10,000 Matching Annotations
  1. May 2022
    1. SciScore for 10.1101/2022.05.27.493693: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: This study was performed in accordance with the guidelines for the care and use of laboratory animals published and approved by the Committee for Ethics on Animal Experiments and the Committee for Animal Biosafety Level 3 Research of the Egyptian Military Scientific Commission.<br>Euthanasia Agents: Doses were mixed with Fc of IgG mouse anti-Human IgM added as an adjuvant immunogen dissolved in human albumin, phosphate buffer, and sodium chloride without any stabilizers or preservatives.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">For the production of different IC antibodies, twenty-four male rabbits were divided into six groups (numbered 1 through 6), each comprising four rabbits.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mice were randomly divided into twelve groups, five mice per group, and classified into two categories.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">nucleocapsid antibody, and membrane antibody (by AMSBIO) were procured, diluted with 1 ml of PBS; i.e. (1/400, 1/200, 1/100, 1/50, 1/25) and incubated at room temperature for at least 2 hours. 1.6. Preparation of Immune Complexes: Two different modes of immune complexes formulation were used in which mixing of a specific concentration of an antigen with its relevant concentration of an antibody took place and named A1, A2, A3, B1, and B2, where A1, A2, and A3 constitute the CRCx3 series and B1 and B2 constitute the CRCx2 series.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The first mode (a non-specific mixture composed of coronavirus antigens and their non-specific antibodies) included SARS-CoV-2 spike protein (S1 subunit) with anti-nucleocapsid antibodies (A1), nucleocapsid antigen (N) with anti-membrane antibodies (A2) and membrane antigen (M) with anti-spike antibodies (A3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S1 subunit ) with anti-nucleocapsid antibodies ( A1) , nucleocapsid antigen ( N ) with anti-membrane antibodies ( A2 ) and membrane antigen ( M</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The second mode (a specific mix composed of coronavirus antigens and their specific antibodies) included spike antigen (S1) with anti-spike antibodies (B1), and nucleocapsid antigen (N) with anti-nucleocapsid antibodies (B2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>spike antigen ( S1 ) with anti-spike antibodies ( B1)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>nucleocapsid antigen ( N ) with anti-nucleocapsid antibodies ( B2)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To finalize the complex preparations (A1, A2, A3, B1, and B2) for inducing anti-complex antibodies production in immunized rabbits, 3 ml of the adjuvant goat IgG anti-human IgM Fc (5 ng/ml) (by ABCAM, Cambridge, UK) was dissolved in human albumin and phosphate-buffered normal saline added to the remainder of the sediments and packaged in 1 ml vials of injectable solution with labels (See Supplement: Fig. 4). 1.7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-complex</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Six weeks later, all vaccinated animals were bled and, from their sera, anti-complex precipitated globulin antibodies were collected.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-complex precipitated globulin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Each group of rabbits produced 15 ml of immune serum (200 mg) containing antibodies to the immune complexes A1, A2, A3, B1, or B2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The amounts of anti-complex antibodies precipitated from each rabbit’s sample are then estimated according to the different concentrations of injected complexes mixtures by ELISA. 1.9. ELISA Assay of Produced Immune Complexes Antibodies: For quantitative titration of anti-immune-complexes produced from experimental rabbits’ sera to the different immune complexes formulae, an ELISA assay was performed by coating each one of five 96-well plates with a specific immune complex of A1, A2, A3, B1, or B2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-immune-complexes</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Component B is an anti-complex-antibodies standard calibrator: 5, 10, 20, 30, 40, and 50 μg/ml (previously prepared from rabbits’ sera) for each of the immune complexes (A1, A2, A3, B1, or B2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Also, from day zero, blood samples were taken on days 14, 28, 42 & 56 to measure serum immunological markers and anti-complexes antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-complexes</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sera optical density at 450 nm was measured and the levels of anti-CRCx3 and anti-CRCx2 neutralizing antibodies (NAbs) were evaluated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CRCx3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CRCx2 neutralizing antibodies ( NAbs )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Increasing serum anti-ICs antibody titers in vaccinated mice was monitored from the beginning and after days 14, 28, 42 & 56 (ELISA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ICs</div><div>suggested: (Kadrmas JL; J Cell Biol. 2004 Cat# ics, RRID:AB_2568207)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The highest produced NAb was Anti-B1 produced against the immune complex of the spike protein and its specific anti-spike antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-B1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, the infected T-helper cell will send signals to excite the B-cells to produce a number of immune antibodies to attach to the viral antigens that are configured by the respiratory cells, thus forming a circulating immune complex that comprises coronavirus antigen (M, N, and S and its specific neutralizing antibody as IC1, IC2, and IC3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IC2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IC3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CRCx was formulated with twenty-five micrograms (25 μg) of different antigens including spike protein (S1 subunit), nucleocapsid (N), or membrane antigen (M) as well as forty micrograms (40 μg) of different antibodies including anti-nucleocapsid, anti-membrane or anti-spike (S1 subunit) antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nucleocapsid, anti-membrane or anti-spike (S1 subunit)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The main aim of this novel immune peptide CRCx is to stimulate the CD8+ T-cells against the foreign antigenic non-complexes as well as any other hidden circulating immune complex form with any antigenic similarity (antigen/specific-antibodies) and to put the whole immunity system on alert and restoring its normal functions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigenic similarity</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The results also did not find the vaccine to cause antibody-dependent enhancement (ADE) [66] as all the data obtained in this study support the safety and immunogenicity of this candidate vaccine series.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-dependent enhancement (ADE) [66</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antigen/nonspecific-antibody-IC vaccine series needs more experiments to validate our primary hypothesis that they may prompt more potent and more long-lasting protection against mutating versions of SARS-Cov-2 as results showed that within the time limit of this trial, the antigen/specific-antibody-IC vaccine series produced higher NAbs against the vaccine ICs. 1.4. Conclusion: The new immune complex (IC) anti-SARS-Cov-2 candidate vaccine CRCx is composed of 5 different combinations: a series of three antigen/nonspecific-antibody termed (CRCx3) and two antigen/specific-antibody termed (CRCx2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen/nonspecific-antibody-IC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antigen/specific-antibody-IC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-Cov-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CRCx2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">However, again, the highest titer in these groups was seen with the high dose CRCx3 subtype composed of spike and its nonspecific antibody of anti-nucleocapsid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nucleocapsid</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Conclusively, according to the results, the spike antigen/anti-spike specific-antibody combination of CRCx2 gives the highest immunogenicity against Covid-19 virus infection both as a prophylaxis and as a therapy.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen/anti-spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In addition, even though both vaccines were found to significantly reduce or abolish viral load and broncho-alveolar effects in animal models challenged with SARS-CoV-2 within 14 days after receiving the booster dose of the vaccines with no signs of pneumonia in histopathological sections of the virus-challenged animals after vaccination, a higher preference was found to the double-dose antigen-specific-antibody (CRCx2) series and/or those from both CRCx series with the spike protein antigen.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific-antibody (CRCx2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cells with an average population of 104 cells were cultured for 18–24 h in each well in the growth medium [Eagle’s Minimum Essential Medium (EMEM)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The genomic content of Vero cells of each well with the minimal number of plaques was extracted for further molecular characterization.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Trail 2: For 14 days, starting on the day 15 from primary immunization in trail 1, the BALB/c mice of groups A, B, C, D, E, and F were intramuscularly challenged in the upper leg with a daily dose/mouse of 0.25 ml (total of 108 IU) of live SARS-Cov-2 virus to which 5 IU of DNA polymerase was added.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(Lonza Bioscience) +L</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Lonza Bioscience</div><div>suggested: (Science Exchange, RRID:SCR_010620)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: The SPSS software Version 25 was used to analyze the level of significance, using one-way ANOVA, paired t-test (2-tailed), and Pearson’s correlation methods.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.25.22273991: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RNA Extraction of STAT samples at LIC R&D site: Reagent plates including binding plate, wash plate, 80% ethanol plate, and elution plate are prepared in advance for RNA extraction using ThermoScientific KingFisher Flex instrument.