammonium chloride (71 g, 1.33 mol) were added to the solution. The reaction was stirred for another 45 min and hepta-O-acetyl lactosyl bromide (47 g, 67.5 mmol), freshly prepared from lactose [peracetylation using acetic anhydride and sodium acetate, followed by anomeric bromination (48% hydrobromic acid in acetic acid)], was dissolved in CH30H (150 mL) and added. Immediately after addition of the bromide, the dark red solution changed to reddish-yellow and then back to dark red in 5 min. The solution was filtered through celite to remove zinc, the celite pad was washed with CH30H and the filtrate was concentrated to give a white and red solid. This mixture was dissolved in water (500 mL) and extracted with CH2CI2 (300 mL x 3). Organic extracts were combined, dried over Na2S04, and concentrated to provide hexa-O-acetyl lactal (36 g, 87%) as an amorphous solid, mp 113° (lit84 mp 114°); [a)D = -18° (c 1.0, CHCI3) (Iit84, -18°, c 1.0, CHCI3). In the next step of complete deacylation, hexa-O-acetyl lactal (36 g, 64.5 mmol) and freshly dried Na2C03 (45 g, 425 mmol) were suspended in anhydrous CH30H (750 mL) and stirred for 90 min at rt. The suspension was filtered to remove excess of Na2C03 and the filtrate was concentrated under reduced pressure to give deprotected lactal (1) as an amorphous solid (19.4 g, 98%); R,= 0.2 in 30% CH30H in CH2CI2; mp 191-193°; [a]D = +27° (c 1.6, H20) (lit84, +27°, c 1.6, H20). 6'-0-(f-butyldimethylsilyl)-lactal (2). A solution of lactal (1, 10 g, 32.4 mmol) and BU2SnO (8 g, 32.5 mmol) in anhydrous CH30H (1000 mL) was heated to reflux for 4 h followed by removal of solvent which provided a yellow powder. The dibutyltin complex was dissolved in anhydrous THF (1000 mL) and TBDMSCI (4.9 g, 32.3 mmol) was added, and the solution was stirred for 48 h at rt. After the completion of reaction, the solvent was evaporated to give a residue which was purified by silica
-
Solution Phase Synthesis of Phosphoglycans
-
Synthesis of Phosphoglycan Repeats of Lipophosphoglycan
-
The NMR spectra of the compounds were obtained on a 300 MHz (for 1H) NMR spectrometer (Avance-DRX 300; Bruker), equipped with a quadrinuclear probe (QNP) and an inverse gradient probe, using XWIN NMR software. Both these probes were 5 mm probes. Deutrated solvents (CDCI3, CD30D, 020 etc) were used for dissolving samples and locking the instrument. Tetramethylsilane (TMS, SiMe4) was used as the internal reference for 1H NMR and 80% ortha-phosphoric acid as external reference for 31 P-NMR. The chemical shifts have been expressed in terms of parts per million (ppm, 6) relative to TMS and coupling constants (J-values) have been expressed in Hertz (Hz). Molecular masses of the compounds were determined by mass spectrometry. Depending on the nature of the compound, electrospray-ionization (ES-MS) was obtained in negative or positive ion mode on a quadrupole mass spectrometer (VG Platform II; VG BioTech, Fisons Instruments, Altrincham, UK) using MassLynx software. High resolution mass spectra were obtained from IICT, Hyderabad and University of Kansas mass spectrometry facility. Optical rotations were obtained using a Perkin-Elmer 241 Spectropolarimeter. Measurements were made at 25°C using sodium D-line. The [alo values have been expressed in the units of 10.1 deg cm2 gm-1. The entire radioactivity operation was carried out in a fume-hood devoted to radiochemical work. Disposable items were discarded at a defined and instructed place. All other necessary precautions for handling radioactivity were taken. Liquid scintillation counting of samples was done on a scintillation counter using preset program for 1H ~ emitter. A suitable aliquot in triplicate was mixed with 5 mL scintillation fluid (Cocktail W-10 g PPO, 0.25 g POPPO and 100 g naphthalene per litre of 1,4-dioxan; SRL) in scintillation vials. For solvent blank, vial containing 5 mL scintillation cocktail was used.
-
All the reagents used in chemical syntheses and biosynthetic experiments were of the highest purity grade available. Glass-backed and aluminium TLC plates (Kieselgel 60 F254) were procured from Merck. Silica coated preparative glass-backed TLC plates were purchased from AnalTech. AG1-X8 and Dowex 2X8 anion exchange resins were obtained from Bio-Rad. All dry solvents were prepared in the laboratory using standard procedures for drying. Milli Q UF (Reverse Osmosed, ion exchanged and Ultra-filtered; Millipore Corporation, USA) grade water was used. For refluxing an oil-bath (high boiling silicone oil) was used and the temperature was controlled by a variostate and sensor. Stirring of the contents of reaction flasks, oil bath etc., were done using appropriate sized magnetic bars and Magnetic stirrer (Remi). For filtration of materials, Whatman #1 paper and Celite (Fluka) was used. For removing solvent from compounds, a flash evaporator (Rotavapour R-114, Buchi) was used which was connected to a water-chiller circulator and at times with a high vacuum pump to remove high boiling solvents. Monitoring the progress of reactions, analysis of column fractions and identification of reaction intermediates were done by thin layer chromatography on glass backed precoated TLC plates. The developed plates were air-dried and subjected to the following detection system: 1. Iodine vapors: Sublime iodine crystals were mixed with silica gel in an air-tight chamber. When the chamber was full of iodine vapors, the plates were exposed to this when yellowish brown spots were visible against white background. 2. Ultraviolet light: U.V. absorbing compounds were visualized by a hand-held UV lamp (Spectroline Model ENF-260C/F) employing both long and short wavelength UV. 3. Ammonium molybdate-ceric sulfate reagent: This reagent was prepared by dissolving ammonium molybdate (2.5 g) and ceric sulfate (1 g) in water (90 mL) and conc. Sulfuric acid (10 mL). The developed plates were immersed in this reagent and heated with a heat-gun (HEJET Model, Aldrich). Blue spots were observed when the compounds reacted with this reagent.
