On 2013 Nov 01, Stephen Turner commented:

Aligning RNA-seq data is challenging because reads can overlap splice junctions. Many other RNA-seq alignment algorithms (e.g. Tophat) are built on top of DNA sequence aligners. STAR (Spliced Transcripts Alignment to a Reference) is a standalone RNA-seq alignment algorithm that uses uncompressed suffix arrays and a mapping algorithm similar to those used in large-scale genome alignment tools to align RNA-seq reads to a genomic reference. STAR is over 50 times faster than any other previously published RNA-seq aligner, and outperforms other aligners in both sensitivity and specificity using both simulated and real (replicated) RNA-seq data. The notable increase in speed comes at the price of a larger memory requirement. STAR requires ~27GB RAM to align reads to a human genome - a moderate amount, but not atypical on most modern servers. STAR aligns ~45 million paired reads per hour per processor. Notably, the STAR algorithm is also capable of handling longer reads such as those from PacBio SMRT and forthcoming nanopore technologies. STAR is free and open source software.

On 2014 Mar 12, George W Hinkal commented:

None

On 2014 Feb 27, George W Hinkal commented:

The National Cancer Institute has been investing in the development of an online webportal of curated cancer nanotechnology data called caNanoLab. The numerical data, nanomaterial characterizations and composition information for the ten nanoparticles related to this publication have been added to the database and can be found at:

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=36601880&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=36601881&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=36601882&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=36601883&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=36601884&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=36601885&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=36601886&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=36601887&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=40566784&page=0&tab=ALL

https://cananolab.nci.nih.gov/caNanoLab/characterization.do?dispatch=summaryView&sampleId=40566786&page=0&tab=ALL

The left navigation links on these pages provide information about each sample (under Navigation Tree).

For general information on how to use caNanoLab, please visit https://cananolab.nci.nih.gov/caNanoLab/home.jsp

On 2016 Dec 22, Peter Good commented:

New insights into studying fever’s dramatic benefit were recently published online at Clinical Nutrition ESPEN: "Simplifying study of fever’s dramatic relief of autistic behavior". Instead of studying only how fever helps, it recommends studying how autistic behavior returns soon after fever. All the complex mechanisms that generated fever have abated or reversed; simpler cooling mechanisms prevail. How many plausible explanations can there be?

It also recommends studying improvements appearing hours before fever’s onset, and improvements persisting days after fever subsides – when stress and heat of brain imaging will be minimal. A scan as autistic behavior returns will be more stressful – but most revealing. Studying fever’s benefit in phases also invites triangulation of decisive factors in relief and recurrence. The full-text PDF can be downloaded at <www.autismstudies.net>

On 2015 Oct 07, Peter Good commented:

Report of a ‘single case clinical trial’ of citrulline for ASD. Glutamine is immediate precursor of citrulline, a (usually) nonprotein amino acid like taurine. Citrulline is immediate precursor of arginine, a protein amino acid most critical as substrate for nitric oxide, primary vasodilator in the brain and body.

After learning that most ingested arginine is taken up by the liver, whereas citrulline bypasses the liver and forms arginine in the kidneys, increasing systemic arginine [Romero MJ, 2006] I replaced 2g/day of arginine I’d been taking for a year with 2–4g/day of citrulline in two doses – before breakfast (fasted state) and several hours after breakfast or lunch (between meals). After five months of 2–4g/day of citrulline (plus 2–4g of taurine), I’ve concluded:

Considerable evidence argues the brain hemispheres of autistic children are chronically isolated and atypically asymmetric in anatomy, function, neurochemistry, and blood flow. Low brain blood flow in hyperexcitable children is especially anomalous – suggesting failure of neurovascular coupling from lack of nitric oxide, the primary vasodilator, or its substrate arginine. Is too much arginine taken up by the liver to detoxify ammonia? One test is oral citrulline, which bypasses the liver and forms arginine in the kidneys, increasing systemic arginine. Replacing 2g/day of oral arginine with 2–4g/day oral citrulline (+ 2–4g taurine) evoked spontaneous speech, calmed anxiety, and enhanced focus and planning – left hemisphere attributes. Evidence that glutathione sustains release of nitric oxide prompted addition of undenatured whey protein for glutathione precursors. Evidence that glutathione also matures myelin argues glutathione depletion is a key mechanism in autism – keeping myelin immature, brain hemispheres isolated, and brain blood flow low. Is autism reversible?

Was my trial of citrulline too subjective? My best evidence is spontaneous speech. I rarely notice right away I’m reading or thinking aloud; in other words, I hear myself speaking, I didn’t intend to. Who is speaking?

My citrulline trial was recently mentioned at Cortical Chauvinism http://corticalchauvinism.com/2015/10/04/peter-good-a-single-case-clinical-trial-with-citrulline/ with a link to a more comprehensive explanation of citrulline’s potential as a remedy for autistic disorders (and the need for glutathione) Chronic neurochemical asymmetry and dysconnection in autism. Implications of a personal trial of citrulline + taurine at: http://www.autismstudies.net

Peter Good Autism Studies La Pine, OR autismstudies1@gmail.com

On 2015 Jun 21, Peter Good commented:

At the 7th International Meeting for Autism Research (IMFAR) pediatric neurologist Andrew Zimmerman and colleagues presented parents’ reports of dramatic improvements of their child’s autistic behavior during fever [1]. These reports were spontaneous responses to their study published the previous year (2007) confirming fever’s benefit in 30 children with autism spectrum disorders (ASD) [Curran LK, 2007]. A few parents reported improvements in a sauna, steam room, or hot tub/bath – rare events. A single sentence on their IMFAR poster lay dormant: “Improvements were reported both during and prior to the onset of fever.” The first formal report of improvements of autistic behavior before fever – a critical clue to the phenomenon.

Zimmerman summarized parents’ anecdotal reports of improvements before fever [3]: “My impression has been that those children who improve before the appearance of fever are those who also have the most striking improvements overall during fever (and are more likely to have enduring effects after fever subsides), possibly 10% of those who have the ‘fever effect’. The ‘fever effect’ may be more common than we realize because there are different gradations of the responses. Also, the improvements in social relatedness and language may then be obscured by sickness behavior during the illness and are subject to a ‘threshold effect’ (i.e. caregiver recognition).” Zimmerman suggested a low grade fever might explain early benefits. “It is usually a period of hours [up to 6–8] when benefits are seen before fever is recognized. . . . Unfortunately we do not have clinical data to support these observations.”

Parents and practitioners have known for decades that fever often relieves a child’s autistic behavior dramatically, and rarely aggravates. It’s also known that improvements in some children persist days after fever breaks, although improvements in most children subside when fever does. Is there a temperature-independent mechanism and a temperature-dependent one? The temperature-dependent mechanism may simply be fever increasing brain metabolism and blood flow – consistently low in these children. The temperature-independent mechanism may be release of free glutamine from skeletal muscles for anabolic responses to infection.

Why would glutamine relieve autistic behavior? Glutamine is precursor (via citrulline) of arginine – required to detoxify ammonia to urea in the liver, synthesize the ATP-transporter creatine, and only substrate for the vasodilator nitric oxide. Ammonia is often high in these children from intestinal bacteria and yeast, yet plasma glutamine is consistently low and brain glutamine often low. Arginine required to detoxify ammonia may deplete arginine as substrate for brain nitric oxide and creatine. Most dietary arginine is taken up by the liver. Because citrulline bypasses the liver and becomes arginine in the kidneys, oral citrulline may be a better source of arginine for brain nitric oxide and creatine than arginine itself.

For further evidence and citations, see A critical clue to fever’s dramatic relief of autistic behavior at www.autismstudies.net.

1. Zimmerman AW, Connors SW, Curran LK. Fever in autism spectrum disorders (ASDs): spontaneous reports. Poster presented at the 7th International Meeting for Autism Research (IMFAR) London 2008 https://imfar.confex.com/imfar/2008/webprogram/Paper2529.html

2. Curran LK, Newschaffer CJ, Lee LC, Crawford SO, Johnston MV, Zimmerman AW. Behaviors associated with fever in children with autism spectrum disorders. Pediatrics 2007;120:e1386–e1392.

3. Zimmerman A (MD). Personal communication 2014.

On 2015 Dec 22, Christopher Southan commented:

GtoPdb is most recently described in the 2016 NAR Database issue http://www.ncbi.nlm.nih.gov/pubmed/26464438

On 2014 Nov 19, Helen E Benson commented:

All content from IUPHAR-DB is now available via the IUPHAR/BPS Guide to Pharmacology (GtoPdb). Our original database now redirects to the new site.

On 2014 Jan 29, Amanda Capes-Davis commented:

KB cells are widely used as a model for multidrug resistance. However, users need to be aware that these cells are NOT oral squamous cell carcinoma. The KB cell line is known to be cross-contaminated with HeLa. For a list of known cross-contaminated or misidentified cell lines, see http://iclac.org/databases/cross-contaminations/.

On 2014 Dec 10, Kath Wright commented:

Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home

On 2014 Nov 26, Matthew Katz commented:

The EORTC and SWOG trials demonstrate that radiation can improve biochemical and disease control after prostatectomy. However, it's still unclear whether it's best to wait for early 'salvage' therapy in proven PSA recurrence or to act immediately after surgery.

Future studies will be helpful for risk stratification and better patient selection. But given the low morbidity of radiotherapy after surgery, it's worthwhile discussing the pros/cons of postoperative radiation in the adjuvant setting or if the PSA begins to rise in the future.

On 2015 Aug 29, Rafael Najmanovich commented:

Beyond the fact that homeopathy to be true would invalidate most of what we know of physics and chemistry it begs an answer to the issue below that Tim Minchin sings:

"It's a miracle! Take physics and bin it! Water has memory! And while it's memory of a long lost drop of onion juice is Infinite It somehow forgets all the poo it's had in it!"

On 2015 Mar 09, Dana Ullman commented:

Jim Woodgett's comment is very typical of skeptics of homeopathy. First, homeopaths do not manufacturer their own homeopathic drugs, just as conventional physicians are not "drug manufacturers."

The researchers at India's Institute of Technology (IIT)(none of which were homeopaths) used standard homeopathic manufacturing methods to make the six different medicines, and using three different types of spectroscopy, the researchers found nanoparticles of each of the original medicines in the final solutions, despite dilutions of 1:100 six times, 30 times, and 200 times (with the typical 40 vigorous succussions/shakings of the solutions in-between each dilution).

Woodgett and his ilk are very humorous in suggesting that homeopathic medicines are "contaminated" with the precise "medicine" that was placed in the original water solution and that is listed on the label of the drug.

It is helpful when skeptics of homeopathy expose their ignorance of the subject in which they vigorously attack, and it is additionally typical that they maintain a deep arrogance despite their ignorance (this is a poor combination of characteristics for those of us who are truly interested in maintaining a good and healthy scientific attitude). What is worse is that Woodgett and his ilk are trying to defend "science" but are not modeling a good scientific aptitude themselves.

On 2015 Mar 09, Jim Woodgett commented:

It is quite bewildering that this hypothesis and study was ever published. It basically suggests that homeopaths, in preparing dilutions, do an incredibly lousy job of this simple task. The inherent flaws include:

1. There is no evidence that general homeopaths adhere to the very strict and unusual procedural limitations of pipetting at the meniscus as required here or allow sufficient time for the "nanoparticles" to "levitate" to that fraction for each of the 200 times the 100 fold dilutions are made.

2. The "levitation" process must be equivalent for all homeopathic ingredients (i.e. they must have the same physico-chemical properties regardless of composition).

3. There is clearly no means to reliably predict the effect of 200 serial dilutions if the dilution factor is variable.

4. This could be devastating if there was indeed a single virus particle in the final potion (e.g. Ebola). In essence, such a preparation would be an infectious agent.

5. Why do homeopaths claim that higher dilutions are stronger than lower dilutions?

The American Chemical Society is truly embarrassing itself in publishing such a terrible study, which is being referred to by practitioning homeopaths to support their beliefs: https://twitter.com/HomeopathicDana/status/574934072511746049

On 2014 Nov 25, Harri Hemila commented:

Novotny JA, 2012 studied vitamin E kinetics and proposed that the requirement for vitamin E may be lower than previously assumed. However, the study was restricted to just 12 healthy participants who were on average 27 years old. It is not obvious that the metabolism of vitamin E remains constant over the life span, and over various lifestyle and health conditions. Furthermore, the study of concentrations and half-lives teaches us little if anything about the relationship between doses and clinical effects.

In clinical outcomes, the effects of vitamin E depend on age and lifestyle conditions. In the large-scale ATBC Study with 29,133 participants, the effects of 50 mg/day vitamin E on common cold incidence diverged at about 65 years Hemilä H, 2006, DOI. Vitamin E had no effect on younger people, but depending on the smoking level and residential neighborhood, it decreased or increased the incidence of colds in the older participants. Furthermore, vitamin E decreased pneumonia risk by 69% in men who had the least exposure to smoking and exercised during their leisure time, but increased pneumonia risk by 79% in those who had the highest exposure to smoking and did not exercise, whereas vitamin E did not differ from the placebo in the remaining participants Hemilä H, 2011, DOI. Apart from smoking and exercise, the effect of vitamin E on pneumonia risk was also modified by weight and dietary vitamin C intake Hemilä H, 2008, DOI. Finally, among the ATBC Study participants with a dietary vitamin C intake above the median, vitamin E increased mortality by 19% in those aged 50–62 years, whereas it decreased mortality by 41% in those aged 66–69 years Hemilä H, 2009, DOI. For each of these three clinical outcomes very strong statistical evidence showed that the effect of vitamin E supplementation was heterogeneous over the ATBC Study participants.

Median dietary vitamin E intake in the ATBC Study, Anonymous, 1994 was 10 mg/day. Although the abovementioned analyses indicate that some subpopulations benefit from vitamin E in doses higher than the median intake, the ATBC Study does not teach us about dose dependency in those subpopulations. Similarly, there were harmful effects in other subpopulations, but here too we do not know at which dose levels the harm started to appear since only one level of vitamin E supplementation was used.

Nevertheless, the substantial heterogeneity in the effects of the constant dose vitamin E supplementation on the clinical outcomes indicates that its metabolism probably varies by the same factors that modify its effects on clinical outcomes. Therefore, Novotny et al.s kinetic findings with 12 young adults should not be extrapolated to the whole adult population, over all ages and over all diverse lifestyle conditions.

Novotny et al. assume that a vitamin E plasma concentration of 12 μmol/L is ideal, and they estimate that a dietary intake of 4 mg/day may be sufficient to maintain such a plasma concentration in all adults. However, Novotny et al. do not present any evidence that 12 μmol/L is the ideal level for clinically relevant outcomes. As described above, the ATBC Study indicates that some subpopulations may benefit from additional vitamin E even though their median dietary intake was 10 mg/day. Therefore, 4 mg/day is insufficient for them if the abovementioned clinical outcomes are used as the basis for evaluating the best doses of vitamin E. Although the ATBC Study analyses do not teach us what the ideal doses of vitamin E are, they indicate that there cannot be a single best dose for all adults. Thus, the significant heterogeneity in the effects of vitamin E on clinical outcomes indicates that estimating a single recommended dose for all adult people may be ill advised.

On 2016 Jan 31, Hamid Salehiniya commented:

Dear Dr Khosravi

Telemedicine is an important issue in all the world, especially in developing country, so we need more research and information on this field(Barriers to telemedicine).

On 2013 Oct 31, John Cannell commented:

The authors reported that immune system dysregulation is common in autism spectrum disorder (ASD”. Vitamin D deficiency produces very similar immune dysregulation.

Prietl B, 2013

Kamen DL, 2010

Yang CY, 2013

Baeke F, 2010

Thus the vitamin D theory of ASD (vitamin D deficiency being the environmental risk factor for this highly heritable disorder) is consistent with the authors work. Three recent studies, using community controls, have found 25(OH)D levels are significantly lower in children with ASD. Two of the studies below (Mostafa et al and Gong et al) also found ASD severity, as rated on standard ASD rating scales, is inversely correlated with 25(OH)D levels. Mostafa et al found an R value of -.86 for the association of serum 25(OH)D with ASD severity.

