2,306 Matching Annotations
  1. Last 7 days
    1. All Bee v1.0 versions are incompatible with the v0.6 Swarm. Node operators who currently run nodes on the Swarm test network should not update to this version. This version is currently only rolled-out to the Swarm mainnet, to which node operators can operate fully-functional nodes when the BZZ token is circulating (after June 21st).

      该版本同测试网的不兼容,到6月21日上主网了才能用。需要BZZ代币。

    1. Reviewer #3 (Public Review):

      The authors modified a previously reported hybrid cytochrome bcc-aa3 supercomplex, consisting of bcc from M. tuberculosis and aa3 from M. smegmatis, (Kim et al 2015) by appending an affinity tag facilitating purification. The cryo-EM experiments are based on the authors' earlier work (Gong et al. 2018) on the structure of the bcc-aa3 supercomplex from M. smegmatis. The authors then determine the structure of the bcc part alone and in complex with Q203 and TB47.

      The manuscript is well written and the obtained results are presented in a concise, clear-cut manner. In general, the data support the conclusions drawn.

      To this reviewer, the following points are unclear:

      1. The purified enzyme elutes from the gel filtration column as one peak, but there seems to be no information given on the subunit composition and the enzymatic activity of the purified hybrid cytochrome bcc-aa3 supercomplex.

      2. It is unclear what is the conclusion of the structure comparison (Fig 6) is regarding the affinity of Q203 for M. smegmatis.

    1. SciScore for 10.1101/2021.06.16.448640: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Patch-clamp experiments: On the day of the experiment, transfected HEK293 or A549 were separated by trypsinization, seeded at low density on 10*10 mm coverslips, and then incubated for 2 to 4 hours to allow adhering of cells on the glass surface.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transformation of yeast cells: The K+ uptake deficient S. cerevisiae strains PLY240 (MATa his3Δ200 leu2-3,112 trp1Δ901 ura3-52 suc2Δ9 trk1Δ51 trk2Δ50::lox-kanMX-lox) [55] was transformed with the constructed pYES2sh plasmids using Frozen-EZ Yeast Transformation II kit (Zymo Research Europe GmbH, Freiburg, Germany) according to manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>trp1Δ901 ura3-52 suc2Δ9 trk1Δ51 trk2Δ50::lox-kanMX-lox </div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For in vitro protein expression the Ep-CoV2 DNA fragment was amplified via PCR using primer pair 1 (table 1) and subsequently cloned into a modified pET24 vector (pET24Δlac) in which the lac-operator and the ribosome binding site (RBS) were replaced by the 5’-UTR of the in vitro expression vector pEXP-5-CT/TOPO (Invitrogen, Karlsbad, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET24</div><div>suggested: RRID:Addgene_73142)</div></div><div style="margin-bottom:8px"><div>pEXP-5-CT/TOPO</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For cloning, pET24Δlac was first linearized with the restriction enzymes NdeI and SalI.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET24Δlac</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The DNA fragment encoding the desired FLAG-TEV tag was generated via PCR using primer pair 2 (table 1) and subsequently cloned into the NdeI restriction site of pET24Δlac/Ep-CoV2 using NEBuilder® HiFi DNA Assembly (NEB, Ipswich, MA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET24Δlac/Ep-CoV2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These fragments were subsequently inserted into a modified pYES2 shuttle vector (pYES2sh) in which the original PGAL1 promoter of pYES2 (Invitrogen, Karlsbad, CA, USA) was replaced by the methionine repressible PMET3 promoter.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pYES2</div><div>suggested: RRID:Addgene_86470)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For this purpose, the coding sequence of KcvPBCV-1 was amplified with appropriate overhangs using primer pair 5 (table1) and subsequently cloned into pYES2sh as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pYES2sh</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For expression in mammalian cells, Ep-CoV2 and Ep-CoV2™ were cloned into pEGFP-N2 which contains the eGFP sequence for generating C-terminal eGFP-tags.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pEGFP-N2</div><div>suggested: RRID:Addgene_78822)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After reaching approximately 80% confluence mammalian cells were (co-)transfected in a 35 mm petri dish with 1 µg of the plasmid carrying the gene of interest and (if necessary) 1 µg of empty pEGFP-N2 or empty pIRES2-mRuby3 to enable identification of transfected cells via eGFP or mRuby3 fluorescence, respectively. pIRES2-mRuby3 was generated by replacing the sequence encoding for the green fluorescent protein eGFP in pIRES2-eGFP by a DNA sequence encoding for the red fluorescent protein mRuby3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pIRES2-mRuby3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pIRES2-eGFP</div><div>suggested: RRID:Addgene_14998)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The capillaries were coated at tapper with Sigmacote® (Merck KgaA, Darmstadt, Germany) and baked after pulling at 65°C for 45 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sigmacote®</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was collected with PatchMaster (HEKA Elektronik, Lambrecht, Germany) and analyzed with FitMaster (HEKA Elektronik, Lambrecht, Germany)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PatchMaster</div><div>suggested: (Patchmaster, RRID:SCR_000034)</div></div><div style="margin-bottom:8px"><div>FitMaster</div><div>suggested: (FITMASTER, RRID:SCR_016233)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. We can also use the capitalized JSX tag to call JavaScript functions with capitalized function names. The functions are also known as the Pure Function Component.

      pure function components

    1. Laut Senatsbeschluss vom Samstag dürfen Läden offen bleiben, es gibt aber eine wichtige Einschränkung: Denn Shoppen im Laden darf nur, wer einen negativen Corona-Schnelltest vorweisen kann, der vom selben Tag stammen muss.

      § 15 (1) S. 1 InfSchMV i.V.m. § 6 (1) Nr. 4 InfSchMV

    1. Author Response:

      Reviewer #1 (Public Review):

      The manuscript by Chakraborty focuses on methods to direct dsDNA to specific cell types within an intact multicellular organism, with the ultimate goal of targeting DNA-based nanodevices, often as biosensors within endosomes and lysosomes. Taking advantage of the endogenous SID-2 dsRNA receptor expressed in C. elegans intestinal cells, the authors show that dsDNA conjugated to dsRNA can be taken into the intestinal endosomal system via feeding and apical endocytosis, while dsDNA alone is not an efficient endocytic cargo from the gut lumen. Since most cells do not express a dsRNA receptor, the authors sought to develop a more generalizable approach. Via phage display screening they identified a novel camelid antibody 9E that recognizes a short specific DNA sequence that can be included at the 3' end of synthesized dsDNAs. The authors then showed that this antibody can direct binding, and in some cases endocytosis, of such DNAs when 9E was expressed as a fusion with transmembrane protein SNB-1. This approach was successful in targeting microinjected dsDNA pan-neuronally when expressed via the snb-1 promoter, and to specific neuronal subsets when expressed via other promoters. Endocytosed dsDNA appeared in puncta moving in neuronal processes, suggesting entry into endosomes. Plasma membrane targeting appeared feasible using 9E fusion to ODR-2.

      The major strength of the paper is in the identification and testing of the 9E camelid antibody as part of a generalizable dsDNA targeting system. This aspect of the paper will likely be of wide interest and potentially high impact, since it could be applied in any intact animal system subject to transgene expression. A weakness of the paper is the choice of "nanodevice". It was not clear what utility was present in the DNAs used, such as D38, that made them "devices", aside from their fluorescent tag that allowed tracking their localization.

      We used a DNA nanodevice, denoted pHlava-9E, that uses pHrodo as a pH-sensitive dye. pHlava-9E is designed to provide a digital output of compartmentalization i.e., its pH profile is such that even if it is internalized into a mildly acidic vesicle, the pH readout is as high as one would observe with a lysosome. This gives an unambiguous readout of surface-immobilized probe to endocytosed probe.

      Another potential weakness is that the delivered DNA is limited to the cell surface or the lumen of endomembrane compartments without access to the cytoplasm or nucleus. In general the data appeared to be of high quality and was well controlled, supporting the authors conclusions.

      We completely agree that we cannot target DNA nanodevices to sub-cellular locations such as the cytoplasm or the nucleus with this strategy. However, we do not see this as a “weakness”, but rather, as a limitation of the current capabilities of DNA nanotechnology. It must be mentioned that though fluorescent proteins were first described in 1962, it was 30 years before others targeted them to the endoplasmic reticulum (1992) or the nucleus (1993)(Brini et al., 1993; Kendall et al., 1992). Probe technologies undergo stage-wise improvements/expansions. We have therefore added a small section in the conclusions section outlining the future challenges in sub-cellular targeting of DNA-nanodevices.

      Reviewer #2 (Public Review):

      The authors demonstrate the tissue-specific and cell-specific targeting of double-stranded DNA (dsDNA) using C. elegans as a model host animal. The authors focused on two distinct tissues and delivery routes: feeding dsDNA to target a class of organelles within intestinal cells, and injecting dsDNA to target presynaptic endocytic structures in neurons. To achieve efficient intestinal targeting, the authors leveraged dsRNA uptake via endogenous intestinal SID-2 receptors by fusing dsRNA to a fluorophore-labeled dsDNA probe. In contrast, neuronal endosome/synaptic vesicle (SV) targeting was achieved by designing a nanobody that specifically binds a short dsDNA motif fused to the fluorophore-labeled dsDNA probe. Combining dsDNA probe injection with nanobody neuronal expression (fused to a neuronal vSNARE to achieve synaptic targeting), the authors demonstrated that the injected dsDNA could be taken up by a variety of distinct neuronal subtypes.

      Strengths:

      While nanodevices built on dsDNA platforms have been shown to be taken up by scavenger receptors in C. elegans (including previous work from several of these authors), this strategy will not work in many tissue types lacking these receptors. The authors successfully circumvented this limitation using distinct strategies for two cell types in the worm, thereby providing a more general approach for future efforts. The approaches are creative, and the nanobody development in particular allows for endocytic delivery in any cell type. The authors exploited quantitative imaging approaches to examine the subcellular targeting of dsDNA probes in living animals and manipulated endogenous receptors to demonstrate the mechanism of dsRNA-based dsDNA uptake in intestinal cells.

      Weaknesses:

      To validate successful delivery of a functional nanodevice, one would ideally demonstrate the function of a particular nanodevice in at least one of the examples provided in this work. The authors have successfully used a variety of custom-designed dsDNA probes in living worms in numerous past studies, so this would not be a technical hurdle. In the current study, the reader has no means of assessing whether the dsDNA is intact and functional within its intracellular compartment.

      We now demonstrate the use of a functional nanodevice to detect pH profiles of a given microenvironment. This functional nanodevice contains two fluorescent reporter dyes, each attached to one of the strands of a DNA duplex. In order to obtain pH readouts, the device integrity is essential for ratiometric sensing.

      Coelomocytes are cells known for their scavenging and degradative lysosomal machinery. Previous studies of the stability of variously structured DNA nanodevices in coelomocytes, have shown that DNA devices based on 38 bp DNA duplexes have a half life of >8 hours in actively scavenging cells such as coelomocytes (Chakraborty et al., 2017; Surana et al., 2013) Given that our sensing in the gut as well as in the neuron are performed in <1 hour post feeding or injection, pHlava-9E is >97% intact.

      Another minor weakness is the lack of a quantitative assessment of colocalization in intestinal cells or neurons in an otherwise nicely quantitative study. Since characterization of the targeting described here is an essential part of evaluating the method, a stronger demonstration of colocalization would significantly buttress the authors' claims.

      We have now quantified colocalization in each cellular system. Please see Figure R1 below (Figure 1 Supplementary figure 1 and Figure 4 Supplementary figure 2 of the revised manuscript).

      Figure R1: a) Pearson’s correlation coefficient (PCC) calculated for the colocalization between R50D38 (red) and lysosomal markers LMP-1 or GLO-1 (green) in the indicated transgenic worms. b) & d) Representative images of nanodevice nD647 uptake (red) in transgenics expressing both prab-3::gfp::rab-3 (green) and psnb-1:snb-1::9E c - e) Normalized line intensity profiles across the indicated lines in b and d; f) Percentage colocalization of nD647 (red) with RAB3:GFP (green). Error bar represents the standard deviation between two data sets.

      While somewhat incomplete, this study represents a step forward in the development of a general targeting approach amenable to nanodevice delivery in animal models.

    2. Reviewer #1 (Public Review):

      The manuscript by Chakraborty focuses on methods to direct dsDNA to specific cell types within an intact multicellular organism, with the ultimate goal of targeting DNA-based nanodevices, often as biosensors within endosomes and lysosomes. Taking advantage of the endogenous SID-2 dsRNA receptor expressed in C. elegans intestinal cells, the authors show that dsDNA conjugated to dsRNA can be taken into the intestinal endosomal system via feeding and apical endocytosis, while dsDNA alone is not an efficient endocytic cargo from the gut lumen. Since most cells do not express a dsRNA receptor, the authors sought to develop a more generalizable approach. Via phage display screening they identified a novel camelid antibody 9E that recognizes a short specific DNA sequence that can be included at the 3' end of synthesized dsDNAs. The authors then showed that this antibody can direct binding, and in some cases endocytosis, of such DNAs when 9E was expressed as a fusion with transmembrane protein SNB-1. This approach was successful in targeting microinjected dsDNA pan-neuronally when expressed via the snb-1 promoter, and to specific neuronal subsets when expressed via other promoters. Endocytosed dsDNA appeared in puncta moving in neuronal processes, suggesting entry into endosomes. Plasma membrane targeting appeared feasible using 9E fusion to ODR-2.

      The major strength of the paper is in the identification and testing of the 9E camelid antibody as part of a generalizable dsDNA targeting system. This aspect of the paper will likely be of wide interest and potentially high impact, since it could be applied in any intact animal system subject to transgene expression. A weakness of the paper is the choice of "nanodevice". It was not clear what utility was present in the DNAs used, such as D38, that made them "devices", aside from their fluorescent tag that allowed tracking their localization. Another potential weakness is that the delivered DNA is limited to the cell surface or the lumen of endomembrane compartments without access to the cytoplasm or nucleus. In general the data appeared to be of high quality and was well controlled, supporting the authors conclusions.

