5,018 Matching Annotations
  1. Apr 2021
    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      We thank the reviewers for their positive comments on our manuscript. To address their criticisms, we propose to do the following experiments:

      Reviewer 1 (mi__nor comments)__:

      1. In Fig. 1, the authors show that Btz-WT, but not Btz-HD, localizes to the posterior pole of the oocyte. Do the authors see Btz-WT and/or Btz-HD localized to MNs/muscles/glia at the NMJ? We have had difficulty detecting the expression of our Btz-GFP transgenes at the NMJ. In case this was due to competition with endogenous wild-type Btz, we will repeat the staining in a btz mutant background. If the protein is still undetectable, we can include data showing the localization of UAS-Btz-GFP when overexpressed in muscles or motor neurons.

      The mitochondrial phenotypes observed in Btz mutants are striking. But it seems possible that there are defects in overall mitochondrial levels in muscle in addition to defects in their localization. Overall, mitochondrial levels seemed reduced in Btz mutants. Is it possible to do a ATP5A immunoblot in Btz mutants to test whether overall mitochondrial levels are altered?

      We will do a Western blot to compare ATP5A levels in btz2/+ and btz2/Df(3R)BSC497 larval carcasses.

      ECM proteins are known to be critical for regulating TGFB signaling. That, taken with the multi-tissue genetic requirement for Btz, suggests that Btz might directly regulate either Ltl or Frac RNA, given that these ECM proteins are likely deposited by multiple cell types.

      We agree that this is a possibility and we will mention it in the Discussion.

      Reviewer 2 (major comments):

      1. In Figure 1, regarding the validation of rescue constructs: the EJC interaction-defective mutant is based solely on conservation, as all structural/interaction studies cited with Btz bound to EJC have been with human proteins. They use Vasa localization as a readout of EJC-dependent function, but this is indirect and only assesses one aspect of EJC function (localization). Since many of the main conclusions in the paper are predicated on this mutant being EJC-independent, they should validate this with the Drosophila orthologs using immunoprecipitation. They demonstrate the capability of expressing GFP-tagged versions of Casc3 WT and mutant in S2 cells, so this should not be a cumbersome control experiment to include. We will express tagged Btz-WT and Btz-HD proteins in S2 cells and test whether they can be co-immunoprecipitated with Myc-tagged Drosophila eIF4AIII.

      Regarding Figure 3, it could be postulated that the number of boutons would be influenced by the length of axons. Is axon outgrowth accounted for in these experiments? This would influence number of synaptic boutons. Panel F looks very different from panel A in terms of axon length (could this be due to axon outgrowth defect and/or impacted muscle size?) Can quantitation be done also by normalizing to axon length (bouton number/axon length)? Or perhaps this is accounted for in muscle size? If so, this should be explained.

      • *

      The NMJ grows during development by adding both axonal branches and synaptic boutons, so its size can be measured by counting the number of boutons or branches or measuring branch length. These measures are usually well correlated. In this paper we used bouton number normalized to muscle surface area as our measure of NMJ size, but we did observe corresponding changes in the number and length of branches, as the reviewer points out. We will explain this more clearly in the text.

      In Figure 3 quantification: n's vary between genotypes significantly, and this should be explained (e.g. was there a recovery issue between genotypes or just fewer needed for WT-like?).

      • *

      The btz mutant larvae are more difficult to dissect due to muscle fragility, and some crosses in this genetic background may have yielded fewer usable filets than desired. We believe the numbers we obtained are sufficient to show which differences are significant.

      In Figure 4 panels B and F (mutants), there appears to be reduced axon outgrowth (see point above). This should be taken into account when expressing bouton number.

      • *

      As explained in our response to point 2, axon length and bouton number are correlated measures of synapse size and vary together in this figure as expected.

      The RNA-seq data (Figure 5) has a potential issue in that they used larvae with a balancer chromosome (Df), which yields a 50% reduction in any genes on that chromosome. They acknowledge this and removed these genes from the analysis, but the concern remains that this still might be a confounding variable (for example, if reduction in any of these genes might disrupt a signaling pathway). We do not think that the RNA-seq needs to be repeated, but we propose that the authors validate these targets using qPCR in their MN-specific btz knockdown system (this way, they can also include magoh and eif4aIII knockdowns for comparison).

      • *

      Because only one btz allele was available, we used transheterozygotes with a deficiency for the region to avoid homozygosing other mutations that might be present on the btz2 chromosome. As a consequence, we did observe reduced expression of genes located within the deficiency (which covers a small region, not an entire chromosome), and it is possible that this might contribute to the phenotype. However, we have seen a similar reduction in NMJ size in btz2 homozygotes. We do not think that motor neuron-specific btz knockdown is a useful genotype to validate the RNA-Seq results because ltl and frac levels do not change significantly in the CNS, only in muscle, and knockdown only in motor neurons would be unlikely to change daw levels measured in the whole CNS. Knocking down mago or eIF4AIII in muscle is lethal before the third larval instar stage, preventing us from comparing their effects on gene expression to those of btz. However, we will do qRT-PCR to measure daw, ltl and frac mRNA levels in btz2 homozygous mutant muscles.

      Reviewer 2 (minor comments):

      1. *Some statements made in the introduction that are not entirely accurate: **

        "A fourth core subunit, known as Barentsz (Btz), Cancer susceptibility candidate gene 3 (CASC3), or Metastatic lymph node 51 (MLN51), associates with the complex following the completion of splicing, and is required for the effects of the EJC on translation, NMD and mRNA localization (Chazal et al., 2013; Palacios et al., 2004; Shibuya et al., 2006; van Eeden et al., 2001)."

        A recent study indicates that Casc3 is not required for EJC-dependent NMD targets in human cells, but rather enhances NMD on a subset of targets (Gerbracht et al. 2020 NAR). Perhaps "is required" should be changed to "plays a role in cytoplasmic EJC-mediated processes, such as...". It has also been shown that EJC core can assemble without Casc3 (e.g. Ballut et al 2005 NSMB, Gehring et al 2009 PLoS Biol). Previous work from the authors show that Casc3 (Btz) is not necessary for EJC function in pre-mRNA splicing (Roignant et al, 2010 Cell). Further, there exists a population of Casc3 lacking EJCs in human cells (Mabin et al 2018 Cell Reports). Collectively, all this evidence points to Casc3 not being a core EJC subunit. *

      • *

      We will change the text so that we do not refer to Btz/Casc3 as a core subunit.

        • "In the mouse brain, haploinsufficiency for Magoh, Rbm8a or Eif4a3 causes severe microcephaly, but complete loss of Casc3 has a much milder effect that can be attributed to developmental delay (Mao et al., 2017; Mao et al., 2016; Mao et al., 2015; Silver et al., 2010)."

        From Mao et al 2017: complete loss and hypomorphic mutants were embryonic and perinatally lethal (contrary to what the authors are stating here), while compound mutants and heterozygotes exhibited neurodevelopmental delay. By "milder effects" the authors could also be referring to brain size being proportional to body size in the complete loss homozygotes; either way, this should be clarified. *

      • *

          By “milder effects” we meant the effect on brain size. We will clarify this in the revised text.
        

      Fly-specific nomenclature could be made more accessible to a broader audience, as the full readership will likely not have expertise in Drosophila genetics. For example, w118, btz2 labels used in figures are not explained anywhere in the manuscript. While the authors do a good job of describing various mutants in a more accessible fashion in the results section, the genotype labels in figures can be better explained in the legends.

      We apologize for this and will clarify the genotype labels in the figure legends.

      Fig 2 L-N panels might warrant more explanation. Can the mitochondria be counted here? Is there also a difference in volume/morphology that could be quantitated? In Figure 2N, muscle fibers are more densely packed in mutant vs. control; can this be explained?

      • *

      We are hesitant to quantify mitochondria or comment on muscle fiber packing based on the EM images, because only one individual of each genotype was examined. We prefer to simply use these images to provide a higher resolution view of the change in mitochondrial distribution that we observed and quantified using light microscopy. However, we do plan to do a Western blot to determine whether there are changes in the number of mitochondria in btz mutants (see Reviewer 1 point 2).

      In Fig 2, to draw parallels between panels A-K and L-N, it might also be helpful to use the red/yellow arrow system on panel A for comparison.

      This is a good suggestion that we will follow.

      In Figure 3, it might be helpful for a general audience to include zoomed-in picture of boutons (as in Fig 5B), as some panels appear to have less defined bouton shape.

      • *

      We do observe that boutons tend to be less well separated from each other in btz mutants, and will include zoomed-in pictures to document this.

      Is the bouton size different in the mutant in Figure 3? Can this be quantified?

      We do not think that there is a significant difference in bouton size in btz mutants, but we will measure this and include a quantification.

      Fold changes are modest and not very apparent in staining (we acknowledge that this could be due to early developmental time point). Images could better point out differences in WT vs. mutant that are not readily apparent to those outside the fly neurodevelopment audience.

      Because of the inherent variability in synapse shape, it can be difficult to appreciate changes in bouton number from a single image. However, our quantifications show that the changes are consistent and significant.

      Fig 4 NMJs are shown on different scale (more zoomed in) than in Figure 3, and differences are bit easier to see at this scale. Presenting Fig 3 on this scale might help the reader with visualizing the differences in WT versus mutant.

      • *

      We will crop the images in Figure 3 so as to show them at the same scale as in Figure 4.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      Summary

      Ho et al. describes the developmental functions of the Drosophila Casc3 ortholog, Barentsz (Btz) using in vivo loss-of-function and rescue experiments in Drosophila larvae. In this study, the authors find that loss of Casc3 contributes to neuromuscular defects in the larval fly. Utilizing transgenics of WT and EJC interaction-defective mutants, they demonstrate that Btz has both EJC-dependent and independent functions in the larval neuromuscular junction, wherein muscle defects are EJC dependent and synaptic defects are EJC-independent. Using RNA-seq, they find that upregulated mRNAs include those that belong to the Activin signaling pathway. They go on to find that the neuromuscular defects in Btz mutants can be attributed to dysregulation of Activin signaling, and are rescued with loss of the Activin ligand, Dawdle (Daw).

      Major Comments

      Overall, the paper presents well-controlled experiments that support the main conclusions. We propose achievable validation experiments that we believe will strengthen the conclusions of the paper. There is some concern that the magnitude of the effects are overstated, or could be made more apparent to a broader audience (i.e. those in the mRNA regulation field beyond Drosophila geneticists).

      • In Figure 1, regarding the validation of rescue constructs: the EJC interaction-defective mutant is based solely on conservation, as all structural/interaction studies cited with Btz bound to EJC have been with human proteins. They use Vasa localization as a readout of EJC-dependent function, but this is indirect and only assesses one aspect of EJC function (localization). Since many of the main conclusions in the paper are predicated on this mutant being EJC-independent, they should validate this with the Drosophila orthologs using immunoprecipitation. They demonstrate the capability of expressing GFP-tagged versions of Casc3 WT and mutant in S2 cells, so this should not be a cumbersome control experiment to include.

      • Regarding Figure 3, it could be postulated that the number of boutons would be influenced by the length of axons. Is axon outgrowth accounted for in these experiments? This would influence number of synaptic boutons. Panel F looks very different from panel A in terms of axon length (could this be due to axon outgrowth defect and/or impacted muscle size?) Can quantitation be done also by normalizing to axon length (bouton number/axon length)? Or perhaps this is accounted for in muscle size? If so, this should be explained.

      • In Figure 3 quantification: n's vary between genotypes significantly, and this should be explained (e.g. was there a recovery issue between genotypes or just fewer needed for WT-like?).

      • In Figure 4 panels B and F (mutants), there appears to be reduced axon outgrowth (see point above). This should be taken into account when expressing bouton number.

      • The RNA-seq data (Figure 5) has a potential issue in that they used larvae with a balancer chromosome (Df), which yields a 50% reduction in any genes on that chromosome. They acknowledge this and removed these genes from the analysis, but the concern remains that this still might be a confounding variable (for example, if reduction in any of these genes might disrupt a signaling pathway). We do not think that the RNA-seq needs to be repeated, but we propose that the authors validate these targets using qPCR in their MN-specific btz knockdown system (this way, they can also include magoh and eif4aIII knockdowns for comparison).

      Minor comments

      Some statements made in the introduction that are not entirely accurate:

      • "A fourth core subunit, known as Barentsz (Btz), Cancer susceptibility candidate gene 3 (CASC3), or Metastatic lymph node 51 (MLN51), associates with the complex following the completion of splicing, and is required for the effects of the EJC on translation, NMD and mRNA localization (Chazal et al., 2013; Palacios et al., 2004; Shibuya et al., 2006; van Eeden et al., 2001)."

      A recent study indicates that Casc3 is not required for EJC-dependent NMD targets in human cells, but rather enhances NMD on a subset of targets (Gerbracht et al. 2020 NAR). Perhaps "is required" should be changed to "plays a role in cytoplasmic EJC-mediated processes, such as...". It has also been shown that EJC core can assemble without Casc3 (e.g. Ballut et al 2005 NSMB, Gehring et al 2009 PLoS Biol). Previous work from the authors show that Casc3 (Btz) is not necessary for EJC function in pre-mRNA splicing (Roignant et al, 2010 Cell). Further, there exists a population of Casc3 lacking EJCs in human cells (Mabin et al 2018 Cell Reports). Collectively, all this evidence points to Casc3 not being a core EJC subunit.

      • "In the mouse brain, haploinsufficiency for Magoh, Rbm8a or Eif4a3 causes severe microcephaly, but complete loss of Casc3 has a much milder effect that can be attributed to developmental delay (Mao et al., 2017; Mao et al., 2016; Mao et al., 2015; Silver et al., 2010)."

      From Mao et al 2017: complete loss and hypomorphic mutants were embryonic and perinatally lethal (contrary to what the authors are stating here), while compound mutants and heterozygotes exhibited neurodevelopmental delay. By "milder effects" the authors could also be referring to brain size being proportional to body size in the complete loss homozygotes; either way, this should be clarified.

      General minor comments:

      • Fly-specific nomenclature could be made more accessible to a broader audience, as the full readership will likely not have expertise in Drosophila genetics. For example, w118, btz2 labels used in figures are not explained anywhere in the manuscript. While the authors do a good job of describing various mutants in a more accessible fashion in the results section, the genotype labels in figures can be better explained in the legends.

      • Fig 2 L-N panels might warrant more explanation. Can the mitochondria be counted here? Is there also a difference in volume/morphology that could be quantitated? In Figure 2N, muscle fibers are more densely packed in mutant vs. control; can this be explained?

      • In Fig 2, to draw parallels between panels A-K and L-N, it might also be helpful to use the red/yellow arrow system on panel A for comparison.

      • In Figure 3, it might be helpful for a general audience to include zoomed-in picture of boutons (as in Fig 5B), as some panels appear to have less defined bouton shape.

      • Is the bouton size different in the mutant in Figure 3? Can this be quantified?

      • Fold changes are modest and not very apparent in staining (we acknowledge that this could be due to early developmental time point). Images could better point out differences in WT vs. mutant that are not readily apparent to those outside the fly neurodevelopment audience.

      • Fig 4 NMJs are shown on different scale (more zoomed in) than in Figure 3, and differences are bit easier to see at this scale. Presenting Fig 3 on this scale might help the reader with visualizing the differences in WT versus mutant.

      Significance

      Overall, this paper contributes conceptually to understanding EJC-mediated mRNA regulation during development. The contribution here is incremental, but meaningful in terms of defining the scope of regulation by the EJC and its peripheral factors in various contexts. These findings will likely be of interest to the fields of RNA metabolism and neurodevelopment. It also adds to the existing work suggesting Casc3 may have additional functions outside of the EJC (e.g. Mao et al. 2017 RNA, Baguet et al 2007 J Cell Sci, Cougot et al. 2014 J Cell Sci); while these previous studies have suggested Casc3 roles in development and mRNA localization/granule formation that are different from the EJC core proteins, this study more directly tests an EJC-independent role in mRNA regulation of specific targets. Further addressing the molecular basis of this regulation will be outside the scope of this article but will be of interest to the field.

      We are molecular biologists who study NMD and are thus equipped to address the EJC-related molecular functions and impact on the transcriptome. We do not have expertise in Drosophila genetics or neurobiology, and thus cannot critically evaluate the specific genetic approaches used or anatomy presented to the full extent. We have, however, pointed out areas that need elaboration regarding the genetic approaches and/or presentation of data that may be unfamiliar to a broader audience (i.e. the RNA metabolism field).

    1. $$ \begin{array}{l} a x^{2}+2 b x y+c y^{2} \text { 可以写作 } \\ {\left[\begin{array}{ll} x & y \end{array}\right]\left[\begin{array}{ll} a & b \\ b & c \end{array}\right]\left[\begin{array}{l} x \\ y \end{array}\right]=1} \end{array} $$

      更线性代数的形式 $$ \left.\begin{array}{l} {\left[\begin{array}{ll} \boldsymbol{x} & \boldsymbol{y} \end{array}\right]\left[\begin{array}{ll} a & b \ b & c \end{array}\right]\left[\begin{array}{l} \boldsymbol{x} \ \boldsymbol{y} \end{array}\right]=1} \ \boldsymbol{X}=\left[\begin{array}{l} \boldsymbol{x} \ \boldsymbol{y} \end{array}\right] \ \boldsymbol{A}=\left[\begin{array}{ll} a & b \ b & c \end{array}\right] \end{array}\right} \quad \Longrightarrow \boldsymbol{X}^{T} \boldsymbol{A} \boldsymbol{X} $$

    1. SciScore for 10.1101/2021.04.16.440101: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Thirty-six female K18-hACE2 mice (Jackson Laboratory, Bar Harbor, USA) were infected intranasally under isoflurane anesthesia with 300 FFU of SARS-CoV-2 strain MUC-IMB-1 p.1 in a total volume of 50 μl.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">48-72 hours post-transfection, cells were harvested without trypsin treatment, washed in FACS buffer (PBS with 0.5% bovine serum albumin and 1 nmol sodium azide) and used for binding assays or frozen in aliquots at −70°C. 105 thawed or freshly transfected cells were incubated first in wells of a 96-well plate with 100μl undiluted hybridoma supernatant or 100 μl mouse serum (1:200 dilutions in R10+ medium), and bound antibodies were detected with a mix of Cy5-conjugated goat anti-pan-mouse IgG-Cy5 conjugated goat anti-mouse (Southern Biotechnology, Birmingham, USA, #SBA-1030-15) antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-pan-mouse IgG-Cy5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse (Southern Biotechnology,</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 105 cells were fixed for 20 min in 2% paraformaldehyde (Morphisto, Frankfurt am Main, Germany) diluted in PBS, washed twice with FACS buffer, resuspended in permeabilization buffer (0.5% Saponin Sigma Aldrich, Taufkirchen, Germany, in FACS buffer) containing fluorochrome-conjugated murine H and L isotype-specific antibodies (antimouse IgG1-APC # 550874 and anti-mouse IgG3-bio # 020620 from BD, Franklin Lakes, USA, antimouse IgG2b-PE SBA-1090-09 and anti-mouse IgG2c-bio SBA-1079-08 from Southern Biotech, Birmingham, USA, anti-mouse Ig light chain lambda APC # 407306 and anti-mouse IgG light chain kappa PE both from Biolegend, San Diego, USA) and incubated for 1 hour at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antimouse IgG1-APC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG3-bio</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antimouse IgG2b-PE SBA-1090-09</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG2c-bio</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse Ig light chain lambda APC</div><div>suggested: (BioLegend Cat# 407306, RRID:AB_961363)</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Competitional binding in the ELISA set up was achieved by applying 50 μl/well of 0.25 μg/ml human ACE2-Biotin (Acro Biosystems, Beijing, China, # A011-214) followed by 50 μl/well serially 2-fold pre-diluted TRES antibodies (2 μg/ml start concentration).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2-Biotin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 1 hour the cells were washed, and a goat anti-human IgG FITC (Jackson ImmunoResearch, West Grove, USA #109-096-088) antibody was applied.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG FITC</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-096-088, RRID:AB_2337666)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were incubated for 30min on ice, washed, and bound antibodies were detected with a mouse IgG2a Alexa647-conjugated antibody directed against human IgG-Fc (BioLegend, San Diego, USA #409320).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>mouse IgG2a</div><div>suggested: (BioLegend Cat# 409320, RRID:AB_2563330)</div></div><div style="margin-bottom:8px"><div>human IgG-Fc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TRES6 and TRES328 antibodies were incubated for one hour at a concentration of 200 ng/ml with 2×106 TCID50 of the CoV2-ER1 virus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TRES6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>TRES328</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 infected cells were visualized using SARS-CoV-2 S protein specific immunochemistry staining with anti-SARS-CoV-2 spike glycoprotein S1 antibody (Abcam, Cambridge, Great Britain) as described previously [64].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 spike glycoprotein S1</div><div>suggested: (Abcam Cat# ab273074, RRID:AB_2847846)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice were boosted intramuscularly either with i) 5 μg of the S protein of SARS-CoV-2 stabilized in a pre-fusion conformation (designated SARS-CoV-2-S protein) and adjuvanted with 25 μg Monophosphoryl Lipid A (MPLA) liposomes (Polymun Scientific GmbH, Klosterneuburg, Austria) into the hind leg, ii) by electroporation of the DNA vaccines used for priming, or iii) with exosomes purified from HEK-293T cells transiently transfected with SARS-CoV-2 DNA as described previously [38].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 2×108 spleen cells and inguinal lymph node cells (about 1×108 B cells) were mixed with 108 Sp2/0 cells and washed 3 times with RPMI1640 medium (Gibco, Thermo Fisher Scientific, Waltham, USA) without FCS. 2 ml PEG was added dropwise within one minute to the suspended cell pellet.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sp2/0</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The S protein was purified from transiently transfected HEK-293F cells as described previously [59].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of escape mutants: 5×106 Vero-E6 cells were seeded on the day before infection in T175 flasks.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice: The TRIANNI C57/Bl6 mouse line HHKKLL was established in cooperation with TRIANNI (Patent US 2013/0219535 A1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57/Bl6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Thirty-six female K18-hACE2 mice (Jackson Laboratory, Bar Harbor, USA) were infected intranasally under isoflurane anesthesia with 300 FFU of SARS-CoV-2 strain MUC-IMB-1 p.1 in a total volume of 50 μl.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">EC50 values were calculated by plotting hACE2 activity against antibody concentrations and applying a 4-parameter curve fit using GraphPad Prism 7.02 (San Diego, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The consensus sequences were analyzed using VDJsolver [60] and IMGT/V-Quest [61].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IMGT/V-Quest</div><div>suggested: (IMGT/V-QUEST, RRID:SCR_010749)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. Author Response:

      Reviewer #1 (Public Review):

      The manuscript by Schrieber et al., explores whether inbreeding affects floral attractiveness to pollinators with additional factors of sex and origin in play, in male and female plants of Silene latifolia. The authors use a combination of spatial sampling, floral volatiles, flower color, and floral rewards coupled with the response of a specialized pollinator to these traits. Their results show that females are more affected by inbreeding and in general inbreeding negatively impacts the "composite nature" of floral traits. The manuscript is well written, the experiments are detailed and quite elaborate. For example., the methodology for flower color estimation is the most detailed effort in this area that I can remember. All the experiments in the manuscript show meticulous planning, with extensive data collection addressing minute details, including the statistics used. However, I do have some concerns that need to be addressed.

      Core strengths: Detailed experimental design, elaborate data collection methods, well-defined methodology that is easy to follow. There is a logical flow for the experiments, and no details are missing in most of the experiemnts.

      Weaknesses: A recent study has addressed some of the questions detailed in the manuscript. So, introduction needs to be tweaked to reflect this.

      Thank you very much for bringing this excellent article to our attention! We adjusted the writing in the introduction and the discussion accordingly. Please consider that this article was first published at the 15th of January 21, while our manuscript was submitted at the 9th of January. Hence, we were not able to account for this study in the first submission. Introduction pp 4-5, ll 48-54: “Although in a few cases inbreeding has been shown to alter single components of flower attractiveness (Ivey and Carr, 2005; Ferrari et al., 2006; Haber et al., 2019), insight into syndrome-wide effects is restricted to a single study. Kariyat et al. (2021) demonstrated that inbred Solanum carolinense L. display reduced flower size, pollen and scent production and receive fewer visits from diurnal generalists. It is necessary to broaden such integrated methodological approaches to other plant-pollinator systems (e.g., nocturnal specialist pollinators) and further floral traits (i.e., flower colour).” Discussion p 19, ll 535-542: “In summary, our research on S. latifolia suggests that in addition to inbreeding disrupting interactions with herbivores by changing plant leaf chemistry (Schrieber et al., 2018) it affects plant interactions with pollinators by altering flower chemistry. Our observations are in line with studies on other plant species (Ivey and Carr, 2005; Kariyat et al., 2012, 2021) and highlight that inbreeding has the potential to reset the equilibrium of species interactions by altering functional traits that have developed in a long history of co-evolution. These threats to antagonistic and symbiotic plant-insect interactions may mutually magnify in reducing plant individual fitness and altering the dynamics of natural plant populations under global change.”

      Some details and controls are missing in floral scent estimation. Flower age, a pesticide treatment of plants that could affect chemistry..needs to be better refined.

      We clarified this issue at different occasions in the methods section. Previous studies (and our study) on S. latifolia have shown no clear differences in the quality of floral scent between sexes. However, one study found higher total emission of VOC in males, while others found no differences. Hence, females produce no specific VOC that are used as oviposition cues but may be differentiated from males by the total amount of emitted VOC and pronounced differences in spatial flower traits. We highlight this at p 6, ll 111-116: “Silene latifolia exhibits various sexual dimorphisms with male plants producing more and smaller flowers that excrete lower volumes of nectar with higher sugar concentrations as compared to females (Gehring et al., 2004; Delph et al., 2010). The quality of floral scent exhibits no clear sex-specific patterns, while male plants have been shown to emit higher or equal total amounts of VOC as compared to females in different studies (Dötterl & Jürgens 2005, Waelti et al. 2009)”.

      Both male and female moths show pronounced behavioural responses to lilac aldehyde isomers and other VOC in the floral scent of S. latifolia (Dötterl et al., 2006). We therefore treated these VOC as typical floral scent compounds. We clarified this at p 7, ll 125-126: “A substantial fraction of floral VOC produced by S. latifolia triggers antennal and behavioural responses in male and female H. bicruris moths (Dötterl et al., 2006).” and p 9, ll 2010-218:” For targeted statistical analyses, we focused on those VOC that evidently mediate communication with H. bicruris according to Dötterl et al. (2006). We analysed the Shannon diversity per plant (calculated with R-package: vegan v.2.5-5, Oksanen et al. 2019) for 20 floral VOC in our data set that were shown to elicit electrophysiological responses in the antennae of H. bicruris (Supplementary File 1). Moreover, we analysed the intensities of three lilac aldehyde isomers, which trigger oriented flight and landing behaviour in both male and female H. bicruris most efficiently when compared to other VOC in the floral scent of S. latifolia. Furthermore, H. bicruris is able to detect the slightest differences in the concentration of these three compounds at very low dosages (Dötterl et al. 2006).”

      We used biological pest control agents in a preventive manner because S. latifolia is often infested by thrips and aphids under greenhouse conditions. The writing in the previous manuscript version was not clear with this regard and we changed the text at p 8, ll 157-161: ” Plants received water and fertilisation (UniversolGelb 12-30-12, Everris-Headquarters, NL) when necessary for the entire experimental period and were prophylactically treated with biological pest control agents under greenhouse conditions to prevent thrips (agent Amblyseius barkeri and Amblyseius cucumeris) and aphid (agent Chrysoperla carnea) infestation (Katz Biotech GmbH, GE) .”

      Indeed, flower size and scent emission can be correlated. Although the question whether differences in scent emission were based on a difference in flower size is an interesting one, it seemed less relevant to us because it is unlikely that our pollinators correct their perception of a scent for the size of a flower (see also p 19, 520-526). We were rather interested in whether scent emission differs between the plant treatments and thus pollinators may chemically perceive such differences. Moreover, we found it problematic to correct our models for flower size by including it as a covariate, which is the reason why we have not assessed this trait during scent collection. In this case, we would have corrected our scent responses for the effects of inbreeding, sex and population origin (i.e., the predictors we are interested in) because all of them determine the size of a flower (Figure 2 c,d). Hence, the inbreeding, sex and origin effects on flower scent would likely vanish. However, it is highly unlikely that the set of genes contributing to sex-, breeding treatment- and origin-based variation in flower size is exactly the same one that determines variation in scent emission per flower, which is basically the assumption underlying the model that includes flower size as a covariate. We critically mentioned the trade-off relationships and our reasoning to not correct for flower size at 9p ll 208-210: “The intensities of VOC were not corrected for flower size because we wanted to capture all variation in scent emission that is relevant for the receiver i.e., the pollinator.”

      While the study is laser-focused on floral traits, as the authors are aware inbreeding affects the total phenotype of the plants including fitness and defense traits. For example, there are quite a few studies that have shown how inbreeding affects the plant defense phenotype. This could be addressed in the introduction and discussion.

      We agree that this aspect is important and therefore addressed it in further detail in the introduction at p 4 ll 34-38: “While it is well established that inbreeding can increase a plant’s susceptibility to herbivores by diminishing morphological and chemical defences (Campbell et al., 2013; Kariyat et al., 2012; Kalske et al., 2014), its effects on plant-pollinator interactions are less well understood. Inbreeding may reduce a plant’s attractiveness to pollinating insects by compromising the complex set of floral traits involved in interspecific communication.” Since other referees suggested to rather tone down than increase the discussion based on floral scent results, we stick to the general feedback relationship among of herbivory and pollination, rather than relating it specifically to volatiles in the discussion at p 19, ll 535-544: “In summary, our research on S. latifolia suggests that in addition to inbreeding disrupting interactions with herbivores by changing plant leaf chemistry (Schrieber et al., 2018) it affects plant interactions with pollinators by altering flower chemistry. Our observations are in line with studies on other plant species (Ivey and Carr, 2005; Kariyat et al., 2012, 2021) and highlight that inbreeding has the potential to reset the equilibrium of species interactions by altering functional traits that have developed in a long history of co-evolution. These threats to antagonistic and symbiotic plant-insect interactions may mutually magnify in reducing plant individual fitness and altering the dynamics of natural plant populations under global change. As such, our study adds to a growing body of literature supporting the need to maintain or restore sufficient genetic diversity in plant populations during conservation programs.”

      Reviewer #2 (Public Review):

      A summary of what the authors were trying to achieve. This interesting and data-rich paper reports the results of several detailed experiments on the pollination biology of the dioceus plant Silene latfolia. The authors uses multiple accessions from several European (native range) and North American (introduced range) populations of S. latifolia to generate an experimental common garden. After one generation of within-population crosses, each cross included either two (half-)siblings or two unrelated individuals, they compared the effects of one-generation of inbreeding on multiple plant traits (height, floral size, floral scent, floral color), controlling for population origin. Thereby, they set out to test the hypothesis that inbreeding reduces plant attractiveness. Furthermore, they ask if the effect is more pronounced in female than male plants, which may be predicted from sexual selection and sex-chromosome-specific expression, and if the effect of inbreeding larger in native European populations than in North American populations, that may have already undergone genetic purging during the bottleneck that inbreeding reduces plant attractiveness. Finally, the authors evaluate to what extent the inbreeding-related trait changes affect floral attractiveness (measured as visitation rates) in field-based bioassays.

      An account of the major strengths and weaknesses of the methods and results. The major strength of this paper is the ambitious and meticulous experimental setup and implementation that allows comparisons of the effect of multiple predictors (i.e. inbreeding treatment, plant origin, plant sex) on the intraspecific variation of floral traits. Previous work has shown direct effects of plant inbreeding on floral traits, but no previous study has taken this wholesale approach in a system where the pollination ecology is well known. In particular, very few studies, if any, has tested the effects of inbreeding on floral scent or color traits. Moreover, I particularly appreciate that the authors go the extra mile and evaluate the biological importance of the inbreeding-induced trait variation in a field bioassay. I also very much appreciate that the authors have taken into account the biological context by using a relevant vision model in the color analyses and by focusing on EAD-active compounds in the floral scent analyses.

      The results are very interesting and shows that the effects of inbreeding on trait variation is both origin- and sex-dependent, but that the strongest effects were not always consistent with the hypothesis that North American plants would have undergone genetic purging during a bottleneck that would make these plants less susceptible to inbreeding effects. The authors made a large collection effort, securing seeds from eight populations from each continent, but then only used population origin and seed family origin as random factors in the models, when testing the overall effect of inbreeding on floral traits. It would have been very interesting with an analysis that partition the variance both in the actual traits under study and in the response to inbreeding to determine whether to what extent there is variation among populations within continents. Not the least, because it is increasingly clear that the ecological outcome of species interactions (mutualistic/antagonistic) in nursery pollination systems often vary among populations (cf. Thompson 2005, The geographic mosaic of coevolution), and some results suggest that this is the case also in Hadena-Silene interactions (e.g. Kephardt et al. 2006, New Phytologist). Furthermore, some plants involved in nursery pollination systems both show evidence of distinct canalization across populations of floral traits of importance for the interaction (e.g. Svensson et al. 2005), whereas others show unexpected and fine-grained variation in floral traits among populations (e.g. Suinyuy et al. 2015, Proceedings B, Thompson et al. 2017 Am. Nat., Friberg et al. 2019, PNAS). Hence, it is possible that the local population history and local variation in the interactions between the plants and their pollinators may be more important predictors for explaining variation in floral trait responses to inbreeding, than the larger-scale continental analyses. Not the least, because North American S. latifolia probably has multiple origins, with subsequent opportunity for admixture in secondary contact.

      Yes, it is necessary to put populations from the same continent into one category, since native and invasive plant populations differ significantly in their evolutionary history (p 5, ll 74-81, http://onlinelibrary.wiley.com/doi/10.1111/j.1365-294X.2012.05751.x). Origin explained sufficient amounts of variation in several traits including flower number, corolla expansion, VOC diversity, lilac aldehyde A intensity, and pollinator visitation rates (see Figures 2-3; and Table 2) and some variation in in the magnitude of inbreeding effects (Figure 2e, f; Figure 3). Even if we would not be interested in differences among native and invasive populations, we would have to include origin as a fixed effect in our models because:

      i) populations within a distribution range are no independent samples,

      ii) origin explains sufficient variation in many responses,

      iii) origin cannot be fitted as a random factor, since it has only two levels (the minimum number of levels for random effect is 4). We agree that it would be very interesting to specifically assess differences in the magnitude of breeding and sex effects among populations within origins. We now discuss this as important future research direction at p 18, ll 500-507: “As such, the precise mechanisms underlying variation in inbreeding effects on different scent traits across population origins of S. latifolia can only be explored based on comprehensive genomic resources, which are currently not available. Future studies should also incorporate field-data on the abundance of specialist pollinators and extend the focus from variation in the magnitude of inbreeding effects among geographic origins to variation among populations within geographic origins and individuals within populations. This would allow a detailed quantification of geographic variation in inbreeding effects and elaborating on the causes and ecological consequences of such variation (Thompson, 2005; Schrieber and Lachmuth, 2017; Thompson et al., 2017)”.

      To empirically address within-origin variation of inbreeding effects with our data, we would have to i) fit correlated random intercepts and slopes for the interaction breeding-sex on the population random factor (models consume min. 22 DF); or ii) include population as a fixed effect in our models (models consume min. 67 DF). We have tried both of these approaches when preparing the revision, but unfortunately it turned out that our study is not designed to address this question. The models for both variants only partially converge (see R-script ll. 1568-1580), and even if they do this does not imply that one can draw solid inference from them. Approach i often results in multiple singular convergence warning messages implying that no variance is explained by population-specific reaction norms to the fixed effects specified in the random effects structure. Approach ii results in odd rank- deficient models (I was seriously worried about type I errors). We simply have too few replicates (5) per population-breeding treatment-sex combination for both approaches. For solid inference we would need 10approach i-40approach ii replicates = 640-2600 individuals. However, our experimental design is sufficient to address the hypothesis we have raised in the introduction as well as general differences in response variables among populations. We now provide information on variance partitioning for all models that include population as a random effect in S9. As you will see, population explains lower amounts of variation in our responses as the fixed effects in 9 out of 12 models. The random effects maternal and paternal genotype (mother&father) explain more variation than the random effect population in 6 of 12 cases. Thus, these data do not make a strong case for an extensive discussion of population-based differences in floral traits and this was also not a question or hypotheses we wanted to address with our study.

      I see no major weaknesses in the study, and but in my detailed response, I have made a few questions and suggestions about the floral scent analyses. In short, the authors have used a technique that is not the standard method used for making quantitative floral scent analyses, and I am curious about how it was made sure that the results obtained from the static headspace sampling using PDMS adsorbents could be used as a quantitative measure. I would suggest the authors to validate the use of this method more thoroughly in the manuscript, and have detailed this comment in my response to the authors.

      Also, and this may seem like a nit-picky comment, I am not convinced that the best way to describe the traits under study is "plant attractiveness", because in the experimental bioassays, most of the traits under study that are affected by the inbreeding treatment, did not result in a reduced pollinator visitation. Most (or all) of these traits may also be involved in other plant functions and important for other interactions, so I suggest potentially using a term like "floral traits" or "(putative) signalling traits".

      We now avoid the term floral attractiveness throughout the manuscript and instead refer to “floral traits”.

      An appraisal of whether the authors achieved their aims, and whether the results support their conclusions: By and large, the authors achieved the aims of this study, and drew conclusions based in these results. One interesting aspect of this work that I think could be discussed a bit deeper is the lack of congruence between the effects of inbreeding on floral traits and the variation in visitation pattern in the bioassay. In fact, the only large effect of inbreeding on a floral trait that may play a role as an explanatory factor is the reduction of emission of lilac aldehyde A in inbred female S. latifolia from North America, which correspond to a reduced visitation rate in this group in the pollinator visitation bioassay. I have made some specific suggestions in my comments to the authors.

      We agree that this aspect required deeper discussion and revised the section at p 19, ll 520-526 accordingly. We believe that the limited spatial vision of H. bicruris in combination with our experimental setup for pollinator observations increased the relative importance of floral scent for pollinator visitation rates (suggested by referee #3).

      A discussion of the likely impact of the work on the field, and the utility of the methods and data to the community: I think that one important aspect of this work that may broaden the impact of this study further is the link between these experiment, and our expectations from the evolution of selfing. Selfing plant species most often conform to the selfing syndrome, presenting smaller, less scented flowers than outcrossing relatives. Traditionally, the selfing syndrome is explained by natural selection against individuals that invest energy into floral signalling, when attracting pollinators is no longer crucial for reproduction. Some studies (for example Andersson, 2012, Am. J. Bot), however, have shown that only one, or a few, generations of inbreeding may reduce floral size as much as quite strong selection for reduced signalling. Here, at least for some populations and sexes, similar results are obtained in this paper regarding several traits (including floral scent), and one way to put this paper in context is by discussing the results in the light of these previous papers.

      We now address this issue at p 16, ll 417-420: “However, our findings highlight that even weak degrees of biparental inbreeding (i.e., one generation sib-mating) can result in a severe reduction of spatial flower trait and scent trait values that is detectable against the background of natural variation among multiple plant populations from a broad geographic region. This observation indirectly supports that the selfing syndrome (i.e., smaller, less scented flowers observed in selfing relative to outcrossing populations of hermaphroditic plant species) may not merely be a result of natural selection against resource investment into floral traits, but also a direct negative consequence of inbreeding (Andersson, 2012).”

      Reviewer #3 (Public Review):

      Schrieber et al. studied the effects of biparental inbreeding in the dioecious plant Silene latifolia, focusing specifically on traits important for floral attractiveness and pollinator attraction. These traits are especially important for dioecious species with separate sexes as they are obligate outcrossers. The authors find that inbreeding mostly decreases floral attractiveness, but that this effect tended to be stronger in the female flowers, which the authors suspect to result from the trade-off with larger investment in the sexual functions in the female plants. The authors then go on to couple the changes in visual and olfactory floral traits to pollinator attraction which allows them to conclude or at least speculate that differences in pollinator behavior are mostly driven by the changes in olfactory traits. The study is robust in its broad and well-balanced sampling of populations, rigorous and in large part meticulously documented experimental designs and linking of the effects on mechanisms to ecological function. The hypothesis are clearly stated and the study is able to address them mostly convincingly. However, some of the aspects of the decisions the authors made and possible caveats need to be addressed and elaborated on.

      A major caveat, in my opinion, is that while the authors find stronger effects of inbreeding on pollinator visitation rates in the plants from the North American (Na) origin, these plants were tested in an environment that was foreign to them, which could have important consequences for the results of this study. This is specifically because the main pollinator Hadena bicruris moth is completely absent from the populations in Na, and yet, was the main pollinator observed in the pollinator attraction experiment. As this pollinator is also a seed predator, the Na populations are released from the selection pressure to avoid attracting the females of this species and thus risking the loss of seeds and fitness. In fact, some of the results suggest that the release from the specialist pollinator and seed predator in Na has led to increase in the attractiveness of the female flowers based on the higher number of flowers visited in the outcrossed females compared to outcrossed males in the plant from the Na origin and the similar, though not statistically significant, pattern in the olfactory cue. While ideally this pollinator attraction experiment should be repeated within the local range of the Na plants, this is of course is not feasible. Instead I suggest the problem should be addressed in the discussion explicitly and its consequences for the interpretation of the results should be considered.

      Indeed, North American populations are tested in their “away”- habitat only and the observed plant performance and pollinator visitation rates can thus provide no direct implications for their “home”-habitat. We state this now more clearly at pp 11-12, ll 283-285. However, our design is appropriate for investigating inbreeding effects on plant-pollinator interactions in multiple plant populations in a common environment. Given the close taxonomic relationship of H. bicruris (main pollinator in Europe) and H. ectypa (main pollinator in North America), the behavioural responses of the former species to variation in the quality of its host plant was considered to overlap sufficiently with responses of the latter species as outlined at pp 11-12, ll 285-291.

      The hypothesis that North American (NA) S. latifolia evolved higher attractiveness to female Hadena moths because H. ectypa is not able to oviposit on female plants in contrast to H. bicruris is indeed a highly interesting one. However, as you have outlined correctly, our study is not designed to elaborate on questions related to adaptive evolutionary differentiation among North American and European plants. Instead of addressing this hypothesis based on our data, we thus take reference to previous studies in the discussion p 17, ll 482-487: “As discussed in detail in previous studies, higher flower numbers in North American S. latifolia plants (Figure 1b) may result from changes in the selective regimes for numerous abiotic factors (Keller et al., 2009) or from the release of seed predation. As opposed to H. bicruris, H. ectypa pollinates North American S. latifolia without incurring costs for seed predation, which may result in the evolution of higher flower numbers, specifically in female plants (Elzinga and Bernasconi, 2009).”

      The incorporation of the VOC data in the actual manuscript was quite limited and I found the reasoning for picking only the three lilac aldehydes (in addition to the Shannon diversity index) for the univariate statistical tests insufficient. How much more efficient was the effect of the lilac aldehydes compared to the other 17 compounds deemed important in the previous study? While the data on this one aldehyde matches the pollinator attraction results, having one compound out of 70 (or out of 20 if only considering the ones identified important for the main pollinator) seems, perhaps, fortuitous lest there is a good reason for focusing on these particular compounds.

      We adapted the text to increase clarity but sticked to our previous choice for the analyses of VOC data.

      i) We now explain our choice of analysing lilac aldehydes with more detail p9, ll 210-218: “For targeted statistical analyses, we focused on those VOC that evidently mediate communication with H. bicruris according to Dötterl et al. (2006). We analysed the Shannon diversity per plant (calculated with R-package: vegan v.2.5-5, Oksanen et al. 2019) for 20 floral VOC in our data set that were shown to elicit electrophysiological responses in the antennae of H. bicruris (Supplementary File 1). Moreover, we analysed the intensities of three lilac aldehyde isomers, which trigger oriented flight and landing behaviour in both male and female H. bicruris most efficiently when compared to other VOC in the floral scent of S. latifolia. Furthermore, H. bicruris is able to detect the slightest differences in the concentration of these three compounds at very low dosages (Dötterl et al. 2006).”

      ii) If one analyses 20 compounds with zero-inflation models (actually two models in one) + 8 floral trait models + 2 pollinator visitation models (zi-models with two component models), one ends up with 52 models investigating complex fixed and random effect structures. To keep type-1 errors as low as possible (see also comment 2.12.b from Referee#2), we approached the more comprehensive VOC data sets with multivariate analyses or Shannon diversity.

      iii) We tested the effect of sexoriginbreeding treatment on the Shannon diversity of 20 active VOC as well as in the random forest analyses with the 20 VOC and 70 VOC dataset and transparently reported the results from all of these analyses in the manuscript. Hence, the incorporation of VOC data was not limited. However, we agree that we have taken too little reference to these results and now changed the text accordingly. Results section p 13 ll 351-354: ”Multivariate statistical analyses of 20 H. bicruris active VOC and all 70 VOC detected in S. latifolia revealed no clear separation of floral headspace VOC patterns for any of the treatments (Figure 2-figure supplement 2). In summary, the combined effects of breeding treatment, sex and range on floral scent were rather week.”

      Sampling time of VOCs is reported ambiguously. Was it from 21:00 to 17:00 the next day or in fact from 9pm to 5AM (instead of 5 pm as reported)? Please be more specific in the text as this is quite important. If sampling tubes were left in place during the daytime, some of the compounds could have evaporated due to heating of the tubes in the summer. It would also be important to mention whether all of the headspace VOCs were sampled on the same day and whether there could be variation in i.e. temperature.

      Thank you very much for identifying this typo! It is from 9 pm to 5 am (p 9, l 186).

      Considering the experimental setup for the pollinator attraction observations and the pooling of the data at the block level (which I think is the right choice) it seems possible the authors were more likely to get a result where pollinator behavior matches the long-distance cue, the VOCs. Short-distance cues such a subtle difference in flower size would perhaps not be distinguished with the current setup. I would be interested to know if the authors agree, and if so, mention this in the discussion.

      Thank you very much for this excellent suggestion! We agree and discuss this aspect in detail at p 19, ll 520-526. Indeed, one would need two different experimental setups to assess the contributions of long and short distance cues. Our setup (large distances among plots) is optimal for long distance cues, while a setup for short distance cues should have all plants in close spatial proximity. However, the latter approach does then not allow to address long-distance cues and to exclude competition/facilitation for pollinators among plants from different treatment groups.

    1. SciScore for 10.1101/2021.04.15.440004: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following two washes in D-BSA, cells were incubated with a fluorescently labelled goat anti-rabbit antibody (Molecular Probes) at a dilution of 1:1000 for 1 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The datasets are composed as following: human lung biopsies of SARS-CoV-2 infected patients and uninfected control; A549 cell line infected with SARS-CoV-2, A549 cell line infected with SARS-CoV-2 overexpressing ACE2, Calu-3 cells infected with SARS-CoV-2; NHBE cell line infected with SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: KCLB Cat# 30055, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Caco-2 cells stably expressing human ACE2 were generated by transduction with third generation lentivirus pLenti7.3 ACE2-EGFP, where the expression of EGFP if guided by an internal ribosome entry site downstream of the ACE2 coding sequence in the same messenger RNA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All cells were grown in DMEM media supplemented with 10% fetal calf serum (FCS), pen/strep, L-glutamine, and passaged 1:10 (HEK-293T-ACE2-TMPRSS2) or 1:6 (Caco-2-ACE2), every three days.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus was propagated once in Calu-1 cells and once in VeroE6-TMPRSS2 cells before sequencing and storage at −80 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>VeroE6-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus titers were determined by plaque assay in VeroE6 TMPRSS2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6 TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RNA-Seq data preprocessing: Human transcriptomics datasets analysed in this study were retrieved from the Gene Expression Omnibus (GEO) repository, annotated with the GEO ID GSE147507 (Blanco-Melo et al., 2020; Daamen et al., 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene Expression Omnibus</div><div>suggested: (Gene Expression Omnibus (GEO, RRID:SCR_005012)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Filtered counts were then normalized through the upper quartile method implemented in the NOISeq package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NOISeq</div><div>suggested: (NOISeq, RRID:SCR_003002)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differential expression analysis was carried out by using the DESeq2 Bioconductor package (Love et al., 2014) and the p values were adjusted using the Benjamini-Hochberg method (Benjamini and Hochberg, 1995).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div><div style="margin-bottom:8px"><div>Bioconductor</div><div>suggested: (Bioconductor, RRID:SCR_006442)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Outliers were identified by using the RLE, NUSE from the affyPLM package (2005) and the slope of the RNA degradation curve implemented in the affy package (Gautier et al., 2004).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>affyPLM</div><div>suggested: (affyPLM, RRID:SCR_001319)</div></div><div style="margin-bottom:8px"><div>affy</div><div>suggested: (affy, RRID:SCR_012835)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The probes were annotated to Ensembl genes (by using the rat2302rnensgcdf (v. 22.0.0) annotation file from the brainarray website4, and the resulting expression matrix was quantile normalized by using the normalizeQuantile function from the limma package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>limma</div><div>suggested: (LIMMA, RRID:SCR_010943)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DrugBank (Wishart et al., 2006, 2018) contains 13579 drug entries, including 2635 approved small molecule drugs, and over 6375 experimental drugs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DrugBank</div><div>suggested: (DrugBank, RRID:SCR_002700)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the 8775 matched compounds, substructure fingerprints were retrieved from PubChem by querying it by CID identifiers.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubChem</div><div>suggested: (PubChem, RRID:SCR_004284)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We created an augmentation pipeline containing 7 main transformations where each transformation instance is applied with a probability of 0.5 implemented using the Numpy scientific programming library and the Pillow package10 for Python (Harris et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Numpy</div><div>suggested: (NumPy, RRID:SCR_008633)</div></div><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.14.439891: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Serum preparation: For human samples, informed consent was obtained from the subjects prior to blood draw.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mouse vaccination: Eight-to twelve-week-old female BALB/c mice were purchased from The Jackson Laboratory and housed in the Laboratory Animal Facility of the Stanford University Medical Center.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In some assays, a human anti-RBD (Invivogene) of known antibody concentration was used as standard.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RBD was then detected using an Alexa Fluor 488 conjugated anti-His antibody (clone J099B1, Biolegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As positive control a neutralizing human anti-SARS-Cov-2 IgG1 antibody was used (Acro).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-Cov-2 IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were cultured in 96-well plates (Corning, V-bottom) at 1×106 cells/well and stimulated for 48 hours with 5 μg/mL of RBD-His or hCD81-His or media alone (RPMI + 5% FCS) in the presence of anti-mouse CD28 antibody [0,5 µg/ml] (Southern Biotech).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>hCD81-His</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse CD28</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following stimulation, cells were washed, stained with Aqua Live/dead viability dye (Thermo Fisher) in PBS, washed two additional times and stained with a cocktail of monoclonal antibodies and Fc block: CD16/32, CD4 BV605 RM4-5, CD8 FITC 53-6.7, CD44 APC IM7, CD69 PE-Cy7 H1.2F3, CD134 BV786 OX-86</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD44</div><div>suggested: (BD Biosciences Cat# 563736, RRID:AB_2738395)</div></div><div style="margin-bottom:8px"><div>CD69</div><div>suggested: (BD Biosciences Cat# 563834, RRID:AB_2738441)</div></div><div style="margin-bottom:8px"><div>CD134</div><div>suggested: (BD Biosciences Cat# 744746, RRID:AB_2742454)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As positive control cells were stimulated with anti-mouse CD3 [0,05 µg/ml] (Southern Biotech) and anti-mouse CD28 antibody [0,5 µg/ml] (Southern Biotech).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse CD3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following stimulation, cells were washed, stained with Aqua Live/dead viability dye (Thermo Fisher) in PBS, washed two additional times and stained with a cocktail of monoclonal antibodies and Fc block: CD16/32, CD4 Ax700 RM4-5, CD8 APC-H7 53-6.7,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD4</div><div>suggested: (Miltenyi Biotec Cat# 130-109-536, RRID:AB_2657974)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tests were performed in triplicates and with a positive control (anti-CD3 monoclonal antibody (0,05 µg/ml; Southern Biotech)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After stimulation wells were washed and incubated with a biotinylated anti-IFNγ antibody (R&D systems, mouse IFNγ Kit Cat # EL485) overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IFNγ</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Hela and 293F transfection: Hela cells and 293F cells were plated at 106 cells per well in a 12 well plate in Opti-MEM media (ThermoFisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293F</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One day before transfection, 6 x 106 HEK293T cells were seeded in a 10-cm culture plate in RPMI containing 10% FCS, 2mM L-glutamine, streptomycin and penicillin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For viral neutralization assays, ACE2-expressing HEK293T46 cells were plated in poly-L-lysine-coated, white-walled</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T46</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse vaccination: Eight-to twelve-week-old female BALB/c mice were purchased from The Jackson Laboratory and housed in the Laboratory Animal Facility of the Stanford University Medical Center.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed, fixed with 2% formaldehyde and acquired on a BD LSR II and analyzed using Cytobank V7.3.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cytobank</div><div>suggested: (Cytobank, RRID:SCR_014043)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 3. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.14.439793: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Cell culture: All experiments including human and animal tissues were approved by the ethics committee of the Shanghai Jiao Tong University Affiliated Shanghai Sixth People’s Hospital.<br>IACUC: All protocols were approved by the Institutional Animal Care and Use Committees of Guangzhou Medical University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cells were confirmed by PCR to be free of mycoplasma contamination.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then incubated with a rabbit anti-SARS-CoV nucleocapsid protein polyclonal antibody (Cat. No.: 40143-T62, Sino Biological, Inc. Beijing), followed by an HRP-labelled goat anti-rabbit secondary antibody (Cat. No.: 111-035-144, Jackson ImmunoResearch Laboratories, Inc. West Grove, PA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV nucleocapsid protein</div><div>suggested: (Creative Diagnostics Cat# DMAB8869, RRID:AB_2392503)</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (Proteintech Cat# SA00006-2, RRID:AB_2651036)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After permeabilizing in 0.1% Triton X-100 in PBS for 5 min, cells were incubated with 3% BSA-PBS for 30 min to block nonspecific antibody binding and then incubated with SARS-CoV-2 nucleocapsid protein antibody (Sino Biological), followed by incubating with Alexa Fluor 488 (Thermo).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 nucleocapsid protein</div><div>suggested: (Bioss Cat# bsm-41414M, RRID:AB_2848129)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BMMs were labelled by F4/80 antibody (Abcam), followed by incubating with Cy3-labeled Goat Anti-Rat IgG(H+L) (Beyotime).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Rat IgG(H+L</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Membranes were incubated with primary antibodies, including actin JLA20 antibody (Developmental Studies Hybridoma Bank),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>actin</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cells (derived from African Green monkey kidney) were grown in (DMEM, Thermo) supplemented with 10% FBS (Thermo) and 1% P/S (Thermo).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production and infection of SARS-CoV-2 pseudovirus: HEK293T cells were transfected with psPAX, plentiv2-Tdtomato and plasmid that carried SARS-Cov-2 S gene or empty vector using Lipofectamine 3000 (Thermo)34</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 infection in Balb/c mouse: Ad5-hACE2 transduced Balb/c mouse model were described previously25.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Balb/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fiji (National Institutes of Health) was employed to analyze and assemble images.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then the feature-barcode matrices were obtained by aligning reads to the mouse genome (GRCm38 Ensemble: version 92) using CellRanger v3.1.0</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CellRanger</div><div>suggested: (SCIGA, RRID:SCR_021002)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: The data were graphed and statistically analysed using GraphPad Prism 8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.13.439274: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">229E S protein was detected with treating the cells with 100 μL (1:50 dilution) of the mouse anti-229E S protein antibody 9.8E12 90 by the inverted drop technique for 1 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-229E S protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following primary antibody incubation, cells were washed and treated with AlexaFluor488-conjugated anti-mouse secondary antibody (1:1000 dilution) (Cedarlane Labs Cat. No. 115-545-003) and DAPI (1 μg/mL) for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 115-545-003, RRID:AB_2338840)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, MRC-5 or LLC-MK2 cells were grown to 90% confluence in a T75 tissue culture flask in standard growth medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>LLC-MK2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, MRC-5 cells were grown to 40% confluency before the first round of transfection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MRC-5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, PsVs were produced by transfection of human kidney HEK293T cells with the full-length SARS-CoV-2 spike (BEI NR52310) or SARS-CoV-1 spike (kindly provided by S. Pöhlmann, Leibniz Institute for Primate Research, Göttingen, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In order to confirm that the reduced infection was not related to cell toxicity, HeLa-ACE2 cell viability upon incubation with serial dilutions of the small molecules was assessed. 10,000 cells/ well of pre-seeded HeLa-ACE2 cells were co-cultured with 2-fold serial dilutions of the small molecules at 37 °C for 48h-60h under the same conditions as in the neutralization assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The compound screening library consists of 10,244 small molecule drugs, retrieved from DrugBank 88 on February 19th, 2020.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DrugBank</div><div>suggested: (DrugBank, RRID:SCR_002700)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) RDKit: Open-source cheminformatics; http://www.rdkit.org) 89.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>http://www.rdkit.org</div><div>suggested: (RDKit: Open-Source Cheminformatics Software, RRID:SCR_014274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Methods 2 and 3 combined the GCN for viral-host target selection and PolypharmDB to predict small molecule binders for the proposed targets.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PolypharmDB</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Method 3 ranked all PolyphamDB compounds according to a weighted aggregate score combining all ten GCN targets.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PolyphamDB</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Slides were visualized on an inverted microscope by widefield epifluorescence (Leica DMi8 microscope, Andor Zyla 4.2-megapixel camera, run by Quorum WaveFX by Metamorph software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Metamorph</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were quantified by measuring the total fluorescence signal using ImageJ software (National Institutes of Health, Bethesda, MD) 91. qRT-PCR detection of NL63: LLC-MK2 cells seeded on 6-well tissue culture plates were infected with NL63 at a MOI of 0.01 for a 1 h adsorption period in the presence of 10 μM capmatinib in a volume of 300 μL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IC50 values were calculated using Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: All statistical analysis for biological experiments were performed with GraphPad Prism 9 software using student t-tests when comparing two conditions (Figs 3B, 3D, 3E, 4B, 4E, 4F, 4G, S2A) or one-way ANOVA with Tukey post-hoc test when comparing multiple conditions (Figs. 3A, 3C, 4A, 4C, S4).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.10.21255202: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Ethical statement: All participants provided written informed consent before enrolment.<br>IRB: The study was conducted according to the Declaration of Helsinki, and approved by the Italian Regulatory Drug Agency (AIFA) and the Italian National Ethical Committee for COVID-19 clinical studies (ClinicalTrials.gov NCT04528641; EudraCT 2020-002835-31).<br>IACUC: Sera from convalescent patients who resolved SARS-CoV-2 infections came from residual specimens used for diagnostic purposes and were utilized according to INMI protocols for observational studies approved form internal ethical committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S1/S2 IgG test on LIAISON® XL analyzers, a chemiluminescence immunoassays (CLIA) detecting anti-S1/S2 IgG (IgG antibody concentrations expressed as arbitrary units, AU/mL >= 15 are considered positive, DiaSorin, Italy); 2) Abbott SARS-CoV-2 assay on Abbott ARCHITECT® i2000sr, a chemiluminescence microparticle assay (CMIA) detecting anti-N IgG (index value Sample/Cut-off >= 1.4 is considered positive; Abbott Diagnostics, Chicago, IL, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S1/S2 IgG ( IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-N IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nucleocapsid monoclonal antibody followed by a secondary anti-mouse IgG peroxidase conjugate and TrueBlue substrate, which forms a blue precipitate on positive cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 Spike and RBD ELISA: SARS-CoV-2 ELISA was developed using as coated antigens either SARS-CoV-2 full length soluble prefusion stabilized Spike protein (expressed in Expi293 cells at ReiThera) or a recombinant RBD (expressed in HEK293 cells, ACROBiosystems).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, 96-well tissue culture plates with sub-confluent Vero E6 cell monolayers were infected with 100 μl/well of virus-serum mixtures and incubated at 37 °C and 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GRAd vector encoding for the reporter gene secreted alkaline phosphatase (SEAP) at a pre-optimized multiplicity of infection (MOI) was preincubated for 1h at 37°C alone or with serial dilutions of control or test serum samples and then added to the 80-90% confluent HEK293 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S1/S2 IgG test on LIAISON® XL analyzers, a chemiluminescence immunoassays (CLIA) detecting anti-S1/S2 IgG (IgG antibody concentrations expressed as arbitrary units, AU/mL >= 15 are considered positive, DiaSorin, Italy); 2) Abbott SARS-CoV-2 assay on Abbott ARCHITECT® i2000sr, a chemiluminescence microparticle assay (CMIA) detecting anti-N IgG (index value Sample/Cut-off >= 1.4 is considered positive; Abbott Diagnostics, Chicago, IL, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This study has some limitations due to the low number of volunteers per arm (N=15), and to the lack of subject randomization amongst study arms on the basis of GRAd neutralizing titer at baseline. Both these aspects could have had an impact in the poor vaccine dose effect observed. However, the explored dose range (4-fold between low and high dose) was limited, and no major dose effect was expected. Nevertheless, for phase 2/3 single-dose regimen we selected the 2×1011 vp (high) dose, due to higher and more consistent immunogenicity especially in the elderly cohort. As for the two-dose regimen, the intermediate dose of 1×1011 vp was selected which represents the best compromise between tolerability and immunogenicity. Finally, data beyond w4 post vaccination on persistence of humoral and cellular responses will be part of a future report once the study follow up will be completed.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04791423</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Study of GRAd-COV2 for the Prevention of COVID-19 in Adults</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04528641</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">GRAd-COV2 Vaccine Against COVID-19</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      We thank the reviewers for their appreciation of our work and for their constructive feedback. We have addressed their comments in the point-by-point answers below. We provide a largely revised manuscript as well as the plan for new experiments, following requests from the reviewers.

      Reviewer #1 (Evidence, reproducibility and clarity (Required)): In their manuscript, Ronchi P. et al. present a thorough and very well detailed workflow for 3D correlative-light and electron microscopy of whole cells in large tissues. Their approach of iterative block trimming and florescence imaging combined with laser branding allowed them explore previously inaccessible tissues and questions. They imaged mammary gland organoids, and resolved the organization of the cells in the organoid and mitotic events. They also specifically targeted tracheal terminal cells of a 3rd instar Drosophila larvae labeled with cytoplasmic DsRed to study their ultrastructure, and several Drosophila ovarian follicular cells (FC) where the cytoplasmic motor protein dynein was knocked down (KD) by RNAi. In the tracheal cells, they observed connected secretory vesicles, probably delivering extra-cellular matrix to the trachea tube. They also found that the overall shape of dynein KD FCs is distorted comparted to WT, and that the localization of multi-vesicular bodies/endosomes inside the FCs changed from an apical to basal membrane localization. Although the approach is not entirely new, the manuscript certainly paves the way for future studies to obtain ultrastructural information from large specimens and combine it with meaningful fluorescence information, it's also beautiful and polished.

      \*Minor comments:**

      1. The authors state that they (line 145) that they found the optimal concentration of UA and the best compromise between EM contrast and fluorescence preservation. However, no detail is provided as to how these parameters were experimentally determined. *

      UA concentration can be optimized in a number of ways, including varying incubation temperature and time. We decided to modify the speed at which the temperature was increased after the freeze substitution step at -90°C. We have experimentally compared 3°C/h vs 5°/h (described in the original on-section CLEM protocol by Kukulski et al) and found a considerable difference for some of the samples we used. This is now described in the revision (lines 152-159). While other protocols might work for some samples, we found this protocol to provide good quality imaging with a large variety of samples we have worked with (including some that are not included in the current paper, e.g. gastrulating Drosophila embryos or C. elegans larvae).

      • More detail as to how the block face was mounted and kept parallel to the glass bottom dish would be helpful. *

      This is now described in lines 182-185.

      Also, what was the optical slice of the confocal and what was the increment in Z?

      The information is now included in lines 191-192.

      • Have the authors tried fluorophores with shorter wavelength (like GFP)? And if so, have they estimated the penetration depth in resin? This would be informative because many GFP lines already exist in the Drosophila model.*

      In the current version, we have limited our study to red fluorescent proteins because UA is autofluorescent in green. This could cause problems when imaging at shorter wavelengths. We have discussed this in lines 442-444. However, we agree that an analysis of the behavior of GFP in confocal imaging of the block could improve our work and increase the potential applicability of this method. We are therefore planning an experiment to compare the behavior of EGFP and mCherry during confocal imaging of the block. This experiment will be included in a future revised version.

      • In figure 6 i, how did the authors identify the structures to be MBVs close to the basal surface in the mutant seeing as they do not look like the MVBs seen in WT cells?*

      In both cases, we identified MVBs as vesicles with a clear lumen containing one or more vesicles of homogenous size. We have included a paragraph in the Material & Methods on “multivesicular body quantification” where this is specified (lines 597-599). The only difference between MVBs of WT and KD cells was their size (shown in Fig. 6j,k,l), and therefore the identification was unambigious.

      Similarly, how were the structures identified as endosomes in figure 5f?

      We thank the reviewer for pointing this out. We agree that it is impossible to discriminate between endocytic and exocytic vesicles in our static data. We have therefore rephrased this as “membrane trafficking” (line 355, line 358, line 946).

      Can the authors quantify the total MVBs in the apical/basal membranes from both RNAi KD and WT?

      We have now segmented all MVBs in 5 KD cells and 5 neighboring WT cells in 4 different oocytes. Representative images, as well as a quantitative analysis of the distribution of MVBs, are shown in Fig. 6m-o. When we segmented MVBs for this analysis, we realized that WT cells showed large MVBs in their apical side (~5-10% of total MVBs) while in KD cells this population was almost completely absent. This is consistent with a role of dynein in MVB fusion. The data are now included in Fig. 6p. We thank the reviewer for her/his suggestion to have a more rigorous analysis of the MVBs, which allowed us to make another interesting discovery.

      • The motivation/question in the case of Drosophila samples was clear but not so obvious in the case of the mammary gland organoids. It would be nice if the authors could give a bit more information.*

      We have included a justification for the use of organoids in lines 226-235.

      • In the introduction (line 124). The dimensions are given in microns and millimeters, which can be a bit confusing. *

      We have changed this (line 132).

      • In the discussion (lines 427-431), "sample preparation protocols compatible with fluorescence preservation have proven satisfactory for FIB-SEM milling and imaging" have also been shown by others (Porrati et al., 2019).*

      We agree with the reviewer and indeed Porrati et al., 2019 was cited in the introduction. We have not claimed that we have shown this for the first time. For completeness, we cite the paper again in the discussion (line 469).

      • Figure 1:
        • It would be helpful if the cell referred to in g was highlighted.*

      As suggested, we have indicated the cell with an arrowhead.

      - Is the cell in (h) the one in g or in a as written?

      We apologize for the mistake. It is indeed the one in g. We have corrected this (line 874).

      - Is the image in (k) inverted compared to (i)?

      The image in k is not inverted compared to i. We are showing raw images of the confocal and FIB-SEM datasets and therefore the two volumes are rotated 90º with respect to each other along the Y axis. As we have realized that this can be confusing for the readers, we have introduced a sentence in Materials and Methods to describe the different orientations between confocal and FIB-SEM datasets (lines 586-589).

      *Figure 2:

      • In panel d it seems that some numbers on the x axis were duplicated.*

      We apologize for the mistake. We have corrected figure 2.

      *Figure 5:

      • How does the perfect overlap confirm the accuracy of targeting?*

      We agree with the reviewer that the overlap is not a measure of accuracy. We have removed the sentence from the legend.

      - In panel (e) it was not particularly easy to understand what is the basal lamina.

      We have manually segmented the 2 basal membranes in different colors. We hope the reviewer will find this representation clearer.

      - In panel (g) the fused vesicle is not as clear as the movie. I also found it open to interpretation whether this is in fact a fused vesicle.

      We agree with the reviewer that a 3D object can be better appreciated in the stack image sequence rather than in a single 2D image. However, to help the visualization of the event in the figure, we have shown the 3 ortho-slices in a perspective view in Fig. 5g. This was the best representation we have found. The video with the stack will be available to the readers for a better inspection.

      We also agree that it is formally impossible to be sure whether the vesicle is in fact releasing material in the apical space or taking it up. Therefore, we describe now the event as “putative site of fusion…” (line 947).

      *Reviewer #1 (Significance (Required)):

      The increasing demand for volume electron microscopy brings a lot of challenges to correlative light and volume electron microscopy workflows. Although the methods used by the authors are not new, their combination is original. The manuscript will certainly contribute to the field of correlative light and volume EM and provide a rather detailed protocol that can be reproduced by others. The workflow is also more efficient than what was previously achieved using x-ray instead of light microscopy(Bushong et al., 2015; Karreman et al., 2016).*

      We thank the reviewer for the careful examination of our work and for the positive statement. We are aware that many of the methods used have already been described by others, but we believe that their combination is original and very powerful.

      Reviewer #2* (Evidence, reproducibility and clarity (Required)):

      In this manuscript, Ronchi et al describe a workflow designed to facilitate the identification and downstream relocation of fluorescently tagged regions of interest within millimetre scale samples, ending with focused ion beam SEM acquisition of the target area. The work follows a logical progression, is well thought out, explained, and illustrated, with proof of concept experiments that are followed up by examples of systems where the potential for the application of the workflow in a 'real' biological question is demonstrated.

      For me, the title reads better as ...targeting for FIB SEM acquisition... *

      We have edited the title according to the reviewer’s suggestion

      I have only minor suggestions for the revision of the manuscript from this initial version. The introduction, and introductory paragraphs for the two model systems would benefit from some revision to make them more concise however.

      We have revised and shortened the introduction and introductory paragraphs for the model systems and we hope the reviewer will find it more concise.

      \*Summary** Line 22 - omit large. *

      Done (line 29)

      Introduction Line 66 - It's probably clearer to discuss this concept as conductivity rather than grounding. We have changed this sentence (line 76)

      Line 105 - Peddie and Collinson 2014 is not the correct reference for this statement. Presumably this is supposed to be Peddie et al 2014? ** We thank the reviewer for spotting this mistake. We have changed the citation (line 1110)

      Line 124 - The external diameter of the carrier would give 7 mm2, but the internal diameter is smaller, so this size is slightly overstated.

      We totally agree. The internal diameter of the carrier is 2mm and therefore the area 3.14 mm2. We have corrected the statement (line 132).

      Results General comment - I find the use of NxNxN/N nm3 to be a confusing way of expressing the measurements, so would suggest splitting these up to express as: N nm3 or NxNxN nm.

      To avoid confusion, we have now opted for: N nm x N nm x N nm.

      Line 141 - no water was used in the FS mixture, and so wasn't needed for preservation of fluorescence? Dry/100% acetone? If no water is needed, this detail should be discussed. We added a clarification of this point (lines 148-150)

      Line 142 - could the authors elaborate on the statement about timing and sample types, to give a better understanding of the context. The sentence referred to other possible applications (e.g. cell monolayers would require shorter FS time). However, as the method described here is aimed at large 3D samples, we find that longer FS times (72h) are always required. We have therefore removed the sentence (line 151).

      Line 150 - on the choice of fluorophores, did the authors examine any shorter wavelengths, or was the decision to use red/far red based on any other evidence? Anecdotally, red and far red fluorophores may offer better preservation and less longevity in this context, but could the authors elaborate on their reasoning behind the choice shown here?

      As replied to reviewer 1, point 3:

      In the current version, we have limited our study to red fluorescent proteins because UA is autofluorescent in green. This could cause problems when imaging at shorter wavelengths. We have discussed this in lines 442-444.

      However, we agree that an analysis of the behavior of GFP in confocal imaging of the block could improve our work and increase the potential applicability of this method. We are therefore planning an experiment to compare the behavior of EGFP and mCherry during confocal imaging of the block. This experiment will be included in a future revised version.

      Line 168 - did immersion in water give rise to any distortion of the resin, or is HM20 sufficiently hydrophobic that this was not a concern? Mismatches in refractive indices (resin, water, glass, oil) could also presumably give rise to some small inaccuracies in depth prediction?

      We observed a little distortion of the block face, due to hydration during the imaging step. However, as noticed during trimming at the microtome, this distortion was small and we could achieve a flat surface after removing 1-2 mm. Therefore this was not relevant for our measurements. We however now mention this in the discussion (lines 453-455). Mismatches of refractive indices also introduce inaccuracies, but these aberrations are reduced the closer the target is to the surface. Therefore, our predictions become more precise after each trimming step to approach the target.

      Line 169 - was it possible to quantify the increase in signal? If the block is being hydrated, but the block is not absorbing water (re above point), then it must only be surface fluorophores that are hydrated

      The quantified increase in fluorescence signal at the surface is now mentioned here (line 187) and can be observed in Fig. 2b. Indeed, only surface fluorophores are hydrated and we argue that this is an important player in the fluorescence intensity increase.

      Line 179 - presumably this is a result of the surface of the block being hydrated (re above points). This is mentioned later, but could be explicitly stated here to make the point more strongly.

      We now state this also in line 186.

      Line 188 - Peddie et al 2014 contains some limited data for mCherry in sections that could be worth mentioning in support of the findings of reduced photobleaching rates

      Thank you for pointing this out. We now cite Peddie et al 2014 (line 208-209)

      Line 268 - It is not explicitly stated earlier, but multiple targets at similar depths would also be possible, presumably We have included a sentence to address this possibility (line 292-293)

      Discussion Line 421 - sections cannot be repeatedly imaged without bleaching too much? Please elaborate on this statement to help strengthen the point as it isn't mentioned earlier in the results.

      Our experience with in section fluorescence imaging is that fluorescent proteins are not very stable and bleach rather quickly. However, as we have not measured this with the same setup and with the same samples, we do not have a rigorous proof for this statement. As we believe the comparison with sections is not an important point here, we have removed the sentence (line 463)

      Line 435 - FIB SEMs and 2Pi systems are not really so 'common' in the sense suggested, so this final statement should be reworded.

      We have changed the sentence (lines 475-477)

      M&Ms Line 540 - grooves, not groves

      Changed (line 589)

      Figure 3 legend Overall, it's a workflow comprising many methods, so it's best described as a schematic of the workflow.

      Changed (line 900)

      Confocal panel - target, not targets, and depth is misspelt.

      We thank the reviewer for spotting these mistakes. We have corrected the figure*

      *

      Figure 4 legend Line 834 - as far as I can see, this is a different organoid that isn't shown in a and b, so this text should be removed.

      The organoid is indeed a different one. We meant that the targeting was performed as shown in a and b. However, as the sentence could generate confusion, we have removed it (line 932).

      Figure 5 legend Line 840 - was, not is

      Changed (line 937)

      Figure 6 a) It would help with clarity to also put e.g. white arrows on the WT epithelium

      As we use arrows and arrowheads to indicate different events in the image, we have used green asterisks to label the nucleus of the WT cell and a red asterisk for the KD, as we have done in all the panels in figure 6, where both cell types are present in the same image.

      f,g) It isn't really clear on first viewing what these images show, so they would benefit from some labels.

      We have added labels to indicate all the cells represented in the images as well as the space in between (VM, vitelline material). Microvilli are now indicated with arrowheads. We have also explained in the figure legend that here we show in detail the structures indicated by black arrows in Fig. 6a, to help give a context to the high mag detail (lines 964-965).

      \*Minor stylistic comments** There should be a space between numbers and units; this is inconsistent throughout. *

      We have corrected this.

      The use of black versus white text on the figures is inconsistent.

      We have fixed this.

      Table 1 - is it in the supplementary material or not? If it is, it should be referenced as such in the text. The formatting could use some refinement to match the standard of the other figures.

      The table is supplementary material. We have now referenced it as such and we have reformatted it.

      Capitalisation is inconsistent throughout.

      We have revised the text.

      The manuscript describes a workflow that connects several pre-existing methods to enable precision targeting of individual fluorescently tagged structures within a larger sample volume. The possibility for multi-modal imaging within a single embed specimen facilitates correlation of data for structure, with that of function. The work will be of interest to all scientists in the field of correlative microscopy

      We thank the reviewer for her/his positive evaluation.

      Reviewer #3* (Evidence, reproducibility and clarity (Required)):

      The manuscript is written very clearly overall. I would like to raise a number of issues that the authors might address. Most are at the level or proof-reading.

      The workflow still depends on availability of a specialized confocal microscope with two-photon laser excitation for marking the region of interest. A tweak to the method might simply be to scratch or etch markings onto the planed surface near the edges. Provided a motorized stage is available on the light microscope, the region of interest could be located precisely with reference to those, and then relocated in the SEM. It would be enough to suggest this, or another similar method, for those who don't have access to the two-photon microscope.*

      In our view, the 2pi branding is important to position the FIB-SEM acquisition with high precision, reliability and confidence. However, we agree with the reviewer that there are other approaches to accomplish this task, which we now mention in the text. One is to simply measure the distance from the edges or corners of the block (lines 256-259). Another, could be to manually introduce landmarks (lines 259-260).

      The second is to clarify in the text that the top-down view of the confocal microscopy is orthogonal to that of the FIB. This appears as a note in the caption to Figure 1, but it is an important point to align the expectations of readers who are not closely familiar with the methods.

      We agree with the reviewer that this is a point that requires further clarification. We have described this in Materials & Methods in the paragraph “Image processing, dataset registration, visualization and segmentation” (lines 586-589).

      The legend labels in Figure 1 do not match the figure itself, as if it were recompiled from an earlier draft: g-j) refers next to a).

      We apologize for the mistake. We have corrected it.

      The decrease in fluorescence intensity with depth into the specimen remains a bit ambiguous. The significant part of the text is dedicated to the suggestion that inherent protein fluorescence is affected by water content in the resin. After cutting back from the surface, are the originally deeper layers still dim, or do they become brighter? In other words, is the effect chemical or optical?

      As we wrote in the discussion, probably both optical effects and hydration play a role in the observed fluorescence drop. The hydration we describe probably only takes place on the block surface when dipping the block in water for imaging. Therefore, when we expose deeper layers after removing the resin on top, they do become brighter. However, we cannot completely disentangle the optical and hydration effect. To make this clearer, we have explained the point in more detail in the discussion (lines 452-455). At the same time, we are planning a new experiment to compare the fluorescence signal in the presence or absence of water in the dish, which will allow us to discriminate between the two effects.

      • Loss of confocal intensity with depth would be expected on the basis of a refractive index mismatch to the design parameters of the objective, especially for high numerical aperture. The objective is specified as multi-immersion but no further details are given. *

      Details of the lense we used are now given in Materials and Methods (lines 539-540)

      Another easy test would be to embed fluorescent beads as intensity standards. There could also be absorption of the fluorescence emission by the resin and stain, but such a strong effect in a few tens of microns would suggest that the block is quite dark. That seems inconsistent with the images in supplementary figures. Personally I was not bothered by the dimming in depth, since the conclusions do not depend on quantitative fluorescence intensities.

      We agree with the reviewer that, although the fluorescence intensity drop is an effect that is worth describing because it has an implication for the identification of fluorescent targets in the block, our method does not rely on quantitative imaging. In all cases, we were able to detect fluorescence signal even very deep from the block surface and this was enough to target those cells at the FIB-SEM.

      In some cases pre-embedding correlative imaging can be quite successful, for example in studies of Jost Enninga (e.g., Mellouk et al, Cell Host & Microbe 2014) or Eric Jorgensen (Watanabe et al, Nature Methods 2011). Do the authors see a distinction between adherent

      cell cultures and unsupported tissues or tissue sections?

      We completely agree with the reviewer that pre-embedding CLEM can be extremely successful and it is a very valuable tool, especially for the study of dynamic event is cell cultures. However, while for adherent cells the targeting is essentially a 2D problem and is facilitated by the fact that cells can be identified on the surface of the block under the SEM beam, for larger 3D samples the situation is much more complicated. We often lack landmarks and surface references and an anisotropic deformation occurs during sample prep, making targeting and localization prediction extremely inaccurate.

      Other investigators have insisted that FIB-SEM requires especially heavy labelling. What was done differently here to make the light labeling possible? Such clues may be very useful to ongoing developments in the literature. Also, the present protocol skips osmium staining entirely. The authors must have compared images with and without osmium. What visible features do we lose as a result?

      We provide a detailed freeze substitution protocol in table S1, such that the method can be easily reproduced. Although FIB-SEM imaging of osmium-free samples is not very common, it has been shown by others before (Porrati et al., 2019), with a slightly different FS protocol.

      We found that our sample preparation is good enough for the detection of all membranous organelles, but also microtubules, centrioles and other subcellular structures. We did not observe any big difference compared to the more standard protocols containing osmium (line 136).

      Perhaps the greatest challenge to large volume electron microscopy is to deal with rare events. Correlative fluorescence light-electron microscopy effectively addresses the issue of finding the region of interest in a two-dimensional specimen such as a thin section or even a monolayer cell culture. For tissues the solutions are still at large. It is almost always impractical to image an entire organ at the resolution required to see macromolecules (work of Harald Hess being the exception that proves the rule). The issue is especially acute where the imaging is destructive, as in the case of serial block-face and FIB-SEM tomography. MicroCT has been used so far as the method of choice in the work-up to locate the region of interest within a large specimen, but the approach requires expensive equipment and time-consuming analysis. Furthermore, it can provide directional clues solely on the basis of morphology. Fluorescence would be a far simpler tool, and more informative when labeling is directed to specific molecular components. The manuscript of Ronchi et al provides a much-needed demonstration and detailed set of instructions for 3D CLEM en route to FIB-SEM volume imaging. The examples are presented are both convincing and esthetic. Success depended on integration of a number of factors, including changes to the specimen preparation, so the workflow will be very useful. In short, I recommend publication.

      We thank the reviewer for the generous comments.