Gong ZL, Luo CM, Wang L, Shen L, Wei F, Tong RJ, Liu Y. Serum 25-hydroxyvitamin D levels in Chinese children with autism spectrum disorders. Neuroreport. 2013 Oct 1. Gong ZL, 2014

Meguid NA, Hashish AF, Anwar M, Sidhom G. Reduced serum levels of 25-hydroxy and 1,25-dihydroxy vitamin D in Egyptian children with autism. J Altern Complement Med. 2010 Jun;16(6):641-5. Meguid NA, 2010

Mostafa GA, Al-Ayadhi LY.Reduced serum concentrations of 25-hydroxy vitamin D in children with autism: relation to autoimmunity. J Neuroinflammation. 2012 Aug 17;9:201. Mostafa GA, 2012

There is a plethora of basic science explaining why low gestational or early childhood 25(OH)D levels would adversely effect brain development.

Eyles DW, Feron F, Cui X, Kesby JP, Harms LH, Ko P, McGrath JJ, Burne TH. Developmental vitamin D deficiency causes abnormal brain development. Psychoneuroendocrinology. 2009 Dec;34 Suppl 1:S247-57. doi: 10.1016/j.psyneuen.2009.04.015. Epub . Review. Eyles DW, 2009

DeLuca GC, Kimball SM, Kolasinski J, Ramagopalan SV, Ebers GC. Review: the role of vitamin D in nervous system health and disease. Neuropathol Appl Neurobiol. 2013 Aug;39(5):458-84. doi: 10.1111/nan.12020. DeLuca GC, 2013

Eyles DW, Burne TH, McGrath JJ. Vitamin D, effects on brain development, adult brain function and the links between low levels of vitamin D and neuropsychiatric disease. Front Neuroendocrinol. 2013 Jan;34(1):47-64. doi: 10.1016/j.yfrne.2012.07.001. Epub 2012 Jul 11. Review. Eyles DW, 2013

Furthermore, the vitamin D theory of autism explains most of the epidemiological facts of ASD.

Cannell JJ. On the aetiology of autism. Acta Paediatr. 2010 Aug;99(8):1128-30. Cannell JJ, 2010

Cannell JJ. Autism and vitamin D. Med Hypotheses. 2008;70(4):750-9. Cannell JJ, 2008

70% of American toddlers do not take the American Pediatric Association's recommended vitamin D supplement of 400 IU/day and few toddlers or pregnant women get any sunshine due to the sun scare. As vitamin D fortified milk consumption and sun exposure has declined, so have toddlers and pregnant women’s vitamin D levels. The dramatic increase in the incidence of ASD occurred during the same time vitamin D levels were falling in toddlers and pregnant women.

Cannell JJ. Autism, will vitamin D treat core symptoms? Medical Hypotheses. 2013 Aug;81(2):195-8. Cannell JJ, 2013

Some autism researchers seem cognizant of the entire body of autism research. For example, a group of well-known European ASD researchers, including Professor Christopher Gillberg of the Gillberg Neuropsychiatric Institute, have recently called for the need for “urgent research” into the vitamin D deficiency theory of ASD.

Kočovská E, Fernell E, Billstedt E, Minnis H, Gillberg C. Vitamin D and autism: clinical review. Res Dev Disabil. 2012 Sep-Oct;33(5):1541-50. doi: 10.1016/j.ridd.2012.02.015. Epub 2012 Apr 21.Kočovská E, 2012

Until all autism researchers become cognizant of the wider body of scientific research, we will continue to wonder how to prevent - and perhaps even treat - this modern day plague.

John J Cannell, MD

Vitamin D Council

http://www.vitamindcouncil.org

On 2016 Mar 22, Christopher Grefen commented:

rBiFC vector maps and sequences can be downloaded from my webpage.

I have prepared this little "How-to guide" for primer design of 2in1 Entry vectors; it can be accessed here.

For any other questions or vector requests, feel free to contact me via email: christopher.grefen@uni-tuebingen.de

On 2016 Mar 18, ZHONGMING ZHAO commented:

My lab recently moved to the University of Texas Health Science Center at Houston. The web site for this database is now available at https://bioinfo.uth.edu/TSGene1.0/.

On 2013 Jul 01, Dita Gratzinger commented:

This important study evaluates the performance characteristics of morphologic classification of myelodysplastic syndromes (MDS) according to the currently-used World Health Organization (WHO) 2008 criteria. Importantly, while moderate agreement was observed overall, significant areas of poor concordance included erythroid dysplasia and percentage of circulating blasts. The latter is particularly important given the impact of small changes in peripheral blood blast percentage on MDS category as per WHO 2008 criteria: a hypothetical patient with 3% bone marrow blasts and multilineage dysplasia would be classified as refractory cytopenia with multilineage dysplasia if she had 0.5% circulating blasts, myelodysplastic syndrome-unclassified if she had 1% circulating blasts, and refractory anemia with excess blasts-1 if she had 1.5% circulating blasts. It is possible that a 500 cell, rather than 200 cell, differential count would be helpful in increasing concordance in instances where circulating blasts are present, although even a low rate of miscalls could still result in discordance when such small changes in percentage result in reclassification.

On 2013 Oct 29, Tom Kindlon commented:

Pacing is another therapeutic option available for chronic fatigue syndrome

In this article, the authors state that there is substantial evidence for two treatments for chronic fatigue syndrome (CFS): cognitive behaviour therapy (CBT) and graded exercise therapy (GET). However, the findings rely largely on a limited number of subjective measures: this is significant given trials of these therapies are effectively non-blinded and thus changes may be due to non-specific factors such as therapist attention and other reporting biases.

For example, the review highlighted the positive results for CBT and GET reported in a large randomized controlled trial (RCT).¹ However, on the only objective measure reported in that paper, the six minute walking test, there was no significant difference between the CBT group and controls. The participants who completed GET did improve somewhat (35 m more than controls); however 379 m remains a very poor result given age- and gender-matched population norms predict around 640 m.² By comparison, a review reported an average distance of 393 m for 1083 patients with various cardiopulmonary disorders.³

Comparable results were found in a review of three RCTs of CBT interventions aimed at increasing activity. While participants recorded lower fatigue scores compared to controls, no difference emerged when activity was objectively assessed.⁴ Apart from some people simply deteriorating, two other explanations are possible for these somewhat paradoxical results. Participants may not have consistently performed the scheduled activities and exercises in the protocol. Alternatively, participants may be reprioritizing their activities, substituting those in the protocol for other activities in their daily lives.² Compliance has generally not been recorded in trials but both explanations are plausible given that post-exertional exacerbation of symptoms is a core feature of CFS.

More concerning, various patient surveys have noted high percentages reporting becoming worse following CBT (mean: 20%, n=1805) and GET (mean: 51%, n=4338).² By comparison, only 2.6% (n=5894) reported such an adverse effect with pacing. The sample size indicates that many people with CFS have utilised pacing. Patient preference is increasingly recognised as important in clinical practice and pacing offers an alternative to CBT and GET that, among other things, is potentially safer.^2,5

Pacing can be symptom or time-contingent, or a combination of both.⁶ The aim is simply to remain as active as possible while avoiding over-exertion. This contrasts with CBT and GET where patients are encouraged to tolerate post-exertional exacerbations. Although not as widely tested as CBT and GET, there is some evidence from RCTs for pacing’s efficacy.⁶

References:

1 White PD, Goldsmith KA, Johnson AL, et al.; PACE trial management group. Comparison of adaptive pacing therapy, cognitive behaviour therapy, graded exercise therapy, and specialist medical care for chronic fatigue syndrome (PACE): a randomised trial. Lancet. 2011;377(9768):823-836.

2 Kindlon T. Reporting of Harms Associated with Graded Exercise Therapy and Cognitive Behavioural Therapy in Myalgic Encephalomyelitis/Chronic Fatigue Syndrome. Bulletin of IACFS/ME. 2011;19(2):59-111. http://iacfsme.org/BULLETINFALL2011/Fall2011KindlonHarmsPaperABSTRACT/tabid/501/Default.aspx (Last accessed: November 11, 2012)

3 Ross RM, Murthy JN, Wollak ID, Jackson AS. The six minute walk test accurately estimates mean peak oxygen uptake. BMC Pulm Med. 2010 May 26;10:31.

4 Wiborg JF, Knoop H, Stulemeijer M, Prins JB, Bleijenberg G. How does cognitive behaviour therapy reduce fatigue in patients with chronic fatigue syndrome? The role of physical activity. Psychol Med. 2010;40(8):1281-7.

5 Mulley AG, Trimble C, Elwyn G. Stop the silent misdiagnosis: patients’ preferences matter. BMJ. 2012;345:e6572

6 Goudsmit EM, Nijs

On 2013 Jun 18, Jonathan Dugan commented:

This work describes ongoing efforts that are closely related to current efforts here at PLOS Labs looking at open, structured methods and tools to evaluate published works by peers.

I thought the section on "Providing Appropriate Incentives" was both an excellent review of the issues there, and the most important part to getting next generation evaluations to occur. Specifically, "there simply isn't any meaningful incentive to contribute" is a core issue in both the issues with current peer review, and with other novel new systems for peer evaluation.

In terms of what happens to traditional pre-publication review, it's my opinion that the existing peer review process is essential for fair reputation management in the professional work of researchers - and our work on this problem is predicated on a hybrid model that preserves 'peer review' in its current form for the foreseeable future. Any future situation around evaluation that "might ultimately obviate the need for conventional journals" would need to be predicated on Internet-scale identity systems and significantly robust and resilient professional reputation systems that are far from being produced at this point. Many issues exist in both identity and reputation online that are unsolved and will likely require changes in the expectation of researchers and the public (think generations of people) in these core concepts before online systems will be successful. A new system that "obviates" peer review would need to be measurably and obviously better for science and for researchers using the system. The hybrid model referred to in the paper with novel methods working beside existing publishers using journals to encode professional reputation using peer review has many extremely positive points in how it works.

On 2014 Jan 15, Satoko Hattori commented:

"ImageLD", "ImageEP", and "ImageTM", image analysis application softwares used in this article, are now freely available from http://www.mouse-phenotype.org/software.html.

On 2013 Oct 27, Graham Coop commented:

This article goes a long way towards demonstrating that the higher genetic similarity between Eurasians and Neandertals is due to recent admixture rather than deep population structure. Back when it appeared as a preprint I wrote a blog post discussing some of the scenarios that the authors' results couldn't distinguish between; i.e. whether the source of the recent gene flow was in fact Neandertal, or another population related to Neandertals. I thought I'd post a link to the post on Haldane's sieve, I've also placed the blog post on figshare to establish a permanent, citable copy of it. The figshare version is here.

My understanding is that the Reich group has now addressed these alternative hypotheses, so it is great to see this moving forward.

On 2014 Jul 27, David Keller commented:

A prokinetic agent with a similar mechanism of action, cisapride, was withdrawn from the U.S. market due to its side-effect of electrocardiographic QT interval prolongation, which increases the risk of an often-fatal heart arrhythmia called torsade de pointes. Therefore, it is pertinent to ask what effect, if any, mosapride may have on the QT interval or other parameters of the ECG. In at least one animal model, the answer appears reassuring, with no QT prolongation noted.(1)

Reference:

1: Endo J, Nomura M, Morishita S, Uemura N, Inoue S, Kishi S, Kawaguchi R, Iga A, Ito S, Nakaya Y. Influence of mosapride citrate on gastric motility and autonomic nervous function: evaluation by spectral analyses of heart rate and blood pressure variabilities, and by electrogastrography. J Gastroenterol. 2002;37(11):888-95. PubMed PMID: 12483243.

On 2013 Jun 13, Julia Salzman commented:

This is an intriguing and provocative study especially given the excerpt below. More controls and more data would be very interesting. For example, could the authors use Sanger or NGS to show that the detected XY DNA in the maternal brain had SNPs or other markers that identified the DNA as coming from their sons?

"Regarding the relationship between pregnancy history and Mc prevalence, five of nine subjects who were known to have at least one son harbored male Mc in at least one of their brain regions (Table S3). All positive individuals had AD; among the negatives were three with AD and one without neurologic disease. One of two women without history of having sons was also positive for male Mc in her brain and without neurologic disease; the negative individual had AD."

On 2013 Jun 30, Jonathan Eisen commented:

A blog post describing some more detail about this paper by Russell Neches (one of the authors) is available here http://phylogenomics.blogspot.com/2012/11/story-behind-paper-functional.html

On 2016 Apr 09, Lydia Maniatis commented:

For comments (and author reply) on the craziness of the claim of "orientation averaging" go here: https://pubpeer.com/publications/62E7CB814BC0299FBD4726BE07EA69

Additional craziness (based on conventional visual psychophysics wisdom):

"The voluntary averaging paradigm assumes that we perceive identical samples as slightly different due to noisy sample estimates (i.e. internal noise) and therefore have to average them to find a group estimate." And the contradiction: "However, voluntarily averaging different samples is a demanding task, and we can easily imagine that observers might see no reason to average samples that appear to be identical. Indeed, we do not often perceive identically oriented Gabors as having slightly different orientations except when their signal strength is weak (with brief or noisy presentation. [No citation for this last]. Indeed, we even perceive slightly different orientations as being identical (Morgan et al 2008). This could be due to a thresholding mechanism preventing us from perceiving our internal noise...."

A few things are worth noting. First, the authors seem to be claiming both that the samples don't look identical ("we perceive identical samples as slightly different") and that they do look identical "we do not often perceive identically oriented Gabors as having slightly different orientations." Which is it? Second, the fact that identical samples look identical in no way interferes with the authors "noise" belief system. They just explain it away on the basis of "a thresholding mechanism." But the noise paradigm, aside from being arbitrary, falls at the mere hint of a logical breeze.

Some things that should be taken into consideration: Some orientations are perceived with more precision than others (vertical, horizontal); we don't perceive orientation averages (see link above for discussion); differences in orientation in a field of oriented objects are subject to pop-out effects, not averaging effects.

The casual attitude towards assumptions that I've commented on frequently is of course on display here too: "This function is typically used [so it must be right] to quantify the averaging efficiency...and, based on the averaging model, this efficiency is assumed [in psychophysics, we can assume anything we want, whether Teller (1984) https://pubpeer.com/publications/70EEEA9EF5D6A4AE003C4559D2832C likes it or not] to be the same in low noise."

How many psychophysicists can dance on the head of a pin? I'm sure there's a model for that.

Also: It seems rather strange at first that there was a condition in which people's (supposed) estimation of “average orientation” was better for the case of four patches versus one patch. We can make sense of this if we consider the authors' methods and some of the conclusions of Solomon, May and Tyler (2015) (commented on also in the link above).

First, the location of the single patch in the periphery was both brief and unpredictable. This unpredictability was designed to avoid saccades to the object.

Second, Solomon, May and Tyler (2015) concluded that the observers were “averaging” one or two patches (because there's really no such thing as an orientation averaging percept). It's a little bit of a stretch to refer to an average of a single one out of a group of patches.

Now, in the single patch condition, it takes a little time to locate and focus attention on the single relevant object. In the four patch condition, the observer could already be focussed on any of the four locations, and base their response on that, perhaps they'd also have time to attend to a second one. Since they don't really consider more than one or two anyway, knowing where the patches are going to appear is an advantage, and explains the paradox.

The proper control (assuming the experiment had been worth doing in the first place) would have been to make the four-patch condition locations unpredictable as well. But instead, the authors contrive a strained interpretation in terms of orientation averaging in one “process” vs no orientation averaging in another.

On 2014 Aug 27, Jim Woodgett commented:

Non-competitive (with regard to ATP) inhibitors are an important addition to the arsenal of GSK-3 inhibitors (like TDZD). However, it should be noted that this analysis did not test GSK-3alpha (a highly structurally related kinase to GSK-3beta and the docking to the crystal structure was performed in silicon with no mutational verification. These pilot compounds are likely to be similarly potent against GSK-3alpha (as is TDZD and essentially all other small molecule GSK-3 inhibitors).