-
General procedures
Tags
- Method-4-Method-1-Method-3-detail
- Method-3-Method-1
- Method-2-Method-1-Method-1
- Method-3-Method-1-Method-2-detail
- Method-5-Method-1-Method-2-detail
- Method-5-Method-1-Method-1-detail
- Method-2-Method-1-Method-1-detail
- Method-2-Method-1-Method-2-detail
- Method-4-Method-1-Method-2
- Method-3-Method-1-Method-1-detail
- Method-2-Method-1-Method-2
- Method-2-Method-1-Method-3-detail
- Method-5-Method-1
- Method-4-Method-1-Method-1
- Method-3-Method-3-Method-1
- Method-4-Method-1-Method-4
- Method-4-Method-1
- Method-5-Method-1-Method-1
- Method-4-Method-1-Method-2-detail
- Method-4-Method-1-Method-4-detail
- Method-3-Method-3-Method-1-detail
- Method-3-Method-2-Method-1-detail
- Method-3-Method-1-Method-2
- Method-1
- Method-2-Method-1
- Method-4-Method-1-Method-3
- Method-5-Method-1-Method-2
- Method-4-Method-1-Method-1-detail
- Method-3-Method-1-Method-1
- Method-1-detail
- Method-5-Method-1-detail
- Method-3-Method-2-Method-1
- Method-2-Method-1-Method-3
Annotators
URL
-
-
sg.inflibnet.ac.in sg.inflibnet.ac.in
-
492 run with 620 nm as the reference filter. The antibody response generated was represented as the geometric mean of the absorbance of individual mice sera in a group of immunized animals. b1 addition, the antibody titer against r-dZP3 was also determined by ELISA. The assay was carried out as described above except that 100 ~l of doubling dilutions of the serum samples (dilutions made in PBST supplemented with 0.1% BSA) were added per well in duplicate. For each serum sample tested, a reciprocal of dilution giving an absorbance of 1.0 was calculated by regression analysis and represented as antibody units (AU).
-
Microtitration plates were coated with optimized concentration of r-bmZP1 (250 ng/well), r-dZP3 (400 ng/well) or r-rG (500 ng/well) in 50 mM PBS, pH 7.4, at 37°C for 1 h and then at 4°C, 0/N. The plates were washed once with PBS and incubated with 1% BSA, (200 Jll/ well) in PBS for 2 h at 37°C for blocking the non-specific sites. All subsequent incubations were carried out for 1 h at 37°C and each incubation was followed by three washings with PBS containing 0.05% Tween-20 (PBST). Post-blocking, the plates were incubated with 1 :50 dilution of either the preimmune or the immune serum samples obtained from mice immunized with the respective plasmid DNA. Antibodies bound tor-bmZP 1, r-dZP3 and r-rG were revealed with 1:2000 dilution of goat anti-mouse IgG (whole molecule) HRPO (Dako). Estimation of the enzymatic activity was carried out with 0.05% OPD in 50 mM citrate phosphate buffer, pH 5.0, containing 0.06% H202 as the substrate. The reaction was stopped with 50 Jll of 5 N H2S04 and the absorbance read at
-
Enzyme Linked Immunosorbant Assay (ELISA)
-
Inbred male BALB/c.T mice (6-8 week, Small Experimental Animal Facility, National Institute of Immunology, New Delhi, India) were immunized intramuscularly (i.m.) with 100 J.lg of respective plasmid DNA or VR1020 vector in 100 J.ll saline (0.9% NaCl) in the anterior tibialis muscle in the hind limbs (each receiving 50 J.ll). Two booster injections of 100 J.lg DNA in saline were given on day 21 and 35. On day 45, mice in each group received i.m. injection of E. coli expressed recombinant protein (20 J.lg/mouse in saline). Mice were anesthetized and bled retro-orbitally on days 0, 45 and 52 for analysis of respective antibody responses.
-
Plasmid DNA administered in saline
-
The proteins were purified by nickel affinity chromatography. The cell pellet ( ~ 1 g) of each clone was solubilized in 5 ml ofbuffer A (6 M guanidine hydrochloride, 0.1 M NaH2P04, 0.01 M Tris, pH 8.0). The suspension was centrifuged at 8000 X g for 15 min at 4°C and the supernatant containing the recombinant protein was mixed with Ni-NT A resin (Nickel-Nitrilotriacetic acid equilibrated with buffer A) and kept for gentle end-to-end shaking for 1 hat RT. The resin was loaded on a column and washed with 10 bed-volumes of buffer A. The column was subsequently washed with 5 bed-volumes each of buffers B, and C, which contained 8 M urea, 0.1 M NaH2P04 and 0.01 M Tris and had successively reducing pH values of 8.0 and 6.3 respectively. The protein was eluted with buffers D and E (composition same as buffer B) in which the pH was further reduced to 5.9 and 4.5 respectively. Five fractions of 4 ml each were collected during elution with buffer D and buffer E respectively. The eluted proteins were analysed by 0.1% SDS-1 0% PAGE (gels stained with Coomassie blue) and Western blot. The fractions showing the purified recombinant protein were pooled and concentrated in an Amicon concentrator using a YM30 membrane and dialyzed against 100 mM phosphate buffer, pH 7.4, containing 4 M urea. The concentration of each purified protein was estimated by bicinchoninic acid (BCA).