    1. SciScore for 10.1101/2021.04.08.21254348: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Patient selection, samples and Institutional Review Board permits: Experiments were carried out following the ethical principles established in the Declaration of Helsinki. Patients (or their representatives) were informed about the study and gave a written informed consent.<br>IACUC: Implications for therapeutic decision-making” approved by La Princesa Health Research Institute Research Ethics Committee (register # 4070) were used; samples and data from patients with severe vs mild disease were provided by the Biobank Hospital Universitario Puerta de Hierro Majadahonda (HUPHM)/Instituto de Investigación Sanitaria Puerta de Hierro-Segovia de Arana (IDIPHISA) (PT17/0015/0020 in the Spanish National Biobanks Network), they were processed following standard operating procedures with the appropriate approval of the Ethics and Scientific Committees.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Samples were stratified and randomly spliced into a training and a test set.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Beads were incubated with either rabbit anti-His-tag antibody (Proteintech Group) or plasma from patients or healthy donors in a final volume of 50 μl in 96-well-plates (Nunc™ MicroWell™ 96-Well, Thermo Fisher Scientific) using the dilutions indicated in each experiment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To visualize antibody bound to antigen-coated beads, either PE-conjugated anti-rabbit antibody (0.25 μg/ml, Southern Biotech)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PE-conjugated anti-rabbit antibody ( 0.25 μg/ml , Southern Biotech)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, PE-conjugated anti-human IgG and IgM, or FITC-conjugated anti-human IgA antibody (Immunostep S.L.) were added (30 μL/well) and incubated for 20 minutes at room temperature under agitation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant cDNAs coding for soluble S (residues 1 to 1208) and RBD (332 to 534) proteins were cloned in the pcDNA3.1 vector for expression in HEK-293F cells using standard transfection methods.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: To assess the prediction capacity of the new methodology, an algorithm was built using Scikit-learn python package [11] (code available on request).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Scikit-learn</div><div>suggested: (scikit-learn, RRID:SCR_002577)</div></div><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Comparison between severe and mild patients in each variable was performed by multiple t-tests followed by False Discovery Rate (1%) correction by two-stage step-up method in Graph Pad Prism 8 Software (GraphPad Software, USA, www.graphpad.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      In addition to an impact on early classification of patients, current limitations in the availability of vaccine doses suggest a novel possible application for sensitive multi-antigen assays for SARS-CoV-2 seropositivity. It has been shown that the antibody response to the first vaccine dose in individuals with pre-existing immunity is comparable or greater to that observed in naïve individuals who have been immunized twice [17]. Screening of the unvaccinated population with an assay sufficiently sensitive to identify individuals previously infected despite waning of antibody titres over time, would allow these individuals to be given the vaccine as a single booster, sparing them from possible suffering and complications after a second dose, and freeing up many urgently needed vaccine doses to be given to individuals with no protection. The test described here would also provide comprehensive information to support selection of convalescent sera or plasma for therapeutic use. Our data indicate the importance of this multi-antigen, multi-isotype analysis to detect potential SARS-CoV-2 reinfections in vaccinated individuals and suggest a possible use in establishing alternative vaccine administration routes that may elicit more potent IgA responses. This multi-antigen and multi-Ig assay can be easily modified for detection of antibodies in other fluids as saliva and breast milk. It is also highly tunable to different research needs, including detection of different immunoglobul...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.08.439006: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All work with infectious SARS-CoV-2 was performed in the Containment Level 3 (CL-3) facilities at University of Toronto using appropriate protective equipment and procedures approved by the Institutional Biosafety Committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Immunization of BALB/c mice: Female BALB/c mice were intranasally immunized with different doses (108 to 1010 viral particles) of HD-Ad_RBD or the HD-Ad vector control (HD-C4HSU) in 20 μl of PBS containing 40 μg/ml of DEAE-Dextran and 0.1% LPC.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies including goat anti-mouse IgG horseradish peroxidase (HRP)-conjugated (31430 thermo) and anti-mouse IgA HRP-conjugated (626720 Invitrogen) were diluted 1:5000, or 1:200 in blocking solution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (Thermo Fisher Scientific Cat# 31430, RRID:AB_228307)</div></div><div style="margin-bottom:8px"><div>anti-mouse IgA</div><div>suggested: (Innovative Research Cat# 62-6720, RRID:AB_138466)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After blocking with FcγIII and FcγII receptors antibody (BD Pharmingen, 553142), cells were stained with live/dead fixable cell stain (Invitrogen 34955), CD44 BV510, CD4 BV711, and CD8a APC-Cy™7 (BD) antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD44</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD4</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serial 10-fold dilutions of the lung homogenates were then added into the monolayer Vero-E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BALB/c and K18-hACE2 C57BL/6 mice were purchased from The Jackson Laboratory.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">K18-hACE2 mice were bred in house and each mouse was genotyped before use.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunization of BALB/c mice: Female BALB/c mice were intranasally immunized with different doses (108 to 1010 viral particles) of HD-Ad_RBD or the HD-Ad vector control (HD-C4HSU) in 20 μl of PBS containing 40 μg/ml of DEAE-Dextran and 0.1% LPC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were analysed on a Becton Dickinson LSR II CFI (SickKids Flow Cytometry Facility), using Flowjo x 10.0 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flowjo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      However, one of the major limitations in the use of these vectors for therapeutic purposes is the transient nature of the transgene expression and the systemic toxicity, which are both due to inflammatory and immune responses triggered by the residual expression of viral proteins40–42. To overcome these problems, HD-Ad, the third generation of Ad vectors, with all viral coding sequences deleted, was used in our study. HD-Ad minimizes the host immune response to the vector and allows long-term expression of the transgene in host tissues or organs, thereby providing a safer and more efficient way for gene delivery and transgene expression30–34. Consistently, we detected high level expression of the RBD in transfected cells and the majority of the protein was secreted, which ensures efficient antigen-dependent stimulation of the host immune system. Consequently, the HD-Ad_RBD vaccine induced extremely high levels of antigen-specific antibody response. For example, the IgG reciprocal GMT in sera reached 1,837,920 even though we used a moderate dose of the vaccine (5×109 viral particles) for vaccination. We also detected high levels of neutralizing antibody against the SARS-CoV-2 virus, and the reciprocal ID50 GMT was close to 1,000, which is in the same range of the neutralizing antibody induced by the two mRNA vaccines (mRNA-1273, BNT162b2) described above. The superior safety profile of HD-Ad allows us to deliver the vaccine by an intranasal route. Compared to intramuscular inj...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. Graham, M. S., Sudre, C. H., May, A., Antonelli, M., Murray, B., Varsavsky, T., Kläser, K., Canas, L. S., Molteni, E., Modat, M., Drew, D. A., Nguyen, L. H., Polidori, L., Selvachandran, S., Hu, C., Capdevila, J., Koshy, C., Ash, A., Wise, E., … Ourselin, S. (2021). Changes in symptomatology, reinfection, and transmissibility associated with the SARS-CoV-2 variant B.1.1.7: An ecological study. The Lancet Public Health, 0(0). https://doi.org/10.1016/S2468-2667(21)00055-4

    1. SciScore for 10.1101/2021.04.06.438540: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti‐SARS‐CoV‐2 N protein antibody was purchased from Sino Biological Inc (Beijing, China)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti‐SARS‐CoV‐2 N protein antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti‐SARS‐CoV‐2 N protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alexa Fluor 488 goat anti‐rabbit IgG (H + L) secondary antibody and Hoechst 33342 were purchased from Molecular Probes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Alexa Fluor 488 goat anti‐rabbit IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti‐rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-SARS-CoV-2 nucleocapsid (N) primary antibody, 488-conjugated goat anti-rabbit IgG secondary antibody and Hoechst 33342 were treated to the cells for immunofluorescence.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2 nucleocapsid (N)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus and cells: Vero and Vero E6 cells were obtained from the American Type Culture Collection (ATCC CCL-81 and C1008, respectively) and maintained at 37°C with 5% CO2 in Dulbecco’s modified Eagle’s medium (DMEM; Welgene), supplemented with 10% heat-inactivated fetal bovine serum (FBS) and 2% antibiotic-antimycotic solution (Gibco).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 cells were seeded at 2.0 × 104cells per well with Eagle’s Minimum Essential Medium (EMEM, ATCC) supplemented with 20% heat-inactivated fetal bovine serum (FBS), 1%</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For viral infection, plates were transferred into the BSL‐3 containment facility and SARS‐CoV‐2 was added at a multiplicity of infection of 0.008 for Vero cells and 0.2 for Calu-3 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DRCs were generated using Prism7 software (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.06.438552: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: For most experiments, 6×6 adjacent fields of view were acquired per sample using automated autofocus and image acquisition settings.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primers and Antibodies: All oligonucleotides and antibodies used in this study are presented in the tables below:</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antibodies</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293 FT cells were grown in DMEM/high glucose supplemented with 10% FBS (Thermo), 50mg/mL gentamycin (Sigma), 1mM sodium pyruvate (Thermo), non essential amino acids (Thermo) and 2mM L-glutamine (Thermo).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These vectors were co-transfected with psPAX2 and pMD2.G packaging vectors (Systems Biosciences) into HEK-293FT cells using standard PEI transfection, the supernatant collected 48h and 72h after transfection, filtered through 0.45 μm filters and used to transduce A549 cells in the presence of 8 μg/mL polybrene (Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293FT</div><div>suggested: ATCC Cat# PTA-5077, RRID:CVCL_6911)</div></div><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293 FT cells were grown in DMEM/high glucose supplemented with 10% FBS (Thermo), 50mg/mL gentamycin (Sigma), 1mM sodium pyruvate (Thermo), non essential amino acids (Thermo) and 2mM L-glutamine (Thermo).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo</div><div>suggested: (Thermo Xcalibur, RRID:SCR_014593)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Molecular docking simulations were performed with Gold 5.4 and AutoDock 4.2.3 softwares.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AutoDock</div><div>suggested: (AutoDock, RRID:SCR_012746)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Signals were quantified using ImageJ software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This cDNA was used for qPCR (5 ng/reaction) using Power SYBR green Master mix (Thermo) with three technical replicates per biological replicate, using 200 nM of the primer sets indicated in Table 1, which were chosen from PrimerBank (Wang et al, 2012).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PrimerBank</div><div>suggested: (PrimerBank, RRID:SCR_006898)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All graphs and statistical analyses were generated using GraphPad Prism software and display mean ± SEM of the normalized values relative to the IFNγ-treated control for each replicate, considered as 100%.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 26. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Response to Reviewers

      Title: "Towards deciphering the Nt17 code: How the sequence and conformation of the first 17 amino acids in Huntingtin regulate the aggregation, cellular properties, and neurotoxicity of mutant Httex1".

      Tracking #: RC-2021-00675 Authors: Vieweg et al.

      MAJOR COMMENTS from Referees #1, #2, and #3

      Referee #1

      General comments

      « The manuscript by Vieweg, Mahul-Mellier, Ruggeri et al., describes the role of the sequence and conformation of the extreme N-terminus of the Huntingtin protein in terms of aggregation and toxicity together with its relation to the polyglutamine length. The authors use some outstanding methods to ensure that the conclusions are based on good quality data. Overall, this is an excellent study.

      We thank the referee for the very positive feedback and for recognizing the quality of our work and his/her appreciation of our systematic approach to dissect the role of the Nt17 domain in regulating the aggregation, cellular properties, and neurotoxicity of mutant Httex1.

      “The manuscript is generally well written although it might benefit from reducing the length of the discussion section ».

      We thank the referee for his/her valuable comment. We have reduced by 10% the discussion as per requested.

      Major comments

      1) “For their in vitro data, the authors do not go beyond 42 polyglutamines. Is there any particular reason for that? The authors see a clear difference between 36Q and 42Q, but although not critical, it would have been useful to use longer repeats. In my view, the authors should at least discuss the rationale for this, particularly as in cellular models they do use 72Q constructs.”

      We thank the referee for raising this point.

      Most HD patients have a polyQ repeat stretch of 40-45 glutamines (1-4).

      In vitro, the use of Httex1 constructs consisting of 42 polyglutamine residues is sufficient to induce mutant Httex1 aggregation and fibril formation. Mutant Httex1 proteins with polyQ repeats of 72Q or higher are highly aggregation-prone and difficult to purify, handle, or disaggregates. This is why all of the in vitro aggregation studies are based on mutant Htt proteins with polyQ ranging from 23Q-53Q (5-14). We have reviewed the literature carefully and were unable to identify any in vitro studies with recombinant Htt proteins containing polyQ repeats of 72 or greater.

      In cells, induction of mature Htt inclusions requires much longer polyQ repeats. This is clearly reflected by the fact that most cellular studies use mutant Htt with polyQ repeats above 64Q and up to 160Q to induce the formation of cellular aggregates (10, 15-30).

      We have recently conducted a systematic study on the effect of the polyQ repeat length on Htt inclusion formation in cells https://www.biorxiv.org/content/10.1101/2020.07.29.226977v1 (21). Characterization of the inclusions by EM revealed that the polyQ tract length dramatically influences the ultrastructure properties and the architecture of the Httex1 inclusions in cells. The dark shell structure that delimitated the core from the periphery of the Httex1 72Q inclusions was absent in the Httex1 39Q inclusions. Also, the Httex1 39Q inclusions appeared less dense compared to that of the Httex1 72Q. Finally, no significant cell death was observed in HEK cells overexpressing 39Q constructs while overexpression of Httex1 72Q was toxic. For these reasons, we and others select to use Httex1 with polyQ repeat of 75 or higher.

      2) « The role of the N-terminus 17 aminoacids of huntingtin (Nt17) is addressed by comparing peptides with and without the Nt17 and their relation to the adjacent polyglutamine tract. Using this approach, the peptide without the Nt17 is composed of pure polyglutamines in its N-terminus, followed by the rest of exon 1 in its C-terminus. This is clearly the key comparison to address the role of the Nt17 in the context of an exon1 containing polyQ. »

      Yes. In fact, we did perform this experiment and assessed if the addition of the Nt17 would be sufficient to inhibit mutant Httex1 aggregation or make ΔNt17-Httex1 aggregate similar to Httex1. This data is included in the original version of the manuscript as Figure S5 in supporting material. We observed that that __the presence of the Nt17 peptide during the aggregation of ΔNt17-exon1 fibrils did not interfere with the aggregation kinetic of mutant Httex1 or alter the fibril morphology of ΔNt17-exon1,__ indicating that intramolecular interactions between the Nt17 domain and the adjacent polyQ tract are key determinants of mutant HTtex1 fibrillization and fibril morphology.

      Referee #2

      General comments

      This article describes the results from studies into mechanisms of the aggregation and toxicity of Htt Exon1 protein. The authors investigated the role of N17, polyQ length, M9C mutation, and phosphorylation. Multiple approaches were used that included biochemical protein design, biophysical measurements, and cell biological experiments with cultured mammalian cells. The authors demonstrate the effects of protein context on aggregation. Furthermore, the authors were able to visualize the aggregates in mammalian cells and in neurons using multiple methods. These are interesting data.

      We greatly appreciate the positive feedbacks on our data and our systematic and integrative approaches.

      There are several major weaknesses in the study. First problem is that most of the results related to aggregation mechanisms and toxicity are not original and incremental when compared to many previously published articles.

      We respectfully disagree with this assessment and suggestion that our studies are not original and represent only incremental advances.

      Originality

      Our study provides novel mechanistic insights into the role of not only the sequence but also the conformational properties of the Nt17 domain in regulating the dynamics of Httex1 fibrillization, the kinetic fibril growth, the structure and morphology of Httex1 fibrils. Besides, we also addressed for the first time how the Nt17 domain and phosphorylation at different residues within this domain regulate the cellular uptake, subcellular localization (phosphorylated proteins) and toxicity of extracellular monomeric and fibrillar forms of mutant Httex1 in primary neurons. We are not aware of previous reports that have conducted similar studies addressing these questions and using multiple methods. Also, some of our findings using native Httex1 sequences are not in agreement with previous reports using Httex1 proteins fused to peptide/protein tags, thus underscoring the limitations of previous studies.

      1) We demonstrated that the Nt17 domain plays an important role in shaping the surface properties of mutant Httex1 fibrils and regulate their lateral association and cellular uptake. Our findings are not in agreement with previous findings published in eLife by Shen et al. __(10)__, where they reported that removal of the Nt17 domain has the opposite effect of what we observed in our study, i.e., ∆Nt17 promotes the formation of fibrils that exhibit a low tendency to laterally associated and form a “bundled” architecture (10). Careful examination of their constructs revealed that all the proteins they used contained a highly charged 15-mer peptide tag (S-tag: Lys-Glu-Thr-Ala-Ala-Ala-Lys-Phe-Glu-Arg-Gln-His-Met-Asp-Ser) at the C-terminus of Httex1, which we believe would strongly influence the aggregation properties of the mainly uncharged ∆Nt17-Httex1 and Httex1 protein, thus possibly explaining the discrepancy between our findings and those of Shen et al (10). In fact, a previous study has shown that adding short peptide tags such as the HA or the LUM tag to mutant Htt171 changed the toxicity dramatically. In addition, we show that the subcellular localization of Htt171 expressed in cells (e.g: expression of Htt171 carrying the LUM tag was more toxic than untagged Htt171 and induced the formation of nuclear aggregates rather than the classical cytoplasmic aggregates) (31). The reference to this paper is now included and discussed in the main manuscript (page 11).

      Our observations __highlight__ the critical importance of using tag-free proteins to investigate the sequence and structural determinants of Httex1 aggregation and structure.

      2) Our study is the first to demonstrate that the Nt17 domain influences the relationship between fibril length and polyQ repeat length. This correlation disappears when the Nt17 is removed. This aspect of our work was not explored by Shen et al. (10), who limited their in vitro aggregation study to Httex1 wild-type and mutants (∆Nt17 or ∆PRD for Polyn Rich Domain).

      3) This is also the first study to assess the effect of modulating the helicity of Nt17 on fibrils growth and morphology and Httex1 cellular properties.

      1. a) Using the helix and membrane-binding disrupting mutation (M8P), we showed that disrupting the Nt17 helix (M8P mutation) slows the aggregation propensity of Httex1 in vitro but does not alter the morphology of the fibrils. In contrast, removing the Nt17 domain leads to a strong lateral association of the fibrillar aggregates with ribbon-like morphology. This demonstrated that the __Nt17 sequence, but not its helical structure, is the key determinant of the quaternary packing of Httex1 fibrils. Shen et al. (10) did not investigate the effect of modulating the helicity of Nt17 on fibrils growth and morphology using M8P mutant__.
      2. b) Our cellular studies comparing the membrane association and uptake of extracellularly added Httex1 43Q and M8P Httex1 43Q fibrils in primary rat striatal neurons showed that disrupting the Nt17 helix promotes the internalization of M8P Httex1 while Httex1 stays bound to the plasma membrane. These findings suggest that the Nt17 helical conformation persists in the fibrillar state or that the Nt17 domain regains its helical structure upon interaction with the plasma membrane resulting in the sequestration of Httex1 fibrils at the membrane and impeding their uptake. This aspect of our study has never been explored in previous studies.
      3. c) Using the site-specific bona fide phosphorylation on T3, S13, SS16, and both S13/S16, this is the first study that shows that modulation of the overall helicity of Httex1 through site-specific phosphorylation of the Nt17 domain (pT3 stabilizes the alpha-helical conformation of Nt17 while pS13 and/or pS16 disrupts it (9)) enhance the rapid uptake of extracellular Httex1 monomeric species into neurons and their nuclear accumulation. Previous studies relied on phosphomimetic mutations (32), which we have shown do not reproduce the effect of phosphorylation at these residues on the structure of Nt17 (8, 9). Shen et al. __(10) did not investigate the effect of modulating the helicity of Nt17 on fibrils growth and morphology using site-specific __phosphorylation of the Nt17 domain. 4) Our overexpression model in HEK cells showed that removing the Nt17 domain or disrupting its helical structure (M8P mutation) was sufficient to prevent the cell death induced by Httex1 72Q overexpression and reduce the number of cells with inclusions drastically. Our data indicate that the cell death level correlates with the number of cells that contain inclusions or the number of inclusions formed in the cells or/and their subcellular localization. In contrast to our results, Shen et al.,__(10)__ demonstrated that the overexpression of ΔN17-Httex1 induced toxicity at a similar level as the full-length Httex1 in striatal-derived neurons or neurons from cortical rat brain slices culture, although ΔN17-Httex1 led to a significant reduction of punctate structures in these cells. The discrepancy between these studies and our Httex1 overexpression model in HEK cells may be due to the fact that in neurons, Httex1 lacking the Nt17 domain accumulates in the nucleus. In contrast, in HEK, it stayed mostly cytosolic. In line with this hypothesis, it has been recently shown that cytosolic inclusions (Httex1 200Q) and nuclear aggregates (Httex1 90Q) contribute – to various extents – to the onset and the progression of the disease in a transgenic HD mice model (33). Thus, the difference in cellular localization but also the cell type (HEK vs. neurons) could influence the toxic response of the cells to the overexpression of ∆Nt17-Httex1, with toxicity triggered only by the nuclear ∆Nt17-Httex1 species.

      5) This is also the first study to investigate the role of the Nt17 domain and Nt17 PTMs in influencing the uptake, the subcellular localization, and the toxicity of extracellular Httex1 species (monomers and fibrils) in primary neurons. We showed that the helical propensity of Nt17 strongly influences the uptake of Httex1 fibrils into primary striatal neurons. At the same time, phosphorylation (at T3 or S13/S16) or removal of the Nt17 domain increased the uptake and accumulation of Httex1 fibrils into the nucleus and induced neuronal cell death. Our findings suggest that the Nt17 domain is exposed in the fibrillar state and is sufficiently dynamic to mediate fibril-membrane interactions and internalization.

      Altogether our results, combined with previous findings from our groups and others demonstrating the role of Nt17 in regulating Htt degradation (34-36), suggest that this domain serves as one of the key master regulators of Htt aggregation subcellular localization of the pathological aggregates, and their toxicity. They further demonstrate that targeting Nt17 represents a viable strategy for developing disease-modifying therapies to treat HD.

      Limitations of previous studies:

      Although the effects of the Nt17 domain in regulating Httex1 aggregation and cellular properties have been studied and reported on by other groups, we would like to stress that most of the published studies had major limitations and used protein constructs that do not share the sequence of native Httex1 and exhibit biophysical and cellular properties that differ from those of native Httex1 sequences.

      1) Many of the studies used Httex1-like model peptides (13, 37), which do not contain the complete sequence of Httex1 (e.g., Nt17 peptide (37)), contain additional solubilizing amino acids such as lysine residues(38-43) or are fused to large proteins (e.g., GST, YFP) (37).

      2) Other studies relied on artificial fusion constructs whereby the polyQ domain (44-46) or Httex1 itself (12, 47-61) are fused to large solubilizing protein tags, such as glutathione-S-transferase (GST), maltose-binding protein (MBP) or thioredoxin (TRX) or C-terminal S-tag (10, 62, 63) or fluorescent proteins (e.g., GFP or YFP) (10, 15, 49, 64, 65) for the cellular studies.

      One of the major limitations of using fusion constructs as precursors for the generation of Httex1 (12, 47-61) is the requirement to cleave the fusion protein in situ by adding a protease to release and initiate the aggregation of Httex1. Enzyme-mediated cleavage of Httex1-fusion proteins often results in the incorporation of additional amino acids at the N- or C-terminus of the protein. This could alter the biophysical and biochemical properties of Httex1 because of the important role of the Nt17 domain and the proline-rich domain in regulating the conformational and aggregation properties of the protein (38, 40, 43, 65, 66). Moreover, it has been shown that commonly used enzymes such as trypsin and thrombin may lead to cleavages within the Nt17 domain and result in the generation of undesired Httex1 fragments (7, 42, 60). The net effect of incomplete and/or unspecific enzymatic cleavage of Httex1 fusion proteins is the generation of heterogeneous protein mixtures, which precludes accurate interpretation and comparison of aggregation and structural data across different laboratories.

      Moreover, several studies have shown that the fusion of small peptide tags or large fusion protein alters the aggregation of mutant Httex1 in vitro and in cells.

      1. We have previously shown that the presence of such tags (e.g., GST) alters the ultrastructural and biochemical properties of Httex1 as well as its aggregation properties in vitro (11).

      We have also recently completed a comprehensive assessment of the GFP tag's impact on the aggregation, inclusion formation, and cellular properties of Httex1 (preprint paper available in BioRxiv https://www.biorxiv.org/content/10.1101/2020.07.29.226977v1 (21)). In this paper, we show that inclusions produced by mutant Httex1 72Q-GFP exhibit striking differences in terms of organization, ultrastructural properties, composition, and their impact on mitochondria functions as compared to the inclusions formed by the tag-free mutant Httex1 72Q. These findings highlight the critical importance of developing new tools that minimize the impact of large fluorescent proteins and/or label-free imaging methods and monitoring Htt aggregation in inclusion formation in cells.

      From Riguet et al., __(21)__. Influence of GFP on the ultrastructural properties of Httex1 cellular inclusions by Correlative light electron microscopy (CLEM). CLEM of Httex1 72Q (+/-GFP) transfected in HEK 293 cells after 48h. Confocal images of A. Httex1 72Q and. B Httex1 72Q GFP, 48h after transfection. Httex1 expression (red) was detected using a specific primary antibody against the N-terminal part of Htt (amino acids 50-64) and the nucleus was stained with DAPI (blue). Electron micrographs of C. Httex1 72Q and D. Httex1 72Q GFP inclusions corresponding to confocal images panel A, and B (white square), respectively. Add-in binary images generated from electron micrographs by median filtering and Otsu intensity threshold. E. **Schematic depictions and original electron micrographs of cytoplasmic inclusions formed by native (tag-free) mutant Huntington exon1 proteins (Httex1 72Q, left) and the corresponding GFP fusion protein (Httex1 72Q-GFP).

      A recent study by Chongtham et al. (31) also supports our findings and shows that adding short peptide tags such as the HA or the LUM tag to mutant Htt171 changed dramatically the toxic properties of Htt171 as well as its subcellular localization and the compactness of the aggregates formed in cells (e.g.: expression of Htt171 carrying the LUM tag was more toxic than untagged Htt171 and induce the formation of nuclear aggregates rather than the classical cytoplasmic aggregates, See Figure 4).

      Figure 4 from Chongtham et al., __(31)__. The influence of peptide modifications on HTT171 fragment behavior. (A) When expressed ubiquitously with da>Gal4, the HTT171-120Q fragment exhibits little or no lethality, but appending either an HA ( ... YPYDVPDYA)oraLUMtag ( ... GCCPGCCGG) to the C-terminus dramatically increases the toxicity of the fragment. (B) Surviving adult flies expressing an HA-tagged HTT171 transgene exhibit about half the life span of those expressing untagged 171. Flies expressingLUM-tagged HTT171 do not survive to adulthood. (C) Flies expressing HA- or LUM-tagged 171 in tracheal cells show only modest increases in lethality that do not rise to the level of significance (P=0.12; 0.09), but the inclusion of tags changes the subcellular behavior significantly. (D) In contrast, in the prothoracic gland, expression of LUM-tagged 171 shows a significant increase in toxicity compared to 171 alone, while the HA-tagged 171 borders on significance (P=0.051). (E) In trachea, pure 171 forms cytoplasmic aggregates, while the inclusion of HA causes some HTT to become nuclear diffuse, and inclusion of the LUM tag causes the bulk of the HTT to appear as diffuse nuclear material with some cytoplasmic aggregates remaining when expressed with btl>Gal4 at 29◦C. (F) In the prothoracic gland, addition of the LUM tag causes aggregated- **cytoplasmic HTT to become weakly staining diffuse-cytoplasmic material while HTT171HA remains as extensive aggregates in the cytoplasm with a haze of diffuse staining as well. Scale bars are 10 μm

      Therefore, in this study, we aimed to investigate for the first time the role of the sequence and the conformational properties of the Nt17 domain in regulating the dynamics of Httex1 fibrillization, the structure and morphology of Httex1 fibrils using a tag-free Httex1 constructs. In our studies, we used multiple methods to examine the structural and cellular properties of these proteins under the same conditions and in the same cellular systems, thus making it possible to correlate the sequence, structural and cellular properties of the different Httex1 proteins (monomers and fibrils). We are happy to see that this was nicely recognized and appreciated by the referee.

      Referee #1 “The authors use some outstanding methods to ensure that the conclusions are based on good quality data. Overall, this is an excellent study.” Referee #3 “Their findings provided the precise information for the role of tag-free Nt17. The paper advanced our knowledge of Nt17, especially in the Huntington disease field.”

      Major comments

      Referee #2 raised the following concerns:

      1) « The main hypothesis of this study solely depends on the ability of N17 domain to enhance aggregation (Fig 1 and Fig 2). According to the method for the protein solubilization 1mM TCEP was added to ∆Htt-Ex1, but not to Htt-Ex1 proteins. It is necessary to rule out the potential effects of TCEP on aggregation assay. »

      We thank the referee for raising this important point. Indeed, we were also concerned about the potential effect of TCEP and conducted experiments to address this point. Our data show that TCEP does not affect our aggregation assay. This new panel is now included in supporting information as Figure S2A-B and mentioned in the corresponding section of the Material and method (page 29).

      2) « The author needs to provide biophysical data of the mutation and phosphorylated proteins with/without Tag. »

      All the proteins used in this study have been extensively characterized in recent publications from our lab __(9, 11, 21)__. All these papers are cited throughout our manuscript as well as in the material and method section.

      The expression, purification and characterization of native tag-free Httex1 with polyQ repeats ranging from 7 to 49Q has been fully described in Vieweg et al., 2016 __(11)__. In this paper, the aggregation properties of tag-free Httex1 and Httex1 fused to GST or MBP tags were compared by sedimentation assay, while the morphology and length of the resulting fibrils were compared by EM.

      The semisynthesis, purification, and characterization of Httex1 42Q phosphorylated at Ser-13 and/or Ser-16 or at T3 was described respectively in Deguire et al., 2018 __(9) and Chiki et al., 2017 (8)__. These studies include kinetics of aggregation and morphological assessment (i.e: heights and lengths) by EM and AFM of the fibrils formed by phosphorylated or unphosphorylated mutants Httex1.

      The Httex1 mutants carrying the GFP tag were not used in the in vitro studies but were studied in our overexpression-based cellular model. The direct comparison characterization of inclusion formation by tag-free and GFP-tagged mutant Httex1 and their impact on cellular homeostasis are fully described in a preprint paper available in BioRxiv https://www.biorxiv.org/content/10.1101/2020.07.29.226977v1 (21). In this paper, we show that inclusions produced by mutant Httex1 72Q-GFP exhibit striking differences in terms of organization, ultrastructural properties, composition, and their impact on mitochondria functions as compared to the inclusions formed by the tag-free mutant Httex1 72Q. These findings highlight the critical importance of developing new tools that minimize the impact of large fluorescent proteins and/or label-free imaging methods and monitoring Htt aggregation in inclusion formation in cells.

      Referee #3

      General comments

      “Their findings provided the precise information for the role of tag-free Nt17.__ The paper advanced our knowledge of Nt17, especially in the Huntington disease field.”__

      We thank referee #3 for the very positive feedback and for recognizing the quality, depth and significance of our work and its potential impact in the field of Huntingtin disease.

      “However, the conceptual advance is limited.”

      We respectfully disagree with this assessment that the conceptual advance of our study is limited.

      Please see our detailed response to Referee #2 regarding our work's originality and novelty (pages 3-8, in our referees' letter).

      Major comments

      Referee #3 raised the following concerns:

      1) Finding of lateral association (bundling) of __Δ__Nt17-Httex1 fibrils is interesting.

      We agree and thank the referee for further highlighting this point.

      However, pathological significance is not clear

      We agree that the significance for delta 17 is not clear as we do not know whether this cleavage occurs in vivo or not. This is why we decided to extend our studies beyond the removal of Nt17 and investigated the effect of natural PTMs that are known to alter the sequence of Nt17 and modulate its helicity. One additional distinguishing feature of our work is that we used proteins (monomers and fibrils) that bear site-specific bona fide phosphorylation on T3, S13, SS16, and both S13/S16.

      1. a) Does even non-truncated form also increase this kind of bundling when polyQ is expanded? We have addressed this specific question in a previous study (11) in which we have compared the morphology and length of fibrils formed from Httex1 with polyQ tract from 23Q to 43Q. The increased lateral association was not observed for the fibrils generated from Httex1 43Q or Httex1 23Q, 29Q, or 37Q (Figure 5F) (11). Besides, in this paper, we were the first to show an inverse correlation between the polyQ-length and fibril length, which suggests structural differences between Httex1 proteins with different polyQ repeat lengths. Others have investigated Httex1 with different polyQ repeat, but not using tag-free Httex1 proteins, and they did not observe this inverse relationship between polyQ lenth and fibril length, as we did here and in our previous studies (11).

      2. b) When fibrils are added to striatal neurons like in Fig.5, is this structural feature preserved on the membrane or inside of the cells? We agree with the referee that this is an important point to address. However, deciphering the structural properties of the membrane-bound and internalized fibrils is not trivial, especially given the limited amount of unlabelled fibrils that are taken up by the cells. This would require extensive optimization of the CLEM technique or the use of an alternative approach such as tomography. Due to the resources and time required to address this important question, this part of the project will be included as part of future projects aimed at investigating the mechanisms of Htt seeding and propagation. We are not aware of any reports by other groups that monitor the structural changes of exogenous fibril after internalization into cells.

      3. c) When Httex1 fibrils species are expressed, is this bundling also observed? In fact, we have recently completed a comprehensive analysis of the comparison of the inclusions formed by mutant Httex1-72Q and ΔNt17 Httex1.

      In this study, we have shown that the expression of Httex1 72Q and the truncated form ΔNt17 Httex1 72Q form cytosolic inclusions of similar size and shape in HEK 293 (Figure 4). We have further characterized the architecture and organization of these inclusions at the ultrastructural level in the context of another project. Our findings are now available online (see Riguet et al., 2021, BioRxiv (21)).

      Using correlative light electron microscopy, we showed that the inclusions formed by Httex1 full length or lacking the Nt17 domain exhibited similar architecture and a ring-like organization. Interestingly, we showed the inclusions are composed of highly organized fibrillar network at the core and periphery of the inclusions. In cells inclusion formation is a multiphasic process driven by different phases of polyQ dependent aggregation processes and complex interactions with lipids, proteins and organelles (ER).

      Although CLEM approach in neurons provides very good contrast of cytosolic or nuclear inclusions, the resolution of this method is not sufficient to allow imaging at the level of individual fibrils and assessing their morphology. Differences between CLEM and EM resolution can be explained as the slices of the cellular objects are much thicker (~ 50 nm) than the fibrils prepared in vitro and directly deposited on the EM grids (the height of Httex1 pre-formed fibrils is between 5 and 7 nm). To improve the imaging and get a stronger contrast of de novo fibrils in our CLEM samples, we used a double-contrast method based on uranyl acetate and lead citrate stains. Nevertheless, the complex cellular environment and the presence of various cellular objects (e.g: organelles and proteins) surrounding the de novo fibrils might prevent the optimal stain penetration from allowing imaging at the level of individual fibrils. Finally, the preparation of the neuronal samples for CLEM imaging includes ethanol and detergents incubation and resin embedding. These steps can limit the ultrastructure detection of the de novo fibrils at the level of individual fibrils and therefore does not allow to determine their organization and their lateral association.

      1. d) What function (cell death, membrane integrity or others) is most correlated with this structural feature? In our extracellular model, we have shown that the conformation and sequence properties of the Nt17 domain are key determinants of the internalization and the subcellular localization of Httex1 fibrils in primary striatal neurons. Httex1 43Q fibrils mostly accumulate at the outer side of the neuronal plasma membrane, Httex1-ΔNt17 43Q fibrils were detected primarily in the nucleus and the M8P-Httex1 43Q fibrils were equally distributed in the cytosol and nucleus.

      Despite exhibiting completely different subcellular distribution and internalization levels, the 3 types of fibrils induced neuronal cell death with the highest toxicity observed for ∆Nt17-Httex1 (Figure 7).

      Our data suggest that the neurotoxic response is primarily dependent on the subcellular localization of the Httex1 species: 1) accumulation of the Httex1 43Q fibrils on the plasma membrane is likely to induce loss of membrane integrity, based on previous observation with aSyn fibrils; 2) the nuclear accumulation of ∆Nt17-Httex1 aggregates has been previously shown to be highly toxic in several cellular and animal models (10, 67, 68).

      Nevertheless, we could not rule out that the high toxicity of ΔNt17-Httex1 fibrils could also be due to their distinct biophysical and structural properties. ΔNt17-Httex1 forms broad fibrils characterized by lateral association, which could provide a surface for the sequestration of intracellular proteins.

      2) The authors claimed, “we investigated for the first time, the role of the Nt17 sequence, PTMs and conformation in regulating the internalization and cell-to-cell propagation of monomeric and fibrillar forms of mutant Httex1”. However, so far this reviewer understands that the authors studied the internalization but not cell-to-cell propagation.

      We agree and apologize for this mistake as we indeed only limited our study to the uptake, subcellular localization, and toxicity of extracellular Httex1 species in our primary neuronal model. The text has been amended, and cell-to-cell propagation has been removed from the abstract as well as in pages 2, 4, 12, and 17.

      Minor points for Referees #1, #2 and #3

      Referee #1

      1. « On page 6, the data on how the Nt17 domain affects Httex1 aggregation, the information on which figure it is referring to is missing. Done. The information regarding the Figure related to this data has now been added page 6.

      In Figure 1A, it is difficult to compare the data on Nt17 and DNt17, particularly for 36Q and 42Q, as the time axis are different. I understand that the kinetics are different, but particularly for the 42Q peptides (Nt17 and DNt17) as their kinetics are not that different, it may be useful to show them in the same panel. »

      Done. The new panel that combined the data on Nt17 and DNt17 has now been added as Figure S1B.

      Referee #2

      1) “Fig 8 the color codes for PolyQ and PolyP need to be corrected. »

      Done.

      2) “It is a challenging technical problem to produce proteins which are rich in Pro and Gln content. But there is not enough experimental details provided in the methods. Please add detailed procedures for expression and purification of these proteins. »

      We thank referee #2 for recognizing the technical challenges to express and produce Httex1 proteins and mutants. The expression, purification and characterization methods of all the proteins used in this manuscript have been extensively detailed in our previous studies (8, 9, 11, 69-71). We have now added the relevant references in the method section (page 29).

      Referee #3

      1) « Fig.3B arrowhead could not be seen. »

      Done. Arrowheads are now added to Fig. 3B.

      2) « Fig.4A: what do arrows mean? No scale bars? »

      The arrows indicate the aggregates formed in HEK cells overexpressing Httex1 39Q and 72Q. This now added to the legend section of the Figure 4.

      The scale bars are already present in both the main and the insets images.

      3) « Fig.5A:no scale bars? »

      Done. Scale bars were added in the 4 images where they were missing.

      4) « Fig.S3. Height and length seem to be wrong. »

      The measurement of height and length are performed as in literature (72), and are consistent with previous studies (8, 9, 11).

      5) « Fig.S6C: hard to compare. D: What is Htt2-90? Also in Fig.S13. »

      We thank the referee for bringing this to our attention and apologize for the lack of consistency in the names used for the proteins studied in Figures S6 and S13. We realized that in Figures S6 and S13 the names of the proteins have been either mislabelled due to the dash that was misplaced or the same proteins have been named in different ways. We agree that this makes it difficult to compare the data between the different panels. We have now corrected our mistakes and Figures S6B and S13 have been updated accordingly.

      The name Htt2-90 corresponds to Httex1 expressed from amino acid 2 to amino acid 90, with the first N-terminal methionine removed.

      6) « There are many abbreviations difficult to understand in supplement. » Fig.S1 Htt18-90(Q18C) etc.

      His6-Intein Ssp stands for the Intein tagged with Histidine amino acid (6 units)

      Htt18-90(Q18C) means Httex1 expressed from amino acid 18 to amino acid 90 with the Glutamine (Q) in position 18 mutated in a Cysteine (C).

      Htt2-17 means Httex1 synthesized from amino acid 2 to amino acid 17, with the first N-terminal methionine removed.

      Htt18-90(Q18A) corresponds to Httex1 expressed from amino acid 18 to amino acid 90 with the Q in position 18 mutated in an Alanine (A).

      References

      1. M. E. MacDonald, S. Gines, J. F. Gusella, V. C. Wheeler, Huntington’s Disease. NeuroMolecular Medicine 4, 7-20 (2003).
      2. S. E. Andrew et al., The relationship between trinucleotide (CAG) repeat length and clinical features of Huntington's disease. Nature genetics 4, 398-403 (1993).
      3. J. F. Gusella, M. E. MacDonald, Huntington's disease: the case for genetic modifiers. Genome Med 1, 80 (2009).
      4. J. M. Andresen et al., The relationship between CAG repeat length and age of onset differs for Huntington's disease patients with juvenile onset or adult onset. Ann Hum Genet 71, 295-301 (2007).
      5. A. S. Wagner et al., Self-assembly of Mutant Huntingtin Exon-1 Fragments into Large Complex Fibrillar Structures Involves Nucleated Branching. Journal of molecular biology 430, 1725-1744 (2018).
      6. Y. Sun, A. Savanenin, P. H. Reddy, Y. F. Liu, Polyglutamine-expanded Huntingtin Promotes Sensitization of N-Methyl-D-aspartate Receptors via Post-synaptic Density 95. Journal of Biological Chemistry 276, 24713-24718 (2001).
      7. A. Ansaloni et al., One-pot semisynthesis of exon 1 of the Huntingtin protein: new tools for elucidating the role of posttranslational modifications in the pathogenesis of Huntington's disease. Angewandte Chemie (International ed. in English) 53, 1928-1933 (2014).
      8. A. Chiki et al., Mutant Exon1 Huntingtin Aggregation is Regulated by T3 Phosphorylation-Induced Structural Changes and Crosstalk between T3 Phosphorylation and Acetylation at K6. Angewandte Chemie International Edition 10.1002/anie.201611750, 1-6 (2017).
      9. S. M. DeGuire et al., N-terminal Huntingtin (Htt) phosphorylation is a molecular switch regulating Htt aggregation, helical conformation, internalization, and nuclear targeting. Journal of Biological Chemistry 293, 18540-18558 (2018).
      10. K. Shen et al., Control of the structural landscape and neuronal proteotoxicity of mutant Huntingtin by domains flanking the polyQ tract. eLife 5, 1-29 (2016).
      11. S. Vieweg, A. Ansaloni, Z. M. Wang, J. B. Warner, H. A. Lashuel, An intein-based strategy for the production of tag-free huntingtin exon 1 proteins enables new insights into the polyglutamine dependence of Httex1 aggregation and fibril formation. Journal of Biological Chemistry 291, 12074-12086 (2016).
      12. J. Legleiter et al., Mutant huntingtin fragments form oligomers in a polyglutamine length-dependent manner in Vitro and in Vivo. Journal of Biological Chemistry 285, 14777-14790 (2010).
      13. B. Sahoo, D. Singer, R. Kodali, T. Zuchner, R. Wetzel, Aggregation behavior of chemically synthesized, full-length huntingtin exon1. Biochemistry 53, 3897-3907 (2014).
      14. J. C. Boatz et al., Protofilament structure and supramolecular polymorphism of aggregated mutant huntingtin exon 1. Journal of molecular biology 10.1016/j.matdes.2019.108334 (2020).
      15. F. J. B. Bäuerlein et al., In Situ Architecture and Cellular Interactions of PolyQ Inclusions. Cell 171, 179-187.e110 (2017).
      16. A. Iwata, B. E. Riley, J. A. Johnston, R. R. Kopito, HDAC6 and microtubules are required for autophagic degradation of aggregated Huntingtin. Journal of Biological Chemistry 280, 40282-40292 (2005).
      17. M. Kim et al., Mutant Huntingtin Expression in Clonal Striatal Cells : Dissociation of Inclusion Formation and Neuronal Survival by Caspase Inhibition. The Journal of neuroscience : the official journal of the Society for Neuroscience 19, 964-973 (1999).
      18. Y. E. Kim et al., Soluble Oligomers of PolyQ-Expanded Huntingtin Target a Multiplicity of Key Cellular Factors. Molecular cell 63, 950-964 (2016).
      19. H. Luo et al., Herp Promotes Degradation of Mutant Huntingtin: Involvement of the Proteasome and Molecular Chaperones. Molecular neurobiology 10.1007/s12035-018-0900-8 (2018).
      20. T. R. Peskett et al., A Liquid to Solid Phase Transition Underlying Pathological Huntingtin Exon1 Aggregation. Molecular cell 10.1016/j.molcel.2018.04.007, 1-14 (2018).
      21. N. Riguet et al., Disentangling the sequence, cellular and ultrastructural determinants of Huntingtin nuclear and cytoplasmic inclusion formation. bioRxiv 10.1101/2020.07.29.226977, 2020.2007.2029.226977 (2020).
      22. K. Tagawa et al., Distinct aggregation and cell death patterns among different types of primary neurons induced by mutant huntingtin protein. Journal of Neurochemistry 89, 974-987 (2004).
      23. Z. Zheng, A. Li, B. B. Holmes, J. C. Marasa, M. I. Diamond, An N-terminal nuclear export signal regulates trafficking and aggregation of huntingtin (Htt) protein exon 1. Journal of Biological Chemistry 288, 6063-6071 (2013).
      24. S. W. Davies et al., Formation of Neuronal Intranuclear Inclusions Underlies the Neurological Dysfunction in Mice Transgenic for the HD Mutation. Cell 90, 537-548 (1997).
      25. L. Mangiarini et al., Exon I of the HD gene with an expanded CAG repeat is sufficient to cause a progressive neurological phenotype in transgenic mice. Cell 87, 493-506 (1996).
      26. D. Martindale et al., Length of huntingtin and its polyglutamine tract influences localization and frequency of intracellular aggregates. Nature genetics 18, 150-154 (1998).
      27. J. Ochaba et al., PIAS1 Regulates Mutant Huntingtin Accumulation and Huntington's Disease-Associated Phenotypes In Vivo. Neuron 90, 507-520 (2016).
      28. G. Schilling et al., Intranuclear inclusions and neuritic aggregates in transgenic mice expressing a mutant N-terminal fragment of huntingtin. Human Molecular Genetics 8, 397-407 (1999).
      29. G. Matsumoto, S. Kim, R. I. Morimoto, Huntingtin and Mutant SOD1 Form Aggregate Structures with Distinct Huntingtin and Mutant SOD1 Form Aggregate Structures with Distinct Molecular Properties in Human Cells. The Journal of biological chemistry 281, 4477-4485 (2006).
      30. S. Waelter et al., Accumulation of mutant huntingtin fragments in aggresome-like inclusion bodies as a result of insufficient protein degradation. Molecular biology of the cell 12, 1393-1407 (2001).
      31. A. Chongtham et al., Effects of flanking sequences and cellular context on subcellular behavior and pathology of mutant HTT. Human molecular genetics 29, 674-688 (2020).
      32. T. Maiuri, T. Woloshansky, J. Xia, R. Truant, The huntingtin N17 domain is a multifunctional CRM1 and ran-dependent nuclear and cilial export signal. Human Molecular Genetics 22, 1383-1394 (2013).
      33. C. Landles et al., Subcellular Localization And Formation Of Huntingtin Aggregates Correlates With Symptom Onset And Progression In A Huntington’S Disease Model. Brain Communications 2 (2020).
      34. C. Cariulo et al., Phosphorylation of huntingtin at residue T3 is decreased in Huntington’s disease and modulates mutant huntingtin protein conformation. Proceedings of the National Academy of Sciences 10.1073/pnas.1705372114, 201705372-201705372 (2017).
      35. R. N. Hegde et al., TBK1 phosphorylates mutant Huntingtin and suppresses its aggregation and toxicity in Huntington's disease models. The EMBO journal 10.15252/embj.2020104671, e104671 (2020).
      36. L. M. Thompson et al., IKK phosphorylates Huntingtin and targets it for degradation by the proteasome and lysosome. Journal of Cell Biology 187, 1083-1099 (2009).
      37. R. S. Atwal et al., Kinase inhibitors modulate huntingtin cell localization and toxicity. Nature chemical biology 7, 453-460 (2011).
      38. A. Bhattacharyya et al., Oligoproline effects on polyglutamine conformation and aggregation. Journal of molecular biology 355, 524-535 (2006).
      39. S. Chen, V. Berthelier, W. Yang, R. Wetzel, Polyglutamine aggregation behavior in vitro supports a recruitment mechanism of cytotoxicity. Journal of molecular biology 311, 173-182 (2001).
      40. S. L. Crick, K. M. Ruff, K. Garai, C. Frieden, R. V. Pappu, Unmasking the roles of N- and C-terminal flanking sequences from exon 1 of huntingtin as modulators of polyglutamine aggregation. Proceedings of the National Academy of Sciences 110, 20075-20080 (2013).
      41. K. Kar, M. Jayaraman, B. Sahoo, R. Kodali, R. Wetzel, Critical nucleus size for disease-related polyglutamine aggregation is repeat-length dependent. Nature Structural and Molecular Biology 18, 328-336 (2011).
      42. R. Mishra et al., Serine phosphorylation suppresses huntingtin amyloid accumulation by altering protein aggregation properties. Journal of molecular biology 424, 1-14 (2012).
      43. A. K. Thakur et al., Polyglutamine disruption of the huntingtin exon1 N-terminus triggers a complex aggregation mechanism Ashwani. Nat Struct Mol Biol 16, 380-389 (2009).
      44. D. Bulone, L. Masino, D. J. Thomas, P. L. San Biagio, A. Pastore, The interplay between PolyQ and protein context delays aggregation by forming a reservoir of protofibrils. PloS one 1, e111 (2006).
      45. L. Masino, G. Kelly, K. Leonard, Y. Trottier, A. Pastore, Solution structure of polyglutamine tracts in GST-polyglutamine fusion proteins. FEBS Letters 513, 267-272 (2002).
      46. Y. Nagai et al., A toxic monomeric conformer of the polyglutamine protein. Nature Structural and Molecular Biology 14, 332-340 (2007).
      47. E. J. Bennett, N. F. Bence, R. Jayakumar, R. R. Kopito, Global Impairment of the Ubiquitin-Proteasome System by Nuclear or Cytoplasmic Protein Aggregates Precedes Inclusion Body Formation. Molecular cell 17, 351-365 (2005).
      48. C. W. Bugg, J. M. Isas, T. Fischer, P. H. Patterson, R. Langen, Structural features and domain organization of huntingtin fibrils. Journal of Biological Chemistry 287, 31739-31746 (2012).
      49. P. R. Dahlgren et al., Atomic force microscopy analysis of the Huntington protein nanofibril formation. Nanomedicine: Nanotechnology, Biology, and Medicine 1, 52-57 (2005).
      50. W. C. Duim, Y. Jiang, K. Shen, J. Frydman, W. E. Moerner, Super-resolution fluorescence of huntingtin reveals growth of globular species into short fibers and coexistence of distinct aggregates. ACS Chemical Biology 9, 2767-2778 (2014).
      51. J. M. Isas, R. Langen, A. B. Siemer, Solid-State Nuclear Magnetic Resonance on the Static and Dynamic Domains of Huntingtin Exon-1 Fibrils. Biochemistry 54, 3942-3949 (2015).
      52. J. Legleiter et al., Monoclonal antibodies recognize distinct conformational epitopes formed by polyglutamine in a mutant huntingtin fragment. Journal of Biological Chemistry 284, 21647-21658 (2009).
      53. E. Monsellier, V. Redeker, G. Ruiz-Arlandis, L. Bousset, R. Melki, Molecular interaction between the chaperone Hsc70 and the N-terminal flank of huntingtin exon 1 modulates aggregation. Journal of Biological Chemistry 290, 2560-2576 (2015).
      54. P. J. Muchowski et al., Hsp70 and Hsp40 chaperones can inhibit self-assembly of polyglutamine proteins into amyloid-like fibrils. Proceedings of the National Academy of Sciences 97, 7841-7846 (2000).
      55. Y. Nekooki-machida et al., Distinct conformations of in vitro and in vivo amyloids of huntingtin-exon1 show different cytotoxicity. Proceedings of the National Academy of Sciences 106, 9679-9684 (2009).
      56. L. G. Nucifora et al., Identification of novel potentially toxic oligomers formed in vitro from mammalian-derived expanded huntingtin exon-1 protein. Journal of Biological Chemistry 287, 16017-16028 (2012).
      57. L. Pieri, K. Madiona, L. Bousset, R. Melki, Fibrillar α-synuclein and huntingtin exon 1 assemblies are toxic to the cells. Biophysical Journal 102, 2894-2905 (2012).
      58. M. A. Poirier et al., Huntingtin spheroids and protofibrils as precursors in polyglutamine fibrilization. Journal of Biological Chemistry 277, 41032-41037 (2002).
      59. E. Scherzinger et al., Huntingtin encoded polyglutamine expansions form amyloid-like protein aggregates in vitro and in vivo. Cell 90, 549-558 (1997).
      60. E. Scherzinger et al., Self-assembly of polyglutamine-containing huntingtin fragments into amyloid-like fibrils: implications for Huntington's disease pathology. Proceedings of the National Academy of Sciences of the United States of America 96, 4604-4609 (1999).
      61. J. L. Wacker, M. H. Zareie, H. Fong, M. Sarikaya, P. J. Muchowski, Hsp70 and Hsp40 attenuate formation of spherical and annular polyglutamine oligomers by partitioning monomer. Nature Structural and Molecular Biology 11, 1215-1222 (2004).
      62. M. Jayaraman et al., Kinetically competing huntingtin aggregation pathways control amyloid polymorphism and properties. Biochemistry 51, 2706-2716 (2012).
      63. A. K. Thakur, W. Yang, R. Wetzel, Inhibition of polyglutamine aggregate cytotoxicity by a structure-based elongation inhibitor. FASEB J 18, 923-925 (2004).
      64. D. W. Colby et al., Potent inhibition of huntingtin aggregation and cytotoxicity by a disulfide bond-free single-domain intracellular antibody. Proceedings of the National Academy of Sciences of the United States of America 101, 17616-17621 (2004).
      65. S. Tam, R. Geller, C. Spiess, J. Frydman, The chaperonin TRiC controls polyglutamine aggregation and toxicity through subunit-specific interactions. Nature Cell Biology 8, 1155-1162 (2006).
      66. R. S. Atwal et al., Huntingtin has a membrane association signal that can modulate huntingtin aggregation, nuclear entry and toxicity. Human Molecular Genetics 16, 2600-2615 (2007).
      67. X. Gu et al., N17 Modifies Mutant Huntingtin Nuclear Pathogenesis and Severity of Disease in HD BAC Transgenic Mice. Neuron 85, 726-741 (2015).
      68. M. B. Veldman et al., The N17 domain mitigates nuclear toxicity in a novel zebrafish Huntington's disease model. Molecular neurodegeneration 10, 67 (2015).
      69. M. s. Anass Chiki et al., One -pot Semi synthesis Of Exon1 Of The Mutant Huntingtin Protein : An Important Advance Towards Elucidating The Molecular And Structural Determinants Of Huntingtin's. Health and Biomedical, 1047-1047 (2014).
      70. A. Chiki et al., Site-specific phosphorylation of Huntingtin exon 1 recombinant proteins enabled by the discovery of novel kinases. Chembiochem : a European journal of chemical biology 10.1002/cbic.202000508 (2020).
      71. A. Reif, A. Chiki, J. Ricci, H. A. Lashuel, Generation of native, untagged huntingtin Exon1 monomer and fibrils using a SUMO fusion strategy. Journal of Visualized Experiments 2018, 1-9 (2018).
      72. F. S. Ruggeri, T. Šneideris, M. Vendruscolo, T. P. J. Knowles, Atomic force microscopy for single molecule characterisation of protein aggregation. Arch Biochem Biophys 664, 134-148 (2019).
    1. SciScore for 10.1101/2021.03.30.21254624: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: For quality control, an RADT was simultaneously performed after verbal consent.<br>IRB: Upon approval by the Institutional Review Board of the University of Cologne, results were retrospectively analyzed including clinical data retrieved from a symptoms diary webtool that all individuals registering for a SARS-CoV-2 test are asked to complete.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 Culture: Vero E6 cells (ATCC CRL-1586) were cultured in complete medium (CM) consisting of Dulbecco’s modified Eagle Medium (DMEM; Thermo Fisher Scientific-Gibco, Waltham, MA) supplemented with 10% fetal calf serum (FCS; GE Healthcare, Chicago, IL), 200 units/ml Penicillin, 200 µg/ml Streptomycin, 0.25</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">AMP Kit running on the Alinity m (Abbott, Illinois, USA) was used for 63 (3.11%) specimens targeting the viral N-and RdRp-genes according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">µg/ml Amphotericin B, 2 mM L-Glutamine and 1 mM sodium pyruvate (all by Thermo Fisher Scientific-Gibco, Waltham, MA) at 37°C in an incubator with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Fisher Scientific-Gibco</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis was performed using Microsoft Excel 16.44 (Microsoft)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GraphPad Prism 9 (GraphPad Software, Inc.)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">), Python 3.8.3, and R 3.6.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This study, however, is subject to some limitations. Although the examined single-center study population was large, our cohort might not be considered representative of the general population due to young age and disproportionate gender distribution. The data on symptoms and their duration are only reliable to a limited extent, since they were retrospectively analyzed from mostly self-reported symptoms entered into a web tool. Furthermore, instead of a nasal swab, we used an oro-and nasopharyngeal swab to investigate RADT performance, which impedes the feasibility for the general public. In combating overdispersed SARS-CoV-2 transmission, rapid detection and isolation of highly infectious individuals is a primary goal (8, 9, 36–40). In our investigation the Standard Q RADT was able to reliably detect high viral load as well as all culture positive samples. Therefore, this test could be used as a fast surrogate marker for viral cultivation in order to identify and prevent SARS-CoV-2 transmissions by highly infectious individuals. Although less sensitive than RT-qPCR, RADT could compensate for this disadvantage through easy and feasible mass screenings (8, 41). Furthermore, one might suspect that RT-qPCR positive, but RADT negative individuals do not pose a high risk of transmissions, since all samples remained culture negative in our experimental setup. However, individual results must be interpreted with caution as SARS-CoV-2 infection could remain undetected in early stages...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.05.21254712: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Written informed consent was obtained in all cases of blood donation and further sample preparation.<br>IRB: Ethical considerations and study registration: The study was approved by the Research Planning Board of European University at St. Petersburg (on May 20, 2020) and the Ethic Committee of the Clinic “Scandinavia” (on May 26, 2020).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody tests: We used three different antibody tests throughout the study: 1) chemiluminescent microparticle immunoassay Abbott Archi-tect SARS-CoV-2 IgG on the Abbott ARCHITECT® i2000sr platform (Abbott Laboratories, Chicago, USA), detecting immunoglobulin class G (IgG) antibodies to the nucleocapsid protein of SARS-CoV-2 with the signal/cut-off (S/CO) ratio of 1.4 for positivity (CMIA Abbot; www.fda.gov/media/137383/download).;</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>immunoglobulin class G (IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2) enzyme-linked immunosorbent assay CoronaPass total antibodies test (Genetico, Moscow, Russia) based on recombinant receptor binding domain of the spike protein of SARS-CoV-2 (Department of Microbiology, Icahn School of Medicine at Mount Sinai, New York, NY, USA), detecting total antibodies with the S/CO ratio of 1.0 for positivity (ELISA Coronapass, pass.genetico.ru); 3) enzyme-linked immunosorbent assay SARS-CoV-2-IgG-EIA-BEST by Vector-Best, Novosibirsk, Russia also detecting IgG antibodies to the spike protein of SARS-CoV-2 with the S/CO ratio of 1.1 for positivity.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vector-Best, Novosibirsk, Russia also detecting IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then 100 μl of the mix was transferred into 96-well microplates with monolayer Vero cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody tests: We used three different antibody tests throughout the study: 1) chemiluminescent microparticle immunoassay Abbott Archi-tect SARS-CoV-2 IgG on the Abbott ARCHITECT® i2000sr platform (Abbott Laboratories, Chicago, USA), detecting immunoglobulin class G (IgG) antibodies to the nucleocapsid protein of SARS-CoV-2 with the signal/cut-off (S/CO) ratio of 1.4 for positivity (CMIA Abbot; www.fda.gov/media/137383/download).;</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div><div style="margin-bottom:8px"><div>Abbott Laboratories</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This study has several limitations. PCR test results that were chosen as a golden standard, were carried out in different laboratories. Although official test certificates that are registered in the national database were provided, false-positive results cannot be ruled out [28]. But as mentioned above, PCR false-positivity is likely to underestimate antibody test sensitivity in this study. Neutralization test results should be considered with caution as well [29]. Such tests can be considered as a surrogate marker of protection from reinfection, but this association needs to be explored in population-based epidemiological studies [15]. In conclusion, this validation study provides a reference that can be used in further seroprevalence reports to correct the results based on test sensitivity and specificity. Choice of the test for longitudinal surveillance is critical for making conclusions about the spread of SARS-CoV-2 and the durability of the immune response. Local tests should be rigorously evaluated for seroprevalence studies because the benefits of using properly validated tests are not only financial or related to matters of convenience. They may provide more accurate and unbiased assessments for the course of the pandemic.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04406038</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Study of the Spread of COVID-19 in Saint Petersburg, Russia</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">ISRCTN11060415</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.06.438630: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Use of healthy volunteer PBMC for this project, including those from WBS, was ethically approved by the Cardiff University School of Medicine Research Ethics Committee (SMREC) nos. 20/55 and 20/101.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies used were against HLA-ABC (W632; AbD Serotec), NCR3LG1/B7-H6 (MAB7144, Biotechne R&D Systems), Nectin 1 (R1.302; Biolegend), MICA (AMO1-100; BAMOMAB), MICB (BMO2-100; BAMOMAB), ULBP2 (BUMO1; BAMOMAB), Spike (1A9; Insight), Nucleocapsid (1C7; Stratech), anti-mouse IgG AF647 (Thermofisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HLA-ABC</div><div>suggested: (Leica Biosystems Cat# NCL-HLA-ABC, RRID:AB_563879)</div></div><div style="margin-bottom:8px"><div>MAB7144</div><div>suggested: (R and D Systems Cat# MAB7144, RRID:AB_2636810)</div></div><div style="margin-bottom:8px"><div>BMO2-100</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>BAMOMAB</div><div>suggested: (BAMoMAB Cat# BM02-100, RRID:AB_2636812)</div></div><div style="margin-bottom:8px"><div>ULBP2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (SouthernBiotech Cat# 1030-31, RRID:AB_2794301)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Target cells were harvested using TrypLE Express (Gibco), preincubated for 30 min with the relevant antibody or serum preparations, then mixed with PBMCs at an effector:target (E:T) ratio of 10:1 in the presence of GolgiStop (0.7 μl/ml, BD Biosciences), Brefeldin-A (1:1000, Biolegend) and anti-CD107a–FITC (clone H4A3, BioLegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Brefeldin-A</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD107a–FITC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibody (anti-nucleocapsid 1C7, Stratech, 1:500 dilution) was added in PBST containing 1% non-fast milk and incubated for 1h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nucleocapsid</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing in PBST, secondary antibody (anti-mouse IgG-HRP, Pierce, 1:3,000 dilution) was added in PBST containing 1% non-fat milk and incubated for 1h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody depletions: Anti-spike antibody was depleted from sera using magnetic bead conjugated spike trimer protein (Acrobiosystems).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-spike</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and viruses: A549 were transduced with lentiviruses expressing human ACE2, and TMPRSS2 (AAT cells), as previously described 27.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The England2 strain of SARS-CoV2 was obtained from Public Health England (PHE), grown on VeroE6 cells, and titrated by plaque assay on both VeroE6 and AAT, as previously described27.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids were midiprepped (Nucleobond Xtra Midi; Machery-Nagel), and transfected into 293T cells using GeneJuice (Merck) according to manufacturers’ instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were loaded onto a trapping column (300μm x 5mm PepMap cartridge trap (Thermo Fisher)) at 10μL/min for 5 minutes at 60 degrees.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PepMap</div><div>suggested: (BioWorks, RRID:SCR_014594)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">During the gradient elution, mass spectra were acquired with the parameters detailed in Fig S4 using Tune v3.3 and Xcalibur v4.3 (Thermo Fisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Xcalibur</div><div>suggested: (Thermo Xcalibur, RRID:SCR_014593)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository74 with the dataset identifier PXD025000 and 10.6019/PXD025000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PRIDE</div><div>suggested: (Pride-asap, RRID:SCR_012052)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Functional Annotation Clustering: Assessment of enriched gene annotation terms in temporal cluster one was carried out using the Functional Annotation Clustering tool at DAVID (david.ncifcrf.gov) v6.875, using the default clustering settings for medium stringency and the following libraries: Uniprot UP_Keyword, GOTERM:MF_ALL, BIOCARTA,, KEGG_PATHWAY and REACTOME_PATHWAY.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DAVID</div><div>suggested: (DAVID, RRID:SCR_001881)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids and transfections: Lentivirus plasmids encoding each SARS-CoV2 ORF individually, with a C-terminal twin-strep tag, were obtained from Addgene76.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Addgene76</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Target cells were harvested using TrypLE Express (Gibco), preincubated for 30 min with the relevant antibody or serum preparations, then mixed with PBMCs at an effector:target (E:T) ratio of 10:1 in the presence of GolgiStop (0.7 μl/ml, BD Biosciences), Brefeldin-A (1:1000, Biolegend) and anti-CD107a–FITC (clone H4A3, BioLegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Biosciences</div><div>suggested: (BD Biosciences, RRID:SCR_013311)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were acquired using an AttuneNxT (Thermo Fisher) and analyzed with Attune NxT software or FlowJo software version 10 (Tree Star).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Where sera were tested at a range of dilutions, the area under the curve (AUC) was calculated using Graphpad Prism 9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.04.438404: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Eligible women were: (n=84 pregnant; n=31 lactating; or n=16 non-pregnant and of reproductive age (18-45); greater than or equal to 18 years old, able to provide informed consent, and receiving the COVID-19 vaccine.<br>IRB: The study was approved by the MGH Institutional Review Board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Eligible women were: (n=84 pregnant; n=31 lactating; or n=16 non-pregnant and of reproductive age (18-45); greater than or equal to 18 years old, able to provide informed consent, and receiving the COVID-19 vaccine.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody-dependent neutrophil phagocytosis: Antibody-dependent neutrophil phagocytosis was measured by a flow cytometry-based assay (48).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antibody-dependent neutrophil phagocytosis</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Antibody-dependent</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PE-coupled mouse anti-human detection antibodies (Southern Biotech) were used to detect antigen-specific antibody binding.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human detection antibodies (Southern Biotech)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antigen-specific</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: THP-1 cells used in phagocytic assays were grown in RPMI media supplemented with 10% FBS, 5% penn/strep, 5% L-glutamine, 5% HEPES buffer (pH 7.2) and 0.5% 2-Mercaptoethanol, and maintained at 2.5×105 cells/ml.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>THP-1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Univariate statistical analysis: For univariate data analysis, statistics were run using GraphPad Prism version 8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Multivariate analysis: Multivariate analyses were performed in R (version 4.0.0) and Python (version 3.9.1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.03.438258: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After blocking in 5% milk powder/PBS for 30 min, cells were incubated with a primary antibody targeting SARS-CoV-2 nucleocapsid protein (Sino Biological, cat. 40143-R001) at a 1:2000 dilution for 1h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 nucleocapsid protein</div><div>suggested: (Bioss Cat# bsm-41414M, RRID:AB_2848129)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 pseudotyped VSV was diluted 1:30 in media in the presence of 100 ng/mL anti-VSV-G antibody (clone 8G5F11, Absolute Antibody) and added 1:1 to each antibody dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-VSV-G</div><div>suggested: (Absolute Antibody Cat# Ab01401-2.0, RRID:AB_2883992)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For antibody-mediated inhibition of trans-infection, cells were pre-incubated with 10 ug/mL anti-SIGLEC1 antibody (Biolegend, clone 7-239) for 30 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SIGLEC1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were incubated with primary antibodies anti-DC-SIGN/L-SIGN (Biolegend, cat. 845002, 1:500</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-DC-SIGN/L-SIGN</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were resuspended in 100 μL of FACS buffer prepared with 0.5% BSA (Sigma-Aldrich) in PBS containing the primary antibodies at a 1:100 dilution: mouse anti-DC/L-SIGN (Biolegend, cat. 845002), rabbit anti-DC-SIGN (Cell Signaling, cat. 13193), mouse anti-SIGLEC1 (Biologend, cat. 346002) or goat anti-ACE2 (R&D Systems, cat. AF933).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-DC/L-SIGN</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-DC-SIGN</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 1 h incubation on ice, the cells were washed two times and resuspended in FACS buffer containing the Alexa Fluor-488-labeled secondary antibodies at a 1:200 dilution: goat anti-mouse (Invitrogen cat.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Takara), Vero E6 (ATCC), MRC5 (Sigma-Aldrich), A549 (ATCC) or HeLa (ATCC) cells were transduced in the presence of 6 ug/mL polybrene (Millipore) for 24 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single cell clones were derived from the A549-ACE2-TMPRSS2 cell line, all other cell lines represent cell pools.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-ACE2-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serial 1:4 dilutions of the monoclonal antibodies were incubated with 200 pfu of SARS-CoV-2 (isolate USA-WA1/2020, passage 3, passaged in Vero E6 cells) for 30 min at 37°C in a BSL-3 facility.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For viral neutralization, cells were seeded into black-walled, clear-bottom 96-well plates at 20,000 cells/well (293T cells were seeded into poly-L-lysine-coated wells at 35,000 cells/well) and cultured overnight at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Trans-infection: Parental HeLa cells or HeLa cells stably expressing DC-SIGN, L-SIGN or SIGLEC1 were seeded at 5,000 cells per well in black-walled clear-bottom 96-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 2 h inoculation, cells were washed four times with complete medium and 10,000 VeroE6-TMPRSS2 cells per well were added and incubated 17-20 h at 37°C for trans-infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell-cell fusion of CHO-S cells: CHO cells stably expressing SARS-CoV-2 S-glycoprotein were seeded in 96 well plates for microscopy (Thermo Fisher Scientific) at 12’500 cells/well and the following day, different concentrations of mAbs and nuclei marker Hoechst (final dilution 1:1000) were added to the cells and incubated for additional 24h hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: RRID:CVCL_Y503)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry analysis for DC-SIGN, L-SIGN, SIGLEC1 and ACE-2: HEK293T cells expressing DC-SIGN, L-SIGN, SIGLEC1 or ACE2 were resuspended at 4×106 cells/mL and 100 μL per well were seeded onto V-bottom 96-well plates (Corning, 3894).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Micrographs were recorded using the Leginon software48 on a 100kV FEI Tecnai G2 Spirit with a Gatan Ultrascan 4000 4k x 4k CCD camera at 67,000 nominal magnification.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Leginon</div><div>suggested: (Leginon, RRID:SCR_016731)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Selected particle images were subjected to the Bayesian polishing procedure implemented in Relion3.054 before performing another round of non-uniform refinement in CryoSPARC followed by per-particle defocus refinement and again non-uniform refinement.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 31. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. Author Response:

      Reviewer #1 (Public Review):

      Redmond et al. use single-cell and single-nucleus RNA-sequencing to reveal the molecular heterogeneity that underlies regional differences in neural stem cells in the adult mouse V-SVZ. The authors generated two datasets: one which was whole cell RNA-seq of whole V-SVZ and one which consisted of nuclear RNA-seq of V-SVZ microdissected into anterior-posterior and dorsal-ventral quadrants. The authors first identified distinct subtypes of B cells and showed that these B cell subtypes correspond to dorsal and ventral identities. Then, they identified distinct subtypes of A cells and classified them into dorsal and ventral identities. Finally, the authors identified a handful of genes that they conclude constitute a conserved molecular signature for dorsal or ventral lineages. The text of the manuscript is well written and clear, and the figures are organized and polished. The datasets generated in this manuscript will be a great resource for the field of adult neurogenesis. However, the arguments and supporting data used to assign dorsal/ventral identities to B cells and A cells could be strengthened, and more rigorous data analysis could result in new biological insights into stem and progenitor cell heterogeneity in the V-SVZ.

      We thank the Reviewer for their feedback on our manuscript. As suggested by Reviewer #1, we are performing additional analyses in the following areas:

      1) Performing additional analyses to further strengthen the dorsal/ventral scRNA-Seq B cell marker analysis and its relationship to our sNucRNA-Seq B data.

      2) Performing additional analyses to identify potential novel biological insights into stem & progenitor cell heterogeneity and text edits to discuss how differentially-expressed sets of genes among B cells and A cells are related to biological processes and/or signaling pathways.

      Reviewer #2 (Public Review):

      The paper is well written, and the data are well analyzed and presented. My concerns centre on terminology and alternative explanations of some of the data, which the authors might deal with in the introduction or discussion.

      We thank Reviewer #2 for their positive reception of our manuscript and the data, and for the constructive suggestions, which we have addressed by changes to the manuscript and in our responses below:

      1) I am slightly confused about some of the data shown in Figure 1. If B cells are defined as GFAP expressing cells, then why do only 25% of the B cells in the plot in Figure 1C express GFAP? I may be missing something here, as other readers may as well. Similarly in the same panel, only 25% of astrocytes seem to be expressing GFAP or GFP driven by a GFAP promotor.

      Importantly, among all cells captured in our scRNA-Seq, only B cells (51.86%), a subpopulation of parenchymal astrocytes (25%) and a small subpopulation of ependymal cells (E cells) had GFAP expression. This is consistent with immunocytochemical staining (Ponti et al. 2013) and other studies of scRNA-Seq expression (Xie et al. 2020). Similarly, Gfp (under the control of hGFAP promoter) is not expected to be expressed in all B cells (here 31.08% of B cells are Gfp+).

      Note that previous work has shown that B cells express different levels of GFAP protein, and some B1 cells were negative (Ponti et al. 2013). This supports the notion that this intermediate filament is a good marker of the V-SVZ primary progenitors, but also present in a subpopulation of parenchymal astrocytes and ependymal cells. However, a negative signal for GFAP does not imply that a cell is not a B cell. This highlights the importance of our clustering analysis revealing additional genes associated with B cells. Our analysis suggests that a combination of Gfap, Thrombospondin 4, Slc1a3 (GLAST) and S100a6 provide a better marker combination to identify B cells.

      The reason for the variability among B cells in the expression of GFAP remains unknown. It could be associated with the normal regulation of intermediate filaments as B cells transit the cell cycle or different stages of their activation or quiescence. It could also be linked to technical aspects of scRNA-Seq analysis: e.g gene dropout; detection limits; sequencing saturation. Since on our dot plot the actual proportion is only graphically shown, to clarify this issue in the text we have added the specific percentages and the following sentences:

      “A fraction of both populations expressed GFAP: 51.85% of B cells (clusters 5,13,14 & 22), 24.37% of parenchymal astrocytes (clusters 21, 26 & 29). This is consistent with previous reports (Chai et al. 2017; Xie et al. 2020; Ponti et al. 2013). Note that across all cells captured in our scRNAseq analysis, only B cells, parenchymal astrocytes or ependymal cells expressed GFAP. Among these three cell types, B cells had the highest average expression of GFAP (4.41 for B cells, 1.00 for astrocytes, 0.29767 for Ependymal cells, values in Pearson residuals). Other markers, like S100a6 (Kjell et al. 2020) (88.9% of B cells; 54% of parenchymal astrocytes and 80% of ependymal cells) and Thbs4 (Zywitza et al. 2018) (45% of B cells; 28.77% in parenchymal astrocytes, 2.88 % in ependymal cells) are also expressed preferentially in B cells and parenchymal astrocytes, but they alone do not distinguish these two cell populations.”

      2) The authors term the germinal zone of the adult mouse brain - the ventricular-subventricular zone. They should discuss the evidence that the adult germinal zone is made up of cells from both the ventricular zone and the sub ventricular zone in the late embryo, where those zones are described clearly on the basis of morphology. Many of the early embryonic neural stem cells are present in the ventricular zone before the sub ventricular zone has developed and continue to be present into the adult. If there is not clear mouse evidence that the progeny of embryonic sub ventricular cells are present in the adult germinal zone independent of embryonic ventricular zone progeny, then the authors might consider calling the zone - the adult ventricular zone, or alternatively terming the neurogenic area around the lateral ventricle the adult germinal zone or by a more straightforward descriptive term - the adult subependymal zone or the adult periventricular zone. Also, I think the first word in line 6 on page 3 should be neural rather than neuronal.

      We agree that the terminology in the field is confusing and multiple names have been used to describe the same region. In order to clarify that we are referring to the same adult periventricular germinal region, we have added a short sentence in the introduction to indicate that the V-SVZ is also referred by other authors as the SVZ, the subependyma or subependymal zone: We have added in the text: “This neurogenic region has also been referred to as the SVZ or the subependymal zone (Kazanis et al. 2017; Morshead et al. 1994)”.

      This reviewer argues that the adult V-SVZ should only be called V-SVZ if a lineage relationship could be established with the embryonic SVZ. To our knowledge there is no need to link the adult SVZ to the embryo, as this structure, like the embryonic SVZ, anatomically sits beneath the VZ (the area next to the ventricle). However, a lineage relationship does exist between the adult V-SVZ and the embryonic VZ, established in previous studies showing that PreB1 cells around E15.5 became quiescent and give rise to adult B cells in the V-SVZ (Fuentealba et al., 2015; Furutachi et al., 2015). In addition, developmental studies show a continuum in the gradual transformation of the embryonic periventricular germinal layers, including the SVZ. Importantly, B1 cells are derived from VZ radial glia (RG), maintain RG markers and retain RG-like interkinetic behavior establishing that functionally and anatomically a VZ is retained in the adult (Merkle et al., 2004; Mirzadeh et al., 2008). Therefore the adult periventricular epithelium is not made of a pure layer of ependymal cells with progenitor cells underneath, as previously thought. Moreover, recent work indicates that just like in the embryo, the more basal adult SVZ progenitors (B2 cells) can be derived from adult VZ progenitors (B1 cells) (Obernier et al. 2018). This transformation of apical to basal cells begins to occur in embryonic stages further suggesting equivalences between the adult and the embryonic progenitor cells. For all the above reasons we prefer to use the term V-SVZ.

      In line 6, page 3, We have changed neuronal cell types to “neural cell types”, as suggested.

      3) The authors refer to their molecularly described B cells as stem cells. Certainly, their lab and others have shown that adult olfactory bulb neurons are the progeny of those B cells, however the classic definition of stem cells (in the blood or intestine for example) require demonstration that single stem cells can make all of the differentiated cells in that tissue. Is their evidence that a single adult B1 cell can make astrocytes, neurons and oligodendrocytes? Indeed, what percentage of the single adult B cells characterized here on the bases of RNA expression can be shown to be multipoint for both macroglial and neuron lineages in vivo or in vitro? Perhaps progenitor or precursor cells might be a better term for a B cells that appears to give rise to neurons primarily.

      This is also an issue of definitions. We modified the text to refer to the primary progenitors in the V-SVZ as adult neural stem cells, or progenitor cells “NSPCs”. We agree that this needs to be clarified and in the introduction we modified one paragraph to indicate:

      “From the initial interpretation that adult NSPCs are multipotent and able to generate a wide range of neural cell types (Reynolds and Weiss 1992; van der Kooy and Weiss 2000; Morshead et al. 1994), more recent work suggest that the adult NSPCs in vivo are heterogeneous and specialized, depending on their location, for the generation of specific types of neurons, and possibly glia (Merkle et al. 2014; Fiorelli et al. 2015; Chaker, Codega, and Doetsch 2016; Merkle, Mirzadeh, and Alvarez-Buylla 2007; Tsai et al. 2012; Delgado et al. 2020).”

      Under normal in vivo conditions, a primitive state for NSCs capable of generating all neuronal and glial cell types of the CNS may only exist at very early stages of development and even their regional specification seems to occur very early (as early as E10.5; Fuentealba et al. 2015). Note that recent work in the hematopoietic system suggests that stem cells there also become restricted embryonically (Carrelha et al., 2018) and in adults their potential to generate lymphoid or myeloid lineages changes dramatically with age, yet at all these ages they are referred as HSCs. We are well aware of the work from the van der Kooy lab, suggesting the existence in the V-SVZ of rare “primitive” Oct4+/GFAP- cells that may be pluripotent and earlier in the lineage from B cells (Reeve et al., 2017). However, as indicated above lineage tracing from the embryo indicates that adult NSPC are specified in the embryo and are already in place and regionally specified between E11.5 and E15. We have investigated whether we could detect Oct4+/Gfap- cells in our datasets. However, we did not detect Oct4 expression in B cells or other cell types. We now indicate in the discussion:

      “It has been suggested that in the adult V-SVZ a more primitive population of Oct4+/GFAP- NSCs may be present and that these cells may be earlier in the lineage from the “definitive” GFAP+ B cells (Reeve et al. 2017). However, regionally specified NSPCs can be lineage traced to the embryo (Fuentealba et al. 2015; Furutachi et al. 2015), and we could not detect a population of Oct4+ cells in our datasets. We, however, cannot exclude that rare primitive OCT4+ NSPCs were not captured in our analysis for technical reasons.” ……. “This underscores the early embryonic regional specification of adult V-SVZ NSPCs and how these primary progenitors maintain a memory of their regions of origin.”

      4) This may be more than a semantic issue, as the rare clonal neurophere forming neural stem cells that do make all three neural cell types in vitro, and also maintain their AP and DV positional identity through clonal passaging in vitro (Hitoshi et al, 2002). However, Emx1 expressing cortical neural stem cells can be lineage traced as they migrate from the embryonic cortical germinal zone to the striata germinal zone in the perinatal period (Willaime-Morawek et al, 2006). Surprisingly, in their new striatal home the Emx1 lineage cortical neural stem cells will turn down Emx1 expression and turn up Dlx2 striatal germinal zone expression. The switch in positional identities of clonal neural stem cells can be seen also in vitro when the stem cells are co-cultured with an excess of cells from a different region and then regrown as clonal neural stem cells. This may suggested that Emx1 expressing neural stem cells (the clonal neurosphere forming cells), may switch their positional identities in vivo as they migrate into the striatal germinal zone, but the downstream neuron producing precursor B cells studied in this paper may maintain their Emx1 expression into the adult germinal zone. This raises an interesting issue concerning which cells in the neural stem cell lineage can be regionally re-specified.

      The interesting question about plasticity and respecification is not addressed by our current manuscript that focuses on the gene expression profile of unmanipulated cells from adult samples. However, regional re-specification is controversial. While work from van der Kooy lab suggests that striatal Emx1+ NSPCs originate in the pallium and migrate into the striatum in the perinatal brain (Willaime-Morawek et la., 2006), other studies suggest that rare Emx1 cells are already present in the developing LGE from embryonic stages as early as E12.5 (Gorski et al. 2002). In addition, we have labeled neonatal radial glial cells in the pallium, when this migration has been suggested to occur, and do not see migration of cells ventrally into the striatal wall. We have also transplanted dorsal NSPCs into ventral locations -- and vice versa -- and do not observe evidence of regional re-specification (Merkle, Mirzadeh, and Alvarez-Buylla 2007; Delgado et al. 2020).

      5) The authors nicely show dorsal versus ventral germinal zone lineages are marked by some of the same positional genes from B cells to A cells, suggesting complete dorsal versus ventral neurogenic lineages giving rise to different types of olfactory bulb neurons. Indeed, they nicely test this idea with dissection of the dorsal versus ventral germinal zones, followed by nuclear RNA sequencing. However, they don't discuss the broader issues concerning the embryological origins of the dorsal versus ventral germinal zones. Emx1 is one of the genes the authors use to mark dorsal lineages. The authors reference papers (Young et al, 2007; Willaime-Morawek et al, 2006;2008) that use Emx1 lineage tracing to show that certain classes of olfactory bulb neurons originate from embryonic cortical neural stem cells that migrate perinatally from the cortical germinal zone into the dorsal subcortical germinal zone. Could cortical versus subcortical embryonic origins of the dorsal versus ventral adult germinal zone explain the origin of different sets of adult olfactory bulb neurons? Further, the authors report that one of the GO terms for their dorsal lineages in cortical regionalization.

      This is a very interesting question that unfortunately we cannot answer. The dorsal domain includes both pallial and subpallial components, but the specific origin of B cells in this dorsal domain and the contribution of the pallium and subpallium remains unresolved.

      We went back to our data to try to find evidence of pallial vs. subpallial components in the dorsal B clusters (5 & 22). Indeed, there are some hints that cluster 22 may be more pallial and 5 more dorsal subpallial. However, when we try to confirm differential distribution of markers associated with these two dorsal subdomains anatomically, it is not possible to determine segregation, likely due to the intermixing of cells as the wedge is formed. We also looked for Dbx1, a relatively specific marker of the border region between pallium and subpallium that has been termed ventral pallium, but unfortunately our scRNA-Seq dataset did not capture this marker. Further, targeted lineage tracing of this region is required to determine the subdivisions of the dorsal V-SVZ. We have added as requested a short discussion on this issue:

      “The dorsal V-SVZ domain is likely further subdivided into multiple subdomains. In the current analysis we pooled together clusters B(5) and B(22) as dorsal. However, largely pallial marker Emx1 and dorsal lateral ganglionic eminence marker Gsx2 were differentially enriched in clusters B(22) and B(5), respectively, suggesting that these two clusters may also represent different sets of regionally specified B cells with distinct embryonic origins. These regions become blurred by cells intermixing in the formation of the wedge region in the postnatal V-SVZ making it difficult to confirm their origin based on expression patterns. In addition to pallial and dorsal subpallial markers, this wedge region likely also includes what has been termed the ventral pallium (Puelles et al. 2016), which is characterized in the embryo by the expression of Dbx1. Unfortunately, our scRNA-Seq analysis did not detect this marker. Further lineage tracing experiments will help determine the precise embryonic origin and nature of the dorsal V-SVZ, including the wedge region.”