On 2016 May 10, Morten Oksvold commented:

Please pay attention to the following report from ORI (Office of Research Integrity) before reading this article:

https://ori.hhs.gov/content/case-summary-pastorino-john-g

On 2013 Oct 31, John Cannell commented:

The authors stated that markers of oxidative stress are present in autism spectrum disorder (ASD). I wonder if the authors are aware that the genes for the antioxidants superoxide dismutase and thioredoxin reductase are directly up-regulated by the secosteroid 1,25 di-hydroxy vitamin D3 (calcitriol). I believe both genes also harbor a vitamin D response element.

Peehl DM, Shinghal R, Nonn L, Seto E, Krishnan AV, Brooks JD, Feldman D. Molecular activity of 1,25‐dihydroxyvitamin D3 in primary cultures of human prostatic epithelial cells revealed by cDNA microarray analysis. J. Steroid Biochem Mol. Biol 2004;92:131–141. PMID:15555907>

Calcitriol also directly up-regulates glutathione reductase and increases glutathione levels.

Jain SK, et alo. Vitamin D upregulates glutamate cysteine ligase and glutathione reductase, and GSH formation, and decreases ROS and MCP-1 and IL-8 secretion in high-glucose exposed U937 monocytes. Biochem Biophys Res Commun. 2013 Jul 19;437(1):7-11. doi: 10.1016/j.bbrc.2013.06.004. Jain SK, 2013

Also, supplemental vitamin D significantly reduces oxidative stress in humans.

Nikooyeh B, et al. Daily intake of vitamin D- or calcium-vitamin D-fortified Persian yogurt drink (doogh) attenuates diabetes-induced oxidative stress: evidence for antioxidative properties of vitamin D.J Hum Nutr Diet. 2013 Jul 5. doi: 10.1111/jhn.12142. Nikooyeh B, 2014

Asemi Z, et al. Vitamin D supplementation affects serum high-sensitivity C-reactive protein, insulin resistance, and biomarkers of oxidative stress in pregnant women. J Nutr. 2013 Sep;143(9):1432-8. doi: 10.3945/jn.113.177550. Asemi Z, 2013

Thus the vitamin D theory of ASD (vitamin D deficiency being the environmental risk factor for this highly heritable disorder) is consistent with the authors work. Three recent studies, using community controls, have found 25(OH)D levels are significantly lower in children with ASD. Two of the studies below (Mostafa et al and Gong et al) also found ASD severity, as rated on standard ASD rating scales, is inversely correlated with 25(OH)D levels. Mostafa et al found an R value of -.86 for the association of serum 25(OH)D with ASD severity.

Gong ZL, Luo CM, Wang L, Shen L, Wei F, Tong RJ, Liu Y. Serum 25-hydroxyvitamin D levels in Chinese children with autism spectrum disorders. Neuroreport. 2013 Oct 1. Gong ZL, 2014

Meguid NA, Hashish AF, Anwar M, Sidhom G. Reduced serum levels of 25-hydroxy and 1,25-dihydroxy vitamin D in Egyptian children with autism. J Altern Complement Med. 2010 Jun;16(6):641-5. Meguid NA, 2010

Mostafa GA, Al-Ayadhi LY.Reduced serum concentrations of 25-hydroxy vitamin D in children with autism: relation to autoimmunity. J Neuroinflammation. 2012 Aug 17;9:201. Mostafa GA, 2012

There is a plethora of basic science explaining why low gestational or early childhood 25(OH)D levels would adversely effect brain development.

Eyles DW, Feron F, Cui X, Kesby JP, Harms LH, Ko P, McGrath JJ, Burne TH. Developmental vitamin D deficiency causes abnormal brain development. Psychoneuroendocrinology. 2009 Dec;34 Suppl 1:S247-57. doi: 10.1016/j.psyneuen.2009.04.015. Epub . Review. Eyles DW, 2009

DeLuca GC, Kimball SM, Kolasinski J, Ramagopalan SV, Ebers GC. Review: the role of vitamin D in nervous system health and disease. Neuropathol Appl Neurobiol. 2013 Aug;39(5):458-84. doi: 10.1111/nan.12020. DeLuca GC, 2013

Eyles DW, Burne TH, McGrath JJ. Vitamin D, effects on brain development, adult brain function and the links between low levels of vitamin D and neuropsychiatric disease. Front Neuroendocrinol. 2013 Jan;34(1):47-64. doi: 10.1016/j.yfrne.2012.07.001. Epub 2012 Jul 11. Review. Eyles DW, 2013

Furthermore, the vitamin D theory of autism explains most of the epidemiological facts of ASD.

Cannell JJ. On the aetiology of autism. Acta Paediatr. 2010 Aug;99(8):1128-30. Cannell JJ, 2010

Cannell JJ. Autism and vitamin D. Med Hypotheses. 2008;70(4):750-9. Cannell JJ, 2008

70% of American toddlers do not take

On 2013 Jun 29, Andries Zijlstra commented:

The authors have also published a definitive review that defines the contribution of cell migration to tumor progression and metastasis. PMID: 21664937

On 2013 Nov 12, Lillian Kenner commented:

In a quest to biochemically characterize the Zuo1 protein’s dual role of regulating transcriptional activation and folding of nascent polypeptides via its association with the ribosome, the functional role of the conformational heterogeneity of this protein is explored. Zuo1, a co-chaperone of Hsp70, consists of an RNA-binding domain and an autoinhibited 4 helix bundle located at the C-terminal domain (CTD). Here the authors show that upon unfolding of the CTD of Zuo1, Zuo1 dissociation from the ribosome and subsequently activating of the transcription factor Pdr1.

This paper highlights the multiple functional states sampled by Zuo1, by the novel concept that regulation can be achieved by an equilibrium of protein folding and unfolding. It also establishes that there is a feedback mechanism initiated from Zuo1’s primary role in translation to regulate transcriptional activity. The authors state that though they are among the first to establish signalling through an unfolding mechanism, they are not the first group to find a link between ribosomal associated proteins and transcriptional regulators.

There are still plenty of questions that could be followed up on. What would cause the unfolding necessary for activation of Prd1? And by what mechanism does this unfolding lead to dissociation from the ribosome? Though this is briefly addressed in the paper by saying that based on thermal unfolding measurements they calculate the CTD to be unfolded 4% of the time, or that perhaps that unfolding is caused by another binding partner.

On 2014 Mar 19, Patrice Brassard commented:

We are interested in the study by Schramm et al. (1) on a relationship between the incidence of sepsis-associated delirium (SAD) and cerebral autoregulation. Cerebral autoregulation was found impaired one day after the diagnosis of sepsis and several patients developed SAD (after four days). SAD was attributed to the impaired cerebral autoregulation detected on day 1 suggesting that impaired dynamic cerebral autoregulation might trigger SAD. As mentioned by the authors, PaCO2 levels were at the upper normal range and increased from day 1 to 4. We consider that these high PaCO2 levels could have impaired dynamic cerebral autoregulation in these patients.

The reason for that consideration is that we (2) and others (3) studied systemic hemodynamics, cerebral blood flow velocity, and dynamic cerebral autoregulation (by transfer function analysis) in healthy volunteers before and after an endotoxin bolus, which represents a model for evaluation of the systemic inflammatory response including vasodilatation (2) without the SAD-associated altered microcirculation. In these healthy volunteers, in whom cerebrovascular reactivity to CO2 seemed intact, endotoxemia was associated with reduced PaCO2 and cerebral perfusion and, in contrast to the patients studied by Schramm et al. (1), with enhanced dynamic cerebral autoregulation. Cerebral autoregulation depends critically on PaCO2 (4-6) and it may be that in septic patients a low PaCO2 would maintain (dynamic) cerebral autoregulation and in turn delay the development of SAD.

Patrice Brassard (a) Yu-Sok Kim (b,c) Johannes van Lieshout (b,c,f) Niels H. Secher (d) Jaya B. Rosenmeier (e)

a) Department of Kinesiology, Faculty of Medicine, Laval University, Quebec, Canada; b) Department of Internal Medicine; c) Laboratory for Clinical Cardiovascular Physiology, Heart Failure Research Center, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands; d) Department of Anesthesia, The Copenhagen Muscle Research Center, Rigshospitalet, University of Copenhagen, Copenhagen, Denmark; e) Department of Cardiology, Gentofte University Hospital, Gentofte, Denmark; f) School of Biomedical Sciences, University of Nottingham Medical School, Queen’s Medical Centre, Nottingham, U.K.

References (1) Schramm P, Klein KU, Falkenberg L, Berres M, Closhen D, Werhahn KJ, David M, Werner C, Engelhard K. Impaired cerebrovascular autoregulation in patients with severe sepsis and sepsis-associated deliriu. Crit Care. 2012;16:R181

(2) Brassard P, Kim YS, van Lieshout J, Secher NH, Rosenmeier JB. Endotoxemia reduces cerebral perfusion but enhances dynamic cerebrovascular autoregulation at reduced arterial carbon dioxide tension. Crit Care Med. 2012;40:1873-1878

(3) Berg RM, Plovsing RR, Ronit A, Bailey DM, Holstein-Rathlou NH, Moller K. Disassociation of Static and Dynamic Cerebral Autoregulatory Performance in Healthy Volunteers After Lipopolysaccharide Infusion and in Patients with Sepsis. Am J Physiol Regul Integr Comp Physiol. 2012 [Epub ahead of print]

(4) Paulson OB, Strandgaard S, Edvinsson L: Cerebral autoregulation. Cerebrovasc Brain Metab Rev 1990; 2:161–192

(5) Ainslie PN, Celi L, McGrattan K, et al: Dynamic cerebral autoregulation and baroreflex sensitivity during modest and severe step changes in arterial PCO2. Brain Res 2008; 1230:115–124

(6) Aaslid R, Lindegaard KF, Sorteberg W, et al: Cerebral autoregulation dynamics in humans. Stroke 1989; 20:45–52

This comment originally appeared here : http://ccforum.com/content/16/5/R181/comments

On 2015 Sep 02, Jeff Kiefer commented:

URL is dead.

On 2017 Sep 18, Robert Garry commented:

A Correction to the May 18, 2016 Correction appeared September 7, 2017. https://doi.org/10.1371/journal.ppat.1005503

The Correction of the Correction states, "The location of Mangala and Boma were switched.”

In fact the locations of Mangala and Boma were not switched. Boma is correctly located in all three versions of the map near the first bend of the Congo River

The village of Mangala is incorrectly located to the east of Boma in the Original Figure 1 [September 27, 2012] and again in the September 7, 2017 Correction of the Correction. Mangala is located to the west of Boma closer to to mouth of the Congo River in the May 18, 2016 Correction. Neither location for Mangala is correct. Rather, Mangala is located about 30 kilometers to the north of Boma.

The Boma Health zone is also incorrectly labelled as the Boma Bungu Health zone in all three versions of Figure 1 and in Figure 7.

These facts are easily verified using a Médecins Sans Frontières (MSF) and other information in my August 11, 2017 post below.

On 2017 Aug 11, Robert Garry commented:

Neither location for Mangala in Grard, Fair, Lee et al., 2012 or the May 18, 2016 correction is correct.

The original version of Figure 1 of Grard, Fair, Lee et al., 2012 and the version from the May 18, 2016 correction show Mangala, the village of the 3 cases reported, to be located in different locations. Neither location is correct. Also, the Boma health zone is incorrectly labeled as the Boma Bungu health zone in Figure 1. Grard, Fair, Lee et al., 2012.

Grard, Fair, Lee et al., 2012 Fig. 1: http://i.imgur.com/pyHvZcU.png

Correction to Grard, Fair, Lee et al., Fig. 1: http://i.imgur.com/ImLkfJi.png

Further, while the authors fixed the country names for Sierra Leone, Liberia, Ivory Coast and Ghana in the “corrected” version, several other errors were not fixed. These include, among other errors, the fact that Sierra Leone has had Lassa fever cases (the most in the world). Guinea, Liberia, Mali, Ivory Coast Togo and Benin have also experienced Lassa fever cases or have been the source of exported cases. Ghana has never had a case of Ebola, but Ivory Coast was the site of a single isolation of Tai Forest virus, a related filovirus. Sudan is incorrectly labeled as North Sudan and has never had an Ebola or Sudan virus case.

The Boma Health Zone is also incorrectly referred to as the Boma Bungu Health Zone in Fig. 7A of Grard, Fair, Lee et al., 2012.

Fig. 7A of Grard, Fair, Lee et al., 2012: http://i.imgur.com/W7kByHN.png

A Médecins Sans Frontières (MSF) map shows that the Boma Health Zone includes the city of Boma (pop 200K), and the rural Boma Bungu Health Zone (HZ) incudes Mangala.

MSF map: http://i.imgur.com/Ru2Zk7s.png

Figure 1 (both versions) and Figure 7 of Grard, Fair, Lee et al. 2012 incorrectly label the Boma HZ as the Boma Bungu HZ.

Two independent sources provided me with the true location of the village of Mangala. First, researchers at the Luki Biosphere sent me a map. Mangala (blue arrow) is located near one of the entrances of the Biosphere occupying a bend in the Luki River on a road 30 Km north of Boma.

Mangala near Luki Biosphere:http://imgur.com/V4XHd16

The MSF Chief of Mission who investigated the Mangala outbreak reported that Mangala was 1) along the Luki river ; 2) along a ‘main’ road and 3) northwards from Boma and the Congo river.

Mangala’s actual location is fully consistent with the early report of this disease cluster.

http://www.promedmail.org/post/20090626.2326

“5 people out of almost a dozen ill individuals have died within a few days from an as yet unidentified disease in the village of Mangala, located some 30 kilometers [19 mi] from the city of Boma, the capital of the province of Bas-Congo [Kongo Central] in the west of the Democratic Republic of the Congo (DRC).”

On 2017 Jul 25, Robert Garry commented:

None

On 2017 Jul 24, Robert Garry commented:

None

On 2016 May 08, Robert Garry commented:

The authors should explain why the location of Mangala is different in the original Figure 1 and in the "corrected" Figure 1.

On 2016 Apr 10, Robert Garry commented:

Two children

I have asked for redacted/deidentified/anonymised copies of original case records used to compile Table 1 and to draw other conclusions surrounding the 2009 deaths of two children from the Democratic Republic of the Congo (DRC) in Grard, Fair, Lee et al., 2012.

This request was made under PLoS’ data access policy (http://journals.plos.org/plosone/s/data-availability). The first line of the policy reads, “PLOS journals require authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception.” The policy goes on to state, "The data policy was implemented on March 3, 2014. Any paper submitted before that date will not have a data availability statement. However for all manuscripts submitted or published before this date, data must be available upon reasonable request." Thus, the PLoS data policy applies to Grard, Fair, Lee et al., 2012.

The PLoS policy gives explicit “Guidance on sharing data sets that derive from clinical studies or other work involving human participants.” According to the PLoS policy, “For studies involving human participants, data must be handled so as to not compromise study participants' privacy.” PloS Pathogens rejected my data request stating, “… because the data requested includes records with confidential patient information, we will not pursue this matter any further as potential compromise of patient privacy is a stated exception to our data policy.”

It is important to note that the PLoS policy links to several websites that provide guidance on anonymisation of patient data. One of the links provided is to the UK Data Archive (http://www.data-archive.ac.uk/create-manage/consent-ethics/anonymisation). The UK Data Archive guidance states, “Direct identifiers are often collected as part of the research administration process but are usually not essential research information and can therefore easily be removed from the data.”

The data in Grard, Fair, Lee et al., 2012 certainly does not fall under one of the rare exceptions to PLoS’ data access policy. On the contrary, the PLoS policy is clear that patient data MUST be provided after proper anonymisation that protects patient privacy. Numerous direct identifiers of the human subjects discussed in this manuscript were provided by the authors, including the name of the village, age and in the case of the two children their date of death. The authors have also made several statements that contradict the original reports of these cases in the DRC. It is a trivial matter to remove other identifiers from the original patient records, such as their names, as I have requested. It is a reasonable request to see the original data about abdominal pain, epistaxis, conjunctival injection, oral hemorrhage, hemorrhagic vomiting, hemorrhagic bleeding etc. found in Table 1 of Grard, Fair and Lee 2012. This is in no way identifying information and should be made available under PloS’ data access policy.