    1. We should think about the number of simultaneous connections (peak and average) and the message rate/payload size. I think, the threshold to start thinking about AnyCable (instead of just Action Cable) is somewhere between 500 and 1000 connections on average or 5k-10k during peak hours.
      • number of simultaneous connections (peak and average)

      • the message rate/payload size.

  2. Jun 2021
    1. SciScore for 10.1101/2021.06.09.447527: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Preparation of hybridoma cell lines producing monoclonal antibodies specific to SARS-CoV-2 spike protein and RBD: Six-week-old Balb/cN mice were primed subcutaneously either with 30 μg of recombinant SARS-Cov-2 Spike protein (S) or Spike-RBD (RBD) in the complete Freund’s adjuvant (SIGMA-ALDRICH) and boosted three times at three-week intervals with 20 μg of the same antigen in the incomplete Freund`s adjuvant.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 spike protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound monoclonal antibodies were detected with goat anti-mouse immunoglobulin (Ig) conjugated with horse radish peroxidase (HRP, Dako, Denmark).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse immunoglobulin ( Ig )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Typically, 10 000 RU (response units) of polyclonal anti-mouse antibody (No. Z 0420; Dako, Denmark) or polyclonal anti-human antibody (I2136, Merck, Germany) was coupled simultaneously in four flow cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The equilibrium dissociation constants KD of antibody-RBD complexes were calculated from the averaged association and dissociation rate constants.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RBD-ACE2 binding inhibition assay: With the aim to select the antibodies blocking the interaction of receptor binding domain (RBD) with angiotensin-converting enzyme 2 (ACE2) receptor, ELISA-based inhibition test was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were fixed with 4% paraformaldehyde and labelled with anti-human ACE2 antibody at 10 μg/ml (cat. # 600-401-X59; Rockland Immunochemicals), followed by goat anti-rabbit IgG secondary antibody at 1/500 dilution (green; cat. # A-11008; Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human ACE2</div><div>suggested: (LSBio (LifeSpan Cat# LS-C347-500, RRID:AB_1271966)</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: (Thermo Fisher Scientific Cat# A-11008, RRID:AB_143165)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Stable cell line HEK293T/17-hACE2 were maintained in selection medium: Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum (FBS), 2 mM L-glutamine (GIBCO), 5μg/ml gentamicin (SIGMA) and 100μg/ml hygromycin B (Invitrogen) at 37°C in 5%CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T/17-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In PRNT, Vero E6 cells (Vero C1008, ATCC CRL 1586) were cultured in Eagle’s minimal essential medium (EMEM, Lonza) supplemented with 5% FBS (GIBCO), Penicillin-Streptomycin-Amphotericin B Solution (10ml/l, Lonza, Switzerland).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: ATCC Cat# CRL-1586, RRID:CVCL_0574)</div></div><div style="margin-bottom:8px"><div>C1008</div><div>suggested: ATCC Cat# CRL-1586, RRID:CVCL_0574)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids that drive protein expression from the CMV promoter were either transfected with polyethyleneimine (PEI) or by electroporation into Expi293 cells that were in exponential growth phase.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S-ACE2 binding inhibition assay: HEK 293T/17 cells stably expressing human ACE2 protein (HEK 293T/17-hACE2) were seeded at 60-70% plating density in 48-well plates and cultivated O/N at 37°C, 5% CO2 in a humidified incubator in DMEM supplemented with 10% (v/v) fetal calf serum, 2 mM L-glutamine, 100 units/mL penicillin/streptomycin (all from Life Technologies Invitrogen, Carlsbad, CA, USA) and 100 μg/ml</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T/17</div><div>suggested: ATCC Cat# CRL-11268G-1, RRID:CVCL_UE07)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the recipient cells HEK293/17-hACE2 were seeded in 96-well plate and cultured overnight in a humidified CO2 incubator (at 5% CO2 and 37°C) in 100 μL of normal growth medium (DMEM) with 10% of FCS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293/17-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MAb–virus mixtures were then added to Vero E6 cell monolayer in 24-well plates and incubated at 37°C for additional 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Preparation of hybridoma cell lines producing monoclonal antibodies specific to SARS-CoV-2 spike protein and RBD: Six-week-old Balb/cN mice were primed subcutaneously either with 30 μg of recombinant SARS-Cov-2 Spike protein (S) or Spike-RBD (RBD) in the complete Freund’s adjuvant (SIGMA-ALDRICH) and boosted three times at three-week intervals with 20 μg of the same antigen in the incomplete Freund`s adjuvant.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Balb/cN</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: Human embryonic kidney HEK293T/17-hACE2 cells with stable expression of human angiotensin-converting enzyme ACE2 (AXON Neuroscience SE) were prepared by stable transfection of pDUO2-hACE2-TMPRSS2a (InvivoGen) with transfection reagent Lipofectamine 3000 (Thermo Fisher Scientific), according the to the manufacturer’s recommendations.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pDUO2-hACE2-TMPRSS2a</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proteins: The prefusion-stabilized SARS-CoV-2 S protein ectodomain (residues 1−1208 from GenBank: MN908947, with proline substitutions at residues 986 and 987, a “GSAS” substitution at the furin cleavage site residues 682–685, a C-terminal T4 fibritin trimerization motif, an HRV3C protease cleavage site, a TwinStrepTag and an 8XHisTag), the receptor binding domain (RBD) fragment of the S protein (amino acids 319-591), containing the His-tag and Twin-Strep-tag and modified ACE2 (angiotensin-converting enzyme 2), containing tags for purification were synthesized at BioCat Co. (BioCat GmbH, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioCat</div><div>suggested: (BioCAT, RRID:SCR_001440)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plasmid DNA was isolated using PureLink®</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PureLink®</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primers for mutagenesis were designed using The QuickChange® Primer Design Program provided by manufacturer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Primer Design Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IC50 values for particular experiments were calculated by nonlinear regression analysis using GraphPad Prism (GraphPad Software Inc.)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were fitted to logistic 4-parameter sigmoidal dose response curve using GraphPad Prism (GraphPad Software Inc.), the goodness of fit was R2>0.9, except for AX266 on B1.1.7 (R2=0.7888), AX96 on B.1.1.7 (R2=0.8766), AX290ch on B1.1.7 (R2=0.8730) and AX677ch on B.1.351 (R2=0.8598).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Variants were called using the ARTIC pipeline (https://artic.network/ncov-2019/ncov2019-bioinformatics-sop.html), which internally filters reads based on quality and length, aligns them to the reference (Wuhan-Hu-1 isolate, NC_045512) using minimap2 (https://github.com/lh3/minimap2), trims primers, and calls variants using Nanopolish (https://github.com/jts/nanopolish).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Nanopolish</div><div>suggested: (Nanopolish, RRID:SCR_016157)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      To avoid this therapeutic limitation, we screened and selected the antibodies showing neutralization activity against several variants of SARS-CoV-2. We took advantage of the mouse immunoglobulin repertoire 18 through the hybridoma technology to isolate monoclonal antibodies neutralizing live authentic SARS-CoV-2 virus. The in vitro and live virus screening assays allowed us to identify two neutralizing antibodies, AX290 and AX677, each of them neutralizing live authentic SARS-CoV-2 virus circulating in Europe in the spring of 2020 and two fast-spreading authentic variants of concern B.1.1.7 and B.1.351. It is important to emphasize that the antibodies were resistant to the E484K mutation, which has been recently shown to endow the S-typed VSV pseudovirus with resistance to several human convalescent sera 33. The authors have suggested that the repertoire of antigenic sites on RBD is limited in some individuals and that this amino acid is a part of a dominant neutralizing epitope. The use of a live authentic SARS-CoV-2 virus to identify the escape mutations, as opposed to other studies that employed an S-typed pseudovirus 10,33,35–38, allowed to eliminate a potential bias from an inadequate infection and replication machinery of a model virus. It has been noted that only some of the spike escape mutations identified in SARS-CoV-2 S-typed infectious vesicular stomatitis virus were found so far in the context of authentic SARS-CoV-2 virus isolates, it is possible that those not...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.07.447437: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The protocols for human specimen collection were approved by the institutional review board of City of Hope.<br>Euthanasia Agents: Mice were euthanized using ketamine (100 mg/kg)/xylazine (10 mg/kg) when body weights dropped below 20% of their original body weights.<br>IACUC: Experiments and handling of mice were conducted under federal, state, and local guidelines and with approvals from the Northern Arizona University (20-005) and City of Hope Animal Care and Use Committees.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cell lines were routinely tested to confirm absence of mycoplasma using the MycoAlert Plus Mycoplasma Detection Kit from Lonza (Walkersville, MD).</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 viral nucleocapsid protein (NP) was detected using the anti-NP protein antibody (PA5-81794, Thermo Fisher) diluted 1:10000 in 0.1% tween-20/1%BSA/PBS solution as a primary antibody, followed by detecting with an anti-rabbit secondary antibody (ab6721, Abcam) at a 1:20,000 dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 viral nucleocapsid protein ( NP )</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2 viral nucleocapsid protein ( NP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>PA5-81794</div><div>suggested: (Thermo Fisher Scientific Cat# PA5-81794, RRID:AB_2788968)</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (Abcam Cat# ab6721, RRID:AB_955447)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FXa-HRP conjugated anti-human Fc antibody (05-4220, Invitrogen) was used as a detecting antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human Fc</div><div>suggested: (Thermo Fisher Scientific Cat# 05-4220, RRID:AB_2532922)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were then washed and incubated with an anti-S protein antibody for 20 minutes at room temperature, followed by staining with a FITC-labeled secondary antibody (111-605-045, Jackson ImmunoResearch).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An HRP-conjugated anti-His tag antibody (ab1187, Abcam) was used as a detecting antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>An HRP-conjugated anti-His tag antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-His tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IHC staining with an anti-FXa protein antibody (PIPA529118, Invitrogen), an anti-furin antibody (ab183495, Abcam), an anti-trypsin antibody (ab200997, Abcam), or an anti-plasmin antibody (LS-C150813-1, LSBio) as a primary antibody was performed by the Pathology Shared Resource Core at City of Hope Beckman Research Institute.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-FXa protein</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-furin</div><div>suggested: (Abcam Cat# ab183495, RRID:AB_2801581)</div></div><div style="margin-bottom:8px"><div>anti-trypsin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-plasmin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">H&E staining and IHC with anti-NP protein antibody (NB100-56576, Novus) as the primary antibody were performed by the Pathology Shared Resource Core at City of Hope Beckman Research Institute.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-NP protein antibody</div><div>suggested: (Creative Diagnostics Cat# DPAB-DC4728, RRID:AB_2501850)</div></div><div style="margin-bottom:8px"><div>anti-NP protein</div><div>suggested: (Creative Diagnostics Cat# DPAB-DC4728, RRID:AB_2501850)</div></div><div style="margin-bottom:8px"><div>NB100-56576</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monkey kidney epithelium-derived Vero cells, Vero E6 cells, human embryonic kidney-derived HEK293T cells, and Chinese hamster ovary (CHO) cells were cultured in DMEM with 10% FBS, penicillin (100 U/ml), and streptomycin (100 μg/ml).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Chinese hamster ovary (CHO)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To determine viral production, Vero cells were pre-seeded for 24 hours and infected with the supernatants collected from MA104 cells infected by VSV-SARS-CoV at 24 or 48 hpi.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation and purification of FXa: CHO cells were transduced with a pCDH lentiviral vector expressing FXa to produce the FXa-Fc fusion protein for functionality assays.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: CLS Cat# 603479/p746_CHO, RRID:CVCL_0213)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus isolates were passaged in Vero E6 cells (ATCC CRL-1586) as previously described3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Assessment of binding between S protein and FXa using flow cytometry: HEK293T cells were transduced with lentiviral vector expressing FXa for 48 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In vivo infection model: 6-8-week-old K18-hACE2 mice were anesthetized with ketamine (80 mg/kg)/xylazine (8 mg/kg) and intranasally infected with 5×103 PFU wild type SARS-CoV-2 or B.1.1.7 variant in 25 μl DMEM, followed by intranasal treatment with PBS, FXa-Fc (200 μg), or Fc (200 μg) in 25 μl DMEM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pull-down assay: HEK293T cells were transduced with a pCDH lentiviral vector expressing the full-length spike (S) protein for 48 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDH</div><div>suggested: RRID:Addgene_102325)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Prism software v.8 (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. The more compelling your title tag, combined with high rankings in search results, the more visitors you’ll attract to your website. This underscores that SEO is not only about search engines, but rather the entire user experience.

      In Moz's example of their Title Tag, they have their name and what their role is as well as what service they provide. Aside from a company name and possibly a role or action, what other key words would be suggested?