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoScientific KingFisher</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequencing STAT samples: A separate STAT pipeline was established at LIC in order to process high priority patient swabs sent directly from hospital emergency departments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAT</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Genome assembly and variant calling: For each specimen, sequencing adapters are first trimmed using Trim Galore v0.6.634, then aligned to the SARS-CoV-2 Wuhan-Hu-1 reference genome (NCBI Nucleotide NC_045512.2) using BWA MEM 0.7.17-r118835.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Trim Galore</div><div>suggested: (Trim Galore, RRID:SCR_011847)</div></div><div style="margin-bottom:8px"><div>BWA</div><div>suggested: (BWA, RRID:SCR_010910)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.26.22275641: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.25.493484: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.25.22275614: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics Statement: We submitted all study materials to the Georgetown University Institutional Review Board for ethical review.<br>Consent: As the study was granted exemption, informed consent was not required to be obtained.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used Microsoft Excel and STATA v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      These mechanisms for collaboration and communication should also be tested using robust simulation exercises that could help identify weaknesses, ambiguities, and bottlenecks [31]. This study and its results suffer from several limitations. First, and most significantly, the results relied on the completion of a survey by one individual. While we attempted to distribute the survey to the local authority who would be most knowledgeable about epidemic and pandemic preparedness in the city, we cannot guarantee that the data captured by responses are completely valid or factual. One person’s knowledge regarding all of the preparedness efforts, activities, and arrangements in their city may be limited. For instance, a majority of survey participants had served in their current professional role for one to four years and may not have been aware of preparedness efforts in their city before this time. Future research may wish to more deeply examine preparedness efforts in specific cities or to validate the results of this study by reviewing the legislation, regulations, and other legal frameworks that provide the foundation for public health preparedness and coordination between levels of government. Additionally, the specific results from each city are unlikely to hold great amounts of external validity. The governance contexts in which participating cities exist vary widely, and it would be inappropriate to generalize results across contexts without examining the specific authoriti...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.25.22275599: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The ordering of the statements in the involvement and attitude scales was randomised to avoid bias in responses.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were conducted using SPSS [29].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.26.493517: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike proteins were captured through their C-terminal His-tag over an anti-His antibody surface.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For each residue within the RBD, the frequency of antibody recognition was calculated as the number of contact antibodies32.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibodies32</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The structures of antibody-spike complexes for modeling were also obtained from PDB (7L5B (2-15), 6XDG (REGN10933), and 7KMG (LY-CoV555)).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REGN10933</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Heavy chain variable (VH) and light chain variable (VL) genes for each antibody were synthesized (GenScript), then transfected into Expi293 cells (Thermo Fisher Scientific), and purified from the supernatant by affinity purification using rProtein A Sepharose (GE).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A14527); Vero-E6 cells were obtained from the ATCC (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CRL-1586); HEK293T cells were obtained from the ATCC (CRL-3216).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization curves and IC50 values were derived by fitting a nonlinear five-parameter dose–response curve to the data in GraphPad Prism v.9.2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PyMOL v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.24.22275467: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">anti-SARS-CoV-2-S anti-receptor binding domain (RBD) pan immunoglobulin assay (units/mL, approximately 1:1 with World Health Organization binding antibody units [BAU]).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2-S anti-receptor binding domain ( RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Additionally, the Meso Scale Diagnostics (MSD, Rockville, MD) research assay was used to measure anti-RBD and anti-nucleocapsid (anti-N) binding antibody via the V-PLEX COVID-19 Respiratory Panel 3 Kit at 1:5000 dilution per manufacturer’s protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-nucleocapsid</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-N</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were conducted on Stata/SE 17.0 (College Station, TX) and Microsoft Excel (2019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      A limitation of this study is that includes a small, heterogeneous sample. While this study aims to capture the real-life efficacy of T+C, the true effect of T/C is difficult to capture due to confounding factors from varying vaccination timeline, SARS-CoV-2 infection status, and other monoclonal antibody injections. Another limitation is the lack of long-term follow-up to assess rates of clinical breakthrough and safety. The study relied on participant surveys sent out a week after T+C doses and unsolicited patient self-reported to assess the safety and clinical breakthrough. Considering that preliminary safety and breakthrough data revealed events months after injections, future studies should be conducted on the long-term safety and breakthrough rate of T+C, particularly in SOTRs as their interaction with T+C has been understudied. T+C is a reasonable complementary strategy to vaccination in high-risk SOTRs to improve neutralizing capacity against select Omicron sublineages. Assessment of the real-world efficacy and safety of T+C in SOTR is of utmost importance, since SOTRs face heightened risks of severe illness or death from COVID-19 and since only few SOTRs were included in the PROVENT trial. Studies such as ours incorporating both clinical and laboratory data offer valuable insights into the real-world efficacy and safety of T+C in one of our most vulnerable population. Further research examining the durability of neutralization against emerging Omicron sublineages is ...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.25.22275006: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The WCG Institutional Review Board approved this study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was performed using SAS Enterprise Guide version 7.15 and visualizations in R statistical software version 4.0.5 (R Project for Statistical Computing).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>R Project for Statistical</div><div>suggested: (R Project for Statistical Computing, RRID:SCR_001905)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Limitations: These overuse measures are indicators of low-value care, and are limited by the diagnostic information available in claims data. We used measures from the Lown Institute overuse metric that had a specific denominator cohort.7 We did not include the two measures from this metric that have a denominator of all patients at the hospital over the selected time period (inferior vena caval filters and renal stenting). We adjusted for and investigated state-level beneficiary counts and COVID-19 incidence rates. A more granular approach could have used counts at the hospital referral region or county level and explored within and across region differences. COVID-19 incidence at more local regional levels may be more predictive of overuse or patient volumes than at the state level. This could be future research built from this current study, which presents a more high-level overview of specific denominator and numerator overuse measure rates throughout 2020. This study only investigated the impact on services through 2020. By the end of 2020, the US was entering another COVID-19 surge that lasted most of the winter. Later in 2021, the COVID-19 Omicron variant wave caused another surge in cases and hospitalizations. The changes to denominator and overuse rates of these measures may be different during each pandemic stage. Conclusions: For most investigated overuse measures, we observed the largest decrease in overuse rates during the COVID-19 shutdown period. These were lar...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.25.22275586: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">We aimed to find, assess and synthesize all randomized controlled trials (RCTs) of severe or critical COVID-19 and acute hypoxemic respiratory failure (AHRF).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      There are several limitations in the included RCTs that should be considered alongside the findings. There was no evidence located for use of non-invasive ventilation strategies in infants or children or important subpopulations (e.g., pregnant women), very limited evidence to support the specific use of named interfaces for the ventilation strategies considered (e.g., nasal cannula, simple face mask, venturi mask, oronasal, helmet or other), and only one RCT reported patient-important outcomes. The hospital LOS data are challenging to interpret as competing risk for death may not have been appropriately accounted for in most RCTs, or it is not possible to assess how competing risk was handled in an RCT66. In the set of included RCTs, the LOS outcomes are generally either secondary or exploratory outcomes, and as such, the estimates presented may be confounded by death. The LOS data for survivors and non-survivors is rarely presented. Patient heterogeneity was noted by Perkins et al. in the pragmatic RECOVERY-RS RCT but not explored in-depth41. Owing to the rapid synthesis approach, there was no formal extraction or synthesis of harm outcomes. When non-invasive ventilation supports are considered, potential benefits must be consiered alongside any conceivable harms. Use of ventilation strategies could delay other clinical intervention that could lead to worsening patient prognosis, cause discomfort to the patient during use, or result in surficial wounds or pressure sores whe...