-
Purification in denatured form
-
incubations were carried out for I h at RT and each incubation was followed by three washings with PBS containing 0.1% Tween-20 (PBST). Post-blocking, the membranes were incubated with 1:1000 dilution ofMA-813 ascites (for detection ofr-bmZP1), MA-451 ascites (for detection of r-dZP3) or rabbit polyclonal anti-r-rG antibodies (for detection of r-rG), followed by an incubation with 1:5000 dilution of goat anti-mouse or goat anti-rabbit immunoglobulins conjugated to horseradish peroxidase (HRPO) (Pierce) respectively. The blots were developed with 0.6% (w/v) 4-chloro-1-naphthol in 50 mM PBS containing 25% methanol and 0.06% H202• The reaction was stopped by extensive washing with double distilled water
-
The cells (2 - 4 x 1 06) transfected with plasmid DNA were resuspended in minimum volume of 2X sample buffer (0.0625 M Tris, pH 6.8, 2% SDS, 10% glycerol, 5% P-mercaptoethanol, and 0.001% bromophenol blue). The samples were boiled for 10 min and resolved on a 0.1% SDS-1 0% PAGE (Laemmli, 1970). The expression of recombinant proteins was analyzed by Western Blot. The proteins were electrophoretically transferred to 0.45 J.lm nitrocellulose membrane 0/N at a constant current of 30 rnA (milliampere) in Tris-Giycine buffer (25 mM of Tris-HCl and 200 mM glycine) containing 20% methanol (Towbin et al., 1979). Post-transfer, the membranes were washed once with PBS and non-specific sites were blocked with 3% BSA in PBS for 90 min at RT. All the subsequent
-
Analysis of expressed recombinant protein by immunoblot
-
COS-I cells were seeded at a density of 2.5 x 105 cells per well in a 6-well tissue culture plate and transfected with plasmid DNA essentially as described above. After 48 h incubation, cells Were trypsinized and counted in a hemocytometer. Cells ( ~ 1 06) were washed twice with PBS and fixed with 0.4% paraformaldehyde in PBS followed by all washings and incubations with respective primary and secondary antibodies in presence of 0.1% Saponin. Antibody concentrations used were same as in indirect immunofluorescence assay. After the final wash, cells were resuspended in PBS and samples were run on an Elite ESP flow cytometer (Coulter Electronics, Hialeh, FL, USA) and data analyzed using WinMDI (version 2.8) software. Cells stained with just secondary antibody were used to account for the background fluorescence. Cells tranfected with VR 1020 vector and probed with primary antibody were used as negative control.
-
Analysis of mammalian cells, transfected in vitro with the plasmid DNA, by flow cytometry
-
To investigate if the expressed protein was membrane bound or cytosolic, cells were fixed in 3. 7% paraformaldehyde followed by all washings and incubations with primary and secondary antibodies either in presence or absence of 0.1% Saponin and processed for indirect immunofluorescence as described above.
-
Localization of the expressed recombinant protein in COS-1 cells
-
albumin (BSA) in PBS for 2 hat 4°C. For detection of r-bmZPI, a murine monoclonal antibody (MAb), MA-813, generated against E. coli expressed r-bmZP1 (Govind et al., 2000), was used as the primary antibody. The cells were incubated with 1 :500 dilution of MA-813 ascites fluid for 2 hat 4°C. Cells were washed 5 times with PBS and incubated for 1 h with a 1:800 dilution of goat anti-mouse Ig-fluorescein isothiocyanate (FITC) conjugate (Sigma) at 4°C. After washing with PBS, coverslips with the cells were mounted in glycerol : PBS (9 : 1 ), and examined under an Optiphot fluorescent microscope (Nikon, Chiyoda-Ku, Tokyo, Japan). For detecting r-dZP3, MAb, MA-451 (1 :500 dilution of ascites fluid), generated against porcine ZP3f3 (a homologue of dZP3) and immunlogically cross-reactive with dZP3 (Santhanam et al., 1998) was used. For detecting r-rG, rabbit polyclonal antibodies (1:1000 dilution) against E. coli expressed r-rG, was used as primary antibody. The polyclonal antibody was provided by Dr. Sangeeta Choudhury, Project Associate, Gamete Antigen Laboratory, National Institute of Immunology, New Delhi. Goat anti-mouse immunoglobulins-FITC conjugate (1 :800) and goat anti-rabbit immunoglobulins-FITC conjugate (1 :2000; Pierce) were used for detecting anti-dZP3 and anti-rG antibodies respectively
-
Initial standardization of transfection conditions was done using VRbmZPl plasmid DNA and COS-I mammalian cell line. In brief, cells were cultured in T-25 tissue culture flasks in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal calf serum (FCS) at 37°C with 5% C02. For subculturing, cells were trypsinized (0.5% trypsin + 0.2% EDTA in DMEM without FCS), centrifuged at 250 X g for 10 min, resuspended in DMEM supplemented with 10% FCS and aliquoted into T-25 flasks. For transfection, cells were seeded on coverslips in a 24-well tissue culture plate at a density of 5x 104 cells/well, a day prior to transfection. To standardize in vitro transfection conditions for optimum expression of bmZP1, varying amount of plasmid DNA was mixed with lipofectamine in DMEM devoid ofFCS (final reaction volume 200 f.!l) and incubated at RT for 45 min. The cells on the coverslips were washed twice with plain DMEM devoid of FCS. DNA-Iipofectamine complex was added dropwise to the cells and the plate incubated for 8 h at 3 7°C in humidified atmosphere of 5% C02• Subsequently, 1 ml of DMEM containing 10% FCS was added per well and cells allowed to grow for 48 h. After incubation, cells were processed for visualization of r-bmZPl by indirect immunofluorescence assay. Cells were washed twice with phosphate buffer saline (PBS; 50 mM Phosphate and 150 mM NaCI, pH 7.4), fixed in chilled methanol (-20°C) for 3 min and blocked with 3% bovine serum
-
Detection of the expressed recombinant protein following i11 vitro transfection of mammalian cells with the plasmid DNA.