    1. SciScore for 10.1101/2021.06.05.447221: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All procedures were performed according to the animal study protocols approved by the FDA White Oak Animal Program Animal Care and Use Committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mice: Hemizygous B6.Cg-Tg(K18-ACE2)2Prlmn/J (K18-hACE) female mice (JAX Stock No. 034860) and noncarrier c57BL/6J male mice (JAX Stock No. 000664) were mated to maintain live colonies at the ABSL2 facility of FDA White Oak Vivarium</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">At the age of 8-10 weeks, K18-hACE mice of both sexes were randomly assigned to experimental groups at approximately 1:1 ratio and were transferred to the ABSL3 facility for infection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Only hACE2 (+) offspring as confirmed by genotyping (Transnetyx) were retained and were used for experiments.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation at 37 °C, 5% CO2 for two days, virus-infected cells were detected using an in-house rabbit polyclonal antibody specific for SARS-CoV-2 N/M/E followed by horseradish peroxidase-conjugated goat anti-mouse IgG (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound antibodies were detected using peroxidase-conjugated goat anti-mouse IgM heavy chain (Southern Biotech) or IgG (H+L) antibodies (Invitrogen) followed by One-step TMB substrate (ThermoFisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>peroxidase-conjugated goat anti-mouse IgM heavy chain ( Southern Biotech )</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG ( H+L ) antibodies ( Invitrogen ) followed by One-step TMB substrate ( ThermoFisher)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus-infected cells were detected using in-house raised rabbit anti-S polyclonal antibody along with peroxidase-conjugated goat anti-rabbit IgG (H+L) secondary antibody (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus-serum mixtures were then added to Vero E6 cells (2X104 cells/well) pre-seeded in 96-well tissue culture plates and were incubated at 37°C, 5% CO2 for 2 days.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice: Hemizygous B6.Cg-Tg(K18-ACE2)2Prlmn/J (K18-hACE) female mice (JAX Stock No. 034860) and noncarrier c57BL/6J male mice (JAX Stock No. 000664) were mated to maintain live colonies at the ABSL2 facility of FDA White Oak Vivarium</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6.Cg-Tg(K18-ACE2)2Prlmn/J</div><div>suggested: RRID:IMSR_JAX:034860)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">At the age of 8-10 weeks, K18-hACE mice of both sexes were randomly assigned to experimental groups at approximately 1:1 ratio and were transferred to the ABSL3 facility for infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In separated experiments, K18-hACE2 mice of both sexes were primed and boosted at 3 weeks intervals with S (10 µg/dose) or RBD (20 µg/dose) emulsified with AddaS03™ (InvivoGen) via intramuscular route.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant proteins: The DNA sequences encoding the full-length S (residues 1-1213) and RBD (residues 319-541) of WA (GenBank: MN985325.1) with a T4 trimerization domain and a 6xHis tag at the C-terminus were codon-optimized and were subcloned into pcDNA5/FRT mammalian expression vector (ThermoFisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA5/FRT</div><div>suggested: RRID:Addgene_31983)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Threshold cycle (Ct) values were calculated using MxPro qPCR software (Agilent) and the N gene copies in individual tissues were interpolated from a standard curve constructed by serial dilutions of a pCC1-CoV2-F7 plasmid expressing SARS-CoV-2 N57.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCC1-CoV2-F7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The copies of expressed hACE2 were interpolated from a standard curve created by serial dilutions of a pSBbi-bla ACE2 plasmid expressing hACE2 (kindly provided by J Yewdell, NIAID/NIH).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSBbi-bla ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>hACE2</div><div>suggested: RRID:Addgene_1786)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Heatmap was generated using Prism 8.4.3 (GraphPad, San Diego, CA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tissue sections were visualized using a Leica Aperio AT2 slide scanner with Aperio ImageScope DX clinical viewing software (Histoserv).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageScope</div><div>suggested: (ImageScope, RRID:SCR_014311)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">R version 4.0.3 (https://www.r-project.org/) was used to perform all the above analyses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.r-project.org/</div><div>suggested: (R Project for Statistical Computing, RRID:SCR_001905)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.06.446826: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Membranes were probed with rabbit-anti-SARS spike (Invitrogen, PA1-411-1165, 0.5ug/ml), rabbit-anti-Orf6 (Abnova, PAB31757, 4ug/ml), Cr3009 SARS-CoV-2 cross-reactive human-anti-N antibody (1ug/ml) (a kind gift from Dr. Laura McCoy, UCL), mouse-anti-alpha-tubulin (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>rabbit-anti-Orf6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>PAB31757</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>mouse-anti-alpha-tubulin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SIGMA, clone DM1A) followed by IRDye 800CW or 680RD secondary antibodies (Abcam, goat anti-rabbit, goat anti-mouse or goat anti-human).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human) .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then incubated with 1μg/ml CR3009 SARS-CoV-2 cross-reactive antibody (a kind gift from Dr. Laura McCoy, UCL) in permeabilization buffer for 30 min at room temperature, washed once and incubated with secondary Alexa Fluor 488-Donkey-anti-Human IgG (Jackson Labs).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>488-Donkey-anti-Human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A blocking step was carried out for 1h at room temperature with 10% goat serum/1%BSA in PBS. Nucleocapsid (N) protein detection was performed by primary incubation with human anti-N antibody (Cr3009, 1ug/ml) for 18h, and washed thoroughly in PBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-N</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Cr3009</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies were detected by labelling with secondary anti-human AlexaFluor-568 and anti-mouse AlexaFluor 488 conjugates (Jackson Immuno Research) for 1h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies: Rabbit anti–Strep-tag II (Abcam #ab232586); Rabbit anti-beta-actin (Cell Signaling Technology #4967); Monoclonal mouse anti-FLAG M2 antibody (Sigma Aldrich, F1804)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti–Strep-tag II</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-beta-actin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-FLAG</div><div>suggested: (Sigma-Aldrich Cat# F1804, RRID:AB_262044)</div></div><div style="margin-bottom:8px"><div>F1804</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Hela-ACE2 cells were a kind gift from Dr. James E Voss (TSRI, USA)51</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Hela-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 cells were grown to 60-80% confluence prior to infection as described previously23. Viruses: SARS-CoV-2 isolate VIC was provided by NISBC, and IC19, B.1.1.7, B.1.1.7 (B) and B.1.1.7 (C) are reported in 11, full isolate names and GISAID references are listed below.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viruses were propagated by infecting Caco-2 cells at MOI 0.01 TCID50/cell, in culture medium at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Innate immune sensing assay: HEK293T cells were seeded in 48-well plates (5×104 cells/well) the day before transfection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For viral protein expression, cells were transfected with 100ng of empty vector or vector encoding either ORF9b, ORF9bS50/53E, VIC N or B.1.1.7 N (pLVX-EF1alpha-IRES-Puro backbone), alongside 10ng of ISG56-firefly luciferase reporter plasmid (kindly provided by Andrew Bowie, Trinity College Dublin), and 2.5ng of a Renilla luciferase under control of thymidine kinase promoter (Promega), as a control for transfection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX-EF1alpha-IRES-Puro</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Amplicon libraries were sequenced using MinION flow cells v9.4.1 (Oxford Nanopore Technologies, Oxford, UK).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MinION</div><div>suggested: (MinION, RRID:SCR_017985)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All samples were acquired on a BD Fortessa X20 using BD FACSDiva software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD FACSDiva</div><div>suggested: (BD FACSDiva Software, RRID:SCR_001456)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was analysed using FlowJo v10 (Tree Star).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image analysis of immunofluorescence experiments: IRF3 raw image channels were pre-processed using a batch rolling ball background correction in FIJI imagej software package56 prior to 514 quantification.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>imagej</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plotted are 1000 randomly sampled cells selected for each condition using the ‘Pandas’ data processing package in Python 3 with a filter of 0.1>=<5. Coimmunoprecipitation of Tom70 with Orf9b: HEK293T were transfected with the indicated mammalian expression plasmids using Lipofectamine 2000 (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For all analyses, samples were injected on a C18 reverse phase column (25 cm × 75 μm packed with ReprosilPur 1.9 μm particles).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ReprosilPur</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Total RNA samples were run on the Agilent Bioanalyzer, using the Agilent RNA 6000 Nano Kit.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Agilent Bioanalyzer</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reads containing possible junctions were extracted by filtering for exact matches to the 3’ end of the leader sequence “CTTTCGATCTCTTGTAGATCTGTTCTC” using the bbduk program in the BBTools package (BBTools -Bushnell B. - sourceforge.net/projects/bbmap/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BBTools</div><div>suggested: (Bestus Bioinformaticus Tools, RRID:SCR_016968)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The filtered and trimmed reads were matched against SARS2 genomic sequence with the bbmap program from BBtools with settings (maxindel=100, strictmaxindel=t, local=t).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>bbmap</div><div>suggested: (BBmap, RRID:SCR_016965)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Host RNA analysis: All reads were mapped to the human host genome (ensembl 101) using HISAT2 aligner58</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HISAT2</div><div>suggested: (HISAT2, RRID:SCR_015530)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differential gene expression were done on read counts extracted for each protein coding gene using featureCount and significance was determined by the DESeq2 R package60.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resource comprises of a comprehensive collection of phosphosite annotations of direct substrates of kinases obtained from six databases, PhosphoSitePlus, SIGNOR, HPRD, NCI-PID</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HPRD</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. One of the consequences (although arguably not the primary motivation) of DRY is that you tend to end up with chunks of complex code expressed once, with simpler code referencing it throughout the codebase. I can't speak for anyone else, but I consider it a win if I can reduce repetition and tuck it away in some framework or initialisation code. Having a single accessor definition for a commonly used accessor makes me happy - and the new Object class code can be tested to hell and back. The upshot is more beautiful, readable code.

      new tag?:

      • extract reusable functions to reduce duplication / allow elegant patterns elsewhere
    1. SciScore for 10.1101/2021.06.04.447160: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The amplified gene was inserted into pBAD-sfGFP vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBAD-sfGFP</div><div>suggested: RRID:Addgene_85482)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In the final construct (pBAD-sfGFP-PLpro), a hexahistidine tag is located at the N-terminus of sfGFP.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBAD-sfGFP-PLpro</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The normalized PLPro activity against drug concentration was analyzed with the inhibition curve (three parameters) analysis option in GraphPad 8.0 to determine the IC50 values.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.02.21258073: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) Human B cell ImmunoSpot® assays: For enumeration of antibody-secreting cells (ASC), irrespective of their antigen specificity, cell suspensions were serially diluted 2-fold in duplicates, starting at 3 x 104 live cells/well, in round-bottom 96-well tissue culture plates (Corning, Sigma-Aldrich) and subsequently transferred into assay plates precoated with anti-Igκ/λ capture antibody contained in the human IgA/IgG/IgM Three-Color ImmunoSpot® kit (from CTL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Igκ/λ</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alternatively, 6XHis-tagged protein solutions at 10µg/mL in PBS (unless otherwise specified) were applied to EtOH pre-conditioned wells precoated overnight at 4°C with 10µg/mL (unless otherwise specified) anti-His tag antibody (Biolegend, San Diego, CA) and incubated overnight at 4°C to improve antigen absorption.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Murine B cell hybridomas: Murine B cell hybridoma lines secreting (IgG1, κ) monoclonal antibody (mAb) with reactivity against the hemagglutinin (HA) protein of the pandemic H1N1 (pH1N1) A/California/04/2009 (CA/09) influenza vaccine strain have been reported previously [70].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>hemagglutinin ( HA</div><div>suggested: (GeneTex Cat# GTX127357, RRID:AB_2728683)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For enumeration of total ASC, irrespective of their antigen-specificity, ∼100 B cell hybridomas were input into wells precoated with anti-Igκ capture antibody contained in mouse B cell ImmunoSpot® kits (from CTL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specificity</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Igκ</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Murine B cell hybridoma lines secreting mAb with reactivity against the Spike protein of SARS-CoV-2 were generated from DBA/2J mice (Jackson Laboratory, Bar Harbor, Maine, USA) that were immunized intraperitoneally with heat-inactivated SARS-CoV-2 virus antigen [71] (∼100µL of virus antigen/mouse) adjuvanted with alum hydroxide on day 0, day 21 and day 42.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DBA/2J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(GraphPad Prism 9, San Diego, CA, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. Munch Tales

      Same feedback as the Atelier. In addition,

      • The job title and "self-employed" sound inconsistent. Consider a more powerful title. I'd get rid of the self-employed tag. It's got a bit of a bad reputation on LI
      • The company description needs to add some points of differentiation. Currently it doesn't impress.
    1. SciScore for 10.1101/2021.06.02.446468: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: All studies were approved by the Emory Institutional Review Board (IRB) under protocol numbers IRB00058507, IRB00057983 and IRB00058271.<br>Consent: Informed consent was obtained from the patients when they had decision making ability or from a legal authorized representative (LAR) if the patient was unable to provide consent.<br>Field Sample Permit: All work with infectious virus and respiratory samples from COVID-19 patients was conducted inside a biosafety cabinet within the Emory Health and Safety Office (EHSO)- and United States Department of Agriculture (USDA)-approved BSL3 containment facility in the Health Sciences Research Building at Emory University following protocols approved by the Institutional Biosafety Committee (IBC) and Biosafety Officer.<br>IACUC: All work with infectious virus and respiratory samples from COVID-19 patients was conducted inside a biosafety cabinet within the Emory Health and Safety Office (EHSO)- and United States Department of Agriculture (USDA)-approved BSL3 containment facility in the Health Sciences Research Building at Emory University following protocols approved by the Institutional Biosafety Committee (IBC) and Biosafety Officer.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single-cell surface antibody-derived tag (ADT), encapsulation, and library generation: Leukocytes from whole blood and ETA samples were incubated with oligo-conjugated Ig-A/D/G/M for 10 mins at 4°C followed by the addition of Human TruStain FcX™ (BioLegend) and 10 min incubation at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Single-cell surface antibody-derived tag ( ADT) , encapsulation</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>library generation: Leukocytes from whole blood and ETA samples</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ADT reads were aligned to a feature reference file containing the antibody-specific barcode sequences.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-specific barcode sequences .</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plaque assays: Vero E6 cells were seeded in a 6-well plates (Falcon) with 5 x 105 cells/well in 5% DMEM 24 h prior to infection and checked to verify ≥80% confluency. 10-fold dilutions of virus, respiratory secretions, and/or scRNA-seq emulsion in serum-free DMEM (200 μL) were incubated on Vero E6 monolayers for 1 h absorption at 37°C with rocking at 15 min intervals.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed in ~4 mL FACS buffer, then resuspended in 200-1000 μL for acquisition using BD FACSDiva™ Software on the Emory Pediatric/Winship Flow Cytometry Core BD FACSymphony™ A5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD FACSDiva™</div><div>suggested: (BD FACSDiva Software, RRID:SCR_001456)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed with FlowJo™ v10.7 (FlowJo LLC)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo™</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To recover neutrophils, scRNA-seq UMI count matrices were imported to R 4.0.2, and data analyses were performed using Seurat v4.042.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Seurat</div><div>suggested: (SEURAT, RRID:SCR_007322)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The R package Slingshot was used to infer the trajectories of neutrophils recruited to the lungs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Slingshot</div><div>suggested: (Slingshot, RRID:SCR_017012)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses: Statistical analyses were performed using GraphPad Prism9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.26.21256092: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Centre, location AMC, the Netherlands and approved by the local ethical committee (NL 73281.018.20).<br>Consent: All individuals provided written informed consent before participating.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All other proteins were produced in HEK293F cells (Invitrogen) maintained in Freestyle medium (Life Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293T cells expressing the SARS-CoV-2 receptor ACE2 were seeded in poly-L-lysine coated 96-wells plates and the next day triplicate serial dilutions of heat-inactivated serum samples were prepared, mixed 1:1 with SARS-CoV-2 pseudovirus, incubated for 1 h at 37°C and then added in a 1:1 ratio to the cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Specifically, a gene encoding amino acids 1-1276, in which the furin cleavage site (amino acids 752-756) was replaced with a GGSGS sequence and amino acids at position 1067 and 1068 were mutated to prolines, was ordered and cloned into a pPPI4 plasmid containing a T4 trimerization domain followed by a hexahistidine tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pPPI4</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mann-Whitney U-tests for unpaired comparisons, Wilcoxon matched-pairs signed rank test for paired comparisons and Spearman correlations were performed in GraphPad Prism 8.3.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Principal component analysis was performed in Matlab 9.6 (R2019a).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Matlab</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. { "id": "https://preview.iiif.io/cookbook/0021-tagging/recipe/0021-tagging/annotation/p0001-tag", "type": "Annotation", "motivation": "tagging", "body": { "type": "TextualBody", "value": "Germany" }, "target": "https://preview.iiif.io/cookbook/0021-tagging/recipe/0021-tagging/canvas/p1" }

      Should this be in an annotations property of the Canvas, Manifest, or AnnotationPage?