      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04326075</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Early CPAP in COVID-19 Patients With Respiratory Failure.</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04381923</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Withdrawn</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">COVIDNOCHE Trial (HFNO Versus CPAP Helmet) in COVID-19 Pneum…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04507802</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Not yet recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Helmet vs Face Mask in Patients With Acute Respiratory Distr…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04667923</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Noninvasive Ventilation in Moderate-to-severe COVID-19-assoc…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04477668</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Helmet Non-Invasive Ventilation for COVID-19 Patients</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04390191</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Terminated</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Early CPAP in COVID-19 Confirmed or Suspected Patients</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04395807</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Terminated</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Helmet CPAP Versus HFNC in COVID-19</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04655638</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">HFNT vs. COT in COVID-19</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.26.22275631: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the institutional review board of the University of Hong Kong / Hospital Authority Hong Kong West Cluster (reference no. UW 20-493).<br>Consent: Given the extraordinary nature of the COVID-19 pandemic, individual patient-informed consent was not required for this retrospective cohort study using anonymized data.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Up to ten control patients were randomly matched with each of the case according to age (within the same year), sex, date of COVID diagnosis (within the same date), Charlson Comorbidity Index (CCI), and full SARS-CoV-2 vaccination (with at least two doses of Comirnaty or three doses of CoronaVac).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were performed using Stata version 17 (StataCorp LP, College Station, TX).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Nevertheless, a number of study limitations should be acknowledged. Firstly, residents at the RCHE were excluded from the current analysis because of substantial missing records, complex referral patterns between different levels and categories of treatment facilities and/or prolonged delays in oral antiviral prescription during the peak of this pandemic wave. Further studies are needed to examine the real-world safety and effectiveness of oral antivirals in specific healthcare settings, for instance, nursing homes and residential care facilities. Secondly, indication bias could not be eliminated in the prescription of oral antivirals, as reflected by the considerably older age and lower percentage of patients who had been fully vaccinated among oral antiviral users than matched controls at baseline. Indication bias might also be present in the clinical decision to prescribe molnupiravir versus nirmatrelvir/ritonavir, as the latter could be confounded by its significant drug-drug interactions. After matching, patient characteristics between oral antiviral and respective control groups were well balanced at baseline. Thirdly, some information biases might exist in the collection of data during the peak of this pandemic wave, such as the self-reporting of COVID-19 cases based on positive RAT with varying sensitivity. Lastly, there might have been an underreporting of COVID-19 cases during the study period, and the overwhelmed public healthcare system might have prevented some p...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.26.22275585: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Participants provided informed consent (recorded digitally on the survey platforms).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Strengths and limitations: LCSS was informed by theory and other stigma scales, co-designed with people with Long Covid and validated in a large UK sample, and takes less than 10 minutes to complete. This study has two notable limitations. First, the convenience non-probability sampling limits generalisability: university-educated white women from England are over-represented, and this may have resulted in an under- or over-estimation of Long Covid stigma. Women and ethnic minorities may be more stigmatised by other similar conditions such as ME/CFS or fibromyalgia(39), though there is little quantitative evidence to support this. The survey did not include patients hospitalised with COVID-19 in the first two weeks of illness, indicating severe acute disease. Stigma levels could be higher in this group as they may have a higher prevalence of prolonged ongoing symptoms(40), or could be lower due to legitimisation of their illness given by the severity of its acute stage. However, the community sample renders this study unique within a largely clinical evidence-base where diagnostic coding for Long Covid remains patchy and inconsistent due to varying knowledge and the absence of specific guidelines(41). The social media recruitment strategy aimed to include an underrepresented group of people living with Long Covid – those not actively engaged with the healthcare system. Second, stigma is a non-pathological construct and measurements do not have standardised diagnostic criteria...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.25.22275300: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics statement: This study was performed in accordance with the Declaration of Helsinki and approved by the corresponding Institutional Review Board (PR(AG)212/2020) of the Vall d’Hebron University Hospital (HUVH), Barcelona, Spain.<br>Consent: Written informed consent was provided by all patients recruited to this study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, anti-CD3 (BV650, BD Biosciences) and anti-CD45 (BV605, BD Biosciences) antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD45</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were subsequently fixed and permeabilized using the FoxP3 Fix/Perm kit (BD Biosciences) and stained with anti-IL-4 (PE-Cy7, eBioscience), anti-IL-10 (PE, BD Biosciences), anti-T-bet (BV421, Biolegend) and anti-IFNγ (AF700, Invitrogen) antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IL-4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>PE-Cy7</div><div>suggested: (Bioss Cat# bs-0698R-PE-Cy7, RRID:AB_11041615)</div></div><div style="margin-bottom:8px"><div>anti-IL-10</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-T-bet ( BV421</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IFNγ</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell surface antibody staining included anti-CD3 (Per-CP), anti-CD4 (BV605) and anti-CD56 (FITC) (all from BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD56</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 serology: The serological status of patients included in this study was determined in serum samples using two commercial chemiluminescence immunoassays (CLIA) targeting specific SARS-CoV-2 antibodies: (1) Elecsys Anti-SARS-CoV-2 (Roche Diagnostics, Mannheim, Germany) was performed on the Cobas 8800 system (Roche Diagnostics, Basel, Switzerland) for the determination of total antibodies (including IgG, IgM, and IgA) against nucleocapsid (N) SARS-CoV-2 protein; and (2) Liaison SARS-CoV-2 TrimericS IgG (DiaSorin, Stillwater, MN) was performed on the LIAISON XL Analyzer (DiaSorin, Saluggia, Italy) for the determination of IgG antibodies against the spike (S) glycoprotein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA ) against nucleocapsid ( N</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To neutralize contaminating VSV*ΔG(Luc)-G particles cells were incubated overnight in media containing 10% of the supernatant from the I1 hybridoma (ATCC CRL-2700), containing anti-VSV-G antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-VSV-G</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells were transfected with 3µg of the omicron plasmid (pcDNA3.1 omicron).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: KCB Cat# KCB 200744YJ, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next day, viral particles were harvested and titrated in VeroE6 cells by enzyme luminescence assay (Britelite plus kit; PerkinElmer).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses: Flow cytometry data was analyzed using FlowJo v10.7.1 software (TreeStar).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data and statistical analyses were performed using Prism 8.0 (GraphPad Software, La Jolla, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.25.22275487: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Daily vaccination rates of BioNTech and CoronaVac were collected from the COVID-19 Thematic Website [</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioNTech</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Limitations: Some limitations exist in our study. First, the study mainly focus on the disease transmissibility while not explore the impact of vaccine or seasonal factors on disease severity. Second, the number of total infections may be underestimated since the proportion of cases that are underreported is largely unknown when the testing capacity is limited. Therefore, we attempted to capture the changes in underreporting and reporting delay in our modelling. Third, model validation may be sensitive to the assumption of the protectiveness of vaccine or natural infections. Here the data used in our study were based on a published empirical study without age stratification [7]. Conclusion: A recent work has suggested a striking effect of temperature on the spread of COVID-19 [10]. Here, we found that temperature was associated with a larger impact on the transmissibility than strict public health interventions without lockdown throughout a significant outbreak in a single city. Incorporating seasonal variation in temperature can improve the accuracy of modelling of SARS-CoV-2 transmission, which helps to find a balance between normal life and low health impact.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.25.22275592: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">35 Exposure and Outcomes: Pregnant women exposed to the pandemic restrictions during the first and second waves between March 1, 2020, and March 31, 2021, were compared to those who were pregnant before the pandemic period.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">42 Analyses were conducted using SAS, version 9.4 (SAS Institute, Inc)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS</div><div>suggested: (SASqPCR, RRID:SCR_003056)</div></div><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      The main limitations of this study should be acknowledged. We did not examine the influence of COVID-19 infection on the study outcomes; however, the number of reported COVID-19 positive pregnant women was small in relation to the total pregnancies in our cohort, and it is unlikely that viral infection would change our results.43 Although, we did not investigate variations across the different regions of Manitoba, the changes to maternal healthcare were implemented across the provincial healthcare system minimizing any differential variability within the data. However, some rural regions may have been substantially impacted during the pandemic compared to larger cities. Moreover, we did not include out of hospital births, maternal smoking and alcohol/substance use, and vaccination rates among pregnant women in Manitoba