Many scientists, organizations and journal editors are now calling for open data policies regarding serious public health threats, such as Zika virus (http://www.npr.org/sections/goatsandsoda/2016/04/02/472686809/scientists-say-its-time-to-end-parachute-research). Based on their analysis of the data summarized in Table 1 Grard, Fair, Lee et al., 2012 concluded that the two children who died in the DRC in 2009 and a nurse that attended then contracted a “typical” hemorrhagic fever. They also concluded that the Rhabdoviridae should now be included with the four other virus families with members that can cause hemorrhagic fever (Chiu, Fair and Leroy, Future Microbiology 8, 139-141, 2013). Bas-Congo virus, whose genome was sequenced from the blood of the nurse, is a rhabodovirus. PLoS has supported efforts to make data on Zika virus open access (http://blogs.plos.org/speakingofmedicine/2016/02/10/zika-emergency-puts-open-data-policies-to-the-test/). PLoS should follow suit and open access to data on Bas-Congo virus.

Robert Garry

On 2016 Apr 03, Robert Garry commented:

To the editors, administrators and board of PLoS Pathogens,

An erratum for this paper has now been published. Revised Figure 1 still contains important errors.

ERRORS (among others): Sierra Leone and other West African countries are now properly labeled, but omitted is the fact that Sierra Leone has experienced Lassa fever cases. In fact the incidence of Lassa fever in Sierra Leone is considered to be the world’s highest. Likewise, Guinea also has many documented Lassa fever cases, but this is omitted. Other the hand, Ghana has never had a documented Ebola virus disease case. Ivory Coast has had one documented case of human infection with Tai Forest virus, which is a filovirus in the same family as Ebola virus.

The authors took this opportunity to change the name of “Bas-Congo hemorrhagic fever” to “Mangala hemorrhagic fever.” I object to both terms as the authors have not established by virology community standards that any human subject discussed in their original manuscript actually had a viral hemorrhagic fever or that their illness was caused by Bas-Congo virus. The new term “Mangala hemorrhagic fever” was not used in the manuscript and its use in this still multiply flawed revised figure is not justified.

The authors provided "raw, uncropped blots” used previously to prepare Supplemental Figure 2. They acknowledge that the original blot used to generate this figure 1) contained additional lanes that had been removed, 2) the incorrect lane 4 was inserted into the published figure and 3) a black-and-white inversion and global gamma correction was applied to the entire image. This is an incomplete accounting of the image manipulations that are now apparent upon inspection of the original image. It would also be appropriate for the authors to acknowledge that further unannounced image manipulations occurred in the published figure resulting in duplications of background artifacts (for example, artifacts resembling question marks near the control band) and other incongruences, such a lighter background around the control band.

The authors of this paper should make available for review the data used to derive Table 1 in Grard, Fair, Lee et al., 2012. Table 1 includes very explicit information about abdominal pain, epistaxis, conjunctival injection, oral hemorrhage, hemorrhagic vomiting, hemorrhagic bleeding, etc. This is an incredible amount of clinical detail to come from a village health unit, particularly in a retrospective analysis of cases. As an expert in viral hemorrhagic fevers, I made a reasonable open data request under the PLoS guidelines to review the patient charts used to compile Table 1.

There are several reasons why I believe that an independent review of this data by an independent expert is necessary and important:

It is extremely difficult to make a diagnosis of any viral hemorrhagic fever on clinical grounds alone, yet the authors wrote definitively that these represented a “ cluster of three human cases of typical acute hemorrhagic fever.” This can only be verified by examining the patient records.

For background I suggest the article found at:

http://www.sciencedirect.com/science/article/pii/S1473309915001607

Regarding the accuracy of clinical diagnosis of Ebola virus disease, these authors write, “Furthermore, the specificity of the WHO case definition was strikingly low at 31·5% (95% CI 26·0–37·6). This implies that 68% of patients who would be selected for admission to a holding unit would not actually have Ebola virus disease (false-positive results)—indeed, a toss of a coin might have yielded a better chance of an accurate result.”

This begs the question that if Ebola clinical diagnosis at the height of the still ongoing West African outbreak was worse than a guess, how can “Mangala hemorrhagic fever” [sic] be diagnosed years later from patient records found in a small African village public health unit?

As for whether the paper meets community standards for causation, it does not. I can do no better to justify this statement than one of the co-authors of Grard, Fair, Lee et al., 2012.

From Future Microbiol. 2010;5(2):177-189: "The discovery of a novel virus in a clinical sample from an individual with an acute or chronic disease does not imply causation or even bona fide association of the virus with the disease."

Bas-Congo virus has been isolated from only a single individual. You cannot have proof of causation with n=1.

Another reason to review the data records is to resolve a discrepancy between the findings reported in Grard, Fair, Lee et al., 2012 who only reported 3 cases and the original reports of the cases, which stated that there were more cases, including others that died. This cluster of cases was first reported in a June 22, 2009 ProMED report stating, “5 people out of almost a dozen ill individuals have died within a few days from an as yet unidentified disease in the village of Mangala.” The original newswire reports, “Patients are being treated with a combination of antibiotics, antacids and other tonics, as well as transfusion and rehydration suggesting that possible bacterial etiologies are being considered.” In this regard, it is worth noting that case three in Grard, Fair, Lee et al. 2012 from whom Bas-Congo virus was isolated recovered quickly after antibiotic treatment. I am interested in examining all the clinical data to determine why other cases were excluded from Grard, Fair, Lee et al. 2012.

My prior request to PLoS Pathogens to see original patient data used to derived Table 1 data was rejected because, “In addition, because the data requested includes records with confidential patient information, we will not pursue this matter any further as potential compromise of patient privacy is a stated exception to our data policy.”

While the PLoS journals should be commended for strengthening their data access policies, in particular to extend their open data requirement to all PLoS manuscripts including those published in 2012, confidentiality is absolutely no grounds to reject my request to see the key elements of the data (the signs and symptoms listed in Table 1) from the patient records in Mangala village in DRC in 2009. The parents of the two children who died (cases one and two) and the nurse that attended them (case three) gave consent to give use private information as case reports in the paper. Age, date of death of the children, and the name of the village (Mangala) are all provided in the paper. It is a trivial matter to redact all of the identifying information from these patient records.

I am publicly requesting access to the patient records used to compile Table 1 of Grard, Fair, Lee et al., 2012, with all identifying information redacted so as to completely avoid confidentiality issues.

Sincerely,

Robert F. Garry, PhD

On 2017 Jun 09, Shafic Sraj commented:

has good references on subluxation / instability of ulnar nerve

On 2015 Feb 23, ROSS LAZARUS commented:

In case anyone actually reads these, the tool factory has been upgraded to allow multiple input files, arbitrary user editable parameters and to support reproducible research through locking execution to a specific R/Perl/Python package dependency (must exist in the toolshed and be installed on the development Galaxy) - the tool factory 2 project website has moved to https://github.com/galaxyproject/tools-iuc/tree/master/tools/tool_factory_2 - support of the original tool factory at the bitbucket site will also continue but most users will probably want to move to the more flexible TF2.

On 2016 May 25, Jonathan Rakar commented:

This paper is part of a dissertation (2016), available here: http://urn.kb.se/resolve?urn=urn:nbn:se:liu:diva-125925

On 2018 Jan 09, Andy Collings commented:

A subset of experimental results from this study were the focus of a replication attempt as part of the Reproducibility Project: Cancer Biology (https://osf.io/e81xl/wiki/home/). The experimental designs and protocols were reviewed and approved in a Registered Report (https://doi.org/10.7554/eLife.04024) and the results of the experiments were published in a Replication Study (https://doi.org/10.7554/eLife.30274).

On 2013 Dec 09, Rhodri Cusack commented:

Neuroimaging can be used to probe cognitive processes like language development at an age when behavioral responses are not yet available. Mueller JL, 2012's report describes the use of electroencephalography (EEG) to investigate individual differences in grammatical rule learning in 3-month old infants.

In their auditory oddball paradigm, triplets of syllables were presented in a sequence. Approximately 10% of triplets contained a final syllable that deviated in pitch and ~10% of triplets deviated in the rule with which the syllables were chosen. Mismatch Responses (MMRs) to pitch deviants have been shown in young infants before (He C, 2007). Early in development (2-3 months), deviants evoke a slowly changing positive MMR and this typically matures by four months to a more rapid, negative MMR, as seen in adults.

The report presents data from 65 infants of age three months. It concludes that pitch deviants elicit an immature positive MMR in 49% of the infants and a negative MMR in the remainder; and that rule deviants elicit a response only in infants with a mature negative pitch MMR. Together, these are taken to indicate that abstract rule learning depends on basic auditory processing abilities. However, the statistics reported do not justify these conclusions.

As the infants were split into groups according to the sign of their pitch MMR, it is circular to then test for a non-zero pitch MMR within each of these groups. The tests have a high risk of Type 2 error, and significant results would be obtained under the null hypothesis that the data comprised noise alone (Kriegeskorte N, 2009). This makes it difficult to interpret the blue waveforms and bars in Fig 2 A,B,C&D, the PxMMR interaction, or the Neg MMR measures in Table 1. Thus, evidence was not provided for the presence of a pitch MMR, although anecdotally, the shapes of the positive and negative curves are similar to those observed previously (He C, 2007). The interactions involving pitch MMR and region will also be biased in the likely circumstance that noise level varies by region. To assess the statistical significance of the pitch MMR (or higher-level interactions), cross validation could be performed by splitting each participant’s data (e.g., assign groups using half of the data, run statistics on the other half)

Statistics were also not presented to show that the positive and negative pitch-MMR groups had a different MMR response to rule deviants. The rule MMR reached significance in the negative group and not in the positive group, but tests were not reported to establish these differed significantly (i.e., Boys: MMRxR; Girls: MMRxR) (Nieuwenhuis S, 2011). The higher-level interaction reported (MMRxRxSex) might be driven by the opposite signs of the boys and girls with negative MMR. Further, the positive rule MMR appears to have different morphology from that previously reported (He C, 2007).

In summary, the conclusions stated are not justified given the reported statistics. Rigorous statistical practices are critical for guiding the interpretation of neuroimaging data, particularly as prominent researchers have suggested only half of all studies will replicate.

Thanks to Bobby Stojanoski, Michelle C. Tran, Annika C. Linke & Conor J. Wild from the Cusack lab for their help in drafting this comment.

On 2014 Dec 10, Kath Wright commented:

Other search filters are available from the InterTASC Information Specialists' Sub-Group Search Filter Resource at https://sites.google.com/a/york.ac.uk/issg-search-filters-resource/home

On 2014 Nov 25, Harri Hemila commented:

Nakano T, 2012 reported an outbreak of tetanus in Japanese macaques (1). Monkeys and humans are unable to synthesize vitamin C and therefore it may have similar effects on both. In 1955, CHAKRABARTI B, 1955 reported that tetanus patients had lower plasma vitamin C levels than healthy controls, and tetanus patients who died had lower levels than those who survived. A controlled trial carried out in Bangladesh in the 1980s tested the effect of intravenous vitamin C on tetanus patients. Jahan K, 1984 administered 1 g/day of vitamin C to children aged 1 to 12 years and none of them died (0/31), whereas 74% (23/31) of control children died. In tetanus patients aged 13 to 30 years, 37% (10/27) of the vitamin C group died, compared with 68% (19/28) of the control group. Although the Jahan trial has methodological shortcomings, the findings should not be ignored on the basis of potential biases Hemilä H, 2013. Furthermore, in an animal study, Dey PK, 1966 reported that five rats administered twice the minimal lethal dose of tetanus toxin all died, whereas 25 rats administered vitamin C either before or after the toxin all lived. Treatment effects of vitamin C should be tested in monkeys with tetanus.

On 2014 Jan 28, Dale D O Martin commented:

The authors incorrectly state that the protein has 5 predicted N-myristoylation sites, but myristoylation can only occur on N-terminal Glycines. I've commented on this on another paper by these authors (http://www.ncbi.nlm.nih.gov/pubmed/18071584 and comment pasted below). I have also contacted the authors and the editor of the journal, but they have not changed it. So, I am highlighting it here.

It should be noted that N-myristoylation can only occur on N-terminal Glycines, hence the name N-myristoylation. This occurs either co-translationally on the nascent polypeptide following the removal of the initiator Met or it can occur posttranslationally following proteolysis, which exposes a new N-terminal Gly. The latter has only been shown to occur in caspase-cleaved proteins. In this case, the Gly follows an Asp residue where caspase will cleave. The authors here predict internal myristoylation at very unlikely positions. Furthermore, the general consensus sequence for myristoylation is GXXXS/C/T where X is any amino acid, except for large bulky residues, and S/C/T are preferred in position 5 (counting from Gly). The first site they predict is GAAPP and is very unlikely to be myristoylated. Caution should be taken when predicting internal myristoylation sites. Unless it is predicted to be cleaved to expose an N-terminal Gly.

On 2013 Nov 19, Karl Clark commented:

The crhr1 TALEN binding sites in the published manuscript contained sequence errors. The actual DNA sequence of the binding sites are: crhr1-Tal1a (left) GTCAACACTGAGCTCTGTAAACCT crhr1-Tal1b (right) CTGCTGCCGACTGGTCCCTGACCT

On 2016 Aug 24, Ben Goldacre commented:

This trial has the wrong trial registry ID associated with it on PubMed: both in the XML on PubMed, and in the originating journal article. The ID given is NCT00123456. We believe the correct ID, which we have found by hand searching, is ISRCTN35739639.

This comment is being posted as part of the OpenTrials.net project^[1] , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected at source, in PubMed and in the accompanying paper.

Many thanks,

Jessica Fleminger, Ben Goldacre*

[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367

* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG

On 2017 Aug 05, Fernando Castro-Chavez commented:

Dear Reader, in this article I explore the representation of the 64 codons of the genetic code within a tetrahedron, putting the 16 hydrophobic codons at the center of each of its four sides, while putting the three exit codons (the stop ones) at the three angles of the base, while the start codon was located at the top angle, just as receiver antenna. This 3-D geometry is compared with my previous efforts on producing one of several meaningful square 2-D representation, and finding the sense of its classic 2-D representation which after rotating 90 degrees per side, every time the equivalent hydrophobic codons appeared, which gave me the idea, in a previous publication, of the rules of variation, that produce equally useful proteins and enzymes by using equivalent amino acids obtained from equivalent codons. Sincerely, Fernando Castro-Chavez.

On 2018 Jan 17, Fernando Castro-Chavez commented:

Dear reader,

In this work I compare the load of the codons from the human genetic code with that one from multiple other organisms, the symmetry discovered according to the frequency per codon was precise, and I discovered that 12 of the most used codons per amino acid end in C, 8 of the most used codons end in G, with one of them being the start codon, and only 2 most used codons end in A, one of then being a stop codon!

Attentively,

Fernando Castro-Chavez, PhD Formerly at the Baylor College of Medicine.

Ciudad Guzmán, Jalisco, MX

01/17/2018

On 2014 Jan 27, Tom Kindlon commented:

References:

[1]. Nijs J, Crombez G, Meeus M, Knoop H, Damme SV, Cauwenbergh V, Bleijenberg G. Pain in patients with chronic fatigue syndrome: time for specific pain treatment? Pain Physician 2012 Sep;15(5):E677-86.

[2]. Kindlon T. Reporting of Harms Associated with Graded Exercise Therapy and Cognitive Behavioural Therapy in Myalgic Encephalomyelitis/Chronic Fatigue Syndrome. Bulletin of the IACFS/ME 2011;19(2):59-111. http://www.iacfsme.org/BULLETINFALL2011/Fall2011KindlonHarmsPaperABSTRACT/tabid/501/Default.aspx . Last Accessed: October 2, 2012.

[3]. Jones DE, Hollingsworth KG, Taylor R, Blamire AM, Newton JL. Abnormalities in pH handling by peripheral muscle and potential regulation by the autonomic nervous system in chronic fatigue syndrome. J Intern Med 2010 Apr;267(4):394-401.

[4]. Jones DE, Hollingsworth KG, Jakovljevic DG, Fattakhova G, Pairman J, Blamire AM, Trenell MI, Newton JL. Loss of capacity to recover from acidosis on repeat exercise in chronic fatigue syndrome: a case-control study. Eur J Clin Invest 2012;42:186-94.