    1. Reviewer #1 (Public Review): 

      The paper by Sim et al describes phospho-proteomic analysis of ATR kinase-dependent pathway in mouse spermatocytes. By administrating an ATR inhibitor, AZ20, to mice and using Rad1 (a component of 911 DNA damage clamp) conditional knockout mouse (cKO), the authors isolated testis from these mice, isolated phospho-peptides and analyzed with Tandem Mass Tag (TMT). The analyses identified 37,180 phosphorylation sites and created the data base for them. Importantly, in-depth analysis of the phosphorylation sites revealed an unique consensus site of the ATR-dependent phosphorylation; S/TPXK, whose kinase has not been identified yet. In addition, the authors showed new ATR-dependent phosphorylation sites in proteins in RNA metabolisms including piRNA biogenesis for transposon silencing and showed ATR-dependent localization of two RNA processing enzymes, SETX helicase, and RANBP3 in meiosis sex chromosome inactivation (MSCI). This is an important body of work as a good resource for phosphorylation in mouse germ cells. The study had been done in a great care with proper controls. The data set in the paper is very much useful and of great interest to researchers in meiosis and DNA damage response (DDR) field.

    1. SciScore for 10.1101/2021.05.26.21257441: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Both studies were conducted at the Amsterdam University Medical Centers in the Netherlands and approved by the local ethical committee.<br>Consent: All individuals included in this study gave written informed consent before participating.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All S constructs were verified by Sanger sequencing and subsequently produced in HEK293F cells (ThermoFisher) and purified as previously described (25).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus was produced by co-transfecting the pCR3 SARS-CoV-2-SΔ19 expression plasmid with the pHIV-1NL43 ΔEnv-NanoLuc reporter virus plasmid in HEK293T cells (ATCC, CRL-11268) (44, 45)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus neutralization assay: HEK293T/ACE2 cells kindly provided by Dr. Paul Bieniasz (44) were seeded at a density of 20,000 cells/well in a 96-well plate coated with 50 μg/mL poly-L-lysine 1 day prior to the start of the neutralization assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T/ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero-E6 cells were added in a concentration of 20,000 cells/well and incubated for 72 h at 35°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">They were ordered as gBlock gene fragments (Integrated DNA Technologies) and cloned PstI/NotI in a pPPI4 expression vector containing a hexahistidine (his) tag with Gibson Assembly (ThermoFisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pPPI4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus was produced by co-transfecting the pCR3 SARS-CoV-2-SΔ19 expression plasmid with the pHIV-1NL43 ΔEnv-NanoLuc reporter virus plasmid in HEK293T cells (ATCC, CRL-11268) (44, 45)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCR3 SARS-CoV-2-SΔ19</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pHIV-1NL43 ΔEnv-NanoLuc</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The inhibitory concentration (IC50) and neutralization titers (ID50) were determined as the NAb concentration and serum dilution at which infectivity was inhibited by 50%, respectively using a non-linear regression curve fit (GraphPad Prism software version 8.3) (45)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      While our study aims to provide an overview of many different aspects of pre-existing immunity against VOC, there are some limitations. In this study, we present a vaccinee population that consists of primary health care workers that are generally of middle age, with only four (8%) participants being older than 60 (Table 1). However, we found no correlation between age and titers in convalescent patients against any of the VOC tested. Moreover, we have focused on the neutralization potential of immune sera and did not examine antibody effector functions which have been implicated previously in the control of SARS-CoV-2 infection (41). Similar to other studies, our convalescent and vaccinee sera samples were collected four to six weeks after infection and four weeks after vaccination (i.e. at the peak of immunity), respectively. While we present findings that may have implications for additional booster vaccines and the monitoring of VOC, we did not examine the aspect of waning antibody titers and how those might influence VOC binding and neutralization. Finally, we have merely examined an early line of defense against infection with SARS-CoV-2 (i.e. serum antibody levels), while we expect memory B cells to play an important part in re-infections with SARS-CoV-2 VOC. Indeed, swift re-activation of memory compartments may lead to reduced transmissibility, a milder course of disease and a more potent immune response. In conclusion, we observed a substantial reduction in binding ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.01.446555: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To detect expression pattern or biotinylation pattern, the primary antibody, such as anti-V5 (Invitrogen, cat. No. R960-25, 1:5,000 dilution), was incubated for 1 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-V5</div><div>suggested: (Thermo Fisher Scientific Cat# R960-25, RRID:AB_2556564)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing three times with TBST for 5 min at room temperature, secondary antibodies, namely mouse-HRP (Bio-rad, cat. No. 1706516, 1:3,000 dilution) and rabbit-HRP (Cell signaling, cat. No. 7074S, 1:3,000 dilution), or SA-HRP (Thermofisher, cat. No. 21126, 1:10,000 dilution) were incubated for 1 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>mouse-HRP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>rabbit-HRP</div><div>suggested: (Carl Roth Cat# 4750, RRID:AB_2890006)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HeLa cells and A549 cells were from Laboratory of Dr.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Obtaining Secreted Proteins in Cell Culture Media: After biotin labeling of HEK293 cells expressing SEC61B-TurboID, cells were incubated with no FBS DMEM for 16 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proteome Digestion & Enrichment of Biotinylated Peptides: For mass sampling, HEK293T cells were split in three T75 flasks for triplicate samples per each condition.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression Plasmids: Genes with epitope tag (i.e. V5, FLAG, HA, twin strep) were cloned into pCDNA3, pCDNA3.1, and pCDNA5 using digestion with enzymatic restriction sites and ligation with T4 DNA ligase.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA3</div><div>suggested: RRID:Addgene_15475)</div></div><div style="margin-bottom:8px"><div>pCDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div><div style="margin-bottom:8px"><div>pCDNA5</div><div>suggested: RRID:Addgene_49428)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For transiently co-expressed two constructs, vPOI-GFP and TurboID-GBP, cells were grown at 70–80% confluence and transfected with wanted constructs using PEI.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>vPOI-GFP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pearson correlation was conducted using image J software program (NIH).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>image J</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing three times with TBST for 5 min at room temperature, results of immunoblotting assay were obtained using ECL solution using GENESYS program.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GENESYS</div><div>suggested: (GeneSys, RRID:SCR_015770)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Enlarged fluorescence images were fitted to the electron micrographs using the Image J BigWarp program.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Image J BigWarp</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Processing MS data and Identification of Proteins: All MS/MS data were searched using MaxQuant (version 1.5.3.30) with Andromeda search engine at 10 ppm precursor ion mass tolerance against the SwissProt Homo sapiens proteome database (20,199 entries, UniProt (http://www.uniprot.org/)).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MaxQuant</div><div>suggested: (MaxQuant, RRID:SCR_014485)</div></div><div style="margin-bottom:8px"><div>UniProt</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The imputation of protein intensity were conducted using Perseus software program.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Perseus</div><div>suggested: (Perseus, RRID:SCR_015753)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. Critical to the acceptance of the position of the script subtag was the inclusion of information in the registry to make clear the need to avoid script subtags except where they add useful distinguishing information. Thus, the registry entry for the language subtag "en" (English) has a field called "Suppress-Script" indicating that the script subtag "Latn" should be avoided with that language, since virtually all English documents use the Latin script.
      • not worth saying
      • not necessary to say/write
      • useless information

      Suppress-Script

    2. Another problem was the ambiguity of RFC 3066 regarding the generative syntax. The idea of "language-dash-region" language tags was easy enough to grasp; most users didn't read RFC 3066 directly or consider the unstated-but-realized implication that other subtags might sometimes occur in the second position.

      unstated-but-realized

    3. Because ISO code lists were not always free and because they change over time, a key idea was to create a permanent, stable registry for all of the subtags valid in a language tag.

      Why was it not free???