      6) The percentages of dividing cells based on gene expression is given for some clusters of cells but not others. It might be useful to have a chart showing the percentages of cells in cycle (ki67 expression) for each cluster. This might be especially useful in characterizing some fo the differences between various subclusters of B, A and C cells. On page 9 it is suggested that the heterogeneity amongst C cell clusters was driven by cell cycle genes. However, it is possible to remove the cell cycle genes from the data analysis to see if this then produces clearer dorsal versus ventral positional identities. This may be an important issue as the dorsal versus ventral positional identity genes appear to be expressed more in less dividing A and B cells, than in the more dividing C cells. This leads to a potentially alternative conclusion - that dorsal/ventral regional identity genes are primarily expressed in the non-dividing post mitotic cells in their resident dorsal or ventral region, and not in precursor cells in the lineage.This could be easiy tested by removing the cell cycle genes from the analysis of highly dividing clusters to see if they then break down into doral versus ventral clusters.

      We now provide a table indicating the fraction of proliferating cells (defined as in S phase or G2-M phase) for all scRNA-Seq clusters.

      Concerning whether dorsal and ventral identities are maintained during the period of proliferation we have analyzed our data looking at dorsal and ventral signature levels over pseudotime (Figure 6-Supplement 1F). Here we do not observe a reduction in either dorsal or ventral score at the proliferative cell stages (pseudotime ~0.75, Figure 2L). This is in contrast to gene signatures that show clear up- or down-regulation over pseudotime, such as Gfap, Egfr & Dcx (Figure 2M). To understand how cell clustering is affected in the absence of proliferative gene influence, and whether clearer dorsal/ventral signatures are observed in proliferating cells, we are performing additional analyses using our scRNA-Seq dataset that is clustered after cell-cycle gene regression.

      References Cited:

      Chaker, Zayna, Paolo Codega, and Fiona Doetsch. 2016. “A Mosaic World: Puzzles Revealed by Adult Neural Stem Cell Heterogeneity.” Wiley Interdisciplinary Reviews. Developmental Biology 5 (6): 640–58.

      Delgado, Ryan N., Benjamin Mansky, Sajad Hamid Ahanger, Changqing Lu, Rebecca E. Andersen, Yali Dou, Arturo Alvarez-Buylla, and Daniel A. Lim. 2020. “Maintenance of Neural Stem Cell Positional Identity by.” Science 368 (6486): 48–53.

      Fiorelli, Roberto, Kasum Azim, Bruno Fischer, and Olivier Raineteau. 2015. “Adding a Spatial Dimension to Postnatal Ventricular-Subventricular Zone Neurogenesis.” Development 142 (12): 2109–20.

      Fuentealba, Luis C., Santiago B. Rompani, Jose I. Parraguez, Kirsten Obernier, Ricardo Romero, Constance L. Cepko, and Arturo Alvarez-Buylla. 2015. “Embryonic Origin of Postnatal Neural Stem Cells.” Cell 161 (7): 1644–55.

      Furutachi, Shohei, Hiroaki Miya, Tomoyuki Watanabe, Hiroki Kawai, Norihiko Yamasaki, Yujin Harada, Itaru Imayoshi, et al. 2015. “Slowly Dividing Neural Progenitors Are an Embryonic Origin of Adult Neural Stem Cells.” Nature Neuroscience 18 (5): 657–65.

      Gorski, Jessica A., Tiffany Talley, Mengsheng Qiu, Luis Puelles, John L. R. Rubenstein, and Kevin R. Jones. 2002. “Cortical Excitatory Neurons and Glia, but Not GABAergic Neurons, Are Produced in the Emx1-Expressing Lineage.” The Journal of Neuroscience: The Official Journal of the Society for Neuroscience 22 (15): 6309–14.

      Kazanis, Ilias, Kimberley A. Evans, Evangelia Andreopoulou, Christina Dimitriou, Christos Koutsakis, Ragnhildur Thora Karadottir, and Robin J. M. Franklin. 2017. “Subependymal Zone-Derived Oligodendroblasts Respond to Focal Demyelination but Fail to Generate Myelin in Young and Aged Mice.” Stem Cell Reports 8 (3): 685–700.

      Kooy, D. van der, and S. Weiss. 2000. “Why Stem Cells?” Science 287 (5457): 1439–41.

      Merkle, Florian T., Luis C. Fuentealba, Timothy A. Sanders, Lorenza Magno, Nicoletta Kessaris, and Arturo Alvarez-Buylla. 2014. “Adult Neural Stem Cells in Distinct Microdomains Generate Previously Unknown Interneuron Types.” Nature Neuroscience 17 (2): 207–14.

      Merkle, Florian T., Zaman Mirzadeh, and Arturo Alvarez-Buylla. 2007. “Mosaic Organization of Neural Stem Cells in the Adult Brain.” Science 317 (5836): 381–84.

      Morshead, C. M., B. A. Reynolds, C. G. Craig, M. W. McBurney, W. A. Staines, D. Morassutti, S. Weiss, and D. van der Kooy. 1994. “Neural Stem Cells in the Adult Mammalian Forebrain: A Relatively Quiescent Subpopulation of Subependymal Cells.” Neuron 13 (5): 1071–82.

      Ponti, Giovanna, Kirsten Obernier, Cristina Guinto, Lingu Jose, Luca Bonfanti, and Arturo Alvarez-Buylla. 2013. “Cell Cycle and Lineage Progression of Neural Progenitors in the Ventricular-Subventricular Zones of Adult Mice.” Proceedings of the National Academy of Sciences of the United States of America 110 (11): E1045–54.

      Puelles, Luis, Loreta Medina, Ugo Borello, Isabel Legaz, Anne Teissier, Alessandra Pierani, and John L. R. Rubenstein. 2016. “Radial Derivatives of the Mouse Ventral Pallium Traced with Dbx1-LacZ Reporters.” Journal of Chemical Neuroanatomy 75 (Pt A): 2–19.

      Reeve, Rachel L., Samantha Z. Yammine, Cindi M. Morshead, and Derek van der Kooy. 2017. “Quiescent Oct4 Neural Stem Cells (NSCs) Repopulate Ablated Glial Fibrillary Acidic Protein NSCs in the Adult Mouse Brain.” Stem Cells 35 (9): 2071–82.

      Reynolds, B. A., and S. Weiss. 1992. “Generation of Neurons and Astrocytes from Isolated Cells of the Adult Mammalian Central Nervous System.” Science 255 (5052): 1707–10.

      Tsai, Hui-Hsin, Huiliang Li, Luis C. Fuentealba, Anna V. Molofsky, Raquel Taveira-Marques, Helin Zhuang, April Tenney, et al. 2012. “Regional Astrocyte Allocation Regulates CNS Synaptogenesis and Repair.” Science 337 (6092): 358–62.

      Xie, Xuanhua P., Dan R. Laks, Daochun Sun, Asaf Poran, Ashley M. Laughney, Zilai Wang, Jessica Sam, et al. 2020. “High Resolution Mouse Subventricular Zone Stem Cell Niche Transcriptome Reveals Features of Lineage, Anatomy, and Aging.”Cold Spring Harbor Laboratory. https://doi.org/10.1101/2020.07.27.223602.

    1. (Ito et al., 2009Ito, M., Baumer, S., Bittanti, M., boyd, danah, Cody, R., Herr-Stephenson, B., … Tripp, L. (2009). Hanging out, messing around, and geeking out: Kids living and learning with new media. Cambridge, MA: MIT Press. [Google Scholar])

      Funny, this is the paper we read earlier this semester.

    1. What does the likelihood for the a priori SBM look like? Fortunately, since 𝜏⃗ τ→\vec \tau is a parameter of the a priori SBM, the likelihood is a bit simpler than for the a posteriori SBM. This is because the a posteriori SBM requires a marginalization over potential realizations of 𝜏𝜏→ττ→\vec{\pmb \tau}, whereas the a priori SBM does not. The likelihood is as follows, omitting detailed explanations of steps that are described above: 𝜃(𝐴)∝ℙ𝜃(𝐀=𝐴)=∏𝑗>𝑖ℙ𝜃(𝐚𝑖𝑗=𝑎𝑖𝑗)Independence Assumption=∏𝑗>𝑖𝑏𝑎𝑖𝑗ℓ𝑘(1−𝑏ℓ𝑘)1−𝑎𝑖𝑗p.m.f. of Bernoulli distribution=∏𝑘,ℓ𝑏|ℓ𝑘|ℓ𝑘(1−𝑏ℓ𝑘)𝑛ℓ𝑘−|ℓ𝑘|Lθ(A)∝Pθ(A=A)=∏j>iPθ(aij=aij)Independence Assumption=∏j>ibℓkaij(1−bℓk)1−aijp.m.f. of Bernoulli distribution=∏k,ℓbℓk|Eℓk|(1−bℓk)nℓk−|Eℓk|\begin{align*} \mathcal L_\theta(A) &\propto \mathbb P_{\theta}(\mathbf A = A) \\ &= \prod_{j > i} \mathbb P_\theta(\mathbf a_{ij} = a_{ij})\;\;\;\;\textrm{Independence Assumption} \\ &= \prod_{j > i} b_{\ell k}^{a_{ij}}(1 - b_{\ell k})^{1 - a_{ij}}\;\;\;\;\textrm{p.m.f. of Bernoulli distribution} \\ &= \prod_{k, \ell}b_{\ell k}^{|\mathcal E_{\ell k}|}(1 - b_{\ell k})^{n_{\ell k} - |\mathcal E_{\ell k}|} \end{align*} Like the ER model, there are again equivalence classes of the sample space <ℎ𝑦𝑝𝑜𝑡ℎ𝑒𝑠𝑖𝑠−ℎ𝑖𝑔ℎ𝑙𝑖𝑔ℎ𝑡𝑐𝑙𝑎𝑠𝑠="ℎ𝑦𝑝𝑜𝑡ℎ𝑒𝑠𝑖𝑠−ℎ𝑖𝑔ℎ𝑙𝑖𝑔ℎ𝑡">𝑛</ℎ𝑦𝑝𝑜𝑡ℎ𝑒𝑠𝑖𝑠−ℎ𝑖𝑔ℎ𝑙𝑖𝑔ℎ𝑡><hypothesis−highlightclass="hypothesis−highlight">An</hypothesis−highlight>\mathcal A_n in terms of their likelihood. Let |ℓ𝑘(𝐴)||Eℓk(A)||\mathcal E_{\ell k}(A)| denote the number of edges in the (ℓ,𝑘)(ℓ,k)(\ell, k) block of adjacency matrix 𝐴AA. For a two-community setting, with 𝜏⃗ τ→\vec \tau and 𝐵BB given, the equivalence classes are the sets: 𝐸𝑎,𝑏,𝑐(𝜏⃗ ,𝐵)={𝐴∈𝑛:11(𝐴)=𝑎,21=12(𝐴)=𝑏,22(𝐴)=𝑐}Ea,b,c(τ→,B)={A∈An:E11(A)=a,E21=E12(A)=b,E22(A)=c}\begin{align*} E_{a,b,c}(\vec \tau, B) &= \left\{A \in \mathcal A_n : \mathcal E_{11}(A) = a, \mathcal E_{21}=\mathcal E_{12}(A) = b, \mathcal E_{22}(A) = c\right\} \end{align*} The number of equivalence classes possible scales with the number of communities, and the manner in which vertices are assigned to communities (particularly, the number of nodes in each community). As before, we have the following. For any 𝜏⃗ τ→\vec \tau and 𝐵BB: If 𝐴,𝐴′∈𝐸𝑎,𝑏,𝑐(𝜏⃗ ,𝐵)A,A′∈Ea,b,c(τ→,B)A, A' \in E_{a,b,c}(\vec \tau, B) (that is, 𝐴AA and 𝐴′A′A' are in the same equivalence class), 𝜃(𝐴)=𝜃(𝐴′)Lθ(A)=Lθ(A′)\mathcal L_\theta(A) = \mathcal L_\theta(A'), and If 𝐴∈𝐸𝑎,𝑏,𝑐(𝜏⃗ ,𝐵)A∈Ea,b,c(τ→,B)A \in E_{a, b, c}(\vec \tau, B) but 𝐴′∈𝐸𝑎′,𝑏′,𝑐′(𝜏⃗ ,𝐵)A′∈Ea′,b′,c′(τ→,B)A' \in E_{a', b', c'}(\vec \tau, B) where either 𝑎≠𝑎′,𝑏≠𝑏′a≠a′,b≠b′a \neq a', b \neq b', or 𝑐≠𝑐′c≠c′c \neq c', then 𝜃(𝐴)≠𝜃(𝐴′)Lθ(A)≠Lθ(A′)\mathcal L_\theta(A) \neq \mathcal L_\theta(A').

      goes in starred section

    2. What does the likelihood for the a posteriori SBM look like? In this case, 𝜃=(𝜋⃗ ,𝐵)θ=(π→,B)\theta = (\vec \pi, B) are the parameters for the model, so the likelihood for a realization 𝐴AA of 𝐀A\mathbf A is: 𝜃(𝐴)∝ℙ𝜃(𝐀=𝐴)Lθ(A)∝Pθ(A=A)\begin{align*} \mathcal L_\theta(A) &\propto \mathbb P_\theta(\mathbf A = A) \end{align*} Next, we use the fact that the probability that 𝐀=𝐴A=A\mathbf A = A is, in fact, the marginalization (over realizations of 𝜏𝜏ττ\pmb \tau) of the joint (𝐀,𝜏𝜏)(A,ττ)(\mathbf A, \pmb \tau). In the line after that, we use Bayes’ Theorem to separate the joint probability into a conditional probability and a marginal probability: (2.1)¶=∫𝜏ℙ𝜃(𝐀=𝐴,𝜏𝜏=𝜏)d𝜏=∫𝜏ℙ𝜃(𝐀=𝐴∣∣𝜏𝜏=𝜏)ℙ𝜃(𝜏𝜏=𝜏)d𝜏=∫τPθ(A=A,ττ=τ)dτ=∫τPθ(A=A|ττ=τ)Pθ(ττ=τ)dτ\begin{align} &= \int_\tau \mathbb P_\theta(\mathbf A = A, \pmb \tau = \tau)\textrm{d}\tau \nonumber\\ &= \int_\tau \mathbb P_\theta(\mathbf A = A \big | \pmb \tau = \tau)\mathbb P_\theta(\pmb \tau = \tau)\textrm{d}\tau \label{eqn:apost_sbm_eq1} \end{align} Let’s think about each of these probabilities separately. Remember that for 𝜏𝜏ττ\pmb \tau, that each entry 𝜏𝜏𝑖ττi\pmb \tau_i is sampled independently and identically from 𝐶𝑎𝑡𝑒𝑔𝑜𝑟𝑖𝑐𝑎𝑙(𝜋⃗ )Categorical(π→)Categorical(\vec \pi).The probability mass for a 𝐶𝑎𝑡𝑒𝑔𝑜𝑟𝑖𝑐𝑎𝑙(𝜋⃗ )Categorical(π→)Categorical(\vec \pi)-valued random variable is ℙ(𝜏𝜏𝑖=𝜏𝑖;𝜋⃗ )=𝜋𝜏𝑖P(ττi=τi;π→)=πτi\mathbb P(\pmb \tau_i = \tau_i; \vec \pi) = \pi_{\tau_i}. Finally, note that if we are taking the products of 𝑛nn 𝜋𝜏𝑖πτi\pi_{\tau_i} terms, that many of these values will end up being the same. Consider, for instance, if the vector 𝜏=[1,2,1,2,1]τ=[1,2,1,2,1]\tau = [1,2,1,2,1]. We end up with three terms of 𝜋1π1\pi_1, and two terms of 𝜋2π2\pi_2, and it does not matter which order we multiply them in. Rather, all we need to keep track of are the counts of each 𝜋π\pi. term. Written another way, we can use the indicator that 𝜏𝑖=𝑘τi=k\tau_i = k, given by 𝟙𝜏𝑖=𝑘1τi=k\mathbb 1_{\tau_i = k}, and a running counter over all of the community probability assignments 𝜋𝑘πk\pi_k to make this expression a little more sensible. We will use the symbol 𝑛𝑘=∑𝑛𝑖=1𝟙𝜏𝑖=𝑘nk=∑i=1n1τi=kn_k = \sum_{i = 1}^n \mathbb 1_{\tau_i = k} to denote this value: ℙ𝜃(𝜏𝜏=𝜏)=∏𝑖=1𝑛ℙ𝜃(𝜏𝜏𝑖=𝜏𝑖)Independence Assumption=∏𝑖=1𝑛𝜋𝜏𝑖p.m.f. of a Categorical R.V.=∏𝑘=1𝐾𝜋𝑛𝑘𝑘Pθ(ττ=τ)=∏i=1nPθ(ττi=τi)Independence Assumption=∏i=1nπτip.m.f. of a Categorical R.V.=∏k=1Kπknk\begin{align*} \mathbb P_\theta(\pmb \tau = \tau) &= \prod_{i = 1}^n \mathbb P_\theta(\pmb \tau_i = \tau_i)\;\;\;\;\textrm{Independence Assumption} \\ &= \prod_{i = 1}^n \pi_{\tau_i} \;\;\;\;\textrm{p.m.f. of a Categorical R.V.}\\ &= \prod_{k = 1}^K \pi_{k}^{n_k} \end{align*} Next, let’s think about the conditional probability term, ℙ𝜃(𝐀=𝐴∣∣𝜏𝜏=𝜏)Pθ(A=A|ττ=τ)\mathbb P_\theta(\mathbf A = A \big | \pmb \tau = \tau). Remember that the entries are all independent conditional on 𝜏𝜏ττ\pmb \tau taking the value 𝜏τ\tau. This means that we can separate the probability of the entire 𝐀=𝐴A=A\mathbf A = A into the product of the probabilities edge-wise. Further, remember that conditional on 𝜏𝜏𝑖=ℓττi=ℓ\pmb \tau_i = \ell and 𝜏𝜏𝑗=𝑘ττj=k\pmb \tau_j = k, that 𝐚𝑖𝑗aij\mathbf a_{ij} is 𝐵𝑒𝑟𝑛(𝑏ℓ,𝑘)Bern(bℓ,k)Bern(b_{\ell,k}). The distribution of 𝐚𝑖𝑗aij\mathbf a_{ij} does not depend on any of the other entries of 𝜏𝜏ττ\pmb \tau. Remembering that the probability mass function of a Bernoulli R.V. is given by ℙ(𝐚𝑖𝑗=𝑎𝑖𝑗;𝑝)=𝑝𝑎𝑖𝑗(1−𝑝)𝑎𝑖𝑗P(aij=aij;p)=paij(1−p)aij\mathbb P(\mathbf a_{ij}=a_{ij}; p) = p^{a_{ij}}(1 - p)^{a_{ij}}, this gives: ℙ𝜃(𝐀=𝐴∣∣𝜏𝜏=𝜏)=∏𝑗>𝑖ℙ𝜃(𝐚𝑖𝑗=𝑎𝑖𝑗∣∣𝜏𝜏=𝜏)Independence Assumption=∏𝑗>𝑖ℙ𝜃(𝐚𝑖𝑗=𝑎𝑖𝑗∣∣𝜏𝜏𝑖=ℓ,𝜏𝜏𝑗=𝑘)𝐚𝑖𝑗 depends only on 𝜏𝑖 and 𝜏𝑗=∏𝑗>𝑖𝑏𝑎𝑖𝑗ℓ𝑘(1−𝑏ℓ𝑘)1−𝑎𝑖𝑗Pθ(A=A|ττ=τ)=∏j>iPθ(aij=aij|ττ=τ)Independence Assumption=∏j>iPθ(aij=aij|ττi=ℓ,ττj=k)aij depends only on τi and τj=∏j>ibℓkaij(1−bℓk)1−aij\begin{align*} \mathbb P_\theta(\mathbf A = A \big | \pmb \tau = \tau) &= \prod_{j > i}\mathbb P_\theta(\mathbf a_{ij} = a_{ij} \big | \pmb \tau = \tau)\;\;\;\;\textrm{Independence Assumption} \\ &= \prod_{j > i}\mathbb P_\theta(\mathbf a_{ij} = a_{ij} \big | \pmb \tau_i = \ell, \pmb \tau_j = k) \;\;\;\;\textrm{$\mathbf a_{ij}$ depends only on $\tau_i$ and $\tau_j$}\\ &= \prod_{j > i} b_{\ell k}^{a_{ij}} (1 - b_{\ell k})^{1 - a_{ij}} \end{align*} Again, we can simplify this expression a bit. Recall the indicator function above. Let |ℓ𝑘|=∑𝑗>𝑖𝟙𝜏𝑖=ℓ𝟙𝜏𝑗=𝑘𝑎𝑖𝑗|Eℓk|=∑j>i1τi=ℓ1τj=kaij|\mathcal E_{\ell k}| = \sum_{j > i}\mathbb 1_{\tau_i = \ell}\mathbb 1_{\tau_j=k}a_{ij}, and let 𝑛ℓ𝑘=∑𝑗>𝑖𝟙𝜏𝑖=ℓ𝟙𝜏𝑗=𝑘nℓk=∑j>i1τi=ℓ1τj=kn_{\ell k}= \sum_{j>i}\mathbb 1_{\tau_i = \ell}\mathbb 1_{\tau_j = k}. Note that ℓ𝑘Eℓk\mathcal E_{\ell k} is the number of edges between nodes in community ℓℓ\ell and community 𝑘kk, and 𝑛ℓ𝑘nℓkn_{\ell k} is the number of possible edges between nodes in community ℓℓ\ell and community 𝑘kk. This expression can be simplified to: ℙ𝜃(𝐀=𝐴∣∣𝜏𝜏=𝜏)=∏ℓ,𝑘𝑏|ℓ𝑘|ℓ𝑘(1−𝑏ℓ𝑘)𝑛ℓ𝑘−|ℓ𝑘|Pθ(A=A|ττ=τ)=∏ℓ,kbℓk|Eℓk|(1−bℓk)nℓk−|Eℓk|\begin{align*} \mathbb P_\theta(\mathbf A = A \big | \pmb \tau = \tau) &= \prod_{\ell,k} b_{\ell k}^{|\mathcal E_{\ell k}|}(1 - b_{\ell k})^{n_{\ell k} - |\mathcal E_{\ell k}|} \end{align*} Combining these into the integrand from Equation (\ref{eqn:apost_sbm_eq1}) gives: 𝜃(𝐴)∝∫𝜏ℙ𝜃(𝐀=𝐴∣∣𝜏𝜏=𝜏)ℙ𝜃(𝜏𝜏=𝜏)d𝜏=∫𝜏∏𝑘=1𝐾𝜋𝑛𝑘𝑘⋅∏ℓ,𝑘𝑏|ℓ𝑘|ℓ𝑘(1−𝑏ℓ𝑘)𝑛ℓ𝑘−|ℓ𝑘|d𝜏

      i love. its complicated. make it a 'starred subsection' or something.

    1. SciScore for 10.1101/2021.04.02.438182: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Preparation of test virus suspension: For preparation of SARS-CoV-2 test virus suspension, Vero E6 cells were seeded in a 75 cm2 flasks at 2×106 cells in Dulbecco’s Modified Eagle’s Medium (DMEM, supplemented with 10 % (v/v) fetal calf serum (FCS), 1 % non-essential amino acids, 100 IU/mL penicillin, 100 µg/mL streptomycin and 2 mM L-Glutamine).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For preparation of BCoV virus suspension, U373 cells were cultivated in a 75 cm2 flask with in Minimum Essential Medium Eagle (EMEM) supplemented with L-glutamine, non-essential amino acids and sodium pyruvate and 10 % FCS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>U373</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fitting of virus titer decay: To model the decay in virus titer, we implemented a Weibull distribution fit in GraphPad Prism version 9.0.2 for Windows (GraphPad Software, San Diego, California USA, www.graphpad.com) Calculation of the reduction factor: The loss in virus titer by desiccation was calculated by subtracting the titer on the different carriers after desiccation from the titer of the initial virus control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.02.438204: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">UNCN1T cells (a human bronchial epithelial cell line; Kerafast; cat# ENC011) were cultured in BEGM media (Bronchial Epithelial Cell Growth Medium; Lonza: cat# CC-3170) in FNC (Athena Enzyme Systems; cat# 0407) coated 96-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UNCN1T</div><div>suggested: RRID:CVCL_ZC91)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MTT cell viability assay: Vero and HepG2 cells were seeded at the density of 20,000 cells/well in a 96 well plate containing 100 µL complete DMEM (Gibco, USA) supplemented with 10% FBS (Gibco, USA) and 1% Penstrep (Gibco, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HepG2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, 3X106 HEK293T cells were co-transfected with a plasmid containing lentiviral backbone expressing luciferase and ZsGreen (BEI catalog number NR-52516), a lentiviral helper plasmid expressing HIV Gag-Pol (BEI catalog number NR-52517), a lentiviral helper plasmid expressing HIV Tat (BEI catalog number NR-52518) and a lentiviral helper plasmid expressing HIV Rev (BEI catalog number NR-52519) along with a plasmid expressing spike protein of SARS-CoV-2 7 using jetPRIME transfection reagent (Polyplus-transfection; NY, USA) as per manufacturer’s instruction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 entry inhibitor screening assay: For screening SARS-CoV-2 entry inhibitors, 24 hrs before starting the assay, 20,000 HEK293T-ACE2 cells were seeded per well in a poly-l-lysine-coated 96-well plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, Vero E6 cells were seeded in 6-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The percentage inhibition of SARS-CoV-2 replication in MU-UNMC-1 and MU-UNMC-2 treated cells was calculated with respect to viral loads in untreated control wells that received DMSO (considered 0% inhibition) and negative control wells (uninfected cells).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MU-UNMC-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Measuring the combinational antiviral potential of MU-UNMC-2 and Remdesivir: To determine the possible synergistic antiviral effect of MU-UNMC-2 on RDV and vice versa against SARS-CoV-2 replication, we tested combined doses of the two in SARS-CoV-2 infected UNCN1T and Vero-STAT1 knockout cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-STAT1</div><div>suggested: ATCC Cat# CCL-81-VHG, RRID:CVCL_YZ45)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Hitfinder, Zinc database ZincDatabase, Zinc15Database</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Zinc</div><div>suggested: (Zinc, RRID:SCR_008596)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ChEMBL, Bingo, JChemforExcel, ChemDiff, and BindingMOAD (https://www.click2drug.org/index.php#Databases).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ChEMBL</div><div>suggested: (ChEMBL, RRID:SCR_014042)</div></div><div style="margin-bottom:8px"><div>JChemforExcel</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The top 500 compounds, the best Glide, was then re-docked using the ‘Induced Fit’ program of the Schrödinger Suite.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fit’</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: The CC50 and IC50 values were computed using four-parameter variable slope sigmoidal dose-response models using GraphPad Prism (version 8.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The 3-D interaction landscape between remdesivir and MU-UNMC-2 was calculated based on Loewe additive model using SynergyFinder v.2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SynergyFinder</div><div>suggested: (SynergyFinder, RRID:SCR_019318)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04303299</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Fight COVID-19 Trial</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04392427</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Not yet recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">New Antiviral Drugs for Treatment of COVID-19</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04260594</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Not yet recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Clinical Study of Arbidol Hydrochloride Tablets in the Treat…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04355026</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Use of Bromhexine and Hydroxychloroquine for Treatment of CO…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04276688</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Lopinavir/ Ritonavir, Ribavirin and IFN-beta Combination for…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04445272</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Clinical Trial to Evaluate the Effectiveness and Safety of T…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04433078</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">RepurpoSing Old Drugs TO SuppRess a Modern Threat: COVID-19 …</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04358614</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Baricitinib Therapy in COVID-19</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04338958</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ruxolitinib in Covid-19 Patients With Defined Hyperinflammat…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04280705</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Adaptive COVID-19 Treatment Trial (ACTT)</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04315948</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Trial of Treatments for COVID-19 in Hospitalized Adults</td></tr></table>


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. He also introduced a code by which numbers were translated into words to aid memorising them. The code was as follows: 1=p,a;2=b,e;3=c,i;4=d,o;5=t,u;6=f,ar,ra;7=g,er,re;8=l,ir,ri;9=m,or,ro;0=n,ur,ru1 = p, a; 2 = b, e; 3 = c, i; 4 = d, o; 5 = t, u; 6 = f, ar, ra; 7 = g, er, re; 8 = l, ir, ri; 9 = m, or, ro; 0 = n, ur, ru1=p,a;2=b,e;3=c,i;4=d,o;5=t,u;6=f,ar,ra;7=g,er,re;8=l,ir,ri;9=m,or,ro;0=n,ur,ru. So to remember a number such as 314159 one produced a word such as 'cadator' which then translated back into 314159. The assumption here was that 'cadator' was easier to remember than 314159.

      Sadly no reference to which book or portion in which this segment appears.

    1. SciScore for 10.1101/2021.04.01.438087: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing for 3 times, 100 μl of 0.2 μg/ml HRP-conjugated goat anti-Mouse IgG (H+L) (Thermo Fisher Scientific, 31430) or goat anti-Human IgG (H+L) (Promega, W4031) antibodies were added for 30 min at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>W4031</div><div>suggested: (Promega Cat# W4031, RRID:AB_430835)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Interactions were visualized by the incubation of tetramethylrhodamine (TRITC) labelled secondary goat anti-mouse IgG antibodies (Fc specific; 1:1000 dilution in binding buffer; Life Technologies) and goat anti-Human IgG (Fc specific)-Cy3 (1:1000 dilution in binding buffer; Merck).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the day before transfection, 293-F cells were diluted to 0.7×106 cells/ml in 30 ml FreestyleTM 293-F medium and grown at 120 rpm at 37°C with 8% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293-F</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293-6E cells were cultivated in FreeStyle F17 expression medium (Thermo Fisher Scientific, A1383502</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293-6E</div><div>suggested: RRID:CVCL_HF20)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">AFM measured Spike binding to Vero E6 cells: Vero E6 cells were grown on culture dishes using DMEM containing 10% FBS, 500 units/mL penicillin and 100 µg/mL streptomycin, at 37°C with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, proteins with a C-type lectin-like/IPR001304 domain were downloaded from InterPro 66.0 and supplemented with proteins obtained in jackhmmer searches using the PF00059.20 lectin C-type domain definition versus the mouse-specific UniProt and Ensembl databases.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>InterPro</div><div>suggested: (InterPro, RRID:SCR_006695)</div></div><div style="margin-bottom:8px"><div>Ensembl</div><div>suggested: (Ensembl, RRID:SCR_002344)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The C-type lectin-like regions were extracted from the full-length proteins using the SMART CLECT domain definition with hmmersearch v3.1b2 and extended by 5 amino acids on both sides.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SMART</div><div>suggested: (SMART, RRID:SCR_005026)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To reduce redundancy, principal isoforms were selected using appris 2016_10.v24.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>appris</div><div>suggested: (APPRIS, RRID:SCR_012019)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis was performed using the Gwyddion 2.55 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gwyddion</div><div>suggested: (Gwyddion, RRID:SCR_015583)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The quantification of fluorescence was done using ProScanArray Express software (Perkin Elmer) employing an adaptive circle quantification method from 50 μm (minimum spot diameter) to 300 μm (maximum spot diameter).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ProScanArray Express</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Average RFU (relative fluorescence unit) values with local background subtraction of four spots and standard deviation of the mean were recorded using Microsoft Excel and GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The full model is available at the MolSSI / BioExcel COVID-19 Molecular Structure and Therapeutics Hub (https://covid.molssi.org//models/#spike-protein-in-complex-with-human-ace2-spike-spike-binding).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioExcel</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.03.31.437907: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">In τ-STED mode, the 775 nm pulsed laser beam is superimposed at a typical power of 100 – 250 mW before the objective.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies for WB: mouse anti-S (1A9) 1:1000 (GTX632604, GeneTex)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GTX632604</div><div>suggested: (GeneTex Cat# GTX632604, RRID:AB_2864418)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies for Western blot analysis were HRP-conjugated anti-mouse purchased from Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA. Cell infection (unsynchronized) for immunofluorescence study of virus entry: 105 VeroE6 cells were seeded in 35 mm glass bottom dishes (Willco, Amsterdam) with 2 ml of culture medium and cultured for 1 days at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse purchased from Santa Cruz Biotechnology , Inc .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies for immunofluorescence studies: Secondary antibodies for immunofluorescence studies and combinations: Immunostaining of infected cells: Methanol-fixed infected cells and a methanol-fixed negative control were incubated overnight at 4 C° with 150 μl of a solution of anti-S IgG or anti-N IgG in PBS + 3% BSA (Sigma-Aldrich, Milan, Italy).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-N IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Kinetic study of virus growth in cells: VeroE6 cells were seeded in a 24 well plate at 105 cell/well in 1 ml of culture medium and cultured for 1 day at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cDNA of Caco-2 and HepG2 cells was used as a positive control of TMPRSS2 amplification.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HepG2</div><div>suggested: CLS Cat# 300198/p2277_Hep-G2, RRID:CVCL_0027)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunostaining of non-infected cells: 105 Vero-E6 cells were seeded in 35 mm glass bottom dishes (Willco, Amsterdam) with 2 ml of culture medium and cultured for 1 days at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The in-house one-step RT-qPCR reaction mixtures were run in a CFX Connect Real-Time PCR instrument (Bio-Rad Laboratories, Hercules, CA, USA) using a previously standardized thermal conditions (52.0 °C for 5 min, 95.0 °C for 10 s, 45 cycles of 10 s at 95.0 °C, and 62 °C for 30 s).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bio-Rad Laboratories</div><div>suggested: (Bio-Rad Laboratories, RRID:SCR_008426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lysates were quantified, loaded on 4-15% precast protein gels (BIORAD) and proteins were separated by SDS-PAGE and electro-blotted onto Hybond-C-Extra (Amersham Biosciences) nitrocellulose membranes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BIORAD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Colocalization of the green and far-red images was quantified by Pearson’s coefficient R according to the method by Costes et al. 65 by the colocalization threshold and colocalization test routines of Fiji.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single molecule localization analysis: Acquired dSTORM stacks were processed by Thunderstorm, a Fiji plugin for PALM and STORM data analysis 66.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STORM</div><div>suggested: (SToRM, RRID:SCR_006696)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Graphics and statistics: Graphs were prepared using Prism 7 (GraphPad) and IgorPro8 (Wavemetrics) software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 20. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.01.438120: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Cell lines: The wild-type SARS-CoV-2 S glycoprotein, with Asp 614, was inducibly expressed in Lenti-x-293T human female kidney cells from Takara Bio (Catalog #: 632180).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were Western blotted with 1:2,000 dilutions of rabbit anti-SARS-Spike S1, mouse anti-SARS-Spike S1, rabbit anti-SARS-Spike S2 or a 1:5,000 dilution of mouse anti-β-actin as the primary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-Spike</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-Spike S2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-β-actin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HRP-conjugated anti-rabbit or anti-mouse antibodies at a dilution of 1:5,000 were used as secondary antibodies in the Western blots.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HRP-conjugated</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Beads were washed three times and samples were Western blotted with a mouse anti-S1 antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lenti-x-293T cells were grown in DMEM with 10% FBS supplemented with L-glutamine and Pen-Strep.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Lenti-x-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">On the day prior to transfection, 293T cells were seeded in 6-well plates at a density of 1 x 106/well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Purification of the S glycoproteins: To express the SARS-CoV-2 S glycoprotein for purification, 293T-S cells were induced with 1 µg/ml doxycycline for two days.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-S</div><div>suggested: RRID:CVCL_LC70)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Approximately 4 x 104 293T-ACE2 cells were then added to each well, and the cultures were maintained for an additional 24 h at 37°C before luciferase activity was measured.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The adjusted integrated volumes of S, S1 and S2 bands from unsaturated Western blots were calculated using Fiji ImageJ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization activity was calculated from the reduction in luciferase activity compared to controls, using GraphPad Prism 8 (GraphPad Software Inc.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.03.30.437622: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies were purified as described below or purchased from the following manufacturers: Mouse anti-FLAG M2 (Sigma-Aldrich; F3165); Goat anti-Mouse IgG(H+L), Human ads-Alexa Fluor® 488 (SouthernBiotech;</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-FLAG</div><div>suggested: (Sigma-Aldrich Cat# F3165, RRID:AB_259529)</div></div><div style="margin-bottom:8px"><div>anti-Mouse IgG(H+L</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-FLAG signal was also used as an internal normalization control to correct for changes in transfection efficiency and spike expression when measuring antibody or ACE2 binding.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then washed with PBS-BSA and stained with secondary antibodies (5 μM Alexa Fluor® 488 anti-mouse (SouthernBiotech; 1031-30) and 10 μM Alexa Fluor® 647 anti-human (SouthernBiotech; 2048-31) in PBS-BSA), shaking at 950 rpm for 1 hr at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human</div><div>suggested: (SouthernBiotech Cat# 2048-31, RRID:AB_2795692)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Membranes were blocked in LICOR Odyssey Blocking Buffer (Neta Scientific) incubated with the following primary antibodies overnight: mouse anti-FLAG M2 antibody (1:10,000; Sigma-Aldrich; F3165) for spike protein or RBD detection and mouse anti-beta tubulin antibody (1:5000; Thermo Fisher; MA5-16308) as a loading control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-beta tubulin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The membrane was washed three times with PBST (1X PBS, 0.1% Tween 20) for 10 min and then incubated with the following secondary antibody for 2 hrs: goat anti-mouse IRDYe® 680 conjugated antibody (1:10,000; abcam; ab216776).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The assay went through the following steps: 1) baseline: 60 s with BLI buffer; 2) IgG immobilizing: 360 s with anti-FLAG IgG; 3) spikes loading: 360 s with diluted supernatants; 4) baseline: 300 s with BLI buffer; 5) association: 600 s with serial diluted analytes (antibodies or ACE2); 6) dissociation: 600 s with BLI buffer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-FLAG IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expi293 cells were cultured in Expi293 Expression Medium (Sigma-Aldrich; A1435101) and maintained in a humidified atmosphere of 8% CO2 and 37 °C while shaking continuously at 125 rpm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The HIV particles pseudotyped with SARS-CoV-2 spike variants D614G or B.1.1.7 were generated in HEK293T cells, following previously published protocols68.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mixture was then added to HEK-293T target cells, stably expressing human ACE2 in 96-well white plates with a clear bottom.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were transiently co-transfected with plasmids for (1) HIV virion formation proteins (HDM-Hgpm2, pRC-CMV-Rev1b, and HDM-tat1b; (2) one of the envelope proteins (2019-nCoV Spike-D614G mutant, B.1.1.7 variant or VSV-G) and (3) the lentiviral backbone expressing luciferase reporter (pHAGE-CMV-Luc2-IRES-ZsGreen-W).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Spike-D614G</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed using FlowJo v9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Half-maximal inhibitory concentrations (IC50) were calculated using a 3-parameter logistic regression equation (GraphPad Prism v9.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">EDTA-free Protease Inhibitor Cocktail; Millipore Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cocktail; Millipore Sigma</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Particle stacks were then imported into cryoSPARC v3.1.0 for 2D classification, ab initio 3D reconstruction, heterogeneous 3D refinement, and homogeneous 3D refinement70.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We then used the Biopython Bio.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Biopython</div><div>suggested: (Biopython, RRID:SCR_007173)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We then used the python parasail package (https://github.com/jeffdaily/parasail-python) to perform a semi-global alignment of each sequence to the reference sequence71.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.03.29.437516: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants provided written informed consent (virtual).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study design and participant recruitment: Pregnant women at two tertiary care centers in Boston, Massachusetts were approached for enrollment in a COVID-19 pregnancy biorepository study starting April 2, 2020 (Massachusetts General Hospital and Brigham and Women’s Hospital; Mass General Brigham IRB approval #2020P000804).</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phycoerythrin (PE)-coupled mouse anti-human detection antibodies (Southern Biotech) were used to detect antigen-specific antibody binding.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human detection antibodies (Southern Biotech)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antigen-specific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The next morning, membranes were washed 6x 10 min in TBS-T (20x stock from ThermoFisher was diluted 1:20 in H2O), followed by incubation with secondary antibodies at 1:15,000 dilution and hFAB Rhodamine Anti-Tubulin (Bio-Rad) at 1:4000 dilution for 1 hr in Intercept T20 (TBS) Antibody Diluent (Li-Cor Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Rhodamine Anti-Tubulin</div><div>suggested: (Bio-Rad Cat# 12004165, RRID:AB_2884950)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were then incubated in primary antibodies diluted in 5% bovine serum albumin (BSA) for 1.5h at room temperature (Placental Alkaline Phosphatase (PLAP – ab212383) - 1:1000, Neonatal Fc Receptor (FcRn – ab193148) – 1:100, CD16 (CD16 – Leica NCL-L-CD16) – 1:100), CD32 (R&D AF1330) – 10ug/ml, CD64 (Origene TA506331)-1:100.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PLAP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>FcRn – ab193148</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD16</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD32</div><div>suggested: (US Biological Cat# C2384-02G, RRID:AB_2278355)</div></div><div style="margin-bottom:8px"><div>CD64</div><div>suggested: (OriGene Cat# TA506331, RRID:AB_2623714)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The slides were washed in PBS Tween 0.1% and incubated in fluorescently conjugated secondary antibodies (1:400 in 5% BSA – Goat anti-Mouse IgG2a (A-21133), Goat anti-mouse IgG2b (A-21141), Goat anti-rabbit (ab150080), anti-mouse Igg1-(AF647 biolegend), donkey anti goat (AA1056)).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (Abcam Cat# ab150080, RRID:AB_2650602)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CellProlifer software was similarly used to quantify immunohistochemistry for ACE2 and CD163.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CellProlifer</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">O-PLSDA models were built using the R ‘ropls’ Bioconductor package (orthI =1; PredI=1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bioconductor</div><div>suggested: (Bioconductor, RRID:SCR_006442)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using GraphPad Prism 9 and R (version 4.0.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A limitation of our study is the infection of participants primarily in the third trimester, because these samples were collected during the initial wave of the SARS-CoV-2 pandemic in Boston. Whether maternal SARS-CoV-2 infection in the first and second trimester alters ISG and Fc receptor expression, and how such altered expression might durably impact placental immune function, is a question that remains to be answered in future studies. In addition, although we found no significant association between disease severity and placental gene expression or antibody transfer, such examinations were limited by the relatively small number of women with severe or critical illness. Finally, while our regression models did not find time from infection to delivery to be a significant contributor to the antibody transfer ratios, we cannot entirely rule out any contribution of timing of maternal infection to the reduced antibody transfer noted in males. However, our robust sexually dimorphic gene and protein expression results, with significant upregulation of both placental ISGs and Fc receptors in males, demonstrate placental factors are a stronger driver of antibody transfer than any time-from-infection effect. In conclusion, our comprehensive evaluation of the impact of fetal sex on placental gene expression and transplacental antibody transfer in maternal SARS-CoV-2 infection provides insight into sexually dimorphic or sex-specific placental innate and adaptive immune responses to m...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.03.29.436639: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Female K18-hACE2 (B6.CgTg(K18ACE2)2Prlmn/J HEMI) mice (6–8 weeks old) were obtained from Jackson and randomly assigned into cages in groups of 10 animals.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Female K18-hACE2 (B6.CgTg(K18ACE2)2Prlmn/J HEMI) mice (6–8 weeks old) were obtained from Jackson and randomly assigned into cages in groups of 10 animals.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RBD-hFc was detected by incubation of the membrane with purified IgG fraction from serum of rabbit immunized with SARS-CoV-2 spike protein for over-night at 4°C, followed by a secondary antibody IRDye 680RD goat anti-rabbit (LIC-92668071) incubation of 1 h at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and animals: HEK293T cells (ATCC CRL-3216) and Vero E6 cells (ATCC CRL-1586) were maintained at 37°C, 5% CO2 in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Evaluation of in vitro RBD-hFc expression in transfected HEK293 cells was performed essentially as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Female K18-hACE2 (B6.CgTg(K18ACE2)2Prlmn/J HEMI) mice (6–8 weeks old) were obtained from Jackson and randomly assigned into cages in groups of 10 animals.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6.CgTg(K18ACE2)2Prlmn/J HEMI )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The purified protein was sterile-filtered and stored in PBS. Animal Vaccination Experiments: For RBD-hFc mRNA vaccination studies, groups of 6–8 week old female K18-hACE2 mice were administered intramuscularly (50 μL in both hind legs) with SARS-CoV-2 RBD-hFc mRNA (5 μg) encapsulated with LNP formulation #14.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were recorded on a Cooled Falcon IIIEC (FEI) Direct Detection Device by TIA software attached to the Talos or a Gatan MultiScan 791 camera by DigitalMicrograph software (Gatan, U.K.) on the Tecnai.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DigitalMicrograph</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The number of plaques in each well was scored and the NT50 (Serum dilution at which the plaque number was reduced by 50%, compared to plaque number of the control, in the absence of serum) was calculated using the Prism software version 8 (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(GraphPad Software Inc., USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were performed using GraphPad Prism 8 statistical software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.03.28.437363: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Human subjects: The Institutional Review Board of the Affiliated Huaqiao Hospital of Jinan University approved this study.<br>Consent: All subjects provided informed consent at the time of enrollment that their samples could be used for this study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were stained with PE anti-human HLA-A2 antibody (BioLegend) at 4 °C in the dark for 30 min, and acquired in flow cytometer FACS Canto (BD).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human HLA-A2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HLA-A2 positive PBMC samples were further stained with PE labeled tetramer (home-made), PerCP labeled human CD8+ antibody (BioLegend), APC labeled human CCR7 antibody (BioLegend), FITC labeled human CD45RA antibody (BioLegend) and acquired with flow cytometer FACS Canto (BD).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human CD8+</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>human CCR7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>human CD45RA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">0.5 × 106 CD8+ T cells isolated from health donors were co-cultured with 0.5 × 106 peptide-loaded T2A2 cells stained with 5 μmol/L CFSE (TargetMol), and stimulated with 1 μg/mL anti-human CD28 antibodies (BioLegend) and 50 IU/mL IL-2 (SL PHARM, Recombinant Human Interleukin-2(125Ala) Injection).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human CD28</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PyMol 1.1 software was used to calculate the angle deflection of benzene ring in the polypeptide, and used the central atoms of three amino acids to calculate the angle.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: The data were analyzed by one-way ANOVA and paired-samples t-tests for statistical significance by using Graphpad prism 8 and SPSS 22.0 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 25 and 27. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.03.25.21254215: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Study population, setting, and data collection: Sixteen seronegative controls and a total of 125 in-patients individuals were recruited, following informed consent, for the study from the COVID Care Centres associated with BYL Nair hospital and T N medical college, Municipal Corporation of Greater Mumbai (MCGM), Mumbai following approval of institutional ethics committees.<br>IRB: Study population, setting, and data collection: Sixteen seronegative controls and a total of 125 in-patients individuals were recruited, following informed consent, for the study from the COVID Care Centres associated with BYL Nair hospital and T N medical college, Municipal Corporation of Greater Mumbai (MCGM), Mumbai following approval of institutional ethics committees.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IgG and IgM antibodies against SARS-CoV-2 were detected in fresh plasma samples using Rapid test from Voxpress (Voxtur Bio LTD, India) and Chemiluminescence immunoassay (CLIA) directed against SARS-CoV-2 anti-NC IgG.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-NC IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis was carried out using FlowJo software (BD biosciences) Immunophenotyping: For phenotypic characterization, immunostaining of 200 μl of fresh peripheral whole blood with following fluorescently labelled monoclonal antibodies, anti-CD3 (Clone:SK7), anti-CD4 (Clone: RPA-T4)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD4</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis was carried out using FlowJo software (BD biosciences) Immunophenotyping: For phenotypic characterization, immunostaining of 200 μl of fresh peripheral whole blood with following fluorescently labelled monoclonal antibodies, anti-CD3 (Clone:SK7), anti-CD4 (Clone: RPA-T4)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: Statistical analysis was performed in GraphPad Prism 8 using non parametric tests.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

  2. Mar 2021
    1. SciScore for 10.1101/2021.03.24.21254277: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Three separate alignments were performed using MAFFT implementing the L-INS-I algorithm and manually inspected for accuracy using Geneious Prime(r) 2021.1.1 (https://www.geneious.com)24.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div><div style="margin-bottom:8px"><div>Geneious Prime(r</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A maximum likelihood tree was estimated for each lineage using IQ-TREE implementing the following: Hasegawa-Kishino-Yano nucleotide substitution model with a gamma distributed rate variation among sites (HKY+Γ) and an ultrafast bootstrap method (1000 repetitions)25,26.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IQ-TREE</div><div>suggested: (IQ-TREE, RRID:SCR_017254)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. Reviewer #2 (Public Review):

      In this manuscript, the authors set out to provide a comprehensive meta-analysis of associations between masculinized phenotypes and fitness-relevant outcomes (mating, reproduction, and offspring viability), so as to assess the current state of evidence for hypotheses of sexual selection on human males across high- and low-fertility populations. I enjoyed reading this manuscript, which is well organized and very clearly written. I also appreciated the depth of the analyses reported by the authors. Overall, I am pleased with this research and think it will make a valuable contribution to the literature on human sexual selection and masculinity more generally.

      I do not have any major concerns regarding the methods and results. However, I think the paper would greatly benefit from introducing greater nuance into the theoretical framework and conclusions, which I believe will meaningfully change some of the takeaways presented in the discussion. I have provided references throughout to aid the authors in this effort during revision, though they should certainly not feel compelled to cite each reference provided. I would also appreciate that the authors provide some estimates of (a priori) statistical power when they make claims regarding statistical power in the interpretation of results.

      Major comments:

      The authors have done a very nice job of efficiently introducing the reader to mainstream hypotheses regarding sexual selection on human male phenotypes, particularly those emphasized within evolutionary psychology. I recognize that the authors' primary contribution is empirical and that they have in large part followed the typical presentation of these hypotheses in previous literature. However, given that this paper may be an important point of reference for future research in this area, I would like to encourage the authors to address some important nuances in greater detail that are frequently overlooked.

      (i) The authors argue that "Sexual selection is commonly argued to have acted more strongly on male traits as a consequence of greater variance in males' reproductive output (3) and male-biased operational sex ratio, i.e. a surplus of reproductively available males relative to fertile females (e.g. 4)". This argument then leads to a discussion of why formidability as indexed by strength and other potential indicators of physical dominance are expected to be under selection in males. However, recent work in sexual selection theory has begun to emphasize the importance of the co-evolution of male offspring care and reproductive competition, leading in many cases to opposite predictions compared to classical models of OSR. In particular, more recent models predict that males should often increase rather than decrease offspring care relative to mating effort when men are in relative abundance. These predictions have received support in recent empirical studies in human populations, and help to explain otherwise puzzling patterns such as e.g. the association between male-biased sex ratios and monogamy + low reproductive skew across many taxa. Please see

      Kokko, H., & Jennions, M. D. (2008). Parental investment, sexual selection and sex ratios. Journal of evolutionary biology, 21(4), 919-948. Schacht, R., Rauch, K. L., & Mulder, M. B. (2014). Too many men: the violence problem?. Trends in Ecology & Evolution, 29(4), 214-222. Schacht, R., & Borgerhoff Mulder, M. (2015). Sex ratio effects on reproductive strategies in humans. Royal Society open science, 2(1), 140402.

      Considering these models, one might expect that a variety of behavioral and psychological phenotypes would be under male-specific sexual selection that are simply not considered in the present study. One might also expect that appropriate proxies of male fitness will also vary across populations, independently of the presence/absence of contraception. The authors argue that they selected mating-based proxies of reproductive behaviors and attitudes under the assumption that "preferences for casual sex, number of sexual partners, and age at first sexual intercourse (earlier sexual activity allows for a greater lifetime number of sexual partners)... correlated with reproductive success in men under ancestral conditions". Yet, in large-scale industrialized societies that have undergone a demographic transition, high status males are often observed to invest more in offspring care and the production of intergenerationally transferable wealth at the expense of greater fertility, which may be an adaptive response to shifting demands in relation to competition for status.

      Shenk, M. K., Kaplan, H. S., & Hooper, P. L. (2016). Status competition, inequality, and fertility: implications for the demographic transition. Philosophical Transactions of the Royal Society B: Biological Sciences, 371(1692), 20150150.

      In general, long-run fitness may often not map so simply onto promiscuous sexual behavior in such a straightforward way. Measures such as age at first intercourse may also be confounded with environmental heterogeneity among participants, which could instead indicate environmentally induced plasticity within individuals' lifetimes toward a faster pace of life.

      (ii) Related to this point, the authors discussion of the relationship between testosterone and male phenotypes is somewhat over-simplified, although again in keeping with much of the previous literature in evolutionary psychology. While it was long emphasized that testosterone is a mechanism of aggression per se, recent work has shown that testosterone is better understood as a mechanism for increasing status-seeking, competitive behavior, which can greatly vary in form across socioecological contexts.

      Eisenegger, C., Haushofer, J., & Fehr, E. (2011). The role of testosterone in social interaction. Trends in cognitive sciences, 15(6), 263-271.

      Unfortunately, most of the fWHR and 2D:4D literature has ignored these findings and continues to focus solely on aggression even in WEIRD student samples, where we can be certain that aggression is generally not a viable strategy for attaining and maintaining social status. To my knowledge, only a few studies have explicitly tested this more nuanced hypothesis regarding associations between masculinized phenotypes and differing forms of status-seeking behavior, both of which have found support for ecologically contingent effects in regards to fWHR. Martin et al. (2019) predicted and found support in bonobos for higher fWHR predicting higher scores on an affiliative measure of social rank among both males and females, consistent with the importance of relationship strength and social network centrality for competitive advantage among bonobos. Similarly, Hahn et al. (2017) found that fWHR in human males consistently predicts prosocial behavior and leadership in large-scale institutions. This is consistent with the fact that leadership traits, rather than aggression and formidability per se, are often important predictors of status in human societies (and in contexts of relatively higher SES within those societies).

      Hahn, T., Winter, N. R., Anderl, C., Notebaert, K., Wuttke, A. M., Clément, C. C., & Windmann, S. (2017). Facial width-to-height ratio differs by social rank across organizations, countries, and value systems. PLoS One, 12(11), e0187957. Martin, J. S., Staes, N., Weiss, A., Stevens, J. M. G., & Jaeggi, A. V. (2019). Facial width-to-height ratio is associated with agonistic and affiliative dominance in bonobos (Pan paniscus). Biology Letters, 15(8), 20190232.

      In regard to the male-male competition hypothesis, as noted in the previous comment, we might therefore expect sexual selection to occur on a variety of male traits other than formidability related measures, as well as to be highly population-specific-rather than there being some universal optimum for "masculine" traits-given that what constitutes an adaptive male phenotype likely varies across populations in regard to both male-male competition and female choice. Finally, it should be noted that testosterone is by no means the only sex hormone relevant to considering patterns of human sexual dimorphism. Please see Dunsworth (2020) for a discussion of the centrality of estrogen in proximally explaining sexual dimorphism in body size

      Dunsworth, H. M. (2020). Expanding the evolutionary explanations for sex differences in the human skeleton. Evolutionary Anthropology, 29, 108-116.

      (iii) The authors should provide more references to (and brief discussion of) mixed results regarding the degree of sexual dimorphism in facial and digit ratio metrics. While they cite a few studies in the introduction, one might leave the text with the impression that there is clear enough evidence for 2D:4D being influenced by (pre-natal) sex hormones and being a sexually dimorphic phenotype. However, these results have been strongly challenged, not only be ref 14 and 20 in the main text, but also various other studies e.g.

      Barrett, E., Thurston, S. W., Harrington, D., Bush, N. R., Sathyanarayana, S., Nguyen, R., ... & Swan, S. (2020). Digit ratio, a proposed marker of the prenatal hormone environment, is not associated with prenatal sex steroids, anogenital distance, or gender-typed play behavior in preschool age children. Journal of Developmental Origins of Health and Disease, 1-10. Richards, G. (2017). What is the evidence for a link between digit ratio (2D: 4D) and direct measures of prenatal sex hormones?. Early Human Development. Richards, G., Browne, W. V., Aydin, E., Constantinescu, M., Nave, G., Kim, M. S., & Watson, S. J. (2020). Digit ratio (2D: 4D) and congenital adrenal hyperplasia (CAH): Systematic literature review and meta-analysis. Hormones and Behavior, 126, 104867. Richards, G., Browne, W. V., & Constantinescu, M. (2021). Digit ratio (2D: 4D) and amniotic testosterone and estradiol: An attempted replication of Lutchmaya et al.(2004). Journal of Developmental Origins of Health and Disease.

      Similarly, not all metrics of facial masculinity are equally valid given current empirical evidence. In a recent longitudinal study, only cheekbone prominence was found to show consistent evidence of sexual dimorphism across age groups.

      Robertson, J. M., Kingsley, B. E., & Ford, G. C. (2017). Sexually dimorphic faciometrics in humans from early adulthood to late middle age: Dynamic, declining, and differentiated. Evolutionary Psychology, 15(3), 1474704917730640.

      Overall, I found the authors' discussion of how they selected the specific facial metrics lumped together in their analyses to be underspecified. Please note in the discussion as well that BMI is a well-known confound in studies of facial masculinity and may be a cause of null results in the present study (unless I happened to miss this in the regard to the moderation results - if so, my apologies!).

      Geniole, S. N., Denson, T. F., Dixson, B. J., Carré, J. M., & McCormick, C. M. (2015). Evidence from meta-analyses of the facial width-to-height ratio as an evolved cue of threat. PloS one, 10(7), e0132726.

      (iv) Finally, please provide reference to and potentially brief discussion of the current state of the literature as regards "good genes" hypotheses of female choice, which is relevant for determining how useful previous studies are for directly addressing this hypothesis. Please see:

      Achorn, A. M., & Rosenthal, G. G. (2020). It's not about him: Mismeasuring 'good genes' in sexual selection. Trends in Ecology & Evolution, 35, 206-219.

    1. SciScore for 10.1101/2021.03.26.437180: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Cell culture and virus infection: Cells were cultured at 37°C and 5% CO2 and routinely screened for mycoplasma contamination.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies included: beta-actin-HRP (AC-15, Sigma Aldrich), pSTAT1 (Y701) (58D6, Cell Signaling Technology), STAT1 (42H3, Cell Signaling Technology), pSTAT2 (D3P2P, Cell Signaling Technology), STAT2 (D9J7L, Cell Signaling Technology), hcGAS (D1D3G, Cell Signaling Technology), hSTING (D2P2F, Cell Signaling Technology), MyD88 (D80F5, Cell Signaling Technology), TBK1 (D1B4, Cell Signaling Technology), MAVS (ALX-210-929-C100</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSTAT1</div><div>suggested: (Fluidigm Cat# 3153003, RRID:AB_2661824)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were incubated with antibodies against human MxA (clone M143, kind gift from G Kochs) and SARS-CoV-2 N protein (clone EY-2A, kind gift from Alain Townsend56; 1:200, 30 minutes, 4°C), and goat anti-mouse AlexaFluor 488 (Life Technologies, A11029) and anti-human AlexaFluor 647 (1:500, 30 minutes, 4°C; Life Technologies, A21445), and resuspended in CellFix (1:10 in water; BD, 340181).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 N protein</div><div>suggested: (ABclonal Cat# A20021, RRID:AB_2862924)</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Molecular Probes Cat# A-11029, RRID:AB_138404)</div></div><div style="margin-bottom:8px"><div>anti-human AlexaFluor 647</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A21445</div><div>suggested: (Molecular Probes Cat# A-21445, RRID:AB_2535862)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 cells (ATCC) were maintained in MEM (Gibco) supplemented with 10% v/v foetal calf serum (FCS, Gibco), 2 mM L-glutamine (Gibco), 1x sodium pyruvate (Gibco) and 1x non-essential amino acids (Gibco).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">THP1 cells (kind gift from V Cerundolo) were maintained in RPMI (Sigma Aldrich) supplemented with 10% v/v (FCS) and 2 mM L-glutamine (Gibco).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>THP1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All other cells (A549, kind gift from G Kochs; HEK293T, HEK293 and VERO E6, kind gifts from C Reis E Sousa; Huh7, kind gift from J McKeating) were maintained in DMEM (Sigma Aldrich) supplemented with 10% v/v FCS and 2 mM L-glutamine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, virus was serially diluted ten-fold in DMEM with 1% FCS, and 100 μl of dilutions were added in quadruplicates to 24 well plates containing 2.5 x 105 Vero E6 cells in 500 μl of medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">0, ENZO Life Science), IRF3 (D6I4C, Cell Signaling Technology), MDA5 (generated in house55) and RIG-I (clone ALME-I, ProSci #PSI-36-102).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDA5</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After removing the overlay and the medium, cells were washed in PBS, and fixed and stained using Amido Black stain for at least 30 minutes at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Amido</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentiviral shRNA knockdown: Lentiviral plasmids encoding shRNAs targeting GFP (control; SHC005) and MAVS (06: TRCN0000149206; 45: TRCN0000148945) were obtained from the Sigma Mission library (Merck Darmstadt)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sigma Mission library</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were analysed by flow cytometry on an Attune NxT Flow Cytometer (Thermo Fisher Scientific) and data were analysed using FlowJo software (BD).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.03.26.21254427: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Human subjects: This study was approved by the Washington University Institutional Review Board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Three commercial serological assays and an anti-S ELISA granted EUA at Mt. Sinai Hospital, but used on a research basis for this study, were used to directly measure antibody levels in serum specimens.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed and incubated with 1 µg/mL anti-S antibody (CR3022) and HRP conjugated goat anti-human IgG.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus was propagated in Vero E6 cells in Dulbecco’s Modified Eagle Medium (DMEM, Corning) that was supplemented with 10% FBS, glucose, L-glutamine, and sodium pyruvate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Abbott SARS-CoV-2 IgG assay was performed on an Abbott Architect i2000 and detects antibodies to the nucleocapsid protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott Architect</div><div>suggested: (Abbott ARCHITECT i1000sr System, RRID:SCR_019328)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The positive cutoffs for each assay are 1.0 (S/C), 1.4 (S/C), and 1.0 (COI) for the Ortho Clinical, the Abbott, and the Roche assays, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      There are several limitations associated with this study. Among the greatest limitations is the lack of standardization between assays, even among the same manufacturers. This was previously noted with the neutralization assay, though the same is true among commercial assays. Since several of the assays have been designated as qualitative (i.e. the Roche, Abbott, and Ortho Clinical assays), there is limited evidence that semi-quantitative results are comparable between different instruments by the same manufacturer above the cutoff. For example, since there is no material to verify linearity at higher concentrations, a result of 15 S/C at one institution using the Ortho Clinical assay may vary from the Ortho Clinical assay at another institution. This may underlie the differences between the established cutoff and FDA cutoff for the Roche assay. In general, this problem will continue to plague the field until quantitative assays are universally adopted and standardized to SARS-CoV-2 antibody reference material, such as that recently released by the World Health Organization (27). This is further complicated by unclear direction as to how to report a qualitative assay result as quantitative under an EUA, which does not permit modification of the manufacturer’s Instructions for Use. Another limitation of the current study is that a limited number of assays were evaluated, limiting the generalizability of results. It is also important to note that these specimens were obtained e...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.03.26.21254337: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: This bespoke app recorded consent to the study, symptoms, test results, an upload of a photograph of the completed test, and responses to a one-item acceptability question.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Strengths and limitations: This is the first qualitative study examining views and experiences of students and staff of regular asymptomatic SARS-CoV-2 testing in a university setting using LFTs. It highlights a number of key issues related to acceptability and feasibility of regular testing as well as its behavioural implications. We note some limitations. The mean number of tests conducted by each interview and survey participant was higher than the mean number of tests in non-interviewed participants, so our sample may over-represent those who continued to test regularly. Additionally, the FACTS participants were university student and staff volunteers, whose motivation to participate and perceived benefits may be different from those in the wider university population, and other non-university settings. The majority of interview participants were also staff. We adopted rapid qualitative analysis to aid identification of key issues but full transcription of qualitative data could have minimised the potential for errors of interpretation. However, we discussed interpretation of data on a regular basis with other members of the team and extensive notes have been made after each interview. Implications for policy and practice: Our study indicates that messages highlighting the benefits for family, friends and society in identifying asymptomatic cases and contributing to fighting the pandemic and ultimately lifting lockdowns might be beneficial for encouraging regular use of L...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.03.21.21254072: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Additionally, during the COVID-19 pandemic, an electronic informed consent was obtained from all SARS-CoV-2 positive subjects or their surrogates for inclusion.<br>IRB: The registry was approved by the institutional review board of WCMC (1405015116, 20-05022072, 20-03021681).<br>IACUC: All animal experiment procedures, breeding, and ethical use were performed in accordance with the guidelines set by the Institutional Animal Care and Use Committee at Mount Sinai School of Medicine.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infectious titers of SARS-CoV-2 were determined by plaque assay in Vero E6 cells in Minimum Essential Media supplemented with 2% FBS, 4 mM L-glutamine, 0.2% BSA, 10 mM HEPES and 0.12% NaHCO3 and 0.7% agar.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Some variables (including comorbidities and outcomes) were derived from the REDCap project via manual abstraction, while others (e.g. in-hospital medication usage) were derived from automatically extracted EHR data.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Band density was quantified using ImageJ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Response to all reviewers

      We thank all the reviewers for carefully considering our manuscript and providing useful comments and suggestions. We agree with the general comment that testing our key findings in breast cancer cells is important. We will therefore carry out this work over the coming months and include this data in the revision. The other specific comments we address individually in the point-by-point responses below, which provides an outline of the other new experiments we plan to carry out prior to revision.

      In addition to this, we would like to just highlight one general point that we only picked up when considering these responses. It is important to highlight this to all reviewers now, since we believe it adds clinical weight to our conclusions. This relates to the issue of P53, which our manuscript shows drives resistance to CDK4/6 inhibition in cells by inhibiting long-term cell cycle withdrawal following genotoxic damage.

      P53 loss has been implicated in abemaciclib resistance in breast cancer patients (P53 mutation was detected in 2/18 responsive patients and 10/13 non-responsive patents (Patnaik et al., 2016)). This was recently corroborated in a larger scale study in breast cancer: the first whole exome sequencing study aimed at characterising intrinsic and acquired resistance to CDK4/6 inhibitors (Wander et al., 2020). In this recent study, P53 loss/mutation was identified in 0/18 sensitive tumours, 14/28 intrinsically resistant tumours, and 9/13 tumour with acquired resistance**. This was the most frequent single genetic change associated with resistance (58.5%), although 8 other genetic changes were also associated with resistance to differing degrees (7-27%).

      Most of these other resistance events occurred in pathways known previously to help drive G1/S progression following CDK4/6 inhibition: i.e. fully predictable resistance mechanism (RB loss, CCNE2 amplification, ER loss, RAS/AKT1 activation, FGFR2/ERB22 mutation/amplification). Importantly, when the authors attempted to recapitulate these resistance event in breast cancer cell lines, they could demonstrate the expected increase in proliferation following CDK4/6 inhibition in all situation tested, except for P53 loss. This caused the authors to conclude that “loss of P53 function is not sufficient to drive CDK4/6i resistance”. This would appear to us to be an unsatisfactory explanation given the clinical data. However, the authors speculated further that: “Enrichment of TP53 mutation in resistant specimens may result from heavier pre-treatment (including chemotherapies), may be permissive for the development of other resistance-promoting alterations, or may cooperate with secondary alterations to drive CDK4/6i resistance in vivo.”

      We believe that our data provide a crucial alternative explanation for these clinical findings. P53 does not affect the efficiency of a G1 arrest (fig.2), but rather it prevents the resulting genotoxic damage from inducing long-term cell cycle withdrawal (figs.2,3). Therefore, this could explain why it drives resistance in clinical disease but not in the in vitro cell growth assays employed by Wander et al. This highlights a crucial general point of our paper – important effects like this can be missed or misinterpreted until the true nature of long-term cell cycle withdrawal is appreciated.

      As part of our breast cancer work at revision we will analyse this closely by comparing the effect of p53 loss on long-term cell cycle withdrawal. If the current RPE1 data holds true in breast cancer, then we believe that out study would provide a crucial explanation for these clinical findings, and in turn, these clinical data would throw weight behind our conclusion that genotoxic damage and p53 loss is a clinically important consequence of CDK4/6 inhibition in patients.


      Reviewer #1 (Evidence, reproducibility and clarity (Required)): Comments on 'CDK4/6 inhibitors induce replication stress to cause long-term cell cycle withdrawal' The rationale for this work is to understand the mechanism by which Cdk4/6 inhibitors inhibit tumour cell growth, specifically via senescence which seems to be a frequent outcome of Cdk4/6 inhibition. Although several mechanisms by which Cdk4/6 inhibition induce senescence have been proposed these have varied with the cancer cell model studied. To examine the mechanism for the cytostatic effect of cdk4/6i in therapy without potential confounding effects of different cancer cell line backgrounds, Crozier et al tackle this question in the non-transformed, immortalised diploid human cell line, RPE1. They use live cell imaging and colony formation to track the impact of G1 arrests of different lengths induced by a range of clinically relevant cdk4/6 inhibitors. They also use CRISPR-mediated removal of p53 to examine the role of p53 in the observed cell cycle responses. After noting that G1 arrest of over 2 days leads to a pronounced failure in continued cell cycle and proliferation that is associated with features of replication stress, they perform a proteomics analysis to determine the factors responsible for this. They discover that MCM complex components and some other replicative proteins are downregulated and overall suggest a mechanism whereby downregulation of these essential replication components during a prolonged G1 induce replication stress and ultimate failure of proliferation. They show the impact of cdk4/6 inhibition can be increased by combining with either aneuploidy induction (to indirectly elevate replication stress), aphidicolin (to directly elevate replication stress) or chemotherapy agents that damage DNA. Overall this is a well written and presented manuscript. Data are extremely clearly presented and described clearly within the text. Most appropriate controls were included and the work is performed to a high standard. I have a few comments about the proteomic analysis, and the link between MCM component deregulation and the induction of replication stress:

      - We thank the reviewer for this careful, detailed review, and for their kind comments about our work.

      **Major points:**

      1. Relevance to cancer. I appreciate that examining the mechanism in a diploid line is a sensible place to start. However it remains a bit unclear precisely which aspects of this mechanism might be conserved in cancer. It could be helpful to provide evidence (if it exists) of the impact of cdk4/6 inhibition in tumour cells. For example, are catastrophic mitosis, senescence, etc observed? And is there anything further known about the relationship between tumour mutations such as p53 and clinical response to Cdk4/6i?

      - It is important to point out that senescence is a common outcome of CDK4/6 inhibition in tumour cells, but exactly why tumour cells become senescent is still unclear. There have been many possible explanations proposed (see introduction), but so far, none of these implicate DNA damage. This is surprising for us, considering that DNA damage remains the best-known inducer of senescence and this is how most other broad-spectrum anti-cancer drugs induce permanent cell cycle exit. P53 loss has been associated with CDK4/6i resistance in the clinic, but this has also not previously been linked to genotoxic stress or senescence following CDK4/6 inhibition (see detailed description of this in comment to all reviewers above).** Therefore, our data could help to explain both of these key findings. However, we appreciate the importance of testing these results in breast cancer cells, therefore we will perform these experiments and include the data after revision.

      Also - many of the phenotypes followed in this manuscript vary considerably with the length of G1 and the length of release. Which of these scenarios might mimic in vivo conditions?

      - We see that a prolonged arrest (> 2 days) is necessary to see genotoxic effects in RPE cells. Clinically, palbociclib is administered in 3-week on/1-week off cycles, therefore this is consistent with the possibility that replication stress is induced during the off periods to cause genotoxic damage and cell cycle withdrawal.

      Relating to the downregulation of MCM complex members, and the potential impact on origin licensing, how would this mechanism be manifest in cancer cells that have already deregulated gene transcription programs, and are already experiencing replication stress?

      - We hypothesise that cancer cells with ongoing replication stress maybe more sensitive to the MCM downregulation caused by CDK4/6 inhibition. The rationale is that a reduction in licenced origins would impair the ability of dormant origins to fire in response to replication problems, therefore making elevated levels of replication stress less tolerable. This is consistent with the enhanced effect of CDK4/6 inhibition seen when replication stress is elevated in RPE cells. Moreover, others have shown that experimentally reducing MCM protein levels induces hypersensitivity to replication stress in transformed cell lines such as U2OS and HeLa (Ge et al., 2007; Ibarra et al., 2008). Thus, low MCM levels and reduced origin licensing can contribute to replication failure in cancer cells.

      1. MCM protein levels and proposed impact on chromatin loading and origin licensing. Several MCM components are clearly reduced at the protein level. A chromatin assay (assaying fluorescence of signal remaining after pre-extraction of cytosolic proteins) suggests that MCM loading on chromatin is reduced, and this is taken to suggest a reduction in origin licensing. This is quite an indirect method - and it is difficult to conclude that the reduced chromatin bound fraction really represents a meaningful reduction in origin licensing. It would be more convincing if either positive and negative controls for this assay were included. Moreover it is not clear if this MCM reduction and proposed reduction in licensed origins would actually impact replication in an otherwise unperturbed state? Many more origins are licensed than actually fire during a normal S-phase, so it is not entirely clear that MCM levels could lead directly to replication stress here.

      - Quantifying the non-extractable MCM proteins is in truth the most direct assay for origin licensing (not origin firing) available in human cells. To our knowledge, there are no reports of MCM loading by this or similar assays that are not strongly correlated with origin licensing per se. The reviewer is correct that modest reductions in MCM loading are well-tolerated in the absence of other perturbations. Specifically, Ge et al found no proliferation effects after 50% MCM loading reduction, but any further reduction introduced a proliferation delay (Ge et al., 2007). Of note, the U2OS cells used in that study also have a functional p53 response.

      - Another important point that is worth emphasizing, is that many of the differentially downregulated proteins only function at replication forks (fig.4c). Therefore, we believe that the replication stress is a combined result of poor licencing and reduced levels of replication fork proteins that are needed after the origins fire. We will clarify this point in the revised manuscript.

      1. Loss of MCM protein levels and chromatin loading occurs after 1 day, not 4 days, of Cdk4/6 inhibition. The current proposal (based on evidence from the live cell imaging, and the induction of hallmarks of replication stress in figures 1-3) seems to be that something occurs between 2 and 7 days of cdk4/6i to prevent cells from resuming a normal cell cycle. Thus the proteomics was performed between 2 and 7 days, and MCM proteins identified as major changed proteins between those times. However, according to Western blots and FACS profiles in Figure 4, the major reduction in MCM protein levels, and chromatin loading occurs already at 1 day of of cdk4/6i (Figure 4d,e,f). However, replication stress is not observed after this timepoint (Figure 3) - so this seems to decouple the timings of MCM reduction from induction of replication stress. How can this be reconciled?

      - We agree that some of the observed changes to replisome components are quite considerable after just 1 day of arrest (some of these downregulations such as Cdc6 or phospho-Rb can be attributed to the cell cycle arrest itself - Cdc6 is unstable in G1 - but others, such MCM proteins, are not typically lost during G1). We were initially surprised by this too, considering that the phenotype clearly appears later than 1 day of arrest. It is important to state though, that the levels of almost all replisome components continue to decline as the duration of arrest is extended, eventually falling to considerably lower levels than seen after just 1 day. This is observed for MCM2, MCM3 and PCNA by western (fig.4e,e) and a large number of other replisome components by proteomics (fig.4c, 2 vs 7 days). Even MCM loading, which is 58% reduced after just 1-day arrest, is still reduced even further to just 20% of controls after 7 days (p- Our interpretation of the phenotypic data in light of this, is that replication problems become apparent when the number of licensed origins and the function of the replisome is compromised below a certain threshold; which most likely depends on cell type and, in particular, the levels of endogenous replication stress. So, in RPE cells, 1-day treatment is clearly tolerable, perhaps because there are still enough origins to complete DNA replication successfully. But, importantly, if replication stress is enhanced in these cells then 1-day of palbociclib arrest now starts to cause observable defects. This is evident in Figure 5h, where 1-day palbociclib treatment causes minimal effect on long-term growth on its own, but growth is reduced considerably when replication stress is elevated with genotoxic drugs. We interpret this to mean that the reduction in licenced origins and replisome components observed after 1 day of arrest, starts to become problematic in situations when replication stress is elevated.*

      - This is actually an important point that we will highlight this at revision, because one prediction is that other cells with elevated replication stress (e.g. tumour cells with oncogene-induced replication stress) may begin to see defects after as little as 1-day palbociclib arrest.

      **Minor points:**

      1. All the live cell tracking figures would be even more informative if a quantification of key features (such as a cumulative frequency of S-phase entry, or a mean+SD of time in G1, S and G2) were also presented.

      - We agree this will be useful, and we will include this information after revision.

      1. In Figure 2D the cells released from palbociclib seem to delay longer in G1 until they start to enter S phase, compared to cells co-treated with STLC (Figure 2B). Why would this be? It is difficult to tell if other subtle effects might be present in between the +STCL and -STLC conditions, so additional graphs such as those suggested above might be informative here in particular.

      - Fig.2d shows a representative experiment (50 cells) because it is difficult to interpret these individual cell cycle profiles when more than 50 cells are presented. However, we have all the data from 3 experiments (150 cells), therefore we will also calculate timings as suggested and present this information after revision.

      1. Figure 4f It would be helpful to see the FACS plot for at least one of the conditions quantified in the graph as a comparison.

      - These plots will be included after revision

      1. MCM2 protein is not down in p53 wt, but is reduced in p53 KO cells - why is this? And why is MCM2 not impacted when the other MCM complex members are?

      - We think perhaps there has been a mistake in interpreting these graphs. MCM2 is actually slightly lower in WT than KO cells at 1 days, and similar at 4 and 7 days (Fig.4d,e). MCM2 is also reduced slightly more than MCM3 (fig.4d,e) and MCM2, 3, 4, and 5 are all reduced by similar extents between 2 and 7 days palbociclib arrest (30-40% reductions; Fig.4c).

      Inducing aneuploidy with reversine to elevate replication stress may result in additional aneuploidy-related stresses that confound this interpretation. For example, aneuploidy per se is known to elevate p21 and p53 levels, and chromosome mis-segregation could elevate DNA damage. For these reasons these experiments are not as compelling as the direct elevation of replication stress using aphidicolin.

      - We agree that the aneuploidy experiment could have many different interpretations, and only one of these relates specifically to replication stress. This was also commented on by reviewer 3, so we feel it is best to remove this data and just keep the data on drugs that affect replication stress or DNA damage directly. We will address the effects of aneuploidy more extensively in a separate study.

      **Interesting points to follow up/add more mechanism**

      1. What is mechanism of protein downregulation of MCM etc? Was gene transcription impacted, or is this a question of protein stability? Depletion of one subunit can destabilise the complex leading to protein loss of the other MCM subunits, so perhaps this effect could be due to downregulation of a single MCM complex member.
      2. Are these findings specific to Cdk4/6 inhibitors, or would another means or arresting cells in G1 have the same impact?

      Both of these points are interesting questions and they are actually the focus of an entirely separate study that is ongoing. In particular, we are working on the mechanism(s) of MCM and replisome downregulation.

      Reviewer #1 (Significance (Required)): The central question of the paper is an important one so this work would be of interest to many in the clinical and preclinical fields, and also to the cell cycle and replication stress fields.

      - We thank the reviewer for this, and we agree that linking CDK4/6 inhibitors to genotoxic stress is important both for our understanding of cell cycle control and for cancer treatment. We are actually amazed that these drugs have not previously been linked to genotoxic stress, given that they appear to have broad pan-cancer activity and all other broad-spectrum anti-cancer drug work by causing genotoxic stress.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)): In this paper, Saurin and colleagues investigate the effects of CDK4/6 inhibitors on cell cycle arrest and re-entry. The authors report that long-term G1 arrest induced by CDK4/6i interferes with DNA replication during the next cell cycle, leading to DNA damage and mitotic catastrophe. Additionally, this compromised replication state sensitizes cells to chemotherapeutics that enhance replication stress. The major claims advanced in this paper are well-supported by the presented evidence. Well I have several questions regarding the significance (see below), I have only a few minor points regarding the methodology. 1) Regarding the down-regulation of MCM components induced by long-term palbo treatment shown in Figure 4: MCM levels are tightly regulated by cell cycle phase. I could imagine that this gene expression change may be a consequence of, for instance, 2 days CDK4/6i treatment arresting 95% of cells in G1 while 7 days of CDK4/6i treatment causes a 99.9% G1 arrest. The data in Figure 1B seems to argue against this hypothesis, but how was that data generated? Can the authors rule out a subtle change in S-phase % over 7 days in palbo? Alternately, is the down-regulation of MCM genes a consequence of cells entering senescence?

      - We have performed extensive long-term movies with these cells, and we never see cells dividing or exiting G1 after the first day of palbociclib treatment. This is illustrated in fig.1b which demonstrates that 100% of FUCCI cells are in G1 (Red) at each of the timepoints. This will be clarified in the legend. In addition, MCM protein levels do not actually oscillate with cell cycle phase (Matson et al., 2017; Méndez and Stillman, 2000), although their mRNA levels certainly do (Leone et al., 1998; Whitfield et al., 2002). Furthermore, RPE and mammalian fibroblasts retain MCM proteins after 2 days of growth factor withdrawal despite transcriptional repression of their respective genes **(Cook et al., 2002; Matson et al., 2019)

      - We see significant changes in MCM levels at a time when cells are still permissive to enter the cell cycle following drug release. Therefore, MCM reduction is not a consequence of senescence. Rather, we believe that it is one of the causes of cell cycle withdrawal following the subsequent S-phase.

      2) For the drug studies presented in figure 5, it is important that the authors perform the appropriate statistical comparisons and analyses to demonstrate true synergy. The authors show that combining palbo and certain chemotherapies causes a greater decrease in clonogenicity than palbo alone. This may or may not be surprising (see below) - but this by itself is insufficient to support the claim that palbo "sensitizes" cells to genotoxins. If you treat cells with two poisons, in 9 out of 10 cases, you'll kill more cells than if you treat cells with one poison alone. But that could be due to totally independent effects - see, for instance, Palmer and Sorger Cell 2017. There are several well-established statistical methods for investigating drug synergy - like Loewe Additivity or Bliss Independence - and one of these methods should be used to analyze the drug-combination studies presented in Figure 5.

      - This analysis will be performed at revision

      Reviewer #2 (Significance (Required)): While this study is a comprehensive analysis of the effects of CDK4/6i in RPE1 cells in 2d culture, I am not convinced of its broader significance. 1) So far as I can tell, the authors do not cite any studies establishing that CDK4/6i results in a significant increase in G1-arrested cells in treated patients. What evidence is there for this claim? I am aware that this has been demonstrated in xenografts and in mouse models, but I could not find evidence for this from actual clinical studies. Here, I am reminded of the very interesting work from Beth Weaver's group on paclitaxel - Zasadil STM 2014. While it had been widely assumed that paclitaxel causes a mitotic arrest, they actually show that this drug kills tumor cells by promoting mitotic catastrophe without inducing a complete mitotic arrest. Similarly, in the absence of existing clinical data, the underlying assumption regarding the effects of CDK4/6i that motivates this paper may not be accurate. For instance, if CDK4/6i acts through the immune system (as suggested by Jean Zhao and others), then this G1 arrest phenotype could be entirely secondary to the drug's actual mechanism-of-action.

      - We are very surprised by the suggestion that CDK4/6 inhibitors may not need to cause a G1 arrest in patient tumours. We appreciate that that these inhibitors effect the immune system in many different ways to combat tumourigenesis, but there is also an overwhelming amount of evidence that a G1 arrest in patient tumours is critical for the overall response. Perhaps the most striking evidence is the fact that RB loss in tumours is one of the best-characterised mechanism of resistance in breast cancer patients (Condorelli et al., 2018; Costa et al., 2020; Li et al., 2018; O'Leary et al., 2018; Wander et al., 2020). In addition, tumours types that typically achieve a poor CDK4/6i-induced G1 arrest in preclinical models, such as TNBCs, also exhibit a poor response to CDK4/6i therapy in patients. Recently a luminal androgen receptor subtype of TNBCs has been identified that responds to CDK4/6 inhibition, due to low CDK2 activity which can otherwise drive G1 progression independently of CDK4/6 in basal-like TNBCs (Asghar et al., 2017; Liu et al., 2017). This rationalises combination therapies that converge to inhibit G1 more effectively in this subtype (e.g. AR antagonist + CDK4/6 inhibition (Christenson et al., 2021)), which is akin to the oestrogen receptor and CDK4/6 combinations that have proven so successful at treating HR+ breast cancer. Many other combinations are also currently in trials based on the same premise that inhibiting upstream G1/S regulators can enhancing the response by inducing a more efficient G1 arrest (MEK, PI3K, AKT, mTOR) (Klein et al., 2018).