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.25.22275603: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: 17 The study protocol was approved by the Institutional Review Board at the City University of New York (CUNY).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Our cross-sectional study has limitations, including self-report of testing outcomes over a 14-day recall period (subject to recall bias) and limited sample size especially in subgroups of those with evidence of COVID-19. For those with prior COVID, we did not capture information on timing of prior infections, which underestimates the degree of hybrid protection, though a substantial proportion of NYC adults were infected during the recent BA.1 surge.9,16 Our case definition would likely capture some, but not all, of the estimated 20-30% of individuals whose SARS-CoV-2 infection may remain asymptomatic throughout their infection,30,31 as well as those who were symptomatic but were not aware of a close contact. Finally, our survey could not include those whose primary language was not English or Spanish. Strengths include the representative nature of the study, the study’s timing at the start of the BA.2 /BA.2.12.1 surge, and measurement of several important factors that are not currently available through routine surveillance, including outcomes among those who do not test positive with a provider, prevalence among individuals vulnerable to COVID-19, hybrid protection, and awareness/uptake of nirmatrelvir/ritonavir.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.25.22275610: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lineages were determined by running sequences through PANGO v1.8, Pangolin v4.0.6, and pangoLEARN v1.2.133, and Scorpio v0.3.17 (O’Toole et al., 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PANGO</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. Our build bots do it by parsing your HTML files directly at deploy time, so there’s no need for you to make an API call or include extra JavaScript on your site. # HTML forms Code an HTML form into any page on your site, add data-netlify="true" or a netlify attribute to the <form> tag