[5]. Lane RJ, Soteriou BA, Zhang H, Archard LC. Enterovirus related metabolic myopathy: a postviral fatigue syndrome. J Neurol Neurosurg Psychiatry 2003;74:1382-6.

[6]. Knoop H, Stulemeijer M, Prins JB, van der Meer JW, Bleijenberg G. Is cognitive behaviour therapy for chronic fatigue syndrome also effective for pain symptoms? Behav Res Ther 2007;45:2034-43.

[7]. Bleijenberg G, Prins JB, Bazelmans E. Cognitive-behavioral therapies. In Handbook of Chronic Fatigue Syndrome, (ed. L. A. Jason, P. A. Fennell and R. R. Taylor), pp. 493–526. New York, Wiley; 2003.

[8]. Núñez M, Fernández-Solà J, Nuñez E, Fernández-Huerta JM, Godás-Sieso T, Gomez-Gil E. Health-related quality of life in patients with chronic fatigue syndrome: group cognitive behavioural therapy and graded exercise versus usual treatment. A randomised controlled trial with 1 year of follow-up. Clin Rheumatol 2011 Mar;30(3):381-9.

[9]. Evaluatierapport (2002–2004) met betrekking tot de uitvoering van de revalidatieovereenkomsten tussen het Comité van de verzekering voor geneeskundige verzorging (ingesteld bij het Rijksinstituut voor Ziekte- en invaliditeitsverzekering) en de Referentiecentra voor het Chronisch vermoeidheidssyndroom (CVS). 2006. Dutch language version: http://www.riziv.fgov.be/care/nl/revalidatie/general-information/studies/study-sfc-cvs/pdf/rapport.pdf (Accessed October 2, 2012). French language edition: http://www.riziv.fgov.be/care/fr/revalidatie/general-information/studies/study-sfc-cvs/pdf/rapport.pdf (Accessed October 2, 2012).

[10]. Wiborg JF, Knoop H, Stulemeijer M, Prins JB, Bleijenberg G. How does cognitive behaviour therapy reduce fatigue in patients with chronic fatigue syndrome? The role of physical activity. Psychol Med 2010;40:1281-7.

On 2014 Jan 27, Tom Kindlon commented:

Pain in patients with chronic fatigue syndrome: more research required to be confident about its etiology and treatment*

{I submitted this letter but it was not accepted for publication]

The review of pain in chronic fatigue syndrome (CFS) by Nijs and colleagues is welcome: as they highlight, pain symptoms are almost universally experienced by patients and are associated with disability levels(1). The importance of pain in the condition is emphasised by the “myalgic” in "myalgic encephalomyelitis" (ME), a term often used synonymously with CFS, and indeed five of the references in the paper have ME in their titles.

The authors recommend that "clinicians should be able to explain to their CFS patients why they are in pain, and such an explanation should be scientifically based". Similarly, to treat the condition, they say "it is crucial to understand the etiology of pain from CFS." Unfortunately, CFS is generally classed as a medically unexplained condition with a lack of consensus on its etiology.

Nijs et al. discuss some of the pathophysiological findings in the condition. However, the review is far from complete in terms of listing all the abnormalities associated with exertion, a frequent cause of pain in the illness(2). While central sensitisation certainly may play a part, peripheral abnormalities appear also to be important. One example that was not mentioned is the abnormal processing of intramuscular pH following exertion(3). These results were subsequently replicated; CFS subjects demonstrated postexercise acid exposure on the order of 50 times higher than normal sedentary controls(4). Moreover, an intriguing study found an association between an abnormal lactate response following an anaerobic threshold exercise test and the presence of enterovirus sequences in muscle in a proportion of CFS patients(5). This also highlights the well-recognised heterogeneity of patients diagnosed with CFS(2), suggesting that one intervention may not be suitable for all. The pain physiology education the authors recommend assumes that central sensitisation characterises and dominates the clinical picture; this is far from universally agreed upon by those in the field.

The other intervention the review highlighted was the form of cognitive behaviour therapy (CBT) that encourages scheduled increases in activity. This recommendation was based on a single paper(6). Nijs et al.’s paper did not clarify that CBT was only found to be "effective" (for pain) for the adult CFS patients that were classed as "recovered" (“recovery” was defined by only a single variable; it is unclear whether this was a post-hoc subgroup analysis). Moreover, the adult study was an uncontrolled trial so improvements reported in the “recovered” subgroup may be due to non-specific factors such as attention by the therapist.

It is also far from clear whether this form of CBT would meet the authors’ own criteria that the explanations given to patients by clinicians are "scientifically based". A manual for this form of CBT explains that patients may be told "the symptoms cannot be explained by persistent virus, nor by dysfunction of the immune system, digestive disorders or other physical causes ... the onset of the fatigue may have been somatic, but that is no longer relevant"(7). There is a lack of robust scientific evidence for these statements.

Nijs et al. did not mention a randomised controlled trial (RCT) comparing a multidisciplinary treatment, combining CBT, graded exercise therapy (GET) and pharmacological therapy, with “usual treatment” (exercise counselling and pharmacological treatment)(8). Unfortunately, there was no waiting list control group but neither intervention was associated with improvements at 12 months compared to baseline in any of the pain measures employed (SF-36 bodily pain, VAS pain intensity and an item determining whether functional impairment was related to pain). In fact, the multidisciplinary treatment (involving CBT and GET) produced statistically significant deteriorations in two of the pain measures.

This raises the important issue of the level of harms associated with graded activity interventions in CFS. An audit of Belgian adult speciality CFS clinics found that following an intervention based on GET and CBT (mean duration: 41 sessions), 31% of patients reported a worsening of their pain as measured by the SF-36 pain subscale(9). Six months following completion, 31% of patients also reported a deterioration in their SF-36 pain scores compared to baseline. More generally, outside of clinical trials, high percentages of patients undertaking programs based on encouraging the scheduling of increased activity or exercise, have reported becoming worse globally following them(2). The “safety profile” appears to be better in research studies. However, the research environment can be somewhat artificial, and differ from routine practice(2). The apparent smaller amount of deteriorations following graded activity/exercise interventions in RCTs may potentially arise from patients not actually increasing their overall activity levels in such trials, perhaps due to a more cautious approach in the research setting(2). For example, a review of three Dutch RCTs of CBT interventions found using actigraphy that, upon completion, activity was not different compared to waiting list controls, a paradoxical result given these programs were based on encouraging increased activity(10). This could occur either through low compliance rates or, alternatively, activity substitution, where participants reduce other activities in their daily lives to compensate for specific activities or exercises (e.g. walking sessions), that are part of a program(2). Moreover, a mediation analysis of the same three CBT studies found that reported changes in fatigue were not due to changes in physical activity levels(10). Similarly, Knoop et al. found in their study that the changes in reported pain were not explained by changes in physical activity, as Nijs et al. themselves reported(1,6). Instead the only relationship found was that a decrease in pain was associated with a decrease in fatigue. Given such data it may be premature to encourage increased total activity.

Clearly more research needs to be conducted to both understand the causes of pain in CFS and to test potential treatments. Given the number of RCTs of nonpharmacological therapies for CFS that have been published, it is disappointing how infrequently pain outcome measures have been used. Hopefully the review by Nijs et al. will help remedy this gap as well as highlighting the need for researchers to try to understand the mechanisms of any change observed.

*possible title – the journal can choose a different title if it prefers

(References continue in next message - this is over the limit)

On 2017 Jan 05, Melissa Rethlefsen commented:

The authors have wisely searched in multiple sources to inform this systematic review. Even better, they have listed the number of references found per information source prior to deduplication in their flow diagram. Upon closer examination of the flow diagram, I noted that after deduplication, the authors were left with 395 citations. This seems highly unusual, since some of their individual information sources (e.g., Scopus and "ISI Web of Science") individually contain more than 395 citations.

Though it is possible that there is some duplication in Scopus, it is highly unlikely that there were 76 duplicates in that database. Because the search strategies are not included in full (without interpretation required) and would not work in a database other than MEDLINE (due to the use of the "major medical subject heading 'pulmonary arterial hypertension'", which is MEDLINE specific), it is difficult to ascertain whether Scopus may have been searched multiple times, perhaps with multiple searches, without deduplication prior to exporting the results. This is likely the answer, but it remains unclear.

For the ISI Web of Science, it is markedly more challenging to guess what the difference between the 680 results and the 395 total deduplicated results may have been. This is primarily because the reason for the gap of 285 articles could theoretically be attributed to several reasons. The first and foremost reason is that ISI Web of Science is not a database; it is a platform that hosts many databases, depending on the subscriptions held by the institution. For example, at my institution, our ISI Web of Science platform hosts: Science Citation Index Expanded (SCI-EXPANDED) --1900-present Social Sciences Citation Index (SSCI) --1900-present; Arts & Humanities Citation Index (A&HCI) --1975-present; Emerging Sources Citation Index (ESCI) --2015-present; BIOSIS Previews; MEDLINE; Russian Science Citation Index; SciELO Citation Index; and KCI: Korean Journal Database. It is unclear which ISI Web of Science database(s) were searched in this instance. If multiple databases on the platform were searched individually (perhaps Science Citation Index and MEDLINE, e.g.), that could lead to the deduplicated results being lower than the individual platform's results. It could also be, however, that multiple searches were performed without deduplication before exporting results. Since the search strategy loosely described in the text would not work in ISI Web of Science, except in the MEDLINE database within, it is unclear what searches may have been performed on that platform.

Though the authors make a good attempt to make their methods transparent, the limited search strategy reporting and incomplete reporting as to database usage makes their data flow hard to track and reproduce. Having a librarian or information specialist on the team may have helped to improve their search process and reporting.

On 2013 Jun 16, Akhil Vaidya commented:

Malaria parasites generate millimolar concentration of heme inside the infected RBC as a consequence of hemoglobin digestion. It is generally accepted that all this heme is detoxified within the parasite food vacuole to produce hematin crystals. On the other habd, if this heme was available as a substrate for heme oxygenase, one can imagine significant generation of biliverdine and carbon monoxide in infected RBC. Therefore, identification of a gene encoding a protein with significant homology to heme oxygenase was a surprise. The paper by Sigala et al., however, lays to rest this possibility by conclusively showing that infected RBC contain no more biliverdine or bilirubin than uninfected RBC, and that the annotated heme oxygenase of Plasmodium falciparum has little enzymatic activity expected. Thus, this protein, which is conserved among all species of malaria parasites, is likely to have acquired a new function while losing its enzymatic activity. It would be of interest to find out what this function could be.

On 2013 Oct 31, John Cannell commented:

The authors reported that immune system dysregulation is common in autism spectrum disorder (ASD”. Vitamin D deficiency produces very similar immune dysregulation.

Prietl B, 2013

< PMID:20119827>

< PMID:23359064>

< PMID:20427238>

Thus the vitamin D theory of ASD (vitamin D deficiency being the environmental risk factor for this highly heritable disorder) is consistent with the authors work. Three recent studies, using community controls, have found 25(OH)D levels are significantly lower in children with ASD. Two of the studies below (Mostafa et al and Gong et al) also found ASD severity, as rated on standard ASD rating scales, is inversely correlated with 25(OH)D levels. Mostafa et al found an R value of -.86 for the association of serum 25(OH)D with ASD severity.

Gong ZL, Luo CM, Wang L, Shen L, Wei F, Tong RJ, Liu Y. Serum 25-hydroxyvitamin D levels in Chinese children with autism spectrum disorders. Neuroreport. 2013 Oct 1. Gong ZL, 2014

Meguid NA, Hashish AF, Anwar M, Sidhom G. Reduced serum levels of 25-hydroxy and 1,25-dihydroxy vitamin D in Egyptian children with autism. J Altern Complement Med. 2010 Jun;16(6):641-5. Meguid NA, 2010

Mostafa GA, Al-Ayadhi LY.Reduced serum concentrations of 25-hydroxy vitamin D in children with autism: relation to autoimmunity. J Neuroinflammation. 2012 Aug 17;9:201. Mostafa GA, 2012

There is a plethora of basic science explaining why low gestational or early childhood 25(OH)D levels would adversely effect brain development.

Eyles DW, Feron F, Cui X, Kesby JP, Harms LH, Ko P, McGrath JJ, Burne TH. Developmental vitamin D deficiency causes abnormal brain development. Psychoneuroendocrinology. 2009 Dec;34 Suppl 1:S247-57. doi: 10.1016/j.psyneuen.2009.04.015. Epub . Review. Eyles DW, 2009

DeLuca GC, Kimball SM, Kolasinski J, Ramagopalan SV, Ebers GC. Review: the role of vitamin D in nervous system health and disease. Neuropathol Appl Neurobiol. 2013 Aug;39(5):458-84. doi: 10.1111/nan.12020. DeLuca GC, 2013

Eyles DW, Burne TH, McGrath JJ. Vitamin D, effects on brain development, adult brain function and the links between low levels of vitamin D and neuropsychiatric disease. Front Neuroendocrinol. 2013 Jan;34(1):47-64. doi: 10.1016/j.yfrne.2012.07.001. Epub 2012 Jul 11. Review. Eyles DW, 2013

Furthermore, the vitamin D theory of autism explains most of the epidemiological facts of ASD.

Cannell JJ. On the aetiology of autism. Acta Paediatr. 2010 Aug;99(8):1128-30. Cannell JJ, 2010

Cannell JJ. Autism and vitamin D. Med Hypotheses. 2008;70(4):750-9. Cannell JJ, 2008

70% of American toddlers do not take the American Pediatric Association's recommended vitamin D supplement of 400 IU/day and few toddlers or pregnant women get any sunshine due to the sun scare. As vitamin D fortified milk consumption and sun exposure has declined, so have toddlers and pregnant women’s vitamin D levels. The dramatic increase in the incidence of ASD occurred during the same time vitamin D levels were falling in toddlers and pregnant women.

Cannell JJ. Autism, will vitamin D treat core symptoms? Medical Hypotheses. 2013 Aug;81(2):195-8. Cannell JJ, 2013

Some autism researchers seem cognizant of the entire body of autism research. For example, a group of well-known European ASD researchers, including Professor Christopher Gillberg of the Gillberg Neuropsychiatric Institute, have recently called for the need for “urgent research” into the vitamin D deficiency theory of ASD.

Kočovská E, Fernell E, Billstedt E, Minnis H, Gillberg C. Vitamin D and autism: clinical review. Res Dev Disabil. 2012 Sep-Oct;33(5):1541-50. doi: 10.1016/j.ridd.2012.02.015. Epub 2012 Apr 21.Kočovská E, 2012

Until all autism researchers become cognizant of the wider body of scientific research, we will continue to wonder how to prevent - and perhaps even treat - this modern day plague.

John J Cannell, MD

Vitamin D Council

http://www.vitamindcouncil.org

On 2014 Nov 27, Jakob Suckale commented:

When was the sexism scale determined in the time course of the study? The sentence in the methods section is not clear. Did the faculty give this self-evaluation, presumably by questionnaire, at the same time as they rated the applications, possibly reducing their gender bias? Or did the sexism evaluation take place after the analysis of the applicant?

On 2015 Jul 23, Bill Cayley commented:

A good example of when a less-medical approach may be better: https://lessismoreebm.wordpress.com/2015/07/24/randomized-clinical-trial-on-the-effect-of-coffee-on-postoperative-ileus-following-elective-colectomy/

On 2016 Jun 04, FREDERICK DOMANN commented:

The original reference for the genesis of the MnSOD over expressing MCF-7 cells used in this study can be found here: http://www.ncbi.nlm.nih.gov/pubmed/10626823

On 2016 Jun 04, FREDERICK DOMANN commented:

None

On 2014 Jan 07, Brett Snodgrass commented:

Dear Reader,

Case reports may render pertinent drug safety signals, but usually do not warrant definitive conclusions.

Contrast the findings from a case of in utero cocaine exposure, there were multiple arteries of multiple vascular beds c FMD. The focal FMD reported in this case is likely idiopathic. If amphetamine caused the vasospasm, why was the FMD focal? Since Sumatriptan causes vasospasm, then the possibility of synergy between amphetamine and sumatriptan might be considered.