      - In response to the specific question about clinical G1 arrest in patients, tumour samples from breast cancer patients shows a decrease in S-phase specific markers pRB and TopoIIa following abemaciclib treatment (Patnaik et al., 2016) and there is extensive evidence of a profound cell cycle arrest following CDK4/6 inhibition as judged by staining with the mitotic marker Ki67 (Hurvitz et al., 2020; Johnston et al., 2019; Ma et al., 2017; Prat et al., 2020). Whilst this does not formally prove a G1-arrest is specifical responsible for this overall cell cycle arrest, that is the implicit assumption given the known mechanism of action of CDK4/6 inhibitors in cells.

      2) How relevant are RPE1 cells? Clinically, CDK4/6 inhibitors are combined with fulvestrant (which would not have an effect in RPE1), and the activity that they exhibit in breast cancer has not been matched in any other cancer types. The underlying biology of HR+ breast cancer (particularly regarding the regulation of CCND1 expression and the G1/S transition by estrogen) may not be recapitulated by other cell types. Moreover, the artificial media used in cell culture experiments may alter the regulation of the G1/S transition. I do not believe that these experiments conducted in RPE1 cells in 2d cell culture are generalizable.

      - Fulvestrant/tamoxifen are effective because they enhance the efficiency of a CDK4/6i arrest by reducing Cyclin D expression to enhance Cyclin D-CDK4/6 inhibition. That convergence onto the G1/S transition is why ER antagonists enhance the CDK4/6 response. i.e. CDK activity is inhibited and CycD transcription is reduced, therefore this double hit allows breast cancer cells to arrest in G1 more efficiently than healthy tissue which is not oestrogen-responsive (this provides yet more evidence the G1 arrest in tumours is crucial for the clinical response). It is true that RPE1 cells do not respond to the oestrogen treatment, but that is not really relevant here in our opinion. We are not testing the efficiency of a G1 arrest beyond the initial characterisation in figure 1. We are mainly examining how cells respond to that G1 arrest afterwards. It could be that components of the cell culture media affect that downstream response in unanticipated ways, but we feel that is very unlikely.

      - Having said that, we agree that the general point on the relevance of RPE cells is a valid one, and we will repeat key experiment in breast cancer cells. We suspect that the reason replisome components become widely downregulated during a G1 arrest will not be a specific phenomenon that is characteristic of one particular cell type. Nevertheless, it is important to validate that assumption.

      3) I am confused about the effects of CDK4/6i on genotoxin sensitivity. Replogle and Amon PNAS 2020 and several citations contained therein report that CDK4/6i protects cells from DNA damage. Moreover, trilaciclib has recently received FDA approval for its ability to protect the bone marrow from cytotoxic chemotherapy! Is this a question of dose timing/intensity? The FDA approval of trilaciclib for this indication should certainly be discussed. This underscores my concern that certain findings in this paper are RPE1/tissue culture artifacts, with limited generalizability.

      - The studies the reviewer refers to demonstrate that halting cell cycle progression can protect cells from genotoxic drugs that cause DNA damage during S-phase. However, we can only think that the reviewer must have missed the critical point here: The genotoxic agents in figure 5 were added after washout from CDK4/6 inhibition (we will highlight this more clearly in the revised manuscript). After drug removal, cells enter S-phase with replication competence problems (as a result of the CDK4/6 arrest) and they then experience additional problems during S-phase (as a result of the genotoxic agents included following washout). These effects synergise to enhance replication stress, a key conclusion of figure 5.

      - This does is in no way support that notion that “findings in this paper are RPE1/tissue culture artefacts with limited generalizability”. Experiments in 2D tissue culture have furnished some of the most important fundamental discoveries in cancer research. It remains to be seen whether our study will cause a paradigm shift in our thinking about how CDK4/6 inhibitors work, but we believe that it may do. We appreciate that this will not become clear until our findings are followed up and validated in preclinical models and human disease, but that does not, in our opinion, make them any less valid at this stage. As stated earlier, we will confirm this is not a RPE1 cell phenomenon, but if this holds up in breast cancer cells then we believe our data will have an important impact on future preclinical and clinical work in this area.

      **Referees cross-commenting** I think that we largely agree that RPE1 is not a great model for this study, and repeating certain key experiments in an ER+ BC line like MCF7 may be warranted.

      - We agree that it would add value to examine our findings in BC cells, therefore we will address this point at revision by repeating key experiments in BC cells.

      Additionally, I wanted to draw attention to the fact that, to my knowledge, the evidence for palbociclib inducing a G1 arrest in patients is incredibly spotty. For early-stage breast tumors where palbo is most effective, nearly all tumor cells are in G1 anyway. I think that it makes the most sense that palbo is actually working through immune modulation or through some secondary mechanism, rather than enforcing a G1 arrest. So I'm not sure about the premise of this study.

      - As discussed above, there is extensive evidence that proliferation is reduced in response to CDK4/6 inhibition in patients (Hurvitz et al., 2020; Johnston et al., 2019; Ma et al., 2017; Patnaik et al., 2016; Prat et al., 2020). We agree that proliferation in patient tumours can be slower than observed in preclinical models, and there can be many reasons for this, especially within solid tumour where hypoxia is a major factor that limits proliferation. However, we do not agree that this implies that drugs that target these tumours do not act on proliferating cells. In fact, most other broad-spectrum non-targeted chemotherapies used to treat cancer also work by targeting dividing cells, and many of these are also more effective in early stage breast cancer. In addition, and as discussed extensively above, there are many studies supporting the interpretation that a G1 arrest is critical for CDK4/6i response in breast cancer patients. Considering all of these points, we strongly believe that the premise of our study – to characterise why a G1 arrest becomes irreversible – is valid and important. This point Is also made in numerous recent reviews which also highlight that this key mechanistic information is currently lacking (Goel et al., 2018; Klein et al., 2018; Knudsen and Witkiewicz, 2017; Wagner and Gil, 2020).

      - We do not disagree that the immune effects are important in patients – indeed, we cited and discussed these studies in our manuscript. However, we would argue that this works together with a G1 arrest in tumour cells. The G1 arrest most likely induces a senescent response that stimulates immune engagement and tumour clearance. These multifactorial effect of CDK4/6 inhibition, on both the tumour and the immune system, are discussed at length in these reviews: (Goel et al., 2018; Klein et al., 2018; Wagner and Gil, 2020).

      Reviewer #3 (Evidence, reproducibility and clarity (Required)): The authors clearly demonstrate, with appropriate techniques, that cells treated with clinically relevant CDK4/6 inhibitors lead to a cell cycle arrest, that is only partly reversible. The authors also demonstrate clearly that release from a cdk4/6i arrest leads to two phenomena: the inability to initiate S-phase, and a cell cycle exit in G2. The inability to initiate S-phase is partly dependent on p53, the cell cycle exit is fully dependent on p53. In the absence of p53, cells that are released from a CDK4/6i block frequently enter mitosis with unrepaired DNA lesions. The authors clearly demonstrate that cdk4/6 inhibition leads to down regulation of key replication genes. Combined treatment with genotoxic agents further exaggerates the phenotype of cell cycle exit upon cdk4/6 inhibition. **Specific comments:** Figure 1B: the loss of reversibility remains at approximately 50%. Does the phenotype of replication protein depletion not happen in the 50% of cells that do restart the cell cycle? it would be good if the authors could experimentally address the heterogeneity that is observed.

      - This is actually a result of the fixed analysis use in fig.1B. The irreversibility is much higher than 50% after long durations of arrest, but at the 24h timepoint used in this fixed assay many cells have exited G1 but not yet had a chance to revert back into G1 from S/G2 phase. We will reinforce this point in the legend. This highlights the value of our extensive live cell assays that can fully capture cell cycle profiles, and accurately determine when cell do/don’t enter or withdraw from different stages of the cell cycle. We believe that an overreliance of fixed endpoints in previous studies may have contributed to the genotoxic effects in S-phase being missed previously: many studies show senescence after drug washout, but the cause of that senescence only becomes apparent when you observe that cells withdraw with defects after the first S-phase.

      Figure 1C: the G1 state after S-phase. The read-out here is loss of the Fucci reporter geminin. Does observation reflect p53-dependent activation of the APC/C-Cdh1 prematerely? this is a known effect of persistent DNA damage in G2 cells.

      - Yes, we expect that APC/C-Cdh1 activation causes geminin and cyclin degradation when cells permanently withdraw from the cell cycle from G2. This is likely caused by p53-dependent p21 activation in response to DNA replication defects, as has been shown previously in direct response to DNA damage.

      Figure 2: there seem to be two distinct phenotypes when comparing p53-wt and p53-KO: the ability to initiate S-phase after CDK4/6i removal (which is largely gone in p53 KO, only slight number after 7d treatment). And cell cycle-drop-out after S-phase (this seems to be fully p53 dependent). I am not sure if a single mechanisms explains both.

      - We agree that there are p53-dependent effects on speed/extent of S-phase entry and on the resulting withdrawal from G2. It may not be a single mechanism that connected these effects, although they may be related. Our manuscript mainly focusses on the DNA replication defects and cell cycle withdrawal, but in the future, it will be important to also characterise what causes the delay in cell cycle re-entry following CDK4/6 inhibition. We suspect that this could reflect differing depths of quiescence, potentially caused by p21, which would explain the p53-dependence.

      Figure 3a: related to the proviso point. it is unclear if the p21 up regulation happens in G1 or G2 cells, and related to the inability of cells to initiate S-phase, or the cell cycle exit in G2.

      - This is a good point, and as discussed above, we suspect both maybe related to p21. We will examine p21 levels during a G1 arrest to compare to the levels seen following release, and we will include this data after revision.

      It is stated that a combined action of the p53 pathways and ATR signaling prevent mitotic entry in RPE-wt cells. However, ATR should also be able to do this in p53-KO cells. Does cdk4/6i inhibiton also down-regulation of ATR pathway components?

      - We do not detect downregulation of any ATRi components in the mass spec data comparing 2 and 7 day palbociclib arrest.

      Following the observation that CDK4/6i leads to replication stress, I would hypothesise that these cells would be very sensitive to agents that inhibit the response to replication stress (inhibitors of Wee1, ATR or Chk1). Yet, these agents work preferentially in p53-deficient cells, and require cell cycle progression. Sequential treatment with CDK4/6 inhibition followed by cell cycle checkpoint inhibition may help in uncovering the phenotype.

      - This is a good point and we will perform experiments with ATR inhibitors after release from CDK4/6 inhibition to examine if this enhances the phenotype.

      The authors increase the amount of replication stress using chemotherapeutic approaches or MPS1 inhibitors. The chemotherapeutic approaches are relevant clinically, but mechanistically it don't understand this beyond adding up treatments that lead to replication defects.

      - We agree that the main value of these experiments is not to provide mechanistic insight, but rather to demonstrate that CDK4/6 inhibition can enhance the effect of current genotoxic drugs. Considering CDK4/6 inhibitors are well-tolerated, this could represent an effective way to enhance the tumour-selectivity of current genotoxic therapeutics. This has been suggested previously in a pancreatic cancer study (Salvador-Barbero et al., 2020), but the reasons given for synergy were different (DNA damage repair) and the order of drugs exposure was reversed (genotoxic before CDK4/6i). This underscores the potential importance of our new data.

      - From a mechanistic point of view, these data do still suggest that CDK4/6i and genotoxic drugs converge onto the same replication stress phenotype, thereby supporting our overall conclusions. One interpretation is that a reduction in replisome levels and licenced replication origins impairs the ability of cells to overcome replication problems induced by chemotherapy drugs. Conceptualising how these drugs may synergize in this way will be important in designing new studies and trials to address this synergy more broadly.

      The aneuploidy treatment is a bit weird, because it may trigger a p53 response, before the cells are released from a cdk4.6i arrest. besides, mps1 inhibition does more than just cause replication stress and is not very clinically relevant in this context.

      - We agree that the aneuploidy experiment could have many different interpretations, and only one of these relates specifically to replication stress. This was also commented on by reviewer 1, so we feel it is best to remove this data and just keep the data on drugs that affect replication stress or DNA damage directly. We will address the effects of aneuploidy more extensively in a separate study.

      Reviewer #3 (Significance (Required)): In their manuscript entitled: Crozier and co-workers studied the effects of CDK4/6 inhibition on cell growth. CDK4/6 inhibitors are currently used in the treatment for hormone-positive breast cancers, but their cell biological effects on tumor cells remain incompletely clear, which may hamper the further clinical development of these drugs for breast cancer or other cancers. Inhibition of CDK4/6 is known to trigger a cell cycle arrest, and it is currently unclear how this could lead to long-term tumor control. This manuscript addresses the question why cdk4/6 inhibitors cause long-term cell cycle exit.

      - We thank the reviewer for this simple description of our work, which we think pitches the significance very clearly. There are currently 15 different CDK4/6 inhibitors in clinical trials, and more than 100 further trials using the 3 currently licenced inhibitors in a wide variety of tumour types and drug combinations. Although the clinical work on these drugs is huge, it is unclear how they cause long-term cell cycle arrest and we now link this to genotoxic stress for the first time. This explains clearly why this work is potentially very significant. We agree, however, that the main caveat is the need to demonstrate our findings are also applicable to breast cancer cells. But, if this is the case, we believe this would represent a paradigm shift in our understanding of how these drugs work, especially considering that genomic damage is an universal route to prolonged cell cycle exit in response to almost all other broad-spectrum anti-cancer drugs.

      There are two issues that affect the significance of the findings: the authors start their manuscript with a strong translational/clinical issue, but solely use RPE1 cell lines to address this issue2. it remains unclear if their observations hold true in breast cancer models. it would be advised to repeat key findings in a hormone receptor-positive breast cancer model.

      - We will examine the applicability of our findings in breast cancer cells and include this work at revision.

      the effects of CDK4/6 inhibitors are observed in clinically relevant doses. however, the effects are observed upon switch-like wash out. this does not per se reflect the pharmacodynamics of more gradual increase and decrease of drug concentrations in tuner cells. by washing out the CDK4/6 inhibitors. the significant of this work would be greater if cell cycle exit with replication stress would be observed either in clinical samples or in vivo treated cancer cells.

      - We agree that the significance of this work will ultimately only become fully apparent if replication stress is confirmed in clinical samples or in vivo. We envisage that our study will stimulate exactly this type of analysis in future. However, we would also add that the gradual increase/decrease in drug concentrations seen in patients is still likely to lead to switch like cell cycle re-entry given the switch-like nature of cell cycle controls at the G1/S transition. So, the timing may be different, but we would not predict that the downstream response in S-phase would be. However, whether replication stress is seen during drug-free washout periods in patients is clearly a critical future question, as we highlight in the discussion.

      References

      Asghar, U.S., Barr, A.R., Cutts, R., Beaney, M., Babina, I., Sampath, D., Giltnane, J., Lacap, J.A., Crocker, L., Young, A., et al. (2017). Single-Cell Dynamics Determines Response to CDK4/6 Inhibition in Triple-Negative Breast Cancer. Clin Cancer Res 23, 5561-5572.

      Christenson, J.L., O'Neill, K.I., Williams, M.M., Spoelstra, N.S., Jones, K.L., Trahan, G.D., Reese, J., Van Patten, E.T., Elias, A., Eisner, J.R., et al. (2021). Activity of combined androgen receptor antagonism and cell cycle inhibition in androgen receptor-positive triple-negative breast cancer. Mol Cancer Ther.

      Condorelli, R., Spring, L., O'Shaughnessy, J., Lacroix, L., Bailleux, C., Scott, V., Dubois, J., Nagy, R.J., Lanman, R.B., Iafrate, A.J., et al. (2018). Polyclonal RB1 mutations and acquired resistance to CDK 4/6 inhibitors in patients with metastatic breast cancer. Annals of oncology : official journal of the European Society for Medical Oncology 29, 640-645.

      Cook, J.G., Park, C.H., Burke, T.W., Leone, G., DeGregori, J., Engel, A., and Nevins, J.R. (2002). Analysis of Cdc6 function in the assembly of mammalian prereplication complexes. Proceedings of the National Academy of Sciences of the United States of America 99, 1347-1352.

      Costa, C., Wang, Y., Ly, A., Hosono, Y., Murchie, E., Walmsley, C.S., Huynh, T., Healy, C., Peterson, R., Yanase, S., et al. (2020). PTEN Loss Mediates Clinical Cross-Resistance to CDK4/6 and PI3Kα Inhibitors in Breast Cancer. Cancer Discov 10, 72-85.

      Ge, X.Q., Jackson, D.A., and Blow, J.J. (2007). Dormant origins licensed by excess Mcm2-7 are required for human cells to survive replicative stress. Genes Dev 21, 3331-3341.

      Goel, S., DeCristo, M.J., McAllister, S.S., and Zhao, J.J. (2018). CDK4/6 Inhibition in Cancer: Beyond Cell Cycle Arrest. Trends Cell Biol 28, 911-925.

      Hurvitz, S.A., Martin, M., Press, M.F., Chan, D., Fernandez-Abad, M., Petru, E., Rostorfer, R., Guarneri, V., Huang, C.S., Barriga, S., et al. (2020). Potent Cell-Cycle Inhibition and Upregulation of Immune Response with Abemaciclib and Anastrozole in neoMONARCH, Phase II Neoadjuvant Study in HR(+)/HER2(-) Breast Cancer. Clin Cancer Res 26, 566-580.

      Ibarra, A., Schwob, E., and Méndez, J. (2008). Excess MCM proteins protect human cells from replicative stress by licensing backup origins of replication. Proceedings of the National Academy of Sciences of the United States of America 105, 8956-8961.

      Johnston, S., Puhalla, S., Wheatley, D., Ring, A., Barry, P., Holcombe, C., Boileau, J.F., Provencher, L., Robidoux, A., Rimawi, M., et al. (2019). Randomized Phase II Study Evaluating Palbociclib in Addition to Letrozole as Neoadjuvant Therapy in Estrogen Receptor-Positive Early Breast Cancer: PALLET Trial. J Clin Oncol 37, 178-189.

      Klein, M.E., Kovatcheva, M., Davis, L.E., Tap, W.D., and Koff, A. (2018). CDK4/6 Inhibitors: The Mechanism of Action May Not Be as Simple as Once Thought. Cancer Cell 34, 9-20.

      Knudsen, E.S., and Witkiewicz, A.K. (2017). The Strange Case of CDK4/6 Inhibitors: Mechanisms, Resistance, and Combination Strategies. Trends in cancer 3, 39-55.

      Leone, G., DeGregori, J., Yan, Z., Jakoi, L., Ishida, S., Williams, R.S., and Nevins, J.R. (1998). E2F3 activity is regulated during the cell cycle and is required for the induction of S phase. Genes Dev 12, 2120-2130.

      Li, Z., Razavi, P., Li, Q., Toy, W., Liu, B., Ping, C., Hsieh, W., Sanchez-Vega, F., Brown, D.N., Da Cruz Paula, A.F., et al. (2018). Loss of the FAT1 Tumor Suppressor Promotes Resistance to CDK4/6 Inhibitors via the Hippo Pathway. Cancer Cell 34, 893-905.e898.

      Liu, C.Y., Lau, K.Y., Hsu, C.C., Chen, J.L., Lee, C.H., Huang, T.T., Chen, Y.T., Huang, C.T., Lin, P.H., and Tseng, L.M. (2017). Combination of palbociclib with enzalutamide shows in vitro activity in RB proficient and androgen receptor positive triple negative breast cancer cells. PloS one 12, e0189007.

      Ma, C.X., Gao, F., Luo, J., Northfelt, D.W., Goetz, M., Forero, A., Hoog, J., Naughton, M., Ademuyiwa, F., Suresh, R., et al. (2017). NeoPalAna: Neoadjuvant Palbociclib, a Cyclin-Dependent Kinase 4/6 Inhibitor, and Anastrozole for Clinical Stage 2 or 3 Estrogen Receptor-Positive Breast Cancer. Clin Cancer Res 23, 4055-4065.

      Matson, J.P., Dumitru, R., Coryell, P., Baxley, R.M., Chen, W., Twaroski, K., Webber, B.R., Tolar, J., Bielinsky, A.K., Purvis, J.E., et al. (2017). Rapid DNA replication origin licensing protects stem cell pluripotency. eLife 6.

      Matson, J.P., House, A.M., Grant, G.D., Wu, H., Perez, J., and Cook, J.G. (2019). Intrinsic checkpoint deficiency during cell cycle re-entry from quiescence. J Cell Biol 218, 2169-2184.

      Méndez, J., and Stillman, B. (2000). Chromatin association of human origin recognition complex, cdc6, and minichromosome maintenance proteins during the cell cycle: assembly of prereplication complexes in late mitosis. Mol Cell Biol 20, 8602-8612.

      O'Leary, B., Cutts, R.J., Liu, Y., Hrebien, S., Huang, X., Fenwick, K., André, F., Loibl, S., Loi, S., Garcia-Murillas, I., et al. (2018). The Genetic Landscape and Clonal Evolution of Breast Cancer Resistance to Palbociclib plus Fulvestrant in the PALOMA-3 Trial. Cancer Discov 8, 1390-1403.

      Patnaik, A., Rosen, L.S., Tolaney, S.M., Tolcher, A.W., Goldman, J.W., Gandhi, L., Papadopoulos, K.P., Beeram, M., Rasco, D.W., Hilton, J.F., et al. (2016). Efficacy and Safety of Abemaciclib, an Inhibitor of CDK4 and CDK6, for Patients with Breast Cancer, Non-Small Cell Lung Cancer, and Other Solid Tumors. Cancer Discov 6, 740-753.

      Prat, A., Saura, C., Pascual, T., Hernando, C., Muñoz, M., Paré, L., González Farré, B., Fernández, P.L., Galván, P., Chic, N., et al. (2020). Ribociclib plus letrozole versus chemotherapy for postmenopausal women with hormone receptor-positive, HER2-negative, luminal B breast cancer (CORALLEEN): an open-label, multicentre, randomised, phase 2 trial. Lancet Oncol 21, 33-43.

      Salvador-Barbero, B., Álvarez-Fernández, M., Zapatero-Solana, E., El Bakkali, A., Menéndez, M.D.C., López-Casas, P.P., Di Domenico, T., Xie, T., VanArsdale, T., Shields, D.J., et al. (2020). CDK4/6 Inhibitors Impair Recovery from Cytotoxic Chemotherapy in Pancreatic Adenocarcinoma. Cancer Cell 37, 340-353.e346.

      Wagner, V., and Gil, J. (2020). Senescence as a therapeutically relevant response to CDK4/6 inhibitors. Oncogene.

      Wander, S.A., Cohen, O., Gong, X., Johnson, G.N., Buendia-Buendia, J.E., Lloyd, M.R., Kim, D., Luo, F., Mao, P., Helvie, K., et al. (2020). The genomic landscape of intrinsic and acquired resistance to cyclin-dependent kinase 4/6 inhibitors in patients with hormone receptor positive metastatic breast cancer. Cancer Discov.

      Whitfield, M.L., Sherlock, G., Saldanha, A.J., Murray, J.I., Ball, C.A., Alexander, K.E., Matese, J.C., Perou, C.M., Hurt, M.M., Brown, P.O., et al. (2002). Identification of genes periodically expressed in the human cell cycle and their expression in tumors. Mol Biol Cell 13, 1977-2000.

    1. SciScore for 10.1101/2021.03.24.21253992: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: The cell line was obtained from the ATCC and has been tested negative for contamination with mycoplasma.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S2 (PDB 6VXX) was downloaded from PDB51, and formatted using PyMol. (The PyMOL Molecular Graphics System, Version 2.0 Schrödinger, LLC.) Flow cytometry: As detailed in previous manuscripts and reproduced here for convenience52, antibody clones and vendors used for flow cytometry analysis were as follows: BB515 anti-hHLA-DR (G46-6) (1:400</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-hHLA-DR ( G46-6 )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed three times with PBS-T (PBS with 0.1% Tween-20) and 50 μl of HRP anti-Human IgG Antibody (GenScript #A00166, 1:5,000) or anti-Human IgM-Peroxidase</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Human IgM-Peroxidase</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2, strain USA-WA1/2020, was obtained from BEI Resources (#NR-52281) and was amplified in Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The search for polymorphisms in comparison with the reference genome (MN908947.3) was performed using Python scripts, and visualization of genome annotations were done using DNA Features Viewer 3.0.163.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S2 (PDB 6VXX) was downloaded from PDB51, and formatted using PyMol. (The PyMOL Molecular Graphics System, Version 2.0 Schrödinger, LLC.) Flow cytometry: As detailed in previous manuscripts and reproduced here for convenience52, antibody clones and vendors used for flow cytometry analysis were as follows: BB515 anti-hHLA-DR (G46-6) (1:400</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analysed using FlowJo software version 10.6 software (Tree Star).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations of Study: As with all case studies, a limitation on the generalizability of our findings to wider patient populations is present. Also, while the lack of immunological responsiveness to vaccination or acute infection in immunosuppressed and solid organ transplant populations is well documented, there may be additional mechanisms contributing to these defects beyond those discussed in this manuscript - particularly with regards to SARS-CoV-2 infection. Our analysis of the immunophenotype of the patient was limited to surveys of circulating immune dynamics; however, numerous studies have also described perturbations in immunity at tissue sites not easily amenable to direct interrogation. We also did not directly analyze antigen specific T-cell responses during either infection, which may reveal additional dysfunction not discussed within this manuscript. Lastly, we also did not fully address every potential avenue of viral immune evasion to immune responses and accordingly suggest that a greater understanding of the virus-intrinsic and host-intrinsic features determining susceptibility to SARS-CoV-2 reinfections is required. Future studies should investigate not only the circulating and systemic adaptive immune responses during SARS-CoV-2 reinfections, but also the possibility that local defects in immune responsiveness among barrier tissue sites may also enable recurrent SARS-CoV-2 infection. Quantification and Statistical Analysis: All statistical analysis was per...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.03.23.21254060: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The studies were reviewed by the Yale University Human Investigation Committee and ethical approval was given by the Yale university Institutional Review Board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human subjects: Volunteers from an ongoing serology study of health care workers were recruited to have their SARS-CoV-2 spike antigen-specific antibody levels followed over time after vaccination with SARS-CoV-2 mRNA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed three times with PBS-T (PBS with 0.1% Tween-20) and 50 μL of HRP anti-Human IgG Antibody (Parmingen/BD Biosiences, San Jose, CA) or HRP anti-human IgA (BioLegend, San Diego, CA) were added at 1:2000-fold dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgA</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.03.24.436864: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: SARS-CoV-2 hamster studies: All procedures involving animals were performed in accordance with guidelines of the Institutional Animal Care and Use Committee of Washington University in Saint Louis.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animals were randomized from different litters into experimental groups and were acclimatized at the BSL3 facilities for 4-6 days prior to experiments.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Four- to six-week old male Syrian hamsters were obtained from Charles River Laboratories and housed in an enhanced ABSL3 facility at Washington University in St Louis.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed and sequentially incubated with an oligoclonal pool of SARS2-2, SARS2-11, SARS2-16, SARS2-31, SARS2-38, SARS2-57, and SARS2-71 anti-S antibodies (33) and HRP-conjugated goat anti-mouse IgG (Sigma 12-349) in PBS supplemented with 0.1% saponin and 0.1% bovine serum albumin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS2-57</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS2-71</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: Expi293F cells were cultured in Expi293 Expression Medium (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293F</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All viruses were passaged once in Vero-TMPRSS2 cells and subjected to deep sequencing after RNA extraction to confirm the introduction and stability of substitutions (16).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, plaque assays were performed to isolate the VSV-SARS-CoV-2 escape mutant on Vero cells with mAb 2C08 in the overlay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Area under the curve was calculated using Graphpad Prism v8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Four μL RNA was used for real-time qRT-PCR to detect and quantify N gene of SARS-CoV-2 using TaqMan™ Fast Virus 1-Step Master Mix as described (53) or using the following primers and probes: Forward: GACCCCAAAATCAGCGAAAT; Reverse: TCTGGTTACTGCCAGTTGAATCTG; Probe: ACCCCGCATTACGTTTGGTGGACC; 5’Dye/3’Quencher: 6-FAM/ZEN/IBFQ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GACCCCAAAATCAGCGAAAT</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Reverse</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>TCTGGTTACTGCCAGTTGAATCTG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Probe</div><div>suggested: (UniPROBE, RRID:SCR_005803)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 27. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      We are grateful to the editors at Review Commons and to the reviewers for their thoughtful attention to our manuscript. Our work presents data showing that deletion of the apoptosis regulator Mcl-1 in CNS stem cells that give rise to neurons and glia resulted in specific degeneration of the white matter, beginning after postnatal day 7 (P7). Cellular analysis shows that oligodendrocytes were depleted while astrocytes persisted. Co-deletion of apoptosis effectors Bax or Bak rescued different aspects of the Mcl-1 deletion phenotype, confirming the role of apoptosis. Based on these observations, we conclude that oligodendrocytes require MCL-1 to prevent spontaneous apoptosis, and that MCL-1 depletion results in leukodystrophy, which resembles severe cases of the human disorder Vanishing White Matter Disease (VWMD). We further suggest that MCL-1 deficiency, caused by the eIF2B mutations of VWMD, may play a critical role in VWMD pathogenesis.

      The reviewers questioned the similarity of the Mcl-1 deletion phenotype to VWMD and were not convinced that MCL-1 deficiency is integral to VWMD. Based on reviewer feedback, we concede that a firm link to VWMD is not supported by the available data. We consider, however, that our findings that MCL-1 is required for oligodendrocyte survival and white matter stability remain highly significant. Accordingly, we propose to revise the work as suggested by Reviewer 1 to highlight the insight our data provide as to apoptosis regulation in glia and its importance for brain development, and to revise the title, as suggested by Reviewer 3, to remove the specific reference to VWMD.

      In the revision, we will make clear that the comparison to specific leukodystrophies is hypothetical and will require extensive follow-up experiments that are suggested by the findings of this work, as described in the reviews. Revising our work by removing the assertion that our data strongly implicate MCL-1 in VWMD pathogenesis will address the main reviewer concern, strengthen the logical flow, and highlight the potential for MCL-1 to be broadly relevant to white matter pathology. The significance of our findings that oligodendrocytes depend on MCL-1 protein to prevent their spontaneous apoptosis, and that MCL-1 deficiency produces white matter degeneration, will not be altered by these changes. Our data will continue to show that MCL-1 dependence is a physiologic vulnerability of oligodendrocytes that sets them apart from astrocytes and neurons and that this vulnerability is sufficient to cause white matter-specific brain degeneration when MCL-1 expression is blocked.

      The other issues raised by the reviewers are all tractable and can be addressed with new experiments that we can complete in a short time-frame, such as studies of retinal pathology and addition immunohistochemistry studies, or with changes to the text. We consider that with these revisions, the manuscript will be an important contribution to understanding glial biology and the pathogenesis of white matter-specific disorders. We describe in detail below our responses to reviewer feedback and planned changes to the manuscript.

      Reviewer comments are in italics and our responses are in plain text.

      *Reviewer #1 (Evidence, reproducibility and clarity (Required)):**

      **Comments** *

      While we acknowledge many important points in this review, this first point is based on a premise that is inaccurate. Based on published data, we respectfully disagree with the statement that “Depletion of MCL-1 in any tissue would promote apoptosis in cells of this tissue”. Most cells do not require an anti-apoptotic protein to prevent spontaneous apoptosis; cells that depend on anti-apoptotic proteins are specifically referred to as “primed for apoptosis” (1-5). Our conditional deletion genotypes ablated Mcl-1 in neurons of the forebrain and cerebellum and in all subtypes of glial cells. The loss of oligodendrocytes in our Mcl-1-deleted mice shows that a specific subset of white matter cells in the postnatal brain require MCL-1. Together with the increase in apoptosis and the rescues by co-deletion of Bax or Bak, these data demonstrate that cells within the oligodendrocyte lineage are primed for apoptosis in a manner that is restricted by MCL-1. In contrast, we have shown in published data that we cite in this manuscript that conditional deletion of Mcl-1 cerebellar granule neurons, the largest neuronal population in the brain, does not cause apoptosis (6); these data provide direct evidence that large populations of cells in the brain do not depend on MCL-1. We therefore disagree with the characterization of the brain-specific Mcl-1 deletion phenotype as “non-specific”.

      • The white matter disease is interpreted as similar to VWM; VWM is specifically investigated and MCL-1 is found to be decreased in VWM brain tissue. The decrease is most likely nonspecific. Decrease in MCL-1 is most likely part of a general mechanism of degeneration of brain tissue or white matter. That is a different but also important conclusion. It is essential that other progressive leukodystrophies and acquired brain diseases with tissue degeneration, such as encephalitis, are investigated as well to see whether MCL-1 is also decreased in these disorders. If so, the MCL-1 decrease in white matter disease and other brain degenerative disease should be described as a final common pathway rather than specifically applicable to VWM.*

      We agree that MCL-1 is likely to be a final common point in multiple disease processes that affect white matter. As described in our response to point 3 below, we are persuaded by the reviewers that the proposed similarity of the Mcl-1 deletion phenotype and VWMD is not sufficiently supported by the available evidence. We will revise the text to make clear that we consider that impaired MCL-1 is “likely part of a general mechanism of degeneration of… white matter”.

      • Adding to point 2 is the fact that the pathology of the brain-specific MCL-1 knock-out mouse does not resemble the pathology of VWM at all. The central features of VWM are abnormal astrocyte morphology with astrocytes having a few stunted processes, lack of reactive astrogliosis, lack of microgliosis, increase in number of oligodendrocytes and presence of foamy oligodendrocytes. The increase in oligodendrocytes in VWM may be such that the high cellularity leads to diffusion restriction on MRI. Bergmann glia are typically ectopic, but not reduced in number. By contrast, the brain-specific MCL-1 knock-out mouse is characterized by decreased numbers of oligodendrocytes, increased numbers of microglia, reactive astrogliosis, decreased numbers of Bergmann glia and ectopic granule cells. No morphological abnormalities of oligodendrocytes and astrocytes are observed. So, histopathologically the only shared feature is preferential involvement of the brain white matter.*

      We are persuaded by the reviewers that our assertion of a high degree of similarity between the Mcl-1 deletion phenotype and VWMD was not adequately supported by our available data. In the revision, we will state that a role for MCL-1 deficiency in VWMD pathogenesis is hypothetical, and that additional studies beyond the scope of this project will be needed to test this hypothesis. However, we reassert that the white matter specificity of the Mcl-1-deletion phenotype is important.

      The reviewer accurately characterizes the pathology of the Mcl-1 deletion phenotype and notes “the preferential involvement of the white matter”. We consider that the preferential involvement of white matter, and of oligodendrocytes within the white matter are highly significant. We will revise the work to focus on the Mcl-1 deletion phenotype, the white matter specificity, and the potential relevance to diverse white matter-specific disease.

      While we concede that more data would be needed to firmly connect MCL-1 to VWMD, we do not agree that the Mcl-1 phenotype “does not resemble the pathology of VWM at all”. There is a diversity of published observations of pathology in VWMD and not all published reports support the descriptions in the reviewer comment. This diversity of findings is highly relevant to our work. For example, while autopsy studies of humans with end stage VWMD show lack of microgliosis (7), studies of mice with a mutation known to cause VWMD in humans, that clearly recapitulate VWMD, show robust microgliosis earlier in the disease process (8). These different observations raise the possibility that microgliosis occurs during the period of active neurodegeneration or at least that in murine brain, the VWMD process activates a microglial reaction. Either interpretation would support a likeness between Mcl-1-deleted mice and VWMD mouse models. Another study of cerebellar pathology in twin human fetuses with characteristic VWMD mutations showed complete absence of Bergmann glia (9). We propose in the revision to address the reviewer’s concerns by presenting the diversity of perspectives on microglial reaction and Bergmann glial changes in VWMD, including all of the citations above.

      • The clarity of the work would benefit from a different approach to introduce the study. It would help the reader to know that (1) gray matter cell specific Mcl-1 deletion in mice did not cause apoptosis and (2) apoptosis may have different effector proteins. This important information is now in the discussion. The switch to another cell type in the brain (hGFAP+ cells) would be logical and the significance of the work may improve. When approaching the topic from the field of leukodystrophies one would not necessarily think of deleting the Mcl-1 gene, especially as this gene is not associated with any known leukodystrophy and tends to associate with preneoplastic and neoplastic disease.*

      We appreciate these suggestions, which we agree will enhance the logical flow and the significance, in line with our response to point 3. We will revise the Introduction as suggested.

      • The authors claim that the ISR is activated in VWM, which means that eIF2α phosphorylation levels are increased, general protein synthesis is decreased and a transcription pathway is regulated by ATF4 and other factors. However, this is not what is seen in VWM. Increased eIF2α phosphorylation and reduced general protein synthesis are not observed in VWM; strikingly, the level of eIF2α phosphorylation is reduced, general protein synthesis appears at a normal rate, and only the ATF4-regulated transcriptome is continuously expressed in VWM astrocytes. *

      This point is not well-settled, as published studies show that the ISR is activated in VWMD despite decreased eIF2α phosphorylation (10, 11). Published scRNA-seq studies of mice with VWMD mutations moreover, show that the ISR transcriptome is activated in oligodendrocytes, as well as neurons, endothelial cells and microglia (8). We will address this concern in the revision by citing these published reports that show both decreased eIF2α phosphorylation and lines of evidence that support ISR activation.

      Fritsh et al. show that MCL-1 protein synthesis is reduced by increased eIF2α phosphorylation due to reduced translation rates at the Mcl-1 mRNA and not due to differences in Mcl-1 mRNA levels.

      We agree with this interpretation of Fritsh et al, which is fully compatible with our proposed mechanism. We suggest that ISR activation in VWMD decreases translation of Mcl-1 mRNA, leading to reduced MCL-1 protein expression. MCL-1 protein is rapidly degraded and may therefore be a more sensitive detector of impaired translation than other readouts. We currently cite published work documenting altered translation in VWMD in the manuscript and in the revision will add the reference Moon et al, which is directly on point (11).

      One would a priori not expect to find altered MCL-1 synthesis rates in the mildly affected VWM mouse model Eif2B5R132H/R132H.

      The model does not show reduced global translation under normal conditions, but rather hypo-activity of eIF2B affects the translation of specific mRNAs (12). We will make this point clear in the revision.

      Actually, ISR deregulation has not been reported in the Eif2B5R132H/R132H VWM mouse model. The authors need to rephrase this part of their study taking this information into account, when explaining their experiments and interpreting their results.

      Consistent with the data that the ISR is activated in VWMD, mice show ATF4 up-regulation and other evidence of ISR activation (13) and impaired responses to physiologic stress (14, 15). In the revision, we will add these citations. To address the reviewer concerns, we will state in the revision that ISR activation is one of many potential mechanisms of reduced MCL-1 expression.

      The authors now imply that their study adds mechanistic insight into the VWM field and that is not the case.

      As we describe in response to point 3, we will acknowledge in the revision that the assertion that MCL-1 deficiency causes VWMD is hypothetical.

      In addition, Figure 7C shows differences in actin signal rather than MCL-1 signal, suggesting that transfer of the actin protein from the gel to the blot was not optimal for the middle lanes. MCL-1 protein may thus not be reduced in these samples from Eif2B5R132H/R132H VWM mice.

      We stand by our Western blot data that show that MCL-1 levels are lower in the Eif2B5R132H/R132H VWM mouse model, coincident with the onset of symptoms. The Western blot shown is a representative image that includes 3 biological replicates for each condition and of a total of 12 mice. The quantification demonstrates the reproducibility of the finding.

      • Can the authors show in which cell type was apoptosis found (lines 315-316)? Their study uses the hGFAP - Cre mouse model to generate conditional Mcl-1 knock-out mice. The original paper by Zhuo et al. describing the hGFAP - promoter mouse model suggests that Mcl-1 expression is also affected in neurons and ependymal cells. The authors can investigate this further to assess which cell types (1) are sensitive to apoptosis by Mcl-1 deletion and (2) depend on Bax and Bak.*

      Apoptosis may occur at different times in different cell populations, and asynchronous apoptosis can be difficult to detect at any point in time, which can complicate the suggested studies. Despite significant effort, we have not been able to co-localize any markers with dying cells in our model.

      To address the question of neuronal involvement, the revised manuscript will refer to prior published studies (16-18) which show that Mcl-1 deletion affects forebrain neural progenitors. In this context, we will discuss that our Mcl-1 deletion studies show that significant neural progenitor populations survive prenatal Mcl-1 deletion and generate appropriate cortical and hippocampal architecture in Mcl-1-deleted mice at P7, prior to the onset of white matter degeneration.

      To identify involved glial cells, we quantified the cells that were depleted or persisted in the Mcl-1 deleted brain. These studies identified oligodendrocytes and Bergmann glial as cell types depleted during P7-P15, when postnatal degeneration occurs in Mcl-1 deleted mice. In contrast, astrocytes persisted, indicating that astrocytes are not MCL-1-dependent. In the review, we will add new data quantifiying the immature, PDGFRA-expression subset of oligodendrocytes, which will increase the specification of which cells are depleted by Mcl-1 deletion.

      We share the reviewer’s interest in the question of which subsets of Mcl-1 dependent cells are rescued by co-deletion of Bax or Bak. As known markers may not be sufficient to distinguish these subsets, we consider that scRNA-seq studies are an ideal approach to identify these subsets and their specific gene expression patterns. However, these studies are outside the scope of the present work, which establishes that specific white matter cells depend on Mcl-1.

      • Heterozygous deletion of Bak greatly reduces the number of Bak-expressing cells (Fig. 3C, line, 331-333). Authors need to explain this remarkable finding. *

      As we state in the text, the reduced Bak expression in the heterozygous Bak +/- mice is consistent with a gene dosage effect, which has been observed for other genes.

      Please provide raw IHC data.

      Our IHC data is “raw” in the sense of unaltered. We are happy to include a supplementary figure with additional low power and high-power images of BAK staining.

      Co-staining with neuronal, astrocytic or oligodendrocytic markers would be insightful.

      To address this point, we have successfully performed double labeling with antibodies to BAK and with antibodies to the oligodendrocyte marker SOX10 and the astrocyte marker GFAP. We will add these images to the revision. These images show that BAK+ cells include oligodendrocytes and astrocytes. The position and morphology of the BAK+ cells show that they are not neurons.

      In addition, what does the Western blot signal for the BAX protein represent in Bax homozygous knock out mice (Fig. 3C)?

      We will add text stating that the small residual BAX protein detected in the conditional Bax-deleted mice can be attributed to BAX expression in cells outside the Gfap lineage, including endothelial cells, vascular fibroblasts, and microglia.

      Can the percentage of BAX+ cells in Mcl-1/BaxdKO corpus callosum be determined, similarly as was done for BAK? Co-staining with neuronal, astrocytic or oligodendrocytic markers would be insightful here as well. The legend of Fig. 3D does not state what staining is shown (H&E?).

      We were not able to label BAX protein in individual cells using immunohistochemistry. In contrast, BAK immunohistochemistry worked well, allowing us to analyze the cellular distribution of BAK protein. We will revise the legend in 3D to state the staining is H&E.

      • What explains the strong GFAP expression in processes of Mcl-1 KO astrocytes? Are these cells refractory to apoptosis or to hGFAP-driven Cre expression and recombination? Do they lack BAK or BAX or other apopotic-regulating protein? Or do specific factors compensate for the loss of MCL-1?*

      As we discuss in our response to point 1 above, not all cells require MCL-1 to prevent spontaneous apoptosis. The persistence of GFAP+ astrocytes in Mcl-1-deleted mice shows that astrocytes do not require MCL-1 to maintain their survival. These data do not mean that these astrocytes are refractory to apoptosis, but rather they are not primed for apoptosis in a way that is critically restricted by MCL-1. We will add a discussion of these implications to the revision.

      • Which developing symptoms do the authors refer to in line 468? Please specify and introduce appropriate references.*

      We will add a description of symptoms to the revision.

      • The definition of leukodystrophies given in the paper is outdated. Leukodystrophies are not invariably progressive and fatal disorders. For more recent definition of leukodystrophies see Vanderver et al., Case definition and classification of leukodystrophies and leukoencephalopathies, Mol Genet Metab 2015, and van der Knaap et al., Leukodystrophies a proposed classification system based on pathology, Acta Neuropathol 2017.*

      We appreciate this advice. We will revise the Introduction accordingly and cite the recommended work.

      • It is not correct that there is no specific targeted therapy clinically implemented to arrest progression of the disease in any leukodystrophy. Perhaps hematopoietic stem cell transplantation is not specific targeted, although curative if applied in time in adrenoleukodystrophy and metachromatic leukodystrophy, but certainly genetically engineered autologous hematopoietic stem cells would qualify the definition. In any case, the suggestion that no leukodystrophy is treatable is not correct.*

      We appreciate this correction. We will revise the text to provide a more detailed description of treatment options while underscoring the need for mechanistic insight.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      In this manuscript, the authors characterize the phenotype associated with brain-specific deletion of the mcl-1 gene in mice as a model for vanishing white matter-like disease in humans. Unfortunately, the gfap gene is expressed in many cell types during development which are outside of the intended cell type for this study, so functional data presented from the mutant mice is open to interpretation. The authors have not ruled out other interpretations of their results. The authors need to address major shortcomings in their data interpretation by addressing the following issues.

      We appreciate that concerns related to vision and hearing in the Mcl-1 deleted mice, and address these concerns as described below.

      On line 57, the authors indicate that seizures are common in leukodystrophy. This is controversial. Patients may have attacks that look like seizures, but without EEG recordings there is no way to distinguish these events from myoclonus. The authors should note this ambiguity.

      We will note this ambiguity in the revision. On line 58, the authors indicate the absence of treatments for leukodystrophies. The authors should review the following articles: PMID: 7582569, 15452666 and 27882623, and moderate the text.

      We will cite these papers and moderate the text as recommended

      The methods section is lacking in details in several areas. For example beginning line 136, there is virtually no indication of the MRI details without going to secondary literature. The authors should provide a brief description including magnet strength, type of imaging and the general sequence, software used to collect and analyze the images.

      We will include these details in the revision.

      Were the brains actually harvested fresh, where mechanical stresses easily deform brain structure, prior to immersion fixation for 48h? This could be troubling despite the method being previously published.

      Brains were harvested fresh and drop fixed. We have extensive experience over more than ten years in handling brain tissue from neonatal mice and subsequently analyzing MRI images and sections. These methods have allowed us to make quantitative volumetric comparisons of the 3-dimensional architecture of the developing brain using MRI in prior studies, that detected genotypic differences in brain growth without confounding fixation artefact (19). We can confirm that no mechanical stress of handling can reproduce the white matter specific changes that we see in the Mcl-1-deleted brain. We did not detect any abnormalities in control brains subjected to the same handling techniques. Beginning on line126, the authors could at least indicate the fixative details and whether the mice were perfused or tissue was immersion fixed. Compare this lack of detail with the description of lysis buffer beginning on line 158.

      We will add fixation details to the revision.

      Behavioral testing at young ages is rather problematic regarding data interpretation. For example, open field testing (Fig. 2B) at postnatal day 7, which relies on visual cues, is rather dubious when mice do not open their eyes until 12-13 days after birth. How would the pups know if they were in the middle of an open field and exhibit thigmotaxis, even if they were capable of the behavior at such a young age? Thus, the P7 data likely cannot be interpreted in terms of the knockouts being normal.

      We fully agree with the reviewer on the challenges with behavioral analysis of such young mice. The rationale for the open field test was that, at P7, mouse pups are gaining greater control of hind limb function, which can be observed as a transition from pivoting in one place to forward locomotion. Thus, we measured the number of pivots and distance traveled in the open field as indicators for maturation of motor function. Center time was presented to show that, at P7, both WT and knockout mice stayed in the middle (i.e., the groups were at the same stage of limited mobility). We consider that these measures, together with geotaxis and latency to righting (Table 1), provide a developmentally-appropriate neurologic assessment for an age when behaviors are very limited. We will make clear in the revision that these specific tests must be considered together in order to be informative.

      By P14, when the mutants exhibit a phenotype, they are already significantly underweight, which can lead to non-specific phenotypes such as retinal dysfunction or degeneration. Did the authors look for pathological changes in the retina?

      Further, GFAP is expressed in retina of many vertebrate species (PMID 1283834) which would inactivate mcl1 in that tissue and possibly lead to blindness. Indeed, the table at the following link provides a list of tissues in which the gfap-cre transgene is expressed during development. The authors need to address this major issue. http://www.informatics.jax.org/allele/MGI:2179048?recomRibbon=open

      We appreciate this suggestion and we will look for pathology in the retina and optic nerve. Such pathology, if we find it, is likely to be specific, as the optic nerve is myelinated and we have already noted extensive myelination abnormalities in the Mcl-1-deleted mice. If we find retinal or optic nerve abnormalities, we will note the potential for these abnormalities to impact on open field testing.

      For the startle response, which relies on normal hearing, did the authors check to determine if the mutants are deaf? This is very difficult at such a young age, especially prior to tight junction assembly in the lateral wall at around P14. Again, GFAP is expressed in the cochlea at an early age (see PMID 20817025) and may have caused degenerative pathology in this tissue. The authors need to address this major issue.

      The reviewer brings up the potential issue of deafness as a confounding factor for acoustic startle testing. Our results showed that startle responses in the mutant mice were increased at P14, which clearly indicates the mice were able to hear the acoustic stimuli. Further, at P14 and P21, both WT and knockout mice had orderly patterns of prepulse inhibition, providing confirmation of good hearing ability at each timepoint. We will make these points clear in the revision.

      *Reviewer #2 (Significance (Required)):

      Unknown.*

      The reviewer has not raised specific issues with the significance. We consider the significance of our work to be the finding that oligodendrocyte-lineage glial cells depend on MCL-1 and thus are primed for apoptosis, such that disrupting MCL-1 expression results in catastrophic degeneration of the cerebral white matter. Addressing the reviewer’s concerns described in the section on Evidence, reproducibility and clarity will support this significance.*

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      Cleveland et al. tried to argue that brain-specific depletion of apoptosis regulator MCL-1 reproduces Vanishing White Matter Disease (VWMD) in mice. The authors show that brain-specific MCL-1 deficiency leads to brain atrophy, increased brain cell apoptosis, decreased oligodendrocytes, decreased MBP immunoreactivity, and activation of astrocytes and microglia. It is known that VWMD is a hypomyelinating disorder caused by mutation of eIF2B subunits, which displays severe myelin loss but minimal oligodendrocyte apoptosis or loss in the CNS white matter. In fact, a number of studies show increased oligodendrocyte numbers in the CNS white matter.*

      Published reports show decreased normal oligodendrocytes and increased immature oligodendrocyte populations (20)**.

      The characteristic oligodendrocyte pathology is foamy oligodendrocytes (Wong et al., 2000), rather than apoptosis.

      Foamy oligodendrocyte pathology and increased oligodendrocyte apoptosis are not mutually exclusive. The above referenced paper, Wong et al, in addition to foamy oligodendrocytes, also describes a “decrease in numbers of cells with oligodendroglial phenotype, both normal and abnormal” (21); this decrease is compatible with increased apoptosis. Moreover, published reports specifically describe apoptotic oligodendrocytes in human brains with VWMD (22). To address this point, we propose to include both of these citations in the revision to reference foamy oligodendrocyte pathology in VWMD and to state that this pathologic finding does exclude a role for apoptosis in VWMD pathogenesis.

      Since the CNS pathology of brain-specific MCL-1 deficient mice is drive by brain cell apoptosis, the relevance of this mouse model to VWMD is very limited.

      Whether apoptosis plays a mechanistic role in VWMD is less clear than this comment suggests, as described in multiple publications (22, 23).

      The title of this manuscript is misleading, and should be changed.

      We accept that our statement that Mcl-1-deletion recapitulates VWMD is premature and not adequately supported by the available data. We will revise the title, introduction and discussion accordingly, to focus on the white matter specificity of the Mcl-1-deletion phenotype.

      *Moreover, there are a number of major concerns.**

      1. Figure 1 clearly shows severe atrophy of neocortex in Mcl-1 cKO mice; however, the white matter appears largely normal in the cerebellum and brain stem. Mcl-1 cKO mice also display ventricular dilation and possible atrophy of corpus callosum. The authors should discuss severe atrophy of neocortex in Mcl-1 cKO mice and the possibility that ventricular dilation and corpus callosum atrophy result from severe atrophy of neocortex?*

      The cortical atrophy that the reviewer notes begins after P7 and is minimal at P14 when white matter loss is already pronounced. At P21, when there is clear cortical thinning, the white matter loss is extreme. Based on the time course, we consider that the white matter loss is the primary pathology, and the cortical thinning is secondary. Importantly, glial cells populate the cortex as well as the white matter and our cellular data show that oligodendrocytes are reduced in the cortex as well as in the white matter structures. Based on these lines of evidence, we consider that the primary cell type affected is the oligodendroglial population of the glia. We will add a discussion along these lines to the revision.

      We agree that the brain stem is preserved. Our data show that the hGFAP-Cre promoter is least efficient in the brain stem and midbrain regions (Sup Fig.1). We will note this differential efficiency in the revision.

      • The motor and sensory tests in Figure 2 are potential interesting, but their relevance to myelin abnormalities is limited. The authors should perform the behaviors tests that are highly relevant to myelin abnormalities.*

      The tests presented show progressive neurologic impairment, correlating with the onset of neuropathology. In the revision we will note that ataxia and tremor are common features of leukodystrophies and the Mcl-1-deleted mice show both ataxia and tremor.

      • It is well expected that there are increased apoptotic cells in the brain of Mcl-1 cKO mice. The authors should perform double labeling to demonstrate which cell types undergo apoptosis: neurons, oligodendrocytes, or other cell types? On the other hand, Figure 3A shows that there are substantial apoptotic cells in the cerebral cortex, which is consistent with severe cerebral cortex atrophy in Mcl-1 cKO mice, suggesting neuron apoptosis in the cerebral cortex. Neuron apoptosis would further rule out the relevance of Mcl-1 cKO mice to VWMD.*

      These studies would be of interest, but we have not been able to co-label apoptotic cells in the Mcl-1-deleted mice with any marker. In the advanced state of apoptosis when dying cells are detectable by TUNEL staining, the relevant marker proteins have been degraded beyond recognition by IHC. In contrast, the apoptotic marker cleaved caspase-3, which is positive earlier in the apoptotic process and might allow marker co-labeling, was not detectably elevated in the Mcl-1-deleted mice. We attribute the lack of cleaved caspase-3+ cells to the asynchronous nature of the increased cell death, and to the short duration in which dying cells are cleaved caspase-3+. While double label studies of dying cells have been problematic, our studies quantifying each cell type provide information to address the reviewer’s question. Our cell counts show clearly that oligodendrocytes are the primary cell type reduced in number in the Mcl-1 deleted mice.

      • Figure1, 4 the authors use H&E staining to demonstrate white matter loss. H&E staining is good to show general CNS morphology; however, it is impossible to use H&E staining to quantify the integrity of the white matter. The authors should perform specific staining to quantify white matter loss in the mouse models.*

      Our MBP stains later in the paper are used to quantify white matter loss.

      • Figure 5, MBP IHC is good to show general myelin staining, but is not a reliable assay to quantify myelin integrity in the CNS. The authors should perform electron microscopy analysis to quantify myelin integrity in the CNS in the mouse models.*

      Our studies of MBP staining show that the myelinated area in cross sections is significantly reduced in the Mcl-1-deleted mice. Electron microscopy studies cannot show whether the myelinated area is reduced and studies of myelin integrity are not needed to prove that reduced oligodendrocytes correlate with reduced myelination.

      • Figure 6, SOX10 is a marker of oligodendrocytes and OPCs. The authors should quantify the number of oligodendrocytes (using oligodendrocyte markers, such as CC1) and the number of OPCs (using OPC markers, such as NG2). Does deletion of BAK or BAX reduce oligodendrocyte apoptosis in the CNS of Mcl-1 cKO mice?*

      We agree that this is an important question, and we are working to quantify OPCs in the Mcl-1-deleted mice by counting cells labelled with the OPC marker PDGFRA. We will add these data to the revision and discuss their significance when we know what they show.

      • The authors show that the level of MCL-1 is comparable in brain lysates of wildtype and eIF2B5 R132H/R132H mice at the age of 7 months, and moderately decreased in eIF2B5 R132H/R132H mice at the age of 10 months. VWMDis a developmental disorder. Similarly, brain-specific MCL-1 deficiency causes developmental abnormalities in the CNS. The normal level of MCL-1 in 7-month-old eIF2B5 R132H/R132H mice strongly suggests that MCL-1 is not a major player involved in the pathogenesis of VWMD. Does brain-specific MCL-1 deficiency starting at the age of 10 months (using CreERT mice) cause CNS abnormalities in adult mice?*

      We agree that Mcl-1 deletion in our model disrupts postnatal brain development. Our studies show that in early life, oligodendrocytes depend on MCL-1 to prevent spontaneous apoptosis. It is an interesting, but separate question whether Mcl-1 deletion induced in the adult would also cause a similar phenotype. The suggested studies would take over a year to conduct, and while they are of interest, they are not required to prove our main point, which is that developmental leukodystrophies may result from the dependence of oligodendrocytes on MCL-1. In the revision, we will state that our comparison on the Mcl-1-deletion phenotype to VWMD is hypothetical, and that additional studies are needed to test this hypothesis.

      • Does MCL-1 deletion exacerbate the pathology in eIF2B5 R132H/R132H mice? Moreover, does MCL-1 overexpression rescue the pathology in eIF2B5 R132H/R132H mice? These two experiments are necessary to demonstrate the involvement of MCL-1 in VWMDpathogenesis.*

      We agree that these are interesting and important studies; however, these studies will require years to complete and extensive resources. These studies are not needed to show that Mcl-1 deletion produces early onset white matter degeneration, which is our main point. As in our response to point 7 above, we will state in the revision that our comparison on the Mcl-1-deletion phenotype to VWMD is hypothetical, and list these experiments as follow up studies that are needed to test this hypothesis.

      *Reviewer #3 (Significance (Required)):

      The study will not significantly advance the understanding of VWMD pathogenesis.*

      We recognize that our assertion of a direct relevance to VWMD was premature, and that additional studies, beyond the scope to this project, are needed to determine if MCL-1 deficiency contributes to VWMD pathology. We agree that the available data do not yet inform VWMD pathogenesis, but these data may become relevant to VWMD as follow-up studies are conducted. The data remain highly relevant to the broad group of leukodystrophies as they demonstrate a physiologic vulnerability of oligodendrocytes that sets them apart from astrocytes and neurons, and thus may play a role in disorders in which oligodendrocyte pathology is central.

      Neuroscientists may be interested in the reported findings.

      We appreciate the reviewer noting the significance for neuroscience.

      My field of expertise: oligodendrocyte, myelin, neurodegeneration, ER stress

      References cited:

      1. K. A. Sarosiek, C. Fraser, N. Muthalagu, P. D. Bhola, W. Chang, S. K. McBrayer, A. Cantlon, S. Fisch, G. Golomb-Mello, J. A. Ryan, J. Deng, B. Jian, C. Corbett, M. Goldenberg, J. R. Madsen, R. Liao, D. Walsh, J. Sedivy, D. J. Murphy, D. R. Carrasco, S. Robinson, J. Moslehi, A. Letai, Developmental Regulation of Mitochondrial Apoptosis by c-Myc Governs Age- and Tissue-Specific Sensitivity to Cancer Therapeutics. Cancer Cell 31, 142-156 (2017).
      2. R. Dumitru, V. Gama, B. M. Fagan, J. J. Bower, V. Swahari, L. H. Pevny, M. Deshmukh, Human Embryonic Stem Cells Have Constitutively Active Bax at the Golgi and Are Primed to Undergo Rapid Apoptosis. Mol Cell 46, 573-583 (2012).
      3. T. Ni Chonghaile, K. A. Sarosiek, T. T. Vo, J. A. Ryan, A. Tammareddi, G. Moore Vdel, J. Deng, K. C. Anderson, P. Richardson, Y. T. Tai, C. S. Mitsiades, U. A. Matulonis, R. Drapkin, R. Stone, D. J. Deangelo, D. J. McConkey, S. E. Sallan, L. Silverman, M. S. Hirsch, D. R. Carrasco, A. Letai, Pretreatment mitochondrial priming correlates with clinical response to cytotoxic chemotherapy. Science 334, 1129-1133 (2011).
      4. J. A. Ryan, J. K. Brunelle, A. Letai, Heightened mitochondrial priming is the basis for apoptotic hypersensitivity of CD4+ CD8+ thymocytes. Proc Natl Acad Sci U S A 107, 12895-12900 (2010).
      5. M. Certo, V. D. G. Moore, M. Nishino, G. Wei, S. Korsmeyer, S. A. Armstrong, A. Letai, Mitochondria primed by death signals determine cellular addiction to antiapoptotic BCL-2 family members. Cancer Cell 9, 351-365 (2006).
      6. A. J. Crowther, V. Gama, A. Bevilacqua, S. X. Chang, H. Yuan, M. Deshmukh, T. R. Gershon, Tonic activation of Bax primes neural progenitors for rapid apoptosis through a mechanism preserved in medulloblastoma. The Journal of neuroscience : the official journal of the Society for Neuroscience 33, 18098-18108 (2013).
      7. D. Rodriguez, A. Gelot, B. della Gaspera, O. Robain, G. Ponsot, L. L. Sarlieve, S. Ghandour, A. Pompidou, A. Dautigny, P. Aubourg, D. Pham-Dinh, Increased density of oligodendrocytes in childhood ataxia with diffuse central hypomyelination (CACH) syndrome: neuropathological and biochemical study of two cases. Acta Neuropathol 97, 469-480 (1999).
      8. Y. L. Wong, L. LeBon, A. M. Basso, K. L. Kohlhaas, A. L. Nikkel, H. M. Robb, D. L. Donnelly-Roberts, J. Prakash, A. M. Swensen, N. D. Rubinstein, S. Krishnan, F. E. McAllister, N. V. Haste, J. J. O'Brien, M. Roy, A. Ireland, J. M. Frost, L. Shi, S. Riedmaier, K. Martin, M. J. Dart, C. Sidrauski, eIF2B activator prevents neurological defects caused by a chronic integrated stress response. Elife 8, (2019).
      9. A. Trimouille, F. Marguet, F. Sauvestre, E. Lasseaux, F. Pelluard, M. L. Martin-Negrier, C. Plaisant, C. Rooryck, D. Lacombe, B. Arveiler, O. Boespflug-Tanguy, S. Naudion, A. Laquerriere, Foetal onset of EIF2B related disorder in two siblings: cerebellar hypoplasia with absent Bergmann glia and severe hypomyelination. Acta Neuropathol Commun 8, 48 (2020).
      10. T. E. M. Abbink, L. E. Wisse, E. Jaku, M. J. Thiecke, D. Voltolini-Gonzalez, H. Fritsen, S. Bobeldijk, T. J. Ter Braak, E. Polder, N. L. Postma, M. Bugiani, E. A. Struijs, M. Verheijen, N. Straat, S. van der Sluis, A. A. M. Thomas, D. Molenaar, M. S. van der Knaap, Vanishing white matter: deregulated integrated stress response as therapy target. Ann Clin Transl Neurol 6, 1407-1422 (2019).
      11. S. L. Moon, R. Parker, EIF2B2 mutations in vanishing white matter disease hypersuppress translation and delay recovery during the integrated stress response. RNA 24, 841-852 (2018).
      12. G. Raini, R. Sharet, M. Herrero, A. Atzmon, A. Shenoy, T. Geiger, O. Elroy-Stein, Mutant eIF2B leads to impaired mitochondrial oxidative phosphorylation in vanishing white matter disease. J Neurochem 141, 694-707 (2017).
      13. L. Kantor, D. Pinchasi, M. Mintz, Y. Hathout, A. Vanderver, O. Elroy-Stein, A point mutation in translation initiation factor 2B leads to a continuous hyper stress state in oligodendroglial-derived cells. PLoS One 3, e3783 (2008).
      14. Y. Cabilly, M. Barbi, M. Geva, L. Marom, D. Chetrit, M. Ehrlich, O. Elroy-Stein, Poor cerebral inflammatory response in eIF2B knock-in mice: implications for the aetiology of vanishing white matter disease. PLoS One 7, e46715 (2012).
      15. L. Marom, I. Ulitsky, Y. Cabilly, R. Shamir, O. Elroy-Stein, A point mutation in translation initiation factor eIF2B leads to function--and time-specific changes in brain gene expression. PLoS One 6, e26992 (2011).
      16. L. C. Fogarty, R. T. Flemmer, B. A. Geizer, M. Licursi, A. Karunanithy, J. T. Opferman, K. Hirasawa, J. L. Vanderluit, Mcl-1 and Bcl-xL are essential for survival of the developing nervous system. Cell Death Differ 26, 1501-1515 (2019).
      17. S. M. Hasan, A. D. Sheen, A. M. Power, L. M. Langevin, J. Xiong, M. Furlong, K. Day, C. Schuurmans, J. T. Opferman, J. L. Vanderluit, Mcl1 regulates the terminal mitosis of neural precursor cells in the mammalian brain through p27Kip1. Development 140, 3118-3127 (2013).
      18. C. D. Malone, S. M. Hasan, R. B. Roome, J. Xiong, M. Furlong, J. T. Opferman, J. L. Vanderluit, Mcl-1 regulates the survival of adult neural precursor cells. Mol Cell Neurosci 49, 439-447 (2012).
      19. S. E. Williams, I. Garcia, A. J. Crowther, S. Li, A. Stewart, H. Liu, K. J. Lough, S. O'Neill, K. Veleta, E. A. Oyarzabal, J. R. Merrill, Y. I. Shih, T. R. Gershon, Aspm sustains postnatal cerebellar neurogenesis and medulloblastoma growth. Development, (2015).
      20. M. Bugiani, I. Boor, B. van Kollenburg, N. Postma, E. Polder, C. van Berkel, R. E. van Kesteren, M. S. Windrem, E. M. Hol, G. C. Scheper, S. A. Goldman, M. S. van der Knaap, Defective glial maturation in vanishing white matter disease. J Neuropathol Exp Neurol 70, 69-82 (2011).
      21. K. Wong, R. C. Armstrong, K. A. Gyure, A. L. Morrison, D. Rodriguez, R. Matalon, A. B. Johnson, R. Wollmann, E. Gilbert, T. Q. Le, C. A. Bradley, K. Crutchfield, R. Schiffmann, Foamy cells with oligodendroglial phenotype in childhood ataxia with diffuse central nervous system hypomyelination syndrome. Acta Neuropathol 100, 635-646 (2000).
      22. K. Van Haren, J. P. van der Voorn, D. R. Peterson, M. S. van der Knaap, J. M. Powers, The life and death of oligodendrocytes in vanishing white matter disease. J Neuropathol Exp Neurol 63, 618-630 (2004).
      23. M. Bugiani, I. Boor, J. M. Powers, G. C. Scheper, M. S. van der Knaap, Leukoencephalopathy with vanishing white matter: a review. J Neuropathol Exp Neurol 69, 987-996 (2010).
    1. SciScore for 10.1101/2021.03.17.21253349: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics: The study was approved by the Regional Ethics Committee South-East (REK 19864)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Strengths and limitations: We use nation-wide register-based data on both notified COVID-19 and occupation. Because we include all residents of Norway aged 20 to 70 years and utilize routinely registered data, important strengths of our study are limited bias due to selection and misclassification. Important limitations are, first, we were not able to adjust for socioeconomic factors such as income or education, living conditions, urban living, health literacy or risky behavior. We acknowledge that all these factors are relevant for risk of infection and may be associated with persons’ occupation. Second, there may be differences within occupational groups in working contracts, working conditions and tasks. We hypothesize that workers on temporary contracts work more disadvantaged hours and perform tasks with higher risk of infection than others, as well as experience a stronger pressure to come to work even with symptoms of infection. Our data did not include information on whether participants had temporary or permanent position, but we suspect that immigrants more often than others work on temporary contracts. Third, other characteristics of occupations, such as distance to other people and possibility to work from home may (10) be just as relevant as occupations per se. A relatively large proportion of the population, about one in four, was not registered with any work, and excluding these from the reference group did not lead to substantial changes in results. A fourth l...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.03.22.436379: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Both the double-transduced pool and the cloned cell lines were analyzed with SDS-PAGE using an anti-V5 antibody (#MA5-15253, Invitrogen) for TMPRSS2 and an anti-ACE2-antibody (#15983, Cell Signaling Technology).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-V5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-ACE2-antibody ( #15983 , Cell Signaling Technology) .</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The viral vectors were generated by transfecting HEK293T cells using polyethylenimine with the packaging vector pCMV-dR8.91 and the vesicular stomatitis virus (VSV-G) envelope expression vector pMD2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Another human lung epithelial cell line Calu-3 and human colorectal adenocarcinoma cell line Caco-2 were kept in Minimum Essential Medium Eagle (MEM) supplemented with 20% FCS, 1% L-Glutamine, 1% penicillin/streptomycin, and 1% MEM Non-essential Amino acid Solution (100X).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6-TMPRSS2 cells (ATCC® CRL-1586) were maintained in MEM supplemented with 10% FCS, 1% L-Glutamine and 1% penicillin/streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 virus isolates (wild type, B.1.1.7, and B.1.351), obtained from nasopharyngeal swabs of patients (Cantuti-Castelvetri et al., 2020; Virtanen et al., 2021) (MOI 0.05), were incubated with Calu-1 cells in 48-well plates (40.000 cells/well) for 1 h at 37°C and 5% CO2, after which virus inoculum was removed and cells were washed twice with PBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This compound also failed to change the viral infection in ACE2/TMPRSS2-expressing HEK cells after 24 h of treatment (Fig. 4f).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Slight reduction of cell viability was observed in infected HEK293T-ACE2-TMPRSS2 cells after fluoxetine, clomipramine, chlorpromazine, pimozide, and reboxetine treatment (Fig.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2-TMPRSS2</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.03.23.436593: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.3 SARS CoV2 Viral Infection: Vero cells seeded in 96-well plates were cultured at 37°C, 5% CO2 in Dulbecco Minimum Essential Medium (DMEM) (Gibco) supplemented with 10% (v/v) Fetal Bovine Serum (FBS) (Gibco), 3.7 g/L sodium bicarbonate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data is represented as mean ± SD using GraphPad Prism 8 (Ver 8.4.2 GraphPad Software, LLC.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. Consonant Pronunciation

      b - boy / ban

      c - chat / ceeb

      d - dog / dara

      f - fire / fas

      g - good / agsi

      j - job / jox

      k - keep / kaani

      l - land / lakk

      m - mark / naam

      n - nice / àdduna

      ñ - genius / gaañ

      p - paint / puso

      r - rat / raxas

      s - soup / kawas

      t - take / tubaab

      w - wait / kéwél

      x - (see note below) / xaalis

      y - yes / yaa

      There is no English equivalent for this sound, it is a slightly guttural sound that is between x and k. It may also be pronounced merely as h, especially among non-natives.

      mb - mbaa

      mp - dàmp

      nd - ndey

      ng - ngan

      nj - njaay

      ŋ - masoŋ

      Prenasalized consonants don't exist in English the way they do in Wolof. ng and ŋ sound almost the same if not the same. Words like sing, bring, king, mango, etc. are the closest to this sound.

    2. Vowel Pronunciation

      a - absorb / sant

      aa - far / laaj

      e - get / dem

      ee - where / seet

      é - say / bés

      ée - sane / wéer

      ë - bird / kër

      i - pit / fit

      ii - meet / siis

      o - moment / fomp

      ó - no / jóg

      oo - door / loos

      óo - phone / fóon

      u - cook / ubbi

      uu - moon / juuyoo

    1. SciScore for 10.1101/2021.03.22.436337: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Bioluminescence Imaging (BLI) of SARS-CoV-2 infection: All standard operating procedures and protocols for IVIS imaging of SARS-CoV-2 infected animals under ABSL-3 conditions were approved by IACUC, IBSCYU and YARC.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">SARS-CoV-2 infection and treatment conditions: For all in vivo experiments, the 6 to 8 weeks male and female mice were intranasally challenged with 1 x 105 FFU in 25-30 µl volume under anesthesia (0.5 - 5 % isoflurane delivered using precision Dräger vaporizer with oxygen flow rate of 1 L/min).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody depletion of immune cell subsets: For evaluating the effect of NK cell depletion during CV3-1 prophylaxis, anti-NK1.1 (clone PK136; 12.5 mg/kg body weight) or an isotype control mAb (BioXCell; clone C1.18.4; 12.5 mg/kg body weight) was administered to mice by i.p. injections every 2 days starting at 48 h before SARS-CoV-2-nLuc challenge till 8 dpi.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-NK1.1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">containing Fc blocking antibody against CD16/CD32 (BioLegend Inc) before staining with antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD16/CD32</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Grids were incubated 1 hr with 10% calf serum in PBS to block nonspecific antibody binding, then incubated 2 hrs with anti-S antiserum (Cohen et al., 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Grids were rinsed (4x 10’) with PBS then labeled for 2 hrs with 10 nm gold conjugated goat anti-mouse secondary antibody (Ted Pella, Inc.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">At 48 hours post transfection, 293T cells were stained with CV3-1 and CV3-25 antibodies (5μg/mL), using cross-reactive anti-SARS-CoV-1 Spike CR3022 or mouse anti-His tag (Sigma-Aldrich) as positive controls.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CV3-25</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alexa Fluor-647-conjugated goat anti-human IgG (H+L) Abs (Invitrogen) and goat anti-mouse IgG (H+L) Abs (Invitrogen) were used as secondary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An anti-mouse SARS-CoV-2 nucleocapsid protein (Clone 1C7, Bioss Antibodies)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse SARS-CoV-2 nucleocapsid protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following extensive washing with PBS, an anti-mouse IgG HRP secondary antibody solution was formulated in PBS + 1% non-fat milk.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody dependent cellular cytotoxicity (ADCC) assay: For evaluation of anti-SARS-CoV-2 ADCC activity, parental CEM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 ADCC activity</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Second, serially diluted clarified tissue homogenates were used to infect Vero-E6 cell culture monolayer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Uninfected monolayer of Vero cells treated identically served as controls to determine basal luciferase activity to obtain normalized relative light units.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cells were maintained in complete Dulbecco’s Modified Eagle Medium (DMEM; Thermo Fisher, Cat. #11965–092) containing 10% fetal bovine serum (Gibco, Thermo-Fisher, Cat. #16140–071), 1% HEPES Buffer Solution (15630–130), and 1 % penicillin– streptomycin (Thermo Fisher, Cat. #15140–122).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, pseudoviral particles were produced by transfecting 2×106 HEK293T cells with pNL4.3 Luc R-E- (3.5 μg), plasmids encoding for SARS-CoV-2 Spike or SARS-CoV-1 Spike (3.5 μg) protein and VSV-G (pSVCMV-IN-VSV-G, 1 μg) using the standard calcium phosphate method.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells were transfected by the calcium phosphate method with the pNL4.3 R-E-Luc plasmid (NIH AIDS Reagent Program) and a plasmid encoding for SARS-CoV-2 Spike at a ratio of 5:4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">THP-1 cells were used as effector cells and were stained with another cellular dye (cell proliferation dye eFluor670).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>THP-1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bioluminescence Imaging (BLI) of SARS-CoV-2 infection: All standard operating procedures and protocols for IVIS imaging of SARS-CoV-2 infected animals under ABSL-3 conditions were approved by IACUC, IBSCYU and YARC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>YARC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image sequences were assembled and converted to videos using Image J.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Image J</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The images were processed using Nikon Elements AR version 4.5 software (Nikon Instruments Inc, Americas) and figures assembled with Photoshop CC and Illustrator CC (Adobe Systems, San Jose, CA, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Photoshop</div><div>suggested: (Adobe Photoshop, RRID:SCR_014199)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data were processed and plotted using GraphPad Prism 8 v8.4.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FlowJo software (Treestar) was used to generate FACS plot shown in Figure S7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tomographic tilt-series and large-area montaged overviews were acquired automatically using the SerialEM software package (Mastronarde, 2005, 2008; Mastronarde and Held, 2017).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tomographic data was calculated, analyzed, and modeled using the IMOD software package (Mastronarde, 2005, 2008; Mastronarde and Held, 2017) on iMac Pro and MacPro computers (Apple, Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IMOD</div><div>suggested: (IMOD, RRID:SCR_003297)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S-MEN particles were then re-suspended in 50 mM pH 7.5 HEPES buffer, labeled with Cy3B(3S) and Cy5 derivative (LD650-CoA) and purified through an optiprep gradient as previously described (Lu et al., 2019; Lu et al., 2020; Munro et al., 2014) smFRET images of S-MEN particles was acquired on a home-built prism-based total internal reflection fluorescence (TIRF) microscope, as described previously (Lu et al., 2020). smFRET data analysis was performed using MATLAB (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(MathWorks)-based customized SPARTAN software package (Juette et al., 2016).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPARTAN</div><div>suggested: (SPARTAN, RRID:SCR_014901)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">P values were indicated as ∗, p < 0.05; ∗∗, p < 0.01; ∗∗∗, p < 0.001; ∗∗∗∗, p < 0.0001. Schematics: Schematics for showing experimental design in figures were created with BioRender.com.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioRender</div><div>suggested: (Biorender, RRID:SCR_018361)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 65, 66, 67, 68, 62 and 63. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.03.15.435423: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Specifically, six of these datasets were based on CRISPR-Cas9 assay results, including (1-2) CRISPR_A549-H and CRISPR_A549-L, based on high (-H) and low (-L) multiplicity of infection of SARS-CoV-2 in A549 cells [21]; (3-5) CRISPR_HuH7-SARS2, CRISPR_HuH7-229E, CRISPR_HuH7-OC43, based on HuH7 cells infected by SARS-CoV-2, HCoV-229E, and HCoV-OC43, respectively [22]; and (6) CRISPR_VeroE6, based on SARS-CoV-2-infected VeroE6 cells [23].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HuH7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Functional enrichment analyses, including Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO) biological process enrichment analyses, were performed using Enrichr [30] for the CRISPR datasets.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div><div style="margin-bottom:8px"><div>Enrichr</div><div>suggested: (Enrichr, RRID:SCR_001575)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neurological disease gene profiles: We extracted neurologic disease-associated genes/proteins from the Human Gene Mutation Database (HGMD) [31], and defined a gene to be disease-associated, if it had at least one disease-associated mutation from HGMD reported in the literature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Human Gene Mutation Database</div><div>suggested: (Human Gene Mutation Database, RRID:SCR_001621)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All single-cell analyses were performed using Seurat v3.1.5 [39] following the processing steps from the original publication of each dataset.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Seurat</div><div>suggested: (SEURAT, RRID:SCR_007322)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the bulk RNA-sequencing dataset, differential expression analysis was performed using edgeR v3.12 [40]</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>edgeR</div><div>suggested: (edgeR, RRID:SCR_012802)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Each PPI edge has one or more source information of five categories of evidence from publicly available databases and datasets: protein complexes identified by robust affinity purification-mass spectrometry from BioPlex V2.016 [49]; binary PPIs discovered by high-throughput yeast two-hybrid systems in three datasets [24, 50, 51]; signaling networks revealed by low-throughput experiments from SignaLink2.0 [52]; low-throughput or high-throughput experiments uncovered kinase-substrate interactions from KinomeNetworkX [53], Human Protein Resource Database (HPRD) [54], PhosphoNetworks [55], PhosphositePlus [56], DbPTM 3.0 [57], and Phospho.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioPlex</div><div>suggested: (BioPlex, RRID:SCR_016144)</div></div><div style="margin-bottom:8px"><div>HPRD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>DbPTM</div><div>suggested: (dbPTM: An informational repository of proteins and post-translational modifications, RRID:SCR_007619)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELM [58]; and PPIs curated from literatures identified by yeast two-hybrid studies, affinity purification-mass spectrometry, low-throughput experiments, or protein three-dimensional structures from BioGRID [59]</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioGRID</div><div>suggested: (BioGrid Australia, RRID:SCR_006334)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PINA [60], Instruct [61], MINT [62], IntAct [63], and InnateDB [64].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MINT</div><div>suggested: (MINT, RRID:SCR_001523)</div></div><div style="margin-bottom:8px"><div>IntAct</div><div>suggested: (IntAct, RRID:SCR_006944)</div></div><div style="margin-bottom:8px"><div>InnateDB</div><div>suggested: (InnateDB, RRID:SCR_006714)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Eigenvector centrality [66] of the nodes in the networks were computed using Gephi 0.9.2 [67] to evaluate the influence of the nodes considering the importance of their neighbors.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gephi</div><div>suggested: (Gephi, RRID:SCR_004293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis and network visualization: Python package SciPy v1.3.0 [69] was used for the statistical tests unless specified otherwise.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div><div style="margin-bottom:8px"><div>SciPy</div><div>suggested: (SciPy, RRID:SCR_008058)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Networks were visualized with Gephi 0.9.2 [67] and Cytoscape 3.8.0 [70].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cytoscape</div><div>suggested: (Cytoscape, RRID:SCR_003032)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The transcriptomic datasets used in this study (GSE147528, GSE157827, GSE138852, GSE157103, GSE149689, and GSE163005) were downloaded from the NCBI GEO database (https://www.ncbi.nlm.nih.gov/geo/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NCBI GEO</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>https://www.ncbi.nlm.nih.gov/geo/</div><div>suggested: (Gene Expression Omnibus (GEO, RRID:SCR_005012)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations: We acknowledge several limitations. First, our human protein-protein interactome was built using high-quality data from multiple sources; yet it is still incomplete. The PPIs in our interactome is undirected. However, it has been shown that incorporating directionality of the human PPI does not change network proximity results [114]. Therefore, the network associations could be either positive or negative, and require further investigation. In addition, as our network proximity analysis relies on disease-associated genes, literature bias could affect the results because more highly-studied genes are more likely to appear in the dataset. Second, we analyzed expression levels of the key SARS-CoV-2 entry factors and found low expression levels for ACE2 and TMPRSS2. However, we cannot rule out the possibility of SARS-CoV-2 directly targeting the brain via as-yet unidentified mechanisms. Third, possible pathways of neuroinflammation and microvascular injury were tested using data of either individuals with AD or COVID-19, but not both. Future studies using genetics and multi-omics data from individuals with both AD and COVID-19 will be needed to confirm and extend these network-based findings. The significance of our findings in the context of the general population of COVID-19 frequently suffering from “brain fog” without a formal diagnosis of AD needs further investigation.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04320277</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Not yet recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Baricitinib in Symptomatic Patients Infected by COVID-19: an…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04321993</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Treatment of Moderate to Severe Coronavirus Disease (COVID-1…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. She cites three things in particular: Barth, R.S. (1972). Open Education and the American School Katz, L. G. (1972). “Research on Open Education: Problems and Issues” Resnick, L. B. (1972). “Open Education: Some Tasks for Technology.” 

      Ha! Was just searching for those three texts. Resnick's is on Archive.org (1hr loan).

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      The authors aimed to understand the control and the elimination of disseminated tumor cells by NK cells within the lung, their main question being how pulmonary NK cells are able to prevent tumor cells from colonization in the lung.

      To dissect this question, Hiroshi Ichise and colleagues took advantage of the ultra-sensitive bioluminescence whole body imaging system combined with intravital two-photon microscopy technology involving genetically-encoded biosensors tumor or NK cells to explore the behavior and functional competences of NK cells in an experimental lung metastasis model.