      gross

    1. SciScore for 10.1101/2022.05.26.493529: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.26.493539: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To measure the surface expression level of S protein, effector cells were stained with rabbit anti-SARS-CoV-2 S S1/S2 polyclonal antibody (Thermo Fisher Scientific, Cat# PA5-112048, 1:100)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Normal rabbit IgG (SouthernBiotech, Cat# 0111-01, 1:100) was used as negative controls, and APC-conjugated goat anti-rabbit IgG polyclonal antibody (Jackson ImmunoResearch, Cat# 111-136-144, 1:50) was used as a secondary antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 111-136-144, RRID:AB_2337987)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The deparaffinized sections were exposed to EnVision FLEX target retrieval solution high pH (Agilent, Cat# K8004) for 20 minutes at 97°C to activate, and mouse anti-SARS-CoV-2 N monoclonal antibody (clone 1035111, R&D systems, Cat# MAB10474-SP, 1:400) was used as a primary antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 N</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: HEK293T cells (a human embryonic kidney cell line; ATCC, CRL-3216)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, HEK293 cells (a human embryonic kidney cell line; ATCC, CRL-1573) and HOS-ACE2/TMPRSS2 cells (HOS cells stably expressing human ACE2 and TMPRSS2) (Ferreira et al., 2021; Ozono et al., 2021) were maintained in DMEM (high glucose) (Sigma-Aldrich, Cat# 6429-500ML) containing 10% fetal bovine serum (FBS, Sigma-Aldrich Cat# 172012-500ML), and 1% penicillin-streptomycin (PS) (Sigma-Aldrich, Cat# P4333-100ML).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HOS-ACE2/TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293-ACE2/TMPRSS2 cells (HEK293 cells stably expressing human ACE2 and TMPRSS2) (Motozono et al., 2021) was maintained in DMEM (high glucose) containing 10% FBS, 1 µg/ml puromycin, 200 ng/ml hygromycin (Nacalai Tesque, Cat# 09287-84) and 1% PS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293-ACE2/TMPRSS2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293-C34 cells (IFNAR1 KO HEK293 cells expressing human ACE2 and TMPRSS2 by doxycycline treatment) (Torii et al., 2021) were maintained in DMEM (high glucose) containing 10% FBS, 10 μg/ml blasticidin (InvivoGen, Cat# ant-bl-1) and 1% PS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293-C34</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero cells [an African green monkey (Chlorocebus sabaeus) kidney cell line; JCRB Cell Bank, JCRB0111] were maintained in Eagle’s minimum essential medium (EMEM) (Sigma-Aldrich, Cat# M4655-500ML) containing 10% FBS and 1% PS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6/TMPRSS2 cells (VeroE6 cells stably expressing human TMPRSS2; JCRB Cell Bank, JCRB1819) (Matsuyama et al., 2020) were maintained in DMEM (low glucose) (Wako, Cat# 041-29775) containing 10% FBS, G418 (1 mg/ml; Nacalai Tesque, Cat# G8168-10ML) and 1% PS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 cells (a human lung epithelial cell line; ATCC, HTB-55) were maintained in EMEM (Sigma-Aldrich, Cat# M4655-500ML) containing 20% FBS and 1% PS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: ATCC Cat# HTB-55, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3/DSP1-7 cells (Calu-3 cells stably expressing DSP1-7) (Yamamoto et al., 2020) were maintained in EMEM (Wako, Cat# 056-08385) containing 20% FBS and 1% PS. 293S GnTI(-) cells (HEK293S cells lacking N-acetylglucosaminyltransferase (Kubota et al., 2016) were maintained in DMEM (Nacalai tesque, #08458-16 containing 2% FBS without PS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293S</div><div>suggested: RRID:CVCL_A784)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the amount of pseudoviruses prepared was quantified by the HiBiT assay using Nano Glo HiBiT lytic detection system (Promega,Cat# N3040) as previously described (Ozono et al., 2021; Ozono et al., 2020), and the same amount of pseudoviruses (normalized to the HiBiT value, which indicates the amount of p24 HIV-1 antigen) was inoculated into HOS-ACE2/TMPRSS2 cells, HEK293-ACE2 cells or HEK293-ACE2/TMPRSS2 and viral infectivity was measured as described above (see “Neutralization assay” section).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">On day 3 (24 hours posttransfection), 16,000 effector cells were detached and reseeded into 96-well black plates (PerkinElmer, Cat# 6005225), and target cells (VeroE6/TMPRSS2 or Calu-3/DSP1-7 cells) were reseeded at a density of 1,000,000 cells/2 ml/well in 6-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3/DSP1-7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 infection: One day before infection, Vero cells (10,000 cells) and VeroE6/TMPRSS2 cells (10,000 cells) were seeded into a 96-well plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6/TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Preparation of mouse sera: BALB/c mice (female, 7 weeks old) were immunized with 1 μg SARS-CoV-2 BA.2 RBD protein in 50% AddaVax (Invivogen, Cat# vac-adx-10) at day 0 and 14.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting PCR fragment was digested with KpnI and NotI and inserted into the corresponding site of the pCAGGS vector (Niwa et al., 1991).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_127347)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2 S RBD (residues 322-536) was cloned into the expression vector pHLsec containing the N-terminal secretion signal sequence and the C-terminal His6-tag sequence (Aricescu et al., 2006).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHLsec</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">kit (Roche, Cat# KK2601) and assembled in vivo by yeast [Saccharomyces cerevisiae strain EBY100 (ATCC, MYA-4941)] homologous recombination with pJYDC1 plasmid (Addgene, Cat# 162458) as previously described (Dejnirattisai et al., 2022; Kimura et al., 2022a; Kimura et al., 2022b; Motozono et al., 2021; Yamasoba et al., 2022a; Zahradnik et al., 2021a)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pJYDC1</div><div>suggested: RRID:Addgene_162458)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To prepare effector cells, HEK293 cells were cotransfected with the S-expression plasmids (500 ng) and pDSP8-11 (500 ng) using PEI Max (Polysciences, Cat# 24765-1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pDSP8-11</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To prepare target cells, HEK293 and HEK293-ACE2/TMPRSS2 cells were transfected with pDSP1-7 (500 ng) (Kondo et al., 2011).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pDSP1-7</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequencing reads were trimmed using fastp v0.21.0 (Chen et al., 2018) and subsequently mapped to the viral genome sequences of a lineage A isolate (strain WK-521; GISAID ID: EPI_ISL_408667) (Matsuyama et al., 2020) using BWA-MEM v0.7.17 (Li and Durbin, 2009).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA-MEM</div><div>suggested: (Sniffles, RRID:SCR_017619)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Variant calling, filtering, and annotation were performed using SAMtools v1.9 (Li et al., 2009) and snpEff v5.0e (Cingolani et al., 2012).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAMtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The viral genome sequences were mapped to the reference sequence of Wuhan-Hu-1 (GenBank accession number: NC_045512.2) using Minimap2 v2.17 (Li, 2018) and subsequently converted to a multiple sequence alignment according to the GISAID phylogenetic analysis pipeline (https://github.com/roblanf/sarscov2phylo).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Minimap2</div><div>suggested: (Minimap2, RRID:SCR_018550)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tree reconstruction was performed by RAxML v8.2.12 (Stamatakis, 2014) under the GTRCAT substitution model.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RAxML</div><div>suggested: (RAxML, RRID:SCR_006086)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Parameter estimation was performed via the MCMC approach implemented in CmdStan v2.28.1 (https://mc-stan.org) with CmdStanr v0.4.0 (https://mc-stan.org/cmdstanr/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CmdStan</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>https://mc-stan.org</div><div>suggested: (Stan, RRID:SCR_018459)</div></div><div style="margin-bottom:8px"><div>CmdStanr</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The assay of each serum was performed in triplicate, and the 50% neutralization titer (NT50) was calculated using Prism 9 software v9.1.1 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RBD expression and ACE2 signal were recorded by using a FACS S3e cell sorter device (Bio-Rad), background binding signals were subtracted and data were fitted to a standard noncooperative Hill equation by nonlinear least-squares regression using Python v3.7 (https://www.python.org) as previously described (Kimura et al., 2022a; Kimura et al., 2022b; Motozono et al., 2021; Yamasoba et al., 2022a; Zahradnik et al., 2021b).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div><div style="margin-bottom:8px"><div>https://www.python.org</div><div>suggested: (CVXOPT - Python Software for Convex Optimization, RRID:SCR_002918)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Surface expression level of S proteins (Figures 3C and S2B) was measured using FACS Canto II (BD Biosciences) and the data were analyzed using FlowJo software v10.7.1 (BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The size of syncytium (GFP-positive area) was measured using Fiji software v2.2.0 (ImageJ) as previously described (Suzuki et al., 2022; Yamasoba et al., 2022a).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The stained cells were washed with tap water and dried, and the size of plaques was measured using Fiji software v2.2.0 (ImageJ).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were incorporated as virtual slide by NDP.scan software v3.2.4 (Hamamatsu Photonics).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NDP.scan</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These analyses were performed in R v4.1.2 (https://www.r-project.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.r-project.org/</div><div>suggested: (R Project for Statistical Computing, RRID:SCR_001905)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.24.22275552: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, ProQuest Health and Medical Complete, ScienceDirect, Ovid, HERDIN, Google Scholar, and Cochrane Library.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Google Scholar</div><div>suggested: (Google Scholar, RRID:SCR_008878)</div></div><div style="margin-bottom:8px"><div>Cochrane Library</div><div>suggested: (Cochrane Library, RRID:SCR_013000)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Another limitation is the possibility that some relevant studies were not taken into account because they have been published in languages other than English (e.g., Chinese). We also did not have access to some other databases that may store some articles on COVID-19 and cognitive dysfunctions. And lastly, there could be some other studies on this theme in the literature that skipped our attention and analyses. However, a comprehensive search strategy that covers a broad range of evidence was implemented. This systematic review gathered evidence that could provide clarity on the association between brain fog and COVID-19 infection. The information acquired in this study may help re-evaluate the impact of the virus. Furthermore, the use of the data gleaned from this analysis may assist in earlier treatment, allowing physicians and clinicians to manage the neurological manifestation effectively. Additionally, this will aid in the development of various therapeutic strategies to support COVID-19 patients in recovering from impaired cognitive capacity. Finally, the analysis of such data could provide an insight into the challenges that this virus could cause people in their prime years, particularly those in the workforce.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.24.22275549: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.