-
6000 X g for 15 min at 4°C. Plasmid DNA was purified from the pellet using QIAGEN DNA purification kit according to the manufacturer's instructions. The purified plasmid DNA (1.5 -2.0 mg/ml) was dissolved in autoclaved double distilled water and stored in aliquots (500 f.!l each) at -20°C until further use.
-
A single colony of the respective clones was picked up from a freshly streaked LB + Kan (50 f.!g/ml) plate, inoculated into 5 ml of LB + Kan medium and incubated for 8 hat 37°C with vigorous shaking (-250 rpm). Subsequently, 500 fll of this primary culture was inoculated into 500 ml LB+ Kan and grown at 37°C 0/N. The culture was centrifuged at
-
Purification of plasmid DNA in large amount
-
N-VITRO TRANSFECTION OF MAMMALIAN CELLS WITH V ARlO US PLASMID DNA CONSTRUCTS AND CHARACTERIZATION OF EXPRESSED RECOMBINANT PROTEINS
-
stranded DNA. The reaction was carried out at 37°C for 1 h. The reaction mixture contained 100 ng Bgl II digested VR1020 vector, SAP (0.5 U) and 1 fll lOX SAP buffer (20 mM Tris-HCl, pH 8.0, 10 mM MgCh) in 10 f.!l oftotal reaction volume. The reaction was stopped by inactivating the enzyme at 65°C for 15 min. The digested bmZP1 eDNA was ligated with SAP treated VR1 020 at vector : insert ratio of 1:10 in a 10 fll reaction volume for 16 h at l6°C. The reaction mixture contained 10 ng VR1020 vector, 26 ng bmZPl insert, 1 fll lOX ligase quffer (30 mM Tris-HCl, pH 7.8, 10 mM MgCh, 10 mM DTT and 1 mM ATP), lfll T4 DNA ligase (20 U) in a total reaction volume of 10 fll. The ligation product was used for transformation of DH5a competent cells as described previously. Transformants were selected on LB plates containing 50 f.!g/ml Kanamycin (Kan). Similarly, the inserts corresponding to dZP3, rG and dZP3-rG fusion were digested with Bgl II restriction enzyme, gel purified and cloned in VR1020 vector, except that the ligation product of dZP3-rG fusion with VR1020 was transformed into JM109 competent cells
-
The insert corresponding to bmZP1 was released from the pPCR-Script-bmZPl clone by Bgl II restriction and purified on the agarose gel. VR1020 vector was similarly digested and gel purified. To prevent self-ligation, the digested vector was treated with Shrimp Alkaline Phosphatase (SAP), which removes 5'-phosphate from the termini of double
-
Cloning in VRl 020 mammalian expression vector
-
Selected transformants were grown in 250 ml of LBamp 0/N. The cells from the 0/N cultures were harvested by centrifugation (4°C) at 4000 X g for 30 min. The cell pellet was resuspended in 5 ml of TEG solution containing lysozyme (2.0 mg/ml in 10 mM Tris-HCl, pH 8.0) and incubated at RT for 15 min. Alkaline-SDS (10 ml) was added to the mixture and again incubated at R T for 10 min after mixing the contents gently by inverting the tube. Post-incubation, chilled sodium acetate solution (7.5 ml) was added and the contents were incubated on ice for 15 min. After incubation, the mixture was centrifuged at 10,000 X g at 4°C and processed in the similar fashion as described above upto addition of isopropanol. The DNA pellet was resuspended in 500 Jll TE containing 20 Jlg/ml RNase and incubated for 1 h at 37°C. Plasmid DNA was then extracted as described above. The DNA pellet was air-dried and finally dissolved in 200 Jll ofTE
-
Large scale plasmid DNA isolation
-
collected by centrifugation at 12,000 X g for 15 min, and washed with 70% ethanol. The pellet was air-dried and resuspended in 20 Jll TE. The clones were checked for the pres~nce of the insert by restriction analysis. The digestion products were checked on 1% agarose gel for the release of the insert. One positive clone was selected from each set of transformations and the plasmid DNA was purified in large amount for the insert preparation.
-
Transformants picked following blue-white selection were inoculated in 5 ml LB medium containing 100 j...tg/ml ampicillin (LBamp) and grown 0/N. Following day, 1.5 ml aliquots of 0/N culture were harvested by centrifugation at 10,000 X g in a microfuge. The supernatant was discarded and the pellet was resuspended in 100 j...tl of chilled TEG (25 mM Tris-Cl, pH 8.0, 10 mM EDTA and 50 mM glucose) and incubated for 10 min at RT. After incubation, 200 j...tl of freshly prepared alkaline-SDS (0.2 N NaOH, 1% SDS; sodium dodecyl sulfate) was added and the contents were mixed gently by inversion. This was followed by incubation on ice for 10 min. Post-incubation, 150 j...tl of ice-cold sodium acetate solution (3 M, pH 5.2) was added to the mixture and incubated on ice for 15 min. After incubation, the contents were centrifuged at 12,000 X g for 15 min at 4°C and the supernatant was carefully transferred to a fresh tube. DNA was precipitated by adding 0.6 volumes of isopropanol and incubating at RT for 10 min. The DNA pellet was obtained by centrifugation at 12,000 X g at RT for 15 min, air-dried and dissolved in 200 j...tl of TE. To remove RNA contamination, 50 j.lg of DNase free RNase was added and incubated for 1 h at 37°C. Plasmid DNA was then extracted once with an equal volume of phenol equilibrated with TE (I 0 mM Tris, pH 8.0 and 1 mM EDT A) followed by extraction with phenol : chloroform : isoamyl alcohol (25 : 24 : 1) and then with chloroform : isoamyl alcohol (24 : 1 ). DNA was precipitated by addition of 2 volumes of chilled 100% ethanol to the aqueous phase and incubating the contents at -70°C for 30 min. The DNA pellet was
-
Small scale plasmid DNA isolation and restriction
-
separately on LB plates containing 100 j...tg/ml ampicillin, 80 j...tg/ml of X-gal and 20 mM of IPTG. The plates were incubated at 37°C for 12 h.