      First, the authors have monitored the fate of intravenously injected B16-Akaluc cells from 5 min to 10 days and observe that tumor cells decrease rapidly within the first 12-24 hours. In parallel, they performed asialoGM1+ and NK1.1+ cells depletion by injection of depleting anti-aGM1 and anti-NK1.1 antibodies in order to see the involvement of these populations on the elimination of the disseminated tumor cells. They conclude that a rapid decrease of the tumor cells is mediated by NK cells. Consisting with this first data, the authors observe also the same early NK cells mediated impact on two other syngenic mouse tumor cell lines : the BRAFV600E melanoma and the colon adenocarcinoma MC-38.

      In a second part, the authors dissected NK cell dynamic behaviors in the pulmonary capillaries by taking advantage of the NKp46iCRExrosa26dtTomato mice where NKp46+ cells are fluorescents and performed 2P intravital imaging to follow the in situ the NKp46+ cells behavior. They could nicely observe that NK cells arrive from the capillaries and patrol on the lung epithelial cells in a stall-crawl-jump manner. Moreover, they also show that the attachment to the pulmonary capillaries is mediated by LFA-1. In the presence of B16F10 tumor model, they observe that NK cells stay longer in the capillaries and increase their duration time of crawling indicating that NK cells stay in contact longer with tumor cells.

      The authors then explored the NK-mediated tumor killing in the lung by measuring tumor cell apoptosis using B16F10-SCAT3 cells (which leads to visualize caspase 3 activation) and Ca2+ influx in tumor cells expressing two Ca2+ sensors, GCaMP6s and R-GECO. They could observe casp3 activation but also Ca+ influx on tumor cells within few minutes after encountering NK cells. They also observe that evasion of NK cell surveillance is mediated by Nectin-5 and Nectin-2 expressed on tumor cells.

      Then, they focus on NK cell activation by looking at ERK activation. To do so, they have isolated NK cells from Tg mice expressing a FRET-based ERK biosensor and performed in vitro killing assay against B16-R-GECO tumor cells but also in vivo experiments. For the in vivo experiments, they have developed reporter mice whose NK cells express the FRET biosensor for ERK. They observe that ERK-dependent NK cell activation contributes to the elimination of disseminated tumor cells within the first few hours but not after 24hours. Indeed, theu observe that B16F10-Akaluc tumor cells are equally eliminated when injected 24h after a first injection of B16F10 or PBS in mice. The authors concluded that tumor cell acquire the capacity to evade NK cell surveillance after 24h rather than a hypothesis toward NK cells loose tumoricidal activity over time.

      Finally, the authors have explored their last result on the potential tumor cell evasion of the NK cell surveillance. They show that this NK cell evasion is mediated by the shedding of cell surface Necl-5. They next show that clivage of extracellular domain of Necl-5 was mediated by thrombin in vitro and that anti-coagulation factors such as Warfarin, Edoxaban or Dabigatran Etexilate promote tumor elimination as observed by the bioluminescence experiments. This loss prevents the NK cell signaling needed for effective killing of tumor targets.

      However, most of the results remain correlations and have not been formally demonstrated or miss controls.

      B16F10 is a well known and characterized NK cell target in a in vivo model so the first part is not really knew except the in situ behavior of NK cells within the lung capillaries. The new mecanism of thrombin-mediated shedding of Necl-5 causing evasion from NK Cell surveillance is really concentrated on the last figure (Fig N{degree sign}6) and some supplemental experiments are mandatory and needed to really confirm this affirmation.

      Response: We deeply appreciate the reviewer’s effort to evaluate our work. The reviewer criticizes that the mechanism is well known except “the in situ behavior of NK cells within the lung capillaries.” Indeed, this is what we wish to emphasize in our work. Nobody has ever seen how NK cells kill metastatic tumor cells in the lung. There is a big GAP between in vitro tissue culture experiments and in vivo macroscopic counting of metastatic nodules. Most researchers do not even know when and where in the lung NK cells kill metastatic tumor cells. Live imaging is a powerful approach to address such questions.

      Reviewer #1 (Significance (Required)):

      There are several points to address to improve the significance of these data.

      \*Major points***

      1) A global point : 3 mice/group is to small to analyse and interprete data because of the heterogeneity of the mice. Mean +/- SEM have to represented instead of SD.

      Response: For the sake of animal welfare, researchers are asked to use minimal number of mice. Moreover, only one mouse can be observed in each imaging session, which takes several hours. In most experiments we performed two independent experiments with three mice each. We believe, the number is appropriate for this type of experiment. In the case of small number of samples, we think SD is better than SEM.

      2) The authors used the well known polyclonal anti-asialoGM1 Ab to deplete NK cells. AsialoGM1 is also expressed by ILC1, T, NKT and gd+T cells but also basophils (Trambley J et al., Asialo GM1(+) CD8(+) T cells play a critical role in costimulation blockade-resistant allograft rejection. JCI, 1999). The authors checked the involvement only for the basophils. They have to check the depletion of each of these populations specifically in the lung to assume that the depletion impact only the NK cells or they must change their conclusion on the entire manuscrit and say that not only NK cells is responsible and involved in the control of the disseminated tumor cells but maybe also ILC1, NKT and or gd+T cells.

      Response: We obtained similar observations by using BALB/c nu/nu mice, which lack T cells. Therefore, we can exclude the contribution of T cells at least in the acute phase (*3) Lines 133 to 136 : The authors say that they « did not observe any significant difference in the relative increase of the bioluminescence signal between the control and αAGM1-treated mice, implying that NK cells eliminate disseminated melanoma cells primarily in the acute phase (Response: After 24 hrs, the slope of increment of bioluminescence intensity (BLI) did not change significantly betweenαAGM1-treated mice and control mice. In both mice, the doubling times of melanoma cells are approximately one day.

      4) Fig S3A-B : The authors say that basophils express aGM1 so they performed basophils involvement on the elimination of B16F10 tumor cells with depleting aCD200R3 mab. They also checked the involvement of neutrophils and monocytes. They observed that basophils, neutrophils and monocytes are not involved on the B16F10 elimination. But what is the hypohesis to assess the role of neutrophils and monocytes ? Moreover, they did not explore Basophil roles in the other models including MC-38, BRAFV600E and 4T1 tumor cells.

      Response: We depleted neutrophils and monocytes because antibody-mediated removal of leukocytes could have non-specifically increased the survival of tumor cells. As for expanding the number of experiments with different cell lines, we are afraid but it is too much burden, considering the period required for the experiments and animal welfare.

      5a) Fig 1D : Missing control : the author must add the WT Balbc + a-AGM1 as control.

      Response: We have this data, which will be included in the revised paper.

      5b) Lines 154 to 156 : the authors say that « T cell immunity does not contribute to tumor cell reduction » because tumor cells are eliminated in the nu/nu mice as efficiently as in the WT Balbc mice. This is not correct because they are looking in a window that correspond to innate immunity activation (up to 24h) so they cannot talk about T cell immunity, the adpative response will come more later around 8 days after.

      Response: Yes, we are focusing on the early phase of the rejection of metastatic tumor cells. We will rephrase the sentences.

      6) Line 159 : (refer to point #2) To affirm that NK cells is critical and involved in the elimination of the disseminated tumor, authors have to perform experiment in a model of NK cell deficiency. The most relevant nowaday is the NKp46ICRExrosa26DTA mice that are deficients in NK cells but also ILC1 cells. Indeed, the authors have used the NKp46iCre mice model for other questions.

      Response: As the reviewer stated, the contribution of NK cells in the rejection of metastatic tumors is very well known. We do not think we need to repeat the experiments by using other genetically modified mouse lines, which will take at least one year. We wish to emphasize again that the new findings of our paper are in the in vivo imaging.

      7a) Fig 2F : IC missing

      Response: According to the reviewer's suggestion, we will perform control experiments with an isotype control.

      7b) Lines 181-182 : Authors conclude that the effect of anti-LFA-1 on NK cells adhesion to the pulmonary endothelial cells is mediated primarily by LFA-1. It is not totally true because it is partially mediated as observed in the fig 2F. So authors should change their conclusion and precise that the involvement is partially mediated by LFA-1.

      Response: We will rephrase the result section in the revised paper.

      8) Fig S5B-C-D and S7: The authors talk about tumor cell death. But they are analyzing Ca2+ influx in vitro so it is a little bit different from the cell death. I'm wondering how the cell death is mesured espacially in the fig S5D and S7?

      Response: Under microscopes, apoptosis can be easily recognized by the appearance of blebs. We will include videos in the revised paper.

      9) Fig 4H and lines 232-233 : the authors conclude that « damage to tumor cells is dependent on the engagement of DNAM-1 on NK cells ». There is any experiment performed to affirm this point so the authors cannot maintain this conclusion. First, the authors only analyzed Ca2+ influx at a specific time point. So this result only show that Nectin-5 and/or Nectin-2 expressed by B16F10 is involved in the Ca2+ influx following NK cell contact but there is any data on DNAM-1 contribution. So, the role on the NK cells and specifically DNAM-1+ NK cells have not been adressed here. To answer to that question, the author have to perform in vivo model of engrafted WT vs Necl-5/2 ko B16F10 in a WT vs DNAM1 deficient NK cells mouse model to ascertain the contribution of Necl-5/2-DNAM-1 on NK cells. Moreover, survival curve and bioluminescent experiments would be very appreciated.

      Response: We have shown the data with Necl-5/Nectin-2-deficientB16F10 cells in Fig. S7. I understand the importance of the experiment with the DNAM-1-deficient mice. But the introduction of another knockout mouse line cannot be performed easily. Instead, we will tone down the conclusion on the requirement of signaling from Necl-5/Nectin-2 to DNAM-1.

      10) Lines 253-254 : the authors talk about tumor apoptosis but they are looking at Ca2+ influx. So, they should change their conclusion or show killing experiment.

      Response: In Figure S7, we have shown that the sustained Ca2+ influx is a useful surrogate marker for apoptosis. We will include this information explicitly in the revised paper.

      11) Fig 6 : the authors conclude that the trombin dependent shedding of Necl-5 causes evasion of NK cells surveillance. Moreover, all experiments are correlations and do not implicate in the same experiment Necl-5, DNAM-1+ NK cells and trombin or anti-coagulation factors. So, as in the comment #9, to adress this point, the authors should inject WT vs Necl-5 deficient B16F10-Akaluc into WT vs NK cell depleted mice and monitor the bioluminescence of the tumor cells within 24h following injection of anti coagulation factors as in the fig 6H. Moreover, the monitoring of the survival curve and the number of the lung metastasis would be also very important and informative to really answer to this point.

      Response: We will try the requested experiments during revision.

      \*Minor points***

      1) Fig 2E: The authors assess the involvement of LFA-1 and MAC-1 on the NK cells attachement to the the pulmonary endothelial cells. But there is other adhesion molecules that are known to be expressed by NK cells as for example CR4 (CD11c/CD18). So, the attachement of NK cells could be also due to this molecule.

      Response: We agree. The text will be modified to suggest the involvement of other adhesion molecules.

      2) Lines 190 to 197 : Authors should put this methodology part in the « material and method » in order to be more clear on the message they want to deliver.

      Response: We will modify the text according to the suggestion.

      3) line 228 : There is any hypothesis or explanation regarding the use of Necl5/Necl2 deficient B16F10. Why authors decided to go and explore this pathway ? Authors could add some transition sentence and explanation to help readers.

      Response: We will refer to previous papers suggesting the role of DNAM-1 and its ligands, Necl-5 and nectin-2.

      4) The author could performed the same experiment as in Fig S7D and assessed ERK activation of DNAM+ vs - NK cells against WT vs Necl-5/Necl-2KO R-GEKO B16F10 cells.

      Response: We will try the suggested experiments.

      5) Line 283 : Thanks to reformulate the sentence. Check the firgures associated with the text.

      Response: We will correct this error. The figures will be Fig. 5E and 5F.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      The authors use in vivo imaging techniques to investigate the killing of lung metastasis by NK cells. They demonstrate that the cleavage of CD155 may result in resistance of killing by NK cells and suggest that this could be an immune evasion mechanism of metastatic tumor cells.

      Overall, the subject is highly relevant, and the in vivo imaging is an interesting and highly relevant technique. However, the message, that tumor cells escape the killing by NK cells by cleavage of CD155 is interesting, but not yet fully supported by the data.

      \*Major comments:***

        • Figure 6: To support their main claim the authors would need to transfect the tumor cells with a CD155 mutant, which cannot be cleaved by Thrombin and show that these tumor cells can no longer escape NK cell-mediated killing. This experiment is straight forward and feasible. Another important experiment along this line would be the use the CD155/CD112 deficient tumor cells (Which the authors use in figure 4) in the experiments shown in figure 1. One would expect that tumor control by NK cells within the first 24h is absent when using these tumor cells.* Response: We previously made five CD155 mutants, which could be resistant to thrombin-mediated cleavage, and re-expressed in CD155/CD112 deficient tumor cells. However, none of the mutants was not killed by NK cells both in vivo and in vitro. It appears that the potential thrombin-cleavage site(s) reside in the recognition site by DNAM-1. We will include this observation in the discussion.
      • Figure 5: The demonstration that ERK is activated in this in vivo setting is novel. However, ERK activation is not DNAM-1 specific and the ERK inhibitor is significantly less effective that the depletion of NK cells. Therefore, the relevance of these data to the main message of the manuscript is unclear and the figure could be omitted.*

      Response: We agree that the modest effect of MEKi implies that ERK activation is dispensable for NK activation. However, ERK activation is a useful marker of NK cell activation. The data shown here vividly show the timing of NK cell activation and following tumor cell killing. Because the in vivo dynamics of NK cell activation and tumor cell killing is the most important message of this work, we wish to show this data.

      • In general, the issue of NK cell exhaustion should be addressed in more detail. The experiments do not address serial killing activity of NK cells and more data is needed to show that it is not an exhaustion of NK cells but the cleavage of CD155 from the tumor cells that prevents further killing.*

      Response: We believe, Fig. 5G clearly shows that NK cells are not exhausted 24 hours after tumor cell injection.

      **Minor comments:**

      • Figure 1C: The relevance of this experiment needs to be better explained.*

      Response: We will rephrase the result section in the revised paper.

      • Figure 3A: What does SHG stand for?*

      Response: It is shown in line 625, M&M section. We will show the statement that SHG stands for second harmonic generation channel in the figure legend.

      • Figure 3: Please add a statistical analysis for these experiments.*

      Response: We will include P values in the revised paper.

      • Figure 4: The use of the caspase-3 and the calcium sensors may detect different cytotoxic mechanisms used by the NK cells. While caspase-3 can be activated by death receptor and perforin/granzyme B mediated killing, the calcium sensor may report mostly on perforin mediated membrane damage. These killing mechanisms have different kinetics and are differentially used during serial killing by NK cells. This should be addressed (at least in the discussion).*

      Response: We thank this invaluable comment. We will include this discussion.

      Reviewer #2 (Significance (Required)):

      Investigating the in vivo cytotoxicity of NK cells against tumor cells by using live imaging technologies is highly relevant for the understanding of the dynamic relationship between tumor and killer cells. Therefore, the subject of this manuscript and the technologies used are very relevant, as in vivo killing activities do not always translate to the in vivo setting.

      Response: We thank the reviewer for the favorable comment.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      \*Summary***

      Ichise et al., present a solid work describing the modality and time frame of action of NK control over seeding metastatic cells within the lung vasculature. Th authors use a variety of technique able to dissect how NK patrol lung vasculature, that they interact with cancer cells as they interact with the endothelial cells and they activate a ERK dependent activation leading to calcium influx in cancer cells leading to their death. The data support the notion that this NK control occur over an early time frame, 4h after cancer cells arrival and is mediated by Necl expression on cancer cells. After this time point cancer cells show a thrombin dependent loss of Necl expression on their surface and therefore become resistant to NK control.

      \*Comments:***

      The data presented are supporting the conclusions. This work utilizes a variety of elegant strategy combining reporter strategy with in vivo imaging to assess the phenomenon of interaction, ERK activation, Calcium Inflax and Apoptosis activation directly in the lung.

      In term of experiments, I found the work thorough and complete.

      The data a presented well overall and the statistics seems adequate.

      I only have few suggestions:

      Supplementary Figure S3, show the use of antiLy6G to deplete neutrophils in the lungs of C57BL/6 mice injected with melanoma B16F10 cells. It was recently shown that this antibody is not efficient in depleting neutrophils in this background, but only lead neutrophils to internalise the Ly6G so they cannot be detected by FACS. As shown in Boivin et al 2020 http://doi.org/10.1038/s41467-020-16596-9) neutrophils depletion in C57BL/6 mice can be achieved by using antiGr1 antibody. Therefore, if the authors aim to show this additional control, which I also agree is really good to have, I suggest performing the experiment accordingly to the best-known practice.

      Response: We will perform the suggested experiment.

      Figure 1E: in the text the experiment is described as 4T1 Akaluc cells were inoculated into the foot pad of BALB/c mice with either control antibody or αAGM1, but the legend states that mice subcutaneously injected with B16 Akaluc cells into footpad.

      As B16 melanoma cells are not in BALB/c background, I assume the legend needs to be corrected as the cells should be 4T1, however I wonder if injecting 4T1 breast cancer cells in the footpad could have let to the substantial growth required for lung metastasis without impairing the animal mobility. Could it be that cells where actually injected in the fat pad of the mice and this is just a misspelling in the text?

      In this case, the different in the tissue residence NK cells could also potentially explain why 4T1 are not cleared in the fat pad like the B6 cells are in the footpad.

      The authors should comment on the difference in the in clearance of the cells at the injection site in Figure 1C VS Figure 1E.

      Response: We apology the erratum in the legend.

      Figure 1C was performed to examine whether NK cells in the lung could be exhausted or inert 14 days after the inoculation of B16F10 cells. In this experiment, Akaluc-expressing B16F10 cells were inoculated to monitor the bioluminescence for 24 hrs.

      In figure 1E, we used Akaluc-expressing 4T1 breast cancer cells because 4T1 cells inoculated into footpad can be spontaneously metastasized to the lung (Kamioka et al., 2017). We observed the bioluminescence of 4T1 cells in the lung for up to 20 days.

      Ref: Kamioka, Y., Takakura, K., Sumiyama, K., and Matsuda, M. (2017). Intravital FRET imaging reveals osteopontin-mediated polymorphonuclear leukocyte activation by tumor cell emboli. Cancer Sci 108, 226-235.

      Reviewer #3 (Significance (Required)):

      The present work is highly relevant to the field of cancer metastasis. While it is known that NK are responsible for the first line of defence against metastatic seeding, most of the studies focuses on how they are suppressed or influenced by other immune cells. The present study provides a very accurate description of their mechanism of action, how they depend in the interaction with the endothelial cells and highlight the novel aspect of thrombin in inducing cancer cells NK resistance. What cause thrombin activation is the next relevant question, by in my opinion this study is complete and important.

      My field of expertise is cancer metastasis and their interaction with the immune system and I personally enjoy very much reading this work.

      Response: We thank the reviewer for favorable comments and appreciate the effort to evaluate our work.

    1. SciScore for 10.1101/2021.03.15.435440: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All experiments were conducted with institutional IACUC approval (MGH protocol 2014N000252).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Immunizations: All immunizations were performed using female C57BL/6 mice (Jackson Laboratory) aged 6-10 weeks.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">150 μL of HRP-conjugated rabbit anti-mouse IgG antibody, sourced commercially from Abcam (at a 1:20,000 dilution in PBS), was used for the secondary incubation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expi 293F cells (ThermoFisher) were used to express proteins.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293F</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transient transfection of 293T cells was used to generate lentiviral particles.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following incubation, 10,000 293T-ACE2 cells (37) in 20 μL of media containing 15 μg/mL polybrene was introduced to each well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunizations: All immunizations were performed using female C57BL/6 mice (Jackson Laboratory) aged 6-10 weeks.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gblocks were then cloned into pVRC and sequence confirmed via Genewiz.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Genewiz</div><div>suggested: (GENEWIZ, RRID:SCR_003177)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FlowJo (version 10) was used to analyze FCS files.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nonlinear regressions were fitted to the data using GraphPad Prism (version 9), allowing IC50 values to be calculated via the interpolated 50% inhibitory concentration.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.03.16.435594: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The animal experiments were approved by Peking University Laboratory Animal Center (Beijing), and undertaken in accordance with the National Institute of Health Guide for Care and Use of Laboratory Animals.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">For mouse vaccination, groups of 6-8 week-old female BLAB/c mice were intramuscularly immunized with LNP-circRNARBD (10 μg, N = 5; 50 μg, N = 5), or Placebo (empty LNP, N = 5) in 150 μL using a 1 mL sterile syringe, and 2 weeks later a second dose was immunized to boost the immune responses.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2-specific IgG antibody titer was measured by ELISA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2-specific IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then washed in stain buffer (PBS supplemented with 2.5% FBS) and suspended in Fc Block for 5 min at RT prior to staining with a surface stain of following antibodies: CD3 (Invitrogen, 45-0031-82)/CD4 (BD, 562285)/CD8 (BD, 553035)/CD69 (BD, 557392)/CD44 (BD, 563058)/CD62L (BD, 560507).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD3</div><div>suggested: (Abcam Cat# ab52305, RRID:AB_955118)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">circRNA transfection in vitro: For the circRNA transfection in HEK293T or NIH3T3 cells, 3×105 cells per well were seeded in 12-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NIH3T3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then the supernatant of HEK293T-hACE2 cells were removed and the mixer of serum and pseudovirus were added to each well. 36-48 hr later, the luciferase activity, which reflecting the degree of SARS-CoV-2 pseudovirus transfection, was measured using the Nano-Glo Luciferase Assay System (Promega).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, serum was diluted at 1:100 with 5 additional serial 5-fold dilution, and incubated with the same volume of pseudovirus with a TCID50 of 1.3×104 for 60 min at 37°C. 20,000 Huh-7 cells/well were cultured with mixture at 37°C for 24 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression of neutralizing nanobodies or ACE2 decoys by circular RNAs: HEK293T cells were transfected with circular RNA in transfection reagent.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse vaccination and serum collection: The BALB/c mice were ordered from Beijing Vital River Laboratory Animal Technology Co., Ltd.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For mouse vaccination, groups of 6-8 week-old female BLAB/c mice were intramuscularly immunized with LNP-circRNARBD (10 μg, N = 5; 50 μg, N = 5), or Placebo (empty LNP, N = 5) in 150 μL using a 1 mL sterile syringe, and 2 weeks later a second dose was immunized to boost the immune responses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The half-neutralization titer of serum (NT50) was determined using four-parameter nonlinear regression in Prism 8 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Relative luciferase units (RLU) were normalized to untreated groups, and analyzed by four-parameter nonlinear regression in Prism (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the neutralization assay of circRNAnAB or circRNAACE2 decoys, the HEK293T-hACE2 cells were seeded in 96-well plates (50,000 cells/well) and incubated for approximate 24 hr until reaching over 90% confluent.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>circRNAnAB</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis was performed using FlowJo software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 19. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.03.15.435528: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animal procedures were performed under the approvals of the Institutional Animal Care and Use Committee (IACUC) of University of Washington, Seattle, WA, and University of North Carolina, Chapel Hill, NC.<br>IRB: This study was approved by the University of Washington Human Subjects Division Institutional Review Board (STUDY00000959 and STUDY00003376).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">HEK293T/17 is a female human embryonic kidney cell line (ATCC).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Cell lines other than Expi293F were not tested for mycoplasma contamination nor authenticated.<br>Authentication: Cell lines other than Expi293F were not tested for mycoplasma contamination nor authenticated.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Convalescent human sera: Samples collected between 1–60 days post infection from individuals who tested positive for SARS-CoV-2 by PCR were profiled for anti-SARS-CoV-2 S antibody responses and those with anti-S Ab responses were maintained in the cohort 83.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the antibody incubations, the libraries were secondarily labeled with 1:100 FITC-conjugated anti-MYC antibody (Immunology Consultants Lab, CYMC-45F) to label for RBD expression and and 1:200 Alexa-647-conjugated goat anti-human-IgA+IgG+IgM (Jackson ImmunoResearch 109-605-064) to label for bound serum or plasma antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-MYC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human-IgA+IgG+IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed 4 × in TBST, then anti-mouse (Invitrogen), anti-NHP (AlphaDiagnostics), or anti-human (Invitrogen) horseradish peroxidase-conjugated antibodies were diluted 1:5,000 and 25 μL added to each well and incubated at 37°C for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-NHP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Competition ELISA of ---mouse sera and immobilized hACE2 or antibodies for SARS-CoV-2 S2P or SARS-CoV S2P: 384-well Maxisorp plates (Thermo Fisher) were coated overnight at room temperature with 3 µg/mL of hACE2-Fc, CR3022 (Yuan and Wu et al. 2020), or S309 (Pinto et al. 2020) in 20mM Tris pH 8 and 150mM NaCl.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were slapped dry and a 30-minute pre-incubated 1:5 serial dilution of mouse sera in TBST, with in initial dilution of 1:50 for hACE2-Fc competition or 1:10 for antibody competition, and a constant concentration of biotinylated (Avidity) SARS-CoV-2 S2P or SARS-CoV 2P at their EC50 values were added.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S2P</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Relative luciferase units were plotted and normalized in Prism (GraphPad) using as zero value cells alone or infected with supernatants of non-tranfected cells infected with VSV(G*ΔG-luciferase) VSV(G*ΔG-luciferase) in the presence of anti-VSV-G antibody and as 100% value cells infected with virus alone.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VSV(G*ΔG-luciferase) VSV(G*ΔG-luciferase</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-VSV-G</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: Expi293F cells are derived from the HEK293F cell line (Life Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293F</div><div>suggested: RRID:CVCL_D615)</div></div><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The HEK-ACE2 adherent cell line was obtained through BEI Resources, NIAID, NIH: Human Embryonic Kidney Cells (HEK293T) Expressing Human Angiotensin-Converting Enzyme 2, HEK293T-hACE2 Cell Line, NR-52511.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells in DMEM supplemented with 10% FBS, 1% PenStrep seeded in 10-cm dishes were transfected with the plasmid encoding for the corresponding S glycoprotein using lipofectamine 2000 (Life Technologies) following manufacturer’s indications.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus Neutralization: HEK-hACE2 cells were cultured in DMEM with 10% FBS (Hyclone) and 1% PenStrep with 8% CO2 in a 37°C incubator (ThermoFisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-hACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice: Female BALB/c mice (Stock # 000651, Balb/c cByJ mice) four weeks old were obtained from Jackson Laboratory, Bar Harbor, Maine, and maintained at the Comparative Medicine Facility at the University of Washington, Seattle, WA, accredited by the American Association for the Accreditation of Laboratory Animal Care International (AAALAC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Balb/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animals were housed and maintained at the New Iberia Research Center (NIRC) of the University of Louisiana at Lafayette, an AAALAC International accredited institution, in accordance with the rules and regulations of the Guide for the Care and Use of Laboratory Animal Resources.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NIRC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were immediately read at 450 nm on a BioTek plate reader and data plotted and fit in Prism (GraphPad) using nonlinear regression sigmoidal, 4PL, X is log(concentration) to determine EC50 values from curve fits.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04742738</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety and Immunogenicity Study of SARS-CoV-2 Nanoparticle V…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04750343</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety and Immunogenicity Study of SARS-CoV-2 Nanoparticle V…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.03.19.436166: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the local ethics committee of the Canton of Zurich, Switzerland (Kantonale Ethikkommission Zurich BASEC ID 2020 – 00646) and is registered at clinicaltrials.gov (ClinicalTrials.gov Identifier: NCT04410263).<br>Consent: The non-COVID-19 thrombus section was obtained from a patient with a general consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">purified anti-human CD95 (FAS) blocking antibody (10 μg/ml, clone A16086F, Biolegend) or respective DMSO and H2O control were added prior to incubation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human CD95</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, staining with anti-Fas-L BV421 (NOK-1) from Biolegend or anti-RIPK1 AF488 (Polyclonal) from Bioss Antibodies was carried out in Fix/Perm solution B for 30 min at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Fas-L</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-RIPK1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lactate dehydrogenase release measurement: Supernatants were incubated 1:2 with the substrate solution of the CytoTox 96® Non-Radioactive Cytotoxicity Assay (Promega) for 30 min in the dark in a 96-well plate (Greiner), after which the stop solution was added.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CytoTox</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were processed using ImageJ software (Schneider et al., 2012).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differences between two groups were calculated using either unpaired t-test, Mann-Whitney, paired t-test or Wilcoxon signed-rank test in Prism (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Correlation of clinical parameters was computed using non-parametric Spearman correlation in Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04410263</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Microbiota in COVID-19 Patients for Future Therapeutic and P…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.03.18.21253861: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">The A-DROP system is a 6-point scale (0–5) that assess the clinical severity of CAP according to the following parameters: (i) age (male ≥ 70 years, female ≥ 75 years), (ii) dehydration (blood urea nitrogen (BUN) ≥ 210 mg/L), (iii) respiratory failure (arterial oxygen saturation (SpO2) ≤ 90% or partial pressure of oxygen in arterial blood (PaO2) ≤ 60 mmHg), (iv) orientation disturbance (confusion), and (v) low blood pressure (systolic blood pressure (SBP) ≤ 90 mmHg) (Shindo et al., 2008).</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our study has several limitations. First, the study population was restricted to patients in hospitals that voluntarily participated in the QIP. Therefore, a selection bias cannot be excluded. Second, the diagnoses of the outpatient pneumonia cases recorded in files E and F were not classified as in form 1 and may not be sufficiently robust. However, files E and F contained the start date of diagnosis and date of visit and allowed us to extract the outpatient cases newly diagnosed with pneumonia. Therefore, the trend for the number of outpatient pneumonia cases was approximately assessed. Despite these limitations, our research provided important information on the impact of the COVID-19 epidemic on CAP inpatients using a large-scale Japanese database. Further studies are warranted to identify the long-term impact of the decrease of inpatient CAP cases on patient outcomes and health care systems. In conclusion, we showed a marked reduction of inpatient CAP cases during the COVID-19 epidemic in Japan using large-scale administrative data. The decrease in the year-over-year ratio of the number of inpatient cases was greater for the milder pneumonia cases.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.03.18.21253907: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: The study was approved by the respective IRBs and written, informed consent obtained from all participants or, when incapacitated, their legal guardian before enrollment and sample collection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Median age and range for UC cohort was 37 (32–46), and 30 individuals were males (60%).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alexa Fluor-647-conjugated goat anti-human IgG (H+L) Abs (Invitrogen) were used as secondary antibodies to detect plasma binding in flow cytometry experiments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry analysis of cell-surface staining: Using the standard calcium phosphate method, 10 μg of SARS-CoV-2 Spike expressor and 2 μg of a green fluorescent protein (GFP) expressor (pIRES-GFP) were transfected into 2 × 106 293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All samples were acquired on an LSRII cytometer (BD Biosciences) and data analysis was performed using FlowJo v10.0.7 (Tree Star).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.03.20.436163: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Participants provided written informed consent.<br>IRB: The study was reviewed by the Oxford Research Ethics Committee B (18/SC/0361).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">C57BL/6J male mice were purchased from Charles River and housed in individually ventilated cages under a 12/12 dark/light cycle with a ZT0 corresponding to 7am.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 1h, the cells were washed with PBS before medium containing a VSV-G antibody (I1, mouse hybridoma supernatant from CRL-2700, ATCC) and supernatants harvested after 24h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VSV-G</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>I1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Membranes were blocked in 5% milk in PBS/0.1% Tween-20, then incubated with anti-ACE2 (Abcam ab108252), anti-TMPRSS2 (SCBT sc-515727), anti-BMAL1 (Abcam Ab93806) or Anti-β-actin (Sigma A5441) primary antibodies and appropriate HRP-conjugated secondary antibodies (DAKO).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: (Abcam Cat# ab108252, RRID:AB_10864415)</div></div><div style="margin-bottom:8px"><div>anti-TMPRSS2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-BMAL1</div><div>suggested: (Abcam Cat# ab93806, RRID:AB_10675117)</div></div><div style="margin-bottom:8px"><div>Anti-β-actin</div><div>suggested: (Sigma-Aldrich Cat# A5441, RRID:AB_476744)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: Calu-3, Huh-7, HEK293T and VERO E6 cells were cultured in DMEM supplemented with 10% fetal bovine serum (FBS), 2mM L-glutamine, 100 U/mL penicillin and 10μg/mL streptomycin (all reagents from Life Technologies/Thermo Fisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 pseudoparticle genesis and infection: SARS-CoV-2 lentiviral pp were generated by transfecting HEK-293T cells with p8.91 (Gag-pol), pCSFW (luciferase reporter) and a codon optimised expression construct pcDNA3.1-SARS-CoV-2-Spike, as previously reported53.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The VSV*ΔG used for generating the pps was propagated in BHK-21 G43 cells stably expressing VSV-G.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21 G43</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral titres were determined by infecting Calu-3 cells and measuring cellular luciferase after 48h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, Vero E6 cells were inoculated with serial dilutions of SARS-CoV-2 stocks for 2h followed by addition of a semi-solid overlay consisting of 3% carboxymethyl cellulose (SIGMA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">C57BL/6J male mice were purchased from Charles River and housed in individually ventilated cages under a 12/12 dark/light cycle with a ZT0 corresponding to 7am.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Airway epithelial cells were taken using 2mm diameter cytology brushes from 3rd to 5th order bronchi and cultured in Airway Epithelial Cell medium (PromoCell, Heidelberg, Germany) in submerged culture.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PromoCell</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-β-actin-HRP conjugate (Abcam ab49900) and/or Coomassie brilliant blue staining was used to verify equal protein loading and densitometric analysis performed using ImageJ software (NIH).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Promoters (−1kb from TSS) of genes encoding SARS-CoV-2 host factors were analyzed with the HOMER (Hypergeometric Optimization of Motif EnRichment) tool for motif discovery (E-box motif CANNTG; RORE motif RGGTCA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HOMER</div><div>suggested: (HOMER, RRID:SCR_010881)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">P values were determined using Mann-Whitney testing (two group comparisons) or with a Kruskal–Wallis ANOVA (multi group comparisons) using PRISM version 9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PRISM</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.03.17.435802: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animal caretakers and pathology personnel were blinded for the treatment groups.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">In vivo hamster model: Syrian hamsters (Mesocricetus auratus) RjHan:AURA strain, male and females 4-10 weeks old, were individually caged in a human biosafety level 3 laboratory.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monocyte isolation was determined with the following flow cytometry antibody panel after 10 min incubation with anti-human CD32 (StemCell – 18520): APC anti-human CD14 (Biolegend – 301808), PE-Cy7 anti-human CD3 (Biolegend – 344186), AF488 anti-human CD20 (Biolegend – 302316) and live/dead Sytox Blue stain (Invitrogen – S34857).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human CD32</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human CD14</div><div>suggested: (BioLegend Cat# 348805, RRID:AB_2889063)</div></div><div style="margin-bottom:8px"><div>anti-human CD3</div><div>suggested: (BioLegend Cat# 348805, RRID:AB_2889063)</div></div><div style="margin-bottom:8px"><div>anti-human CD20</div><div>suggested: (BioLegend Cat# 302316, RRID:AB_493227)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following flow cytometry antibody panel was used to determine monocyte differentiation and M1 polarization after 10 min incubation with anti-human CD32: APC anti-human CD14 (Biolegend – 344186) BV421 anti-human CD80 (Biolegend – 305222), PE anti-human CCR7 (Biolegend 353204), APC/Fire750 anti-human CD209 (330116) and 7-AAD viability staining solution at 5 μl/1×106 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human CD32: APC anti-human CD14</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human</div><div>suggested: (BioLegend Cat# 305222, RRID:AB_2564407)</div></div><div style="margin-bottom:8px"><div>anti-human CD80</div><div>suggested: (BioLegend Cat# 305222, RRID:AB_2564407)</div></div><div style="margin-bottom:8px"><div>anti-human CCR7</div><div>suggested: (BioLegend Cat# 353204, RRID:AB_10913813)</div></div><div style="margin-bottom:8px"><div>APC/Fire750 anti-human CD209</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">REGN-COV2 antibody cocktail was generated as a 1:1 mix of REGN10933 and REGN10987.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REGN10987</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound Fc-tagged proteins were detected with anti-human HRP-conjugated secondary antibodies (Jackson ImmunoResearch – 109-035-088) at 1:3000 dilution in PBS 0.5% BSA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human HRP-conjugated secondary</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, after incubation with kit’s ViraBind™ reagents and virus inactivation, samples were incubated in microwell plates precoated with anti-p24 antibodies followed by a subsequent incubation with secondary FITC-conjugated anti-HIV p24 monoclonal antibody (1:1000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-p24</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-HIV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, well were exposed to HRP-conjugated anti- FITC monoclonal antibody (1:1000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti- FITC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody-virus mixtures were then cultured with 3 x 104 HEK-293T cells previously genetically engineered to express human ACE2 and TMPRSS2, in the presence of 8 μg/mL of polybrene, in 48-well plates with a final volume of 0.5 mL per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed with 0.05% v/v PBS-Tween and sequentially incubated with mouse anti-SARS-CoV-2 N protein antibody (The Native Antigen Company – MAB12183-100) at 1:500 dilution and HRP-conjugated goat anti-mouse IgG antibody (Jackson ImmunoResearch – 115-035-146) at 1:5000 dilution in 3% w/v milk in 0.05%PBS-Tween.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 N protein</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (DSHB Cat# LEP100 IgG, RRID:AB_528124)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sup-T1 (ATCC – CRL-1942), U937 (ATCC – CRL-1593.2) and K562 (ATCC – CCL-243) were cultured in Roswell Park Memorial Institute (RPMI) 1640 medium (Gibco – 21875034) supplemented with 10% Foetal Calf Serum (FCS, Biosera – FB 1001/500) and 2 mM GlutaMAX™ (Gibco – 35050061) at 37°C with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>U937</div><div>suggested: ATCC Cat# CRL-1593, RRID:CVCL_0007)</div></div><div style="margin-bottom:8px"><div>K562</div><div>suggested: ATCC Cat# CCL-243, RRID:CVCL_0004)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sup-T1 cells were γ-retrovirally transduced to express the S glycoprotein of SARS-CoV-2 Wuhan Hu-1 strain co-expressed with eBFP as a marker gene.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sup-T1</div><div>suggested: BCRC Cat# 60191, RRID:CVCL_1714)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Supernatant from transfected CHO cells was purified using 1 ml HiTrap MabSelect PrismA (GE Healthcare – 17549851) affinity chromatography with in-line dialysis in PBS via HiTrap 5 ml desalting columns (GE Healthcare – 29048684) using an Akta™ Pure system (GE Healthcare), following manufacturer’s recommendations.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding capacity of ACE2(HH:NN) Fc, LALA Fc and LALA-PG Fc to SupT1 expressing wild-type SARS-CoV-2 full length spike was assessed via incubation of test protein at 45.6 nM with 2-fold serial dilutions for 30 mins at RT, followed by secondary incubation with anti-Human IgG (H+L) AF647 (Invitrogen – A21445) for 20 mins at RT in the dark.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SupT1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody-virus mixtures were then cultured with 3 x 104 HEK-293T cells previously genetically engineered to express human ACE2 and TMPRSS2, in the presence of 8 μg/mL of polybrene, in 48-well plates with a final volume of 0.5 mL per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 virus neutralisation assay: Vero cells (ATC-CCL81) cultured in Dulbecco’s MEM (Sigma, Cat. No. D6546) with 10% FCS and 2 mM L-Glutamine (Sigma, Cat No. G7513) and 1% penicillin/streptomycin (Invitrogen cat no. 15140148) were seeded the day prior to infection at 2 x104 cells per well in 96-well flat bottom plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: ATCC Cat# CCL-81, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293 cells were used for reverse transfection and expression.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysed with GraphPad Prism 8 (GraphPad software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Stained samples were acquired using a MacsQuant10 instrument (Miltenyi Biotec) and analyzed on FlowJo software (BD).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysed with Graph Prism 8 (GraphPad software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graph Prism</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Hit detected by fluorescent secondary antibody using ImageQuant software (GE Healthcare).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageQuant</div><div>suggested: (ImageQuant, RRID:SCR_014246)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.05.21.108381: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">First, thermally lysed patient sample and RT-LAMP reagents are injected through the female luer lock connectors from two separate syringes without the use of microfluidic pumps.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Finally, 0.47U/μL BST 2.0 WarmStart DNA Polymerase (New England Bioloabs), 0.3 U/μL</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>New England Bioloabs</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Off Chip amplification data analysis: The off-chip RT-LAMP fluorescence curves and amplification threshold bar graphs were analyzed using a MATLAB script and plotted using GraphPad Prism 7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Chip Image and data analysis: Fluorescence images were recorded with IP Webcam in smartphones and were saved in JPG format from which fluorescence intensity and baseline fluorescence was analyzed on Image J.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Image J</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.04.16.044503: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Research was conducted under a project license from the Dutch competent authority (license number AVD1010020174312) and the study protocol was approved by the institutional Animal Welfare Body (Erasmus MC permit number 17-4312-02).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Influenza virus, SARS-CoV-2 and Aleutian Disease Virus seronegative 6 month-old female ferrets (Mustela putorius furo), weighing 700–1000 g, were obtained from a commercial breeder (TripleF (USA)).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serology: Sera were tested for SARS-CoV-2 antibodies using a receptor binding domain (RBD) enzyme-linked immunosorbent assay (ELISA) as described previously, with some modifications 31.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound antibodies were detected using horseradish peroxidase (HRP)-labelled goat anti-ferret IgG (Abcam) and 3,3',5,5'-Tetramethylbenzidine (TMB, Life Technologies) as a substrate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ferret IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Swabs were stored at −80 °C in transport medium (Minimum Essential Medium Eagle with Hank's BSS (Lonza), 5 g L−1 lactalbumine enzymatic hydrolysate, 10% glycerol (Sigma-Aldrich), 200 U ml−1 of penicillin, 200 mg ml−1 of streptomycin, 100 U ml−1 of polymyxin B sulfate (Sigma-Aldrich), and 250 mg ml−1 of gentamicin (Life Technologies)) for end-point titration in VeroE6 cells as described below.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.05.28.121533: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 2 h incubation at RT, plates were washed 5 times with washing buffer and incubated with goat-anti-human IgG or goat-anti-human IgG(H+L) secondary antibody conjugated to horseradish peroxidase (HRP) (SouthernBiotech) in blocking buffer at a 1:4000 or 1:2000 dilution, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>goat-anti-human IgG(H+L</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For SARS-CoV-2, MERS-CoV, HCoV-NL63 and HCoV-OC43 mutations to remove the S1/S2 furin cleavage site were introduced.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-NL63</div><div>suggested: RRID:CVCL_RW88)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation with 293TACE2 cells for 48 hours at 37°C, cells were washed twice with PBS, lysed with Luciferase Cell Culture Lysis 5x reagent (Promega), and NanoLuc Luciferase activity in lysates was measured using the Nano-Glo Luciferase Assay System (Promega)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293TACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic trees: Sequence alignments of S proteins and RBD/S1B domains were made with Clustal Omega (Sievers et al., 2011).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Clustal Omega</div><div>suggested: (Clustal Omega, RRID:SCR_001591)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic trees were calculated from these amino acid alignments using PhyML 3.0 (Guindon et al., 2010) and visualized with PRESTO (http://www.atgc-montpellier.fr/presto).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PhyML</div><div>suggested: (PhyML, RRID:SCR_014629)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The developing reaction was quenched by addition of 100µl 1N HCl and absorbance was measured at 450nm using Gen5 software on a Synergy Neo2 Reader (BioTek)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gen5</div><div>suggested: (Gen5, RRID:SCR_017317)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Half-maximal inhibitory concentrations (IC50 values) for purified plasma IgGs and Fabs were determined as molar concentrations (to account for the IgG versus Fab difference in molecular weight) using 4-parameter nonlinear regression (Prism, GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Grids were imaged at 300 keV using a Titan Krios transmission electron microscope (Thermo Fisher) operating at RT, equipped with a K3 direct electron detector (Gatan) using SerialEM 3.7? (Mastronarde, 2005).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Extracted particles were used to generate ab initio models in cryoSPARC that were further processed by 3D classification to separate out complexes and S trimer structures alone.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The C105 Fab coordinates were refined using Phenix (Adams et al., 2010) and cycles of manual building in Coot (Emsley et al., 2010) (Table S1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phenix</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.05.05.078154: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: IRCCS – Lazzaro Spallanzani Rome (IT) and Azienda Ospedaliera Universitaria Senese, Siena (IT) that provided samples from SARS-CoV-2 convalescent donors who gave their written consent.<br>IRB: The study was approved by local ethics committees (Parere 18_2020 in Rome and Parere 17065 in Siena) and conducted according to good clinical practice in accordance with the declaration of Helsinki (European Council 2001, US Code of Federal Regulations, ICH 1997).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">This study was unblinded and not randomized.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blood samples were screened for SARS-CoV-2 RNA and for antibodies against HIV, HBV and HCV.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibodies against HIV</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HCV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA assay with S1 and S2 subunits of SARS-CoV-2 S-protein: The presence of S1- and S2-binding antibodies in culture supernatants of monoclonal S-protein-specific memory B cells was assessed by means of an ELISA assay implemented with the use of a commercial kit (ELISA Starter Accessory Kit, Catalogue No. E101; Bethyl Laboratories, Montgomery, TX, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S2-binding</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After an incubation of 1 h at 37°C, plates were washed and incubated with 25 μl/well secondary antibody (horseradish peroxidase (HRP)-conjugated goat anti-human IgG-Fc Fragment polyclonal antibody, diluted 1:10,000 in blocking buffer, Catalogue No. A80-104P; (Bethyl Laboratories, Montgomery, TX, USA) for 1 h at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG-Fc</div><div>suggested: (Bethyl Cat# A80-104P, RRID:AB_67064)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">25 μL/well of alkaline phosphatase-conjugated goat anti-human IgG (Sigma-Aldrich) and IgA (Jackson Immuno Research) were used as secondary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>alkaline phosphatase-conjugated goat anti-human IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-055-190, RRID:AB_2888997)</div></div><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PNPP (p-nitrophenyl phosphate) (Thermo Fisher) was used as soluble substrate to detect SARS-CoV-2 S-protein specific monoclonal antibodies and the final reaction was measured by using the Varioskan Lux Reader (Thermo Fisher Scientific) at a wavelength of 405 nm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>( p-nitrophenyl phosphate )</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>p-nitrophenyl phosphate </div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For virus propagation, sub-confluent Vero E6 cell monolayers were prepared in T175 flasks (Sarstedt) containing supplemented D-MEM high glucose medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The protein was purified from filtered cell supernatants using NiNTA resin (GE Healtcare #11-0004-58)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GE Healtcare</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed using the FlowJo data analysis software package (TreeStar, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.05.13.094490: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For testing patient serum, a dilution series of RBD-scFv was performed to test for optimal levels of protein to induce agglutination in presence of patient anti-RBD antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(hyperactive piggyBac transposase) were co-transfected using Lipofectamine 3000 into HEK 293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One prep of 800 μL supernatant through one column of the kit yielded 102 μg/mL of RBD-scFv measured by NanoDrop™ 2000/2000c Spectrophotometers (ThermoFisher), which was used in subsequent experiments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NanoDrop™</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ThermoFisher</div><div>suggested: (ThermoFisher; SL 8; Centrifuge, RRID:SCR_020809)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A key limitation of this assay is that it does not distinguish between IgG, IgA, or IgM against SARS-CoV-2, which may be desired in certain clinical scenarios. IgG subclasses can similarly not be distinguished. Also, the assay is highly dependent on the viral antigen deployed, such that clinicians should be aware if RBD antibody levels are negative, the patient could have still had COVID19. While the assay is simple and can be read with the naked eye, there is more subjectivity to it compared to interpreting lines on lateral flow assays or light detection in chemiluminescent ELISA’s. Depending on mixing technique and provider comfort, there could be variability, likely necessitating training and/or deployment of controls in order to ensure proper reading of the assay. A negative control test without fusion protein will be important to include during clinical implementation for patients with positive tests, given that rare patients may have IgM autoantibodies causing agglutination.31 Given the similarities of this test to currently used ABO typing32 and Monospot assays for EBV antibodies,33 we ultimately do not see this being a significant barrier. Lastly, the fusion protein stability is unknown, which is important for use in low-resource countries. Past studies with similar fusion proteins for hemagglutination assays found stability at least 30 days at 37°C and 6 months at 4°C with no loss of assay agglutination activity.14 Ultimately, similar investigations will be important...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.04.17.042366: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The slopes and intercepts of the linear regression lines were tested for statistical significance using Analysis of Covariance (ANCOVA) (GraphPad Prism 6).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      One caveat however for fast DIRECT-PCR of samples with low viral load is that of sampling error, since only 1 μL of sample is used. Nucleic acid extractions, on the other hand, serve to concentrate RNA from typical sample volumes of 150-300 μL, although their yield can also be low and variable. Hence, where samples are expected to have low counts near to the limit of detection, DIRECT-PCR with larger volume reactions (25 μL) to include higher template volume may be necessary to reduce risk of false negatives. Reduction in amplification efficiency is a common concern in DIRECT-PCR from crude samples (e.g. respiratory samples, blood and serum). The presence of PCR inhibitors can decrease the sensitivity and accuracy of pathogen detection through interfering with polymerase activity, degradation of nucleic acids and efficient cell lysis (23). A variety of methods have been developed to overcome such inhibition, including inhibitor tolerant polymerases, additives and buffer modification. In our study, we used one commercially available formulation that tolerated PCR inhibition in sputum and nasal exudates as well as blood/serum/urine (data not shown), and it is not unlikely that other formulations could be used as well in our study. While amplification directly from sputum and nasal exudate reduced the efficiency of PCR compared to water controls, there was no net effect on the threshold of detection. Nasopharyngeal swabs and sputum have been suggested to be effective clinical sa...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.04.30.071290: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The animal study protocol has been approved by the Animal Ethics Committee of School of Basic Medical Sciences, Fudan University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">After a 4-hour co-cultivation period, five fields were randomly selected in each well and the number of fused and unfused cells in each field were counted directly under an inverted fluorescence microscope, based on much larger cell size of fused cells.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Transduction and infection of mice: Eight-week-old male mice (BALB/c) (SLAC Laboratory Animal, Shanghai, China) were raised in pathogen-free cages in the BSL-3 laboratory of Fudan University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunofluorescence analysis: To detect the viral nucleocapsid protein (N protein), anti-N polyclonal antibodies were generated using standard immunization of BALB/c mice with recombinant N protein derived from E. coli.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>viral nucleocapsid protein ( N protein)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero-E6 cells grown in 96-well plate were fixed in 4% paraformaldehyde, permeabilized by 0.2% Triton X-100 (Thermo Fisher Scientific, Waltham, USA), blocked with 3% BSA, and stained overnight with the anti-N antibody (1:1000 dilution) at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-N</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The samples were then incubated with Alexa Fluor donkey anti-mouse IgG 488-labeled secondary antibody (1:1000 dilution, Thermo Fisher Scientific) for 1 hour at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The wells were then washed with PBS and incubated with mouse anti-His antibody (1:1000 dilution, Abmart</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: (LSBio (LifeSpan Cat# LS-C129774-1000, RRID:AB_10832018)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, Berkeley Heights, USA) at 37°C for 1 hour, followed by incubation with Horseradish peroxidase (HRP)-conjugated goat anti-mouse antibody (Abmart) at 37°C for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HRP-goat anti-human Fc antibody (Abmart) was used for final signal detection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human Fc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The membranes were blocked with 3% bovine serum albumin (BSA) in PBST (PBS containing 0.05% Tween 20, pH7.0) and incubated with human ACE2 Rabbit Polyclonal antibody (1:100 dilution, Proteintech, Wuhan, China) followed by HRP-conjugated goat anti-rabbit IgG secondary antibody (1:5000 dilution, Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HRP-conjugated goat</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG secondary antibody ( 1:5000 dilution , Invitrogen)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To detect hACE2 expression, the sections were first incubated in blocking reagent and then with hACE2 Rabbit Polyclonal antibody (1:100 dilution, Proteintech) at 4 °C overnight, followed by incubation with HRP-conjugated goat anti-rabbit IgG secondary antibody (1:5000 dilution, Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For viral antigen detection, the sections were sequentially incubated with mouse polyclonal antibody to SARS-CoV-2 N protein (1:500 dilution) and HRP-conjugated goat anti-mouse IgG secondary antibody (1:5000 dilution, Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 N protein</div><div>suggested: (ABclonal Cat# A20021, RRID:AB_2862924)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell line, virus, compounds and constructs: African green monkey kidney Vero-E6 cells and human embryonic kidney HEK293T cells were cultured at 37°C with 5% CO2 in Dulbecco’s modified Eagle medium (DMEM) (Gibco, Carlsbad, USA) containing 2 mmol/L L-glutamine, 50 U/mL penicillin, 100 mg/mL streptomycin, and 10% (vol/vol</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, the plasmid pAd5-hACE2 was linearized with restriction enzyme PacI and used to transfect HEK293 cells as described previously30.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To evaluate the relationship between the timing of compound addition and the antiviral efficacy, Vero-E6 cells cultured in 96-well plate (4.0 x 104 cells/well) were treated with protoporphyrin IX (2.5 μM), verteporfin (1.25 μM) or DMSO at different timepoints relative to virus infection (Fig. 2a).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transduction and infection of mice: Eight-week-old male mice (BALB/c) (SLAC Laboratory Animal, Shanghai, China) were raised in pathogen-free cages in the BSL-3 laboratory of Fudan University.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pCAGGS-SARS-CoV-2-S that encodes the SARS-CoV-2 Spike gene was generated by GENEWIZ (Suzhou, China)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GENEWIZ</div><div>suggested: (GENEWIZ, RRID:SCR_003177)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Meanwhile, the structures of the compounds, protoporphyrin IX and verteporfin, were obtained from the EMBL-EBI and PubChem compound databases.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubChem</div><div>suggested: (PubChem, RRID:SCR_004284)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Firstly, the ligand and receptor coordinate files were prepared respectively to include the information needed by AutoDock and the PDBQT files were created.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AutoDock</div><div>suggested: (AutoDock, RRID:SCR_012746)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then the three-dimension of the grid box was set in AutoDockTools to create the grid parameter file.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AutoDockTools</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Afterwards, AutoGrid was used to generate the grid maps and AutoDock was run for receptor-ligand docking.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AutoGrid</div><div>suggested: (Autogrid, RRID:SCR_015982)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Data were analyzed using Prism 7 (GraphPad) and were presented as mean ± SEM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The dose response curves of viral RNA levels or cell viability versus the drug concentrations were plotted and evaluated by Prism 7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.07.09.196337: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As a primary antibody, either serum from a convalescent covid-19 Brazilian patient diluted 1:500 in PBS or a polyclonal rabbit antibody anti-SARS-CoV-2 nucleocapside protein (GeneTex) at 2 μg/mL in PBS were used to detect SARS-CoV-2 infection in Vero cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PBS or a polyclonal rabbit antibody anti-SARS-CoV-2 nucleocapside protein ( GeneTex ) at 2 μg/mL in PBS</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 nucleocapside protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As secondary antibodies, goat anti-human IgG labeled with FITC (Chemicon) or goat anti-rabbit IgG labeled with Alexa 488 (Thermo Scientific) was used diluted at 4 μg/mL in PBS and incubated for 30 min with 5 μg/mL 4’,6-Diamidine-2’-phenylindole dihydrochloride (DAPI, Sigma-Aldrich) in PBS to stain nuclei.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1×105 Vero CCL-81 cells were seeded on each well of a 24-well plate in DMEM High Glucose supplemented as described above at 37° C with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero CCL-81</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phenotypic screening assay: An amount of 2000 Vero E6 cells were seeded on each well of a 384-well assay plate (Greiner Bio-One) in 40 μL of DMEM High Glucose (Sigma-Aldrich) supplemented with 10% heat-inactivated Fetal Bovine Serum (Thermo Scientific), 100 U/mL of penicillin and 100 μg/mL of streptomycin (Thermo Scientific) at 37 °C, 5% CO2 for 24 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As a primary antibody, either serum from a convalescent covid-19 Brazilian patient diluted 1:500 in PBS or a polyclonal rabbit antibody anti-SARS-CoV-2 nucleocapside protein (GeneTex) at 2 μg/mL in PBS were used to detect SARS-CoV-2 infection in Vero cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These two parameters were used to calculate the concentration of EC50 and CC50, compounds concentrations that reduce the infection ratio, and cell survival in 50%, respectively, compared to non-treated infected controls of each compound using GraphPad Prism version 7.0 (GraphPad Software, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Functional and network analysis: Functional and network analysis was performed with Ingenuity Pathway Analysis (IPA, Qiagen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ingenuity Pathway Analysis</div><div>suggested: (Ingenuity Pathway Analysis, RRID:SCR_008653)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.07.08.194613: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">The fixative was removed, and monolayers washed three times with PBS before scraping cells into 1mL MEM/5% FBS and sonicated (3 × 10 second on,10 seconds off at 100% power and amplitude) using a UP200St with VialTweeter attachment (Hielscher Ultrasound Technology).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and virus: Vero E6 cells (Vero C1008; ATCC CRL-1586) were cultured in modified Eagle’s minimum essential medium (MEM) supplemented with 10% (v/v) fetal calf serum (FCS).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: ATCC Cat# CRL-1586, RRID:CVCL_0574)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For TCID50s, ten-fold dilutions of virus stock (25μL) were plated onto 96-well plates containing Vero E6 cell suspension (2.5 × 104 cells/well in 100μl</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Zymo Research); guanidine hydrochloride (GCHl) and guanidine thiocyanate (GITC) buffers containing Triton X-100 (both Oxoid/Thermo Fisher); Virus Transport and Preservation Medium Inactivated (BioComma)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioComma</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were performed using GraphPad Prism 8 (v8.4.1, GraphPad Software). 2.4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nucleic acid was extracted from cell culture media manually using a QIAamp Viral RNA Mini Kit (QIAGEN) or using NucliSENS easyMAG or EMAG platforms (both BioMérieux).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioMérieux</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.03.17.20036954: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics statement: This study was approved by the Medical Ethical Committee of Peking Union Medical College Hospital (approval number 002285), General Hosptical of Central Threater Command of the PLA (approval number 2020-003-1), and Shijiazhuang Fifth Hospital (approval number 2020-002).<br>Consent: Written informed consent from all the patients was obtained, and all records and information on the patients were anonymized.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Using a dispenser (XYZ3000; BioDot, Irvine, CA), rS1 and the secondary polyclonal antibody (2 mg/mL) were coated onto the nitrocellulose membrane as the test and control lines, respectively, at a dispensing rate of 1.0 μL/cm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>rS1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Positive recombinant plasmids (210 μg each) and liposomes (280 μL) were diluted in 7 mL of opti-MEM medium for 5 min, respectively, mixed for 30 min and H293 cells (1.2× 106 /mL) were added.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>H293</div><div>suggested: RRID:CVCL_H293)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.04.06.028902: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RNA was extracted from 700 μl of 2 ml of patient’s swab medium using Abbott mSample Preparation Systems DNA kit on m2000sp instrument; the eluate was 90 μl.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott mSample Preparation Systems</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RT-QPCR plates were automated: prepared on the Abbott m2000sp and routinely detected on m2000rt using the Altona RealStar® SARS-CoV-2 RT-PCR Kit RUO according to the manufacturer’s instruction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.11.292631: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: The original clinical studies to obtain blood samples after written informed consent were previously described6 and had been approved by the Ethics Board of ChongQing Medical University.<br>IRB: The original clinical studies to obtain blood samples after written informed consent were previously described6 and had been approved by the Ethics Board of ChongQing Medical University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibodies were isolated using flow sorting for isolation and cloning of single antigen-specific B cells and the antibody variable genes encoding monoclonal antibodies6.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibodies6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant antibody production and purification: For the construction of antibody expression Vectors, VH and VL 2nd PCR products were inserted separately into the linearized plasmids (pcDNA3.4) that encode constant regions of the heavy chains and light chains via a homologous recombination kit (Vazyme, C112).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C112</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence analysis of antigen-specific mAb: IMGT/V-QUEST (http://www.imgt.org/IMGT_vquest/vquest) and IgBLAST (https://www.ncbi.nlm.nih.gov/igblast/), MIXCR (https://mixcr.readthedocs.io/en/master/) and VDJtools (https://vdjtools-doc.readthedocs.io/en/master/overlap.html) tools were used to do the variable region analysis and annotation for each antibody clone.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific mAb: IMGT/V-QUEST (http://www.imgt.org/IMGT_vquest/vquest)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A CM5 chip (GE Healthcare) was linked with anti-human IgG-Fc antibody to capture about 9000 response units of the NAbs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG-Fc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 30 min incubation at 37 °C, the plates were washed 5 times and incubated with goat anti-human IgG (H+L) antibody conjugated with ALP (Thermo Fisher, a18808, 1:5000) for 30 min at 37 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Thermo Fisher Scientific Cat# A18808, RRID:AB_2535585)</div></div><div style="margin-bottom:8px"><div>a18808</div><div>suggested: (Thermo Fisher Scientific Cat# A18808, RRID:AB_2535585)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reacted mAbs were detected using ALP-conjugated Goat F(ab’)2 Anti-Human (IgG (Fab’)2) secondary antibody (Abcam, ab98532, 1:2000) for 30 min at RT, followed with quantification detection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>F(ab’)2 Anti-Human (IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ELISA plates were washed 4 times by Blocking Buffer and 50 μL Goat F(ab’)2 Anti-Human (IgG (Fab’)2) secondary antibody conjugated with ALP (Abcam, ab98532, 1:2000) was incubated with the plate at RT for 30 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Human</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The next days, the membranes were washed with TBST and incubated with HRP-conjugated Goat-anti-human Fc antibody (Abcam, ab99759, 1:10000) for 1 h at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ab99759</div><div>suggested: (Abcam Cat# ab99759, RRID:AB_10673762)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells were grown to 80% confluency before transfection with VSV-G pseudotyped ΔG-luciferase, pWPXL and pSPAX2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 72 hrs, the luciferase activities of infected HEK293T/ACE2 cells were detected by the Bright-Luciferase Reporter Assay System (Promega, E2650).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T/ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the incubation, the mixtures were then transferred into 96-well plates, which were seeded with Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence analysis of antigen-specific mAb: IMGT/V-QUEST (http://www.imgt.org/IMGT_vquest/vquest) and IgBLAST (https://www.ncbi.nlm.nih.gov/igblast/), MIXCR (https://mixcr.readthedocs.io/en/master/) and VDJtools (https://vdjtools-doc.readthedocs.io/en/master/overlap.html) tools were used to do the variable region analysis and annotation for each antibody clone.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgBLAST</div><div>suggested: (IgBLAST, RRID:SCR_002873)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The half-maximal inhibitory concentrations (IC50) of the evaluated mAbs were tested by the Varioskan LUX Microplate Spectrophotometer (Thermo Fisher), and calculated by a four-parameter logistic regression using GraphPad Prism 8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.20.300574: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">All wildtype and shRNA experiments in lung alveolosphere cells, as well as all CRISPR-engineered AA and GG experiments were conducted in NSB3113 (female, 18 years old, European descent) and NSB3188 (female, 14 years old, European descent) (Schrode et al., 2019).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentivirus generation: Third-generation VSV.G pseudotyped HIV-1 lentiviruses were produced by polyethylenimine (PEI, Polysciences #23966-2)-transfection of HEK293T cells and packaged with VSVG-coats using established methods.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 was propagated in Vero E6 cells in DMEM supplemented with 2% FBS, 4.5 g/L D-glucose, 4 mM L-glutamine, 10 mM Non-Essential Amino Acids, 1 mM Sodium Pyruvate and 10 mM HEPES.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reads were aligned to Mesocricetus auratus Ensembl MesAur1.0 using STAR aligner, and mappid using CustomDESeq2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_015899)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differential expression analysis was performed using edgeR (v3.26.8) (Robinson et al., 2010), limma (v3.40.6) (Ritchie et al., 2015) and Glimma (v1.12.0) (Su et al., 2017) packages.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>edgeR</div><div>suggested: (edgeR, RRID:SCR_012802)</div></div><div style="margin-bottom:8px"><div>limma</div><div>suggested: (LIMMA, RRID:SCR_010943)</div></div><div style="margin-bottom:8px"><div>Glimma</div><div>suggested: (Glimma, RRID:SCR_017389)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Enrichment analysis was performed using WebGestaltR (0.4.4) using custom neural gene sets of interest (Schrode et al., 2019) and interferon gene sets (Blanco-Melo et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>WebGestaltR</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.29.317289: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Adult female C. sonorensis (n=200) midges were allowed to feed on defibrinated sheep blood mixed 1:1 (v/v) with SARS-CoV-2 (2.0 x 106</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The W8a, CxTrR2, HSU, and C6/36 cells were maintained in CuVa medium, L-15 medium (with 10% tryptose phosphate broth) and Medium 199H, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C6/36</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Arthropod homogenates (100 μl) were added on to VeroE6 cells in 24 well plates and incubated at 37°C and 5% CO2 for 3 days.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.10.02.324046: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animal experiments: Mouse immunization studies were carried out in the animal housing facility of the Paul-Ehrlich-Institute, in compliance with the regulations of German animal protection laws and authorized by the responsible state authority (V54-19c20/15-F107/1058). 11-19 weeks old female BALB/c mice received one or two intramuscular injections of 1×106 ffu of either VSVΔG-minispike-eGFP (VSV G), or VSVΔG (VSV G) “empty” dissolved in 30 μl PBS, or an equal volume of PBS alone, four weeks apart (prime or prime/boost).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BHK-G43 cells (Hanika et al., 2005), kindly provided by Georg Herrler, and BSR-MG-on cells (Finke et al., 2003) were maintained in GMEM media containing 10% fetal bovine serum, 0,5% Pen/Strep, 1% MEMs/NEAAs and 19,5mL tryptose phosphate broth (Thermo Fisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-G43</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Microscopy: For live cell imaging, VeroE6 or HEK293T cells were seeded into poly-D-lysine (Millipore-Sigma)-coated multiwell plates one day prior to infection with VSV replicons at the indicated MOIs or plasmid transfection by lipofection, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus and serum dilutions were incubated at 37°C for 20 min before 50 μl of VeroE6 cells were added to each well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animal experiments: Mouse immunization studies were carried out in the animal housing facility of the Paul-Ehrlich-Institute, in compliance with the regulations of German animal protection laws and authorized by the responsible state authority (V54-19c20/15-F107/1058). 11-19 weeks old female BALB/c mice received one or two intramuscular injections of 1×106 ffu of either VSVΔG-minispike-eGFP (VSV G), or VSVΔG (VSV G) “empty” dissolved in 30 μl PBS, or an equal volume of PBS alone, four weeks apart (prime or prime/boost).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Construction of cDNAs: NCBI Reference Sequence NC_045512.2 of nCoV, Wuhan isolate 1, was used to synthesize human codon optimized cDNAs encoding full length HA-tagged spike (S-HA), and minispike (Thermo Fisher GeneArt).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Fisher GeneArt</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data representation and statistical analysis: Statistical analyses were performed using GraphPad Prism version 8.4.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.10.19.345363: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Influenza virus, SARS-CoV-2 and Aleutian Disease Virus seronegative 6 month-old female ferrets (Mustela putorius furo), weighing 640– 1215 g, were obtained from a commercial breeder (TripleF, USA).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound antibodies were detected using horseradish peroxidase (HRP)-labelled goat anti-ferret IgG (Abcam) and 3,3’,5,5’-Tetramethylbenzidine (TMB, Life Technologies) as a substrate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ferret IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MDCK cells were maintained in EMEM supplemented with 10% fetal bovine serum (Greiner), 100 IU ml-1 penicillin-100 µg ml-1 streptomycin mixture (Lonza), 200 mM L-glutamine (Lonza), 1.5 mg ml-1 sodium bicarbonate (Lonza), 10 mM Hepes (Lonza), and 1x nonessential amino acids (Lonza).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDCK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cells were maintained in Dulbecco’s Modified Eagle Medium (DMEM, Gibco or Lonza) supplemented with 10% fetal bovine serum (Greiner), 100 IU ml-1 penicillin-100 µg ml-1 streptomycin mixture (Lonza), 2 mM L-glutamine (Lonza), 1.5 mg ml-1 sodium bicarbonate (Lonza) and 10 mM Hepes (Lonza).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.16.300277: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All animal experimentation was reviewed and approved by Emory University’s Institutional Animal Care and Use Committee (IACUC) under permit PROTO202000035.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">The regularized log expression values were obtained using the rlog function with the parameters blind =FALSE and filtType = “parametric”.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The slides were cooled, rinsed twice in distilled water and 1X TBS with 0.05% Tween-20 (TBS-T), blocked (TBS-T + 0.25% casein) for 30 minutes at room temperature, then incubated at room temperature with antibodies against IL-6 (Sigma; Cat. No. SAB4301665 at 1:250 for 1 hour), Mx1 (EMD; Cat. No. MABF938 at 1:1000 for 1 hour), MPO (Dako; Cat. No. A0398 at 1:1000 for 1 hour), pSTAT3 (Cell Signaling; Cat. No. 9145L at 1:200 for 2 hours), Iba-1 (BioCare; Cat. No. CP290A at 1:500 for 1 hour) and pJAK2 (abcam; Cat. No. ab32101 1:150 for 1 hour)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IL-6</div><div>suggested: (Leinco Technologies Cat# I-150, RRID:AB_2830544)</div></div><div style="margin-bottom:8px"><div>Mx1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pSTAT3</div><div>suggested: (Fluidigm Cat# 3158005, RRID:AB_2661827)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunophenotyping was performed using anti-human monoclonal antibodies (mAbs), which we (Harper et al., 2020; McGary et al., 2017; Micci et al., 2015; Pino et al., 2019) and others, including databases maintained by the NHP Reagent Resource (MassBiologics), have shown as being cross-reactive in RMs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human monoclonal antibodies ( mAbs)</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero cells were cultured and maintained in MEM (Sigma) supplemented with 10% heat inactivated fetal bovine serum (FBS) (Gibco) and 1 mM L-glutamine (Gibco), 50 U/ml penicillin and 50 μg/ml streptomycin (Gibco).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 (NR-52281: BEI Resources, Manassas, VA; USA-WA/2020, Lot no. 70033175) was passaged on Vero E6 cells at a MOI of 0.01 to produce the infectious viral stock.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were collected and processed by Thermo Xcalibur 3.0 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Xcalibur</div><div>suggested: (Thermo Xcalibur, RRID:SCR_014593)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sections were incubated with Thyroid Transcription Factor-1 (Clone 8G7G3/1) for overnight at 4°C followed by a detection polymer system (MACH 2™; Biocare Medical)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MACH</div><div>suggested: (MACH, RRID:SCR_009621)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RNA quality was assessed using an Agilent Bioanalyzer and total RNA was used as input for cDNA synthesis using the Clontech SMART-Seq v4 Ultra Low Input RNA kit (Takara Bio) according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Agilent Bioanalyzer</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bulk RNA-Seq analysis: The quality of reads was evaluated using FastQC (https://www.bioinformatics.babraham.ac.uk/projects/fastqc/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FastQC</div><div>suggested: (FastQC, RRID:SCR_014583)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The combined genomic and gtf files were used for generating the STAR index.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_015899)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The VennDiagram R library was used to create the venn diagrams.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VennDiagram</div><div>suggested: (VennDiagram, RRID:SCR_002414)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GSEA 4.1.0 (https://www.gsea-msigdb.org/) was used for gene set enrichment analysis with the following gene sets: Hallmark and Canonical pathways (MsigDB), NHP ISGs (Sandler et al.) and Rheumatoid arthritis (KEGG map05323).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GSEA was run with default parameters with the permutation type set to gene_set.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GSEA</div><div>suggested: (SeqGSEA, RRID:SCR_005724)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The input for GSEA was the regularized log expression values obtained from DESeq2 which was filtered to remove genes with mean expression <=0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differential gene expression between the clusters was assessed by MAST (Finak et al., 2015).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAST</div><div>suggested: (MAST, RRID:SCR_016340)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Heatmaps, Dot plots and Violin plots were generated using ggplot2 (Wickham, 2016) package in R.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A panel of the following mAbs was used for the longitudinal phenotyping of innate immune cells in whole blood (500 μL), as described in (Kuri-Cervantes et al., 2020), and mononuclear cells (106 cells) derived from LN biopsies, BAL, and lung: anti-CD20-BB700 (clone 2H7; 2.5 μL; cat. # 745889), anti-Ki-67-BV480 (clone B56; 5 μL; cat. # 566109), anti-CD14-BV605 (clone M5E2; 2.5 μL; cat. # 564054), anti-CD56-BV711 (clone B159; 2.5 μL; cat. # 740781), anti-CD115-BV750 (clone 9-4D2-1E4; 2.5 μL; cat. # 747093), anti-CD3-BUV395 (clone SP34-2; 2.5 μL; cat. # 564117), anti-CD8-BUV496 (clone RPA-T8; 2.5 μL; cat. # 612942), anti-CD45-BUV563 (clone D058-1283; 2.5 μL; cat. # 741414), anti-CCR2-BUV661 (clone LS132.1D9; 2.5 μL; cat. # 750472), anti-CD16-UV737 (clone 3G8; 2.5 μL; cat. # 564434), anti-CD69-BUV805 (clone FN50; 2.5 μL; cat. # 748763), and Fixable Viability Stain 700 (2 μL; cat. # 564997) all from BD Biosciences; anti-CD38-FITC (clone AT1; 2.5 μL; cat. # 60131FI) from STEMCELL Technologies; anti-CD161-BV421 (clone HP-3G10; 5 μL; cat. # 339914), anti-HLA-DR-BV650 (clone L243; 5 μL; cat. # 307650), anti-CD11c-BV785 (clone 3.9; 5 μL; cat. # 301644), anti-CD11b-PE (clone ICRF44; 2.5 μL; cat. # 301306), and anti-CD123-APC-Fire750 (clone 315; 2.5 μL; cat. # 306042) all from Biolegend; anti-GranzymeB-PE-TexasRed (clone GB11; 2.5 μL; cat. # GRB17) from Thermo Fisher; anti-CD66abce-PE-Vio770 (clone TET2; 1 μL; cat. # 130-119-849) from Miltenyi Biotec; and anti-CD27-PE-Cy5 (clone 1A4CD27; 2.5 μL; cat. # 6607107) and anti-NKG2A-APC (clone Z199; 5 μL; cat. # A60797) from Beckman Coulter (Supplementary Fig. 4).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Biosciences</div><div>suggested: (BD Biosciences, RRID:SCR_013311)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Acquisition of data was performed on a FACSymphony A5 (BD Biosciences) driven by FACS DiVa software and analyzed with FlowJo (version 10.7; Becton, Dickinson, and Company).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used the Phenograph clustering approach (https://github.com/jacoblevine/PhenoGraph) Determination of intracellular cytokine induction following SARS-CoV-2 S peptide pool and PMA/Ionomycin stimulation: Cryo-preserved PBMCs were thawed, resuspended in RPMI medium supplemented to contain a final concentration of 10% Fetal Bovine Serum (FBS) (Corning Life Sciences/Media Tech Inc, Manassas, VA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phenograph</div><div>suggested: (Phenograph, RRID:SCR_016919)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Panel 1: anti-CD3 BUV395 (clone SP34-2; 2.5 μL; cat. # 564117), anti-CD8-BUV496 (clone RPA-T8; 2.5 μL; cat. # 612942), and Fixable Viability Stain 700 (2 μL; cat. # 564997) all from BD Bioscience; anti-CD4 APC/Cy7 (clone OKT4; 2.5 μL; cat. # 317418) from Biolegend; To detect intracellular expression of cytokines, mononuclear cells were fixed and permeabilized with a Cytofix/Cytoperm kit (BD Biosciences) and stained as follows: anti-IL-21 BV421 (clone 3A3-N2.1; 5 μL; cat# 564755) from BD Bioscience; anti-IL-2 BV650 (clone MQ1-17H12; 5 μL; cat# 500334) and anti-IFNγ PE/Dazzle 594 (clone B27; 5 μL; cat# 506530) both from Biolegend; anti-IL-17a Alexa Fluor 488 (clone eBio64DEC17; 5 μL; cat# 53-7179-42)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Bioscience</div><div>suggested: (BD Biosciences, RRID:SCR_013311)</div></div><div style="margin-bottom:8px"><div>Biolegend</div><div>suggested: (BioLegend, RRID:SCR_001134)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">anti-IL-22 APC (clone IL22JOP; 5 μL; cat# 17-7222-82), and anti-TNFα PE-Cyanine7 (clone Mab11; 0.5 μL; cat# 25-7349-82) all from Thermo Fisher Scientific; and anti-IL-4 PE (clone 7A3-3; 5 μL; cat# 130-091-647) from Miltenyl Biotech.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Fisher Scientific</div><div>suggested: (Thermo Fisher Scientific, RRID:SCR_008452)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses, unless otherwise noted, were performed with Prism version 8 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data tables for expression counts for bulk and single-cell RNA-Seq for BAL are deposited in NCBI’s Gene Expression Omnibus and are accessible through GEO accession #####</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene Expression Omnibus</div><div>suggested: (Gene Expression Omnibus (GEO, RRID:SCR_005012)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Being performed in an animal model, this study has some key advantages and some important limitations. Advantages include the ability to correct for parameters that may impact clinical outcome and treatment readout, including using the same virus inoculum, dose, and route of infection, and starting baricitinib at the same phase of infection in all subjects. Furthermore, the NHP model permits longitudinal collection of BAL and lung at necropsy, which in turn allows the in-depth characterization of the impact of baricitinib on immune activation and immunologic responses, including single-cell RNA sequencing analyses of macrophages, at the foci of infection. The main limitation of the study is the small group size, with a total of eight RMs; furthermore, being that SARS-CoV-2 infected RMs is a model of moderate COVID-19 (at least in animals between 11-17 years old as in our study) and with treatment initiated early after infection, we cannot determine if the therapeutic impact of baricitinib will be the same in severe COVID-19 patients and when started later than 2 days post-infection. Mitigating that concern, in our study, treatment started at peak viremia, including in BAL, and once inflammatory signatures were already highly up-regulated, mimicking the conditions in which baricitinib would be administered clinically. Indeed, a recent small clinical trial in 20 severe COVID-19 patients indicated that baricitinib mitigated immune dysregulation by reducing plasma levels of IL6, ...