      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      4.3 Limitations and future research opportunities: This study has several limitations, which pose opportunities for future research. This is an ecological study using aggregated data at the county level. It is subjected to ecological fallacy. Future studies can use individual level data or experimental studies to confirm the causal relations and the potential underlying mechanisms (Jiang et al., 2021). Second, the unit of analysis is the county due to the availability of COVID-19 mortality data and other confounding variable. Though county data are widely used in nationwide studies, future studies should use finer-grained data (i.e., census tract level data). Different scales of analyses may reveal different associations between neighborhood greenspace and health outcomes (Richardson et al., 2012). Third, our research investigated associations using data from 2020, but the situation has continued to evolve with the emergence of vaccines and COVID-19 variants (e.g., Delta and Omicron). Future studies should consider the new situations accordingly.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.24.22275508: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.


      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Limitations: There are several limitations to this study, First, mortality during 2020 is almost certainly under-estimated. Deaths during 2020 were based on an early release file for the National Death Index (NDI), which according to the National Center for Health Statistics, accounted for only about 95% of all recorded US deaths in 2020 at the time of the NDI search (Ryff et al., 2022). Second, the MIDUS sampling frame excluded the institutionalized population, who suffered especially high mortality early during the early stages of the pandemic. Thus, mortality among the MIDUS cohort is likely to be lower than pandemic-related mortality for the population as a whole. Third, we have no information about the degree to which MIDUS participants complied with public health orders during the pandemic and whether it differed by personality. Nor do we have any information about self-destructive behaviors (e.g., alcohol and drug abuse) during the pandemic. Fourth, personality was measured in 1995-96, approximately 25 years prior to the pandemic. Finally, the MIDUS sample under-represents minorities, who suffered higher mortality during the pandemic. Future Analyses: It will be useful to replicate this analysis using the Health Retirement Survey (HRS), which samples Americans older than 50, once mortality data become available for 2020. HRS has a much larger sample than MIDUS and thus, will yield more statistical power for modeling excess mortality. HRS also has a more ethnically dive...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.22.22275422: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.2 Sequence analyses and processing: Python 3.8.0 language programming and ′Numpy′ and ′Pandas′ libraries were used in this research to preprocess FASTA files, extract NSP3, NSP4, and NSP6 from other genes, and perform sequence alignment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.21.22275421: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Once aligned using the MEGA X program (TAMURA et al., 2018), ambiguous sites, lost data and gaps, were excluded. 2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA X</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.24.22275498: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Ethical approvals and consent to participate: The Jaramogi Oginga Odinga Teaching and Referral Hospital (JOOTRH): Institution and Ethical Review Committee provided research and ethical approval with license number IERC.<br>IRB: Ethical approvals and consent to participate: The Jaramogi Oginga Odinga Teaching and Referral Hospital (JOOTRH): Institution and Ethical Review Committee provided research and ethical approval with license number IERC.<br>Field Sample Permit: Additional research and ethical approval was provided by the National Commission for Science, Technology and Innovation (NACOSTI) with License Number ABS/P/20/7959.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      There were two limitations that the health workers noted about the study. First, the study was designed as a pilot to the Kisumu County Department of Health, in which the usage of AgRDT was done alongside confirmatory PCR testing. Although participants were informed about the possibility of discrepant results, these did result in some confusion. It was found out that a major cause of the discrepancy was attributed to non-adherence by healthcare staff to the study procedures where sometimes one and the same nasal pharyngeal swab was used for both AgRDT and PCR testing. This could result in false-negativity, due to dilution of the sample (15). Secondly, the test-result communication channels were not always clear and changed during the project, involving 3 different partners in addition to the participating facilities. There were no formal DoH protocols on communication channels, and in some cases feedback was not relayed to patients in a timely manner causing frustration and anxiety (16).