-
The DH5a strain of E. coli was grown overnight (0/N) in LB at 37°C and subcultured ( 1: 1 OO)in 100 ml of fresh LB. The culture was grown until absorbance at 600 nm (A6oo) reached 0.4. The culture was centrifuged at 2500 X g for 15 min at 4°C. The cell pellet was resuspended in 10 ml of freshly prepared sterile ice cold CaC}z (100 mM) solution and incubated for 30 min on ice. Cells were centrifuged at 1800 X g and the pellet was very gently resuspended in 2 ml of chilled CaCh (100 mM) containing 15% glycerol. Aliquots of 100 111 were dispensed into sterile, chilled 1.5 ml eppendorf tubes and stored at -70°C until further use. For transformation, the ligation products from the above reactions were added separately to a vial each of DH5a competent cells thawed on ice. The contents were gently mixed and incubated on ice for 30 min. The cells were then exposed to heat shock at 42°C for 90 sec and incubated on ice for another 2 min. The transformed cells were grown in 1 ml of LB medium for lh at 37°C with shaking for the expression of the ampicillin resistance marker gene W-lactamase). Aliquots from each transformation were plated
-
Preparation of competent cells and transformation
-
The Luria Bertani (LB; pH 7.5) medium was prepared in double distilled water by adding, NaCl 1%, Yeast extract 0.5%, and Tryptone 1% and sterilized by autoclaving under pressure (15 lbslinch2) for 20 min. Solid growth medium was prepared by adding 1.5% agar to LB prior to autoclaving. Appropriate antibiotics were added after cooling the medium to approximately 50-60°C. Bacterial cultures were grown in LB medium at 37°C in an orbital shaker set at 200 revolutions per minute (rpm).
-
Media composition and bacterial culture
-
The PCR products obtained by amplification were resolved on a 0.8% low melting point (LMP) agarose gel using IX TAE buffer (40 mM Tris, 20 mM acetic acid and 1 mM EDT A) and purified from the gel. The purified PCR products were first blunt-ended at 72°C for 30 min using 0.5 units (U) of cloned Pfu polymerase, 1 OmM dNTPs, 1 OX polishing buffer (Stratagene). These PCR products were ligated separately to pPCR-Script Amp SK ( +) cloning vector, using vector to insert ratio of 1 :20 in a 10 Jll reaction volume for 3 h at room temperature (RT). The reaction mixture contained 10 ng of pPCR-Script Amp SK(+) cloning vector, 4 U ofT4 DNA ligase, 0.5 Jll of 10 mM rATP, 1 Jll of lOX reaction buffer, 5 U of S1f I restriction enzyme. The buffers and enzymes used were supplied along with the PCR-Script™ Amp cloning kit (Stratagene). For dZP3-rG fusion, the PCR amplified product was ligated with pGEM-T Easy vector (Promega) without blunting. The reaction mixture contained 50 ng pGEM-T Easy vector, 130 ng of fusion PCR product, 3 U ofT4 DNA ligase and 5 fll of2X Rapid Ligation buffer (30 mM Tris-HCl, pH 7.8, 10 mM MgC}z, 10 mM DTT, 2 mM ATP and 10% polyethylene glycol). The reaction was carried out at 16°C for 16 h.
-
Agarose gel electrophoresis and ligation of PCR amplified fragments in pPCR-Script Amp SK (+)cloning vector
-
mm followed by the addition of forward and reverse primers and another round of amplification for 35 cycles involving denaturation at 94°C for 1 min, annealing at 55°C for 2 min and extension at 72°C for 2 min followed by a final extension at noc for 15 min. Rest of the PCR conditions were same as described for bmZPl.
-
The general strategy to assemble by PCR the eDNA encoding dZP3-rG fusion protein is schematically shown in Fig. 1. Two rounds ofPCR were carried out to assemble the dZP3-rG eDNA. Jn the first round, eDNA corresponding to dZP3 encompassing part of the N-terminal segment of rG and rG eDNA encompassing part of the C-terminal segment of dZP3 were PCR amplified using pQE30-dZP3 and pQE30-rG plasmids respectively as templates. The eDNA corresponding to dZP3 was PCR amplified using forward primer 5 '-GAAGATCTCAGACCATCTGGCCAACT-3' having Bgl II site and reverse primer 5'-CGTGTAAATAGGGAATTTAGTGTGGGAAACAGACTT-3', containing 12 nucleotides from the N-terminal end of rG eDNA at the 3 'end of the primer, using an annealing temperature of 49°C. The eDNA corresponding to rG was PCR amplified using forward primer 5'-AAGTCTGTTTCCCACACTAAATTCCCTATTTACACG-3' containing 12 nucleotides from the C-terminal end of dZP3 eDNA at the 5 'end of the primer and reverse primer 5'-GAAGATCTTTACCCCCAGTTCGGGAG-3' having Bgl II site using an annealing temperature of 45°C. The amplified fragments of dZP3 eDNA containing a part of N-terminal end of rG eDNA at its 3'end and rG eDNA containing a part of C-terminal end of dZP3 eDNA at its 5' end were gel purified and used as templates for the next round of PCR employing forward primer of dZP3 eDNA and reverse primer of rG eDNA to obtain amplified fusion product of dZP3 followed by rG eDNA ( dZP3-rG). The templates were denatured at 94 oc for 10 min. Initial amplification was carried out for 2 cycles of denaturation at 94°C for 2 min, annealing at 51 oc for 2 min and extension at 72°C for 2
-
Assembly of eDNA encoding dZP3-rG fusion protein by PCR
-
described for bmZP1 except that for rGVR, rGVRt and rGVRst an annealing temperature of 45°C and for rGVRs an annealing temperature of 50°C was used.