Please see the following article regarding In Utero cocaine expsoure. http://www.ncbi.nlm.nih.gov/pubmed/17868884

For additional commentary, please see https://twitter.com/BrettSnodgrass1/status/413491218023481344

Thank you kindly.

Addendum: The following case report contains similar findings, but without amphetamine exposure. Please exercise caution when using a case report to create an association. http://www.ncbi.nlm.nih.gov/pubmed/17905452

On 2017 Mar 24, University of Kansas School of Nursing Journal Club commented:

Team Members: Maddie Ehlers, Britta Smith, Sameer Upadhyaya, Clarissa Negrete, Briginé Newman, Nadia Grayfer, Amy Barnes. [Class of 2017]

Background Introduction:

We chose this article because it elaborates on the effect of Magnet recognition in the workplace and addresses issues that students like us will likely be affected after graduation and begin our careers. The outcomes of this study show what nurses can do to create a better work environment and how they can make needed changes in both the unit and organization. The gap in knowledge the article intends to fill in this course is the differences in the work environment, staffing, and nursing outcomes between a Magnet and non-Magnet organization. The findings bridged the gap to whether Magnet versus non-Magnet designation impacts nursing dissatisfaction, burnout, and turnover. Since we are students about to begin our nursing careers, we would like to work for an organization which allows us to avoid these negative facets. Therefore, having evidence that demonstrate the benefits of Magnet hospital versus a non-Magnet hospital can impact our decision making when selecting future workplace.

Methods:

This article was found through the CINAHL database. The purpose of this study was to examine whether work environments, staffing and nurse outcomes differ between Magnet and non-Magnet hospitals. A secondary analysis was done on data from a study of hospitals in 4 states (California, Florida, Pennsylvania and New Jersey). Researchers had distributed surveys to homes of a random sample of RNs using the state licensure lists from 2006-2007. All nurses who completed the survey were asked to provide the name of their employer, allowing researchers to combine responses by hospital. The final sample consisted of 567 hospitals and 46 of them were ANCC Magnet recognized. Sample also included 4,562 nurses working in Magnet hospitals and 21,714 nurses working in non-Magnet hospitals (Kelly et al. 2012). The survey was designed to measure five different components of the workplace: (1) nurse characteristics, (2) nurse staffing, (3) work environment, (4) education and (5) hospital characteristics. Work environment was measured using the 31-item Practice Environment Scale of Nursing Workforce Index. For education, nurses were to report their highest education in nursing and they would then calculate the hospital-level measure of proportion of nurses with a baccalaureate degree or higher. For hospital characteristics, they looked into the hospital designations such as, teaching status, postgraduate trainees and whether the hospital was a high-technology facility or not (Kelly et al. 2012). For measurement of outcomes, specifically job related burnout, they used the emotional exhaustion subscale of the Maslach Burnout Inventory Human Services Survey or MBI-HSS. The instrument assessed 3 domains: emotional exhaustion, depersonalization, and personal accomplishment. For measurement of nurse satisfaction, they asked nurses a single-item question, “How satisfied are you with your current job?” Intent to leave was characterized by nurses answering yes, they intend to leave their current employer within 1 year (Kelly et al. 2012). Overall, they tested the differences between the groups at the hospital level to estimate differences between Magnet and non-Magnet organizations. A series of logistic regression models were implemented to completely estimate the differences in job dissatisfaction, burnout and intent to leave in Magnet versus non-Magnet hospitals. Of the many models, the final model estimated the effects of the Magnet status while taking into account the individual nurse factors, hospital characteristics and hospital-nursing characteristics. All analyses were conducted with STATA version 11 (Kelly et al. 2012).

Findings:

The key findings were that Magnet hospitals are more teaching oriented, have more technology, and are more non-profit based than non-magnet hospitals. They found no difference in staffing between Magnet and non-Magnet even though Magnet hospitals were a lot bigger in size. It was also noted that Magnet hospitals have more certified specific nurses on their units which leads to better work environments. In addition, in California, the patient workload is a lot less than in their Magnet hospitals than non-Magnet hospitals. Lastly, Magnet hospitals are less likely to have nurse burnout and have better overall nurse satisfaction (Kelly et al. 2012). Although this study was successful in proving the hypothesis, there were limitations that arose. It was a cross sectional study to only a little over twenty percent of the Magnet hospitals at that time (Kelly et al. 2012). Therefore, they cannot generalize these hospitals to the whole population of Magnet hospitals. However, if the study were redone and the percentage of Magnet hospitals examined was expanded, we believe the study could be more generalizable across the nation and have a phenomenal impact on the number of hospitals that strive towards Magnet status.

Implications:

This literature selected is important to nursing because it shows evidence on the benefits of being involved with a Magnet institution. The main aspects this article looked at were dissatisfaction, burnout, and the intent to leave between current employed nurses at Magnet and non-Magnet organizations. Any nurse does not want to lose their drive for nursing and quality patient care. By providing facts on the benefits of Magnet institutions we can help prevent nursing dissatisfaction. The findings of the article are important to us in regard to the study of the health care microsystem. Since this article looked at patient workload, staffing issues, and work environments, this can lead to the determination of a healthy/positive work environment which can ultimately determine if a nurse remains satisfied in their area of practice. Furthermore, nurse satisfaction levels will ultimately affect turnover rates and prevent nurses from leaving the profession altogether. On a personal level, as we strive to enter in the nursing profession, we want to be in an institution where we are satisfied with our careers, so it is important for us as new grad nurses to find a work environment in which we can develop and thrive. Based on the results of this study, we are best suited to thrive and develop within a Magnet organization. In addition, we will be able to further develop as nurse leaders within a Magnet organizations. The study relates to the future of nursing practice because as future nurses want to find a way to stay satisfied in our practice, and the article demonstrates the importance of Magnet organizations in nurse job satisfaction. The article acts as reinforcement for us to be the change in the workplace. It also creates awareness as we are making decisions for our future careers, and to remember to consider the benefits of a Magnet versus non-Magnet hospital. As we know, increased nurse satisfaction creates a better work environment which ultimately increases patient outcomes.

References:

Kelly, L. A., McHugh, M. D., & Aiken, L. H. (2012). Nurse outcomes in magnet and non- magnet hospitals. Journal Of Nursing Administration, 42(10), S44-9. doi:10.1097/NNA.0b013e31822eddbc

On 2015 Aug 27, Bernard Friedenson commented:

For more information please see the article entitled "Mutations in Breast Cancer Exome Sequences Predict Susceptibility to Infection and Converge on the Same Signaling Pathways" This article is available at http://la-press.com/article.php?article_id=5029

On 2016 Aug 30, Ben Goldacre commented:

This trial has the wrong trial registry ID associated with it on PubMed. The ID given is NCT0050722 - the correct ID, which we found within the text of the article itself, is NCT00507221.

This comment is being posted as part of the OpenTrials.net project^[1] , an open database threading together all publicly accessible documents and data on each trial, globally. In the course of creating the database, and matching documents and data sources about trials from different locations, we have identified various anomalies in datasets such as PubMed, and in published papers. Alongside documenting the prevalence of problems, we are also attempting to correct these errors and anomalies wherever possible, by feeding back to the originators. We have corrected this data in the OpenTrials.net database; we hope that this trial’s text and metadata can also be corrected in PubMed.

Many thanks,

Jessica Fleminger, Ben Goldacre*

[1] Goldacre, B., Gray, J., 2016. OpenTrials: towards a collaborative open database of all available information on all clinical trials. Trials 17. doi:10.1186/s13063-016-1290-8 PMID: 27056367

* Dr Ben Goldacre BA MA MSc MBBS MRCPsych<br> Senior Clinical Research Fellow<br> ben.goldacre@phc.ox.ac.uk<br> www.ebmDataLab.net<br> Centre for Evidence Based Medicine<br> Department of Primary Care Health Sciences<br> University of Oxford<br> Radcliffe Observatory Quarter<br> Woodstock Road<br> Oxford OX2 6GG

On 2015 Dec 20, Atanas G. Atanasov commented:

Excellent and very comprehensive overview on the topic, thanks a lot to the authors for putting it together<br> Kind regards,

Atanas

http://pharmakognosie.univie.ac.at/people/atanasov-atanas-g/<br> http://homepage.univie.ac.at/atanas.atanasov/<br> http://about.me/Atanas_At

On 2015 Oct 25, Albert Gjedde commented:

This is an important review, unfortunately with an excess of acronyms that seriously impair the reading if you are unfamiliar with the usages common in the field, and occasional typographical errors, such as missing Capital letters after full stops (see abstract for example), probably because of blanket spelling changes that were not caught by the Publisher.

On 2016 Nov 18, James C Coyne commented:

This meta-analysis provides a misleading estimate of the efficacy of mindfulness-based stress reduction for cancer patients. Only two of the nine studies entered into the meta-analysis were actually RCTs. One found noa significant effect of mindfulness on the outcome variables, the other, an effect for only one of three outcomes. The claims of "moderate-to-large" effects depend on small, uncontrolled, nonrandomized trials. There was no rating of quality of trials or risk of bias, and therefore no taking of the poor quality of the trials into account. Trials of mindfulness are known to have high risk of bias and inadequate control groups.

Given the rush to implement mindfulness interventions in psychosocial care of cancer patients, there is need for independent assessment of whether there is any benefit. This review does not provide a valid assessmen.

An extended critique of this study can be found at https://jcoynester.wordpress.com/2016/11/18/mindfulness-based-stress-reduction-to-improve-the-mental-health-of-breast-cancer-patients/

On 2014 Apr 23, Raphael Levy commented:

I have commented on this article at PubPeer

On 2014 Jan 31, Huiqi Qu commented:

Common causes of liver disease in Mexican Americans were identified by machine learning methods in this study.

On 2014 Feb 12, Steven Salzberg commented:

Lior Pachter demonstrated, and published in arxiv (http://arxiv.org/abs/1212.3076), serious flaws in the statistics upon which this result is based. Pachter's argument (which Science itself declined to publish, as he explained on his blog (http://liorpachter.wordpress.com) demonstrates that the Ward and Kellis result may be incorrect. This would cast doubt on the paper's assertion that the method finds new evidence for purifying selection in humans for particular gene ontology terms.

On 2015 May 20, Alejandro Bortolus commented:

Dear readers, Please note that the Retraction of this article was only due to a wrong name problem: my name and lastname were mixed up in the final publication. However, Springer corrected this error in a second VALID version of the article published with a different DOI: 10.1007/s13280-012-0339-5. The only difference between the retracted and the valid versions are in the author's (my) name and the DOI. There is nothing different or wrong with the article itself, its contents, or anything else in it. Enjoy it, and let me now if you need more explanation or if you want me to send you my personal author´s copy which was originally posted as open-access in the Editor's Choice section of AMBIO. Yours sincerely, Alejandro Bortolus

On 2014 Jun 01, Ivan Oransky commented:

A former research fellow describes life in this lab: http://retractionwatch.com/2014/05/30/braggadacio-information-control-and-fear-life-inside-a-brigham-stem-cell-lab-under-investigation/

On 2014 Apr 09, Ivan Oransky commented:

This paper has been retracted: http://retractionwatch.com/2014/04/08/harvard-and-the-brigham-investigating-leading-heart-group-for-compromised-data/

On 2015 Mar 25, University of Kansas School of Nursing Journal Club commented:

There is a lack of understanding in the literature related to the factors that impact IPNG scores. Our group chose this article because we have discussed these concepts in class, including shared governance models that promote shared decision-making and the IPNG questionnaire, but did not discuss characteristics that may impact his or her score. We were also interested in investigating how employed nurses’ scores compare to those of our senior nursing class. The findings of this study may be significant to nurses in a variety of roles. Shared governance is a factor in Magnet designation, so individuals working to either pursue or maintain Magnet status may be interested in learning if there is a relationship between nurse characteristics and their perception of shared governance at their institution (Overcash et al., 2012). In addition, this study may help nursing leadership to better understand factors that could be helpful in developing and maintaining a shared governance foundation, which will ultimately lead to higher quality patient care. For staff nurses not currently involved in shared governance, this study may lead to reflection upon their perceptions and pursue taking part in a shared decision making model that their institution.

One major limitation that decreases the generalizability of this study is that it was only completed at one institution in the Midwestern United States. It would be interesting to investigate the effects of these demographic factors on IPNG scores in various healthcare facilities world-wide to see if the results are consistent. In addition, the results of this study are limited by its small sample size of nurses surveyed. Another limitation of this study is that it was conducted at an oncology hospital, which would employ a fairly specific subset of specialized nursing personnel. In order to increase the generalizability of this study, it would be necessary to use larger hospitals that contain a variety of patient care units. In order to establish a model for disseminating power and promoting autonomy and leadership of clinical nurses, many Magnet status hospitals utilize shared governance. It is important that the value of shared governance continues to be investigated from different angles. A shared decision making model has been shown to make improvements in fall reduction, development of patient education materials, and nurse retention (Overcash et al., 2012). As a member of the clinical microsystem, each nurse should understand his or her opportunity to make his or her voice heard and take part in decision making that impacts clinical practice and patient care. As decisions are made relating to direct patient care and the patient experience, shared governance becomes another means in which to advocate for our patients on a larger level.

One potential barrier that Overcash et al. (2012) discussed to successful shared governance related to a lack of nurses taking part in these councils. The fewer the number of nurses taking part in shared governance councils the less likely that it is will be successful and continue to exist at that institution. While each healthcare institution must make a financial investment in each nurse that takes part in shared governance due to additional staffing needed for patient care during meetings, the cost is worth it in the long run. Members of a shared decision making model bring back to their units a “solid foundation for a good working environment” (Overcash et al., 2012, p. E3). Through increasing the number of nurses with a role on shared governance councils, this may facilitate engagement and empowerment of other nurses as well. This study suggested that none of the demographic factors alone demonstrated a significant correlation with IPNG scores, and this is a key finding, especially for new graduate nurses. This finding suggests that nurses new to the institution or to nursing in general have the capacity to perceive the concept of shared governance regardless of age or other factors. As new graduate nurses, it is essential that we seek out opportunities for participation in shared governance in order to share the unique nursing perspective of our generation.

Team 13: Mariah Charland, Emily Chambers, Ashley Heiman, Nicole Otey, Kayla Eddins, Hannah Gerwick, Jamie Winters

On 2014 Mar 20, Pedro Reche commented:

We recognized that protein biosynthesis and degradation leaves an indelible trace in the distribution of viral-specific CD8 T cell epitopes throughout the proteomes. This trace led as to identify an ingenious and novel system to control protein expression based on early termination of protein translation. Virus simplicity demands simple solutions and this system explain why in viruses with a single CDS, the structural proteins required for viral assembly are always located at the n-terminal portion of the translated CDS (e.g. capsid proteins) while non-structural proteins are placed towards the c-terminus.

On 2016 Nov 20, Morten Oksvold commented:

An investigation committee at Wayne State University (WSU) recommends that 42 articles from Fazlul Sarkar to be retracted (report finished August 31, 2015). This article represents one of them.

This information was published by Retraction Watch (November 17, 2016) and you can find a link to the full report here:

http://retractionwatch.com/2016/11/17/details-of-investigative-report-into-sarkar-released-by-aclu/

This article should therefore no longer be cited.

On 2013 Jun 29, Andries Zijlstra commented:

A comprehensive review article discussing the method described in this article and its relation to other in vitro migration assay is discussed in PMID: 23038152.

On 2016 Dec 25, Eric Yarnell commented:

The correct authors for this paper are Mao, JF and Xu, HL and Wu, XY and Nie, M and Lu, SY and Xing, HD and Liao, LM. The listing as it is has the given names and family names reversed.