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04401579</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Adaptive COVID-19 Treatment Trial 2 (ACTT-2)</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04421027</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Study of Baricitinib (LY3009104) in Participants With COVI…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.03.24.20042119: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the ethics committee of Wuhan Central Hospital.<br>Consent: As the study is a retrospective study and does not involve patients’ privacy, the informed consent can be exempted Data collection: Chronic comorbidities, demographic data, laboratory examinations, and chest CT scans were reviewed using electronic medical records.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Internal validation: Patients were randomly assigned in a 2:1 fashion to undergo training and hold-out test sets.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used the Statistical Package for the Social Sciences, version 22.0 (IBM Corp., Armonk, NY, USA) for statistical analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Statistical Package for the Social Sciences</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Importantly, our study has limitations. First, laboratory testing methods may not be the same in every hospital and the optimal cutoff point for the product value may vary. Further, only 377 patients were included in this study, where the product of N/L*CRP*D-dimer was found for the first time, so larger-scale data from randomized trials are needed to estimate whether to use this predictor in clinical practice.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.03.26.20044222: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the Ethics Committee of The Third People’s Hospital of Shenzhen (2020-115), which waived the requirement for written patient consent for this retrospective analysis.<br>Consent: All patients gave their oral consent to participate in this retrospective study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA assay for anti-SARS-CoV-2 IgG and IgM antibody: Microtiter plates (Sangon Biotech) were coated overnight at 4°C with 4 μg/mL recombinant SARS-CoV-2-RBD (Receptor binding domain) proteins (50 μL per well) expressed by our laboratory through 293-T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After three washes, 100 μL of horseradish peroxidase (HRP)-conjugated goat anti-human IgG (for IgG antibody titer detection) and IgM (for IgM antibody titer detection) antibodies solution (Sangon Biotech) were added to each plate, respectively, and incubated at 37°C for 60 minutes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG (for IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgM</div><div>suggested: (Nicholas M. Kanaan at Michigan State University Cat# TOC1, RRID:AB_2832939)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: A statistical analysis was performed using SPSS 26.0 (IBM, Chicago).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This study has several limitations. First, this study is a single-center retrospective study and the duration of follow-up is short, and more clinical observations are needed to evaluate the potential risk of SARS-CoV-2 recurrence and infection. Second, dynamics of SARS-CoV-2 RNA in COVID-19 patients need to be monitored and evaluated for RP patients. Second, additional studies should measure the dynamic changes of serum specific antibody levels in RP patients and evaluate the continuous protective effect of serum specific antibodies on patients with COVID-19. Finally, we should differentiate RP patients from relapse ones from convalescent subjects, for who two distinct prevention and control strategies will be adopted. Taken together, our findings revealed the clinical features of RP patients who did not show recurrence of clinical symptoms and abnormal laboratory tests. However, hyper-sensitive detection methods revealed the existence of SARS-CoV-2 RNA in RP patient specimens tested to be negative using the commercial kit. Therefore, it is necessary to develop a more accurate quantitative assessment of the RNA dynamics and additional discharge criteria to help physicians make a decision. This study provided valuable empirical information and clinical evidence support for effective management of COVID-19 patients during convalescent period. Further study should evaluate the potential clinical significance and transmission risk of RP patients.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.04.03.20051722: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the Institutional Ethics Board of Wuhan Union Hospital of Tongji Medical College, Huazhong University of Science and Technology (No. Union Hospital-0093).<br>Consent: Written informed consent was waived by the Ethics Commission of the designated hospital for the emerging infectious diseases.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">The threshold of Scr was 54-133 (μmol/L) for male and 44-106 (μmol/L) for female, BUN was 2.9-8.2 (mmol/L), serum uric acid was 208-428 (μmol/L) for male and 155-357 (μmol/L) for female, as well as Cystatin C was 0.63-1.25 (mg/L) for male and 0.54-1.15 (mg/L) for female.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were performed using SPSS 20.0 software, and P <0.05 was regarded as a significant difference.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.04.06.20055475: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Human samples: The 26 COVID-19 patients enrolled in the study were provided written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single-cell sorting by flow cytometry: For B cell enrichment, PBMCs were firstly stained with FITC-conjugated anti-CD19 antibody (Biolegend) on ice for 30 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD19</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PE-conjugated anti-CD20 antibody (Biolegend),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD20</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">APC-Cy7-conjugated anti-CD3 antibody (Biolegend),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">anti-CD14 antibody (Biolegend),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD14</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">anti-CD56 antibody (Biolegend) and APC-Cy7-conjugated LIVE/DEAD dye (Life Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD56</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing with PBST, the bound antibodies were incubated with anti-human IgG HRP detection antibody (Bioss Biotech) for 30 min, followed by washed with PBST, then PBS and addition of TMB (Beyotime).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, the incubated mixtures were added to ELISA plates and allowed to develop for 30 min, followed by PBST washing and anti-mouse Fc HRP antibody (Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse Fc HRP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The digested heavy and light chain genes were further cloned into human IgG1 heavy chain and light chain expression vectors, respectively. Transfection: Human embryonic kidney (HEK) 293T cells of 80-90% confluent in the 15 cm tissue culture plate were transfected with master mixture containing 9 μg heavy chain plasmid, 9 μg light chain plasmid and 60 μl</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, the mixtures were incubated with 10,000 hACE2-plasmid transiently transfected 293T cells for 40 min on ice, followed by stained with Alexa Fluor 647-conjugated goat anti-mouse IgG (Biolegend) and APC-Cy7-conjugated LIVE/DEAD dye (Life Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Concisely, HEK-293T cells were transfected with psPAX2, pLenti-GFP and 2019-nCov S plasmids by using TransIT-293 Transfection reagent (Mirus).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">At 40 hours-post incubation, the luciferase activity of infected hACE2/293T cells were detected by Dual-Luciferase Reporter Assay System (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>hACE2/293T</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.04.10.20060699: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Statistical analysis: An inverse probability of treatment weighting (IPTW) approach was used to “emulate” randomisation and balance the differences in baseline variables between treatment groups.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Although this may appear to be a limitation, we used robust clinical outcomes here, i.e., death and ICU admission, which are substantially more clinically relevant. COVID-19 pneumonia progression in the second week of illness is associated with a so-called “cytokine storm”,17,22 which is thought to be responsible for the clinical worsening of many patients. Most of the patients included in this study had an inflammatory syndrome defined by C-reactive-protein higher than 40 mg/l, which suggests that a cytokine storm syndrome had already begun.23 Drugs decreasing virus shedding may therefore be inadequate at this stage; this is why many anti-inflammatory drugs are currently being tested, such as tocilizumab, corticosteroids, and others. Despite the immunomodulatory properties of HCQ, which include regulation of the production of pro-inflammatory cytokines such as IL-2, IL-1, IL-6 and TNFα,24 and endosomal inhibition of toll-like receptors, which play a major role in innate immune response,25 this treatment showed no effectiveness in this specific population. Finally, HCQ blocks the KCNH2-encoded hERG/Kv11.1 potassium channel and can potentially prolong the QTc, with potential severe consequences such as sudden cardiac death and cardiac arrhythmia.26 Besides QTc prolongations, we observed 2 other significant cardiologic events in this study, and the French national drug agency has reported 3 deaths potentially related to HCQ since its promotion to the public as a potential treat...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.04.14.20064733: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Data extraction: Eight researchers (N Yang, X Luo, W Li, X Chen, Y Liu, M Ren, X Zhang and L Wang) were divided into four groups to extract the data and collect the following information for each study: basic information (title, first author, country or region of participants, date of publication/posting, journal, and study type), patient information (sample size, female/male ratio, adult/children ratio, age range, mean age), outcome information (primary outcome: sensitivity of chest CT imaging using reverse transcription polymerase chain reaction (RT-PCR) results as reference; other outcomes, including probability of bilateral or unilateral pneumonia, ground-glass opacities (GGO) and consolidation, number of lobes affected, location of lobe involvement, rounded morphology, linear opacities, crazy-paving pattern, air bronchogram, interlobular septum thickening, pleural thickening, halo sign, reverse halo sign, pleural effusion and lymphadenopathy).</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Search strategy: We searched Medline (via PubMed), Embase, Cochrane library, Web of Science, China Biology Medicine disc (CBM), China National Knowledge Infrastructure (CNKI) between 1 January 2020 and 31 March 2020, using terms with (“2019-novel coronavirus” OR “Novel CoV” OR “2019-nCoV” OR “2019-CoV” OR “Wuhan-Cov” OR “Wuhan Coronavirus” OR “Wuhan seafood market pneumonia virus” OR COVID-19 OR SARS-CoV-2 OR “novel coronavirus pneumonia”) AND</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Medline</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div><div style="margin-bottom:8px"><div>Embase</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div><div style="margin-bottom:8px"><div>Cochrane library</div><div>suggested: (Cochrane Library, RRID:SCR_013000)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We also searched Google Scholar and the preprint servers, including SSRN (https://www.ssrn.com/index.cfm/en/), medRxiv (https://www.medrxiv.org/) and bioRxiv (https://www.biorxiv.org/), as well as reference lists of the identified articles, to find additional studies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Google Scholar</div><div>suggested: (Google Scholar, RRID:SCR_008878)</div></div><div style="margin-bottom:8px"><div>bioRxiv</div><div>suggested: (bioRxiv, RRID:SCR_003933)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data synthesis: We performed a meta-analysis using STATA 15.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      However, this review also has some limitations: 1) though we conducted a systematic search, we only included articles published or posted in English and Chinese, which may introduce publication bias; 2) we only included case series and case reports, cases selection of included studies may introduce bias; 3) due to most of studies conducted in China, some cases may be overlapping between studies; and 4) there was large heterogeneity between included studies.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.04.14.20064535: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: All serum samples were collected under the approval of the intuitional review board (IRB) from Peking Union Medical College Hospital (Ethical number: ZS-2303) and Beijing Proteome Research Center.<br>Consent: Written informed consent was waived due to the rapid emergence of this infectious disease.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The array was then incubated for 30 min with a mixture containing Cy3 Affinipure donkey anti-human IgG(H+L) and Alexa Fluor 647 Affinipure goat anti-human IgM FC5µ antibody (Jackson ImmunoResearch, USA) (2μg/mL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG(H+L</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgM FC5µ</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differentially-expressed SARS-CoV-2 antibodies were identified using Mann Whitney U-test with a p-value of 0.05.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Differentially-expressed SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The circos plot was made using circos (http://circos.ca/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>circos</div><div>suggested: (Circos, RRID:SCR_011798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.04.16.20068411: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CK-MB, CRP and Goat anti Mouse IgG (H + L) (R-PE) specific antibodies and standards and were acquired from Fitzgerald Industries International (Acton, Massachusetts).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CK-MB , CRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse monoclonal anti-human antibodies for cTnI, (clone M18 and 560), CK-MB, MYO (clone 7C3),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human antibodies for cTnI ,</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">NT-proBNP (clone 15C4), CRP, and goat anti mouse IgG (H + L) (R-PE) antibodies were conjugated to beads sensors for target capture.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti mouse IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>R-PE </div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, NT-proBNP (clone 13G12), and CRP antibodies using Alexa Fluor 488 protein labeling kit (Invitrogen, Eugene, Oregon) for target detection using manufacturer specified protocols.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NT-proBNP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CRP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Control software and user interface was developed in MATLAB® 2014a (Natick, MA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB®</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image analysis: Images were analyzed using a custom image analysis tool developed with MATLAB as described previously.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      One limitation of this study was that all patients in the training dataset had hypertension and are, thus, at an elevated risk for cardiovascular events. Since the test panel contains several cardiac biomarkers, it’s possible that these training data could lead to overoptimistic results. However, in addition to cardiac biomarkers, the expanded biomarker panel represents diverse pathophysiology (i.e., indicators of infection, inflammation, mortality, thrombotic events, and rhabdomyolysis) which have the potential to significantly improve generalizability. Plans to evaluate and optimize the COVID-19 Severity Score model on external data are in place. Despite this limitation, the preliminary results demonstrate strong promise for the COVID-19 Severity Score. Reporting these preliminary findings now is critically important given the stage of the pandemic. Previously we have used the p-BNC platform to develop various wellness and disease severity scores for oral cancer18, 19, 32 and cardiac heart disease.22 Shown in Figure 5 is the initial rough scale for the COVID-19 Severity Score which was based on the CDC’s Interim Clinical Guidance for Management of Patients with Confirmed COVID-19.33 The continuous scale COVID-19 Severity Score has the potential to assist the identification of patients with severe/critical disease status. For example, most patients (∼80%) with a low COVID-19 Severity Score may be considered at Mild/Moderate risk for developing complications up to mild pneumo...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.04.22.20075671: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Patient Population: This study was approved by the Cedars-Sinai Institutional Review Board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">The Tisdale score consists of age ≥ 68 yrs, female sex, use of loop diuretics, potassium level ≤ 3.5 mEq/L, baseline QTc ≥ 450 ms, acute MI, number of QT prolonging medications, sepsis, and heart failure and has been developed as a risk score for QTc interval prolongation.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Of the PUI and confirmed COVID-19 cases, we only included patients who had at least two 12-lead electrocardiograms (ECGs) performed in our MUSE system between 1/1/2020 and 4/5/2020.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MUSE</div><div>suggested: (Muse, RRID:SCR_014418)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations: The variation in dosing patterns and duration of treatment for each medication are important to note as this can potentially influence when the ECG with the longest QTc may be observed. Due to inconsistency in obtaining daily ECGs during medication administration, we believe that the 12% of patients who experienced critical QTc prolongation was likely an under-estimation. Furthermore, variability in heart rates, especially in the setting of sepsis, can affect QT interval correction. We reported the QTc using Bazett’s correction, which is consistent with the majority of the published literature as well as ECG recording machines in typical use. The relatively small sample size does not allow for assessment of torsades des pointes risk with these agents.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.04.22.20075200: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Nonetheless, the need of a BSL3 laboratory facility to handle SARS-CoV-2 represents the main limitation of this experiment. 3.2. SARS-CoV-2 titers in wastewater and effluent water: A total of 42 influent, and 18 secondary and 12 tertiary treated effluent water samples were collected from 12 March to 14 April 2020 and investigated for the occurrence of SARS-CoV-2 RNA. Samples were considered positive for Ct below 40 (as in Medema et al., 2020 and F. Wu et al., 2020) and titrated by using the quantified plasmid control for each of the RT-qPCR targets. The 83.3% (35 positive samples out of 42) influent samples and the 11.1% (2 out of 18) secondary treated water samples were tested positive for at least one SARS-CoV-2 RT-qPCR target. None of the tertiary effluent samples (0 out of 12) tested positive for any of the SARS-CoV-2 RT-qPCR target (Figure 2). A relevant number of influent water samples (12%) showed Ct ranging between 37 and 40, even though lower Ct of 34-37 were observed (29%). In all samples, MgV recoveries were above 1% (10.05 ± 14.10%). On average, SARS-CoV-2 RNA titers of 5.15 ± 0.25, 5.53 ± 0.24, and 5.49 ± 0.27 log gc/L were quantified in wastewater by using N1, N2 and N3 primer/probe mixes, respectively. Titers of 4 and 5 to more than 6 log gc/L have been reported in Massachusetts and France, respectively (F. Wu et al., 2020; Wurtzer et al., 2020). A secondary effluent sample resulted positive for N2 and quantified as 5.40 log gc/L. An additional secondary efflue...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.05.02.20080879: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical approval for all sera used in this study was waived by the local ethics committee of the HUG that approves usage of leftover of patient serum collected for diagnostic purposes.<br>Consent: Serum samples from unmatched PCR-confirmed COVID-19 hospitalized patients were collected for routine diagnostic purposes under a general informed consent and outpatients were asked if they were willing to return to the hospital after their symptoms had subsided and to donate a serum sample under written general informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 3x washing with PBS-T, secondary goat anti-human-IgG antibody conjugated with Alexa488 (Jackson ImmunoResearch, #109-545-088) was diluted 1:200 in PBS and 25μl were applied to each spot.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human-IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, Vero B4 cells were transfected with the mammalian expression vector pCG1-SCoV2-S (kindly provided by M. Hoffmann and S. Pöhlmann, DPZ, Göttingen, Germany) using Fugene HD (Promega, #E2311).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero B4</div><div>suggested: CCLV Cat# CCLV-RIE 1146, RRID:CVCL_1912)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VSV-based pseudo-neutralization assay: VeroE6 cells were seeded in 96-well plates at 2 × 104 cells per well and grown into confluent monolayer overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GFP positive infected cells were counted with ImageXpress® Micro Widefield High Content Screening System (Molecular Devices) and data analyzed with MetaXpress 5.1.0.41 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MetaXpress</div><div>suggested: (MetaXpress, RRID:SCR_016654)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses: Analyses were performed with Graph Pad Prism version 8.3.1 software using Fisher’s bilateral exact test and Mann-Whitney U-test where appropriate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graph Pad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our analyses revealed the following limitations of the manufacturer’s seropositivity cut-off. First, with an inter-assay imprecision of 15% assessed at an IgG ratio of 2.09 (above than the 1.5 two cut-off value selected) translating into a LSC of 0.42 IgG ratio, our results indicate that the analytical imprecision is higher than the range of the indeterminate zone proposed by the manufacturer, which encompasses a delta of 0.3 IgG ratio. This implies that any result within the 0.8-1.1 IgG ratio range could be randomly either above, within or below these values just because of analytical imprecision. Secondly, with a LSC of 0.42 our results indicated that a higher IgG ratio cut-off value was needed to secure an optimal specificity and PPV. Adding the 0.42 LSC to the 1.1 cut-off yielded a 1.5 ratio as the IgG seropositivity cut-off with a PPV of 100%, the lower end of the 95%CI still being compatible with a 97% rule-in strategy. Notably, using this cut-off in the subgroup of patients under 21 dpos/dpd, the SP and PPV were still 100%, however, with broader confidence intervals. Similarly, in an attempt to maximize the negative predictive value at the rule-out cut-off, the cut-off had to be decreased from 0.8 to 0.5 IgG ratio in order to reach an overall NPV of 97%, with a 93% at the lower end of the 95CI. In the subgroup of patients under 21 dpos/dpd this interval was found to be substantially larger (95%CI: 45–91). Taken together, these results indicate that at this stage the op...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.05.04.20090043: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical approval was obtained from the University Research Ethics Committee, Universiti Brunei Darussalam (Ref: UBD/OAVCR/UREC/Apr2020-05).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were conducted using Microsoft Excel and R (ver. 3.6.3) (15).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This study has several limitations. First, as a retrospective study based on a contact tracing dataset, the index case determination or the direction of transmission may be uncertain, particularly as a substantial proportion of cases are asymptomatic. Moreover, without accounting for outside sources of infection, setting-specific SARs could have been overestimated (although no community transmission has been detected in Brunei). Viral sequencing can confirm homology between the strains infecting the index and secondary cases across the various settings, however this was not conducted for all cases. Second, we have not accounted for other potential environmental factors such as the relative size of the household, time spent at home with others, air ventilation, and indirect transmission through fomites. Third, we do not have information on NPIs practiced by the close contacts; presumably, individuals would take precautions during an outbreak. Fourth, symptom status of the cases was reported during their swab collection date. We assume this to be reflective of their actual condition when their close contacts were exposed, however, this may not be necessarily true for all cases. Finally, the generalizability of our results are limited due to no community transmission, a lack of cases in settings such as residential care facilities and dormitories, and small number of cases. The main strength of our study is the availability of a complete contact tracing dataset at the national l...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.05.11.20097741: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The project received approval from the Ethics Committee of canton Vaud, Switzerland (2020-00657) that waived the need for informed consent.<br>Consent: The project received approval from the Ethics Committee of canton Vaud, Switzerland (2020-00657) that waived the need for informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A quarter of patients for which there were no limitation of care eventually required MV. MV occurred early during the course of hospitalization and the median duration of MV was shorter than previously reported [18]. This effect could result from selection bias of patients with no limitations of care and the limited duration of follow-up. As infection with SARS-CoV-2 may cause an excessive host immune response, leading to ARDS and death [19]. We would expect biomarkers of inflammation to be associated with unfavourable outcomes. In this study, CRP >40 mg/L on admission was associated with higher odds of MV, suggesting that an unfavourable course is more frequent in patients with a severe inflammatory response related to the infection. Several studies have identified an increased risk of mortality in COVID-19 patients with elevated CRP [17,20]. Other biomarkers (for example, d-dimers) have also been identified as being associated with an increased risk of unfavourable outcome, but we did not identify this link in our study [6]. We believe that CRP is an ubiquitous biomarker whose result could potentially help clinicians assessing the risk of MV in patients with COVID-19. Its use could be easily scaled up due to the availability of numerous point-of-care test. In our study, we noted an increase in the risk of mechanical ventilation for increasing score values for NEWS, CRB-65 and qSOFA. qSOFA has been proven a useful predictor of mortality among patients with suspected infectio...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.05.10.20096958: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For this reason, based on the coordinates we used and the length of endogenous retroviral elements, we considered a length of 9000bp for HML-3, HML-5 and HML-6, 10000bp for HML-1, HML-2, HML-4 and HML-6, HERV-W, HERV-L, HERV-E, HERV-I and HERV-FRD, a length of 9000bp for HML-3, HML-5 and HML-6, 12000bp for HERV-9 and 17000bp for HERV-H for the calculation of -f for each virus, in order to increase the sensitivity of the detection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HML-4</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RNAseq data from BALF samples of healthy individuals were downloaded from Sequence Read Archive (SRA) with accession numbers: SRR10571724, SRR10571730, SRR10571732.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sequence Read Archive</div><div>suggested: (DDBJ Sequence Read Archive, RRID:SCR_001370)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bioinformatics Analysis: Bowtie2 with default settings for paired-end data was used for the alignment of these data to hg19 human genome assembly (25).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bowtie2</div><div>suggested: (Bowtie 2, RRID:SCR_016368)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samtools sort and index commands were used with default settings.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bedtools multicov command was used for the quantification of the expression of these genes with the -f option for the detection of reads that overlap with the genes coordinates by at least 80%, the same way as with the endogenous retroviral elements.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bedtools</div><div>suggested: (BEDTools, RRID:SCR_006646)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IBM SPSS Statistics for Windows, Version 23.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      One limitation of our study is the small number of samples; thus, our findings need to be replicated in more patients, but also need to be followed up by functional studies. Nevertheless, our findings might also (at least partially) provide a working hypothesis to explain the mechanism of action of Lopinavir/ritonavir which has been shown to inhibit the expression of at least one HERV family (HK2) (23). Interestingly, there is also evidence of the potential benefit of antiretroviral treatment against SARS-CoV-2 infection, as there is an ongoing phase 2b/3 Clinical Trial for the assessment of the effectiveness of leronlimab, a CCR5 antagonist, against COVID-19 (24). We find that multiple HERV families are upregulated in Bronchoalveolar Lavage Fluid (BALF), but not in PBMCs, in patients with COVID-19 compared to healthy individuals. Furthermore, we were able to identify upregulation in the expression of HERVs in senescence induced HBECs in comparison to non-induced cells, a fact that indicates the potential role of increased endogenous retroviral expression as a mediator of inflammatory reactions in older individuals that are at increased risk due to the disease. The findings merit further study regarding the potential involvement of HERVs in COVID-19. It thus seems feasible that should HERV expression be aetiologically linked to COVID-19 this expression could be a therapeutic target that to minimize the likelihood of severe Covid-19 and death. It remains to be seen if HERV exp...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.05.12.20098962: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical approval: This study was approved by the relevant institutional review boards (approved number 20-009).<br>Consent: We obtained written consent form all study participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, 100 μl HRP-labeled anti-IgG tracer antibody was added into the wells and then the samples were incubated for 30 minutes at room temperature (20-25 °C).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Wilcoxon rank sum tests or Kruskal-Wallis tests, as appropriate, were used to compare the titer of SARS-CoV-2 IgG antibody between groups.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: The data were analyzed using JMP version 14.0.0 (SAS institute Inc. Cary, NC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS institute</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      There are several limitations to this study. First, as this was a single-center study, selection bias might have affected our findings. Second, the small sample size restricted the statistical power of our analyses. Third, as our participants were recruited from departments where exposure to COVID-19 was more likely, the reported seroprevalence might be an overestimate relative to that of workers at other departments or the general population. Fourth, because the COVID-19 pandemic is an ongoing emerging situation, a significant proportion of available research might be premature; in our discussion, we have referred to such studies. In conclusion, we have shown relatively high frequency of positive and borderline SARS-CoV-2 antibody status in healthcare workers in the southern part of Kyoto city, an area frequented by tourists. Our results suggest that COVID-19 might have already been present in Kyoto at the early stage of pandemic. Several previous studies have evaluated SARS-CoV-2 antibody profiles in patients with COVID-19 (15-17); however, our study is the first to quantitatively evaluate antibody levels in healthcare workers involved with patients during the COVID-19 peri-pandemic period. Serial evaluation of SARS-CoV-2 IgG antibody will reveal risk factors associated with COID-19 susceptibility and mechanisms of disease spread. Finally, these results should be approached with caution, as there remains a lack of evidence regarding the role of antibodies present after reco...

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04327206</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">BCG Vaccination to Protect Healthcare Workers Against COVID-…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04362124</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Withdrawn</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Performance Evaluation of BCG Vaccination in Healthcare Pers…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.05.21.20109280: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibody (HRP conjugated: Goat anti-Human IgG (H+L) Cross-Adsorbed Secondary Antibody,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, Goat anti-Human IgM Cross-Adsorbed Secondary Antibody, Goat anti-Human IgA Cross-Adsorbed Secondary Antibody; ThermoFisher) was diluted at 1:4000 in blocking buffer and 100 μl of each antibody was then added to each well and incubated for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Human IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These samples were tested for the presence of SARS-CoV-2 antibody and were also run against a panel of spike proteins from four other beta-coronaviruses; MERS, SARS1, OC43 and HKU1 to establish seroprevalence estimates for these pre-pandemic coronaviruses in a current population.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein expression: Manufacturer’s protocols were followed for the transfection and culturing of Expi293 cells (Thermo Fisher Scientific, Waltham MA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04334954</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">SARS-COV2 Pandemic Serosurvey and Blood Sampling</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT01386424</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Screening for LID Clinical Studies Unit Healthy Volunteer Pr…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.05.20.20108399: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study Selection: Studies were considered eligible for inclusion if they 1) were designed as a randomized controlled trial, case-control study, or cohort study and 2) assessed the relationship between ACEI/ARB use and the level of inflammation, disease severity, and mortality in patients with COVID-19.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Literature Search: Two authors (L X. and Y.L) independently searched the PubMed and Embase databases for published articles and the preprint platforms medRxiv (https://www.medrxiv.org/) and bioRxiv (https://www.biorxiv.org/) (since many studies are available on these websites prior to publication, which allows for collection of the latest data) without language restrictions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div><div style="margin-bottom:8px"><div>Embase</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div><div style="margin-bottom:8px"><div>bioRxiv</div><div>suggested: (bioRxiv, RRID:SCR_003933)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analyses: RevMan5.3 (Review Manager [RevMan]</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RevMan</div><div>suggested: (RevMan, RRID:SCR_003581)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">], version 5.3, Cochrane Collaboration) software was used for statistical data processing, and the OR and 95% CIs were used to estimate the effect.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cochrane Collaboration</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Study Limitations: Our research has several limitations. First, all of the included articles were observational and therefore cannot confirm the cause-and-effect relationship between ACEI/ARB therapy and the clinical prognosis of patients with COVID-19; a large-scale RCT is needed to confirm our results. Second, coexisting conditions such as hypertension have been shown a key prognostic determinant (e.g. severity and mortality) in patients with COVID-19. The guidelines recommend that patients with hypertension and COVID-19 continue their ACEI/ARB therapy, and our study reinforced this recommendation and further showed that the use of ACEI/ARB therapy might be associated with better clinical outcomes in the general population with COVID-19 and in hypertensive patients with COVID-19. However, the benefit of RAAS inhibitors in non-hypertensive patients might differ from those with hypertensive patients. Due to data limitations, we cannot analyze the severity and clinical prognosis of ACEI/ARB therapy in patients with COVID-19 without hypertension. Third, studies have shown that ACEIs and ARBs may play different roles in patients with COVID-19, due to limited data, we were unable to perform subgroup analyses of ACEIs and ARBs. Fourth, some characteristic clinical values (e.g., drug variables) were missing. For example, the specific details of RAAS inhibitors were lacking in all studies, which might have impact on our results. Fifth, considering that all of the included studies we...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.05.19.20107094: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Whilst we believe our work is the most comprehensive of its kind to date in Brazil, there are a number of limitations which are worthy of discussion. Limitations and possible biases in case ascertainment cannot be ruled out, in common with all observational / database research. Ethnicity is missing in 39% of our data. This is not specific to COVID-19 (32% for the full SIVEP-Gripe dataset) but we cannot be sure that this is not subject to bias. We have limited our analysis to patients who were hospitalised since testing in the community is more likely to be biased according to local factors. However, again here, we cannot be sure that the availability of testing practice is homogeneous even in this population. Indeed, the fact that a large fraction of patients that have tested positive are admitted to the hospital clearly shows that testing, at least as far as this dataset is concerned, is performed only when symptoms are severe, indicating in turn that the number of COVID-19 cases in Brazil is likely to be much higher than suggested by available data.2829 It is possible that health-seeking behaviour varies with both ethnicity and region and late presentation may be an important determinant of ultimate hospital outcome. We are not able to consider this in our analysis as physiological severity at hospital presentation / admission data is not available in the SIVEP-Gripe dataset. However, a recent UK study did not demonstrate an important effect of physiological severity16 at l...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.05.27.20114652: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Patient Samples: All serum samples were obtained via antecubital venipuncture and collected into BD Vacutainer serum collection tubes in using protocols approved by the UCSF Institutional Review Board and in accordance with the Declaration of Helsinki.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were again washed, and antibodies bound to the coated antigens detected using 20 μL of anti-human Fab (Jackson ImmunoResearch Laboratories 109-036-097, [1:5000]), anti-human IgM (Sigma-Aldrich A6907, [1:3000]), anti-human IgG (Sigma-Aldrich A0170, [1:3000]), or Protein L (Thermo Fisher Scientific 32420, [1:5000]) as indicated for 30 minutes at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human Fab</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgM</div><div>suggested: (Sigma-Aldrich Cat# A6907, RRID:AB_258318)</div></div><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Sigma-Aldrich Cat# A0170, RRID:AB_257868)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All graphing and statistical analysis was performed in GraphPad Prism (Version 8.4.2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.05.31.20118588: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral stocks of SARS-COV-2 were obtained from the Biodefense and Emerging Infections Research Resources Repository and were propagated in Vero-E6 cells grown in Dulbecco’s Modified Eagle Medium (DMEM) without phenol red, with 2% Fetal Bovine Serum (FBS), L-glutamine, penicillin/streptomycin, non-essential amino acids, and hydroxyethyl piperazineethanesulfonic acid (HEPES).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(6) However, an absence of CPE in the Vero E6 cells at 4 days post inoculation indicates a loss of infectivity and is evidence of inactivation of the SARS-CoV-2 samples (Figure 1B).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations of the study include that no soiling agents were used. However, at Henry Ford Health System, as in other healthcare facilities, personnel are instructed not to reuse respirators that are visibly soiled. Further, it is still unclear what the infectious dose is for SARS-CoV-2; therefore, it is unknown if a significant reduction in viral load eliminates contagious risk. In conclusion, UVC at a dose of 1.5 J/cm2 applied to both sides is effective at decontaminating SARS-CoV-2 on some N95 respirators. This dose may only be an appropriate decontamination method to facilitate reuse of PPE for healthcare personnel when applied to certain models/materials. In addition, some straps may require additional disinfection to maximize the safety to the frontline workers. Implementation of widespread UVC decontamination methods requires a careful consideration of model, material type, design, and fit-testing following irradiation. It should also be emphasized that similar cautions should be practiced for all other methods of respirator decontamination.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.06.12.20128736: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was reviewed and approved by BIDMC’s institutional review board (IRB protocol no. 2020P000451).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">We used bootstrapping to test whether the n results for a given arm exhibited appreciable differences from others, specifically by testing whether a given arm differed from random samples from (i) results pooled across the three arms that used the same nasal-swab sampling procedure or (ii) all results.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transport conditions and swabs used: Standard nasal swabs were compared under three different specimen-transport conditions: (i) a guanidine thiocyanate (GITC) transport buffer, part of the Abbott multi-Collect Specimen Collection Kit, catalog no. 09K12-004; Abbott Laboratories, Abbott Park, IL), (ii) dry, with no buffer; and (iii) in modified CDC viral transport media (VTM) (Hank’s balanced salt solution containing 2% heat inactivated FBS, 100µg/mL gentamicin, 0.5µg/mL fungizone, and 10mg/L Phenol red, produced by the Beth Israel Deaconess Medical Center [BIDMC</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott Laboratories</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Dry swabs were eluted in 2mL of Abbott mWash1</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used Python (v3.6-3.8) and its NumPy, SciPy, Matplotlib, Pandas, and ct2vl libraries for the above analyses and related visualizations.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div><div style="margin-bottom:8px"><div>NumPy</div><div>suggested: (NumPy, RRID:SCR_008633)</div></div><div style="margin-bottom:8px"><div>SciPy</div><div>suggested: (SciPy, RRID:SCR_008058)</div></div><div style="margin-bottom:8px"><div>Matplotlib</div><div>suggested: (MatPlotLib, RRID:SCR_008624)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Literature review: We searched Pubmed and the preprint servers bioRxiv and medRxiv through June 1, 2020 for all literature on nasal-swab sampling for SARS-CoV-2 and extracted sample sizes, collection methods, RT-PCR assay information, and 2×2 contingency table data comparing nasal swabs to NP swabs wherever available.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pubmed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div><div style="margin-bottom:8px"><div>bioRxiv</div><div>suggested: (bioRxiv, RRID:SCR_003933)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Interestingly, we found no difference among transport media conditions and between sampling protocols, suggesting that lower sensitivity of nasal swab sampling is an overall limitation of the anatomical location of nasal swabs and that the protocols and media conditions we tested are interchangeable. Thus, for patients above a critical threshold of 1,000 copies/mL (Fig. 2), nasal swabs collected in VTM, GITC transport medium, and as dry swabs are all likely to perform equally well in the population, providing multiple potential options for specimen acquisition. Our results suggest several settings in which nasal swabs may and may not best be used. Peak infectiousness is likely to occur near or shortly before symptom onset20,21 and nasopharyngeal viral load is often undetectable a week after symptom onset2. Lower-sensitivity testing would therefore likely miss patients with early developing presymptomatic infections and patients presenting multiple days after symptom onset. Notably, for those presenting later to care, a false-negative diagnosis could bear significant clinical implications in not only erroneously reassuring the patient and clinical team, but also excluding them from potentially useful and rationed therapies such as remdesivir22 or others. Importantly, based on viral load distribution in first-time tested individuals at our institution, ∼20% of newly presenting SARS-CoV-2 positive individuals would be missed if sampled solely using nasal swabs6, highlighting the...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.06.14.20125997: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The Institutional Review Board of Tongji Hospital, Wuhan, China, approved this retrospective study and written informed consent was waived (No. TJ-C20200140).<br>Consent: The Institutional Review Board of Tongji Hospital, Wuhan, China, approved this retrospective study and written informed consent was waived (No. TJ-C20200140).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Acute cardiac injury (ACI) was diagnosed if serum levels of TNI were more than 0.342 μg/L for males and more than 0.156 μg/L for females.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All the analyses were performed using SPSS (version 21.0) and GraphPad Prism (version 8.4.0) software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      [19] Our retrospective cohort study has some limitations. Firstly, only admission examination for the indicator of eGFR was captured in the collected data, and the overall level of IKF might therefore be underestimated. Secondly, the information of patients prior to admission was not put into the medical history, so it could not be determined whether the patients continued to take or changed the medication during hospitalization. Thirdly, there was no national unified standard for the normal reference values of some laboratory indicators, thus we followed the standards set by the hospital. Finally, the data entry of underlying diseases was based on the inquiries of patients enrolled in the hospital and might be underestimated due to the influence of awareness rate.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.06.14.20130765: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the Research Ethics Commission of Zhongnan Hospital of Wuhan University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Stata/SE 15.1 software (StataCorp, College Station, TX, USA) and R software 3.5.1 were applied for all analyses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      However, some limitations existed in our study. First, due to the retrospective nature of the study, not all laboratory tests (including serum ferritin, IL-8, tumor necrosis factor-α and erythrocyte sedimentation rate) were done in all patients, especially in non-critically ill patients. Thus, their roles might be underestimated in predicting critical-ill events. Second, lack of effective antiviral drugs and late transfer from other community hospitals might have contributed to the development of critical-ill events in some patients, which may bias our results. Third, regarding the survival analyses, the p values for cTnI, haemoglobin, and IL-6 did not reach the statistical significance might due to inadequate follow-up and small samples. Further prospective study with large sample is warranted. In summary, our data suggested that hypersensitive cTnI greater than 0.04 ng/mL, BUN greater than 7.6 mmol/L, decreased haemoglobin, and high IL-6 were risk factors of critical-ill events in patients with COVID-19.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.06.25.20140061: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PCR reaction was performed using 2.5 μl of cDNA in a final volume of 25 μl (Kit Platinum SuperFi Green PCR Master Mix, Thermo), using 1 μl of the primer (10 μM).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo</div><div>suggested: (Thermo Xcalibur, RRID:SCR_014593)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequences were identified using BLAST analysis (https://blast.ncbi.nlm.nih.gov/Blast.cgi).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div><div style="margin-bottom:8px"><div>https://blast.ncbi.nlm.nih.gov/Blast.cgi</div><div>suggested: (TBLASTX, RRID:SCR_011823)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For comparison purposes, all Italian SARS-CoV-2 genome sequences available at the time of analysis (12th June 2020; n=134) were retrieved from Gisaid (https://www.gisaid.org/) and aligned with the study sequences using the MEGA X software (Kumar et al., 2018).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA X</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.06.29.20140632: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the Local Ethics Committee of the HUS Helsinki University Hospital.<br>Consent: Informed consent was obtained from the patients or the next of kin of those critically ill.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Anemia was defined as hemoglobin < 134 g/l for men and < 117 g/l for women, leukopenia as white blood cells < 3.4 × 109/l and lymphopenia as blood lymphocytes < 1.2 × 109/l and thrombocytopenia as platelet count < 150 × 109/l.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using SPSS version 26.0 (IBM SPSS Statistics®) and Stata 16.1 (StataCorp, College Station, TX, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our study had several limitations. The sample size was small, which should be taken into account when interpreting the results. All patients admitted to HUS Jorvi Hospital with COVID-19 or influenza were not eligible; for example they lived outside of the Jorvi Hospital catchment area or did not consent to participate. Elderly patients were underrepresented as patients with pre-existing treatment limitations or not requiring specialized care were admitted to the secondary care Espoo Hospital. The time from symptom onset to hospitalization may not be completely comparable between COVID-19 and influenza patients because, until March, only patients with symptom onset within the last 7 days were included. Furthermore, this study is based on clinical data and no extra laboratory testing or radiological imaging was done in addition to the detection of influenza and SARS-CoV-2 RNA. Consequently, CT scans, coagulation markers, cardiac biomarkers or blood gas analyses were mostly not available and thus were not included here. During the COVID-19 epidemic, occasionally SARS-CoV-2 detection alone was conducted without influenza testing on clinical grounds, however, of the COVID-19 patients included in this study, 21 (75%) were tested for influenza and no co-infections were found. In conclusion, COVID-19 requiring hospitalization had a more severe clinical course than influenza. As SARS-CoV-2 and influenza may continue to circulate simultaneously and influenza already strains health care...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.07.22.212761: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The protocol was approved by the ethical committee of Osaka University Hospital (No. 19546)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Control serum was obtained from pooled human serum (#BJ11787, Tennessee Blood Services, TN, USA) mixed from five males and five females, which were collected in February 2019 and confirmed to be noninfected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody test kits: SARS-CoV-2-specific IgG and IgM antibodies of serum samples collected from COVID-19 patients were detected using a rapid immunochromatographic test for detecting antibodies against SARS-CoV-2 (IgM; RF-NC001, IgG; RF-NC002, KURABO, Japan), a 2019-nCoV IgG/IgM detection kit (C6603C, Vazyme, China), a COVID-19 Human IgM/IgG Rapid Test (DC0301</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgM</div><div>suggested: (Abgent Cat# AM2019a, RRID:AB_11138086)</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing each well with 0.05% PBS Tween-20 (PBS-T), the cells were incubated with horseradish peroxidase (HRP)-conjugated antibodies specific for human IgG (1:10,000; AP004</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the IgG subclass determination assay, anti-human IgG subclass-specific HRP-conjugated antibodies (1:10,000; IgG1 (AP006), IgG2 (AP007), IgG3 (AP008), and IgG4 (AP009), Binding Site) were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG subclass-specific HRP-conjugated antibodies ( 1:10,000; IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>AP006</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>AP007</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>AP008</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>AP009</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Either 293T or BHK cells were grown to 90% confluence on 35-mm tissue culture plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing the wells with PBS-T, color was developed with the peroxidase chromogenic substrate 3,3’,5,5’-tetramethylbenzidine (TMB; Sigma Aldrich, MO, USA), and the reactions were terminated with 0.9 N sulfuric acid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TMB; Sigma Aldrich</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Peptide array: CelluSpots peptide array was performed using CelluSpots™ covid19_hullB (98.301, Intavis) or CelluSpots™ covid19_hullS (98.302, Intavis) according to the manufacturers’ instructions: blocked by immersing the slides in PBS containing 5% skim milk overnight at 4°C on an orbital shaker, incubated with diluted serum samples (1:10) overnight at 4°C on an orbital shaker, washed with PBS-T buffer with 0.05% Tween-20, and incubated with diluted HRP-conjugated antibodies specific for human IgG (1:10,000; AP004</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CelluSpots™</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A chemiluminescent signal visualized by Chemi-Lumi One L (07880-70, Nacalai Tesque) was detected with a ChemiDoc Touch imaging system (Bio-Rad) and analyzed with Image Lab software version 6.0.1 (Bio-Rad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Image Lab</div><div>suggested: (Image Lab Software, RRID:SCR_014210)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was performed using Prism GraphPad version 6.07 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      As a study limitation, this study protocol has been approved to analyze only human serum samples without any clinical information. Because the onset of infection or severity of patients cannot be known, we cannot discuss the time course of antibodies with the clinical status of the patients. Although the magnitude of IgG production might be dependent on the duration of COVID-19, we can evaluate the dominant B cell epitope of each patient. There have been concerns regarding vaccine enhancement of disease by certain candidate COVID-19 vaccine approaches via antibody-dependent enhancement (ADE). This phenomenon is observed when non-neutralizing virus-specific IgG facilitates entry of virus particles into Fc-receptor-expressing cells, leading to inflammatory activation of macrophages and monocytes (Taylor et al, 2015). A study in SARS-CoV-1-infected rhesus macaques found that anti-S IgG contributes to severe acute lung injury (ALI) and massive accumulation of monocytes/macrophages in the lung (Liu et al, 2019). To avoid this phenomenon, a specific neutralizing antibody is required, which can also be achieved by a B cell epitope vaccine. Therefore, we speculate that the next generation of vaccines for COVID-19 should consider the B cell epitope in terms of safety and efficiency. In summary, we conducted full B cell epitope mapping and validated the predicted B cell epitope of S protein, utilizing human sera from patients with COVID-19. Based on the analysis of neutralizing activit...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.07.25.221135: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: COVID-19 convalescent serum was collected previously (58) in accordance with ethical requirements (ethics committee UK Erlangen, license number AZ. 174_20 B)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western blot: Protein expression was analyzed by polyacrylamide gel electrophoresis on 8%-16% precast gradient gels (Thermo) and Western blotting using antibodies to ACE2 (AF933, R&D Systems), c-Myc-epitope (clone 9E10, Santa Cruz Biotechnology), SARS spike (NB100-56578, Novus Biologicals), HIV-1 Gag p24 (clone 749140, R&D), and GAPDH (GenScript) in NETT-G (150 mM NaCl, 5mM EDTA, 50 mM Tris, 0.05% Triton X-100, 0.25% gelatin, pH 7.5) and donkey anti-mouse horseradish peroxidase (HRP)-coupled (Dianova)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>NB100-56578</div><div>suggested: (Novus Cat# NB100-56578, RRID:AB_838846)</div></div><div style="margin-bottom:8px"><div>HIV-1 Gag p24</div><div>suggested: (R and D Systems Cat# MAB7360, RRID:AB_10993570)</div></div><div style="margin-bottom:8px"><div>GAPDH</div><div>suggested: (LSBio (LifeSpan Cat# LS-C94067-150, RRID:AB_1932766)</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, goat anti-rabbit HRP-coupled (Life Technologies) or rabbit anti-goat HRP-coupled (Proteintech) secondary antibody in 5% dry milk powder in PBS with 0.05% Tween 20.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-goat HRP-coupled ( Proteintech )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were then incubated in either convalescent serum at 1:1000 dilution or soluble ACE2-Fc fusion protein at 2 ng/μl, both described elsewhere (58), for 1h in 10% FCS in PBS, followed by one wash in a large volume of PBS and then incubation with Alexa647-coupled anti-human secondary antibody (Thermo Fisher Scientific) at 1:200 in 10% FCS in PBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human secondary</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For Calu-3 cells 1mM Sodium-Pyruvate (Thermo Fisher Scientific) was added.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: KCLB Cat# 30055, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry: 293T cells were transfected with the respective spike expression constructs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 infections: Primary SARS-CoV-2 isolate ER-PR2 was a kind gift from Klaus Überla, Erlangen, and was originally isolated on Vero cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T effector cells were seeded in a 10 cm dish at 70-80% confluency and transfected with either the Vp16-Gal4 (all experiments except Fig.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vp16-Gal4</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was analyzed using Flowing software (version 2.5) and GraphPad Prism, version 6, for Windows (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These datapoints with the undiluted sample set to 1 was approximated by an exponential function using Microsoft Excel 2020.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04355026</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Use of Bromhexine and Hydroxychloroquine for Treatment of CO…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04273763</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Evaluating the Efficacy and Safety of Bromhexine Hydrochlori…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04340349</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Enrolling by invitation</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Low-dose Hydroxychloroquine and Bromhexine: a Novel Regimen …</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.07.22.20160259: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: These subjects were used as healthy controls (HCs) from whom serum samples were collected after obtaining informed consent.<br>IRB: This study was approved by the ethics committee of The First Hospital of Shanxi Medical University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">In total, 68 recovered patients, including 48 males, aged 21-49 years-old, and 20 females, aged 24-66 years-old, along with 28 healthy controls, including 8 males, aged 21-53 years-old, and 20 females, aged 22-53 years-old were included.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Further, the included patients would be excluded if they fulfilled any of the following testing criteria: positive in HBsAg, HCV antibody, or HIV antibody; creatinine above 120 μmol/L, creatine kinase above 500 U/L</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCV</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HIV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">10 μL of each monoclonal antibody were added to tube A (CD45-FITC/CD4-RD1/ CD8-ECD/CD3-PC5 antibody) or tube B (CD45-FITC/CD56-RD1/ CD19-ECD/CD3-PC5 antibody).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD45-FITC/CD4-RD1/ CD8-ECD/CD3-PC5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD45-FITC/CD56-RD1/ CD19-ECD/CD3-PC5</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fluorescent detection was then performed on a calibrated flow cytometer for each sample in sequence. 2.6. Statistics: All statistical analyses were performed using EXCEL (Microsoft) and SPSS Statistics version 21.0 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      There are some limitations in this study. Firstly, due to the lack of clinical data during the early infection stage, continuous observational data from the same cases are absent, and potential influence by early events are not considered. Secondly, the sample size was relatively small in comparison with Wuhan where the disease originated, which may have some impact on the statistical results. In future experiments, we will conduct follow-up studies in the patients who recovered from COVID-19, and determine a quantitative basis for intervention of rehabilitation measures. This will help treat the diseases at an earlier stage by promoting medical intervention in a timely manner. Moreover, it may be beneficial to analyze if a particular population has an added immunological advantage while combating the virus.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.07.25.217158: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: After this step, the pellets were placed on ice and resuspended with propidium iodide, which is a viability marker of cells and the cytotoxic activity of antibodies was determined by flow cytometry, after gating on lymphocytes, based on their morphology.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, bound FcγR molecules were revealed with peroxidase conjugated anti-tag antibody (Miltenyi, 120-003-811; 1/5000 in 2% bovine serum albumin) and tetramethylbenzidine (TMB) reagent.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound pig IgG were revealed with a secondary anti-pig-HRP-conjugated antibody (Bethyl Laboratories, USA) diluted in washing buffer, at 1:1000, incubated 1h at RT and washed 3 times.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-pig-HRP-conjugated</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The human Fc tag was then revealed with a specific HRP-conjugated anti-human IgG secondary antibody (diluted in in PBS-Tween-0.05%-1% skimmed milk powder at 1:1000, incubated 1h at RT and washed 3 times).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant proteins from SARS-CoV-2 have been manufactured from Hek-293 cells and were purchased from Interchim, Monluçon, France.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Hek-293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Swine serum dilutions were mixed with equal volumes of SARS-CoV-2 (BetaCoV/Hong Kong/VM20001061/2020 [KH1], corresponding to the D614 variant) or SARS-CoV (strain HK39849, SCoV) at a dose of 200 plaque-forming units determined by Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding to human FcγR: The binding of IgG from DKO swine to the FcγRI, FcγRIIa and FcγRIIb human receptors was tested using an ELISA assay and BIAcore surface plasmon resonance (SPR).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BIAcore</div><div>suggested: (Biacore T100 System, RRID:SCR_019679)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">His-Tagged FcγRI, FcγRIIa and FcγRIIb receptors (CD64/32a/32b, R&D Systems; 100μL, 2.4 μg/mL in 2% bovine serum albumin) were then added and incubated for 2h at room temperature (RT).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>R&D Systems</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were performed on GraphPad Software (GraphPad Software, San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04431219</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">First in Human Study: LIS1, an Induction Treatment in Kidney…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04453384</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Study to Evaluate the Safety and Efficacy of XAV-19 in Patie…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.07.24.217570: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Mice used in the experiments were raised in Animal Facility of Center of Biomedical Analysis in Tsinghua University and treated in compliance with the animal ethics guidelines.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">SARS-CoV-2 vaccines immunization: 6-8 week old Babl/c mice (4-5 mice per group, female) were separately subcutaneously vaccinated with SARS-CoV-2 S protein 5 μg/mouse, CDGSF 20 μg/mouse, Alhydrogel® adjuvant 2% 100 μg/mouse.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Animal Facility of Center of Biomedical Analysis in Tsinghua University has been authenticated by Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC)</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, cells were harvested and strained with mouse anti-CD86-phycoerythrin antibodies (BD Pharmingen, dilution 1/200) at ice for 1h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD86-phycoerythrin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing again, diluted rabbit anti-mouse IgG-Peroxidase antibodies (1/2000 dilution, Sigma) were added to each well (100 μL per well) and incubated for 1h at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG-Peroxidase</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing with PBS and PBST, isotype antibodies IgG1, IgG2a, IgG2b, IgG3, IgA and IgM (anti-mouse antibodies from goat, Sigma) were diluted to 1:1000 and added to each well (100μL per well).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG2b , IgG3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1 cell line: J774A.1 cells (mouse monocyte macrophage cell line) were cultured in DMEM (dulbecco’s modified eagle medium) containing 10% fetal bovine serum (FBS) at 37°C, 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>J774A.1</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT02675439</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety and Efficacy of MIW815 (ADU-S100) +/- Ipilimumab in P…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT03010176</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Study of MK-1454 Alone or in Combination With Pembrolizumab …</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.07.24.20161307: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: It started its activity on March 16, 2020, following approval by the Ethical Review Board of the Promoter Center, University of Siena (Protocol n. 16929, approval dated March 16, 2020).<br>Consent: Written informed consent was obtained from all individuals who contributed samples and data.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Heart involvement was considered on the basis of one or more of the following abnormal data: a cardiac Troponin T (cTnT) value higher than the reference range (<15 ng/L) (indicative of ischemic disorder), an increase in the N-terminal (NT)-pro hormone BNP (NT-proBNP) value (reference value <88 pg/ml for males and <153 pg/ml for females) (indicative of heart failure), and the presence of arrhythmias (indicative of electric disorder).</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To achieve this overall aim, the following specific objectives are being pursued: i) to perform sequencing (WES) on 2,000 COVID-19 patient samples [performed by the University of Siena (UNISI)]; ii) to perform genotyping (GWAS) on 2000 COVID-19 patients [performed by the Institute for Molecular Medicine of Finland (FIMM)]; iii) to associate the host genetic data obtained on 2,000 COVID-19 patients with severity and prognosis; iv) to share phenotypic data and samples across the GEN-COVID consortium platform as well as in cooperation with research institutions and national platforms through the GEN-COVID Disease Registry and Biobank; v) to share genetic data through the Network of Italian Genome (NIG: http://www.nig.cineca.it/, NIG database: http://nigdb.cineca.it) at CINECA, the largest Italian computing center.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Biobank</div><div>suggested: (HIV Biobank, RRID:SCR_004691)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Library enrichment was tested by qPCR and the size distribution and concentration were determined using Agilent Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Agilent Bioanalyzer</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quality checks (SNP calling quality, cluster separation, and Mendelian and replication error) were done using GenomeStudio analysis software (Illumina).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GenomeStudio</div><div>suggested: (GenomeStudio, RRID:SCR_010973)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The computer package Plink v1.90 [8] was used to process 700k SNP-genotyping data and to calculate SNP genotype statistics.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Plink</div><div>suggested: (PLINK, RRID:SCR_001757)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting plot is obtained with the Python Seaborn package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.07.27.20163147: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sample Collection and diagnostics: Residual VTM from SARS-CoV-2 positive nasopharyngeal swabs collected during clinical assessment of asymptomatic and symptomatic patients at Stanford Healthcare were</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Stanford Healthcare</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Non-SARS-CoV-2 reads were filtered out with Kraken220, using an index of human and viral genomes in RefSeq (index downloaded from https://genexa.ch/sars2-bioinformatics-resources/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RefSeq</div><div>suggested: (RefSeq, RRID:SCR_003496)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reads per COVID gene were collected from the ReadsPerGene STAR output file, and the total mappable reads were collected from the Log.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_015899)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">500 μl of 1.3 pM DNA sequencing library was loaded into a MiniSeq Mid Output Kit (300-cycles) (FC-420-1004), and sequenced using MiniSeq DNA sequencer (Illumina Inc., San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MiniSeq</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">27,28 Host Sequence Alignment: Low-coverage FASTQ sequences underwent quality control assessment via FastQC v0.11.8 before alt-aware alignment to GRCh38.p12 using BWA-MEM v0.7.17-r1188.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FastQC</div><div>suggested: (FastQC, RRID:SCR_014583)</div></div><div style="margin-bottom:8px"><div>BWA-MEM</div><div>suggested: (Sniffles, RRID:SCR_017619)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After duplicate marking, base quality score recalibration was performed with Picard Tools’ BaseRecalibrator and high-confidence variant call sets from dbSNP and the 1000 Genomes Project.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Picard</div><div>suggested: (Picard, RRID:SCR_006525)</div></div><div style="margin-bottom:8px"><div>dbSNP</div><div>suggested: (dbSNP, RRID:SCR_002338)</div></div><div style="margin-bottom:8px"><div>1000 Genomes Project</div><div>suggested: (1000 Genomes Project and AWS, RRID:SCR_008801)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quality control metrics, including coverage, were generated with Qualimap BAMQC v2.2.1, Samtools v1.10, and Mosdepth v0.2.9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Qualimap</div><div>suggested: (QualiMap, RRID:SCR_001209)</div></div><div style="margin-bottom:8px"><div>Samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Finally, quality control reports for each sample were aggregated using MultiQC v1.9</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MultiQC</div><div>suggested: (MultiQC, RRID:SCR_014982)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) Variant Calling, Imputation, PCA, Kinship: BAM files were used for an initial calling with bcftools v1.9 mpileup29.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>bcftools</div><div>suggested: (SAMtools/BCFtools, RRID:SCR_005227)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.07.27.223578: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">For each model, compounds were randomly split into two groups of approximately equal sizes, one used for training and the other for testing.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After an incubation at 37⍰°C for 24⍰h, 2.5 μL/well of detection reagent mixture of two labeled anti-ZIKV NS1 antibodies was added to assay plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ZIKV NS1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 cytopathic effect (CPE) assay: Vero-E6 cells previously selected for high ACE2 expression 27 (grown in EMEM, 10% FBS, and 1% Penicillin/Streptomycin) were cultured in T175 flasks and passaged at 95% confluency.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plates were transported into the BSL-3 facility were a 25 μL aliquot of virus inoculated cells (4000 Vero E6 cells/well) was added to each well in columns 3-24.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">NS1 TR-FRET assay: HEK293 cells were maintained in EMEM medium with 10% fetal bovine serum, 1% pen/strep (Gibco, Cat. # 15140–122).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For activity-based models, only compounds that showed activity in at least 10% of the Sytravon, Genesis or MLS assay panel were kept for analyses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Genesis</div><div>suggested: (Genesis, RRID:SCR_015775)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.07.26.222257: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Monkey studies were carried out in an animal biosafety level 4 (ABSL-4) facility with protocols approved by the Laboratory Animal Welfare and Ethics Committee of the Chinese Academy of Sciences.<br>Consent: The blood was taken from a convalescent COVID-19 patient after got his signature for the informed consent form.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Nine 6 or 7 year-old rhesus monkeys (3 females and 6 males) were divided into 3 groups: a control group (one female and two males), a pre-exposure group (one female and two males) and a post-exposure group (one female and two males).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the generation of human ACE2-hFc and SARS-CoV-2 RBD-mFc recombinant proteins, RBD or ACE2 sequence (1-615aa, accession number: NP_068576.1) was cloned into mouse IgG1 or human IgG1 Fc backbone in pKN293E expression vectors and transiently transfected into HEK293 cells followed by media collection and purification using MabSelect SuRe antibody purification resin (Cat: 29-0491-04, GE Healthcare).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>human IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing twice with 1 × PBS, cells were stained with 1/200 diluted Goat Anti human IgG Fc-FITC antibody (Cat: F9512, Sigma) for 45 min and analyzed using flow cytometry (CytoFLEX, Beckman Coulter).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti human IgG</div><div>suggested: (Sigma-Aldrich Cat# F9512, RRID:AB_259808)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then 10 μL anti-FcγRI antibody-FITC (Cat: 10256-R401-F, Sino Biological), anti-FcγRIIa antibody-FITC (Cat: 10374-MM02-F, Sino Biological), anti-FcγRIIIa antibody-FITC (Cat: 10389-MM41-F, Sino Biological) and FITC-labeled anti-FcγRIIb antibody (Cat: NBP2-14905, Biotechne; Cat: MX488AS100-1KT, Sigma-Aldrich) were added into cells (1×106 cells/sample in 100 μL) and incubated for 60 min at 2-6°C and analyzed using flow cytometry (CytoFLEX, Beckman Coulter)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-FcγRIIa</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antibody-FITC</div><div>suggested: (Alomone Labs Cat# AAR-007-F, RRID:AB_2756537)</div></div><div style="margin-bottom:8px"><div>anti-FcγRIIIa</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-FcγRIIb</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and viruses: HEK293 (ATCC, CRL-3216) cells, Huh7 (Institute of Basic Medical Sciences CAMS, 3111C0001CCC000679) cells and Vero E6 (ATCC, CRL-1586) cells were cultured at 37 °C in Dulbecco’s Modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Raji (ATCC, CCL-86) cells, THP-1 (ATCC, TIB-202) cells and K562 (ATCC, CCL-243) cells were cultured at 37 °C in RPMI 1640 Medium with 10% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>THP-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">antibodies, heavy chain and light chain plasmids were transiently co-transfected into HEK293 cells or stably expressed in CHO cells followed by purification with Protein A resin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: CLS Cat# 603479/p746_CHO, RRID:CVCL_0213)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The TCID50 was determined by the transduction of pseudovirus into Huh7 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: CLS Cat# 300156/p7178_HuH7, RRID:CVCL_0336)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody-dependent enhancement (ADE) assay: The ADE assays were performed using Raji, THP-1 and K562 cell lines.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K562</div><div>suggested: NCI-DTP Cat# K-562, RRID:CVCL_0004)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Maokang Biological) for 30 min at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Maokang Biological</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The 50% neutralization titer (NT50) was calculated using GraphPad Prism 7.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.07.29.227595: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Vaccination of CD-1 mice with the hAd5 S-Fusion + N-ETSD vaccine candidate: CD-1 female mice (Charles River Laboratories) 7 weeks of age were used for immunological studies performed at the vivarium facilities of Omeros Inc. (Seattle, WA).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The constructs created included: Transfection of HEK 293T cells with hAd5 constructs: To determine surface expression of the RBD epitope by vaccine candidate constructs, we transfected HEK 293T cells with hAd5 construct DNA and quantified surface RBD by flow cytometric detection using anti-RBD antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were harvested 1, 2, 3, and 7 days post transfection by gently pipetting cells into medium and labeled with an anti-RBD monoclonal antibody (clone D003 Sino Biological Catalog # 40150-D003) and F(ab’)2-Goat anti-Human IgG-Fc secondary antibody conjugated with R-phycoerythrin (ThermoFisher Catalog # H10104).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human IgG-Fc</div><div>suggested: (Thermo Fisher Scientific Cat# H10104, RRID:AB_2536546)</div></div><div style="margin-bottom:8px"><div>R-phycoerythrin</div><div>suggested: (Thermo Fisher Scientific Cat# H10104, RRID:AB_2536546)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To label N, cells were then incubated with an anti-flag monoclonal (Anti-Flag M2 produced in mouse, Sigma cat# F1804) antibody at 1:1000 in phosphate buffered saline with 3% BSA overnight at 4°C, followed by washes in PBS and a 1 hour incubation with a goat anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor Plus 555 (Life Technologies, Cat# A32727) at 1:500.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Flag</div><div>suggested: (Sigma-Aldrich Cat# F1804, RRID:AB_262044)</div></div><div style="margin-bottom:8px"><div>anti-Mouse IgG</div><div>suggested: (Thermo Fisher Scientific Cat# A32727, RRID:AB_2633276)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For co-localization studies, cells were also incubated overnight at 4°C with a sheep anti-Lamp1 Alexa Fluor 488-conjugated (lysosomal marker) antibody (R&D systems, Cat# IC7985G) at 1:10 or a rabbit anti-CD71 (transferrin receptor, endosomal marker) antibody (ThermoFisher Cat# PA5-83022) at 1:200.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Lamp1</div><div>suggested: (Rockland Cat# 200-301-G09, RRID:AB_2611215)</div></div><div style="margin-bottom:8px"><div>anti-CD71 (transferrin receptor, endosomal marker)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After removal of the primary antibody, two washes in PBS and three 3 washes in PBS with 3% BSA, cells were incubated with fluor-conjugated secondary antibodies when applicable at 1:500 (Goat anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488, Life technologies, A-11034) for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Rabbit IgG</div><div>suggested: (Thermo Fisher Scientific Cat# A-11034, RRID:AB_2576217)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-Spike S2 (SinoBiological Cat #40590-T62) was used as the primary antibody and IRDye® 800CW Goat anti-Rabbit IgG (H + L) (Li-Cor, 925-32211) as the secondary antibody using the Ibind Flex platform.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Spike S2</div><div>suggested: (Imported from the IEDB Cat# S2, RRID:AB_2833224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were incubated with ACE2-Fc for 20 minutes and, after a washing step, were then labeled with a PE conjugated F(ab’)2-goat anti-human IgG Fc secondary antibody at a 1:100 dilution, incubated for 20 minutes, washed and acquired on flow cytometer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fluorescent-conjugated antibodies against mouse CD8β antibody (clone H35-17.2, ThermoFisher), CD4 (clone RM4-5, BD), IFN-γ (clone XMG1.2, BD), and TNF-α (clone MP6-XT22, BD) and staining was performed in the presence of unlabeled anti-CD16/CD32 antibody (clone 2.4G2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>mouse CD8β</div><div>suggested: (Bio X Cell Cat# BE0223, RRID:AB_2687706)</div></div><div style="margin-bottom:8px"><div>CD4</div><div>suggested: (BioLegend Cat# 391503, RRID:AB_2721611)</div></div><div style="margin-bottom:8px"><div>IFN-γ</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>TNF-α</div><div>suggested: (Leinco Technologies Cat# T798, RRID:AB_2832121)</div></div><div style="margin-bottom:8px"><div>anti-CD16/CD32</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells (2-4 × 105 cells per well of a 96-well plate) were added to the ELISpot plate containing an immobilized primary antibodies to either IFN-γ or IL-4 (BD), and were exposed to various stimuli (e.g. control peptides, target peptide pools/proteins) comprising 2 μg/mL peptide pools or 10 μg/mL protein for 36-40 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IL-4 (BD)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA for detection of antibodies: For antibody detection in sera from inoculated mice, ELISAs specific for spike and nucleocapsid antibodies, as well as for IgG subtype (IgG1, IgG2a, IgG2b, and IgG3) antibodies were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG subtype (IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation, the wells were washed with PBST and 100 μL of a 1/5000 dilution of anti-mouse IgG HRP (GE Health Care; Cat # NA9310V), or anti-mouse IgG1 HRP (Sigma; Cat # SAB3701171), or anti-mouse IgG2a HRP (Sigma; Cat # SAB3701178), or anti-mouse IgG2b HRP (Sigma; catalog# SAB3701185), or anti-mouse IgG3 HRP conjugated antibody (Sigma; Cat # SAB3701192) was added to wells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG2a</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG2b</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calculation of relative μg amounts of antibodies: A standard curve of IgG was generated and absorbance values were converted into mass equivalents for both anti-S and anti-N antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-N</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The constructs created included: Transfection of HEK 293T cells with hAd5 constructs: To determine surface expression of the RBD epitope by vaccine candidate constructs, we transfected HEK 293T cells with hAd5 construct DNA and quantified surface RBD by flow cytometric detection using anti-RBD antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunocytochemical labeling of hAd5 infected HeLa cells: To determine subcellular localization of N after infection or transfection of HeLa cells with hAd5 N-wild type (WT) or hAd5 N-ETSD (each with a flag tag to allow labeling), 48 hours after infection or transfection cells were fixed with 4% paraformaldehyde (PFA) and permeabilized with 0.4% Triton X100, in PBS) for 15 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant ACE2-IgG1Fc protein was produced using Maxcyte transfection in CHO-S cells that were cultured for 14 days.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cell neutralization assay: All aspects of the assay utilizing virus were performed in a BSL3 containment facility according to the ISMMS Conventional Biocontainment Facility SOPs for SARS-CoV-2 cell culture studies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vaccination of CD-1 mice with the hAd5 S-Fusion + N-ETSD vaccine candidate: CD-1 female mice (Charles River Laboratories) 7 weeks of age were used for immunological studies performed at the vivarium facilities of Omeros Inc. (Seattle, WA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD-1</div><div>suggested: RRID:MGI:2686808)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were harvested 1, 2, 3, and 7 days post transfection by gently pipetting cells into medium and labeled with an anti-RBD monoclonal antibody (clone D003 Sino Biological Catalog # 40150-D003) and F(ab’)2-Goat anti-Human IgG-Fc secondary antibody conjugated with R-phycoerythrin (ThermoFisher Catalog # H10104).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher Catalog</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fluorescent-conjugated antibodies against mouse CD8β antibody (clone H35-17.2, ThermoFisher), CD4 (clone RM4-5, BD), IFN-γ (clone XMG1.2, BD), and TNF-α (clone MP6-XT22, BD) and staining was performed in the presence of unlabeled anti-CD16/CD32 antibody (clone 2.4G2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher</div><div>suggested: (ThermoFisher; SL 8; Centrifuge, RRID:SCR_020809)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry was performed using a Beckman-Coulter Cytoflex S flow cytometer and analyzed using Flowjo Software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flowjo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 14. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.02.230839: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The number of red/green color cells in random fields was determined using thresholding and particle analysis in the Fiji modification of ImageJ and expressed as a dead/live cell ratio.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Cell lines were authenticated and tested to ensure the cultures were free of mycoplasma infection.<br>Contamination: Cell lines were authenticated and tested to ensure the cultures were free of mycoplasma infection.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Abnova ACE2 polyclonal antibody #PAB13444, Santa Cruz Biotechnology ACE2 Antibody (E-11) #sc-390851, Sigma Anti-TMPRSS2 Antibody, clone P5H9-A3 #MABF2158, Sigma Anti-IL6 antibody produced in rabbit #SAB1408591, Santa Cruz Biotechnology TMPRSS2 Antibody (H-4) #sc-515727, TMPRSS2 (EMD Millipore #MABF2158), Cell Signaling Technology Phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (D13.14.4E)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-IL6</div><div>suggested: (Sigma-Aldrich Cat# SAB1408591, RRID:AB_10742282)</div></div><div style="margin-bottom:8px"><div>#SAB1408591</div><div>suggested: (Sigma-Aldrich Cat# SAB1408591, RRID:AB_10742282)</div></div><div style="margin-bottom:8px"><div>TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Rabbit mAb #4370, Cell Signaling Technology p44/42 MAPK (Erk1/2) Antibody #9102, Ran (BD Biosciences #610341)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Erk1/2</div><div>suggested: (Cell Signaling Technology Cat# 9102, RRID:AB_330744)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, Caspase-8 (Cell Signaling #9746), Sigma Monoclonal Anti-β-Actin antibody produced in mouse #A5441.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-β-Actin</div><div>suggested: (Sigma-Aldrich Cat# A5441, RRID:AB_476744)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Invitrogen Goat anti-Rabbit IgG (H+L) Secondary Antibody, HRP # 31460 and Goat anti-Mouse IgG (H+L) Secondary Antibody, HRP # 31430 were diluted 1:5000 in 2.5% non-fat milk. qRT-PCR methods and primers: Total RNA was isolated from cells using the RNeasy Mini Kit (Qiagen)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Rabbit IgG</div><div>suggested: (Thermo Fisher Scientific Cat# 31460, RRID:AB_228341)</div></div><div style="margin-bottom:8px"><div>anti-Mouse IgG</div><div>suggested: (Thermo Fisher Scientific Cat# 31430, RRID:AB_228307)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western blots evaluating cleaved caspase 8 were performed using Cell Signaling antibody (#9746).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cleaved caspase 8</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines and culture conditions: Normal human primary small airway epithelial cells HSAEC, normal human bronchial epithelial cells BEAS-2B, normal human lung fibroblast MRC-5, human NSCLC cells H1975, H1299, Calu-3, Calu-6, human mesothelioma cells MSTO-211H, NSCLC patient-derived cell line, human natural killer cells NK-92, normal human colon epithelial cells CCD 841 CoN and human colorectal cancer cells HT-29, HCT116 were used in this study.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HSAEC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>MRC-5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>H1299</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">H1975, H1299, MSTO-211H and NSCLC patient-derived cell line were cultured in RPMI-1640 medium supplemented 10% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>H1975</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">NK-92 cells were cultured in Alpha Minimum Essential medium without ribonucleosides and deoxyribonucleosides but with 2 mM L-glutamine and 1.5 g/L sodium bicarbonate supplemented with 0.2 mM inositol; 0.1 mM 2-mercaptoethanol; 0.02 mM folic acid; 100 U/ml recombinant IL-2, 12.5% horse serum and 12.5% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NK-92</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HCT116 and HT-29 were cultured in McCoy’s 5A (modified) medium supplemented 10% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCT116</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HT-29</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293T cells at 75% confluency were co-transfected with the backbone vector pHAGE-fullEF1α-ZsGreen-IRES-Puro(R), plasmids expressing lentiviral proteins Tat, Rev and Gag/Pol, and plasmids expressing D614 or G614 S protein (a gift from Dr. Hyeryun Choe, The Scripps Research Institute, Jupiter, FL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 pseudoviruses (5 x 106) or VSV-G lentivirus (2 x 105) were used to spin-infect (931 g for 2 hr at 30°C) Calu-3 or BEAS-2B cells in a 6-well plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BEAS-2B</div><div>suggested: RRID:CVCL_WZ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To test the inhibitors, Calu-3 or BEAS-2B cells were pre-treated with the inhibitors for 48 hr, spun-infected with pseudovirus followed by another 48 hr incubation with the inhibitors.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The number of red/green color cells in random fields was determined using thresholding and particle analysis in the Fiji modification of ImageJ and expressed as a dead/live cell ratio.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry analysis of ZsGreen+ cells was carried out 48 hr after infection on a BD LSRII flow cytometer and with the FlowJo software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This is a limitation of the work, as is lack of direct evidence that MEKi attenuate SARS-CoV-2 infection of human cells. Our evidence is indirect, and the effects are predicted based on current knowledge of SARS-CoV-2 infectivity factors, and consistent with recent results showing SARS-Cov-2 effects on the kinome including MAPK p38 activation [45]. Our results showing infection of SARS-CoV-2-S pseudovirus of human bronchial epithelial cells, human small airway epithelial cells, or lung cancer cells provide an experimental model system to discover or test therapeutics with potential to block coronavirus infection. The observed effect of MEKi to reduce SARS-CoV-2-S pseudovirus infection of human cells is consistent with our other evidence that MEKi may attenuate coronavirus infectivity factors to inhibit infection. In pursuit of a therapeutic agent that could attenuate cytokine storm while reducing viral infectivity and boosting NK cells activity, we found that VS-6766 decreases G-CSF and other cytokines. These cytokines of interest were increased in COVID-19-(+) patient plasma samples in our study. The combination of remdesivir and VS-6766 was not associated with increased cytokine expression at nontoxic doses of the drugs. The MEKi plus remdesivir drug combinations do not block NK-mediated cell killing and in fact the MEKi stimulate NK killing activity towards target cells. Moreover, the drug combinations do not inhibit TRAIL-mediated killing of target cells. The observed sti...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 64, 38, 39, 40, 57, 58, 29, 62 and 63. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.07.29.227462: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-Spike protein antibody (1A9), which was a mouse monoclonal antibody (IgG1) detecting the spike proteins of both SARS-CoV and SARS-CoV-2 through S2 subunit, was purchased from GeneTex (GTX632604).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Spike protein</div><div>suggested: (GeneTex Cat# GTX632604, RRID:AB_2864418)</div></div><div style="margin-bottom:8px"><div>IgG1</div><div>suggested: (GeneTex Cat# GTX632604, RRID:AB_2864418)</div></div><div style="margin-bottom:8px"><div>GTX632604</div><div>suggested: (GeneTex Cat# GTX632604, RRID:AB_2864418)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The proteins were under the following concentrations: DC-SIGN, L-SIGN, Dectin-2, MGL all at 1 μg/ml, MR at 2.5 μg/ml, biotinylated plant lectins GNA and VVA both at 1 μg/ml, Con A at 0.1 μg/ml, or antibodies mAb100 at 1 μg/ml and anti-spike antibody 1A9 at 0.5 μg/ml.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Dectin-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-spike</div><div>suggested: (Imported from the IEDB Cat# 1A9, RRID:AB_2848025)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were incubated with full-length S protein trimer (20 μg/ml) or the monoclonal antibody against DC-SIGN, #120507 (2 μg/ml) and L-SIGN, #120604 (2 μg/ml), or buffer only (negative control) on ice for 30 minutes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DC-SIGN</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells were transfected with MR-Fc DNA (kind gift from L. Martinez Pomares).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: Human fibroblast cell line 3T3, and the DC-SIGN-, and L-SIGN-transduced 3T3 cells (3T3-DC-SIGN+ and 3T3-DC-SIGNR+, respectively) were obtained through the AIDS Reagent Program, Division of AIDS, NIAID, NIH from Drs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>3T3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cells seeded in 6-well plates were infected with SARS-CoV-2 at a multiplicity of infection (MOI) of 1 or mock infected.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry: For cell surface binding assay, the cultured 3T3, 3T3-DC-SIGN and 3T3-L-SIGN cells were collected and washed with cold PBS once.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>3T3-L-SIGN</div><div>suggested: NIH-ARP Cat# 9948-54, RRID:CVCL_0R24)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: Human fibroblast cell line 3T3, and the DC-SIGN-, and L-SIGN-transduced 3T3 cells (3T3-DC-SIGN+ and 3T3-DC-SIGNR+, respectively) were obtained through the AIDS Reagent Program, Division of AIDS, NIAID, NIH from Drs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AIDS Reagent Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">KewalRamani, HIV Drug Resistance Program, NCI45.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Drug Resistance Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Affinity constant was calculated with GraphPad Prism 6.0 (GraphPad Software, Inc.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The results shown were from three independent experiments analyzed by FlowJo software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">h5ad files were loaded by “read_h5ad” and violin plots were illustrated by “pl.stacked_violin” in scanpy 1.5.1, which is a model for single cell analysis in Python57.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python57</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the single-cell RNA sequencing analysis of bronchoalveolar immune cells in patients with SARS-CoV-2, dataset was retrieved from Liao et al.12 and Gene Expression Omnibus (GEO) under the accession number GSE145926, which contains 6 severe and 3 moderate SARS-CoV-2 patients and 3 healthy controls12.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene Expression Omnibus</div><div>suggested: (Gene Expression Omnibus (GEO, RRID:SCR_005012)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">h5 format was loaded for analysis through R package Seurat v358, 59.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Seurat</div><div>suggested: (SEURAT, RRID:SCR_007322)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.01.22.914952: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">And the virus were detected using SL-CoV Rp3 NP antibody followed by Cy3-conjugated mouse anti-rabbit IgG.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Rp3 NP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An anti-Human IgG-HRP conjugated monoclonal antibody (Kyab Biotech Co., Ltd, Wuhan, China) was used at a dilution of 1:40000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2 expression was detected using mouse anti-S tag monoclonal antibody followed by FITC-labelled goat anti-mouse IgG H&L (Abcam, ab96879).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: (Abcam Cat# ab96879, RRID:AB_10687475)</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (Abcam Cat# ab96879, RRID:AB_10687475)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral replication was detected using rabbit antibody against the Rp3 NP protein (made in house, 1:100) followed by cyanin 3-conjugated goat anti-rabbit IgG (1:50, Abcam, ab6939).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Rp3 NP protein</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: (Abcam Cat# ab6939, RRID:AB_955021)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following cells were used for virus isolation in this study: Vero, Vero E6, and Huh7 that were cultured in DMEM +10% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: CLS Cat# 300156/p7178_HuH7, RRID:CVCL_0336)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HeLa cells transiently expressing ACE2 were prepared by a lipofectamine 3000 system (Thermo Fisher Scientific) in 96-well plate, with mock-transfected cells as controls.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">nCoV-2019 grown from Vero E6 cells was used for infection at multiplicity of infection 0.05.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following cells were used for virus isolation in this study: Vero, Vero E6, and Huh7 that were cultured in DMEM +10% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The raw NGS reads were firstly processed by Cutadapt (v1.18) with minimum read length of 30bp.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cutadapt</div><div>suggested: (cutadapt, RRID:SCR_011841)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BWA (v0.7.12-r1039) was utilized to align reads to local database with a filter hits parameter at 0.8 FMM value and minimum alignment score at 30.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA</div><div>suggested: (BWA, RRID:SCR_010910)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">NGS reads were assembled into genomes using Geneious (v11.0.3) and MEGAHIT (v1.2.9).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Geneious</div><div>suggested: (Geneious, RRID:SCR_010519)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence alignment and editing were conducted using ClustalW and GeneDoc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ClustalW</div><div>suggested: (ClustalW, RRID:SCR_017277)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Maximum Likelihood phylogenetic trees based on nucleotide sequences of full-length ORF1b and S genes were constructed using the Jukes-Cantor model with bootstrap values determined by 1000 replicates in the MEGA6 software package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA6</div><div>suggested: (MEGA Software, RRID:SCR_000667)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.07.16.20155853: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Patient samples and Institutional Review Boards: This study used samples from the research project “Immune response dynamics as predictor of COVID-19 disease evolution.<br>Consent: All included patients (or their representatives) were informed about the study and gave a written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plates were washed again and 100 μL/well of the indicated detection antibody [(AffiniPure Rabbit Anti-Human IgM, Fcµ fragment specific;</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Human IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Rabbit Anti-Human Serum IgA, α chain specific; AffiniPure Rabbit Anti-Human IgG, Fcγ fragment specific) from Jackson Labs, or anti-human (Fab)’2 HRPO-labelled antibody from Thermo Fisher Scientific] was added and incubated for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Human Serum IgA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-Human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The recombinant cDNA was cloned in a vector derived from the pEF-BOS (11) for transient expression in HEK293 cells, and in the pBJ5-GS vector for stable protein production in CHO cells following the glutamine synthetase system (12).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CHO</div><div>suggested: CLS Cat# 603479/p746_CHO, RRID:CVCL_0213)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Graphics and statistical analysis was performed with Graph Pad Prism 8 Software (GraphPad Software, USA, www.graphpad.com) and Stata 14.0 for Windows</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.07.30.227470: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For CR3022, CR3015 (van den Brink et al., 2005), CR3046 and S309 (Pinto et al., 2020) the heavy and light chain were cloned into a single IgG1 expression vector to express a fully human IgG1 antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR3015</div><div>suggested: (Fitzgerald Industries International Cat# 10C-CR3015M1, RRID:AB_1288272)</div></div><div style="margin-bottom:8px"><div>CR3046</div><div>suggested: (Fitzgerald Industries International Cat# 20C-CR3046R, RRID:AB_1288447)</div></div><div style="margin-bottom:8px"><div>S309</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>human IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, cells were incubated in 50 μl/well blocking buffer containing primary antibodies ACE2-Fc (5 µg/mL, 1 µg/mL and 0.2 µg/mL)(1 µg/mL for radar plot), S309 (1 µg/mL), SAD-S35 (1 µg/mL), CR3015 (5 µg/mL), CR3022 (5 µg/mL), CR3046 (5 µg/mL), and convalescent serum (1:400) for 1 hr at 4 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After blocking, the cells were incubated with 50 μl/well of secondary antibodies HRP conjugated Mouse Anti Human IgG (Jackson, 1:2500) or HRP Conjugated goat anti mouse IgG (Jackson, 1:2500) then incubated 40 min at 4 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti Human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed twice with FACS buffer and stained with goat anti-Human IgG Alexa Fluor 647 (Invitrogen) or goat anti-Mouse IgG Alexa Fluor 647 (Invitrogen) secondary antibody for 30 min in FACS buffer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation, the membrane was washed three times with TBST for 5 min and subsequently incubated for 1 hr with 1:10,000 IRDye 800CW-conjugated goat-anti-human secondary antibody (Li-COR) in TBST-5% Blocker.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>secondary</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For IgG1 and IgG2a ELISAs, a similar protocol was followed as described above, but respectively using Goat anti-Mouse IgG1-HRP and Goat anti-Mouse IgG2a-HRP as secondary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Mouse IgG1-HRP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Mouse IgG2a-HRP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry: MRC-5 cells (0.4×106 cells/well) were seeded in 6-well plates and after overnight growth transduced with Ad26 vectors encoding SARS-CoV-2 S transgenes at 5000 vp/cell for 48 hrs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MRC-5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BioLayer Interferometry (BLI): Expi293F cells were transiently transfected using ExpiFectamine (Life Technologies) according to the manufacturer’s instructions and cultured for 3 days at 37°C and 10% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293F</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Acceptor HEK293 cells were transfected in 6-well plates (Corning) with ACE2, TMPRSS2 and the PEP86 subunit, or just the PEP86 subunit (‘No spike’) as negative control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero-E6 cells were seeded at 12,000 cells/well in 96-well tissue culture plates 1 day prior to infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 30 min incubation, the mixture was inoculated onto susceptible Vero E6 cells in MW96 well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animals: Female BALB/c or C57BL6 mice (specific pathogen-free), aged 8-12 weeks at the start of the study were purchased from Charles River laboratories (Sulzfeld, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>C57BL6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data processing for the different proteins was performed using Biopharma finder 3.1 (Thermo Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Biopharma</div><div>suggested: (TransCelerate BioPharma, RRID:SCR_003728)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Overlays between brightfield and GFP channels were made in ImageJ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using SAS version 9.4 (SAS Institute Inc. Cary, NC, US) and R version 3.6.1 (2019-07-05).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04436276</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Study of Ad26.COV2.S in Adults (COVID-19)</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.01.24.919183: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Paired-end (150 bp) sequencing of the RNA library was performed on the MiniSeq platform (Illumina)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MiniSeq</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data processing and viral agent identification: Sequencing reads were first adaptor- and quality-trimmed using the Trimmomatic program26.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Trimmomatic</div><div>suggested: (Trimmomatic, RRID:SCR_011848)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All of these assembled contigs were compared (using blastn and Diamond blastx) against the entire non-redundant nucleotide (Nt) and protein (Nr) database, with e-values set to 1×10-10 and 1×10-5, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>blastn</div><div>suggested: (BLASTN, RRID:SCR_001598)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To identify possible aetiologic agents present in the sequence data, the abundance of the assembled contigs was first evaluated as the expected counts using the RSEM program28 implemented in Trinity.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RSEM</div><div>suggested: (RSEM, RRID:SCR_013027)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Non-human reads (23,712,657 reads), generated by filtering host reads using the human genome (human release 32, GRCh38.p13, downloaded from Gencode) by Bowtie229, were used for the RSEM abundance assessment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gencode</div><div>suggested: (GENCODE, RRID:SCR_014966)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As the longest contigs generated by Megahit (30,474 nt) and Trinity (11,760 nt) both had high similarity to the bat SARS-like coronavirus isolate bat-SL-CoVZC45 and were at high abundance (Table S1 and S2), the longer one (30,474 nt) that covered almost the whole virus genome was used for primer design for PCR confirmation and genome termini determination.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Trinity</div><div>suggested: (Trinity, RRID:SCR_013048)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The viral genes were aligned using the L-INS-i algorithm implemented in MAFFT (version 7.407)31.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic trees were inferred using the Maximum likelihood (ML) method implemented in the PhyML program (version 3.0)32, using the Generalised Time Reversible substitution (GTR) model and Subtree Pruning and Regrafting (SPR) branch-swapping.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PhyML</div><div>suggested: (PhyML, RRID:SCR_014629)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The best-fit model of nucleotide substitution was determined using MEGA (version 5)33</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA</div><div>suggested: (Mega BLAST, RRID:SCR_011920)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Amino acid identities among sequences were calculated using the MegAlign program implemented in the Lasergene software package (version 7.1, DNAstar)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MegAlign</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Genome recombination analysis: Potential recombination events in the history of the sarbecoviruses were assessed using both the Recombination Detection Program v4 (RDP4)16 and Simplot (version 3.5.1)34.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Recombination Detection Program</div><div>suggested: (Recombination Detection Program, RRID:SCR_018537)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sequences of the spike RBD domains of WHCV, Rs4874 and Rp3 were searched by BLAST against the primary amino acid sequence contained in the SWISS-MODEL template library (SMTL, last update: 2020-01-09, last included PDB release: 2020-01-03).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.01.22.915660: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells: 293T, A549, BHK, Caco-2, Huh-7.5, PK-15, and Vero cells were maintained in DMEM (Sigma) supplemented with 10% FBS, penicillin/streptomycin, and L-glutamine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RhiNi/40.1, AJ-primary, AJi, HypNi, RaKSM-2.5i, RhiLu, and RhiNi cells were maintained in DMEM/F12 (Gibco) supplemented with 12% FBS, penicillin/streptomycin, non- essential amino acids, sodium pyruvate and L-glutamine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RhiNi</div><div>suggested: RRID:CVCL_RX64)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Receptor transfection: BHK cells were seeded in black 96-well plates and transfected the next day with 100ng plasmid DNA encoding human ACE2, DPP4, APN or empty vector, using polyethyleneimine (Polysciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T cells were seeded onto 6-well plates pre-coated with poly-L-lysine (Sigma) and transfected the next day with 1200ng empty plasmid and 400ng of plasmid encoding coronavirus spike or GFP as a no pseudotype control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.10.20171777: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The databases searched were Medline, Embase, Cochrane Library, International Network of Agencies for Health Technology Assessment (INAHTA)HTA database & Open Grey, to include all evidence published up to 4 May 2020.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Medline</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div><div style="margin-bottom:8px"><div>Embase</div><div>suggested: (EMBASE, RRID:SCR_001650)</div></div><div style="margin-bottom:8px"><div>Cochrane Library</div><div>suggested: (Cochrane Library, RRID:SCR_013000)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pooled estimates were calculated for diagnostic accuracy outcomes using a random effects bivariate binomial model in MetaDTA v1.25.[</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MetaDTA</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Of the 25 studies that assessed antibody tests, 10 reported diagnostic accuracy in terms of both sensitivity and specificity, almost all using RT-PCR (initial or repeat testing) as the reference standard.[18,22,23,25-27,30-33] Accepting the limitations already discussed around the absence of a diagnostic reference standard, the overall sensitivity reported in these studies varied widely, from 18.4% to 96.1% although the specificity was more consistent and ranged from 88.9% to 100%. The clinical implications of these data are that considerable uncertainty remains about the implications of a negative antibody test with a significant possibility of false negativity, while the presence of a positive antibody test carries with it a high likelihood of previous COVID-19 infection. There is very limited information available on the accuracy of point-of-care antibody tests. Our study has some limitations, primarily due to the nature of the evidence found by our searches. The rapid nature of this work (to help inform decision makers at the outset of the COVID-19 pandemic in the United Kingdom) meant some steps in a full systematic review were not completed: there was minimal consultation with decision makers on the inclusion and exclusion criteria for the review, and we did not publish our protocol in advance of commencing the review. Other limitations relate to the nature of the evidence we found, and that this work was completed during the early stages of the COVID-19 pandemic. The l...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.06.240325: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The baculovirus was amplified through two passages in Sf9 cells, and then used to infect 1 L of Sf21 cells (Expression Systems) and incubated for 48 hrs at 27°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sf9</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A custom written Labview routine 36 controlled the data acquisition and the (x-, y-, z-) positions analysis/tracking of both the magnetic and reference beads in real-time.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Labview</div><div>suggested: (LabView , RRID:SCR_014325)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Maximum likelihood estimation (MLE) fitting routine: The above stochastic-pausing model was fit to the dwell time distributions using a custom Python 3.7 routine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.01.30.926881: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Biotinylated Ub-based probes were detected with a fluorescent streptavidin Alexa Fluor 647 conjugate (1:10 000) in TBS-T with 1% BSA, and UCH-L3 was detected with a mouse anti-human monoclonal IgG1 antibody (1:1000) and fluorescent goat anti-mouse (1:10 000) using an Azure Biosystems Sapphire™ Biomolecular Imager and Azure Spot Analysis Software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human monoclonal IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DUB labeling in cell lysates: A-431 cells were cultured in DMEM supplemented with 10% fetal bovine serum, 2 mM L-glutamine, and antibiotics (100 U/mL penicillin, 100 µg/mL streptomycin) in a humidified 5% CO2 atmosphere at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A-431</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Kinetic parameters were calculated using GraphPad Prism software with the Michaelis-Menten equation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.07.241877: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics statement-: All animal studies were conducted in accordance with the Guide for Care and Use of Laboratory Animals of the National Institutes of Health and approved by the Saint Louis University Animal Care and Use Committee (IACUC; protocol 2771).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Horseradish peroxidase conjugated goat-anti-human IgG secondary antibody was added and allowed to incubate for 1 hour at room temperature prior to being washed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A p2 stock was then grown from this p1 stock by infecting Vero-E6 cells at an MOI of 0.01 in complete DMEM and harvested at 96 hours post infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In vitro transfection and infection experiments were completed using murine fibroblast 3T3 cells cultured in complete DMEM and were obtained from American Type Culture Collection (ATCC CRL-1658).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>3T3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibody-virus complex was then added to each well of a 96-well flat bottom plate containing a monolayer of Vero WHO cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero WHO</div><div>suggested: ECACC Cat# 88020401, RRID:CVCL_JF53)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Foci of infected Vero cells were stained with anti-SARS polyclonal guinea pig sera (BEI) overnight at 4°C and washed 3 times with 0.05% Triton-X in PBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Eight-week-old Ifnar1-/- mice were transfected with 10 μg of RNA using Polyplus in vivo-jet RNA in vivo transfection reagent prepared according to the manufacturer’s instructions and administered via intravenous (IV) and intranasal (IN) combination route (100 μl and 20 μl, respectively). 24 hours following transfections, mice were infected with 5×104 focus forming units (FFU) of SARS-CoV-2 via IV and IN combination route (100 μl and 20 μl, respectively).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ifnar1-/-</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.13.20173757: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RT-LAMP reaction mixtures: RT-LAMP reactions were prepared by mixing 7.5 μl commercial 2x LAMP master mix (NEB E1700L) or our own LAMP mix (40 mM TrisHCl, pH 8.5, 20 mM (NH4)2SO4, 100 mM KCl, 16 mM MgSO4, 0.2% Tween-20, 2.8 mM each dNTP, 16 µg/ml polA LF, and 2.6-7.7 µg/ml RT) with 1.5 μl of 10x primer/beacon master mix (final concentration: 1.6 μM FIP/BIP, 0.2 μM F3/B3, 0.4 μM LF/LB,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>LAMP</div><div>suggested: (LAMP, RRID:SCR_001740)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The assay was performed using the ThermoFisher QuantStudio 5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher QuantStudio</div><div>suggested: (Primer Express Software, RRID:SCR_017376)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.09.20154435: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">A healthy clean-shaven male test subject in his 20s (non-smoker, no known respiratory illnesses, no current medications, average peak expiratory flow of 720 l/min) was used to demonstrate the effects of each mask.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      We are aware of the limitations of these results due to the absence of precision measurements, singular tests without repetition and variability in tidal volumes and force of exhalation. To an extent, these will have been minimised by using the same test subject and through attempting to standardise the evaluation protocol. It is difficult to draw definitive conclusions beyond comparing the vapour plume between the tests. In doing so, the images starkly demonstrate that in normal conditions, even in the absence of forced exhalation, the flutter valve permits exhaled material to enter the surrounding environment. Previous studies have demonstrated that fluid-repellent surgical masks are effective at directing exhaled material laterally and away from the patient15,26. Based on our results some FFP3 masks may instead be redirecting the exhaled material towards the patient. This may represent an increased risk of infection in cases where mucosal surfaces are exposed, e.g. during surgery or intubation. Further studies are mandatory to confirm and expand on our findings.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.09.242867: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Periplasmic extract ELISA (PE-ELISA): In order to identify positive clones, 400 clones from each of the 4 libraries were randomly picked and expressed in microplate for PE-ELISA verification.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mouse anti-HA antibody (Covance, Princeton, NJ, USA) and goat anti-mouse IgG-alkaline phosphatase (Sigma-Aldrich) were added to the wells for incubation successively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HA</div><div>suggested: (Covance Cat# MMS-101P, RRID:AB_2314672)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, the plates were incubated with the mouse anti-HA antibody followed by goat anti-mouse IgG-alkaline phosphatase (Sigma-Aldrich).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG-alkaline</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The HEK 293 were grown in DMEM supplemented with 1% Penicillin-Streptomycin and 10% FBS for Nbs functional analysis, and in CD05 (OPEM, SH, CN) for proteins production.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Activity assay of Nbs blocking SARS-CoV-2-RBD/ACE2: To determine the activity of anti-SARS-CoV-2-RBD Nbs blocking SARS-CoV-2-RBD/ACE2 interaction, ACE2/HEK 293 stable cell line was constructed using a lentiviral packaging system. 3×105 ACE2/HEK 293 cells were incubated with the 2.5 μg/mL purified SARS-CoV-2-RBD labeled with biotin, and a gradient concentration of anti-SARS-CoV-2-RBD Nbs, followed by staining with streptavidin-PE (eBioscience, San Diego, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ACE2/HEK 293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">200 μL of the Nbs-virus mixture was added into a 24-well culture plate containing Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of SARS-CoV-2 spike RBD wildtype and mutant proteins: The coding sequence of SARS-CoV-2 spike RBD was achieved from the UniProt website (https://www.uniprot.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UniProt</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div><div style="margin-bottom:8px"><div>https://www.uniprot.org/</div><div>suggested: (Universal Protein Resource, RRID:SCR_002380)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic tree: The multiple alignment and the construction of the tree was made by Clustal Omega, and pair-wise distance was calculated by the strategy of Neighbor-joining47.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Clustal Omega</div><div>suggested: (Clustal Omega, RRID:SCR_001591)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The binding interaction model of Nb with SARS-CoV-2 Spike protein were generated by Pymol (https://pymol.org/2/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pymol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analysis was performed using GraphPad Prism 6 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04452318</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">COVID-19 Study Assessing the Efficacy and Safety of Anti-Spi…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.12.248823: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animal work was approved under Fred Hutchinson Cancer Research Center IACUC protocol (1893). 2.5. Spike Pseudotyped Lentivirus Neutralization assays: SARS-CoV-2</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animal studies: Seven week old female BALB/c mice (Jackson Labs) anesthetized intraperitonially with 100mg/kg of ketamine + 10mg/kg of xylazine in PBS and infected intranasally with 50ul of either a high (8 × 105 TCID50) or low (8 × 104 TCID50) dose of ΔNA(RBD)-Flu, or with ΔNA(GFP)-Flu virus (8 × 104 TCID50), or mock infected with OptiMEM.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were stained with either recombinant biotinylated ACE2 ectodomain (ACROBiosystems, AC2-H82E6) or CR3022 antibody (kindly provided by Neil King and Mike Murphy, University of Washington, Institute for Protein Design) for 1 hour at room temperature, washed with FACS buffer, resuspended in secondary stain, a 1:200 dilution of PE-conjugated streptavidin (Thermo Fisher, S866) or PE-conjugated Goat Anti-Human IgG (Jackson Labs, 109-115-098), and incubated on ice for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AC2-H82E6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div><div style="margin-bottom:8px"><div>Anti-Human IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-115-098, RRID:AB_2337675)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, we transfected a co-culture of 293T cells and MDCK-SIAT1-TMPRSS2 cells [34] with reverse genetics plasmids encoding the internal segments from the A/WSN/33 virus (PB1, PB2, PA, NP, M, NS), the hemagglutinin (HA) segment from the A/Aichi/2/1968 virus with an amino acid mutation in the receptor binding site (Y98F), and either the ΔNA(RBD) or ΔNA(GFP) segment described above, or the NA segment from A/WSN/33 virus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>MDCK-SIAT1-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We infected MDCK-SIAT1-TMPRSS-2 cells at a low multiplicity of infection (MOI = 0.02 TCID50).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDCK-SIAT1-TMPRSS-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infections of 293T-ACE2 cells were performed in poly-L-lysine coated plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The neutralization assays were performed in MDCK-SIAT1-CMV-PB1 cells using this GFP-expressing virus as described previously [36–39].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDCK-SIAT1-CMV-PB1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animal studies: Seven week old female BALB/c mice (Jackson Labs) anesthetized intraperitonially with 100mg/kg of ketamine + 10mg/kg of xylazine in PBS and infected intranasally with 50ul of either a high (8 × 105 TCID50) or low (8 × 104 TCID50) dose of ΔNA(RBD)-Flu, or with ΔNA(GFP)-Flu virus (8 × 104 TCID50), or mock infected with OptiMEM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis and compensation were performed using FlowJo v10.7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As with Spike pseudotyped lentivirus neutralization assays, curves were plotted and IC50s were calculated using the neutcurve Python package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Our study also has several important limitations. First, we examined the effect of ΔNA(RBD)-Flu vaccination only in influenza-naïve mice. For other live attenuated vaccines, pre-existing immunity against the vaccine vector (influenza virus, in this case) can reduce effectiveness [46,47]. This limitation could potentially be overcome by creating variants of ΔNA(RBD)-Flu that contain HA subtypes to which the human population is naïve, although we did not attempt that here. Second, we performed experiments using only in a single strain of mice (BALB/cJ) and have not examined the results of vaccination with ΔNA(RBD)-Flu in non-human primates or other animal models. Third, although the ΔNA(RBD)-Flu grew to reasonably high titers that were sufficient for our experiments, the titers were still lower than those obtained using virus with an intact NA segment. Fourth, although we demonstrated high SARS-CoV-2 neutralizing antibody titers at three weeks post vaccination, we did not perform experiments to examine the durability of these titers over longer timeframes. Finally, while the presence of neutralizing titers against SARS-CoV-2 is correlated with protection against infection in animal models [48,49] and preliminarily in human studies [50], we did not directly test if the neutralizing antibodies elicited by ΔNA(RBD)-Flu are protective against viral challenge. Despite these limitations, vaccines based on ΔNA(RBD)-Flu have several possible advantages. First, the vaccine induces neutr...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.07.06.20147256: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study definitions: ACRI was affirmed when cTnI level was >0.342 μg/L for males and >0.156 μg/L for females17 or NT-proBNP level was ⩾ 486 pg/mL.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Current diagnostic tests for COVID-19 include RT-PCR assay of nasal and pharyngeal swab specimens for nucleic acid, positive serology for anti-COVID-19 specific IgM and/or IgG antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-COVID-19 specific IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were conducted using SAS 9.4 (SAS Institute Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations: This study has some limitations. First, due to the retrospective study design, not all laboratory tests were done in all patients, and the laboratory index testing for each patient was measured at different time. Second, due to special circumstances during the outbreak, arterial blood gas test, electrocardiography and echocardiography data were lacking for many cases, which limits the assessment of the extent of ACRI. Third, we did not monitor the dynamic change of blood pressure, which made this study lack of evidence of new onset hypertension to support our hypothesis. Last, it was a single-center study. The number of samples is not big enough and selection bias may exist, thus further prospective multi-centric clinical studies are warranted to further confirm the findings obtained in the present study.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.13.248575: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence data collection: A total of 3,665 complete nucleotide genomes of the “Coronaviridae” family were downloaded from the Virus Pathogen Database and Analysis Resource (ViPR) database 5 to be used for machine learning algorithm training.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ViPR</div><div>suggested: (vipR, RRID:SCR_010685)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FASTA sequences for S protein (YP_009724390), E protein (YP_009724392), M protein (YP_009724393), N protein (YP_009724397), NSP3 (YP_009742610), NSP5 (YP_009742612), NSP8 (YP_009742615), NSP9 (YP_009742616), and NSP12 (YP_009725307) were obtained from the NCBI Protein database and used for downstream evolutionary and immune epitope analyses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NCBI Protein</div><div>suggested: (NCBI Protein, RRID:SCR_003257)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Genetic features including nucleotides and gaps for a given window were converted to binary vector representations using LabelEncoder and OneHotEncoder from the Python scikit-learn library 31</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Additional Python libraries used include BioPython 32, NumPy 33, and pandas 34.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioPython</div><div>suggested: (Biopython, RRID:SCR_007173)</div></div><div style="margin-bottom:8px"><div>NumPy</div><div>suggested: (NumPy, RRID:SCR_008633)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Five supervised learning classifiers from scikit-learn were used for training and evaluation, with seeds set at 17 for algorithms that use a random number generator.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>scikit-learn</div><div>suggested: (scikit-learn, RRID:SCR_002577)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Evolutionary analyses: Protein sequences used for evolutionary analyses were aligned using MAFFT version 7 with the “L-INS-i” strategy 30.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alignments were visualized using Jalview 2.11.1.0 35.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Jalview</div><div>suggested: (Jalview, RRID:SCR_006459)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenic analyses were performed using MEGA10.1.8 software 36.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA10.1.8</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.11.246314: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics Statement: Animal experiment approval was provided by the Institutional Animal Care and Use Committee (IACUC) at Rocky Mountain Laboratories.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">All tissue slides were evaluated by a board-certified veterinary anatomic pathologist blinded to study group allocations.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animal experiments: Four to six week-old male and female (15 animals each) transgenic K18-hACE2 mice expressing hACE2 (Jackson laboratories, USA, (20)) were inoculated intranasally (I.N.) with 25 µL sterile Dulbecco’s Modified Eagle Medium (DMEM) containing either 104 TCID50 (low dose group, n = 14), 105 TCID50 (high dose group, n = 14) or 105 TCID50 γ-irradiate (45) (control group, n = 2) SARS-CoV-2.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike-specific antibodies were detected with goat anti-mouse IgM or IgG Fc (horseradish peroxidase (HRP)-conjugated, Abcam) for 1 h at RT and visualized with KPL TMB 2-component peroxidase substrate kit (SeraCare, 5120-0047).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Specific anti-CoV immunoreactivity was detected using an in-house SARS-CoV-2 nucleocapsid protein rabbit antibody at a 1:1000 dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 nucleocapsid protein</div><div>suggested: (Bioss Cat# bsm-41414M, RRID:AB_2848129)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Macrophage (CD68) and T-cell (CD3) immunoreactivities were detected using CD68 rabbit polyclonal antibody (Abcam) at a 1:250 dilution and prediluted CD3 rabbit monoclonal antibody (2GV6, Roche Tissue Diagnostics), respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD68</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, ImmPRESS-VR Horse anti-rabbit polymer was used as the secondary antibody (Vector Laboratories).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">B-cell (CD45) immunoreactivity was detected using anti CD45R rat monoclonal antibody (Abcam) at a 1:500 dilution and ImmPRESS goat anti-rat polymer (Vector Laboratories) as secondary antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD45</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti CD45R</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rat polymer</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6 cells were maintained in DMEM supplemented with 10% fetal bovine serum, 1 mM L-glutamine, 50 U/mL penicillin and 50 μg/mL streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.07.28.20162941: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Serum samples: Serum samples corresponding to preCOVID and acute COVID individuals were provided by the Basque Biobank (www.biobancovasco.org) after approval from the corresponding ethics committee (CEIC-E 20-26, 1-2016).<br>Consent: All participants in the study provided informed consent and were anonymized.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies were diluted in 100 µL of PBS containing 5% FBS: anti-human IgG-PE (1:50) (Clone G18-145, BD Biosciences Cat#555787</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG-PE</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-3756, RRID:AB_654591)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) and anti-human IgM-BV421 antibodies (1:1000) (Clone G20-127, BD Biosciences Cat#555783).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgM-BV421</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After three washes with 250 μL of PBST in a plate washer (Biotek), each well was incubated with an anti-human IgG-horseradish peroxidase (HRP) conjugated secondary antibody (1:5000) (GenScript Cat#A01854) or anti-human IgM-HRP (Novus Biologicals Cat#NBP1-75014) for 1 hour at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG-horseradish</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgM-HRP</div><div>suggested: (SouthernBiotech Cat# 2020-05, RRID:AB_2795603)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pearson correlation analyses between gMFI values obtained by C19BA and percentage of inhibition obtained by the neutralization assay for anti-RBD, anti-S1 and anti-N IgG antibodies were calculated using Prism 8 (GraphPad) considering a 95% confidence interval.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-N IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Results were analyzed using FlowJo version 10 (BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization assay: Binding of RBD to recombinant ACE2 was measured by a commercial surrogate virus neutralization test (sVNT) (cPass™ SARS-CoV-2</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: (Active Motif Cat# 91351, RRID:AB_2847848)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed using Prism 8 (GraphPad)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogram generated from the FASTA alignment file was performed using FastTree (https://www.genome.jp/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FastTree</div><div>suggested: (FastTree, RRID:SCR_015501)</div></div><div style="margin-bottom:8px"><div>https://www.genome.jp/</div><div>suggested: (GenomeNet, RRID:SCR_004165)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.11.247395: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: After a 7-day acclimation time, mice were anesthetized with a mixture of ketamine/xylazine and challenged intranasally with 105 plaque-forming units (pfu) of mouse-adapted SARS-CoV-2 MA strain for the evaluation of vaccine efficacy (IACUC protocol 20-114.0).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mouse immunizations and challenge: Female BALB/c (Stock: 000651) mice were purchased at the age of four weeks from The Jackson Laboratory, Bar Harbor, Maine, and maintained at the Comparative Medicine Facility at the University of Washington, Seattle, WA, accredited by the American Association for the Accreditation of Laboratory Animal Care International (AAALAC).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed 4x in TBST, then anti-mouse (Invitrogen) or anti-human (Invitrogen) horseradish peroxidase-conjugated antibodies were diluted 1:5,000 and 25 μL added to each well and incubated at 37°C for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293T cells were co-transfected using Lipofectamine 2000 (Life Technologies) with an S-encoding plasmid, an MLV Gag-Pol packaging construct, and the MLV transfer vector encoding a luciferase reporter according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The seed virus was amplified twice in Vero E6 cells at low moi for 48 h to create a working stock which was titered by plaque assay (Hou et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse immunizations and challenge: Female BALB/c (Stock: 000651) mice were purchased at the age of four weeks from The Jackson Laboratory, Bar Harbor, Maine, and maintained at the Comparative Medicine Facility at the University of Washington, Seattle, WA, accredited by the American Association for the Accreditation of Laboratory Animal Care International (AAALAC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_JAX:000651)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Chromatographic peaks for the most abundant and non-overlapped isotopic peaks were determined and integrated with MassLynx (Waters).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MassLynx</div><div>suggested: (MassLynx , RRID:SCR_014271)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were immediately read at 450 nm on a VarioSkanLux plate reader (ThermoFisher) and data plotted and fit in Prism (GraphPad) using nonlinear regression sigmoidal, 4PL, X is log(concentration) to determine EC50 values from curve fits.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fifty percent inhibition titer (IC50) was calculated in GraphPad Prism 8.3.0 by fitting the data points using a sigmoidal dose-response (variable slope) curve.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were run on the Cytek Aurora and analyzed using FlowJo software (Treestar)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data were baseline subtracted and aligned to pre-loading with polyclonal Fabs using the Pall Forté Bio/Sartorius analysis software (version 12.0) and plotted in PRISM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PRISM</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT03547245</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Phase I Trial to Evaluate the Safety and Immunogenicity of…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT03186781</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Influenza HA Ferritin Vaccine, Alone or in Prime-Boost Regim…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT03814720</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Dose, Safety, Tolerability and Immunogenicity of an Influenz…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 39. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.10.241414: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 (ATCC HTB-55) and Caco-2 (ATCC HTB-37) were cultured in Eagle's Minimum Essential Medium (EMEM) supplemented with 10% FCS, 2 mM L-glutamine, 100 IU/mL penicillin, 100 μg/mL streptomycin and 1x non-essential amino acid solution (Gibco MEM</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: ATCC Cat# HTB-55, RRID:CVCL_0609)</div></div><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 seeded in a well of a 24-well plate were infected with 30 PFU of SARS CoV 2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plaque area was measured with help of ZEISS ZEN lite 3.0 (Blue edition), and plotted using GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting sequence reads were aligned with reference (BWA 0.7.8).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA</div><div>suggested: (BWA, RRID:SCR_010910)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The alignment file was sorted (SAMtools version 1.10) and realigned (GATK IndelRealigner version 3.7).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GATK</div><div>suggested: (GATK, RRID:SCR_001876)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Finally, pileup file (SAMtools) was created and mutation were detected with VarScan (version 2.3.9).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAMtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div><div style="margin-bottom:8px"><div>VarScan</div><div>suggested: (VARSCAN, RRID:SCR_006849)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mutation frequencies were converted to percent values and plotted with ggplot2 (R/Bioconductor 4.0)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.07.242271: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This program and associated human subject research, performed in in accordance with the ethical standards of the Helsinki Declaration, were approved by the NorthShore University HealthSystem Institutional Review Board.<br>Consent: All potential donors provided written consent for the study and provided information about their COVID-19 disease history and demographics.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Samples were divided into tertiles based on the Roche assay results, then 47 were randomly selected to equally sample each tertile.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 S1 RBD Ig ELISA: The anti-SARS-CoV-2 S1 RBD total Ig assay employed a standard indirect enzyme immunoassay technique (ELISA), described in detail elsewhere, using a secondary antibody recognizing all human immunoglobulin isotypes (goat anti-human IgG H+L-HRP, Invitrogen/ThermoFisher) [12,13]</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgG H+L-HRP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Live SARS-CoV-2 Virus Neutralization Assay: Vero E6 cells (2.5×104) were seeded in each well of a 96-well Black/Clear Flat Bottom TC-treated plate (Falcon) and incubated in DMEM overnight at 37°C with 5% CO2 prior to infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A nonlinear regression method was used to determine the dilution that neutralized 50% of mNeonGreen fluorescence (NT50) by using Prism 8 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.09.242917: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Production of human monocyte-derived macrophages and dendritic cells: Blood samples were obtained from healthy human donors (Hospital 12 de Octubre, Madrid, Spain) under informed consent and IRB approval.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate monocyte-derived macrophages (M2-MDMs), CD14+ monocytes were purified using anti-human CD14 antibody-labeled magnetic beads and iron-based LS columns (Miltenyi Biotec) and used directly for further differentiation into macrophages (Dominguez-Soto et al., J Immunol 2011).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human CD14</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As a control, inhibition experiment was performed in the presence of anti-DC/L-SIGN antibody (R&D Systems).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-DC/L-SIGN</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">EXPI293 cells grown in EXPI293 expression medium were transiently transfected with the S ectodomain vector according to the manufacturer’s protocol (Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EXPI293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: Baby hamster kidney cells (BHK-21, 12-14-17 MAW, Kerafast, Boston, MA) and African Green Monkey Cell Line (VeroE6) were cultured in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum (FBS), 25 μg/mL gentamycin and 2 mM L-glutamine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Trans-infection: For trans-infection studies, Jurkat DC-SIGN, Jurkat L-SIGN, Jurkat Langerin (3 × 105 cells) or MDDCs (5 × 104 cells) were challenged with recombinant SARS-CoV-2, EBOV-GP or VSV-G pseudotyped viruses (MOI: 0.5-2) and incubated during 2 h at room temperature with rotation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Jurkat</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Jurkat DC-SIGN and MDDCs were then resuspended in RPMI medium and co-cultivated with adherent Vero E6 cells (1.5 × 105 cells/well) on a 24-well plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Jurkat DC-SIGN</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To facilitate the visualization of the molecules, a Gaussian filter was applied to the images using Photoshop, then the gray levels were saturated and the background eliminated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Photoshop</div><div>suggested: (Adobe Photoshop, RRID:SCR_014199)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the 2D classification, images were processed with RELION 2.1 (Scheres, 2012).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RELION</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.12.20171694: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical approval: This study was approved by the Institutional Review Board at the Icahn School of Medicine at Mount Sinai, IRB-20-03424, and approved by NYC Health + Hospitals.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study design and setting: We retrospectively reviewed medical charts of all pregnant women who were universally screened for SARS-CoV-2 on admission to the L&D Unit at Elmhurst Hospital.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      One limitation of our study was the use of two different test types for universal screening. We were initially using BioReference Laboratory tests which returned in several days, and as rapid tests became available we switched to the Cepheid Rapid PCR. These tests likely had different sensitivities and specificities (though we were not provided with this information) and may have affected our screening results. SARS-CoV-2 screening fundamentally shifted the way we roomed, counseled, and followed women (Fig 2). Cohorting women by SARS-CoV-2 infection status allowed us to most safely use the restricted space. Several walls were built to further partition the space in the triage, labor, and postpartum areas in order to ensure separation of SARS-CoV-2 positive women and those of unknown status from women known to be negative. In the early days of the pandemic, SARS-CoV-2 positive mothers were roomed separately from their infants, however, this procedure was reconsidered as the volume of known SARS-CoV-2 positive mothers increased with universal screening. Given limited physical space and staff to isolate all infants and considering the importance of simulating the home-environment during the postpartum hospitalization to promote safe infant care and breastfeeding, we proceeded with shared decision making with SARS-CoV-2 positive mothers around rooming-in with their infants. Severe overcrowding of housing is a challenge where most of our mothers live, making isolation of a baby an...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.15.252437: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All animal studies were approved by the Institutional Animal Ethics committee (IAEC) No. RR/IAEC/72-2019, Invivo/GP/084.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Guinea Pig Immunizations: Groups of four, female, Hartley strain guinea pigs, (6-8 weeks old, approximately weighing 300 g) were immunized with 20 μg of purified antigen protein diluted in 50 μl PBS, (pH 7.4), and mixed with 50 μl of AddaVax™ adjuvant (vac-adx-10) (1:1 v/v Antigen: AddaVax™ ratio per animal/dose) (InvivoGen, USA).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Genes for the heavy and light chain of the CR3022 antibody were obtained from Genscript (USA) and cloned into the pcDNA3.4 vector Purification of recombinant proteins expressed in Expi293F cells: Transfections were performed according to the manufacturer’s guidelines (Gibco, Thermofisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The expression levels were monitored by dot blot analysis with anti-His tag antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His tag antibodies .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following this blot was washed and incubated with α-guinea pig ALP conjugated antibody (Sigma) at 1:5000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>α-guinea pig ALP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following this, Rabbit ALP enzyme conjugated to anti-Guinea Pig IgG secondary antibody (diluted 1:5000 in blocking buffer) (50 μL/well) was added and incubated for 1 hour at 25 °C, 300 rpm (Sigma-Aldrich).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Guinea Pig IgG</div><div>suggested: (LSBio (LifeSpan Cat# LS-C56297-5000, RRID:AB_10379625)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, rabbit ALP enzyme conjugated to anti-Human IgG secondary antibody (diluted 1:5000 in blocking buffer) (50 μl/well) was added and samples incubated for 1 hour at 25°C, 300 rpm (Sigma-Aldrich).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human IgG secondary antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The wells were incubated with anti-His Antibody (1:10000 dilution) conjugated with Horseradish peroxidase (HRP) enzyme for 1 hr at RT following which the reaction was visualized by adding 50μL of the chromogenic substrate, TMB (Thermo Fisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: (LSBio (LifeSpan Cat# LS-C67878-100, RRID:AB_1815148)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the plasmids pCAGGS-SARS2-S and pCAGGS-SARS-S were transiently expressed on HEK 293T cells using Polyethylenimine (PEI) (Polysciences, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then the viruses were titrated in Vero E6 cells and stored at −80 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The unbound tag-free protein was collected and protein concentration was determined by absorbance (A280) using NanoDrop™2000c with the theoretical molar extinction coefficient calculated using the ProtParam tool (ExPASy).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ProtParam</div><div>suggested: (ProtParam Tool, RRID:SCR_018087)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reference-free 2D classification using single-particle analysis: The evaluation of micrographs was done with EMAN 2.1 (56).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EMAN</div><div>suggested: (EMAN, RRID:SCR_016867)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reference free 2D classification of different projections of particle were performed using simple_prime2D of SIMPLE 2.1 software (57</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SIMPLE</div><div>suggested: (SIMPLE, RRID:SCR_009389)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of Pseudotyped SARS-CoV-2 and pseudovirus neutralisation assay: The full-length synthetic construct of Spike glycoprotein of SARS-CoV-2 (GenBank: MN908947) was synthesized from Genewiz, UK.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Genewiz</div><div>suggested: (GENEWIZ, RRID:SCR_003177)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.27.20183434: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We supplemented the Medline search by hand-searching Epistemonikos COVID-19 in L^OVE Platform (https://app.iloveevidence.com/topics) and McMaster COVID-19 Evidence Alerts (https://plus.mcmaster.ca/COVID-19/) for relevant prognosis or aetiology studies up to 12 June 2020.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Medline</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Study Selection: All records retrieved by the searches were exported to a Microsoft Office Excel (Microsoft Corporation, Redmond, WA) spreadsheet for screening.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Office Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quality Assessments: To expedite quality assessments, we did not use a formal tool; instead we focused on key variables that were considered to be most relevant to the topic, and that would allow for meaningful stratification of studies by quality.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Quality Assessments</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The Equity Matrix applied to COVID-19 with evidence to-date can be found elsewhere.[11] Strengths and Limitations: The expedited methods used in this review allowed for a rapid but comprehensive synthesis of the highest quality evidence available on multiple risk factors associated with severe COVID-19 outcomes that is applicable to OECD countries. Generalizationsto other countries should be made with caution, as high risk groups in these populations may differ. We excluded studies only examining patients with severe COVID-19 (i.e., in ICU settings), and therefore our findings for mechanical ventilation and mortality are applicable to people with COVID-19 or in general populations, but not necessarily all those with severe infection. Most studies of patients in the ICU setting that we located were relatively small and descriptive in nature, such that many would have been excluded due to lack of adjustment or only have been able to provide low or very low certainty evidence due to their lack of precision. As described previously, many available studies do not control for any important confounding variables which limited the number of studies and risk factors included in this review. Given the rapid emergence of new evidence on the topic, potential associations (or lack of association) for which only low or very low certainty of evidence is available should continue to be reviewed as new primary research is published. There is a need for high quality primary research (accountin...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.07.12.20151068: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the Institutional Review Board at Columbia University Irving Medical Center.<br>Consent: Written consent was obtained from CPD subjects.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Cytopathic effect was revealed by crystal violet staining, and scored by an observer blinded to the study design and sample identity.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Peroxidase affiniPure goat anti-human IgG (H+L) antibody, anti-human IgM antibody (Jackson Immune Research, New Grove, PA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, or anti-human IgA antibody (Thermofisher, Waltham, MA) was subsequently added into each well and incubated for 1hr at 37°C, washed and TMB substrate (Sigma, St. Louis) was added and the reaction was stopped using 1M sulfuric acid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>1M sulfuric acid.</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantitation of antibody titrations in ELISA and neutralization assays: For quantitation of neutralization titers in the pseudovirus assay, RFP signal driven by the pseudovirus normalized to the GFP signal derived from the SARS-Cov-2 S protein and ACE2 transfected cells was measured at 24 and 48hr; the ratio of normalized RFP at 48 hours (RFP48) to normalized RFP at 24 hours (RFP24) was calculated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This expression vector was transiently transfected into HEK293F cells and the spike trimer secreted in the supernatant was purified 3-5 days post transfection by metal affinity chromatography using an Ni-NTA (Qiagen) column.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Initially, VSV-ΔG-RFP pseudotyped with VSV G is used to infect 293T (human kidney epithelial) cells that were co-transfected with full length codon optimized SARS-CoV-2 S-protein (Epoch Life Science, Sugar Land, TX), the viral entry receptor ACE2 (Epoch Life Science, Sugar Land, TX) and green fluorescent protein (GFP).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">During the assay, infected, S protein-expressing HEK293T cells generate VSV-ΔG-RFP viruses that bear S protein which subsequently infects and drives RFP expression in Vero cells and undergo multiple cycles of entry and budding in the HEK293T cells due to the co-expression of S protein with ACE2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Live virus neutralization assay: Two-fold dilutions of plasma in 50µL of Dulbecco’s Modified Eagle Media (DMEM) were incubated with 200 plaque forming unit (pfu) of SARS-CoV-2 in 50µL of DMEM for 30min at 4°C. 100µL of DMEM 4%FBS containing 4×104 Vero E6 cells were added on the top of the former mix in order to have final dilution of sera from 1:50 to 1:6400 (4 wells per dilution).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image analysis was performed using ImageJ 36.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Heatmaps of this ratio at all titrations for all samples were generated using the Python data visualization library, seaborn41</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: All statistical analysis was performed using Prism 8 software (GraphPad, San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.19.253369: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics Statement: The project “The application of antibody tests patients infected with SARS-CoV-2” was approved by the ethics committee of ChongQing Medical University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then these PBMCs was incubated with mixed antibodies cocktail at 4 °C for 30 min (the antibodies cocktail including FITC-anti-human CD19 antibody (Biolegend, clone: SJ25C1)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD19</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, BV421-anti-human IgD antibody (Biolegend, clone: IA6-2), PerCP-Cy5.5-anti-human IgG antibody (Biolegend, clone: M1310G05),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BV421-anti-human IgD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>PerCP-Cy5.5-anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The second PCR products were further cloned into the antibody linear expression cassettes or expression vectors to express full IgG1 antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>full IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed with phosphate-buffered saline, 0.05% Tween-20 (PBST) and ALP-conjugated goat anti-human IgG (H+L) antibody (Thermo Fisher) was added into each well and incubated at 37°C for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then ALP-conjugated anti-mouse-Ig-Fc antibody was added into the wells and incubated at 37°C for 30 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse-Ig-Fc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The CM5 chip (GE Healthcare) was coupled with an anti-human IgG-Fc antibody to capture 9000 response units antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG-Fc</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After measuring the nucleic acid concentration, purified overlapping PCR products of paired heavy and light chain expression cassettes were co-transfected in HEK293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation, the mixtures were then transferred into 96-well plates, which were seeded with Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis was performed utilizing the FlowJo software (FlowJo, LLC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Half-maximal inhibitory concentrations (IC50) were calculated using the four-parameter logistic regression in GraphPad Prism 8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence analysis of antigen-specific mAb sequences: IMGT/V-QUEST (http://www.imgt.org/IMGT_vquest/vquest) and IgBLAST (https://www.ncbi.nlm.nih.gov/igblast/), MIXCR (https://mixcr.readthedocs.io/en/master/) and VDJtools (https://vdjtools-doc.readthedocs.io/en/master/overlap.html) tools were used to do the VDJ analysis and annotation, germline divergence for each antibody clone.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgBLAST</div><div>suggested: (IgBLAST, RRID:SCR_002873)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Abs DNA sequences were compared with each other by ClustalW (pairwise alignments) to analyze sequence similarity, and EvolView (https://www.evolgenius.info/evolview/) was used for the decoration of Phylogeny tree.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ClustalW</div><div>suggested: (ClustalW, RRID:SCR_017277)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">R packages (ggplot2, pheatmap) were used for the bar chart, heatmap and Cicos plot.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04497987</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Study of LY3819253 (LY-CoV555) and LY3832479 (LY-CoV016) i…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04426695</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety, Tolerability, and Efficacy of Anti-Spike (S) SARS-Co…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04425629</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety, Tolerability, and Efficacy of Anti-Spike (S) SARS-Co…</td></tr></table>