    1. SciScore for 10.1101/2021.05.29.446300: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the biotinylated bait preparations, bait constructs were mixed with a pHLsec-BirA-ER vector (Chang et al., 2015) into a 3 to 1 ratio and co-transfected in HEK293T cells in the presence of 0.1 mM Biotin (MilliporeSigma B4639).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following five backbone constructs used for the Fc fusion or biotinylated baits and AP fusion probes were derived from the pHLsec vector (Aricescu et al., 2006). (1) The pHLsec-3C-Fc (C103A)-8H vector contains a C-terminal Human Rhinovirus (HRV)-3C protease cleavage site followed by the human immunoglobulin heavy constant gamma 1 (resi 102-330; having a C103A mutation to remove an unpaired cysteine; UniProtKB code P01857) and an 8xHis tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHLsec</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>C103A)-8H</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(2) The pHLsec-Fc-Avi-6H vector contains the human immunoglobulin heavy constant gamma 1 (resi 101-330; UniProtKB code P01857) followed by an Avi tag that can be biotinylated by BirA ligases and a 6xHis tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHLsec-Fc-Avi-6H</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(3) The pHLsec-3C-mVenus-Avi-8H vector derived from pHLsec-mVenus-12H (Chang et al., 2015) was tagged with a C-terminally HRV-3C protease cleavage site followed by a mVenus fusion protein, an Avi tag and finally an 8xHis tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHLsec-mVenus-12H</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(4) The pHL-N-AP-Myc-8H vector was constructed N-terminally with the human alkaline phosphatase (AP; resi 1-506; NCBI code NP_001623) followed by a Myc tag and finally a C-terminal 8xHis tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHL-N-AP-Myc-8H</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(5) The pHLsec-C-Myc-AP-8H vector contains a C-terminal Myc tag followed by the human AP (resi 18-506; NCBI code NP_001623) and finally an 8xHis tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHLsec-C-Myc-AP-8H</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Lgr4LRR was constructed into the pHLsec-3C-mVenus-Avi-8H vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHLsec-3C-mVenus-Avi-8H</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 RBD insert was grafted into the pHLsec-mMGD21-3C-mVenus-Avi-8H vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHLsec-mMGD21-3C-mVenus-Avi-8H</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2ECD (resi 19-615), NBVHH-72, and NBH11-D4 were cloned into the pHLsec-AP-8H vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHLsec-AP-8H</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the biotinylated bait preparations, bait constructs were mixed with a pHLsec-BirA-ER vector (Chang et al., 2015) into a 3 to 1 ratio and co-transfected in HEK293T cells in the presence of 0.1 mM Biotin (MilliporeSigma B4639).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHLsec-BirA-ER</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following five backbone constructs used for the Fc fusion or biotinylated baits and AP fusion probes were derived from the pHLsec vector (Aricescu et al., 2006). (1) The pHLsec-3C-Fc (C103A)-8H vector contains a C-terminal Human Rhinovirus (HRV)-3C protease cleavage site followed by the human immunoglobulin heavy constant gamma 1 (resi 102-330; having a C103A mutation to remove an unpaired cysteine; UniProtKB code P01857) and an 8xHis tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UniProtKB</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The structures of Tspan28 (CD81; PDB codes 1G8Q and 5TCX) were selected to generate an initial computational model of Tspan12EC2 with Modeller (Eswar et al., 2006).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Modeller</div><div>suggested: (MODELLER, RRID:SCR_008395)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Notably, the structures of Tspan25 (CD53; PDB code 6WVG), and Tspan29 (CD9, PDB codes 6RLR and 6K4J) were not available during the HHpred search.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HHpred</div><div>suggested: (HHpred, RRID:SCR_010276)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the protein design of Antibody Display Tspan12EC2, LAIR1 insert was removed from the model of MGD21 Fab fragment (PDB code 5NST) and the Tspan12EC2 model was docked into the MGD21 VH manually by using COOT (Emsley et al., 2010) and PyMOL Molecular Graphic System (Schrödinger, LLC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      At present, the limitations for selecting POI for Antibody Display such as protein shape and size remain unclear; further studies will be required to address these questions. Comparing with conventional Fc fusion proteins in which the POI is fused to the N terminus of Fc usually including the flexible hinge region, we reasoned that the Antibody Display, which grafts the POI onto the β-strands G and F of the heavy chain, provides several potential advantages: (1) design and production of a more conformationally constrained chimeric protein, (2) reduction of proteolysis with the POI inserted into a stable antibody Ig fold, and (3) extension of the current antibody engineering toolkit for generating bispecific and chimeric antibodies. Further studies will be needed to explore these potential advantages. An intriguing feature of using the Antibody Display for Tspan12EC2 is with a better yield of protein production than Tspan12EC2. Our functional assays demonstrated that Tspan12EC2 bound to Norrin directly, in agreement with previous genetic studies (Lai et al., 2017). As Tspan12 playing critical roles in CNS vascular development (Junge et al., 2009; Zhang et al., 2018) and tumorigenesis (Knoblich et al., 2014; Otomo et al., 2014), Tspan12EC2-AD may be a useful reagent for these studies. Moreover, Tspan proteins are well known for their important roles in regulating tumor migration, invasion and metastasis (Charrin et al., 2014; Hemler, 2014; Vences-Catalan and Levy, 2018). Antibo...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.31.445667: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1 mg of cell lysate was cleared with protein A magnetic beads to remove non-specific interactions (S1425S, NEB) and incubated overnight with anti-ZAP antibody (Proteintech 16820-1-AP) or anti-IgG from rabbit as a control (Cell Signaling, a gift from Dr. Mathias Munschauer, HIRI-HZI).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ZAP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After transfer using Trans-Blot (Bio-Rad), nitrocellulose membranes were developed using the following primary antibodies: anti-His-tag (ab18184), anti-DDDDK (ab49763), anti-ALFA (FluoTag®-X2 anti-ALFA AlexaFluor 647), anti-ZC3HAV1 (Proteintech 16820-1-AP).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His-tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-ALFA</div><div>suggested: (Antibodies-Online Cat# ABIN125862, RRID:AB_11186338)</div></div><div style="margin-bottom:8px"><div>anti-ZC3HAV1</div><div>suggested: (Proteintech Cat# 16820-1-AP, RRID:AB_2728733)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following secondary antibodies were used: IRDye® 800CW Goat anti-rabbit and IRDye® 680RD Donkey anti-Mouse (both LI-COR).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (LI-COR Biosciences Cat# 926-68073, RRID:AB_10954442)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The nitrocellulose membranes were developed using anti-DDDDK primary (Abcam ab49763) and IRDye® 680RD donkey anti-mouse secondary antibody (LI-COR).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-DDDDK</div><div>suggested: (Abcam Cat# ab49763, RRID:AB_869428)</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the experiments, optical tweezers (OT) constructs were mixed with 4 μl of polystyrene beads coated with antibodies against digoxigenin (AD beads, 0.1% v/v suspension, Ø 1.76 μm, Spherotech), 10 μl of assay buffer (20 mM HEPES, pH 7.6, 300 mM KCl, 5 mM MgCl2, 5 mM DTT and 0.05% Tween) and 1 μl of RNase inhibitor.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>digoxigenin</div><div>suggested: (Millipore Cat# AQ300D, RRID:AB_11212694)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 cells (ATCC HTB-55) were cultured in MEM (Sigma) supplemented with 10% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: ATCC Cat# HTB-55, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The supernatant was used to transduce naïve Huh7 cells in the presence of 10 μg/ml polybrene (Merck Millipore).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus was raised for two passages on Caco-2 cells (HZI Braunschweig).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: CLS Cat# 300137/p1665_CaCo-2, RRID:CVCL_0025)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To study the effect of ZAP-S on SARS-CoV-2 infection, Huh-7 cells were employed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: CLS Cat# 300156/p7178_HuH7, RRID:CVCL_0336)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were infected with 200000 pfu/ml, corresponding to an MOI of 0.03 at 24h post-infection, cell culture supernatants were collected and titrated by plaque assay on Vero E6 cells (ATCC CRL-1586).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Polysome profiling analysis: A plasmid expressing ZAP-S N-terminally tagged with a His-tag was transfected into HEK293 cells using PEI, as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To check endogenous ZAP-S expression, HEK cells were transfected with a plasmid containing the same backbone and His-tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TFRC (NM_003234.4), ZAP (NM_024625.4) and ZNF346 (NM_012279.4) were placed in frame with the coding sequence for ECFP in pFlp-Bac-to-Mam (gift from Dr.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pFlp-Bac-to-Mam</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein-coding sequences were introduced by Golden Gate Assembly using AarI cut sites 69. pET-SUMO-GFP (gift from Prof. Utz Fischer, Julius-Maximilians-University, Würzburg, Germany) was used as the parental vectors for protein overexpression in E. coli.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-SUMO-GFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Optical tweezers constructs were based on the wild type SARS-CoV-2 frameshifting site (nucleotides 13475-13541) cloned into the plasmid pMZ_lambda_OT, which encodes for the optical tweezer handle sequences (2Kb each) flanking the RNA structure (130 nt).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMZ_lambda_OT</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VSV-G envelope pseudo-typed lentivirus for the generation of stable cell lines was produced by co-transfection of each transfer plasmid with pCMVdR 8.91 71 and pCMV-VSV-G (gift from Prof. Weinberg, Addgene plasmid # 8454 72).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV-VSV-G</div><div>suggested: RRID:Addgene_8454)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RNAs were labeled at the 3’ end using pCp-Cy5 (Cytidine-5’-phosphate-3’-(</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCp-Cy5</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry data were analyzed with FlowJo software (BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bands corresponding to the –1 or 0-frame products, 58 kDa and 33 kDa respectively, on western blots of in vitro translations were quantified densitometrically using ImageJ software 74.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Graphs were plotted using GraphPad Prism 8.4.3 software. Microscopy: HEK293 cells were cultured on glass slides and transfected as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The results were plotted using Prism 8.0.2 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All data are available in the main text, the supplementary materials as well as in Mendeley Data: DOI: 10.17632/c7rbxb86k2.1</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Mendeley</div><div>suggested: (Mendeley Data, RRID:SCR_002750)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr style="background-color:#FF0000"><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT811</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Trial number did not resolve on clinicaltrials.gov. Is the number correct?</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr></table>


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.31.446386: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the transfer, the membrane was blocked in 1% Casein in PBS (Thermo Scientific) and stained using primary antibodies directed against SARS-CoV-2 S (1:1,000, Biozol, 1A9, #GTX632604), ACE2 (1:1,000</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, VSV-M (1:2,000, Absolute Antibody, 23H12, #Ab01404-2.0), V5-tag (1:1,000</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>V5-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, Cell Signaling, #13202), GAPDH (1:1,000, BioLegend, #631401) and Infrared Dye labelled secondary antibodies (1:20,000, LI-CORIRDye).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GAPDH</div><div>suggested: (BioLegend Cat# 631401, RRID:AB_2247301)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human embryonic kidney 293T cells purchased from American type culture collection (ATCC: #CRL3216) were cultivated in Dulbecco’s Modified Eagle Medium (DMEM, Gibco) supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS, Gibco), 2 mM L-glutamine (PANBiotech), 100 μg/ml streptomycin (PANBiotech) and 100 U/ml penicillin (PANBiotech).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: ATCC Cat# CRL-3216, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudoparticle production: To produce pseudotyped VSVΔG-GFP particles, 6*106 HEK 293 T cells were seeded 18 hours before transfection in 10 cm dishes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Stem Cell Culture and Intestinal Differentiation: Human embryonic stem cell line HUES8 (Harvard University, Cambridge, MA) was used with permission from the Robert Koch Institute according to the “79.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HUES8</div><div>suggested: RRID:CVCL_B207)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">α5β5 integrin blocking: Caco-2 cells were preincubated with the indicated amounts of α5β5 integrin Inhibitor ATN-161 (Sigma) for two hours and infected with 100 μl freshly produced VSVΔG-GFP pseudo particles.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 cells were preincubated with the indicated amounts of ATN-161 (Sigma) for two hours and infected with SARS-CoV-2 Viral isolate BetaCoV/France/IDF0372/2020 (MOI 0.05, six hours).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression constructs: pCG_SARS-CoV-2-Spike-IRES_eGFP, coding the spike protein of SARS-CoV-2 isolate Wuhan-Hu-1, NCBI reference Sequence YP_009724390.1, was kindly provided by Stefan Pöhlmann (German Primate Center, 473 Göttingen, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCG_SARS-CoV-2-Spike-IRES_eGFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pCG_SARS-CoV-2-Spike C-V5-IRES_eGFP and RaTG13-S (synthesized by Baseclear) was PCR amplified and subcloned into a pCG-IRES_eGFP expression construct using the restriction enzymes XbaI and MluI (New England Biolabs).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCG_SARS-CoV-2-Spike C-V5-IRES_eGFP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCG-IRES_eGFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting amplicons were assembled with a modified pBeloBAC11 backbone, containing CMV and T7 promotors as well as the HDV ribozyme and bGH polyA signal, using the NEBuilder HiFi DNA Assembly Cloning Kit.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBeloBAC11</div><div>suggested: RRID:Addgene_60342)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Assembled DNA was electroporated into E. coli GS1783 strain and resulting clones of pBelo-SARSARS-CoV-2 were confirmed by restriction digestion and next generation sequencing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBelo-SARSARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 ΔS replicon system: HEK293 T cells were seeded in six well format and transfected with 3 μg pBelo-SARSCoV-2-dSpike-GLuc-K2 or pBelo-SARSCoV-2-dSpike-EGFP and 0.25 μg of each expression construct pLVX-EF1alpha-SARS-CoV2-N-2xStrep-IRES-Puro, pCG-ACE2, pCAG-T7-RNA-polymerase and one pCG-vector encoding the spike protein of SARS-CoV-2, RaTG13 or the indicated mutant S respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBelo-SARSCoV-2-dSpike-GLuc-K2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pBelo-SARSCoV-2-dSpike-EGFP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pLVX-EF1alpha-SARS-CoV2-N-2xStrep-IRES-Puro</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCG-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCAG-T7-RNA-polymerase</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCG-vector</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Organoids were imaged using the Cytation 3 cell imaging system and processed with Gen 5 and ImageJ software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence logos were generated using R packages ggplot2 and ggseqlogo34.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: Statistical analyses were performed using GraphPad PRISM 8 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad PRISM</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 28. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.28.446179: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The gene was later modified for expression in HEK293 cells by adding a fluorescent EGFP tag, in frame, to the C-terminus of the E-protein sequence via overlap extension PCR and subsequently subcloning the product into a pcDNA3.1 vector; generating the EcGFP construct.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Microscopy: HEK293T cells were seeded on an 18 mm diameter coverslip and transiently transfected with the constructs mentioned above (Results and Fig. 2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The gene was later modified for expression in HEK293 cells by adding a fluorescent EGFP tag, in frame, to the C-terminus of the E-protein sequence via overlap extension PCR and subsequently subcloning the product into a pcDNA3.1 vector; generating the EcGFP construct.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The gene was subcloned in the pFastBac1 (for Sf9 expression) and pEG-BM (for HEK293 expression) vectors and baculovirus was generated according to the bac-to-bac baculovirus expression system.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pEG-BM</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Colors were added to signals post-acquisition using default look-up tables in Fiji software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Electrophysiology: Whole-cell patch clamp recordings were performed using an EPC-10 amplifier and Patchmaster software (HEKA Elektronik; Lambrecht/Pfalz, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Patchmaster</div><div>suggested: (Patchmaster, RRID:SCR_000034)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Although several articles and preprints in the past year74,79–84 have reported simulations of this structure, a review of their results shows similar limitations, with abbreviated timescales,80–82 reliance on secondary-structure restraints,74 elevated RMSDs,74,80 and/or dewetting in the absence of electric fields.74 Instability of the open structure may reflect underdetermination of the starting protein or membrane models, unresolved interactions with the C-terminal or other domains, or other factors yet to be identified. Taken together, we have shown that recombinantly expressed full-length E protein from SARS-CoV-2 is capable of independent multimerization, possibly as a tetrameric or smaller species. We also confirmed that the protein localizes intracellularly, similar to its predecessor from SARS-CoV, with no evidence of ion channel properties at the cell surface. Our coarse-grained simulations further support a role for the E protein in viral budding, as the presence of the protein bends the surrounding membrane. Reduction of intracellular Ca2+ in E-protein-transfected cells may further promote viral replication. However, our atomistic simulations and permeation calculations based on previously reported NMR structures resulted in unstable proteins incapable of Ca2+ conduction. We emphasize the importance of using high-resolution structural data obtained from a full-length protein to gain detailed molecular insight of the E protein, and enable future drug-screening effort...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

  3. May 2021
    1. tweet at them. This has multiple effects: If they don't respond, it's bad PR
    2. The best advice I can give you is: Seek a smaller provider which often are less formal and more approachable. When you found one where you have a good support, request your friends and family to move to this. You are doing something for them, then it can only happen on your terms.
      • supporting those you like by sending business to them
      • less formal and more approachable
    3. So, +1 for play ball. Level 1 is supposed to filter out all simple issues (and once upon a time, you'll have forgotten something, happens to all of us), and they are not supposed to be creative. They get a script that has been refined over and over. Learn the scripts, prepare the answers, and you'll get to Level 2 more quickly than with any other method.
  4. www.reclam.de www.reclam.de
    1. 5»Du willst wirklichnichtmehr weiterspielen, Else?«–»Nein, Paul, ich kann nicht mehr. Adieu. – Auf Wiederse-hen, gnädige Frau.« –»Aber, Else, sagen Sie mir doch: FrauCissy. – Oder lieber noch: Cissy, ganz einfach.«–»AufWiedersehen, Frau Cissy.« –»Aber warum gehen Sie denn5schon, Else? Es sind noch volle zwei Stunden bis zum Din-ner.«– »Spielen Sie nur Ihr Single mit Paul, Frau Cissy, mitmir ist’s doch heut wahrhaftig kein Vergnügen.« –»LassenSie sie, gnädige Frau, sie hat heut ihren ungnädigen Tag. –

      .