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.25.22275562: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.24.22275398: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Study limitations: While our study provides insight into the variability and natural history of long COVID, there are limitations that should be considered. While the U09.9 code provides a simple inclusion criterion, its application in health systems across the country is not uniform and may differ from one data partner to another. Also, since the use of the code began only recently, patients with long COVID that were diagnosed prior to the introduction of the code are not included, limiting our ability to compare the current clinical manifestations with those observed earlier in the pandemic before widespread vaccination and with different distributions of SARS-CoV2 strains and variants. However, in a pilot study in Denmark, coding with U09.9 was found to have a positive predictive value of 94% for long COVID.56 Our ability to capture clinical manifestations of long COVID is limited by the accessibility of clinical data in EHR systems. Of the 287 HPO terms we identified as being used in published cohort studies on long COVID,19 only 116 were identified in our data. The reasons for this presumably include unstructured data such as symptoms and radiological findings that are not well represented in the OMOP data that is the source of our data. Examples include Gaze-evoked nystagmus (HP:0000640), Pericardial effusion (HP:0001698), and Exercise intolerance (HP:0003546) that are typically diagnosed using specialist examinations or medical history that may not be easily coded in s...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. 1/ It fits into existing spec based testing infrastructure nicely, including running on travis, code coverage using SimpleCov, switching between generating a profile (RubyProf), a benchmark (Benchmark::IPS) or normal test run. 2/ Some of my benchmarks do have expect clauses to validate that things are working before invoking the benchmark.

      Answering the question:

      I don't understand the point of putting it in a spec. What does that gain you over using benchmark-ips the normal way?

    2. I think RSpec should provide around(:context)/around(:all). Not because of any particular use case, but simply for API consistency. It's much simpler to tell users "there are 3 kinds of hooks (before, after and around) and each can be used with any of 3 scopes (example, context and suite)". Having some kinds of hooks work with only some kinds of scopes makes the API inconsistent and forces us to add special case code to emit warnings and also write extra documentation for this fact.
    1. RadGenNets: Deep Learning-Based Radiogenomics Model For Gene Mutation Prediction In Lung Cancer

      Data Discovery/Status Report

      Click Here for full report

      Summary of datasets and Open Science materials associated with article: - 4 Dataset(s) - 1 Code(s)

      1 Image Dataset(s) - 1 "X-Ray Computed Tomography"

      2 Genetic Data Dataset(s) - 1 "High-Throughput Nucleotide Sequencing" - 1 "Sequence Analysis"

      1 dataset Dataset(s) - 1 "dataset"