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 24. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.14.20173393: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Patient and healthy donor samples and IVIG batches: Collection of blood from anonymous healthy donors was carried out at the French Institute of Blood Donation (EFS, Etablissement français du sang, Paris, France) in 2015 in line with Local and Regional Ethics Committee “CPP - Ile de France-VI” at the Pitié-Salpêtrière Hospital.<br>Consent: All patients or their relatives gave informed consent.<br>IACUC: This study was approved by the Local Ethical Committee of Sorbonne Université (n°2020-CER2020-21).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Photonic ring immunoassay: SARS-CoV-2 specific IgG antibodies were measured with The Maverick TM SARS-CoV-2 Multi-Antigen Serology Panel (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 specific IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This patient was confirmed positive by a SARS-CoV-2 RT-PCR on March 6th, 2020, and the virus was isolated by inoculating Vero cells with a sputum sample in our biosafety level-3 (BSL-3) facility.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, 100 μL of Vero E6 cells suspension (3.105 cells/mL) was added to the mixture and incubated at 37°C with 5% CO2 until a microscopic examination was performed on day 4 for the cytopathic effect (CPE)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus production and permissive cell line generation: Pseudotyped vectors were produced by triple transfection of 293T cells as previously described18.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Functional titer (TU) was determined by qPCR after the transduction of a stable HEK 293T-hACE2 cell line.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate this cell line, HEK 293T cells were transduced at a multiplicity of infection (MOI) 20 with an integrative lentiviral vector expressing the human ACE2 gene under the control of the UBC promoter.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Half maximal inhibitory concentrations IC50 were determined using the Graphpad Prism software 5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.27.20183319: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Human subjects and study approval: Written informed consent was obtained from COVID-19 convalescent and healthy blood donors before leukapheresis or peripheral blood samples were obtained.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To determine whether the addition of agonistic co-stimulatory antibodies increased the sensitivity of detection of ICC by flow cytometry, PBMCs were stimulated with 1ug/ml S or 1 µg/ml BSA, either with or without 2 µg/ml anti-CD28 and 2 µg/ml anti-CD49d (BD Biosciences) for 18h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD28</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD49d</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Inducible stable cell lines were generated in Freestyle 293-F cells (Thermofisher) as previously described (36, 57).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293-F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Influenza virus strain A/Peurto Rico/8/1934 (PR8) was grown in embryonated chicken eggs and tissue culture infectious dose determined by infection of MDCK cells (58).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDCK</div><div>suggested: CLS Cat# 602280/p823_MDCK_(NBL-2, RRID:CVCL_0422)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">WT SARS-CoV-2 Neutralization Assay: 100 μl of Vero E6 cells were seeded into a 96 well plate at 0.3×106 cells/mL and were incubated overnight for attachment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were washed twice, then resuspended in FACS buffer and acquired on the BD LSRFortessa X-20 flow cytometer using FACSDiva</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FACSDiva</div><div>suggested: (BD FACSDiva Software, RRID:SCR_001456)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data and Statistical analysis: Flow cytometry data were analyzed using FlowJo v10</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical and graphical analyses were performed using Graphpad Prism v6.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A potential caveat to our findings is that we included only 2 of the SARS-CoV-2 proteins in our cytokine analysis and not the full spectrum of SARS-CoV-2 antigens. However, the cytokine profile we observed in the supernatants of S and N stimulated PBMC is quite similar to that reported by Weiskopf et al for SARS-CoV-2 ARDS patient PBMC collected 3 weeks after ICU admission and stimulated with peptide megapeptide pools covering most of the SARS-CoV-2 proteins (23). There were, however, some differences noted, such as their detection of IL-17A, which we did not detect in our assays. The cytokine profile we detect in the supernatants of SARS-CoV-2 convalescent PBMC after antigen stimulation is similar to the overall cytokine profile reported at the acute phase of infection, including high levels of IL-6, IL-10 and TNF-α (46, 47). This is consistent with the evidence that memory T cells are imprinted by the acute inflammatory milieu (44). Schultheiss et al.(48) recently analyzed total PBMC from SARS-CoV-2 active and early convalescent patients and also noted that total CD4+ T cells showed an altered non-classical Th1 profile, similar to what we observe here with antigen-specific T cell responses. They also noted Th17 responses, which were not consistently observed in the antigen-specific T cells in our cohort. Of note, we observed a disconnect between ICC responses and analysis of T cell responses to S and N based on activation markers. This was not unique to SARS-CoV-2, however,...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 49 and 44. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.19.257022: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibody was detected with a peroxidase-conjugated anti-rabbit secondary antibody (1:1000, Dianova), followed by addition of AEC substrate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture and virus production: Caco-2 cells, a colon carcinoma derived cell line, was maintained in MEM (Minimal Essential Medium) containing 10% (v/v) foetal bovine serum,10,000 U penicillin/streptomycin and 2% (v/v) L-glutamine (Sigma Aldrich, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proteins derived from Caco-2 cells infected with SARS-CoV-2 after 24 h post infection and matching search terms “glycolysis” and “pentose phosphate pathway” in KEGG database were selected for further analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GraphPad Prism 8 software was used to plot the graphical representation and to perform statistical analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.13.250217: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For labelling, cells were incubated with primary antibody (anti-ACE2 antibody (Abcam, #ab189168), anti-PLD2 antibody, or anti-PIP2 antibody) for 60 min in antibody buffer (PBS with 5% BSA and 0.05% TritonX-100) at room temperature followed by 5 washes with wash buffer (PBS with 1% BSA and 0.05% TritonX-100) for 15 min each.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-PLD2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-PIP2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies (donkey anti-rabbit Cy3B and Alexa 647 conjugated CTxB) were added with antibody buffer for 30 min at room temperature followed by 5 washes as stated above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After a 3 h incubation, the plate was washed with 200 μL PBST for 4 times and 100 μL HRP-linked goat anti-rabbit IgG secondary antibody (Invitrogen™ #31460) at 0.4 μg/ml concentration in PBST buffer was added for 1 h incubation in the dark.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In vivo and in vitro PLD Assay: In vivo PLD2 activity was measured in cultured HEK 293T cells by an enzyme-coupled product release assay using amplex red reagent as described previously14.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were acquired by Andor iXon 897 EMCCD camera and Zen 10D software with an exposure time of 18 ms per acquisition.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Zen</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analyses: Data calculations and graphs were performed in Prism 6 (GraphPad software) or Microsoft Excel.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.17.20176552: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the institutional review board at the Children’s Hospital of Philadelphia.<br>Consent: Verbal informed consent was obtained from patients or their guardians in accordance with the Declaration of Helsinki.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantification of SARS-CoV-2 serum antibody titers: Serum IgG, IgM, and IgA antibody titers against SARS-CoV-2 antigens were quantified by enzyme-linked immunosorbent assays (ELISA) as previously described (13).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Also included in this mixture to neutralize any potential VSV-G carryover virus was 1E9F9, a mouse anti-VSV Indiana G, at a concentration of 600 ng/ml (Cat#Ab01402-2.0, Absolute Antibody, Oxford, UK).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-VSV</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of VSV pseudotypes with SARS-CoV-2 S for neutralization assays: 293T cells plated 24 hours previously at 5 × 106 cells per 10 cm dish were transfected using calcium phosphate with 35μg of pCG1 SARS-CoV S delta18 expression plasmid encoding a codon optimized SARS-CoV S gene with an 18 residue truncation in the cytoplasmic tail (kindly provided by Stefan Pohlmann (German Primate Center, Göttingen, DE).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cells stably expressing TMPRSS2 were seeded in 100 μl at 2.5×104 cells/well in a 96 well collagen coated plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The serum-virus mixture was then used to replace the media on VeroE6 TMPRSS2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6 TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using Prism version 8 (GraphPad Software, San Diego CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.20.259838: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics statement: All animal studies were conducted in accordance with the Guide for Care and Use of Laboratory Animals of the National Institutes of Health and approved by the Saint Louis University Animal Care and Use Committee (IACUC; protocol 2771)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The primary antibody consisted of polyclonal anti-SARS-CoV-2 guinea pig sera (BEI: NR-0361) and was diluted 1:15,000 with FFA Staining Buffer (1 × PBS, 1mg/ml saponin (Sigma: 47036)).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The secondary antibody consisted of goat anti-mouse conjugated horseradish peroxidase (Sigma: A-7289) diluted 1:5,000 in FFA Staining Buffer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus was passaged two times in Vero E6 cells (ATCC® CRL-1586™) before clarification by centrifugation (3000 rpm for 30 min) and storage at −80°C until further use.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SHHC17 cells were gifted by K. Toth.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SHHC17</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Focus forming assay: One day prior to the assay, Vero WHO cells were plated in a 96 well flat bottom tissue culture treated plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero WHO</div><div>suggested: ECACC Cat# 88020401, RRID:CVCL_JF53)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Media was then removed from the 96-well flat bottom plate containing the Vero WHO cell monolayer and replaced with 100μL per well of diluted samples.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The total peak area under the curve (AUC) was calculated using GraphPad Prism 8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.29.272963: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All animal experiments were carried out under an Institutional Animal Care and Use Committee (IACUC) approved protocol according to NIH guidelines.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing with TBST wells were incubated with HRP-conjugated anti-mouse secondary antibodies (Thermo Fisher) (1:10000 dilution in TBST) and developed with 1-Step Ultra TMB-ELISA Substrate Solution (Thermo Fisher) according to the manufacturer’s protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell Culture: HEK293 and HT1080 cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% (v/v) fetal bovine serum (FBS), 2mM L-glutamine, 1mM Na-pyruvate and penicillin-streptomycin mixture (100μg/ml).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HT1080</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Deglycosylation: Deglycosylation of S protein from the lysate of HEK293 cells transfected with pTwist-EF1a-nCoV-2019-S-2xStrep plasmid was performed as described previously [35] using PNGase F (New England Biolabs).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of SARS-CoV2 pseudovirus particles: HEK293FT cells in T75 flask were cotransfected with 6 μg of pTwist-EF1a-nCoV-2019-S-2xStrep plasmid, 9 μg of psPAX2 plasmid and 12 μg of pCDH-GFP-IRES-Puro plasmid [36].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293FT</div><div>suggested: ATCC Cat# PTA-5077, RRID:CVCL_6911)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice immunization and hybridoma fusion: 5 weeks old BALB/c mice were immunized according to the standard protocol [32] with several modifications.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunoglobulin sequences were analyzed using IgBLAST (https://www.ncbi.nlm.nih.gov/igblast/), BLASTn (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE) and SignalP-5.0 (http://www.cbs.dtu.dk/services/SignalP/) software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgBLAST</div><div>suggested: (IgBLAST, RRID:SCR_002873)</div></div><div style="margin-bottom:8px"><div>BLASTn</div><div>suggested: (BLASTN, RRID:SCR_001598)</div></div><div style="margin-bottom:8px"><div>https://blast.ncbi.nlm.nih.gov/Blast.cgi</div><div>suggested: (TBLASTX, RRID:SCR_011823)</div></div><div style="margin-bottom:8px"><div>http://www.cbs.dtu.dk/services/SignalP/</div><div>suggested: (SignalP, RRID:SCR_015644)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.15.252395: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animal research was conducted in compliance with the Animal Welfare Act and other federal statutes and regulations relating to animal care and experimentation under protocol #4390, approved by the Institutional Animal Care and Use Committee (IACUC) at Kansas State University on April 8, 2020.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Following embedding, tissue sections were cut and stained with hematoxylin and eosin and evaluated by a board-certified veterinary pathologist who was blinded to the treatment groups.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Eighteen pigs (mix of males and females, five weeks of age) were used in the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serological testing: To detect SARS-CoV-2 antibodies in sera, indirect ELISAs were performed using recombinant SARS-CoV-2 Receptor Binding Domain (RBD) expressed in HEK cells with a C-terminal Strep-Tag and the Nucleocapsid (N) protein expressed in E.coli with a C-terminal His-tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>His-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">100 μL anti-pig-IgG or IgM secondary antibodies, conjugated with peroxidase, were diluted 1:2,500 in blocking buffer and then incubated at room temperature for 1 hour, protected from light.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-pig-IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The optical density (OD) value was measured at 450 nm within 5 minutes of adding the stop solution to quantify the amount of antigenbinding antibody present in the sample.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigenbinding</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum from pigs infected with African Swine Fever Virus (ASFV) and the baculovirus-expressed ASFV-p54 antigen were used as a positive control for anti-pig-IgG or IgM secondary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus was passaged three times in VeroE6 cells (ATCC® CRL-1586™), before being passaged two times in swine testicle (ST; ATCC CRL-1746™) and four times in porcine kidney (PK-15; ATCC® CCL-33™) cell lines to investigate suitability of these swine cell lines for propagation of SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serological testing: To detect SARS-CoV-2 antibodies in sera, indirect ELISAs were performed using recombinant SARS-CoV-2 Receptor Binding Domain (RBD) expressed in HEK cells with a C-terminal Strep-Tag and the Nucleocapsid (N) protein expressed in E.coli with a C-terminal His-tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.14.251207: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Matrix processing and substrate scoring: The matrices were normalized by the sum of the 17 randomized amino acids (all amino acids expect for serine, threonine and cysteine), to yield a position specific scoring matrix.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detection of SRPK1, membranes were incubated with primary antibody (BD cat. no. 611072) at 0.025 µg/mL in PBST containing 5% milk overnight at 4 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SRPK1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detection of GAPDH, membranes were incubated with primary antibody (Cell Signaling, cat. no. 2118S) at a dilution of 1:10,000 in PBST containing 5% milk overnight at 4 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GAPDH</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-mouse (Invitrogen cat. no. A16072) and anti-rabbit (Thermo Scientific cat. no. A16104) secondary antibodies were used at 1:20,000 and 1:10,000 dilutions, respectively, in PBST containing 5% milk for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-mouse</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were stained with either an anti-dsRNA antibody (J2, Sigma MABE1134) at a 1:125 dilution, or an anti-SARS-CoV-2 Spike RBD protein (ProSci #9087) at a 1:150 dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-dsRNA</div><div>suggested: (Millipore Cat# MABE1134, RRID:AB_2819101)</div></div><div style="margin-bottom:8px"><div>J2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 Spike RBD protein ( ProSci #9087</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The reactions were run phos-tag gel and blotted with monoclonal anti-N protein antibody (GeneTex).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-N protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were incubated with primary antibodies: Prosurfactant protein C (1:500, Milipore, cat# AB3786) and SARS-CoV-2 (1:500, Genetex cat# GTX632604) in blocking buffer at 4°C overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: (GeneTex Cat# GTX632604, RRID:AB_2864418)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture (Duke): All cells were obtained from ATCC and grown at 37°C in 5% CO2. 293T and A549 and Huh7 cells were grown in DMEM with 10% FBS, Glutamax, and Penicillin/Streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 cells were grown in EMEM with 10% FBS and Penicillin/Streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HCoV-229E infections and titering: A stock of isolate HCoV-229E VR-740 (ATCC) was grown on Huh7 cells in complete media (DMEM supplemented with 10% FBS, 1% Pen/Strep, Glutamax).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For phosphoproteomic analysis, 6×107 Vero E6 or 6×107 A549-ACE2 cells were treated with 5 µM Alectinib or DMSO in DMEM supplemented with 2% FBS, 4.5 g/L D-glucose, 4 mM L-glutamine, 10 mM</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentiviruses were packaged as per standard protocols with a VSV-G envelope protein, A549 or A549-Cas9 cells were transduced and selected with puromycin at 2μg/mL. siRNA treatment of cells: A549-ACE2 cells were treated with 30μM siRNA (SRPK1: Horizon M-003982-02-0010; Non-targeting: Thermo 4390843) following the HiPerfect (Qiagen) Fast-Forward protocol and plated in 6 well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-Cas9</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differential expression analysis: Differential expression analysis of proteins and phosphorylation sites was done using Limma v3.42 package in R (81).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Limma</div><div>suggested: (LIMMA, RRID:SCR_010943)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A BLAST search was performed over each proteome using the SARS-CoV-2 nucleocapsid protein as the query; the top hit of each virus was taken to be the nucleocapsid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Each designated nucleocapsid was then individually aligned to the SARS- CoV-2 nucleocapsid using MUSCLE.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MUSCLE</div><div>suggested: (MUSCLE, RRID:SCR_011812)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bacterial colonies were then selected and plasmid DNA isolated using the Genejet Plasmid Miniprep kit (Thermo Fisher Cat# K0503).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Fisher Cat#</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV2 primer/probe set were synthesized using IDT DNA based on the sequences provided by the CDC “Research Use Only 2019-Novel Coronavirus (2019-nCov) Real-time RT-PCR Primers and Probes” set N1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Probes”</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reactions were cycled on the Applied Biosystems QuantStudio 3 Real-Time PCR System and analyzed using QuantStudio software version v1.4.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>QuantStudio</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SRPIN340 and SPHINX were suspended in DMSO at 1000X the final concentration indicated, Alectinib at 500X.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPHINX</div><div>suggested: (SPHINX, RRID:SCR_000534)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.20.260190: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus stock was generated at 360Biolabs (Melbourne, Australia) by two passages in Vero cells in virus growth media, which comprised Minimal Essential Medium (MEM) without L-glutamine supplemented with 1% (w/v) L-glutamine, 1.0 μg/mL of L-(tosylamido-2-phenyl)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus and compound mixture were added to Vero E6 cell monolayers in 96-well plates and incubated at 37°C in 5% CO2 for 4 days.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.18.255935: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Inibition by IFITM antibodies and peptides: Calu-3 cells were seeded in 48-well format (peptides assays), or in 24-well format (antibodies assay), 24h later cells were treated with increasing concentrations (20 and 80µg/ml) of IFITMs derived peptides (human IFITM2 long: EEQEVAMLGVPHNPAPPMSTVIH, human IFITM2 short: QEVAMLGVPHNAPPMST-VIH, mouse IFITM2 long: EEYGVTELGEPSNSAVVRTTVIN, human IFITM3 long: EEHEVAVLGAPHNPAPPTSTVIH, scrambled IFITM2: EGESGVTTATVEVVIERNN-LPY) or blocking antibodies (15 and 30 µg/ml) (α-ACE2 AK (AC18Z), Santa Cruz Biotechnology sc-73668; α-IFITM1</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>α-ACE2 AK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gut organoids were treated with increasing concentrations (15 and 30 µg/ml) of IFITMs derived peptides (mouse IFITM2 antibody blocking peptide Santa Cruz sc-373676 P) and blocking antibodies (α-ACE2 AK (AC18Z), Santa Cruz Biotechnology sc-73668, α-IFITM1/2/3 (F-12) Santa Cruz Biotechnology sc-374026) as indicated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>F-12</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-374026, RRID:AB_10916884)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Afterwards cells were washed three times with PBS and fixed with 100µl of Reagent A (FIX & PERM Fixation and Permeabilization Kit, Nordic MUbio) for 30 minutes at room temperature, washed three time with PBS and stained with primary antibody (α-IFITM1 Cell Signaling 13126 S, α-IFITM2 Cell Signaling 13530S, α-IFITM3 Proteintech 11714-1-AP, α-IFITM1/2/3 (F-12) Santa Cruz Biotechnology sc-374026,) diluted 1:20 in PBS or in Reagent B (FIX & PERM Fixation and Permeabilization Kit Nordic MUbio) for 1 h at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>α-IFITM1/2/3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed three times with PBS and stained with secondary antibody (Goat Anti-Rabbit IgG H&L (PE), ab72465,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Rabbit IgG</div><div>suggested: (Abcam Cat# ab72465, RRID:AB_1269142)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sections were permeabilized with 0.5 % Triton-X for 30 min at RT and stained over night with primary antibodies (rabbit anti-IFITM1 Cell Signaling 13126 S, 1:500 or rabbit anti-IFITM2 Cell Signaling #13530S, 1:500 or rabbit anti-IFITM3 Cell Signaling #59212S, 1:250 or anti-SARS-CoV-2 N 1:500 or anti-E-Cadherin 1:500) diluted in antibody diluent (Zytomed) in a wet chamber at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IFITM2 Cell Signaling #13530S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IFITM3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-E-Cadherin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proteins were stained using primary antibodies against IFITM1 (α-IFITM1, Cell Signaling #13126 S, 1:1000,), IFITM2 (α-IFITM2 Cell Signaling #13530S, 1:1000), IFITM3 (α-IFITM3 Cell Signaling #59212S, 1:1000) SARS Spike CoV-2 (SARS-CoV-1/-2 (COVID-19) spike antibody [1A9], GTX-GTX632604, 1:1000), VSV-M</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>α-IFITM1 , Cell Signaling #13126 S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>α-IFITM2 Cell Signaling #13530S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>α-IFITM3 Cell Signaling #59212S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GTX-GTX632604</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse Monoclonal Anti-VSV-M Absolute antibody, ABAAb01404-21.0, 1:1000), actin (Anti-beta Actin antibody Abcam, ab8227, 1:5000 Abcam,), ACE2 (Rabbit policclonal anti-ACE2 Abcam, ab166755, 1:1000) and Infrared Dye labelled secondary antibodies (LI-COR IRDye).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-VSV-M</div><div>suggested: (Kerafast Cat# EB0011, RRID:AB_2734773)</div></div><div style="margin-bottom:8px"><div>ABAAb01404-21.0 , 1:1000) , actin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-beta Actin</div><div>suggested: (Abcam Cat# ab8227, RRID:AB_2305186)</div></div><div style="margin-bottom:8px"><div>ab8227</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ab166755</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For staining following antibodies were used: IFITM1 (α-IFITM1 Cell Signaling 13126 S)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IFITM1</div><div>suggested: (Cell Signaling Technology Cat# 13126, RRID:AB_2798126)</div></div><div style="margin-bottom:8px"><div>α-IFITM1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, IFITM2 (α-IFITM2 Abcam 236735), IFITM3 (α-IFITM3 Cell Signaling 59212S), SARS Spike CoV-2 (SARS-CoV / SARS-CoV-2 (COVID-19) spike antibody [1A9], GTX-GTX632604)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IFITM2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>α-IFITM2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>α-IFITM3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, blotted onto polyvinylidene difluoride (PVDF) membrane, blocked in 5% milk and probed with rabbit anti-V5 (Cell Signaling #13202), mouse anti-FLAG (Sigma #F1804) and rat anti-GAPDH (Biolegend #607902) antibodies, followed by goat anti-mouse, anti-rabbit and anti-rat secondary fluorescent antibodies (LI-COR).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-V5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-FLAG</div><div>suggested: (Sigma-Aldrich Cat# F1804, RRID:AB_262044)</div></div><div style="margin-bottom:8px"><div>anti-GAPDH</div><div>suggested: (BioLegend Cat# 607902, RRID:AB_2734503)</div></div><div style="margin-bottom:8px"><div>anti-mouse,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rat</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human embryonic kidney 293T cells (HEK293T; ATCC) were maintained in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% heat-inactivated fetal calf serum (FCS), L-glutamine (2 mM), streptomycin (100 µg/ml) and penicillin (100 U/ml).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Caco-2 (human epithelial colorectal adenocarcinoma) cells were maintained in DMEM containing 10% FCS, glutamine (2 mM), streptomycin (100 µg/ml) and penicillin (100 U/ml), NEAA supplement (Non-essential amino acids (1 mM)), sodium pyruvate (1 mM).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 (human epithelial lung adenocarcinoma) cells were cultured in Minimum Essential Medium Eagle (MEM) supplemented with 10% FCS (during viral infection) or 20% (during all other times), penicillin (100 U/ml), streptomycin (100 µg/ml), sodium pyruvate (1 mM), and NEAA supplement (1 mM).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: KCLB Cat# 30055, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero cells (ATCC, CCL-81) cells were maintained in DMEM containing 2.5% FCS, glutamine (2 mM), streptomycin (100 µg/ml) and penicillin (100 U/ml), NEAA supplement (Non-essential amino acids (1 mM)), sodium pyruvate (1 mM).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human hESC cultivation and gut organoids differentiation: Human embryonic stem cell (hESC) line HUES8 (Harvard University) was used with permission from the Robert Koch Institute according to the “Approval according to the stem cell law” AZ 3.04.02/0084.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HUES8</div><div>suggested: RRID:CVCL_B207)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Target cell assay: HEK293T cells were transiently transfected using PEI38 with pLV-EF1a-human ACE2-IRES-puro and pCG-IFITM1-IRES_eGFP or pCG-IFITM2-IRES_eGFP or pCG-IFITM3-IRES_BFP.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 virus stock production: BetaCoV/Netherlands/01/NL/2020 or BetaCoV/ France/IDF0372/2020 was propagated on Vero E6 infected at an MOI of 0.003 in serum-free medium containing 1 μg/ml trypsin as previously described16.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2 h post-treatment, cells were infected with SARS-CoV-2 with an MOI of 0.05.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: (Active Motif Cat# 91351, RRID:AB_2847848)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were acquired on a Zeiss LSM 710 and processed using ImageJ (Fiji).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: Statistical analyses were performed using GraphPad PRISM 8 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad PRISM</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.14.20174318: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For further analysis, the data were exported to Statistical Package for Social Science (SPSS) version 21 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      This finding is similar with the previous study which conducted among chronic condition and disability were used very unlikely of substance use and denial types of coping[10] and it also consistent with world health organization recommendation and center of disease control for coping of stress during covid-19 outbreak [4] The main limitations of this study were shortage of time period for data collection which occurred due the data need urgency and the others limitation was lack of validated and reliable tools for perceived stress and coping strategies for this vulnerable groups. However some data quality control mechanisms were conducted to minimize this limitation effects on the study. Lack of previous studies also one of the main limitations. The main significance of assessment of COVID-19 related perceived stresses and coping strategy types are a paramount at several levels. One of it could be to give appropriate intervention types for COVID-19 related perceived stresses and coping strategy types of the patients about covid-19. In addition, it could provide sufficient data for any concerning body like health professionals, psychologist, policy makers and planers in advising the most vulnerable population for prevention and control of COVID-19 physiological and psychological impacts timely and appropriately. It could fill the information gap of the study area and it would be provide a base line information for others researcher to conduct similar study by considering the l...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.18.255877: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 African green monkey kidney epithelial cells (selected for high ACE2 expression) were inoculated with SARS CoV-2 (USA_WA1/2020) at multiplicity of infection (MOI) of 0.002 in media and quickly dispensed into assay plates as 25 μL/well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The concentration-response curves of re-tested compounds were also plotted using GraphPad Prism 9 (GraphPad Software Inc., San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      It is worth briefly reflecting on the limitations of the drug repurposing assay approach. A number of small molecules of interest for treating COVID19 that are currently in clinical trials were not hits in our assay. For example, the TMPRSS2 inhibitors camostat and nafamstat are protease inhibitors approved in Japan for treating pancreatitis, and known to inhibit TMPRSS2 (Shrimp et al., 2020). While TMPRSS2 is reported to be a mediator of SARS-CoV-2 cell entry, Vero E6 cells do not express TMPRSS2, so this class of compound are not active in the Vero E6 assay. The drug efflux transporter P-glycoprotein (P-gp) can reduce cellular concentrations of test agents, and as a kidney epithelial cell line, Vero E6 cells likely expresses significant P-gp concentrations, which would reduce activity of P-gp substrates (Robey et al., 2018). Remdesivir itself is a substrate of Pgp (EMA, 2020), and is weaker against SARS-CoV-2 in assays using Vero E6 cells (EC50 > 1 μM) compared with Calu-3 or Huh7 cell lines (EC50 > 50 nM) (2020). These examples highlight the need for careful interpretation and critical follow-up studies after initial high-throughput screening analyses. Importantly, the comprehensive primary screen datasets of this study for approved and investigational drugs, and mechanism-based bioactive compounds have been made publicly available in real-time on the NCATS OpenData Portal (https://opendata.ncats.nih.gov/covid19/index.html) (Brimacombe et al., 2020). These datasets provide...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 20. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.11.247320: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies and Reagents: PE anti-human CD3 antibody (clone OKT3), FITC and PE/Cy7 anti-human CD56 antibody (clone HCD56,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human CD56</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BioLegend), PE anti-human CD69 antibody (clone FN50, BioLegend)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human CD69</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PE anti-human CD8a antibody (clone RPA-T8, BioLegend),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human CD8a</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">APC/Fire 750 anti-human CD226 antibody (DNAM-1) (clone 11A8, BioLegend),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human CD226</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">APC/Fire 750 antihuman KLRG1 (MAFA) antibody (clone SA231A2, BioLegend)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antihuman KLRG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>MAFA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">anti-human CD335 (NKp46) antibody (clone 9E2, BioLegend)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human CD335</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>NKp46</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">anti-human CD244 (2B4) antibody (clone C1.7, BioLegend)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human CD244</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, PE anti-human CD152 (CTLA-4) antibody (clone BNI3)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human CD152</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CTLA-4 </div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, APC anti-human CD366 (Tim-3) antibody (clone F38-2E2),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human CD366</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Tim-3 </div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">antihuman TIGIT (VSTM3) antibody (clone A15153G)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antihuman TIGIT ( VSTM3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FITC anti-human CD223 (LAG-3) antibody (clone 11C3C65, BioLegend)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human CD223</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>LAG-3 </div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">anti-human CD314 (NKG2D) antibody (clone 1D11), and APC anti-human CD94 (clone DX22, BioLegend) were purchased from BioLegend (San Diego, CA, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NKG2D</div><div>suggested: (US Biological Cat# K1893-28, RRID:AB_2265490)</div></div><div style="margin-bottom:8px"><div>anti-human CD94</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">APC anti-human CD16 antibody (clone 3G8, BD Biosciences)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human CD16</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">anti-human CD314 (NKG2D) antibody (clone 1D11, BD Biosciences), and FITC anti-human CD107a antibody (clone H4A3, BD Biosciences) were purchased from BD Biosciences (San Jose, CA, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human CD314</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human CD107a</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PE anti-human NKG2C/CD159c antibody (clone 134591, R&D Systems) were purchased from R&D Systems.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PE anti-human NKG2C/CD159c antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human NKG2C/CD159c</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">AF647 Goat anti-human IgG(H+L) F(ab’)2 fragment antibody was purchased from Jackson ImmunoResearch (West Grove, PA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AF647 Goat anti-human IgG(H+L ) F(ab’)2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Coronavirus Spike protein (subunit 1) polyclonal antibody was purchased from Invitrogen (Carlsbad, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coronavirus Spike protein ( subunit 1 ) polyclonal antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Coronavirus Spike protein ( subunit 1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">mouse monoclonal antibody IgG1 (clone H-3) was purchased from Santa Cruz Biotechnology (Dallas, TX, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>mouse monoclonal antibody IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antibody IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then stained with anti-mouse (IgG1) secondary antibody in FACS buffer for 30 minutes on ice, washed twice with PBS, and analyzed by Flow Cytometry.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse ( IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Due to the non-specific binding to our CR3022-CAR of our secondary antibody, cells were first blocked with anti-human IgG(H+L) F(ab’)2 fragment for 30 minutes on ice in BM and washed thrice with PBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG(H+L</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then stained with goat anti-rabbit secondary antibody in FACS buffer for 30 minutes on ice, washed thrice with PBS, and analyzed by Flow Cytometry.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: 293T cell line was purchased from the American Type Culture Collection (ATCC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T-hACE2 cell line is a gift from Dr. Abraham Pinter (Rutgers-New Jersey Medical School, PHRI).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Similarly, 293T-hACE2-FFLuc-GFP-RBD cells were transfected with 0.25 μg of SARS-CoV-2-RBD plasmid and 0.25 μg of pHAGE-FFLuc-GFP each well in a 24-well plate (Eppendorf) for 48 hours at 37°C under 5% (v/v) CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-hACE2-FFLuc-GFP-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow Cytometry Analysis: NK92MI and CR3022-CAR cells were stained were stained and washed as previously described.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR3022-CAR</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In a separate 96-well plate, CR3022-CAR-NK-92MI and NK-92MI cells were resuspended at a concentration of 1 × 106 cells/ml.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NK-92MI</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CR3022-CAR construction and retrovirus production: A codon-optimized DNA fragment was synthesized by GENEWIZ encoding the CR3022-specific scFv and sub-cloned into the SFG retroviral vector retroviral backbone in-frame with the hinge component of human IgG1, CD28 trans-membrane domain, intracellular domain CD28 and 4-1BB, and the ζ chain of the human TCR/CD3 complex.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GENEWIZ</div><div>suggested: (GENEWIZ, RRID:SCR_003177)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were acquired using FACS Diva software (BD) and analyzed using FlowJo software (BD)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      We have optimized the NK cell expansion technology to buffer this potential limitation. Thus, in this study, we focused on CR3022-CAR-NK-92MI, a NK-92 cell line expressing IL-2 molecule to sustain the persistence in vivo20. In this study, we provide proof-of-concept for using CR3022-CAR-based cell therapy for treating severe COVID-19 patients. These experiments will expedite preclinical studies and a potential clinical application during the COVID-19 pandemic. Although these findings support the therapeutic potential of CR3022-CAR-NK cells for treating severe COVID-19 patients, there are several limitations presented in the current form of study. First, we use the NK-92 cell line in this study. NK-92-mediated immunotherapy is currently undergoing phase I/II clinical trials21,22. However, NK-92 cells must be irradiated prior to infusion to prevent permanent engraftment because of malignant potential of NK-92 cells. Second, we use pseudotyped SARS-CoV-2-S viral particles, which is different from the natural SARS-CoV-2 virus. Future studies using natural SARS-CoV-2 virus in the ACE2-transgenic mouse model are needed to test the efficacy and toxicity of CR3022-CAR-NK cells. In conclusion, development of this novel CAR-NK cell therapy for the treatment of severe COVID-19 patients with maximal efficacy and minimal toxicity will be required to reduce patient risk and enhance the benefit of these expensive and time-intensive therapies. The studies here characterize the biology of CR3...

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04375176</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Monocytes and NK Cells Activity in Covid-19 Patients</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04280224</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NK Cells Treatment for COVID-19</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04365101</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Natural Killer Cell (CYNK-001) Infusions in Adults With COVI…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04324996</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Phase I/II Study of Universal Off-the-shelf NKG2D-ACE2 CAR…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04416139</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Mesenchymal Stem Cell for Acute Respiratory Distress Syndrom…</td></tr></table>


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.07.17.20156497: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Similarly, the Lab* colors were converted to the RGB color space using built-in MATLAB functions and the Euclidean RGB color difference was computed as:

      Similar as in the Lab* color space, ΔR, ΔG, and ΔB are the differences between the exposed and reference RGB coordinates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Measured doses and their uncertainties (one standard deviation, utotal and unorm) were plotted as heatmaps and histograms using the ‘inferno’ perceptually uniform, colorblind-friendly colormap, which was created by Stéfan van der Walt and Nathaniel Smith and adapted from Python’s matplotlib for use in MATLAB® by Ander Biguri39</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python’s</div><div>suggested: (PyMVPA, RRID:SCR_006099)</div></div><div style="margin-bottom:8px"><div>matplotlib</div><div>suggested: (MatPlotLib, RRID:SCR_008624)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">txt files using a custom Python script and read into MATLAB®.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div><div style="margin-bottom:8px"><div>MATLAB®</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Device-specific calibration facilitates quantification using widely-available imaging tools: To overcome spectrocolorimeter limitations (e.g., cost, availability, and throughput) as well as capture spatial information already recorded in the PCIs, we generated and assessed device-specific calibration curves using widely-available imaging tools under controlled lighting conditions. The calibration curves were generated from raw images of PCIs acquired using a flatbed scanner (Canon LiDE-400), digital SLR camera (DSLR, Nikon D5500), and smartphone (iPhone X) (DSLR and iPhone images were acquired in a light box to provide isolation from ambient illumination). All tools captured the entire surface of both the exposed PCI as well as an unexposed reference. The resulting calibration curves were then compared to those generated with data from the RM200QC (Figure 4(a)). We observe the highest CIEDE2000 ΔE values from measurement with the cameras. Though the flatbed scanner measures the lowest ΔE values, its measurements correspond with those of the RM200QC and conveniently do not require a light box. We further assessed the squared sums of the residuals (SSE) for all fits as a measure of calibration accuracy (Figure 4(b)) and include quantification of the dose measurement relative uncertainty in Supplementary Figure S11. We observe the lowest SSE for the RM200QC, but almost all imaging approaches yield PCI1 quantification meeting the 10% ideal target relative uncertainty for a ∼0.10 ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.28.267526: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: The study protocol and informed consent were approved by the ethics committee at the Chang Gung Medical Foundation and the Taoyuan General Hospital, Ministry of Health and Welfare.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Staining and sorting of plasmablasts: Freshly separated peripheral blood mononuclear cells (PBMCs) or thawed PBMCs were stained with fluorescent-labelled antibodies to cell surface markers purchased from BD Biosciences, USA; Pacific blue anti-CD3 (clone UCHT1, Cat. No. 558117, BD), Fluorescein isothiocyanate anti-CD19 (clone HIB19, Cat. No. 555412, BD), Phycoerythrin-Cy7 anti-CD27 (clone M-T271, Cat. No. 560609, BD), Allophycocyanin-H7 anti-CD20 (clone L27, Cat. No. 641396, BD), Phycoerythrin-Cy5 anti-CD38 (clone HIT2, Cat. No. 555461, BD) and Phycoerythrin anti-human IgG (clone G18-145, Cat. No. 555787, BD).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD3</div><div>suggested: (BD Biosciences Cat# 558117, RRID:AB_397038)</div></div><div style="margin-bottom:8px"><div>anti-CD19</div><div>suggested: (BD Biosciences Cat# 555412, RRID:AB_395812)</div></div><div style="margin-bottom:8px"><div>anti-CD27</div><div>suggested: (BD Biosciences Cat# 560609, RRID:AB_1727456)</div></div><div style="margin-bottom:8px"><div>anti-CD20</div><div>suggested: (BD Biosciences Cat# 641396, RRID:AB_1645724)</div></div><div style="margin-bottom:8px"><div>anti-CD38</div><div>suggested: (BD Biosciences Cat# 555461, RRID:AB_395854)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed and incubated with horseradish peroxidase-conjugated rabbit anti-human IgG secondary antibody (Rockland Immunochemicals, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Both MDCK-Spike and MDCK-RBD cells were then FACS sorted for highly expressing cells using the CR3022 antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound primary antibodies were detected with FITC-conjugated anti-IgG secondary.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The anti-influenza human monoclonal antibody BS 1A, anti-SARS spike glycoprotein MAb CR3022 and convalescent serum were used as antibody controls for each experiment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-influenza</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS spike glycoprotein MAb CR3022</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plaque reduction neutralisation assay (Francis Crick Institute): Confluent monolayers of Vero E6 cells in 96-well plates were incubated with ~14 plaque forming units (PFU) of SARS CoV-2 (hCoV-19/England/02/2020, EPI_ISL_407073) and antibodies in a 2-fold dilution series (triplicates) for 3 hours at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EPI_ISL_407073</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody was biotinylated using EZ-Link Sulfo-NHS-LC-biotin (21237; Life Technologies) and then mixed with competing MAb (in at least 10-fold excess) and transferred to the blocked NUNC plates for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sulfo-NHS-LC-biotin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The control antibody (a non-blocking anti-influenza N1 MAb) or ACE2-Fc without antibody used to obtain the maximum signal and wells with PBS/BSA buffer only were used to determine the minimum signal.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-influenza N1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">50% inhibitory concentrations of the antibodies against ACE2 was determined using non-linear regression curve fit using GraphPad Prism 8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 1 hour a second layer Streptavidin-HRP antibody (S911, Life Technologies) diluted 1:1,600 in PBS/0.1% BSA (37525; Thermo Fisher Scientific) was added and incubated for another 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S911,</div><div>suggested: (Imported from the IEDB Cat# S-9-11, RRID:AB_2848104)</div></div><div style="margin-bottom:8px"><div>S911</div><div>suggested: (Imported from the IEDB Cat# S-9-11, RRID:AB_2848104)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids were transfected into the HEK293T cell line for expression of recombinant full-length human IgG MAbs in serum-free transfection medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow-cytometry based binding assay: MDCK-Spike cells were produced by stably transfecting parental MDCK-SIAT1 cells with cDNA expressing full-length SARS-CoV-2 spike glycoprotein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDCK-Spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MDCK-RBD cells were produced by, stably transducing MDCK-SIAT1 cells with a Lentiviral vector encoding a cDNA expressing RBD amino acids 340-538 (NITN.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDCK-SIAT1</div><div>suggested: ECACC Cat# 05071502, RRID:CVCL_Z936)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MDCK-NTD cells were produced by stably transfecting parental MDCK-SIAT1 cells with cDNA expressing SARS-CoV-2 NTD.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDCK-NTD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MDCK-Spike or MDCK-RBD cells were prepared and resuspended.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDCK-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Triplicate serial dilutions of antibody are pre-incubated with a fixed dose of SARS-CoV-2 (Australia/VIC01/2020, GenBank MT007544) (55) in triplicate before incubation with Vero cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, Vero E6 cells were pre-seeded in a 96 well plate at a concentration of 104 cells per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">30 μl of biotinylated RBD (25 nM) were mixed and 50 μl of the mixture was then transferred to the MDCK-ACE2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDCK-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The binding activities were analyzed by BD FACSCanto™ II flow cytometer (BD Biosciences, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD FACSCanto™</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data are analysed using four-parameter logistic regression (Hill equation) in GraphPad Prism 8.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.04.277426: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Informed consent for participation in this study was obtained from participants.<br>IRB: The study for SARS-CoV-2 genome sequencing was approved by the Ethics Committee of Acıbadem Mehmet Ali Aydınlar University (ATADEK-2020/05/41) and informed consent from the patients was obtained to publish identifying information/images.<br>IACUC: All animal studies received ethical approval by the Yeditepe University Animal Experiments Local Ethics Committee (Yeditepe-HADYEK).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Female or male 11-months-old BALB/c mice were housed in AAALAC International accredited Acıbadem Mehmet Ali Aydinlar University Laboratory Animal Application and Research Center (ACUDEHAM; Istanbul, Turkey) for 7-day toxicity and 21-day toxicity and efficacy tests.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To detect the SARS-COV-2 IgG antibody in mouse serum SARS-COV-2 IgG ELISA Kit (Creative, DEIASL019) was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-COV-2 IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">500,000 cells in 100 μl were added into microplate already coated with a monoclonal antibody specific for mouse IFN-γ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IFN-γ</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Also, in order to determine T cell activation and proliferation, the restimulated cells were stained with the antibodies including CD3, CD4, CD8, CD19, and CD25 as an activation marker (Miltenyi Biotec).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD3</div><div>suggested: (Miltenyi Biotec Cat# 130-094-531, RRID:AB_2721154)</div></div><div style="margin-bottom:8px"><div>CD4</div><div>suggested: (Miltenyi Biotec Cat# 130-095-243, RRID:AB_10827681)</div></div><div style="margin-bottom:8px"><div>CD8</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD19</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD25</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The neutralization ratio was determined by assessing percent neutralization by dividing the index value of serum-virus treated condition wells by the cell index value of untreated control Vero cells (normalized to 100%).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For 34-day efficacy tests, female or male 3-months-old BALB/c mice were housed in Yeditepe University Experimental Research Center.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">LC-MSMS data was searched against the NCBI RefSeq sequence database for protein identification.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RefSeq</div><div>suggested: (RefSeq, RRID:SCR_003496)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using SPSS Statistics software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 34. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.28.272518: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mouse immunizations: Balb/c female mice (6-8 weeks old) were procured from The Jackson Laboratory.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In-house made primary antibodies CR3022, COVA2-15, and CB6 (approximate concentrations 0.8 – 1.3 mg/mL) were added at a 1:10,000 dilution in PBST.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COVA2-15</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CB6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibody was added at 1:10,000 (abcam ab6759, rabbit anti-human IgG H&L HRP) in 5% milk / PBST and incubated for 1 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For purified mAbs and ACE2-Fc, Direct-Blot HRP anti-human IgG1 Fc antibody (Biolegend 410604) was added at a 1:10,000 dilution in diluent buffer for 1 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG1</div><div>suggested: (BioLegend Cat# 410604, RRID:AB_2749913)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CCP samples were obtained from donors who had a clinical diagnosis of COVID-19 and either a positive RT-PCR or SARS-CoV-2 antibody test.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2 pseudotyped lentivirus production and viral neutralization assays: SARS-CoV-2 spike pseudotyped lentivirus was produced in HEK293T cells via calcium phosphate transfection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse immunizations: Balb/c female mice (6-8 weeks old) were procured from The Jackson Laboratory.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Balb/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Dots were quantified using the gel analysis protocol in Fiji (ImageJ) and curves were fit using a linear regression in GraphPad Prism 8.4.1. SEC-MALS of SARS-CoV-2 antigens: SEC-MALS was performed on an Agilent 1260 Infinity II HPLC with Wyatt detectors for light scattering (miniDAWN) and refractive index (Optilab)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Molecular weights were determined using ASTRA 7.3.2 (Wyatt Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ASTRA</div><div>suggested: (ASTRA, RRID:SCR_016255)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single-particle image processing and 3D reconstruction: All movie stacks were first imported into Relion 3.0.6 (70) for image processing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Relion</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Motion-correction was performed with MotionCor2 1.3.2 (71) and the contrast transfer function was determined with CTFFIND4 4.1.13 (72).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MotionCor2</div><div>suggested: (MotionCor2, RRID:SCR_016499)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The initial model was built in cryoSPARC (74) using the ab-initio reconstruction option with octahedral symmetry applied.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT03186781</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Influenza HA Ferritin Vaccine, Alone or in Prime-Boost Regim…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT03814720</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Dose, Safety, Tolerability and Immunogenicity of an Influenz…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.14.296715: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Briefly, the Institutional Animal Care and Use Committee (IACUC) guidelines were followed with animal subjects tested in the immunization study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The CR3022 antibody column was used to extract SARS-CoV-1/2 antigens from the supernatants, which was followed by SEC on a Superdex 200 10/300 GL column (for scaffolded RBD trimer) or a Superose 6 10/300 GL column (for RBD-SPY-SApNPs, spikes, and spike-presenting SApNPs).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For antigen binding, antibodies were diluted in the blocking buffer to a maximum concentration of 5 μg ml−1 followed by a 10-fold dilution series.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen binding ,</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For antibody binding, a 1:5000 dilution of goat anti-human IgG antibody (Jackson ImmunoResearch Laboratories, Inc), or for mouse sample analysis, a 1:3000 dilution of horseradish peroxidase (HRP)-labeled goat anti-mouse IgG antibody (Jackson ImmunoResearch Laboratories), was then made in the wash buffer (PBS containing 0.05% Tween 20), with 50 μl of this diluted secondary antibody added to each well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For all antigens with the exception of S2GΔHR2-NPs, 5 μg ml−1 of antibody in 1× kinetic buffer was loaded onto the surface of anti-human Fc Capture Biosensors (AHC) for 300 s.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human Fc Capture Biosensors ( AHC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Correction of baseline drift was performed by subtracting the mean value of shifts recorded for a sensor loaded with antibody but not incubated with antigen and for a sensor without antibody but incubated with antigen.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen .</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, ExpiCHO cells were thawed and incubated with ExpiCHOTM Expression Medium (Thermo Fisher) in a shaker incubator at 37 °C, 135 rpm and 8% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ExpiCHO</div><div>suggested: RRID:CVCL_5J31)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-1/2-pps were generated by co-transfection of HEK293T cells with the HIV-1 pNL4-3.lucR-E-plasmid (obtained from the NIH AIDS reagent program: https://www.aidsreagent.org/) and the expression plasmid encoding the S gene of SARS-CoV-1 isolate Tor2 (GenBank accession #: NC_004718) and the SARS-CoV-2 isolate Wuhan-Hu-1 (GenBank accession #: MN908947) at a 4:1 ratio by lipofectamine 3000 (Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293T-hACE2 cells at 1×104 were added to each well and the plate was incubated at 37°C for 48 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-hACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Eight-week-old BALB/c mice were purchased from The Jackson Laboratory and housed in ventilated cages in environmentally controlled rooms at The Scripps Research Institute, in compliance with an approved IACUC protocol and AAALAC (Association for Assessment and Accreditation of Laboratory Animal Care) International guidelines.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The HEK293T-hACE2 cell line (catalogue#: NR-52511) and the vector pcDNA3.1(-) containing the SARS-CoV-2 S gene (catalogue#: NR52420) were obtained from BEI RESOURCES (https://www.beiresources.org/) and used in pseudovirus neutralization assays (72).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.beiresources.org/</div><div>suggested: (BEI Resource Repository, RRID:SCR_013698)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were retrieved from a BioTek microplate reader with Gen 5 software, the average background luminescence from a series of uninfected wells was subtracted from each well, and neutralization curves were generated using GraphPad Prism 8.4.3, in which values from wells were compared against a well containing SARS-CoV-1/2-pp only.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 48, 50 and 52. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.07.20187666: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following homogenization and centrifugation (10,000 × g, 20 min, 4°C), the resulting supernatant tissue supernatant was inoculated onto Vero E6 monolayer maintained in optimal virus growth media for SARS-CoV-2 virus (DMEM w/ L-Glutamate</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CyTOF Data analysis: De-barcoded files were uploaded to Cytobank for analyses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cytobank</div><div>suggested: (Cytobank, RRID:SCR_014043)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      While our data point to a novel aspect of COVID-19 pathogenesis, we would also like to mention a few limitations of our study. GI biopsies were not performed on a representative subset of the Discovery or Validation Cohorts, but rather from a distinct set of patients who were undergoing clinical indicated procedures. In addition, we recognize our analysis on intestinal mucosal samples were not performed during the most acute phase of the illness in some patients. A separate study by our group that analyzed stool samples from patients going through the acute phase of COVID-19, found little evidence of an active gut inflammatory response. In particular, such stool samples strikingly lacked any significant increase of IL-1β, IL-6, TNF-α and IL-10, despite the detection of viral genomes (MEDRXIV/2020/183947). Finally, in our clinical outcomes analysis we acknowledge that the reporting GI symptoms can be subject to individual variation and the clinical documentation might vary depending on providers and on the acuity of the patients’ presentation. While it is possible that GI symptoms might have been underreported in patients who were admitted directly to the ICU, our findings are in line with those observed in the External Validation Cohort where patients who died or were admitted to the ICU within 24 hours form initial presentation were excluded from the analysis. In summary, we have observed an unexpected but significant reduction in COVID-19 severity and mortality when patient...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.07.286120: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The Medical Ethical Committee of the Erasmus MC Rotterdam granted permission for this study (METC 2012-512)<br>Consent: For the tracheal aspirates, informed consent was obtained from parents and approval was given by the Medical Ethical Committee (METC no. MEC-2017-302).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were incubated with primary antibodies overnight at 4°C in blocking buffer, washed twice with PBS, incubated with corresponding secondary antibodies Alexa488-, 594 and 647-conjugated secondary antibodies (1:400; Invitrogen) in blocking buffer for 2 hours at room temperature, washed two times with PBS, incubated with indicated additional stains (TO-PRO3, phalloidin-633 (SC-363796, Santa Cruz Biotechnology), Hoechst), washed twice with PBS, and mounted in Prolong Antifade (Invitrogen) mounting medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TO-PRO3 , phalloidin-633 ( SC-363796 , Santa Cruz Biotechnology) , Hoechst)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>phalloidin-633</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Antifade ( Invitrogen ) mounting medium .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2 and TMPRSS2 were stained using goat-anti-hACE2 (AF933, 1:200, R&D Systems) and mouse-anti-TMPRSS2 (sc-515727, 1:200, Santa Cruz Biotechnology), and visualized with rabbit-anti-goat (P0160, 1:200, Dako) and goat-anti-mouse (PO260, 1:100, Dako) horseradish peroxidase labeled secondary antibody, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>TMPRSS2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>mouse-anti-TMPRSS2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>sc-515727</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>rabbit-anti-goat ( P0160</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>( PO260</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Two hours post-infection, cells were washed three times with Opti-MEM I (1X) + GlutaMAX and replaced with medium containing anti-VSV-G neutralizing antibody (clone 8G5F11; Absolute Antibody) at a dilution of 1:50000 to block remaining VSV-G PPs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-VSV-G neutralizing antibody</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 and Calu-3 stable cell lines were maintained in Eagle’s minimal essential medium (EMEM, ATCC®) supplemented with 20% FCS, penicillin (100 IU/mL) and streptomycin (100 IU/mL) at 37°C in a humidified CO2 incubator.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK-293T cells were cultured in DMEM supplemented with 10% fetal calf serum (FCS), sodium pyruvate (1mM,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 (isolate BetaCoV/Munich/BavPat1/2020; European Virus Archive Global #026V-03883; kindly provided by Dr. C. Drosten) and SARS-CoV (isolate HKU39849) were propagated on Vero cells in Opti-MEM I (1X) + GlutaMAX (Gibco), supplemented with penicillin (100 IU/mL) and streptomycin (100 IU/mL) at 37°C in a humidified CO2 incubator.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Aliquots of each dilution were added to monolayers of 2 × 104 VeroE6 cells in the same medium in a 96-well plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Entry route assay: VeroE6, Calu-3 and VeroE6-TMPRSS2 cells were seeded in 24 well plates and kept at 37°C 5% CO2 overnight to achieve 80-100% confluency by the next day.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After a 10 minute incubation step at 37°C 5% CO2, dispase was removed and cold 500 μL AdDF+++ was pipetted onto the apical side of the Transwell to dislodge the pseudostratified epithelial layer, which was subsequently mechanically sheared by pipetting using a P1000 tip.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AdDF+++</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fusion events were quantified by detecting GFP+ pixels after 18 hours incubation at 37°C 5% CO2 using Amersham™</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Amersham™</div><div>suggested: (Amersham Biosciences, RRID:SCR_013566)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was analyzed using the ImageQuant TL 8.2 image analysis software (GE Healthcare) by calculating the sum of all GFP+ pixels per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageQuant</div><div>suggested: (ImageQuant, RRID:SCR_014246)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For nuclear counting fluorescence microscopy images were obtained with a Carl ZEISS Vert.A1 microscope paired with an AxioCam ICm1 camera and Colibri 7 laser (469/38nm for GFP and 365/10nm for BFP) using ZEN analysis software (20x magnification)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Colibri</div><div>suggested: (Colibri, RRID:SCR_007606)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Confocal microscopy images were taken on a LSM700 confocal microscope using ZEN software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ZEN</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analysis was performed with the GraphPad Prism 5 and 8 software using a t-test, one way ANOVA or two-way ANOVA followed by a Bonferroni multiple-comparison test.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 26 and 27. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.10.288548: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics Statement: Experimental design, including housing conditions, sampling regimen, and humane endpoints, were approved by the Animal Care Committee of the Canadian Science Centre for Human and Animal Health in AUD #C-20-005 and all procedures and housing conditions were in strict accordance with the Canadian Council on Animal Care (CCAC) guidelines.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animal numbers were not based on power analysis but on the limitations of the containment animal room size and requirements of CCAC guidelines.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study design: Nineteen domestic, American Yorkshire crossbred pigs (Sus scrufa) (6 castrated males and 13 females, age 8 weeks) were locally sourced in Manitoba, Canada and utilized in this study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum Neutralization Assays: Neutralizing antibody titers in sera were determined via plaque reduction neutralization test against SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Each virus-serum mixture was then added to duplicate wells of Vero E6 cells in a 48-well format, incubated for 1 hour at 37°C, and overlaid with 500 μl of 2.0% carboxymethylcellulose in DMEM per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequences were analysed using an in-house nf-villumina (v2.0.0) Nextflow workflow that performed: read quality filtering with fastp; taxonomic classification with Centrifuge and Kraken2 using a Centrifuge index of NCBI nt downloaded 2020-02-04 and a Kraken2 index of NCBI RefSeq sequences of archaea, bacteria, viral and the human genome GRCh38 downloaded and built on 2019-03-22; removal of non-viral reads (NCBI taxonomic id 10239) using the Kraken2 and Centrifuge taxonomic classification results; de novo assembly by Shovill, Unicycler and Megahit using the taxonomically filtered reads; nucleotide BLAST search of all assembled contigs against NCBI nucleotide downloaded 2020-04-10. nf-villumina</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RefSeq</div><div>suggested: (RefSeq, RRID:SCR_003496)</div></div><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.31.275701: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Mouse experiments were performed according to the UK Animals (Scientific Procedures) Act Project Licence (PBA43A2E4) and approved by the University of Oxford Local Ethical Review Body.<br>IACUC: Pig immunisation and sampling: Pig studies were performed in accordance with the UK Animals (Scientific Procedures) Act 1986 and with approval from the local Animal Welfare and Ethical Review Body (AWERB) (Project Licence PP1804248).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Nine weaned, Large White-Landrace-Hampshire cross-bred pigs of 8–10 weeks of age from a commercial rearing unit were randomly allocated to three treatment groups (5 µg RBD-SpyVLP, 50 µg RBD-SpyVLP or 100 µg spike glycoprotein) (n = 3).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">CPE was scored by researchers who were blinded to the identity of the samples.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Female C57BL/6 or BALB/c mice (∼ 5 weeks old at the time of first immunisation) were obtained from BMS Oxford or Envigo.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed and incubated with horse radish peroxidase (HRP) conjugated goat-anti-human IgG antibody (Dako, P0447) (diluted 1:1,600 in PBS/0/1% BSA) for 1 h at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To test the reactivity of RBD-SpyVLP against a panel of anti-SARS-CoV-2 RBD antibodies, 50 μL of RBD-SpyVLP samples diluted in PBS to 0.5 μg/mL were coated on NUNC plates at 4 °C overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To detect anti-RBD antibody in the immunised mouse sera, 50 µL purified RBD-6H</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were then washed with PBS and 50 μL of secondary HRP goat anti-mouse antibody (Dako P0417) diluted 1:800 in PBS/0.1% BSA was added to the wells for 1 h at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed and 50 μL of a secondary Alexa Fluor 647 goat anti-human antibody (Life Technologies A21455) (1:500 in PBS with 0.1% (w/v) BSA) were added for 1 h at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human antibody ( Life Technologies A21455 )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike glycoprotein ELISA (Mouse and human sera): A cell-based ELISA as described previously 26 was used to determine the anti-spike glycoprotein antibody response in the mouse sera and convalescent plasma.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike glycoprotein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For human sera, 50 μL of a secondary Alexa Fluor 647 goat-anti human antibody (1:500) (Life Technologies A21455) was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human antibody</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">At 24 h post-infection, cells were fixed with 4% paraformaldehyde and permeabilised with 0.2% (v/v) Triton-X-100 in PBS stained to visualise virus plaques, as described previously for the neutralisation of influenza viruses 61, but using a rabbit polyclonal anti-NSP8 antibody (Antibodies Online; ABIN233792) and anti-rabbit-HRP conjugate (Bio-Rad) and detected using HRP on a TMB based substrate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-NSP8</div><div>suggested: (Acris Antibodies GmbH Cat# AP09089SU-N, RRID:AB_2035808)</div></div><div style="margin-bottom:8px"><div>anti-rabbit-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RBD-specific antibody titres in oral and nasal swab fluids were determined by ELISA as detailed above except that the conjugated secondary antibody was replaced with either goat anti-porcine IgG HRP (Bio-Rad Antibodies) at 1:20,000 dilution in PBS with 1% (w/v) skimmed milk and 0.1% (v/v)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-porcine IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tween-20 or goat anti-porcine IgA HRP (Bio-Rad Antibodies) at 1:20,000 dilution in the same diluent.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-porcine IgA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MDCK-RBD cells were generated as previously described 26, 39, 58.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDCK-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, MDCK-Spike was produced by stably transfecting parental MDCK-SIAT1 cells with full-length SARS-CoV-2 spike glycoprotein cDNA using a lentiviral vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDCK-SIAT1</div><div>suggested: ECACC Cat# 05071502, RRID:CVCL_Z936)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse sera was diluted as above and 50 μL was transferred to the washed plates seeded with MDCK-Spike cells for 1 h at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDCK-Spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Authentic SARS-CoV-2 virus neutralisation assay (PRNT): 96 well plates containing a confluent monolayer of Vero-E6 cells were incubated with 10-20 plaque forming units (PFU) of SARS CoV-2 (hCoV-19/England/02/2020, EPI_ISL_407073, kindly provided by Public Health England) and two-fold serial dilution of heat-inactivated mouse sera for 3 h at 37 °C, 5% CO2, in triplicate per serum sample.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Media in the wells seeded with Vero E6 was replaced with 100 µL DMEM with 10% (v/v) FBS and 1% Antibiotic-Antimycotic (Gibco) and 100 µL of the sera-virus mixture was added into the wells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293T cells were seeded at a density of 7.5 × 105 in 6-well plates before transfection with the following plasmids: 500 ng of SARS-CoV-2 spike, 600 ng p8.91 (HIV-1 gag-pol), 600 ng CSFLW</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An RBD protein with a C-terminal biotin acceptor peptide (RBD-BAP) was expressed from plasmid pOPINTTGNeo in Expi293 cells according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Female C57BL/6 or BALB/c mice (∼ 5 weeks old at the time of first immunisation) were obtained from BMS Oxford or Envigo.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nine weaned, Large White-Landrace-Hampshire cross-bred pigs of 8–10 weeks of age from a commercial rearing unit were randomly allocated to three treatment groups (5 µg RBD-SpyVLP, 50 µg RBD-SpyVLP or 100 µg spike glycoprotein) (n = 3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Large White-Landrace-Hampshire cross-bred</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The intensities of bands on each lane were quantified using ImageLab (version 5.2) software (Bio-Rad) and Fiji distribution of ImageJ (version 1.51n).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The intensity of the size distribution was normalised to the peak value and plotted in GraphPad Prism 8 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Isoflurane (Abbott) lightly anaesthetised mice were immunised on day 0 and day 14 IM with 50 µL of RBD-SpyVLP at 0.1 µg or 0.5 µg or equivalent dose of unconjugated SpyTag-RBD or SpyCatcher003-mi3 VLP.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">EPT is defined as the reciprocal of the highest serum dilution that gives a positive signal (blank+10 SD) determined using a five-parameter logistic equation calculated using GraphPad Prism 8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus plaques were quantified and ND50 for sera was calculated using LabView software as described previously 61.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>LabView</div><div>suggested: (LabView , RRID:SCR_014325)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were analysed using a BD LSRFortessa flow cytometer (BD Biosciences) and data analysed using FlowJo software (BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.05.05.079194: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary detection of hACE-2 was done using a goat anti-hACE-2 antibody (1:1,250; #AF933, R&D Systems), a horseradish peroxidase (HRP)-labeled donkey anti-goat antibody (1:5,000, Dianova) and Super Signal West Femto Chemiluminescence Substrate (Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-hACE-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HRP)-labeled donkey anti-goat antibody (1:5,000, Dianova)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As loading control, samples were analyzed for β-actin expression using a mouse anti-β-actin antibody (1:5,000, Sigma Aldrich) and a HRP-labeled goat anti-mouse antibody (1:10,000, Sigma-Aldrich).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-β-actin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(ATCC HTB-37) and H1299 (ATCC CRL-5803) were cultivated in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% heat-inactivated fetal calf serum, 1% non-essential amino acids, 1% L-glutamine and 1% sodium pyruvate (all Thermo Fisher Scientific) in a 5% CO2 atmosphere at 37 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>H1299</div><div>suggested: ATCC Cat# CRL-5803, RRID:CVCL_0060)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells inoculated with cell culture supernatants from uninfected Vero cells mixed with OptiPro serum-free medium supplemented with 0.5% gelatine and PBS, in accordance to virus stock preparation, serves as mock infected controls.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the assay Vero E6 cells were seeded to confluence and infected with serial dilution of virus-containing cell culture supernatant diluted in OptiPro serum-free medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infections for RNA sequencing experiments: Calu-3 cells and H1299 cells were seeded at a concentration of 6 x 10^5 cells/mL and 5 x 10^4 cells/mL, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.05.05.079095: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies were detected using Fluorophore-conjugated secondary goat anti-mouse (IRDye 680RD, 926-68070) and goat anti-rabbit (IRDye 800CW, 926-32211) antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (LI-COR Biosciences Cat# 926-68070, RRID:AB_10956588)</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (LI-COR Biosciences Cat# 926-32211, RRID:AB_621843)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The hESC line RUES2 was cultured on irradiated mouse embryonic fibroblasts (Global Stem, cat. no. GSC-6001G) at a density of 20,000-25,000 cells/cm2 in a medium of DMEM/F12, 20% knockout serum replacement (Life Technologies), 0.1 mM β-mercaptoethanol (Sigma Aldrich) and 20 ng/ml bFGF (R&D Systems), and medium was changed daily. hESC cultures were maintained in an undifferentiated state at 37 °C in a 5% CO2/air environment until stem cells reached about 90% confluence. hESC differentiation into endoderm was performed in serum-free differentiation (SFD) medium of DMEM/F12 (3:1) (Life Technologies) supplemented with N2 (Life Technologies), B27, 50 μg/ml ascorbic acid, 2 mM Glutamax, 0.4 μM monothioglycerol, 0.05% BSA at 37 °C in a 5% CO2/5% O2/95% N2 environment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RUES2</div><div>suggested: RRID:CVCL_B810)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell Lines: HEK293T (human [Homo sapiens] fetal kidney) and Vero E6 (African green monkey [Chlorocebus aethiops] kidney) were obtained from ATCC (https://www.atcc.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Approximately 2.5 × 105 Vero E6 cells were pre-treated with DMSO, 10 μM imatinib, 3 μM MPA or 4.5 μM QNHC for 1 h prior to infection with SARS-CoV-2 at an MOI of 0.01 in DMEM supplemented with 2% FBS, 4.5 g/L D-glucose, 4 mM L-glutamine, 10 mM</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Xenograft formation: 1 million hESC-derived cells at lung progenitor stage (at day 25) were subcutaneously injected into 6-8 weeks old NOD.Cg-Prkdcscid Il2rgtm1WjI/SzJ (NSG) mice (Jackson Laboratory, Bar Harbor, Maine)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NOD.Cg-Prkdcscid Il2rgtm1WjI/SzJ</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell Lines: HEK293T (human [Homo sapiens] fetal kidney) and Vero E6 (African green monkey [Chlorocebus aethiops] kidney) were obtained from ATCC (https://www.atcc.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.atcc.org/</div><div>suggested: (ATCC, RRID:SCR_001672)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody-mediated fluorescence was detected on a LI-COR Odyssey CLx imaging system and analyzed using Image Studio software (LI-COR). qRT-PCR: Total RNA samples were prepared from cells/organoids using TRIzol and Direct-zol RNA Miniprep Plus kit (Zymo Research) according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Image Studio</div><div>suggested: (Image Studio Lite, RRID:SCR_013715)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We normalized the gene expression UMI counts using a deconvolution strategy implemented by the R scran package (v.1.14.1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>scran</div><div>suggested: (scran, RRID:SCR_016944)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The list of dissociation-related genes was originally built on mouse data 29; we converted them to human ortholog genes using Ensembl BioMart.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ensembl</div><div>suggested: (Ensembl, RRID:SCR_002344)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We scaled the normalized counts and performed PCA on the highly variable genes using the ScaleData and RunPCA functions in the R Seurat package 28.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Seurat</div><div>suggested: (SEURAT, RRID:SCR_007322)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The rest plots were generated using the R ggplot2 package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting single end reads were checked for quality (FastQC v0.11.5) and processed using the processed using the nf-core RNA-seq (v.1.4.2) workflow.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FastQC</div><div>suggested: (FastQC, RRID:SCR_014583)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples had adapters trimmed using Trim Galore (v0.6.4) then ribosomal reads removed using SortMeRNA (v.2.1)before being aligned to human reference genome (GRCh38) using STAR aligner30 (v.2.6.1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Trim Galore</div><div>suggested: (Trim Galore, RRID:SCR_011847)</div></div><div style="margin-bottom:8px"><div>SortMeRNA</div><div>suggested: (SortMeRNA, RRID:SCR_014402)</div></div><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_015899)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Raw gene counts were quantified using Subread (v.1.6.4) featureCounts.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>featureCounts</div><div>suggested: (featureCounts, RRID:SCR_012919)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Principal component analysis was performed using Log2 CPM values and gene set analysis was run with WebGestalt 32.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>WebGestalt</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Heatmaps and bar plots were generated using Graphpad Prism software, version 7.0d.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.31.276725: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) IgG monoclonal, primary antibodies and AlexaFluor® goat anti-mouse IgG polyclonal antibodies (Dianova; # 115-545-146).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 115-545-146, RRID:AB_2307324)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Rabbit anti-E-cadherin IgG monoclonal (CellSignaling; 3195S) or rabbit anti-VE-cadherin polyclonal, primary antibodies (CellSignaling; 2158S) and Cy5 goat anti-mouse IgG polyclonal antibodies (Dianova; #111-175-144) were used to detect cell borders of Calu-3 or HUVEC cells on the membrane of the alveolus-on-a-chip model, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-E-cadherin IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-VE-cadherin</div><div>suggested: (Cell Signaling Technology Cat# 2158, RRID:AB_2077970)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the detection of SARS-CoV-2 spike protein a rabbit polyclonal anti-SARS-CoV-2 spike S2 antibody (Sino Biological #40590-T62) was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 spike S2</div><div>suggested: (Thermo Fisher Scientific Cat# PA5-112048, RRID:AB_2866784)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the cultivation of the human alveolus-on-a-chip model we used Calu-3 cells and macrophages at the epithelial side, and HUVECs at the endothelial side.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HUVECs</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For infection of Vero-76 or Calu-3 cells, cells were washed with PBS and either left uninfected (mock) or infected with SARS-CoV-2 with a multiplicity of infection (MOI) of 1 for 120 min in medium (EMEM with HEPES modification and 5 mM L-Glutamine for Vero-76 cells and RPMI 1640 for Calu-3 cells) supplemented with 10 % FCS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-76</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Rabbit anti-E-cadherin IgG monoclonal (CellSignaling; 3195S) or rabbit anti-VE-cadherin polyclonal, primary antibodies (CellSignaling; 2158S) and Cy5 goat anti-mouse IgG polyclonal antibodies (Dianova; #111-175-144) were used to detect cell borders of Calu-3 or HUVEC cells on the membrane of the alveolus-on-a-chip model, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HUVEC</div><div>suggested: KCB Cat# KCB 200648YJ, RRID:CVCL_2959)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cDNA preparation was performed using the SuperScript IV (Thermofisher), followed by a multiplex PCR to generate overlapping 400 nt amplicons using version 3 of the primer set (https://github.com/artic-network/artic-ncov2019/tree/master/primer_schemes/nCoV-2019/V3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermofisher</div><div>suggested: (ThermoFisher; SL 8; Centrifuge, RRID:SCR_020809)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infection by SARS-CoV-2 was visualized using mouse anti-SARS-CoV-2 spike (GeneTex; #GTX632604</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GeneTex</div><div>suggested: (GeneTex, RRID:SCR_000069)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were acquired using an Axio Observer.Z1 microscope (Zeiss) with Plan Apochromat 20x/0.8 objective (Zeiss), ApoTome.2 (Zeiss) and Axiocam 503 mono (Zeiss) and the software Zen 2.6 (blue edition; Zeiss).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Zen</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fiji V 1.52b (ImageJ) was used for further image processing, including Z-stack merging with maximum intensity projection and gamma correction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analyses were performed using Prism 8 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.28.244269: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mouse immunization studies: To test the immunogenicity of DNA vaccines female 8-10 weeks BALB/c OlaHsd mice (Envigo, Italy) were used for immunization protocols.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For total IgG determination, goat anti mouse IgG (H+L)-HRP antibodies (Jackson ImmunoResearch; 115-035-003) were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti mouse IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>H+L)-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To determine specific types of anti-RBD antibodies in mouse sera goat anti-mouse IgG1-HRP (Abcam; ab97240)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG1-HRP</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-2060, RRID:AB_631760)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The next day, cells were infected with VSVΔG*/G virus in serum-free medium for 1h, after which medium was removed and cells were washed with PBS before complete medium supplemented with anti-VSV-G antibody (8G5F11, Kerafast) was added to the cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-VSV-G</div><div>suggested: (Absolute Antibody Cat# Ab01401-2.0, RRID:AB_2883992)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: The human embryonic kidney (HEK) 293, HEK293T (ATCC) cell line and mouse NIH-3T3 cell (ATCC) line was cultured in DMEM (Invitrogen) supplemented with 10% FBS (BioWhittaker) at 37 °C in a 5% CO2 environment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293E cells were cultured in EX-CELL 293 serum-free medium (Sigma) and incubated with agitation at 37°C and 4.5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293E</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For neutralization assay, HEK293 were seeded (2.5*104/well) a day before transfection with plasmids encoding ACE2 (pCG1-ACE2, a kind gift of Stefan Pölhmann), pCMV3-C-Myc-TMPRSS2 and phRL-TK (encoding Renilla luciferase).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To determine RBD specific cytotoxicity, mouse NIH-3T3 cells were seeded into 24-well plates (1*105/well); next day cells were transfected with pCG1-hACE2 (900 ng/well) and pCMV-TMPRSS2 (30 ng/well) plasmids.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NIH-3T3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE-2 (hsACE-2, residues S19 to D615) was codon optimized for H. sapiens and cloned into the pTwist_CMV_BetaGlobin_WPRE_Neo (Twist Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE-2 (hsACE-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse immunization studies: To test the immunogenicity of DNA vaccines female 8-10 weeks BALB/c OlaHsd mice (Envigo, Italy) were used for immunization protocols.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c OlaHsd</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Surrogate assay of protection of viral infection by immunization: Balb/c mice were immunized with RBD-bann according to scheme, presented above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Balb/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Modelling of designed RBD-scaffolded protein cages: Molecular model structures of designed nanovaccines were prepared by performing homology modelling with Modeller (version 9.23)56.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Modeller</div><div>suggested: (MODELLER, RRID:SCR_008395)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For total IgG determination, goat anti mouse IgG (H+L)-HRP antibodies (Jackson ImmunoResearch; 115-035-003) were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Jackson ImmunoResearch</div><div>suggested: (Jackson ImmunoResearch, RRID:SCR_010488)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 20. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.11.293951: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Plaque numbers were scored in at least 3 replicates per dilution by independent readers blinded to the experimental group and the virus titers were determined by plaque-forming units (PFU) per milliliter.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The primary antibody was incubated overnight at 4°C [anti-double-stranded RNA (dsRNA) monoclonal antibody (1:200, Scicons)].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-double-stranded RNA ( dsRNA )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, cells were incubated with primary antibody anti-dsRNA (1:200) overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-dsRNA</div><div>suggested: (Millipore Cat# MABE1134, RRID:AB_2819101)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Day after, cells were incubated with the secondary antibody goat anti-mouse Alexa Fluor 488 (1:400) for 1h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, membranes were incubated with peroxidase-conjugated antibody goat anti-Mouse IgG (H+L), HRP-conjugate (1:10,000, G21040 −Molecular Probes).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Mouse IgG</div><div>suggested: (Thermo Fisher Scientific Cat# G-21040, RRID:AB_2536527)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plaque forming unit assay: For virus titration, monolayers of Vero E6 cells (2 x 104 cell/well) in 96-well plates were infected with serial dilutions of supernatants containing SARS-CoV-2 for 1 hour at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, extract samples (40 μg/lane for NP and 15 μg/lane for Vero cells) were separated by electrophoresis on a 10% SDS polyacrylamide gel and transferred to polyvinylidene difluoride (PVDF) membranes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 propagation: SARS-CoV-2 obtained from a nasopharyngeal swab from a confirmed case in Rio de Janeiro, Brazil (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell cultivation: Human induced pluripotent stem (iPS) cells were obtained from the Coriell Institute for Medical Research repository (GM23279A) or produced in house with CytoTune™-iPS 2.0 Sendai Reprogramming Kit (A16517-Invitrogen) from skin fibroblasts [68] or urine epithelial cells [</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CytoTune™-iPS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primers, probes, and cycling conditions recommended by the Centers for Disease Control and Prevention (CDC) protocol were used to detect the SARS-CoV-2 (https://www.fda.gov).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.fda.gov</div><div>suggested: (U.S. Food and Drug Administration, RRID:SCR_012945)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cytokine multiplex assay and LDH cytotoxicity assay: A multiplex biometric immunoassay containing fluorescent dyed microbeads was used to measure cytokines in the cell culture supernatant (Bio-Rad Laboratories, Hercules, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bio-Rad Laboratories</div><div>suggested: (Bio-Rad Laboratories, RRID:SCR_008426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics were performed using GraphPad Prism software version 8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 strains sequence analyses: Nucleotide sequences from our strain (GenBank accession No. MT710714), from strains used in others works [20,37], and from SARS-CoV-2 reference genome (Wuhan-Hu-1, GenBank accession No. NC_045512.2) were retrieved from NCBI database and from Multiple Sequence Alignment (MSA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NCBI</div><div>suggested: (NCBI, RRID:SCR_006472)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Visualization of SARS-CoV-2 sequences was performed using ClustalW [75] implemented in MEGA X program-version 10.1.8 [76].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ClustalW</div><div>suggested: (ClustalW, RRID:SCR_017277)</div></div><div style="margin-bottom:8px"><div>MEGA X</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.04.20.051011: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Work with live virus was performed at biosafety level-3 containment at the Influenza Research Institute at the University of Wisconsin – Madison under a recombinant DNA protocol approved by the Institutional Biosafety Committee.<br>IRB: Approval to obtain the de-identified clinical sample was reviewed by the Human Subjects Institutional Review Boards at the University of Wisconsin – Madison.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sample collection and cell culture passage conditions: Three different Vero cell lines were purchased from ATCC; Vero 76 (ATCC: CRL-1587), Vero C1008 (ATCC: CRL-1586), Vero STAT-1 KO (ATCC: CCL-81-VHG), and were grown in Minimum Essential Medium (MEM) supplemented with 10% fetal bovine serum (FBS) and L-glutamine at 37°C with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vero C1008</div><div>suggested: ATCC Cat# CRL-1586, RRID:CVCL_0574)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Four samples (primary NP swab, p1 Vero 76, p1 Vero E6, and p1 Vero STAT-1 KO) were pooled on a single flowcell to a final concentration of 8pM with a PhiX-derived control library accounting for 1% of total DNA and was loaded onto a 500-cycle v2 flowcell.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Minor variants from ONT sequences that comprise at least 10% of total sequences in any of the samples were identified using the bbmap callvariants.sh tool (https://jgi.doe.gov/data-and-tools/bbtools/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://jgi.doe.gov/data-and-tools/bbtools/</div><div>suggested: (Bestus Bioinformaticus Tools, RRID:SCR_016968)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, read ends were trimmed to achieve an average read quality score of Q30 and a minimum read length of 100 bases using Trimmomatic (http://www.usadellab.org/cms/?</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Trimmomatic</div><div>suggested: (Trimmomatic, RRID:SCR_011848)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Paired-end reads were merged and then mapped to the reference sequence (Genbank MT039887.1: 2019-nCoV/USA-WI1/2020) using Bowtie2 (http://bowtie-bio.sourceforge.net/bowtie2/manual.shtml).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bowtie2</div><div>suggested: (Bowtie 2, RRID:SCR_016368)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single nucleotide variants (SNVs) were called with Varscan2 (http://varscan.sourceforge.net/using-varscan.html) using a frequency threshold of 1%, a minimum coverage of 100 reads, and a base quality threshold of Q30 or higher [29].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Varscan2</div><div>suggested: (VARSCAN, RRID:SCR_006849)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VCF files were cleaned for additional analyses and figure-generation using custom Python scripts, which are all available at the GitHub repository accompanying this manuscript.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.07.286567: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: The presence of the desired mutations was determined by automated DNA sequencing.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">goat anti-human IgG (H+L) Ab (Invitrogen) and AlexaFluor-647-conjugated donkey anti-goat IgG (H+L) Ab (Invitrogen) were used as secondary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>AlexaFluor-647-conjugated donkey anti-goat IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The generation and maintenance of 293T-ACE2 cell line was previously reported [22].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells were transfected by the calcium phosphate method with the lentiviral vector pNL4.3 R-E-Luc (NIH AIDS Reagent Program) and a plasmid encoding for SARS-CoV-2 Spike (WT or D614G), SARS-CoV-1 Spike or VSV-G at a ratio of 5:4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were acquired on a LSRII cytometer (BD Biosciences, Mississauga, ON, Canada) and data analysis was performed using FlowJo vX.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Hill coefficient analyses were done with using GraphPad Prism version 8.0.1 (GraphPad, San Diego, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04335136</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recombinant Human Angiotensin-converting Enzyme 2 (rhACE2) a…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.08.28.272955: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transfected cells were then incubated overnight at 4°C with monoclonal anti-FLAG M2 mouse antibody (dilution 1:2,000, Sigma-Aldrich).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-FLAG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 3 washes for 10 min with PBS 0.01% Triton X-100, cells were incubated for 1 h at 37 °C with the Alexa Fluor 647-conjugated secondary antibody donkey anti mouse IgG (H+L) (1:2,000</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti mouse IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">T-REx™ HEK293 cells were grown in Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco) supplemented with 10% fetal bovine serum (FBS, Sigma-Aldrich), GlutaMAX™ and Penicillin-Streptomycin (1x).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BioID data analysis: The proteins were identified by comparing all MS/MS data with the Homo sapiens proteome database (Uniprot, release March 2020, Canonical+Isoforms, comprising 42,360 entries + viral bait protein sequences added manually), using the MaxQuant software version 1.5.8.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MaxQuant</div><div>suggested: (MaxQuant, RRID:SCR_014485)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The statistical analysis was done by Perseus software (version 1.6.2.3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Perseus</div><div>suggested: (Perseus, RRID:SCR_015753)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The tabs ‘Enrichment basal condition’ and ‘Enrichment poly(I:C)’ have been generated entering the lists of high confidence proximal interactors of each viral bait protein in the ToppCluster online tool4 (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ToppCluster</div><div>suggested: ( ToppCluster , RRID:SCR_001503)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All interactors individual annotations are shown in Supplemental Table 2, which was generated using the Metascape annotation tool5 (https://metascape.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Metascape</div><div>suggested: (Metascape, RRID:SCR_016620)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Processing of the images was performed using Zeiss Zen 2 software and assembled using Adobe Illustrator.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Adobe Illustrator</div><div>suggested: (Adobe Illustrator, RRID:SCR_010279)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Our code is written in Python 3.87 and makes use of several modules, primarily: NetworkX8 for graph operations, NumPy9 for array manipulation and numerical computations, pandas10 for data handling and Plotly11 for visualization.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      We thus do think that this apparent limitation could be also seen as an asset of our study; (ii) In our opinion, the main limitation sits in the expression of a single protein at a time. Knowing that several viral proteins require viral cofactors, infected context and/or the presence viral RNA to function properly (e.g. NSP10-NSP14 or NSP10-NSP16), the present analysis almost certainly misses cooperative viral interactions. Similar studies performed in infected cells will thus bring highly valuable additional information on putative SARS-CoV-2 pathogenesis mechanisms. As an attempt to mimic a physiopathological context, we artificially induced an anti-viral response by transfecting poly(I:C) and repeating the proximal interactome analysis. These experiments already revealed novel interactions of the utmost importance; and (iii), the proximal interactions are not necessarily physical and should therefore be considered as a discovery step systematically requiring orthogonal or functional validation. However, the proximal interactomics multiple analysis generated by us and others have been at the basis of fundamental mechanism discoveries, supporting the validity of the approach for identifying new biology (see177 for review). This first proximal interaction mapping of SARS-CoV-2 proteins provides a plethora of novel research tracks to better understand this virus pathogenesis. Although for a few proteins our approach did not lead to satisfying results (NSP3, NSP5, NSP8, ORF8 an...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.08.284737: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: HEK293T cells (293T, ATCC, CRL-3216) and VERO-E6 cells (ATCC, CRL-1586) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco) supplemented with 10% fetal bovine serum (FBS), 2.0 mM L-Glutamine, 110 mg/L sodium pyruvate, and 4.5 g/L D-glucose. l1-Hybridoma (CRL-2700) secreting a monoclonal antibody targeting against VSV glycoprotein was cultured in Minimum Essential Medium with Earle’s salts and 2.0 mM L-Glutamine (MEM; Gibco).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CRL-3216</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>l1-Hybridoma</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>VSV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next they were incubated with the mouse monoclonal antibody targeting Flag tag (9A3, #8146S,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody targeting Flag tag ( 9A3</div><div>suggested: (Cell Signaling Technology Cat# 8146, RRID:AB_10950495)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After three rounds of PBS washing, cells were subsequently incubated with 2 μg/ml of the secondary goat anti-rabbit antibody conjugated with Alexa Fluor 594 (A11032, Thermo Fisher Scientific, United States) diluted in 1% BSA /PBS at room temperature for 30 mins.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A11032</div><div>suggested: (Molecular Probes Cat# A-11032, RRID:AB_2534091)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were subsequently incubated with a mouse monoclonal antibody SARS-CoV/SARS-CoV-2 Nucleocapsid Antibody (40143-MM05, Sino Biological, China) at 1:500 at 37°C for 1 hour, and then incubated with 2μg/ml of goat anti-mouse secondary antibody, Alexa Fluor 594 (A-11032, Thermo Fisher Scientific) at 37°C for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Molecular Probes Cat# A-11032, RRID:AB_2534091)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: HEK293T cells (293T, ATCC, CRL-3216) and VERO-E6 cells (ATCC, CRL-1586) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco) supplemented with 10% fetal bovine serum (FBS), 2.0 mM L-Glutamine, 110 mg/L sodium pyruvate, and 4.5 g/L D-glucose. l1-Hybridoma (CRL-2700) secreting a monoclonal antibody targeting against VSV glycoprotein was cultured in Minimum Essential Medium with Earle’s salts and 2.0 mM L-Glutamine (MEM; Gibco).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Coronavirus RBD-hFc binding assay: Recombinant SARS-CoV-RBD-hFc and SARS-CoV-2-RBD-hFc proteins were produced by transient transfection of 293T cells with Lipofectamine 3000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 was amplified on Vero-E6 cells and stored at −150°C, and the titer was determined on Vero-E6 cells through a plaque assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, we aligned the deduced ACE2 protein sequences using the MUSCLE program (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MUSCLE</div><div>suggested: (MUSCLE, RRID:SCR_011812)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sequence logo was generated with WebLogo (https://weblogo.berkeley.edu/logo.cgi).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>WebLogo</div><div>suggested: (WEBLOGO, RRID:SCR_010236)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We performed selective pressure analysis on bat ACE2 using CodeML implemented in PAML (24).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PAML</div><div>suggested: (PAML, RRID:SCR_014932)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Homology-based structural modeling: Molecular models of different bat ACE2 were predicted by I-TASSER (Iterative Threading ASSEmbly Refinement) version 5.1 (31).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>I-TASSER</div><div>suggested: (I-TASSER, RRID:SCR_014627)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The structural alignment and visualization were implemented in PyMOL (33).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.11.293464: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All procedures used in this study (sex-matched, age-matched) complied with federal guidelines and the institutional policies of the Yale School of Medicine Animal Care and Use Committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed three times with PBS-T (PBS with 0.1% Tween-20) and 50μl of mouse IgG-specific secondary antibody (BioLegend #405306, 1:10,000) diluted in dilution solution added to each well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>mouse IgG-specific</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of SARS-CoV-2 virus: To generate SARS-CoV-2 viral stocks, Huh7.5 cells were inoculated with SARS-CoV-2 isolate USA-WA1/2020 (BEI Resources #NR-52281) to generate a P1 stock.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7.5</div><div>suggested: RRID:CVCL_7927)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus titer was determined by plaque assay using Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cytokine assays: Soluble chemokines and cytokines were assessed in CSF supernatant and paired plasma using the HD71 Human Cytokine Array/Chemokine Array (Eve Technologies, Calgary, AB).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AB</div><div>suggested: RRID:BDSC_203)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To identify potential intercellular interactions between different cell types in the scRNA-seq data, we utilized CellPhoneDB v2(10)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CellPhoneDB</div><div>suggested: (CellPhoneDB, RRID:SCR_017054)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Assignments of V(D)J sequences were performed using IgBLAST v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgBLAST</div><div>suggested: (IgBLAST, RRID:SCR_002873)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical methods: All statistical analyses were performed using commercially available software (Prism or Excel).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism or Excel</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human Monoclonal antibodies: Data availability: Gene expression and repertoire data in the study are available in the NCBI repository SRAxxxx Raw mass spectrometry files and data analysis output are available from MassIVE (https://massive.ucsd.edu/) and Proteome Exchange (http://www.proteomexchange.org/) under MassIVE dataset identifier # and Proteome Exchange # Competing Interests: None of the authors declare interests related to the manuscript.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MassIVE</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>http://www.proteomexchange.org/</div><div>suggested: (ProteomeXchange, RRID:SCR_004055)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.01.278689: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The protocol was approved by the Institutional Animal Care and Use Committee (IACUC) at UTMB.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Statistics: Male hamsters were randomly allocated into different groups.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">The investigators were not blinded to allocation during the experiments or to the outcome assessment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Hamster infection: Four-to five-week-old male golden Syrian hamsters, strain HsdHan:AURA (Envigo, Indianapolis, IN), were inoculated intranasally with 2×104 PFU SARS-CoV-2 in a 100-μl volume.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cell lines were verified and tested negative for mycoplasma.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The purified virions were analyzed by Western blot using polyclonal antibodies against spike protein and nucleocapsid as described previously32.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibodies against spike protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">On the following day, sera or monoclonal antibodies were serially diluted from 1/20 starting dilution and nine 2-fold dilutions to the final dilution of 1/5,120 and incubated with D614 or G614 mNeonGreen SARS-CoV-2 at 37°C for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>D614</div><div>suggested: (GenWay Biotech Inc. Cat# GWB-A5D614, RRID:AB_10285218)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For recovering the mutant viruses, the RNA transcripts were electroporated into Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral infection on cells: Approximately 3×105 Vero E6 or Calu-3 cells were seeded onto each well of 12-well plates and cultured at 37°C, 5% CO2 for 16 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virion purification and spike protein cleavage analysis: Vero E6 or Calu-3 2B4 cells were infected with D614 or G614 viruses at an MOI of 0.01.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3 2B4</div><div>suggested: RRID:CVCL_YZ47)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus-serum mixture was transferred to the Vero cell plate with the final MOI of 2.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sequencing reactions were purified using a 96-well plate format (EdgeBio, San Jose, CA, USA) and analyzed on a 3500 Genetic Analyzer (Applied Biosystems, Foster City, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EdgeBio</div><div>suggested: (EdgeBio, RRID:SCR_000183)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The curves of the relative infection rates versus the serum dilutions (log10 values) were plotted using Prism 8 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis was performed in Prism version 7.03 (GraphPad, San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.12.294066: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study cohorts: All studies were performed with the approval of the University of Chicago institutional review board and University of Chicago and University of Wisconsin-Madison institutional biosafety</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Horseradish peroxidase (HRP)-conjugated goat anti-human Ig secondary antibody diluted in PBS 0.1% Tween + 1% milk powder was used to detect binding of antibodies, and after a 1-hour incubation, plates were developed with 100 μl SigmaFast OPD solution (Sigma-Aldrich), with development reaction stopped after 10 minutes using 50 μl 3M HCl.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>goat anti-human Ig secondary antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human Ig secondary</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">D614G spike protein, SARS-CoV-1 RBD, and MERS-CoV RBD were generated in-house and expressed in HEK293F cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plasma/virus mixture was incubated for 30 minutes at 37°C and added to TMPRSS2-expressing Vero E6 cells grown in 1x minimum essential medium (MEM) supplemented with 5% FCS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ORF7a, ORF8, and full-length N proteins were cloned from the 2019-nCoV/USA-WA1/2020 SARS-CoV-2 strain at Washington University.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analysis was performed using Prism software (Graphpad Version 8), JMP</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(SAS Institute Version 15)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04340050</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">COVID-19 Convalescent Plasma</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.15.275891: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell-based Mpro Activity Assay in HEK293A and Huh7: Mpro Expression and Purification: Modified versions of previous protocols based on HRV protease (40) or SUMO protease (51) processing of Mpro fusion proteins were used to obtain purified Mpro with either native or extended termini after expression in E. coli.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293A</div><div>suggested: RRID:CVCL_6910)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cytotoxicity assay in Huh7 cells: 24 h prior to the drug treatment, 10000 Huh7 cells were seeded in 100 μl culture medium (DMEM with 10% FBS, 2mM L-glutamine, penicillin-streptomycin) in a 96-well white microplate (Greiner Bio-One, Austria) pre-coated with poly-D-lysine (10μg/ml, Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antiviral and cytotoxicity assays in Caco-2 cells: The tested Mpro inhibitors were serially diluted from 10 mM DMSO stocks using eight log10 dilutions in test medium (MEM supplemented with 2% FBS and 50 μg/mL gentamicin) yielding a concentration range of 10 pM – 100 μM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARSCoV2 (USA_WA1/2020 strain passaged twice in Vero 76 cells in MEM supplemented with 2% fetal bovine serum and 50 μg/ml gentamicin to prepare a working stock) was prepared at a multiplicity of infection (MOI) that would yield measurable virus titers within 72 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero 76</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The IC50 curves were evaluated using the following equation in Prism (GraphPad):

      Here vrel is the experimentally measured rate of substrate cleavage normalized to the rate of substrate cleavage in the absence of inhibitor, I.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr></table>


      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.10.292078: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Induced cultures were washed and incubated with 400 ng/mL antibody for 1 h at room temperature with gentle agitation, followed by secondary labeling with 1:100 FITC-conjugated anti-Myc to label for RBD expression and 1:200 PE-conjugated goat anti-human-IgG (Jackson ImmunoResearch 109-115-098) to label for bound antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Myc</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-115-098, RRID:AB_2337675)</div></div><div style="margin-bottom:8px"><div>anti-human-IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We then computed the “escape fraction” for each barcoded variant in each antibody-selected library, which we define as Ev = F × (nvpost/Npost)/ nvpre/Npre)/ where F is the total fraction of the library that escapes antibody binding (these fractions are given as percentages in the bottom two rows of Figure S1C), nvpost and nvpre are the counts of variant v in the RBD library after and before enriching for antibody-escape variants with a pseudocount of 0.5 added to all counts, and and are the total counts of all variants before and after the antibody-escape enrichment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-escape enrichment.</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We then computationally applied two filters to remove variants that fail to express properly folded RBD and so escape antibody binding for that trivial reason rather than antibody-specific escape mutations.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-specific escape mutations.</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were stained with recombinant biotinylated ACE2 (ACROBiosystems, AC2-H82E6) and serial dilutions of rCR3022 antibody for 1 h at room temperature, washed with FACS buffer, resuspended in a 1:200 dilution of PE-conjugated streptavidin (ThermoFisher, S866) and APC-conjugated Goat Anti-Human IgG (Jackson Labs, 109-115-098), and incubated on ice for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>AC2-H82E6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-Human IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-115-098, RRID:AB_2337675)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 antibodies were added to each of three wells with the respective antibody at 2.5 μg/mL in a 5 μL/well volume (final 0.1 μg/mL concentration of biotinylated antibody) without washing of unlabeled antibody and then incubated for 1 h at ambient temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence analysis of the gene encoding spike protein from spike protein-expressing VSV escape mutants: To identify escape mutations present in spike protein-expressing VSV antibody-selected escape variants, the escape viruses isolated after RTCA escape screening were propagated in 6-well culture plates with confluent Vero E6 cells in the presence of 10 μg/mL of the corresponding antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VSV</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T-ACE2 cells (BEI NR-52511) were seeded at 1.25e4 cells per well in 50 μL D10 in poly-L-lysine coated 96-well plates (Greiner 655930).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the neutralization assays, the ACE2-293T cells were plated as described above for viral titering.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T cells were seeded at 6e5 cells per well in a 6-well plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S2Pecto protein was expressed in FreeStyle 293 cells (ThermoFisher) or Expi293 cells (ThermoFisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The S6Pecto protein was expressed in FreeStyle293 cells and isolated on a StrepTrap HP column following the addition of BioLock Biotin Blocking Solution (IBA Lifesciences) to the culture supernatant.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FreeStyle293</div><div>suggested: ATCC Cat# PTA-5080, RRID:CVCL_D603)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Eighteen thousand (18,000) Vero E6 cells in 50 μL of cell culture medium were seeded per each well, and plates were placed on the analyzer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The multidimensional scaling in Figure 2D that projects the antibodies into a two-dimensional space of escape mutations was performed using the Python scikit-learn package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div><div style="margin-bottom:8px"><div>scikit-learn</div><div>suggested: (scikit-learn, RRID:SCR_002577)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Compensation and gating was performed using FlowJo v10.7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were collected using a Gatan US4000 4k × 4k CCD camera on a FEI TF20 (TFS) transmission electron microscope operated at 200 keV and controlled with SerialEM (Mastronarde, 2005).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image processing was performed using the cryoSPARC software package (Punjani et al., 2017).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      While these analyses come with the caveat that no experimental measures of the effects of mutations fully capture how they affect true viral fitness, it is nonetheless informative to assess how mutations that escape antibody binding impact the key biochemical functions of the RBD. Remarkably, combining the escape maps with these functional measurements predicts which mutations are selected when spike-expressing virus is grown in the presence of individual antibodies. The selected viral escape mutations are consistently those that have large effects on antibody escape but little negative impact on ACE2 binding and RBD folding, and are also accessible by single-nucleotide mutations. Furthermore, one of the antibodies was highly resistant to viral escape–and we showed this could be explained by the fact that the virus has no escape mutations from this antibody that are both tolerable for RBD function and accessible by single-nucleotide changes. Therefore, complete measurements of both the antigenic and functional consequences of viral mutations provide the phenotypic data necessary to assess both the likelihood of viral escape under antibody pressure and the specific mutations that arise when escape occurs. One immediate implication of our results is that counter to prevailing wisdom, antibody cocktails do not have to target distinct regions of the RBD in order to resist viral escape. Simple inspection of the escape maps reveals pairs of antibodies targeting the RBD’s ACE2-bindi...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.14.20191759: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: They have provided written informed consent for the use of their samples for research.<br>IRB: Ethics approval was given by the French Ethics Committee CPP-lle-de-France 6 (ID RCB: 2020-A00256-33 and ID RCB: 2020-A00280-39) and the French National Data Protection Commission (approval #920102).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, in each well of 96-wells microplates previously coated with anti-SARS-CoV-2 N-antibodies, 50 μl of a solution containing a biotinylated anti-SARS-CoV-2 N antibodies and 50 μl of sera were added.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 N</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Detection of anti-SARS-CoV-2 nucleocapsid IgG: For a subset of 85 sera, corresponding to 80 patients (ICU patients: n = 21, ward patients: n = 36 and outpatients: n = 36), we performed a chemiluminescent microparticle immunoassay detecting anti-N immunoglobulins G (Architect SARS-CoV-2 IG Assay, Abbott).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A limitation of this first N-antigenemia evaluation for COVID-19 diagnosis is the high proportions of ICU and ward patients. N-antigenemia decrease seems to occur earlier in outpatients, but have to be confirmed in larger cohorts. This innovative marker opens new perspectives for diagnostic, such as rapid antigen blood test and combined ELISA assays, detecting both antigens and antibodies. This could provide a valuable new option for COVID-19 diagnosis, only requiring a blood draw, scalable in all clinical laboratories and high throughput analyzers.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04262921</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">French COVID Cohort</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04259892</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Viral Excretion in Contact Subjects at High/Moderate Risk of…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04259892</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Viral Excretion in Contact Subjects at High/Moderate Risk of…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.18.301952: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All the ACE2 variants were expressed in HEK 293F cells by transient transfection using Opti-MEM (Gibco-Thermo Fisher Scientific, Waltham, MA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The expression construct was transiently transfected in HEK 293T cells using polyethylenimine (Polysciences, Inc, Warrington, PA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293 cells were transfected with pCMV-AT1R-IRES-Puro gene using Lipofectamine 3000 reagent (Thermo Fisher Scientifics).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization of HIV-based pseudovirus containing a full-length SARS-CoV-2 S protein was measured using a single-round infection assay in HEK 293T/ACE2 target cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T/ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudotyped virus particles were produced in 293T/17 cells (ATCC) by co-transfection of a plasmid encoding codon-optimized SARS-CoV-2 full-length S containing G614, a packaging plasmid pCMV ΔR8.2 expressing HIV gag and pol, and a luciferase reporter plasmid pHR’ CMV-Luc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T/17</div><div>suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The 293T cell line stably overexpressing the human ACE2 protein was created by the Farzan group at Scripps Research Institute.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">200 μl of each dilution or control were added to confluent monolayers of NR-596 Vero E6 cells in triplicate and incubated for 1 hour at 37°C and 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Automated data collection was carried out using SerialEM version65 at a nominal magnification of 105,000× and the K3 detector in counting mode (calibrated pixel size, 0.825 Å) at a exposure rate of ~14.8 electrons per physical pixel per second.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All density maps were corrected from the modulation transfer function of the K3 detector and then sharpened by applying a temperature factor that was estimated using post-processing in RELION.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RELION</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Several rounds of manual building were performed in Coot.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293 cells were transfected with pCMV-AT1R-IRES-Puro gene using Lipofectamine 3000 reagent (Thermo Fisher Scientifics).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Fisher Scientifics</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The half maximal inhibitory concentrations (IC50) were calculated using GraphPad Prism 8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04335136</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recombinant Human Angiotensin-converting Enzyme 2 (rhACE2) a…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT00886353</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety and Tolerability Study of APN01 (Recombinant Human An…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 27 and 29. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.17.302380: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The anti-spike glycoprotein antibody-coated surfaces were stored under PBS for up to 5 days at 4 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike glycoprotein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Handling virion sample in the AFM: An aliquot (20 μl) of purified SARS-CoV-2 sample was pipetted onto the anti-spike antibody-coated substrate surface and incubated at 37 °C for 30 minutes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike antibody-coated substrate surface</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sample preparation: SARS-CoV-2 was isolated from the oropharyngeal swab of a laboratory-confirmed COVID-19 patient in Hungary and passed two times in VeroE6 cell line (European Collection of Authenticated Cell Culture, Salisbury, U.K.) in Dulbecco’s Modified Eagle’s Medium (Lonza, Basel, Switzerland) supplemented with 5% fetal bovine serum (EuroClone, Pero, Italy) and Cell Culture Guard (PanReac AppliChem, Darmstadt, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.22.308098: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate icSARS-CoV-2-mNG stocks, 200,000 Caco-2 cells were infected with 50 μl of virus stock in a 6-well plate, the supernatant was harvested 48 hpi, centrifuged, and stored at −80°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For quantification of infection rates, images were taken with the Cytation3 (Biotek) and Hoechst+ and mNG+ cells were automatically counted by the Gen5 Software (Biotek).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gen5</div><div>suggested: (Gen5, RRID:SCR_017317)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Software and statistical analysis: GraphPad Prism 8.0 was used for statistical analyses and to generate graphs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.14.296178: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, cells were incubated with chicken α-GFP antibody (1:200, GFP-1010, Aves Labs), rabbit α-Myh9 antibody (1:200, GTX113236, GeneTex) and mouse α-Myh10 antibody (1:200, GTX634160, GeneTex) in 0.1% Triton X-100 PBS containing 10% NGS overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>α-GFP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GFP-1010</div><div>suggested: (Antibodies Incorporated Cat# GFP-1010, RRID:AB_2307313)</div></div><div style="margin-bottom:8px"><div>α-Myh9</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>α-Myh10</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proteins were separated from membrane and cytoplasmic extracts on 8% SDS-PAGE gels and then western blotted with antibodies against PKP2 (EB10841, Everest Biotech),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PKP2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies were anti-goat (ABIN2169607, Antibodies online) and anti-mouse (ABIN6699027,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-goat ( ABIN2169607</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound proteins were eluted with 30 μl loading buffer (10% SDS, 10 mM β-mercapto-ethanol, 20% glycerol, 200 mM Tris-HCl pH 6.8, 0.05% Bromophenolblue), heated for 15 minutes at 95°C, separated on 8% SDS-PAGE gels, and western blotted with antibodies against MYH9 (GTX633960, GeneTex), MYH10 (3404S, Cell Signaling Technology), and EGFP (632380, Clontech).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MYH9</div><div>suggested: (GeneTex Cat# GTX633960, RRID:AB_2888397)</div></div><div style="margin-bottom:8px"><div>GTX633960</div><div>suggested: (GeneTex Cat# GTX633960, RRID:AB_2888397)</div></div><div style="margin-bottom:8px"><div>MYH10 ( 3404S , Cell Signaling Technology) ,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>EGFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies were anti-mouse (ABIN6699027,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies online) and anti-rabbit (ABIN5563398,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: The HEK293T (ATCC, CRL-3216) and HeLa (ATCC, CCL-2) cell lines were maintained in DMEM (GIBCO) supplemented with 10% FBS, 1% penicillin/streptomycin, and 2 mM L-glutamine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We analyzed 8 HL-1 cells expressing PKP2 and 5 cells each expressing the R735X and R735X-EGFP variants.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HL-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunostaining and imaging analysis: HeLa and HL-1 cell lines were fixed with 4% formaldehyde for 10 minutes, then permeabilized for 90 minutes at room temperature with 0.1% Triton X-100, and finally stained with Phalloidin-iFluor 594 Reagent (ab176757, Abcam).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For actomyosin components distribution analysis HL-1 EGFP stable cell lines were seeded at a density of 1×104/cm2 and cultured for 24 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HL-1 EGFP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Maps were analyzed with in-house software written in Python.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The MS/MS spectra were searched with the Sequest algorithm in Proteome Discoverer 1.4 (Thermo Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Proteome Discoverer</div><div>suggested: (Proteome Discoverer, RRID:SCR_014477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The percentage of actin filaments overlying the nucleus was calculated from the phalloidin intensity measured with Fiji software in all Z-stack images above the nucleus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.18.302398: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then washed with PBS, fixed in 4% paraformaldehyde (PFA) in PBS for 15 minutes, washed again with PBS, permeabilized with 0.2% saponin in blocking buffer (2% BSA, 2% FBS in PBS) for 30 minutes at room temperature (RT), and incubated with 1:1000 mouse antibody specific for SARS-CoV-2 nucleocapsid protein (Sino Biological, Beijing, China 40143-MM05) overnight at 4°C in blocking buffer consisting of 2% FBS and 2% BSA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 nucleocapsid protein</div><div>suggested: (Bioss Cat# bsm-41414M, RRID:AB_2848129)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following day, plates were washed 3X with PBS, incubated with a 1:1000 dilution of goat anti-mouse AlexaFluor647 antibody (Abcam, Cambridge, United Kingdom) and DAPI/Hoechst (Invitrogen) in blocking buffer for 1h at RT, washed again 3x with PBS, fixed in 4% PFA, and replaced in PBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and virus: Vero E6 and Calu-3 cells (Calu-3:ATCC HTB-55; Vero E6: ATCC, CRL-1586) were maintained in high glucose DMEM (Gibco, Waltham, MA, USA) supplemented with 10% FBS (R&D Systems, Minneapolis, MN, USA), 1X GlutaMAX (Gibco, Waltham, MA, USA), and 1X PenStrep (Gibco, Waltham, MA, USA) at 37°C and 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2500 Vero E6 (12 μl/well) or 10000 Calu-3 (12μl/well) were seeded in 384-well white optical-bottom tissue culture plates (Nunc) with the Multidrop Combi liquid handling instrument (Thermo Fisher Scientific, Waltham, MA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data was plotted and analyzed with spotfire (Tibco) and GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GSEA Analysis: Compounds were annotated with targets, pathways and mechanisms of actions using the Center for Emerging and Neglected Diseases’ database and for pharmacokinetic data and transporter inhibition data, the DrugBank database 42.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GSEA</div><div>suggested: (SeqGSEA, RRID:SCR_005724)</div></div><div style="margin-bottom:8px"><div>DrugBank</div><div>suggested: (DrugBank, RRID:SCR_002700)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were analyzed for N stain per nuclei with the CellProfiler 3.1.9 software (Broad Institute, Cambridge, MA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CellProfiler</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Custom code written in MATLAB (available at https://gitlab.com/tjian-darzacq-lab/second-derivative-cq-analysis) was used to take the numerical second derivative of fluorescence intensity with respect to cycle number, using a sliding window of ± 3 cycles.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.09.285445: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animal husbandry practices: All animal experiments were performed after obtaining necessary approvals from the Institutional Animal Ethics Committee (IAEC).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The primary antibodies used were anti-N protein rabbit monoclonal Ab (1:1000 dilution) and anti-S1 or S2 or RBD protein rabbit polyclonal Ab (1:1000 dilution), either sourced from commercial or in-house and human convalescent sera from patients (1:500 dilution) at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-N protein</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The secondary antibodies goat anti-rabbit IgG H&L (HRP) (GE NA934,1:4000) and HRP-labeled goat anti-human IgG (gamma chain) cross-adsorbed secondary antibody (Invitrogen, 62-8420) (1:1000)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Innovative Research Cat# 62-8420, RRID:AB_88136)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) conjugated antibody for mouse sera samples, and Goat anti-rabbit IgG HRP conjugate antibody(Santa Cruz Biotechnology, USA) (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antibody(Santa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibody dilution, at which absorbance is above the threshold, was taken as antigen-specific antibody endpoint titers. 10. Immunoglobulin (IgG) Subclass: Th1-dependent IgG2a vs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Immunoglobulin ( IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Th2 -dependent IgG1 antibody subclasses were determined from mice vaccinated sera as previously described 37.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation, wells were washed and added with anti-mouse IgG1 or IgG2a HRP conjugate antibodies at a dilution 1:2500.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibody dilution, at which absorbance is above the threshold, was taken as antigen-specific antibody endpoint titers. 11. Cytokine (IFNγ & IFNα) Estimation by ELISA: To determine IFNγ, Enzyme-Linked Immunosorbent Assay (ELISA) was performed according to the instruction manual.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero cells were revived from GMP master cell bank, which was extensively characterized at BioReliance, USA. SARS-CoV-2</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To perform PRNT90, Vero CCL-81 cell suspension (1.0 × 105 /mL/well) was added in duplicates in 24-well tissue culture plates and cultured in a CO2 incubator at 37°C for 16-24 hrs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero CCL-81</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Maximum Tolerated Dose Test or Single Dose Toxicity Study: Two animals (Swiss Albino mice and Wistar Rats) species were tested with Algel-IMDG with a single maximum dose (containing 200μg Algel and 20μg TLR7/8 agonist molecule).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Wistar</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animals (Swiss Albino mice and Wistar Rats) were administered via an intramuscular route with Algel-IMDG on day 0 and observed for clinical signs, mortality, and changes in body weight if any up to 14 days.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Swiss Albino</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero cells were revived from GMP master cell bank, which was extensively characterized at BioReliance, USA. SARS-CoV-2</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioReliance</div><div>suggested: (BioReliance, RRID:SCR_003791)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A major limitation of this paper is the lack of protective efficacy results conferred from BBV 152. Additional live challenge studies in hamsters and non-human primates are completed at NIV, India, and results will be published shortly. With no established correlate of protection, we also evaluated human convalescent sera from recovered symptomatic SARS-CoV-2 patients. Samples were collected 21 days after virological confirmation (Figure3C). Furthermore, two other SARS-CoV-2 inactivated vaccines (BBIBP-CorV and PiCoVacc) from China have entered late-stage human clinical trials with published data on the preclinical immune response. Results from these candidates have reported comparable findings, albeit PRNT5033, 34. Bharat Biotech has developed a promising inactivated whole virion vaccine candidate which has now entered phase 1/2 clinical development (NCT04471519). The study is designed to evaluate the safety, reactogenicity, tolerability, and immunogenicity of two intramuscular doses of BBV152 in healthy volunteers.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04471519</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Whole-Virion Inactivated SARS-CoV-2 Vaccine (BBV152) for COV…</td></tr></table>


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.24.312769: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All work with SARS-CoV-2 or icSARS-CoV-2-mNG was performed in a biosafety level 3 facility with approval from the office of Environmental Health and Safety and the Institutional Animal Care and Use Committee at Yale University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Only male mice were used due to availability.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cell lines tested negative for Mycoplasma spp.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The P1 stock was then used to inoculate Vero-E6 cells, and after three days, the supernatant was harvested and clarified by centrifugation (450 × g for 5 min), filtered through a 0.45-micron filter, and stored in aliquots at −80°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">From GSE147507 (14), we re-analyzed the raw count data from Calu-3 and A549-ACE2 cells, comparing SARS-CoV-2 infection to matched mock controls.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1 Spike Glycoprotein Gene, NR-52310, was produced under HHSN272201400008C and obtained through BEI Resources, NIAID, NIH. 293T cells were transfected with the pCAGGS vector expressing the SARS-CoV-2 spike glycoprotein and then incubated with replication-deficient VSV expressing Renilla luciferase for 1 hour at 37°C (27).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">icSARS-CoV-2-mNG assay: 6.5 × 103 Calu-3 or 2.5 × 103 Huh7.5 cells were plated in 20 μl phenol red-free media containing 50 μM ibuprofen, 50 μM ibuprofen, or an equivalent amount of DMSO in each well of a black-walled, clear-bottom 384-well plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7.5</div><div>suggested: RRID:CVCL_7927)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice: C57BL/6J and K18-hACE2 [B6.Cg-Tg(K18-ACE2)2Prlmn/J (17)] were purchased from Jackson Laboratory.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2 [B6.Cg-Tg(K18-ACE2)2Prlmn/J</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">K18-hACE2 mice were anesthetized using 30% vol/vol isoflurane diluted in propylene glycol (30% isoflurane) and administered 1.2 × 106 PFU of SARS-CoV-2 intranasally.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">C57BL/6J mice were anesthetized using 30% isoflurane and administered 30 mg/kg ibuprofen, 1 mg/kg meloxicam, or an equivalent amount of DMSO intraperitoneally in a volume of 10 ml/kg daily for 4 days.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We performed differential expression analysis using the Wald test from DESeq2 (45), using a Benjamini-Hochberg adjusted p < 0.05 as the cutoff for statistical significance.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For visualization of PTGS2 expression, the DESeq2-normalized counts were exported and plotted in GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Total cell numbers were quantified by Gen5 software for brightfield images.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gen5</div><div>suggested: (Gen5, RRID:SCR_017317)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.22.308965: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CR3022, a SARS-CoV-1 and SARS-CoV-2 spike binding antibody, and dengue antibody, DEN3, were used as positive and negative controls for the assay, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DEN3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA binding: 96-well half-area plates (Corning cat. #3690, Thermo Fisher Scientific) were coated overnight at 4°C with 2 ug/ml of mouse anti-His-tag antibody (Invitrogen cat. #MA1-21315-1MG</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the washes, a secondary antibody conjugated with alkaline phosphatase (AffiniPure goat anti-human IgG Fc fragment specific, Jackson ImmunoResearch Laboratories cat. #109-055-008) diluted 1:1000 in 1% BSA/PBS-T, was added to each well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AffiniPure goat anti-human IgG Fc fragment specific</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-005-008, RRID:AB_2337534)</div></div><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-055-008, RRID:AB_2337601)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A mixture of fluorescently labeled antibodies to cell surface markers was prepared, including antibodies specific for the T cell markers CD3(APC Cy7, BD Pharmingen #557757), CD4(APC-Cy7, Biolegend #317418) and CD8(APC-Cy7, BD Pharmingen</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD3</div><div>suggested: (Fitzgerald Industries International Cat# 61R-CD3gHUCY5, RRID:AB_1283253)</div></div><div style="margin-bottom:8px"><div>CD4</div><div>suggested: (BioLegend Cat# 317418, RRID:AB_571947)</div></div><div style="margin-bottom:8px"><div>APC-Cy7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD8</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells were transfected with plasmids encoding full-length coronavirus spikes including SARS-CoV-1, SARS-CoV-2, MERS-CoV, HCoV-HKU1, HCoV-OC43, HCoV-NL63 and HCoV-229E.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-NL63</div><div>suggested: RRID:CVCL_RW88)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization assay: Under BSL2/3 conditions, MLV-gag/pol and MLV-CMV plasmids were co-transfected into HEK293T cells along with full-length or variously truncated SARS-CoV1 and SARS-COV2 spike plasmids using Lipofectamine 2000 to produce single-round of infection competent pseudo-viruses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">. 293T cells were plated in advance overnight with DMEM medium +10% FBS + 1% Pen/Strep + 1% L-glutamine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following the infection, HeLa-hACE2 cells were lysed using 1x luciferase lysis buffer (25mM Gly-Gly pH 7.8, 15mM MgSO4, 4mM EGTA, 1% Triton X-100)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">20µL of the supernatant was transferred to a 384-well plate seeded with 2E3 HeLa-ACE2 cells and incubated for an additional 24 hours at 34°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The extend of biotinylation was evaluated by BioLayer Interferometry binding value using streptavidin biosensors.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioLayer</div><div>suggested: (Harvard Medical School Center for Macromolecular Interactions Core Facility, RRID:SCR_018270)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After another two washes, stained cells were analyzed using flow cytometry (BD Lyrics cytometers), and the binding data were generated by calculating the percent (%) PE-positive cells for antigen binding using FlowJo 10 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The absorbance was measured after 8, 20, and 30 minutes, and was recorded at an optical density of 405 nm (OD405) using a VersaMax microplate reader (Molecular Devices), where data were collected using SoftMax software version 5.4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SoftMax</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gibson assembly products were finally transformed into competent E.coli cells and single colonies were picked for sequencing and analysis on IMGT V-Quest online tool (http://www.imgt.org) as well as downstream plasmid production for antibody expression.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>http://www.imgt.org</div><div>suggested: (IMGT - the international ImMunoGeneTics information system, RRID:SCR_012780)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">10µL of human polyclonal sera diluted 1:500 in Perm/Wash Buffer (BD Biosciences)was added to the plate and incubated at RT for 2 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Biosciences)was</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The PFU/mL of the monocyte plate supernatant was calculated and graphed using Prism 8 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Leginon software 37 was used to automate data collection on a FEI Tecnai Spirit (120keV), paired a FEI Eagle 4k x 4k camera.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Leginon</div><div>suggested: (Leginon, RRID:SCR_016731)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RELION 3.0 40 was used to generate the 2D class averages.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RELION</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.10.02.323519: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Construction of the phylogenetic tree: The phylogenetic tree was constructed using a pipeline adapted from the Zika virus pipeline on the nextstrain.org web page (12) employing the Augur (12), the MAFFT (13) and the IQ-tree (14) software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div><div style="margin-bottom:8px"><div>IQ-tree</div><div>suggested: (IQ-TREE, RRID:SCR_017254)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Details of steps which were performed: First all West African and reference sequences in FASTA format were aligned employing the augur command: augur align --sequences westafrica.fasta --reference-sequence sars_cov2_referencesequence.gb --output wa_aligned.fasta --fill-gaps which called MAFFT (13) with the command: mafft --reorder --anysymbol --nomemsave --adjustdirection --thread 1 wa_aligned.fasta.to_align.fasta 1> wa_aligned.fasta 2> wa_aligned.fasta.log Metadata was extracted from the sequences FASTA via the augur command: augur parse --sequences wa_aligned.fasta --fields strain accession date --output-sequences wa_aligned_parsed.fasta --output-metadata metadata.tsv Then a tree was built via the augur command: augur tree --alignment wa_aligned_parsed.fasta --output wa_tree_raw.nwk Calling the IQ-tree algorithm (14) via this command: iqtree -ninit 2 -n 2 -me 0.05 -nt 1 -s wa_aligned_parsed-delim.fasta -m GTR > wa_aligned_parsed-delim.iqtree.log The tree was refined via the Augur software calling TreeTime (15) for Maximum-Likelihood analysis inferring a time resolved phylogeny tree: augur refine --tree wa_tree_raw.nwk --alignment wa_aligned_parsed.fasta --metadata metadata.tsv --output-tree wa_tree.nwk --output-node-data wa_branch_lengths.json --timetree --coalescent opt --date-confidence --date-inference marginal --clock-filter-iqd 4 --keep-polytomies Here, the command from the Zika pieline was adapted to --keep-polytomies to keep all samples.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Augur</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">augur traits --tree wa_tree.nwk --metadata metadata_countries.tsv --output wa_traits.json --columns region country --confidence Augur was called to infer ancestral states of discrete character again using TreeTime (15): augur ancestral --tree wa_tree.nwk --alignment wa_aligned_parsed.fasta --output-node-data wa_nt_muts.json --inference joint Amino acid mutations were identified with the augur translate command: augur translate --tree wa_tree.nwk --ancestral-sequences wa_nt_muts.json --reference-sequence sars_cov2_referencesequence.gb --output wa_aa_muts.json Results were exported via the augur command: augur export v2 --tree wa_tree.nwk --metadata metadata_countries.tsv --node-data wa_branch_lengths.json wa_traits.json wa_nt_muts.json wa_aa_muts.json --colors colors.tsv --lat-longs lat_longs.tsv --auspice-config auspice_config.json --output wa_cov19.json Visualization of the phylogenetic tree and annotation with mutations and clades: The phylogenetic tree was annotated with crucial mutations using the tool FigTree version 1.4.4 (http://tree.bio.ed.ac.uk/software/figtree/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FigTree</div><div>suggested: (FigTree, RRID:SCR_008515)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The limitations of this study are the sample size, possible selection bias of the samples and the intrinsic incompleteness of the phylogenetic analysis which may lead to altered results when more samples are included. Nonetheless, this is the first study of its kind, the data and concept should form the basis for a more extensive analysis due to an increased number of sequenced samples. In conclusion, in this phylogenetic analysis of SARS-CoV-2, we found distinct patterns of viral clades: the later Europe-associated G-clades are predominant in Senegal and Gambia, and combinations of the earlier (L, S, V) and later clades in Ghana and Nigeria. Intriguingly, the later clades emerged before the earlier clades which could simply be due to founder effects or due to latent circulation of the earlier clades. Only a marginal correlation of the G-clades in the West African countries can be associated with mortality which fortunately is at a rather low level therefore disproving fears that the pandemic would massively overwhelm the health systems in Africa. The rather young population and the climate might be factors favoring this low fatality rate in comparison to Western countries but nevertheless a cautious balance between health protection and economics might prevent future disastrous outbreaks.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.23.309849: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transfection: The CPER products (25 μl out of a 50 μl reaction volume) were transfected into HEK293-3P6C33 cells or BHK-21 cells with Trans IT LT-1 (Mirus), following the manufacturer’s protocols.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21</div><div>suggested: ATCC Cat# CRL-6282, RRID:CVCL_1914)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">At 6 hours post-transfection, the culture supernatants of HEK293-3P6C33 cells were replaced with DMEM containing 2% FBS and doxycycline hydrochloride (1 μg/ml), and BHK-21 cells were overlaid by VeroE6/TMPRSS2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293-3P6C33</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The culture supernatants of cells were inoculated onto VeroE6/TMPRSS2 cells in 96-well plates after ten-fold serial dilution with DMEM containing 2% FBS, and the infectious titers were determined at 72 hours post-infection (hpi).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6/TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.06.19.161042: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All work with infectious virus was performed in a Biosafety Level 3 laboratory and approved by the Institutional Biosafety Committee and Environmental Health and Safety. Infections: Cells were plated in 384 well plates (20μL/well) 3,000 cells per well for Vero, 3,000 cells per well Huh7.5, 7,500 cells per well Calu-3.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were blocked (2% BSA/PBST) for 60 minutes and incubated in primary antibody (anti-dsRNA J2) overnight at 4C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-dsRNA J2</div><div>suggested: (SCICONS Cat# 10010200, RRID:AB_2651015)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Stocks were prepared by infection of Vero E6 cells in 2% serum plus 10mM HEPES for five days, freeze-thawed, and clarified by centrifugation (PO).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This seed stock was amplified in Vero CCL81 (P1) at 1.5×106 TCID50/mL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero CCL81</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One hour later cells were infected with SARS-CoV-2 (Vero, MOI=1; Huh7.5 MOI=1; Calu-3 MOI=0.5) Cells were fixed (30hpi Vero and Huh7,5, 48hpi Calu-3) in 4% formaldehyde/PBS for 15min at room temperature and then washed three times with PBST.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Huh7,5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Selectivity index (SI) was calculated as a ratio of drug’s CC50 and IC50 values (SI = CC50/IC50). RT-qPCR: Huh7.5 (750,000 cells/well) or Calu-3 cells (750,000 cells/well) were plated in 6 well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Total RNA was purified using Trizol (Invitrogen) followed by RNA Clean and Concentrate kit (Zymo Researc) 24 hpi for Huh7.5 or 48 hpi for Calu-3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7.5</div><div>suggested: RRID:CVCL_YU20)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The total number of cells and the number of infected cells were measured using MetaXpress 5.3.3 cell scoring module, and the percentage of infected cells was calculated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MetaXpress</div><div>suggested: (MetaXpress, RRID:SCR_016654)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A non-linear regression curve fit analysis (GraphPad Prism 8) was performed on POC Infection and cell viability using log10 transformed concentration values to calculate IC50 values for Infection and CC50 values for cell viability for each drug/cell line combination.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04333550</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Application of Desferal to Treat COVID-19</td></tr></table>


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.30.20204842: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Using a p20 pipette, 4 μL of nuclease-free water, 50% ethanol, and LAMP master mix were sequentially added to washing well 2, washing well 1 and the detection well, respectively in the same manner as the single output device (except different primer sets were used in the two output detection wells).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>LAMP</div><div>suggested: (LAMP, RRID:SCR_001740)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.25.313270: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript) and GAPDH of anti-GAPDH (Proteintech) were used at 1:3000 dilutions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antibodies against nucleocapsid protein of anti-SARS-CoV-2 N protein ( Genscript )</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GAPDH</div><div>suggested: (LSBio (LifeSpan Cat# LS-C41945-3000, RRID:AB_1054935)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The second antibody of HRP-conjugated affinipure Goat anti-mouse IgG (H+L) was diluted at 1:20000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The primary antibodies are anti-OCT4 rabbit polyclonal antibody (Proteintech), anti-SSEA-4 antibody (STEMCELL Technologies), anti-Sox17 antibody (R&D System), anti-Brachyury antibody (Cell Signaling Technology) and ani-Nestin antibody (R&D System).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-OCT4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SSEA-4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Sox17</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Brachyury antibody ( Cell Signaling Technology )</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ani-Nestin</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Other cell lines, coronavirus and key reagents: Vero E6 cells were cultured in high-glucose-containing Dulbecco’s Modified Eagle Medium supplemented with 10% fetal bovine serum.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analyses were analyzed using GraphPad Prism 8 software (GraphPad Software Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.29.20203505: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HSIC2(X,Y) can be approximated by

      where n is a sample size, K and L are n × n dimensional kernel matrices and .</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HSIC2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Repeat the procedure to assess the ANM Y→ X.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Repeat</div><div>suggested: (ProRepeat, RRID:SCR_006113)</div></div></td></tr></table>


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Although we tried to systematically and comprehensively analyze the data, this study has multiple limitations. First, we only analyzed the causal relationship between mobility patterns and the number of new cases or deaths and ignored the role of other potential mitigating factors (e.g, wearing face masks) that could also have contributed to the reduction of new cases or deaths from COVID-19. When data are available, more metrics should be included in the analysis. Second, we have not addressed the confounding bias issue. When confounding is unknown, adjusting for confounding methods cannot be applied to eliminate confounding bias from the causal analysis. Unadjusted confounding bias will distort the inferred (true) causal relationship between the number of new cases or deaths from COVID-19, and metrics for social distancing when these two variables share common causes. This will have substantive implications for developing interventions to mitigate the spread of COVID-19 and reduce the deaths from COVID-19. However, removing confounding from causal analysis for COVID-19 is complicated and will be investigated in the future. In summary, our analysis has provided information for both individuals and governments to plan future interventions on containing COVID-19 and reduction of deaths from COVID-19.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.07.06.190066: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animal studies were approved by the Institutional Animal Care and Use Committee (IACUC) of Icahn School of Medicine at Mount Sinai (ISMMS).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">The pathologist evaluated and photographed both IHC-P for hACE2, and H&E sections, and was blinded to the treatment groups.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mice: Hemizygous 6-week old female K18-hACE2 mice on the C57BL/6J background (Jax strain 034860), were compared to age and sex-matched wildtype (WT) C57BL/6J (Jax strain 000664) and WT BALB/cJ (Jax strain 000651) mice.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A monoclonal rabbit isotype control [clone #SP137; Abcam, Cambridge, MA] or monoclonal rabbit anti-human ACE2 antibody [clone #EPR4436; Abcam Cambridge, MA) diluted in blocking buffer (see above) were added to one section on each slide at a final concentration of 1.33μg/mL for 1h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Biotinylated anti-rabbit secondary antibody was prepared as instructed by guidelines for the VECTASTAIN® Elite ABC-HRP (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines and culture media: T-REx™-293 cells (Life Technologies, Carlsbad, CA) were maintained in high glucose (4500mg/L</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>T-REx™-293</div><div>suggested: RRID:CVCL_D585)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero-E6 cells (ATCC® CRL-1586™, clone E6) were grown in DMEM containing 10% FBS, non-essential amino acids, 2-[4-(</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549 (ATCC® CCL-185™) cells were cultured in Kaighn’s Modification of Ham’s F-12 (F-12K) containing 10% FBS and penicillin-streptomycin, as above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice: Hemizygous 6-week old female K18-hACE2 mice on the C57BL/6J background (Jax strain 034860), were compared to age and sex-matched wildtype (WT) C57BL/6J (Jax strain 000664) and WT BALB/cJ (Jax strain 000651) mice.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: RRID:IMSR_JAX:000664)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Other caveats of the Ad-hACE2 animal model include the non-uniform transduction of the lung epithelium (and consequently, non-uniform expression of hACE2 in the mouse lung), the possibility of triggering non-specific inflammatory responses if used at doses higher than 2.5×108 PFU – or with poorly prepared Ad stocks which have large quantities of empty capsids, and the potential lack of suitability for use of the Ad-hACE2 model in immunization studies using non-replicating Ad vaccines for SARS-CoV-2. However, with this in mind, we describe the successful use of a dose of Ad-hACE2 (7.5×107 PFU) which supports equivalent replication of SARS-CoV-2 in the lung to the previously reported higher dose (33, 61). Most importantly, the flexibility of the Ad-hACE2 model allows studies of multiple mouse strains immediately, without time-consuming breeding to a hACE2 transgenic or knock-in background. In conclusion, further refinement and development of these models and additional small animal models will be critical for studying disease pathogenesis, and for evaluating novel therapeutics and vaccines to protect against SARS-CoV-2 infection.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2020.09.21.306357: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The expression vector was then stably transfected into GH-CHO (dhfr -/-) cell line and high expression clones were selected and adapted to SFM-4-CHO (Hyclone) serum free medium and ACE2-Fc was produced in a 15 L bioreactor as essentially as described for S-Trimer above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>dhfr -/-</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After stepwise gene amplification with increasing concentrations (0.0–10 nM) of MTX (Sigma), a high titer clone was then adapted to SFM-4CHO serum-free medium (GE BioSciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GE BioSciences</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cryo-EM Image processing: For MT S-Trimer protein, motion correction for cryo-EM images and contrast transfer function (CTF) estimation were performed using motioncorr2 (4) and CTFFIND4 (5) respectively. 574,832 particles were automatically picked from 534 images collected on grid without graphene oxide (GO) using Laplacian-of-Gaussian in Relion 3.0.7 (6), and 1,029,938 particles was automatically picked from 1584 images collected on grid with GO.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Relion</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The model was manually built in COOT (7) and real space refinement was performed in Phenix (8) using rotomer, Ramachandran and secondary structure restraints.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>