    1. SciScore for 10.1101/2021.05.26.445185: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Movies were acquired for 10 minutes at 10 frames per second, under illumination with a 532 nm laser at a power of 0.70 µW/µm2, to excite Cy3 fluorophores.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: 5 Traces containing robust smFRET signals for eIF4E–RNA interaction were selected by visual inspection.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Luciferase assays: 100 nM CoV firefly luciferase fusion RNA was added to 12 µL of HeLa lysate reaction mix from an in vitro protein expression kit (Thermo Scientific, 88882), along with 0.5 µL of rocaglamide/RocA solution (Med Chem Express, Product No. HY-19356) or 4E2RCat solution (Med Chem Express, Product No. HY-100733) in varying concentrations as indicated in the Results and Discussion.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For preparation of the luciferase fusion construct, DNA fragments containing the class II T7 promoter Φ2.5, followed by the SARS-CoV-2 5’ untranslated region sequence, the coding sequence for firefly luciferase, and the SARS-CoV-2 5’ untranslated region sequence were assembled in a pUC57 vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pUC57</div><div>suggested: RRID:Addgene_40306)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sequence was inserted into pUC119 via SalI and EcoRI restriction sites incorportated during gBlock synthesis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pUC119</div><div>suggested: RRID:Addgene_50010)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Preparation of fluorescently labeled eIF4E and eIF4E(S209D): The pET-28a(+) vectors containing the sequences of eIF4E or eIF4E(S209D), each fused with an N-terminal Protein G tag, were designed similarly to Feokistova et. al., (2013).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-28a(+ )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pULTRA expression vector, containing inserts encoding tRNACUA and pAzF-tRNACUA-synthetase – a generous gift from Abhishek Chatterjee, Boston College – was co-transformed into an E. coli BL95ΔAΔfabR strain with the pET28a(+)-eIF4E plasmid, and transformants were selected on LB agar containing Kanamycin (50 µg/mL) and Spectinomycin (100 µg/mL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pULTRA</div><div>suggested: RRID:Addgene_24129)</div></div><div style="margin-bottom:8px"><div>pET28a(+)-eIF4E</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The full-length human GAPDH transcript sequence, obtained from UCSC Genome Browser, was purchased as a gBlock from IDT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UCSC Genome Browser</div><div>suggested: (UCSC Genome Browser, RRID:SCR_005780)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">48 Event timings identified from ebFRET analysis were converted to empirical cumulative probability distributions for the times between events, and the event durations, then fit with single- or double-exponential models to determine kon or koff, according to the equations:

      Fitting was carried out in MATLAB by non-linear least-squares regression using the Trust-Region algorithm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. Gwern.net was one of the earliest and most consistent gardeners to offer meta-reflections on their work. Each entry comes with:topic tagsstart and end datea stage tag: draft, in progress, or finisheda certainty tag: impossible, unlikely, certain, etc.1-10 importance tagThese are all explained in their website guide, which is worth reading if you're designing your own epistemological system.
    2. Rory Sutherland (oddly, the vice president of Ogilvy Group)

      His Twitter tag line is: "The Spectator's Wiki Man."

    3. They're not following the conventions of the "personal blog," as we've come to know it.

      There are a number of bloggers who have to some extent, specifically used their blogs for this purpose though. I've documented several at https://boffosocko.com/tag/thought-spaces/

    1. I think so...I actually can't remember. I've used this script quite a bit.

      where did it come from? don't remember

      after a while, something that came from another starts to feel like your own

      you make it your own

    1. Are you also tired and fed up with the bulkiness of jQuery, but also don't want to have to type document.querySelector("div").appendChild(document.createTextNode("hello")); just to add some text to an element?

      happy middle/medium?

    1. --tag-rename '':'my-module-' (the single quotes are unnecessary, but make it clearer to a human that we are replacing the empty string as a prefix with my-module-)
    1. mf-Lon does not recognize or degrade ec-ssrA, providing a protease and cognate degradation tag with orthogonal functionality in E. coli

      I wonder if this insulation will be applicable to other gram negatives? (or other gram positives too?)

    1. This link may be placed in such a way that it is not even necessary for the victim to click the link. For example, it may be embedded within an html image tag on an email sent to the victim which will automatically be loaded when the victim opens their email.
    1. SciScore for 10.1101/2021.05.21.445201: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">αEp9 Abs binding to the potential epitopes was detected using horse radish peroxidase (HRP) conjugated αHuman Fc IgG (Thermo Fisher Scientific, Waltham MA) or αIgM µ-chain specific (Millipore Sigma, Temecula, CA) Abs diluted 1:5000 in ChonBlock Sample Antibody Dilution buffer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HRP) conjugated αHuman Fc IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cloning: Predicted OAS epitopes were subcloned for phage display using the pM1165a phagemid vector (Levin, 2006) with an N-terminal FLAG-tag and a C-terminal P8 M13-bacteriophage coat protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pM1165a</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression and Purification of eGFP fusion peptides: pET28c plasmids encoding eGFP fusions to C-terminal Ep9-FLAG, EpNeu-FLAG, EpPred-FLAG and FLAG (negative control) and N-terminal His6 peptide epitopes, were transformed into BL21DE3 Star E. coli chemically competent cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET28c</div><div>suggested: RRID:Addgene_161936)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alignment of Ep9 sequence with the orthologs from other human coronaviruses (hCoVs) such as SARS-CoV, MERS, HKU-1, NL63, 229E and OC43 was conducted using the Benchling sequence alignment tool (Benchling, 2017) (https://benchling.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://benchling.com</div><div>suggested: (Benchling, RRID:SCR_013955)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To explore a wider range of human host pathogens pBLAST (Altschul et al., 1997) (https://blast.ncbi.nlm.nih.gov/Blast.cgi) was used to search for Ep9 homology in a database of non-redundant protein sequences; common human-host viruses were specified in the organism category.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://blast.ncbi.nlm.nih.gov/Blast.cgi</div><div>suggested: (TBLASTX, RRID:SCR_011823)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The queries were conducted with the blastp (protein-protein BLAST) program (Altschul et al., 1997) with search parameters automatically adjusted for short input sequences.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Using the ProMod3 3.2.0 tool (Studer et al., 2021), a structural model was generated based on the crystal structure (2.35Å, PDB 4GZS 1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ProMod3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: The ELISA data were analyzed in GraphPad Prism 9 (https://www.graphpad.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.23.445348: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The synthesized and mutated genes were cloned into pcDNA 3.4 Topo vector, modified by including a signal sequence of human immunoglobulin heavy chain, His-Tag and SUMOstar protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA 3.4</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. timeless decision theory

      This as since been renamed to updateless decision theory%20is,which%20it%20makes%20its%20decisions.&text=It%20acts%20as%20though%20its,some%20dualist%20free%2Dwill%20theories.)

    1. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary:

      In the manuscript „Intra-helical salt bridge contribution to membrane protein insertion" the authors investigate the effect of salt bridge formation between positively and negatively charged amino acids on the insertion behavior of α-helical protein segments into the membrane. Generally it is believed that polar or even charged residues prevent stable membrane insertion of α-helical protein segments, but some of these authors had already shown in a previous paper that such residues are more frequent than expected in transmembrane helices. In the current study, the authors investigate in detail the role of intra-helical salt bridge formation on stable membrane insertion. Using an in vitro membrane insertion assay based on the E. coli leader peptidase (Lep) protein, they found better membrane insertion for helical segments with opposite charge pairs placed at positions compatible with intra-helical salt bridge formation (positions i→i+1; i→i+3 and i→i+4). Furthermore, the authors performed a database screen which revealed that oppositely charged residues are overrepresented at these positions. Finally they picked two candidate membrane proteins from the database (Halorhodopsin and calcium ATPase 1) and proved the presence of an intra-helical salt bridge and determined the contribution of the salt bridge to the apparent free energy of membrane insertion (ΔGapp), which was in the range of 0,5-0,7 kcal/mol.

      Major comments

      1. It seems that the data in Fig. 3b has been mixed up, making it difficult to judge the conclusions. The bars with forward slash seem to represent the "same charge" data and the bars with backward slash seem to represent the "opposite charge" data (exactly contrary to the figure legend). In general the forward and backward slash representation is not easily distinguishable, and for the position i+4 both bars contain a forward slash (making it impossible to discriminate same and opposite charge). Please use filled and unfilled bars instead. Furthermore the bar diagram in Fig. 3a is stacked for opposite and same charge, whereas in Fig. 3b the respective bars are placed next to each other. Additionally the label of the y-axis in Fig. 3c is misleading, as it is not the "Frac. of opp. charged pairs" but the fraction of oppositely charged pairs that form salt bridges.
      2. The authors don´t give details no how the log odds ratios and the respective p-values have been determined. Please include this in the Materials and Methods section. What does a p-value of 0.00e+00 mean (see Table 2, Spacing: +3, "All Log odds")?
      3. What is the proof that for the isolated helix A from the calcium ATPase 1 the membrane embedded part is identical to the full-length protein? The authors investigated two different helix A peptides, the full-length helix ranging from L49-F78, and one short fragment ranging from L49-A69 containing the more hydrophilic N-terminal region, which is the membrane-embedded region in the full-length protein. The authors state: "In contrast, when only the membrane-embedded sequence was included, the Lep chimera was mainly doubly-glycosylated (Fig. 5c, lane 3), suggesting that helix A is properly inserted when the full helical sequence is present." In my opinion this conclusion cannot be drawn from the data presented. The authors used an isolated helical segment, so in my opinion it is much more likely that the isolated full-length helix inserted via its hydrophobic C-terminal part (L60-F78) into the membrane. The authors themselves state in their manuscript: "It has been previously shown that the position in the membrane of TM helices in protein folded structures does not always correspond to the thermodynamically favored positions in the membrane of the isolated helices." Also the i→i+5 mutant points into that direction, because the effect of disturbing the intra-helical salt bridge for the helix A is much less pronounced compared to the similar data in Fig. 4f for the Halorhodopsin protein. In my opinion this shows that most probably only one charged residue (R63) is embedded inside the membrane (with a membrane embedded part of L60-F78).

      Minor comments:

      1. line 151: ",see Figure 2)" Typo: Bracket missing.
      2. line 172: "Other known structural features can also be hinted at, including aromatic ring stacking by His-Trp pair [20] at i→i+6." Please give some more examples of important structural features of membrane proteins, which can be seen in your analysis (e.g. I think that also the glycine zipper can be seen in the i→i+4 data set).
      3. line 255: "The salt bridge contributes approximately ~0,5 kcal/mol to the apparent experimental free energy of membrane insertion." Please explain that this value was derived from the comparison of the ΔGexp between the wt and the i→i+5 mutant. Please comment also on the large difference between the predicted (ΔGpred) and the experimental values (ΔGexp), even if no salt-bridge is involved (e.g. for the DD mutant).
      4. line 348: "Asp-Lys pairs at position i, i+4 and Glu-Lys pairs at position i→ i+3 are the most prevalent as seen previously in Figure 2. They are both among the most prevalent oppositely charged pairs and the charged pairs that form the highest number of salt bridges in membrane protein structures. This is in stark contrast to Glu-Arg pair at position i→ i+1 that although as frequent in pairs as Asp-Lys and Glu-Lys at positions i→i+4 and i→i+3 respectively, only form salt bridges in one-fourth of the cases." Fig. 2 shows that each charge pair has a different prevalence depending on the order (e.g. Asp-Lys and Lys-Asp pairs). I think for this statement the sum of both prevalences should be taken into account, and as the sum is not easy discernible from Fig. 2, it would help to include a table containing the sums. Furthermore, it would be good to refer also to Fig. 3, which also contains a part of the discussed data.
      5. line 402: "c-myc tag (Glu-Gln-Lys-Leu-Ile-Ser-Glu-Glu-Asp-Leu, EQKLISEEDL) was added in Ct in hanging with de PCR primer before cloning." Please revise the sentence and I think the one letter code for the c-myc tag is sufficient (please correct this also in line 428).
      6. line 420: "A region's total ΔG is the sum of these individual scores weighted on where in the region the residue, a residue in the middle of the helix has a higher weight than residues at the ends." Please revise the sentence, the meaning is unclear.
      7. line 436: "Total protein was quantified and equal amounts of protein submitted to Endo H treatment or mock-treated, followed by SDS-PAGE analysis and transferred into a PVDF transfer membrane (ThermoFisher Scientific)." Please revise the sentence.
      8. line 498: "Topological files with sequence and membrane topology are created with the help of the RCSB secondary structure file and only membranes annotated as pure α-helices were retained." I assume that the description contains a typo (membranes annotated as pure α-helices?)
      9. line 507: typo "..., but we did not clustered the proteins" 14: line 560: "The individual value of each experiment in represented by a solid dot being represented as a green square the experimental ΔG value for the L4/A15 sequence from [2]." Please revise the sentence. 15: line 562: "The wt and simple mutants are shown in white bars." Typo: single mutants 16: line 563: "Charges at compatible distances with salt bridge formation (i→i+1; i→i+3; and i→i+4) are shown in yellow. Not compatible distances with salt bridge formation (i→i+2; and i→i+5) are shown in dark gray. Compatible distances but not compatible amino acid pair (i, i+4 DD pair) is shown in clear gray." The given colors don´t match with the figure (i→i+1 = brown; i→i+3 = orange; i→i+4 = yellow and i→i+4 DD pair = white) 17: line 597: "The different monomers are shown in transparent blue, purple and indigo." The different colors are hardly distinguishable in the figure. 18: Figure 4a: The table could be simplified. I think the column "charges" can be removed, as it contains not really charges and the names of the peptides already contain the same information. The column "Å" contains only a value for the wt (and not for the DK i,i+5 mutant) and as the distance for the wt is also given in Fig. 4g, this column can be also removed.
      10. Fig. 4f: The marker lane is hardly visible (completely dark lane)
      11. Fig. 5b: The column "Å" contains only values for the wt sequences (long and short). See also comment 18.
      12. Fig 5d: Why is in the SDS gel a mass shift between the wt and the i→i+5 mutant visible, even though the peptide mass is equal.
      13. There are several changes of font type or format changes (e.g. line 210-214). Please correct this.

      Significance

      As a structural biologist with a focus on membrane-proteins, I understand that the study is concerned on intra-helical salt bridges, but the implications of inter-helical salt bridges should also be discussed, at least in the introduction or outlook. The authors propose that their results are important for the improvement of membrane protein topology prediction methods, so for this aim it is also necessary to take any potential inter-helical salt bridges into account. In this context, it would be relevant to point point out that there even exist extended rows of salt bridges between transmembrane segments (charge-zippers), which serve an important structural element in several membrane proteins.