-
To obtain the optimum expression of rG in mammalian cells and to study the influence of the SS and the TD on the immune response generated by DNA vaccine, four different constructs of rG eDNA in VR1020 vector were made (Table 1). For cloning rG, BHK21 cells were infected with PMIO strain of rabies virus. Total RNA from the infected cells was prepared at various time period post-infection using TRIZOL reagent. Total RNA was directly used to amplify the eDNA corresponding to rG without the SS and the TD, by RT-PCR, following the manufacturers instruction provided in the kit (Promega). The RT-PCR resulted in amplification of a 1.314 kb fragment. The fragment was cloned in pPCR-Script Amp SK (+) cloning vector and from there into pQE30 expression vector. One of the positive clones (pQE30-rG) expressing rG in E. coli was used as a template to PCR amplify rG eDNA, without the SS and the TD, using BamH I restriction site in the forward primer and Bgl II restriction site in the reverse primer (Table 1 ). For amplification of rG eDNA to prepare rGVRt (-SS, + TD), rGVRs (+ SS,-TD) and rGVRst (+ SS, + TD) constructs, the pKB3-JE-13 clone {ATCC) encoding the full length rG from the Challenge Virus Standard (CVS) strain of the rabies virus was used as a template. The DH5a strain of E. coli was transformed with pKB3-JE-13 plasmid DNA and one of the positive clones was used to PCR amplify' different rG eDNA fragments (for rGVRt, rGVRs and rGVRst constructs) using respective forward and reverse primers as shown in Table 1. All the PCR reactions were carried out with Taq DNA polymerase using the same reaction conditions as
-
PCR amplification of rG cDNAs
-
GAAGATCTCAGACCATCTGGCCAACT-3' as the forward pnmer, and 5'-GAAGATCTT-TAAGTGTGGGAAACAGACTT-3' as the reverse primer as described for bmZPl except that primer annealing was performed at 53°C for 1 min.
-
The dog ZP3 ( dZP3) eDNA, excluding the SS and the TD, was cloned in prokaryotic expression v~ctor, pQE30 (QIAGEN) as described previously (Santhanam et al., 1998). To clone dZP3 eDNA in mammalian expression vector, VR1020, the pQE30-dZP3 clone was used as a template to PCR amplify dZP3 eDNA (79-1056 nt; 978 bp) using 5'-
-
PCR amplification of dZP3 eDNA
-
Expression of the recombinant bmZPl (r-bmZPl, excluding the N-terminal signal sequence [SS] and the C-terminus transmembrane-like domain [TD]) in E. coli using pRSET vector (Invitrogen) has been reported previously (Govind et al., 2001). The above pRSET-bmZPl clone was used as a template for amplification of the bmZPl eDNA (64-1389 nt; 1326 bp ), by polymerase chain reaction (PCR), usmg 5'-GAAGATCTAAGCCTGAGACACCAGGT-3' as the forward pnmer, and 5' -TCTAGATCTACTGAGATCAGG-3' as the reverse primer, for cloning in mammalian expression vector, VRI 020 (VICAL). Both forward and reverse primers were designed with Bgl II restriction sites (denoted in bold). The PCR was performed in a 50 ~1 of final reaction volume (10 mM Tris-HCl, pH 9.0, 50 mM KCl, 1.5 mM MgCb and 0.1% Triton X-100) using 50 pmol of each primer and Taq DNA polymerase for extension. The template was denatured at 94°C for 10 min. Amplification was carried out for 35 cycles of denaturation at 94°C for 1 min, primer annealing at 48°C for 2 min and extension at 72°C for 2 min, followed by a final extension at 72°C for 15 min.
-
PCR amplification of bmZPl eDNA
-
CLONING OF eDNA ENCODING bmZPl, dZP3, rG AND dZP3-rG GLYCOPROTEINS IN MAMMALIAN EXPRESSION VECTOR VR1020
-
Franklin Lakes, NJ, USA. Glass micro-slides and coverslips were purchased from Blue Star, Polar Industries and Co., India.