On 2013 Dec 28, Tsuyoshi Miyakawa commented:

Reduction in the number of parvalbumin positive cells is one of the most consistently observed phenomena in the post-mortem brains of the patients with schizophrenia. This excellent paper provides the evidence supporting the idea that the reduction reflects the immaturity of the type of the cells (fast-spiking GABAergic interneurons (FS neurons)), instead of the reduction of the number of the types of the cells. The reduction of perineuronal net, a maturation marker of the neurons, in the postmortem brains of schizophrenia patients (Pantazopoulos H, 2010) is also in line with this idea. This may not be trivial, since, if it is the case, an approach to get them normally mature could be a potential therapeutic strategy. These important findings raise another question. Is such pseudo-immature status of the type of neurons due to maturation failure or de-maturation of the neurons? There are some evidence that FS neurons may undergo de-maturation by some experimental manipulations, such as chronic fluoxetine treatment (Karpova NN, 2011; Ohira K, 2013) and environmental enrichment (Donato F, 2013). Let me also point out that reduction of parvalbumin is associated with pseudo-immaturity of granule cells in the dentate gyrus in adulthood in the mice lacking a transcription factor, schnurri-2 (also known as MHC enhancer binding protein 2 or human immunodeficiency virus type I enhancer binding protein 2 (HIVEP2)) (Takao K, 2013). We consider schnurri-2 KO mice as an animal model of schizophrenia and, in these mice, pseudo-immaturity of granule cells seem to be due to de-maturation (Supplementary Figure 9 in Takao K, 2013). Considering these findings, it is quite possible that the pseudo-immaturity of FS neurons could also be due to de-maturation (, though it is still quite speculative).

On 2017 Feb 26, Michael D Mayers commented:

I've reformatted the spreadsheet of indications from the supplemental materials of this manuscript in an attempt to make it more machine readable. I've added Drugbank IDs and Disease Ontology IDs for as many drugs and genes as possible. The spreadsheet reformatted spreadsheet is available here on Figshare.

On 2013 Oct 31, John Cannell commented:

The authors reported that immune system dysregulation is common in autism spectrum disorder (ASD”. Vitamin D deficiency produces very similar immune dysregulation.

Prietl B, 2013

< PMID:20119827>

< PMID:23359064>

< PMID:20427238>

Thus the vitamin D theory of ASD (vitamin D deficiency being the environmental risk factor for this highly heritable disorder) is consistent with the authors work. Three recent studies, using community controls, have found 25(OH)D levels are significantly lower in children with ASD. Two of the studies below (Mostafa et al and Gong et al) also found ASD severity, as rated on standard ASD rating scales, is inversely correlated with 25(OH)D levels. Mostafa et al found an R value of -.86 for the association of serum 25(OH)D with ASD severity.

Gong ZL, Luo CM, Wang L, Shen L, Wei F, Tong RJ, Liu Y. Serum 25-hydroxyvitamin D levels in Chinese children with autism spectrum disorders. Neuroreport. 2013 Oct 1. Gong ZL, 2014

Meguid NA, Hashish AF, Anwar M, Sidhom G. Reduced serum levels of 25-hydroxy and 1,25-dihydroxy vitamin D in Egyptian children with autism. J Altern Complement Med. 2010 Jun;16(6):641-5. Meguid NA, 2010

Mostafa GA, Al-Ayadhi LY.Reduced serum concentrations of 25-hydroxy vitamin D in children with autism: relation to autoimmunity. J Neuroinflammation. 2012 Aug 17;9:201. Mostafa GA, 2012

There is a plethora of basic science explaining why low gestational or early childhood 25(OH)D levels would adversely effect brain development.

Eyles DW, Feron F, Cui X, Kesby JP, Harms LH, Ko P, McGrath JJ, Burne TH. Developmental vitamin D deficiency causes abnormal brain development. Psychoneuroendocrinology. 2009 Dec;34 Suppl 1:S247-57. doi: 10.1016/j.psyneuen.2009.04.015. Epub . Review. Eyles DW, 2009

DeLuca GC, Kimball SM, Kolasinski J, Ramagopalan SV, Ebers GC. Review: the role of vitamin D in nervous system health and disease. Neuropathol Appl Neurobiol. 2013 Aug;39(5):458-84. doi: 10.1111/nan.12020. DeLuca GC, 2013

Eyles DW, Burne TH, McGrath JJ. Vitamin D, effects on brain development, adult brain function and the links between low levels of vitamin D and neuropsychiatric disease. Front Neuroendocrinol. 2013 Jan;34(1):47-64. doi: 10.1016/j.yfrne.2012.07.001. Epub 2012 Jul 11. Review. Eyles DW, 2013

Furthermore, the vitamin D theory of autism explains most of the epidemiological facts of ASD.

Cannell JJ. On the aetiology of autism. Acta Paediatr. 2010 Aug;99(8):1128-30. Cannell JJ, 2010

Cannell JJ. Autism and vitamin D. Med Hypotheses. 2008;70(4):750-9. Cannell JJ, 2008

70% of American toddlers do not take the American Pediatric Association's recommended vitamin D supplement of 400 IU/day and few toddlers or pregnant women get any sunshine due to the sun scare. As vitamin D fortified milk consumption and sun exposure has declined, so have toddlers and pregnant women’s vitamin D levels. The dramatic increase in the incidence of ASD occurred during the same time vitamin D levels were falling in toddlers and pregnant women.

Cannell JJ. Autism, will vitamin D treat core symptoms? Medical Hypotheses. 2013 Aug;81(2):195-8. Cannell JJ, 2013

Some autism researchers seem cognizant of the entire body of autism research. For example, a group of well-known European ASD researchers, including Professor Christopher Gillberg of the Gillberg Neuropsychiatric Institute, have recently called for the need for “urgent research” into the vitamin D deficiency theory of ASD.

Kočovská E, Fernell E, Billstedt E, Minnis H, Gillberg C. Vitamin D and autism: clinical review. Res Dev Disabil. 2012 Sep-Oct;33(5):1541-50. doi: 10.1016/j.ridd.2012.02.015. Epub 2012 Apr 21.Kočovská E, 2012

Until all autism researchers become cognizant of the wider body of scientific research, we will continue to wonder how to prevent - and perhaps even treat - this modern day plague.

John J Cannell, MD

Vitamin D Council

http://www.vitamindcouncil.org

On 2014 Feb 27, Tom Kindlon commented:

The validity of the measure of self-critical perfectionism employed in this study is questionable for patients with a chronic, disabling, invisible illness

This paper used the self-critical perfectionism (SCP) subscale of the Depressive Experiences Questionnaire (DEQ). The authors describe such perfectionism as "maladaptive perfectionism".

This may be true for some people with primarily psychological disorders, such as those from whom the DEQ was designed (1), but I question it is true for chronic fatigue syndrome (CFS).

Here are the five items that load most strongly on the self-criticism subscale of the DEQ (1):

1. There is a considerable difference between how I am now and how I would like to be.

2. I often feel guilty.

3. The way I feel about myself frequently varies: There are times when I feel extremely good about myself and other times when I see only the bad in me and feel like a total failure.

4. Often, I feel I have disappointed others.

5. I often find that I don't live up to my own standards or ideals.

Unless somebody actually wants to have a disabling condition, which would be an abnormal response, patients with CFS would generally agree with item #1 and the more fatigue and pain they had, the stronger their agreement with it would be.

To a lesser extent, it seems feasible that quite a lot patients with CFS might agree with items 4 & 5 without it necessarily representing maladaptive perfectionism. CFS is a fluctuating and disabling condition so people may say they will do something but don't manage to do it which could disappoint others. Also, their output at home or in the workplace may be lower than previously which might disappoint employers, family members, etc. (2). The invisible nature of the condition can mean that other people can expect quite a lot from somebody. Similarly, with item five, individuals with CFS may not be able to live up to their own pre-illness standards in various ways, for reasons relating to their illness. For example, as mentioned, the symptoms of CFS could can cause financial pressures (not being able to work or work as much) which can impair one's ability to live up to one's standards or ideals in various ways. Impairments from CFS could also more directly impair one's ability to maintain one's home, involve oneself in family life, and indeed most activities one might be involved in.

It would have been more interesting if the investigators had used patients with another disabling illness such as multiple sclerosis or rheumatoid arthritis as a control group to attempt to control for such issues.

References:

1. Depressive Experiences Questionnaire: http://www.mentalhealthce.com/courses/contentHD/secHD15.html

2. Reynolds KJ, Vernon SD, Bouchery E, Reeves WC. The economic impact of chronic fatigue syndrome. Cost Eff Resour Alloc. 2004 Jun 21;2(1):4.

On 2014 Feb 04, Jan H. Duedal Rölfing commented:

Free full-text available: Danish version, English translation

On 2014 Feb 10, Chetan Phadke commented:

This is fantastic work! It would be wonderful to see similar work being replicated in adults with spasticity as well.

Chetan Phadke (Past recipient of grant funding from Allergan Inc.)

On 2013 Oct 31, John Cannell commented:

The authors stated that markers of oxidative stress are present in autism spectrum disorder (ASD). I wonder if the authors are aware that the genes for the antioxidants superoxide dismutase and thioredoxin reductase are directly up-regulated by the secosteroid 1,25 di-hydroxy vitamin D3 (calcitriol). I believe both genes also harbor a vitamin D response element.

Peehl DM, Shinghal R, Nonn L, Seto E, Krishnan AV, Brooks JD, Feldman D. Molecular activity of 1,25‐dihydroxyvitamin D3 in primary cultures of human prostatic epithelial cells revealed by cDNA microarray analysis. J. Steroid Biochem Mol. Biol 2004;92:131–141. PMID:15555907>

Calcitriol also directly up-regulates glutathione reductase and increases glutathione levels.

Jain SK, et alo. Vitamin D upregulates glutamate cysteine ligase and glutathione reductase, and GSH formation, and decreases ROS and MCP-1 and IL-8 secretion in high-glucose exposed U937 monocytes. Biochem Biophys Res Commun. 2013 Jul 19;437(1):7-11. doi: 10.1016/j.bbrc.2013.06.004. Jain SK, 2013

Also, supplemental vitamin D significantly reduces oxidative stress in humans.

Nikooyeh B, et al. Daily intake of vitamin D- or calcium-vitamin D-fortified Persian yogurt drink (doogh) attenuates diabetes-induced oxidative stress: evidence for antioxidative properties of vitamin D.J Hum Nutr Diet. 2013 Jul 5. doi: 10.1111/jhn.12142. Nikooyeh B, 2014

Asemi Z, et al. Vitamin D supplementation affects serum high-sensitivity C-reactive protein, insulin resistance, and biomarkers of oxidative stress in pregnant women. J Nutr. 2013 Sep;143(9):1432-8. doi: 10.3945/jn.113.177550. Asemi Z, 2013

Thus the vitamin D theory of ASD (vitamin D deficiency being the environmental risk factor for this highly heritable disorder) is consistent with the authors work. Three recent studies, using community controls, have found 25(OH)D levels are significantly lower in children with ASD. Two of the studies below (Mostafa et al and Gong et al) also found ASD severity, as rated on standard ASD rating scales, is inversely correlated with 25(OH)D levels. Mostafa et al found an R value of -.86 for the association of serum 25(OH)D with ASD severity.

Gong ZL, Luo CM, Wang L, Shen L, Wei F, Tong RJ, Liu Y. Serum 25-hydroxyvitamin D levels in Chinese children with autism spectrum disorders. Neuroreport. 2013 Oct 1. Gong ZL, 2014

Meguid NA, Hashish AF, Anwar M, Sidhom G. Reduced serum levels of 25-hydroxy and 1,25-dihydroxy vitamin D in Egyptian children with autism. J Altern Complement Med. 2010 Jun;16(6):641-5. Meguid NA, 2010

Mostafa GA, Al-Ayadhi LY.Reduced serum concentrations of 25-hydroxy vitamin D in children with autism: relation to autoimmunity. J Neuroinflammation. 2012 Aug 17;9:201. Mostafa GA, 2012

There is a plethora of basic science explaining why low gestational or early childhood 25(OH)D levels would adversely effect brain development.

Eyles DW, Feron F, Cui X, Kesby JP, Harms LH, Ko P, McGrath JJ, Burne TH. Developmental vitamin D deficiency causes abnormal brain development. Psychoneuroendocrinology. 2009 Dec;34 Suppl 1:S247-57. doi: 10.1016/j.psyneuen.2009.04.015. Epub . Review. Eyles DW, 2009

DeLuca GC, Kimball SM, Kolasinski J, Ramagopalan SV, Ebers GC. Review: the role of vitamin D in nervous system health and disease. Neuropathol Appl Neurobiol. 2013 Aug;39(5):458-84. doi: 10.1111/nan.12020. DeLuca GC, 2013

Eyles DW, Burne TH, McGrath JJ. Vitamin D, effects on brain development, adult brain function and the links between low levels of vitamin D and neuropsychiatric disease. Front Neuroendocrinol. 2013 Jan;34(1):47-64. doi: 10.1016/j.yfrne.2012.07.001. Epub 2012 Jul 11. Review. Eyles DW, 2013

Furthermore, the vitamin D theory of autism explains most of the epidemiological facts of ASD.

Cannell JJ. On the aetiology of autism. Acta Paediatr. 2010 Aug;99(8):1128-30. Cannell JJ, 2010

Cannell JJ. Autism and vitamin D. Med Hypotheses. 2008;70(4):750-9. Cannell JJ, 2008

70% of American toddlers do not take

On 2013 Nov 01, Stephen Turner commented:

Genometa is a computationally efficient software for bacterial species identification from high-throughput short-read metagenomic sequencing data. Older tools for sequence identification required longer read lengths or genome assembly for species identification. Newer tools are capable of community profiling without assembly. However, tools like MEGAN (Huson DH, 2007) rely on basic local alignment search tool (BLAST) searching, which is computationally demanding. Genometa uses the Bowtie aligner, which is orders of magnitude faster. The authors tested the method against a simulated low-complexity dataset and found that Genometa is highly accurate when query species are included in the reference database (otherwise it performs poorly, as would be expected). This software including a graphical user interface is freely available.

On 2014 Aug 26, Elke Hausner commented:

The importance of study registries has increased markedly over the last few years and it is a highly relevant question whether such registries should regularly be used in Cochrane Reviews as an information source for additional relevant studies or data.

In the discussion section van Enst et al. describe the potential limitations of search portals: however, with their statement “... we found that many authors consult Clinicaltrials.gov which is also accessible through both the WHO ICTRP Search Portal and the MetaRegister” they seem to imply that searching directly in Clinicaltrials.gov (CT.gov) might be redundant. We disagree, as in our opinion it is inadequate to solely rely on the search results from the WHO ICTRP Search Portal (ICTRP).

In our daily work as information specialists in a German HTA agency we regularly search study registries and would like to provide some examples here of various problems encountered with ICTRP.

Limited functions: Commonly available functions of study registries, such as the use of brackets to structure searches, are lacking in ICTRP. The newly introduced function to search for synonyms is also disappointing. In comparison with CT.gov, the example of a search for “dolutegravir” shows that this function is also inadequate (synonyms found in CT.gov for dolutegravir: gsk-1349572, tivicay; synonyms found in ICTRP for dolutegravir: dolutegravir OR "DOLUTEGRAVIR").

Incomplete data: On many occasions we found that studies registered elsewhere (e.g. in CT.gov) cannot be found via ICTRP. In our opinion this calls into question the fundamental suitability of this information source. For example, the studies registered in CT.gov with the numbers NCT01006291, NCT00420212, and NCT00688688 currently cannot be found via ICTRP (status: 18 July 2014).

Error messages after complex search queries: When using ICTRP we often found that the system was unstable, thus making searches difficult or even impossible. For example, when entering more complex search queries the website often crashes. In addition, it frequently takes up to a minute for results to be shown, or after waiting an error message appears.

Summary

In our opinion, the problems described above show a structural problem of ICTRP. As long as these deficits persist, when searching for studies of drugs or non-drug interventions we recommend searching CT.gov separately. For studies of drugs, we additionally recommend searching EU-CT, the registry of the European Medicines Agency.

On 2014 Mar 03, Andrea Messori commented:

Overlapping meta-analyses on novel oral anticoagulants in atrial fibrillation

The systematic review by Baker and Phung [1] is probably the most comprehensive analysis presently available on the comparative effectiveness of novel oral anticoagulants in patients with non-valvular atrial fibrillation. One problem for researchers who are interested in this topic is that PubMed now includes 13 meta-analyses or systematic reviews focused on this issue [1-13]. This confirms that a problem exists with multiple overlapping meta-analyses that study the same randomized trials published on the same topic [14,15]. However, there seems to be no simple solution to this problem.