      The article is well written and most of the conclusions drawn from the experimental results are convincing. I agree with the authors that their results are relevant for future improvement of membrane protein topology prediction software, which so far does not take the possibility of salt bridge formation into account. Therefore, I recommend publication after clarification/revision of the abovementioned points.

    1. SciScore for 10.1101/2021.05.19.444889: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Euthanasia Agents: After 2 weeks, mice were anesthetized with sodium pentobarbital (40 mg/kg, i.p.) with no avoidance response to foot pinch.<br>IACUC: Following imaging was performed using confocal microscope (Nikon) Mouse vaccination: The mouse study was performed under the guidance of Institutional Animal Care and Use Committee (IACUC) of Shanghaitech University, China. Male BALB/c mice aging 6 – 8 weeks were used in this study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Following imaging was performed using confocal microscope (Nikon) Mouse vaccination: The mouse study was performed under the guidance of Institutional Animal Care and Use Committee (IACUC) of Shanghaitech University, China. Male BALB/c mice aging 6 – 8 weeks were used in this study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, the NC membrane was incubated for 1 hour in 5% milk PBST with a 1:1,000 dilution of mouse anti-His tag antibody (Proteintech, Cat# 66005-1-lg).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The slices were then stained using rabbit anti-GFP antibody (Proteintech, Cat# 50430-2-AP) in 0.1% Triton X-100 and 1% serum in PBS overnight at 4 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-GFP</div><div>suggested: (Proteintech Cat# 50430-2-AP, RRID:AB_11042881)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing with PBS, sections were incubated with the Alexa-488 conjugated donkey anti-rabbit antibody (Thermo Fisher Scientific, Cat# A21206) (1:1000 dilution) for 2 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (Thermo Fisher Scientific Cat# A-21206, RRID:AB_2535792)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washes with PBS, HRP-conjugated secondary antibodies (HRP conjugated goat anti-mouse IgG: Proteintech, Cat# SA00001-1; HRP conjugated goat anti-mouse IgG2a: Proteintech, Cat# SA00012-2; HRP conjugated goat anti-mouse IgG1: Proteintech, Cat# SA00012-1; HRP-conjugated goat anti-monkey IgG: Southern Biotech, Cat# 4700-05) were added and incubated for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (Proteintech Cat# SA00012-2, RRID:AB_2890965)</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG2a</div><div>suggested: (Gen-Probe Cat# 855.470.005, RRID:AB_10698621)</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG1</div><div>suggested: (Gen-Probe Cat# 855.470.005, RRID:AB_10698621)</div></div><div style="margin-bottom:8px"><div>anti-monkey IgG</div><div>suggested: (SouthernBiotech Cat# 4700-05, RRID:AB_2796069)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plasmids were transfected into HEK Expi293F cells (Thermo Fisher Scientific, Cat# A14527) using polyethylenimine (PEI) method.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK Expi293F</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudo-virus neutralization assay: To prepare SARS-CoV-2 and related mutated pseudo-viruses, HEK-293T cells were co-transfected with pcDNA3.1-SARS-CoV-2-S or related mutants and pNL4-3.luc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To test the neutralizing activity of immune sera against pseudo-virus, HEK293T cells stably transfected with hACE2 were seeded in 96-well culture plates at a density of 5,000 cells per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following imaging was performed using confocal microscope (Nikon) Mouse vaccination: The mouse study was performed under the guidance of Institutional Animal Care and Use Committee (IACUC) of Shanghaitech University, China. Male BALB/c mice aging 6 – 8 weeks were used in this study.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The coding sequences of S-trimer ECD (residues 1-1208) or RBD were cloned into pTT5 vector with a N-terminal IL-2 signal peptide and a C-terminal 6 × His tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTT5</div><div>suggested: RRID:Addgene_52326)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudo-virus neutralization assay: To prepare SARS-CoV-2 and related mutated pseudo-viruses, HEK-293T cells were co-transfected with pcDNA3.1-SARS-CoV-2-S or related mutants and pNL4-3.luc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1-SARS-CoV-2-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pNL4-3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: Antibody titers of ELISA assay, EC50 value of pseudo-virus neutralization assay were determined using non-linear regression analysis using Graphpad PRISM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad PRISM</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 10 and 21. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.16.444369: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All mouse experiments were approved by the institutional animal care and use committee (IACUC) in Clover Biopharmaceuticals and were conducted according to international guidelines for animal studies.<br>IRB: Human COVID-19 convalescent serum samples: Human convalescent sera samples from recovered COVID-19 patients (table S1) infected with the original SARS-CoV-2 strain were obtained from Public Health Clinical Center of Chengdu in Chengdu, China, under approved guidelines by the Institutional Review Board (IRB), and all patients had provided written informed consent before sera sample were collected.<br>Consent: Human COVID-19 convalescent serum samples: Human convalescent sera samples from recovered COVID-19 patients (table S1) infected with the original SARS-CoV-2 strain were obtained from Public Health Clinical Center of Chengdu in Chengdu, China, under approved guidelines by the Institutional Review Board (IRB), and all patients had provided written informed consent before sera sample were collected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animal studies, facilities and ethics statements: Specific pathogen-free (SPF) BALB/c female mice (6-8 weeks old) for immunogenicity studies were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. and kept under standard pathogen-free conditions in the animal care center at Chengdu Hi-tech Incubation Park.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">2C) of the study, animals in group 1 were randomized to receive a booster (Dose 3 on Day 35) with either 3 µg Prototype or 3 µg B.1.351 S -Trimer (half adjuvanted and half non-adjuvanted).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing 3 times with PBST, the plates were incubated with 1:5000 dilution of rabbit anti-Trimer-Tag antibody (Clover Biopharmaceuticals) at 37°C for 1 h, followed by washing 3 times with PBST and then a 1:20000 dilution of goat anti-rabbit IgG-HRP (Southern Biotech).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Trimer-Tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After transient transfection in 293F cells, the variant S-Trimer antigens were expressed and secreted at sufficient levels to enable further characterization and mouse immunogenicity studies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293F</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animal studies, facilities and ethics statements: Specific pathogen-free (SPF) BALB/c female mice (6-8 weeks old) for immunogenicity studies were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. and kept under standard pathogen-free conditions in the animal care center at Chengdu Hi-tech Incubation Park.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Data arrangement was performed by Excel and statistical analyses were performed using the Prism 8.0 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.15.444222: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animal procedures were performed under the approvals of the Institutional Animal Care and Use Committee of University of Washington, Seattle, WA.<br>Euthanasia Agents: Mice were injected intramuscularly into the gastrocnemius muscle of each hind leg using a 27-gauge needle (BD, San Diego, CA) with 50 μL per injection site (100 μL total) of immunogen under isoflurane anesthesia.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Cell lines: Expi293F cells are derived from the HEK293F cell line, a female human embryonic kidney cell line transformed and adapted to grow in suspension (Life Technologies).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Cell lines other than Expi293F were not tested for mycoplasma contamination nor authenticated.<br>Authentication: Cell lines other than Expi293F were not tested for mycoplasma contamination nor authenticated.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serial dilutions of sera were added to the plates and, after washing, antibody binding was revealed using a hydrogen peroxidase coupled horse anti-mouse IgG antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: Expi293F cells are derived from the HEK293F cell line, a female human embryonic kidney cell line transformed and adapted to grow in suspension (Life Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293F</div><div>suggested: RRID:CVCL_D615)</div></div><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The HEK-ACE2 adherent cell line was obtained through BEI Resources, NIAID, NIH: Human Embryonic Kidney Cells (HEK293T) Expressing Human Angiotensin-Converting Enzyme 2, HEK293T-hACE2 Cell Line, NR-52511.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T-ACE2 cells (BEI NR-52511) were seeded at 1.25×104 cells per well in 50 uL D10 growth media (DMEM with 10% heat-inactivated FBS, 2 mM L-glutamine, 100 U/mL penicillin, and 100 μg/mL streptomycin) in poly-L-lysine coated black-walled clear-bottom 96-well plates (Greiner 655930).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Poly-lysine was removed, plates were dried for 5 min then washed 1× with water prior to plating cells HEK-hACE2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-hACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice: Female BALB/c mice four weeks old were obtained from Jackson Laboratory, Bar Harbor, Maine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The HexaPro-foldon construct used for immunization studies was produced as previously described (24) and placed into pCMV/R with an octa-histidine tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV/R</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Melting temperatures were defined as the maximum point of the first derivative of the melting curve, with first derivatives calculated using GraphPad Prism software after smoothing with four neighboring points using 2nd order polynomial settings.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Midpoint titers calculations (EC50) were generated based on fitted four point logistic equations using the SciPy library in Python, in which the EC50 was the serum dilution at which the curve reached 50% of its maximum.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SciPy</div><div>suggested: (SciPy, RRID:SCR_008058)</div></div><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.13.444010: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Enrolled adults were healthy and provided informed consent prior to any study procedures.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">8 subjects each were randomly chosen from participants from age cohorts 18-55, 56-70, and 71+ years of age who received two doses of 100 mcg mRNA-1273.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were incubated with an anti-SARS-CoV spike primary antibody directly conjugated to biotin (CR3022-biotin) for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV spike</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CR3022-biotin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates are washed and Sulfo-tag labeled anti IgG antibody is applied to the wells and allowed to associate with complexed coated antigen – sample antibody within the assay wells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and Viruses: VeroE6 cells were obtained from ATCC (clone E6, ATCC, #CRL-1586) and cultured in complete DMEM medium consisting of 1x DMEM (VWR, #45000-304), 10% FBS, 25mM HEPES Buffer (Corning Cellgro), 2mM L-glutamine, 1mM sodium pyruvate, 1x Non-essential Amino Acids, and 1x antibiotics.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6-TMPRSS2 cells were kindly provided by Drs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viruses were propagated in Vero-TMPRSS2 cells to generate viral stocks.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudoviruses were mixed with serial dilutions of sera or antibodies and then added to monolayers of ACE2-overexpressing 293T cells (gift of Michael Farzan and Huihui Mu), in triplicate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Saponin [Sigma, 47036-250G-F] in PBS), was added to the fixed Vero cells for 20 minutes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell-surface spike binding: HEK293T cells were transiently transfected with plasmids encoding full length SARS-CoV-2 spike variants using lipofectamine 3000 (L3000-001, ThermoFisher) following manufacturer’s protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To produce SARS-CoV-2 pseudoviruses, an expression plasmid bearing codon-optimized SARS-CoV-2 full-length S plasmid was co-transfected into HEK293T/17 cells (ATCC#CRL-11268) cells with packaging plasmid pCMVDR8.2, luciferase reporter plasmid pHR′CMV-Luc (40) and a TMPRSS2 plasmid (41).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMVDR8.2 , luciferase reporter</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pHR′CMV-Luc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>TMPRSS2</div><div>suggested: RRID:Addgene_53887)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All calculations are performed within Excel and the GraphPad Prism software, version 7.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The samples were then acquired on a BD LSR Fortessa X-50 flow cytometer (BD biosciences) and analyzed using Flowjo (BD biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flowjo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. tag format e.g. #go #push

      IMHO #go == [[go]]. In that sense we should probably support all conventions that clearly demonstrate an [[intent]] to trigger an action, I'm fine adding support for these.

    1. RRID:AB_1097802126183

      DOI: 10.1016/j.celrep.2021.109151

      Resource: (Thermo Fisher Scientific Cat# 26183, RRID:AB_10978021)

      Curator: @Naa003

      SciCrunch record: RRID:AB_10978021

      Curator comments: HA Tag Monoclonal Antibody (2-2.2.14) Thermo Fisher Scientific Cat# 26183


      What is this?

    1. There’s this thing I simply call “365”. With each new year (or sometimes at the end of a notebook, when I feel like it), I make a 2-page spread mind map of things that kept me busy. It’s more or less an analog tag cloud and it’s extremely rewarding to make. You get to browse through previous journals, look at things you’ve written down and actually managed to pull of, and take note of that in one or two words. That creates a thick cloud full of the things that defined you for the last year. It’s actually quite incredible to look at. When I’m done doing that, I try to underline the words that meant more to me than others. Applying the retrospective principles from software development on your own personal life and writing down what made you glad, mad or sad actually helps you do something about that.

      This is an example of spaced repetition being done as retrospective and hiding some of the value of making the important things stand out and reviewing them for better long term retention.