-
immunoglobulins-FITC conjugates were obtained from Pierce, Rockford, IL, USA. Anti-. rabies monoclonal antibody conjugated to FITC was purchased from Centocor Inc, Malvern, P A, USA. Others: Sodium chloride was purchased from S. D. fine-chem. Ltd., Mumbai, India, Lipofectamine and Trizol were obtained from Gibco-BRL, Rockville, MD, USA. UM-449 cell line was a kind gift by Prof. Nirbhay Kumar (TheW. Harry Feinstone Department of Molecular Microbiology and Immunology, John Hopkins University-School of Public Health, N. Wolfe Street, Baltimore, MD 21205, USA), COS-7 cell line was kindly provided by Dr. Chetan Chitnis (Malaria Research Group, International Center for Genetic Engineering and Biotechnology, New Delhi, India), MNA cell line, CVS-11 rabies virus and Standard Rabies Immune Globulin were kindly gifted by Dr. Charles E. Rupprecht (Rabies section, Division of Viral and Rickettsial Diseases, Centres for Disease Control and Prevention, Atlanta, Georgia 30333, USA), Nickel-nitrilotriacetic acid (Ni-NTA) was procured from QIAGEN, ultrafiltration assembly and YM30 membrane from Amicon Corp., Lexington, MA, USA. Bicinchoninic acid (BCA) was purchased from Pierce. Complete and incomplete Freund's adjuvants were procured from Difco laboratories. Nitrocellulose membrane, Tefzel tubing, gold microcarriers and Helios gene gun assembly were obtained from Bio-Rad. T -25, T -75 tissue culture flasks, 6-well tissue culture plates, 8-well tissue culture chamber slide and 96-well microtitration plates were procured from Nunc a/s, Rosakilde, Denmark. The 24-well tissue culture plates were procured from Corning glass works, Corning, NY, USA. The 96-well tissue culture plates were purchased from Becton Dickinson and Co.,
-
Bacterial strains and plasmids: DH5a and BL2l(DE3)pLysS strains of E. coli were purchased from Stratagene, La Jolla, CA, USA. SG13009[pREP4] E. coli strain was obtained from QIAGEN GmbH, Hilden, Germany. Expression vector, VRI 020 was a kind gift from VICAL Incorp., San Diego, CA, USA, pKB3-JE-13 clone was procured from ATCC, Rockville, MD, USA, pQE30 vector was procured from QIAGEN and pRSET-A vector was acquired from Invitrogen Corp., Carlsbad, California, USA. Kits: PCR-Script™ Amp cloning kit was obtained from Stratagene. Plasmid DNA purification mega kit was purchased from QIAGEN. The pGEM-T Easy cloning kit was purchased from Promega, Madison, WI, USA. Primers and Enzymes: Various oligonucleotide primers were custom made by Rama Biotechnologies, India Pvt. Ltd., Secundrabad, AP, India, Sigma-Genosys Ltd, New Delhi, India and Microsynth GmbH, Hilden, Germany. Restriction enzymes were obtained from New England BioLabs (NEB), Beverly, MA, USA and Promega, Taq DNA polymerase and T4 DNA ligase were bought from Promega. Shrimp Alkaline Phosphatase was bought from Amersham. Molecular weight markers: pGEM DNA markers were procured from Promega, /..DNA-Hind III digest and 1 kb DNA ladder were purchased from NEB. Prestained SDS-PAGE standards were obtained from Bio-Rad, Hercules, CA, USA. Antibodies and Conjugates: Rabbit anti-mouse IgG (whole molecule) conjugated to horseradish peroxidase (HRPO) was procured from Dako A/S, Glostrup, Denmark. Goat anti-mouse IgG-FITC conjugate was procured from Sigma. Mouse monoclonal antibody isotyping kit was also purchased from Sigma. Goat anti-mouse immunoglobulins-HRPO, goat anti-rabbit immunoglobulins-HRPO, rabbit anti-goat IgG-HRPO and goat anti-rabbit
-
Chemicals: Tris, glycine, acrylamide, N, N'-Methylene-bisacrylamide, sodium dodecyl sulfate (SDS), P-mercaptoethanol, N, N, N', N'-Tetramethylethylenediamine (TEMED), phenol, ethidium bromide, ethylenediaminetetraacetic acid (EDTA), agarose, Bromophenol blue, Coomassie brilliant blue-R250, calcium chloride, sodium acetate, glucose, lysozyme, glycerol, chloroform, lithium chloride, phenylmethyl sulphonyl fluoride (PMSF), spermidine, saponin, paraformaldehyde were procured from Sigma Chemical Co., St. Louis, MO, USA. Low melting point (LMP) agarose, isoamyl alcohol, sodium deoxycholate, oxidized glutathione, reduced glutathione, dimethyl sulfoxide (DMSO), 4-chloro-1-naphthol, isopropyl-P-D-thiogalactopyranoside (IPTG) and 5-bromo-4-chloro-3-indolyl-P-D-galactopyranoside (X-gal), were purchased from Amresco, Solon, Ohio, USA. Ammonium persulfate and guanidine hydrochloride were purchased from Amersham, Cleveland, Ohio, USA. Alum was procured from Superfos Biosector, Elsenbakken, Frederikssund, Denmark. Reagents for Enzyme Immunoassay: Bovine serum albumin (BSA) and orthophenylene diamine (OPD) were purchased from Sigma. Tween-20 (polyoxyethylene-20-sorbitan monolaurate) was obtained from Amresco. Media and Antibiotics: Bacto tryptone, bacto yeast extract and bacto agar were obtained from Difco laboratories, Detroit, USA, Dulbecco's Modified Eagle's Medium (DMEM) and RPMI-1640 media were purchased from Sigma. Antibiotics such as gentamycin sulfate, ampicillin (sodium salt) and kanamycin were also obtained from Sigma. Fetal calf serum (FCS) was procured from Biological Industries, Hibbutz Beit, Haemek, Israel.