Andrea Messori, HTA Unit, Regional Health Service 50100 Firenze ITALY

1. Baker WL, Phung OJ. Systematic review and adjusted indirect comparison meta-analysis of oral anticoagulants in atrial fibrillation. Circ Cardiovasc Qual Outcomes. 2012 Sep 1;5(5):711-9.
2. Lip GY, Larsen TB, Skjøth F, Rasmussen LH. Indirect comparisons of new oral anticoagulant drugs for efficacy and safety when used for stroke prevention in atrial fibrillation. J Am Coll Cardiol. 2012 Aug 21;60(8):738-46.
3. Sardar P, Chatterjee S, Wu WC, Lichstein E, Ghosh J, Aikat S, Mukherjee D. New oral anticoagulants are not superior to warfarin in secondary prevention of stroke or transient ischemic attacks, but lower the risk of intracranial bleeding: insights from a meta-analysis and indirect treatment comparisons. PLoS One. 2013 Oct 25;8(10):e77694.
4. Assiri A, Al-Majzoub O, Kanaan AO, Donovan JL, Silva M. Mixed treatment comparison meta-analysis of aspirin, warfarin, and new anticoagulants for stroke prevention in patients with nonvalvular atrial fibrillation. Clin Ther. 2013 Jul;35(7):967-984.e2.
5. Biondi-Zoccai G, Malavasi V, D'Ascenzo F, Abbate A, Agostoni P, Lotrionte M, Castagno D, Van Tassell B, Casali E, Marietta M, Modena MG, Ellenbogen KA, Frati G. Comparative effectiveness of novel oral anticoagulants for atrial fibrillation: evidence from pair-wise and warfarin-controlled network meta-analyses. HSR Proc Intensive Care Cardiovasc Anesth. 2013;5(1):40-54.
6. Pink J, Pirmohamed M, Hughes DA. Comparative effectiveness of dabigatran, rivaroxaban, apixaban, and warfarin in the management of patients with nonvalvular atrial fibrillation. Clin Pharmacol Ther. 2013 Aug;94(2):269-76. doi:10.1038/clpt.2013.83.
7. Messori A, Maratea D, Fadda V, Trippoli S. New and old anti-thrombotic treatments for patients with atrial fibrillation. Int J Clin Pharm. 2013Jun;35(3):297-302.
8. Messori A, Maratea D, Fadda V, Trippoli S. Comparing new anticoagulants in atrial fibrillation using the number needed to treat. Eur J Intern Med. 2013 Jun;24(4):382-3.
9. Harenberg J, Marx S, Wehling M. Head-to-head or indirect comparisons of the novel oral anticoagulants in atrial fibrillation: what's next? Thromb Haemost. 2012 Sep;108(3):407-9.
10. Schneeweiss S, Gagne JJ, Patrick AR, Choudhry NK, Avorn J. Comparative efficacy and safety of new oral anticoagulants in patients with atrial fibrillation. Circ Cardiovasc Qual Outcomes. 2012 Jul 1;5(4):480-6.
11. Skjøth F, Larsen TB, Rasmussen LH. Indirect comparison studies--are they useful? Insights from the novel oral anticoagulants for stroke prevention in atrial fibrillation. Thromb Haemost. 2012 Sep;108(3):405-6.
12. Testa L, Agnifili M, Latini RA, Mattioli R, Lanotte S, De Marco F, Oreglia J, Latib A, Pizzocri S, Laudisa ML, Brambilla N, Bedogni F. Adjusted indirect comparison of new oral anticoagulants for stroke prevention in atrial fibrillation. QJM. 2012 Oct;105(10):949-57.
13. Mantha S, Ansell J. An indirect comparison of dabigatran, rivaroxaban and apixaban for atrial fibrillation. Thromb Haemost. 2012 Sep;108(3):476-84.
14. Moher D. The problem of duplicate systematic reviews. BMJ. 2013 Aug 14;347:f5040. doi: 10.1136/bmj.f5040.
15. Siontis KC, Hernandez-Boussard T, Ioannidis JP. Overlapping meta-analyses on the same topic: survey of published studies. BMJ. 2013 Jul 19;347:f4501. doi: 10.1136/bmj.f4501.

On 2013 Nov 24, John Sotos commented:

To the Editor:

Art succeeds only when different people see different things in the same artwork.

Thus, in Clarence Carter’s striking “Port Huron” painting Dr. Torpy sees “abstractly designed clouds” of ovoid shape and uncertain genesis that raise questions about death, infinity, and consciousness (1).

Meteorologists, however, will see clouds of the uncommon “mamma” type, as found on the underside of an unstable “anvil” cloud. The ovoid, down-hanging shape inherent in their name arises from powerful downdrafts that have reached the base of the anvil. Supercell storms frequently display such features (2), which can serve as a warning to aviators. The internet has many photographs of mamma clouds (3).

(1) Torpy JM. The cover. JAMA. 2012; 308: 744.

(2) Wilcox EM. Clouds. London: Duncan Baird Publishers, 2008. Pages 41-43, 160.

(3) http://www.crh.noaa.gov/pah/?n=may2410isolated http://dnr.ne.gov/floodplain/mitigation/FEMA1590.html http://www.srh.noaa.gov/jetstream/synoptic/mam.htm http://www.crh.noaa.gov/ind/other_links.php

On 2013 Oct 23, Chris Del Mar commented:

We appraised this using the FAST mnemonic.

‘F’ind seemed odd: few hits for such a search, (~1000 hits, not including some presumed overlap); ‘A’ppraisal was apparently secure: only RCTs were included, (however little was offered in the form of critically appraising the included studies for methodological rigour); ‘S’ynthesis reaped a major flaw: the studies were meta-analysed in forest plots by changes from baseline – not against the controls. This explains the greater effect sizes than expected, and probably represents a fatal flaw: in effect, only the intervention arms of the RCTs were included in a before-after comparison; ‘T’ransfer of the results was therefore not really applicable.

What should we do?

1 this is a very good teaching tool (a bad example, to see if students can pick the flaws, and a lesson that not all SRs are good!);

2 perhaps this topic needs systematically reviewing properly (if not done already);

3 should we write to the journal to set out the flaw? Perhaps we are probably too late to send in a corrective response.

On 2015 Jul 27, Arnaud Chiolero MD PhD commented:

A very well written paper showing how DAGs can help you understand complex causal patterns mixing confounding, mediation and collider stratification bias.

On 2015 Jan 11, Christopher Southan commented:

Could the authors please confirm that http://www.chemspider.com/Chemical-Structure.29785291.html depicts the correct structure GKT137831? RGYQPQARIQKJKH-UHFFFAOYSA-N

On 2016 Mar 18, ZHONGMING ZHAO commented:

My lab recently moved to the University of Texas Health Science Center at Houston. The web site for this database is now available at https://bioinfo.uth.edu/DTome/.

On 2014 Nov 25, Harri Hemila commented:

The paper has been commented on at the BMJ pages, see: http://heart.bmj.com/content/98/22/1615.responses.

On 2016 Apr 05, Marko Premzl commented:

The third party data gene data set of eutherian interferon-γ-inducible GTPase genes FR734011-FR734074 was deposited in European Nucleotide Archive under research project "Comparative genomic analysis of eutherian genes" (https://www.ebi.ac.uk/ena/data/view/FR734011-FR734074). The 64 complete coding sequences were curated using tests of reliability of eutherian public genomic sequences included in eutherian comparative genomic analysis protocol including gene annotations, phylogenetic analysis and protein molecular evolution analysis (RRID:SCR_014401).

Project leader: Marko Premzl PhD, ANU Alumni, 4 Kninski trg Sq., Zagreb, Croatia

E-mail address: Marko.Premzl@alumni.anu.edu.au

Internet: https://www.ncbi.nlm.nih.gov/myncbi/mpremzl/cv/130205/

On 2014 Jan 31, Huiqi Qu commented:

Insulin resistance is an important public health issue in Mexican Americans .

On 2015 Jan 29, Andrea Messori commented:

Clinical trials evaluating interferon-free treatments for previously untreated genotype 1 hepatitis C infection: state of the art in 2015

Fadda V, Messori A. Hta Unit, Regional Health Service, 50100 Firenze (Italy)

After the publication of the review by Doyle and co-workers (2013), numerous clinical trials have been conducted to evaluate interferon-free treatments for previously untreated hepatitis C infection. To retrieve these trials, we carried out a literature search based on the following criteria: a) enrolment of previously untreated patients with genotype 1 infection; b) administration combination treatments approved by EMA; c) end-point represented by sustained virologic response at the 12th week after completion of treatment (SVR12). Our search was exclusively based on the PubMed version of MEDLINE. The keywords for our initial search were intentionally generic (HCV OR “hepatitis C” combined with the filters of Clinical Trials and period from 2010 to 2014). Among the records extracted through our initial search (N=823), a subgroup of clinical trials (N=24) was selected that evaluated interferon-free treatments. After reading the full text of these 24 articles, we identified the studies that met the inclusion criteria set for our analysis. Our search on PubMed was run on 31 December 2014. The main characteristics of these trials are presented in Table 1.

Table 1. Rates of SVR12 achievement reported in 10 clinical trials (trials are identified based on first author, year of publication, and treatment; rates are reported in parenthesis).

1. Afdal, 2014: SOF/LED-12w (211/214)
2. Feld, 2014 (genotype 1 a): ARIODR-12w (307/322)
3. Feld, 2014 (genotype 1 b): ARIODR-12w (148/151)
4. Ferenci, 2014 (genotype 1 a): ARIOD-12w (185/205) and ARIODR-12w (97/100)
5. Ferenci, 2014 (genotype 1 b): ARIOD-12w (207/209) and ARIODR-12w (209/210)
6. Kowdley, 2014: ARIOD-12w (70/79) and ARIODR-12w (76/79)
7. Kowdley, 2014 (ION-3 trial): SOF/LED-12w (206/216) and SOF/LED-8w (202/215)
8. Lawitz, 2014 (LONESTAR trial): SOF/LED-12w (18/19) and SOF/LED-8w (19/20)
9. Poordad, 2014: ARIODR-12w (191/208)
10. Sulkowsky, 2014: SOF/DAC-12w (41/41)

Abbreviations: w, weeks: ARIODR-12w, ABT-450/ ritonavir/ombitasvir/dasabuvir/ribavirin for 12w; ARIOD-12w, ABT-450/ ritonavir/ombitasvir/dasabuvi for 12w; SOF/DAC-12w, sofosbuvir+daclatasvir for 12w; SOF/LED-8w, sofosbuvir+ledipasvir for 8w; SOF/LED-12w, sofosbuvir+ledipasvir for 12w . Note 1: Trials that reported separate results for patients with genotype 1a and 1b are presented seprately. Note 2: The following combinations treatments, that have been tested in naïve patients with genotype 1 infection, were not included in the above table: daclatasvir+asunaprevir for 24 w; beclabuvir+daclatasvir+asunaprevir for 12w; beclabuvir+daclatasvir+asunaprevir for 24w; sofosbuvir+simeprevir for 24w; sofosbuvir+simeprevir+ribavirin for 12w; sofosbuvir+simeprevir+ribavirin for 24w; sofosbuvir+ledipasvir+ribavirin for 8w; sofosbuvir+daclatasvir for 24w.

References

-Afdhal N, Zeuzem S, Kwo P, et al. Ledipasvir and sofosbuvir for untreated HCV genotype 1 infection. N Engl J Med. 2014 May 15;370(20):1889-98.

-Doyle JS, Aspinall E, Liew D, Thompson AJ, Hellard ME. Current and emerging antiviral treatments for hepatitis C infection. Br J Clin Pharmacol. 2013 Apr;75(4):931-43. doi: 10.1111/j.1365-2125.2012.04419.x.

-Feld JJ, Kowdley KV, Coakley E et al. Treatment of HCV with ABT-450/r-ombitasvir and dasabuvir with ribavirin. N Engl J Med. 2014 Apr 24;370(17):1594-603.

-Ferenci P, Bernstein D, Lalezari J et al. ABT-450/r-ombitasvir and dasabuvir with or without ribavirin for HCV. N Engl J Med. 2014 May 22;370(21):1983-92.

-Kowdley KV, Gordon SC, Reddy KR et al. Ledipasvir and sofosbuvir for 8 or 12 weeks for chronic HCV without cirrhosis. N Engl J Med. 2014 May 15;370(20):1879-88.

-Kowdley KV, Lawitz E, Poordad F et al. Phase 2b trial of interferon-free therapy for hepatitis C virus genotype 1. N Engl J Med. 2014 Jan 16;370(3):222-32.

-Lawitz E, Poordad FF, Pang PS et al. Sofosbuvir and ledipasvir fixed-dose combination with and without ribavirin in treatment-naive and previously treated patients with genotype 1 hepatitis C virus infection (LONESTAR): an open-label, randomised, phase 2 trial. Lancet. 2014 Feb 8;383(9916):515-23.

-Poordad F, Hezode C, Trinh R et al. ABT-450/r-ombitasvir and dasabuvir with ribavirin for hepatitis C with cirrhosis. N Engl J Med. 2014 May 22;370(21):1973-82.

-Sulkowski MS, Gardiner DF, Rodriguez-Torres M et al. Daclatasvir plus sofosbuvir for previously treated or untreated chronic HCV infection. N Engl J Med. 2014 Jan 16;370(3):211-21. doi: 10.1056/NEJMoa1306218. Erratum in: N Engl J Med. 2014 Apr 10;370(15):1469.

On 2013 Dec 23, Wichor Bramer commented:

A comment on this article has appeared in Bramer WM, 2012. However this comment was not linked to the original article because of a mistake by the journal editors.

On 2014 Jan 08, Brett Snodgrass commented:

Dear Authors,

Thank you for the excellent article. Might the connection to the right ventricle represent a vessel of Wearn?

Might the vessel of Wearn have disrupted vasculogenesis?

http://www.sciencedirect.com/science/article/pii/S1054880712001561

Comments and suggestions are welcome here, through Twitter, or via E-mail brettsnodgrass@hotmail.com

https://twitter.com/BrettSnodgrass1/status/418812162203607040/

Thank you kindly.

On 2014 Jan 08, Brett Snodgrass commented:

Dear Authors,

Thank you for the excellent article.

Might figure 2b exhibit an arteriosinusoidal vessel of Wearn? This particular vessel of Wearn is presumably unusually prominent and may be clinically classified as a fistula.

http://bit.ly/JTWearn

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC555823/

For additional commentary related to the vessels of Wearn, please see https://twitter.com/BrettSnodgrass1/status/418788476016791552

Comments and suggestions are welcome.

Thank you kindly.

On 2014 Jan 12, Christian Frech commented:

GPHMM authors comment on their project home page (http://bioinformatics.ustc.edu.cn/gphmm/) on the performance of GPHMM in this comparison:

"We would like to point out critical errors found in a recently paper "Comparison of methods to detect copy number alterations in cancer using simulated and real genotyping data" published in BMC Bioinformatics with PMID 22870940, which was trying to compare different computational approaches including the GPHMM method.

As demonstrated in the GPHMM paper, we showed the superior performance of GPHMM on a cell-line dataset (see Figure 1,2,3 and Table 2 in the paper). However in this BMC paper, we found that the authors evaluated our method with the same dataset, but claimed that GPHMM failed to recognize the alteration pattern in the cell-line samples. Astonished by this apparent contradiction, we contacted them and later it became clear that during the test they WRONGLY replaced an important data file (“hhall.hg18_m.pfb”) in the tool package with another file used in their study.

Given the fact that this is a survey paper trying to accurately compare different methods and provide unbiased guidance to readers and the conclusion they made will pose influence on user's final choice of method in their studies, we suggested them to retest GPHMM and update their results. Unfortunately, except an ambiguous statement in the text saying “the baseline shift can be correctly estimated if a PFB with a modified specification is used”, we found the results and conclusion were not changed at all in the final version of this paper. Therefore, we argue that the performance of GPHMM is significantly underestimated in this paper."