    1. SciScore for 10.1101/2021.05.06.21256766: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants received oral and written information about the study and written consent was obtained.<br>IRB: All protocols performed in the study were in accordance with the ethical standards approved by the Ethical Committee of the Hospital Clínico Universitario of Valencia (Ref. 2020/133) and by the rest of the Ethical and Research’s Committees.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Participants were pregnant with intended breastfeeding and nursing women with positive PCR for SARS-CoV-2 in nasopharynge or presence of SARS-CoV-2 antibodies in serum determined in hospitals.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Those women were randomly selected from the MAMI birth cohort in Spain [15] (ClinicalTrials.gov Identifier: NCT03552939).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Women were excluded when COVID-19 symptomatology required specific treatment and/or hospitalization in intensive care units.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Breast milk SARS-CoV-2-specific antibody detection: Levels of antibodies directed to structural proteins as RBD of the SARS-CoV-2 spike protein and to non-structural viral proteins as cysteine-like protease, also known as the main protease (Mpro) or 3CLpro, were analyzed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 spike protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detection of the different antibody isotypes, anti-human IgA (α-chain-specific) HRP antibody (Thermo-Fisher Scientific; A18781; 1:6.000), anti-human IgM (μ-chain-specific) HRP antibody (Sigma-Aldrich; A0420; 1:4.000), and anti-human IgG (Fc specific) HRP antibody (Sigma-Aldrich; A0170; 1:4.000) were used and incubated for 1 h in 1 % (w/v) milk powder in PBS-T.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HRP</div><div>suggested: (Sigma-Aldrich Cat# A0420, RRID:AB_257886)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, an anti-human IgA antibody pre-adsorbed to the plate allowed to capture the IgA, which was later detected by the addition of a biotinylated detection antibody and streptavidin-conjugated horseradish peroxidase that catalyzed the colorimetric reaction with the chromogenic substrate TMB.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RBD protein was produced under HHSN272201400008C and obtained through BEI Resources, NIAID, NIH: Spike Glycoprotein RBD from SARS-CoV-2, Wuhan-Hu-1 with C-Terminal Histidine Tag, Recombinant from HEK293T Cells, NR-52946.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detection of the different antibody isotypes, anti-human IgA (α-chain-specific) HRP antibody (Thermo-Fisher Scientific; A18781; 1:6.000), anti-human IgM (μ-chain-specific) HRP antibody (Sigma-Aldrich; A0420; 1:4.000), and anti-human IgG (Fc specific) HRP antibody (Sigma-Aldrich; A0170; 1:4.000) were used and incubated for 1 h in 1 % (w/v) milk powder in PBS-T.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo-Fisher Scientific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detection of MPro-reactive antibodies, a commercial ELISA Kit (ImmunoStep, Salamanca, Spain) was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImmunoStep</div><div>suggested: (IMMUNOSTEP, S.L., RRID:SCR_013411)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Endpoint titers were calculated from log-transformed titration curves using 4-parameter non-linear regression function in GraphPad Prism 8.0 and the positive cut-off values obtained from the prepandemic control group for each antigen and isotype.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Regarding the potential limitations, we did not collect skin swabs to control for the potential presence of SARS-CoV-2 in the skin [7,33]. However, all milk samples as well as the infants were negative for SARS-CoV-2 presence. Thus, although there are still limited data, it is accepted that breastfeeding does not represent a vehicle for vertical transmission of SARS-CoV-2 [9]. There are still many open questions: when are SARS-CoV-2 antibodies produced after maternal infection, when can they be detected in breast milk, and how long do they persist. To cover some of these questions, we aimed to determine the presence of antibodies in breast milk samples from COVID-19 women and to compare these with milk samples collected prior to the pandemic as reference controls. While different studies have reported presence of specific IgA antibodies against SARS-CoV-2 [7,12,13,36], limited information is available on IgG and IgM. Our results showed presence of anti-SARS-CoV-2 antibodies in milk, primarily IgA but also IgG and IgM targeting RBD. Furthermore, IgA- and IgG against non-structural MPro were analyzed for the first time in human milk samples. High intra- and inter-individual variability was observed in antibody presence and significant differences were observed for all three antibody classes when compared to prepandemic samples in agreement with previous data [26]. In our dataset we found that 82·9 % of the milk samples tested positive for the RBD antigen at least in one of the ...

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04768244</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Impact of Maternal COVID-19 Disease on Breast Milk and Infan…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT03552939</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">The Impact of Maternal Microbes on Infant Health Programming</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. The Go visibility rules for struct fields are amended for JSON when deciding which field to marshal or unmarshal. If there are multiple fields at the same level, and that level is the least nested (and would therefore be the nesting level selected by the usual Go rules), the following extra rules apply: 1) Of those fields, if any are JSON-tagged, only tagged fields are considered, even if there are multiple untagged fields that would otherwise conflict. 2) If there is exactly one field (tagged or not according to the first rule), that is selected. 3) Otherwise there are multiple fields, and all are ignored; no error occurs.

      这段主要解释嵌套匿名结构在 marshal or unmarshal 时,field key 的冲突情况。我把 untagged 域 json 化的 key 称为 field key,tagged 域 json 化的 key 称为 tag key。

      注意:这里讲的 tagged 域是指设置了 key name 的 tag,没有设置 key name 的 tagged 域在 json 化中使用的还是 filed key。

      本段涉及的域处在同一层级,且该层级至少是一层嵌套层。

      # 至少是这样的嵌套
      type A struct {
          Name string
      }
      
      type B struct {
          Name string
      }
      
      type C struct {
          Name string
      }
      
      type D struct {
          A
          B
          C
      }
      
      func TestFeature(t *testing.T) {
          d := D{A{"A"}, B{"B"}, C{"C"}}
          r, _ := json.Marshal(d)
          fmt.Println(string(r))
      }
      

      以上 D struct 的 instance 有多个相同名称的域 Name。在对其做 marshal or unmarshal 时应用以下规则:

      1、json tagged 的域优先于 untagged 的域考虑。

      # 如果 A 的域被 `json:"Name"`,则 B C 里的 Name 域都被忽略。
      {"Name":"A"}
      

      2、如果 tagged 域的 tag key 唯一,则被正常 marshal or unmarshal,否则冲突的 tagged 域都被忽略。如果 untagged 域的 field key 唯一,则被正常 marshal or unmarshal,否则冲突的 untagged 域都被忽略。

      # 如果 A 和 B 的 Name 域都被 `json:"Name"`,则视为  tag key 冲突,所以两者都被忽略。并且 C 的 Name 域为 untagged,所以 C instance 在这场“Name 域 json 化争夺战”中完全处于下风。最终这场战斗没有人胜出。
      # {}
      
      # 如果 A 的 Name 域被 `json:"Nickname"`,则剩下 B C 两个 untagged 域争夺,根据规则,最终没有在 json string 中见到 Name key。
      # {"Nickname":"A"}
      
    2. Anonymous struct fields

      首先要明白什么是 anonymous struct field,看这里。

      看过上面文章,应该对 anonymous struct field 及其规则有大致的了解。

      在对 anonymous struct field 做 json encoding 时,anonymous struct field 中的 exported field 默认会被当做 outer struct 的 field 来 encoding。

      如果对匿名结构域使用 json tag 功能给予 key name,则在 encoding 时不会被当作匿名结构域应用上述规则。

      如果匿名结构域是 interface{} 类型,则也不会被当作匿名结构域应用上述规则,interface{} 的名称会被当作 key name。

      举例:

      type Kitchen struct {
          NumOfPlates uint
      }
      
      type Door interface {
          echo()
      }
      
      type FrontDoor struct {
          Name string
      }
      
      func (frontDoor *FrontDoor) echo() {
          fmt.Println("I'm " + frontDoor.Name)
      }
      
      type House struct {
          Kitchen    `json:"kitchen"`
          NumOfRooms uint
          Door
      }
      
      func main() {
      
          h := House{Kitchen{10}, 3, &FrontDoor{"Gold Door"}}
      
          sp, _ := json.Marshal(h)
          fmt.Println(string(sp))
      }
      # {"kitchen":{"NumOfPlates":10},"NumOfRooms":3,"Door":{"Name":"Gold Door"}}
      # 正常被当作匿名结构域 encoding json 时:
      # {"NumOfPlates":10,"NumOfRooms":3}
      
    3. The encoding of each struct field can be customized by the format string stored under the "json" key in the struct field's tag.

      struct field 的 json encoding 行为可以通过 json tag 自定义,格式为:json:"keyName,option1,..."

      以下是一些使用情况介绍:

      1、即想使用 json tag 定义行为又要使用 struct field name 来作为 json key:json:",option1,..."

      2、使用 omitempty 选项可以忽略该 field 的 json encoding,如果该 field 的值是空值的话。

      3、使用 json:"-" 的 field 在 encoding 时被忽略。如果想要使用 "-" 做为 json key,那么在 "-" 后加上一个 comma 即可:json:"-,"

      4、如果你想要一些非 string 的类型被 encoding 为 json string,使用 json:",string" 标签选项即可。

      type Person struct {
          Age uint `json:",string"`
      }
      
      func main() {
          p := Person{
              23,
          }
          sp, _ := json.Marshal(p)
          fmt.Println(string(sp))
      }
      # {"Age":"23"}
      
    4. key name

      这里的 key name 不知道指什么,如果指的是 json tag 里给的 key name,那么在上面已经介绍过了,这里难道只再提一下作为 key name 的规则吗?

    1. SciScore for 10.1101/2021.05.12.443228: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics statement: All mice involved in the experiments were approved by the Biomedical Research Ethics Committee of the Institute of Biophysics of the Chinese Academy of Sciences and were performed in compliance with the Guidelines for the Care and Use of Laboratory Animals of the Institute of Biophysics.<br>IACUC: Non-human primates, Rhesus macaques immunogenicity studies were performed in the animal facility of Guangxi Fangchenggang Biotechnology Development Co., Ltd. (GFBDCL), according to the guidelines of the Committee on Animals of GFBDCL (approval No.: SYXK2018-0004/200005).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animals: Female (6-8-week-old) BALB/c mice and C57BL/6J mice were obtained from Vital River (Beijing) and bred under specific pathogen-free (SPF) conditions in the animal facility of the Institute of Biophysics and the Institute of Microbiology, Chinese Academy of Science.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Immunogenicity of I-P-R-F in rhesus macaques: To evaluate the immunogenicity of I-P-R-F in non-human primates, a total of 10 rhesus macaques (5 male and 5 female, weighing 3∼5 kg) purchased from Guangxi Fangchenggang Biotechnology Development Co., Ltd. were randomly assigned into four groups with one male and one female in each group and intramuscularly immunized with high does(50 μg) or low dose(10 μg) of I-P-R-F with or without alum as adjuvant two times at a 14-day interval.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ploy-histidine tagged hACE2, rabbit anti-SARS-CoV-2 nucleocapsid, and HRP-conjugated goat anti-rabbit IgG (H+L) antibody antibodies were purchased from Sino Biological lnc. (Beijing, China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 nucleocapsid,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were then washed with PBST (PBS containing 0.05% Tween 20) and incubated with goat anti-mouse IgG-HRP (1:5000, Cwbiotech) or goat anti-monkey IgG-HRP (1:10000, Invitrogen) at 37°C for 30 minutes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2×106 cells were blocked with anti-CD16/32 (anti-FcγIII/II receptor, clone 2.4G2) and stained with specific fluorescence-labeled antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD16/32 (anti-FcγIII/II receptor,</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blood was collected at indicated time points, and the SARS-CoV-2 specific IgG and neutralization antibody titers in serum were determined.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 specific IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, human immunodeficiency virus backbones expressing firefly luciferase (pNL43R-E-luciferase) and pcDNA3.1 (Invitrogen) expression vectors encoding the SARS-VoV-2 S protein were co-transfected into 293T cells (ATCC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus was stock and amplified in Vero-E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 RBD protein (rRBD) was also expressed in 293F cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293F</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The anti-viral activity of IFNα: The IFNα bioactivity was determined by the anti-viral infection assay using the L929 fibroblast cell line sensitive to VSV infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>L929</div><div>suggested: ECACC Cat# 86032004, RRID:CVCL_4238)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To evaluate the neutralization of vaccinated mice serum, 293-hACE2 cells were seeded into 96-well plates (2×104 per well) and 3-fold serially diluted heat-inactivated serum samples were incubated with 100 TCID50 of pseudovirus for 1 hour at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mixture was incubated for 1 hour at 37°C and then transferred to the 96-well plates seeded with Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animals: Female (6-8-week-old) BALB/c mice and C57BL/6J mice were obtained from Vital River (Beijing) and bred under specific pathogen-free (SPF) conditions in the animal facility of the Institute of Biophysics and the Institute of Microbiology, Chinese Academy of Science.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: RRID:IMSR_JAX:000664)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Female (6-8-week-old) BALB/c or C57BL/6 mice were immunized intramuscularly or subcutaneously with different immunogens in 100μL using insulin syringes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, human immunodeficiency virus backbones expressing firefly luciferase (pNL43R-E-luciferase) and pcDNA3.1 (Invitrogen) expression vectors encoding the SARS-VoV-2 S protein were co-transfected into 293T cells (ATCC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL43R-E-luciferase</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, the coding sequence for RBD with a 6 x his tag on C terminus was cloned into the pEE12.4 vector without a human IgG1 Fc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pEE12.4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, the pseudovirus was produced by co-transfection of the plasmid expressing firefly luciferase (pNL43R-E-luciferase) and pcDNA3.1 expressing the SARS-CoV-2 spike protein into 293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The coding sequence for SARS-CoV-2 RBD spanning S protein 319-541 (GenBank: YP_009724390) was codon-optimized for mammalian cells and synthesized by GENEWIZ, China.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GENEWIZ</div><div>suggested: (GENEWIZ, RRID:SCR_003177)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The fluorescence imaging data were analyzed by Living Image software (PerkinElmer).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Living Image</div><div>suggested: (Living Image software, RRID:SCR_014247)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All the samples were acquired by BD LSRFortessa flow cytometer (BD Bioscience), and the data were analyzed with Flowjo software (TreeStar).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Bioscience</div><div>suggested: (BD Biosciences, RRID:SCR_013311)</div></div><div style="margin-bottom:8px"><div>Flowjo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantification and statistical analysis: All statistical analyses were performed using Graphpad Prism 8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 33, 37 and 38. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.08.21256891: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression and purification of M-MLV and BstLF: The M-MLV gene was synthesized as a Gblock from IDT and cloned into at pET-19b vector with N-terminal 10x His-tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-19b</div><div>suggested: RRID:Addgene_153312)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BstLF DNA sequence from the OpenEnzyme collection was cloned into pET15b with a 6x His-tag at its N-terminus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET15b</div><div>suggested: RRID:Addgene_129689)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Both DNAs can be obtained from the Open Bioeconomy Lab and/or FreeGenes collection32.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FreeGenes</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A potential limitation of our proof of concept method is that the use of intercalating dyes can make target-specific real-time detection challenging44, and could pose as a barrier for use in resource limited areas. Future lower resource implementations of our method could substitute EvaGreen for 100-200 µM halochromic dyes, like Cresol Red, in pH 8.8 buffered reaction mix to cause detectable colorimetric change when amplification products have been produced47. Alternatively more advanced detection methods utilizing sequence specific methods based on the use of probes (e.g. LAMP-BEAC23, OSD48, DARQ49 and QUASR50) could also be utilized as end-point detection methods, and remain to be tested in future work. Such methods would be advantageous as they could be multiplexed for different targets in the same