-
REAGENTS
Tags
- Material-1-detail
- Method-1-Method-11-Method-3
- Method-1-Method-5-detail
- Method-1-Method-11-Method-4
- Method-1-Method-6
- Method-1-Method-4-detail
- Method-1-Method-11-Method-5
- Method-1-Method-3
- method-1-method-8
- Method-1-Method-4
- Method-1-Method-11-Method-5-detail
- Method-1-Method-10
- Method-1-Method-11-Method-4-detail
- Method-1-Method-6-detail
- Method-13-Method-2-Method-1
- Material-1
- Method-1-Method-11-Method-2-detail
- Method-1-Method-11-Method-3-detail
- Method-13-Method-1-detail
- method-1-method-8-detail
- Method-1-Method-5
- Method-1-Method-2
- Method-1-Method-7
- Method-1-Method-2-detail
- method-1-method-9
- Method-1
- Method-1-Method-11-Method-2
- Method-1-Method-3-detail
- method-1-method-9-detail
- Method-1-Method-1-detail
- method-1-method-1
- Method-13-Method-2-Method-1-detail
- Method-1-Method-11
- Method-1-Method-11-Method-1-detail
- Method-1-Method-10-detail
- Method-1-Method-11-Method-1
- Method-1-Method-7-detail
- Method-13-Method-1
Annotators
URL
-
-
shodhganga.inflibnet.ac.in shodhganga.inflibnet.ac.in
-
Abloodsamplewastakenfromthecaudalveinofeachfishwitha1mlheparinisedsyringeand24-gaugeneedle.Thebloodwascentrifuged(400xg,5min)fortheseparationofplasma.Plasmawasstoredfrozen(-70°C)forthedeterminationoftheimmunologicalparameters
-
Collectionofplasma
-
ultrapureHNO3andtissuesamplesweredissolvedin70%HNO3;microwavedfor5minat90W,180W,270Wand360W,untiltotaldigestionhadoccurredandthendilutedwithMilli-Qgradewater(Millipore,Acton,Massachusetts,U.S.A)
-
Totalsodium,potassiumandcalciumconcentrationsweredeterminedwithatomicabsorptionspectrophotometry.Tothispurpose,plasmasamplesweredilutedwith1%
-
Ionconcentrations
-
Plasmaosmolalitywasmeasuredin10pisampleswithavaporpressure osmometer(Wescor,5500,Utah,U.S.A)andexpressedasmmol/kg
-
Plasmaosmolality
-
Forclinicalanalysis,thecontrolandexperimentalfishesweregentlyandrapidly anaesthetizedusingMS222(ethyl-m-aminobenzoatemethanesulphonate)atthedoseof60mgl'1.Thefisheswereimmobilizedwithin1minofapplication.Bloodwascollected fromthecaudalarteryusing1mlsyringefilledwith24Gneedleandinsomefishesbycaudalpedunclecut.Heparinwasusedastheanticoagulant.Immediatelyaftercollection,bloodwascentrifugedfor5minat3000rpmandtheplasmawasseparatedoutandeither usedforanalysisimmediatelyorstoredat20°Cforanalysislater.Samplingprocedureofnetting,anesthesiaandplasmastoringwascompletedwithin10mintoavoidinfluenceofnettingcombinedwithanesthesiaonthebasalcortisollevels(Tancketal.,2000).
-
Plasmaseparation
-
0.89%salinesolutioninaTejElon-glasshomogenizerat4°C.Thehomogenatewascentrifugedat4000rpm(3500xg)at4°Cfor20minutes.Theclearsupernatant(organextract)wasusedforestimationofenzymes
-
Aftereffluentexposure,thecontrolandexperimentalfisheswerekilledbyhammeringonheadanddissectedimmediately.Excisedbrain,gill,muscle,liver,heart,kidneyandair-breathingorganswereweighed(about20mg)andhomogenizedin2mlof
-
Collectionoftissues
-
TotalproteincontentwasdeterminedbytheFolin-CiocalteaumethodofLowryetal.(1951)asmodifiedbyZakandCohen(1961).Bovinecrystallinealbuminwasusedasa referencestandard
-
Totalproteins
Tags
- Method-18-Method-1-Method-2-detail
- Method-16-Method-1
- Method-16-Method-1-detail
- Method-17-Method-1-detail
- Method-18-Method-1-detail
- Method-18-Method-1
- Method-18-Method-1-Method-2
- Method-18-Method-1-Method-1
- Method-19-Method-1
- Method-17-Method-1
- Method-18-Method-1-Method-1-detail
- Method-19-Method-1-detail
Annotators
URL
-
-
www.research.manchester.ac.uk www.research.manchester.ac.uk
-
54Primer NameGenome Co-ordinatesSequence (5’-3’)Brk_RE_FchrX:7200547-7200702AAACCTCTGTGTTCGTCTGGCBrk_RE_RTCCGTAGAAACCGCGCAACBrk_RC_FchrX:7200789-7200926CCGATGTGGAAGGGGTATGGBrk_RC_RGGCTCTGCCAGTTGCTCATAC15_RE_Fchr3R:17325974-17326067GCCAAAATGTCCAGCCACGAC15_RE_RTGACATCCGCGAGTCCGAC15_RC_Fchr3R:17325763-17325861CCGTAGACCGTAATCCGTGAAC15_RC_RCCGCGAAGCACACACTAATCTable 2.4. | Primer sequences to determine DpnII digestion efficiency. Digestion efficiency was calculated using the following formula (Hagège et al., 2007):Digestion Efficiency %= 100-1002CtRE-CtRCDigested-CtRE-CtRCUndigestedSequencing Library Preparation:Prior to preparation of sequencing libraries, 5-6μg 3C libraries were sonicated using a S220 Focussed Ultrasonicator (Covaris) aiming for a peak size of 200bp. Libraries were sonicated with the following settings: Duty Cycle: 10%, Intensity: 5, Cycles per burst: 200 and Mode set as Frequency Sweeping with 6 cycles each of 60s. Following sonication, samples underwent clean-up using AMPure XP SPRI beads (Beckmann Coulter), with sonication quality assessed using a TapeStation 2200 (Agilent). Sequencing libraries were prepared using the NEBNext DNA Prep Reagent set and the NEBNext Multiplex Oligos for Illumina (NEB), following the manufacturers instructions with the following modifications. Firstly, AMPure bead clean up steps were performed x1.8 volume to avoid skewing for larger fragments. Secondly, library PCR amplification was performed using Herculase II Fusion DNA Polymerase kit (Agilent) to a total of 50μl using: 1x Herculase II Buffer, 250μM dNTPs, 0.5μM of both the NEB Universal and NEB Index Primer, and Units Herculase II Polymerase. Libraries were assessed after adaptor ligation and post indexing PCR on a TapeStation 2200 (Agilent)
-