    1. JS is plenty fast and can be used for "large, complicated programs"[1] just fine. The problem with most JS written today is in programmer practices—the way that the community associated with NodeJS pushes one other to write code (which is, ironically, not even a good fit for the JavaScript language). It turns out that how you write code actually matters
    1. SciScore for 10.1101/2022.05.24.493347: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: At regular intervals, aliquots of the supernatant were taken for measurement in the plate reader as described above, and the sampled volume was replaced with PBS. 2.6 In vitro diffusivity measurements: All fluorescence recovery after photobleaching (FRAP) experiments were conducted in the Stanford University Cell Sciences Imaging Facility (CSIF) at room temperature or 37 °C.<br>IACUC: 2.13 In vivo Centi-C10 mAb pharmacokinetic study: All animal studies were performed in accordance with National Institutes of Health guidelines and with the approval of the Stanford Administrative Panel on Laboratory Animal Care (APLAC-32109).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Female B6.Cg-Fcgrttm1Dcr Prkdcscid Tg(FCGRT)32Dcr/DcrJ (The Jackson Laboratory, Stock No. 018441) mice age 12-14 weeks were administered Centi-C10 antibody via IV (retro-orbital) or SC injection under brief isoflurane anesthesia.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fragment Goat Anti-Human IgG, Fcγ fragment specific (Jackson Immunoresearch, 109-036-008, RRID: AB_2337591), and incubating for 1 hr.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fragment Goat Anti-Human IgG</div><div>detected: (Jackson ImmunoResearch Labs Cat# 109-036-008, RRID:AB_2337591)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Hydrogel samples were prepared for the in vivo study from a stock solution of 4 wt% HPMC-C12 dissolved in PBS containing the appropriate concentration of Centi-C10 antibody and 20 wt% NPs stock solution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Centi-C10</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.9 Spike-pseudotyped lentivirus production and viral neutralization assays: Spike-pseudotyped lentivirus was produced in HEK293T cells as previously described.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: RRID:CVCL_HA71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike-pseudotyped lentiviral neutralization assays were performed using HeLa cells overexpressing human ACE2, as described in.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: CLS Cat# 300194/p772_HeLa, RRID:CVCL_0030)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">46 HeLa/ACE2 cells were plated in 96-well clear bottom, white-walled plates 1 day prior to infection at a density of 5,000 cells per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa/ACE2</div><div>suggested: JCRB Cat# JCRB1845, RRID:CVCL_B3LW)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For in vitro release assays and diffusion measurements, a total concentration of 10 mg/mL rat IgG was loaded into the hydrogels (9 mg/mL rat IgG and 1 mg/mL fluorescently-labeled rat IgG). 2.3 Dynamic and flow rheometry: All rheometry experiments were performed on a torque-controlled Discovery Hybrid Rheometer (DHR2, TA Instruments).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DHR2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Female B6.Cg-Fcgrttm1Dcr Prkdcscid Tg(FCGRT)32Dcr/DcrJ (The Jackson Laboratory, Stock No. 018441) mice age 12-14 weeks were administered Centi-C10 antibody via IV (retro-orbital) or SC injection under brief isoflurane anesthesia.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6.Cg-Fcgrttm1Dcr Prkdcscid Tg(FCGRT)32Dcr/DcrJ</div><div>suggested: RRID:IMSR_JAX:018441)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The library was subjected to 4 rounds of selection and ScFv were tested for the binding of SARS-CoV-2 RBD and blocking its interaction with of hu-ACE-2 on high-throughput surface plasmon resonance (SPR) on Carterra LSA Array SPR instrument (Carterra) equipped with HC200M sensor chip (Carterra) at 25 °C. 2.8 Antibody cloning into expression vectors for transient transfection: Heavy chain and light chain sequences of the complimentary determinant regions (CDRs) of centi-C10 ScFv was cloned into each constant region of human IgG1 heavy chain, and human kappa constant IGKC, in the mammalian expression pTT5 vector (Licensed from National Research Council of Canada, Toronto Canada), respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTT5</div><div>suggested: RRID:Addgene_52326)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were transfected using calcium phosphate transfection with 5 plasmids previously described in45 in the following ratios: 10 μg luciferase-containing lentivirus packaging vector (pHAGE-Luc), 3.4 μg FL SARS-CoV-2 Spike, 2.2 μg HDM-Tat1b, 2.2 μg pRC-CMV-Rev1b, and 2.2 μg HDM-Hgpm2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHAGE-Luc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pRC-CMV-Rev1b</div><div>suggested: RRID:Addgene_164443)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.12 Pharmacokinetic (PK) modeling: The IV bolus data was fit to a two-phase exponential decay with the plateau constrained to zero in GraphPad Prism 9 to determine kelim; Vd was calculated from M0/C0, where C0 is the initial concentration from the two-phase exponential.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">47 Simulated pharmacokinetic profiles were generated in MATLAB.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.23.22275454: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.25.493397: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Antisera and ethics: Hamster antisera was generated as we have described previously7, and was carried out under a United Kingdom Home Office License, P48DAD9B4.<br>Consent: All DOVE participants gave informed consent to take part in the study, which was approved by the North-West Liverpool Central Research Ethics Committee (REC reference 21/NW/0073).<br>IRB: All DOVE participants gave informed consent to take part in the study, which was approved by the North-West Liverpool Central Research Ethics Committee (REC reference 21/NW/0073).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK 293T cells were transfected with lentiviral packaging plasmids and the named Spike construct - D614G(WT), BA.1, BA.2 or BA.4/5 to produce</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sera was then combined with target cells expressing human ACE2 (HEK293T or HeLa) and incubated for 48-72 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.23.22275444: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics: This study was approved by the Ethical Review Committee of NUH (permission number 21101927), and the study was conducted in accordance with the Declaration of Helsinki.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      The study has several limitations. First, this was a retrospective study and, therefore, has a potential for biases from incomplete clinician documentation. Second, follow-up information was not available after patients were discharged, which may have led to underestimated rates of hospitalization or mortality. Third, members of the team reviewing the ED revisits were not blinded, which may have introduced assessment bias. Fourth, since different variants of coronavirus have different clinical characteristics, important factors at the triage may be different during other pandemic waves. Lastly, the generalizability of the current study findings to other settings is limited by single-center design. Because of site-specific characteristics, it is possible that other ED sites with differences in availability of transportation and access to professional medical support may have different rates of outcomes than our own patient cohort. In summary, approximately 80% of patients with mild COVID-19 disease can be safely isolated at home in a facility. Ten percent of patients will experience progression of symptoms in the ensuing week that will require hospitalization for treatment—typically at 10 days of symptomatic illness. Clinicians should inform patients, especially those aged >□50 years, or those that are obese with BMI > 25, or those with underlying hypertension, or those presenting to the hospital > 3 days after symptom onset and presenting tachycardia (PR > 100/min) or high bl...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.22.22275323: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.23.22275460: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Ethics: Collection of samples from the Orleans cohort had been approved by the Comité de Protection des Personnes Ile de France IV (NCT04750720).<br>IRB: Collection of samples from the Strasbourg cohort was approved by Institutional Review Board of Strasbourg University Hospital (NCT04441684).<br>Consent: Informed consent was obtained from all participants, and parents provided informed consent for any children under the age of 18 years.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The antigen associated with the lowest sum of residual sum of squares among the four different variant-specific random forest regression models was kept in the model.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Cells tested negative for mycoplasma.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples: Viral neutralization studies: To correlate antibody measurements with neutralization titers, we collected 304 serum samples from individuals with either vaccine-induced or infection-acquired immunity to SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">R-PE) conjugated goat or donkey anti-human IgG antibody was used as detector antibody at 1/120 dilution and goat anti-human IgA at 1/200.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This assay allowed simultaneous detection of antibodies to 30 antigens, including stabilized trimeric Spike ectodomain (16), RBD, Membrane protein (M), Membrane Envelope protein (E), Nucleocapsid protein (NP), and a Membrane-Envelope fusion protein (ME).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RBD , Membrane protein ( M) , Membrane Envelope protein ( E) , Nucleocapsid protein ( NP) ,</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In addition to the measurement of the presence of antibodies to antigens, we also measured the strength of antibody (Ab) binding with an avidity assay (Garcia et al, submitted to Viruses, 2022).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigens</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After these 5 minutes and washing, 100μL of secondary antibodies conjugated to R-phycoerythrin (Jackson Immunoresearch) for detection of specific IgG, diluted at 1/100 was added for 15 minutes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>R-phycoerythrin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, Nucleocapsid-specific IgG antibodies were assessed using an ELISA-based assays on sera incubated in antigen-coated wells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Nucleocapsid-specific IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Anti-Fc IgG VHH (Fc1) was derived from an antibody from immunized alpaca and expressed as a tandem with an optimized catalytic domain nanoKAZ from Oplophorous gracilirostris luciferase.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Fc IgG</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      A limitation of our study was that we assessed levels of immunity from serum only. There is clearly also a role for mucosal immunity in protecting against SARS-CoV-2 infection, especially in the case of infection-acquired immunity. For the last three session in our study we collected nasopharyngeal samples, which we plan to incorporate in future research. Our analysis is dependent on the suitability of neutralizing titers as a correlate of protection against symptomatic COVID-19, based on meta-analyses of vaccine studies (7, 8). This assumption is supported by an analysis of data from phase 3 trials of Moderna’s mRNA-1273 vaccine, which indicated that 68% of vaccine efficacy can be explained by neutralizing titers (31). This leaves up to 32% variation that may be explained by other effects such as cellular immunity or host factors. An additional limitation is that the evidence base for neutralizing titers as a correlate of protection is built on studies of infection with the Ancestral variant. However, antibody levels have been observed to be associated with reduced infection with other variants, most notably Delta (32). Although neutralizing titers have frequently been shown to be associated with protection against severe COVID-19 (7-9), there is a weaker evidence base for their use as a correlate of protection. A final, important limitation is that there is uncertainty in the statistical relationships utilized in this analysis. When considering the inferred protection from ...


      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04750720</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Study of the Kinetics of COVID-19 Antibodies for 24 Months i…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04441684</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Seroprevalence of SARS-CoV-2 in Strasbourg University Hospit…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04644159</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Longitudinal Follow-up of a Population Cohort in a French Ci…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04325646</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sero-epidemiological Study of the SARS-CoV-2 Virus Responsib…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.23.22275445: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Institutional board review was conducted, and The Ethics Committee of South-East Norway confirmed (June 4th 2020, #153204) that external ethical board review was not required.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Finally, because persons testing negative may be more prone to get tested and subsequently visit primary care due to (persistent) symptoms from similar bodily systems as those affected by SARS-CoV-2, we repeated the time-differentiated analyses using a comparison group consisting of untested persons (aged 18-70 years, non-hospitalized, never tested for SARS-CoV-2 and assigned a random, hypothetical test date during our study period) in a sensitivity analysis.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Strengths and limitations: Strengths of our study include the use of sequenced data allowing comparison of omicron vs delta during the same calendar period when the two variants had the largest overlap, combined with health care register data with no attrition. Further, equal access to SARS-CoV-2 testing at no cost for the individuals as well as a universal tax-funded health care system, improve generalizability of findings to other countries. A limitation of our study is that we could not include antigen or home tests as they were not registered. Polymerase chain reaction testing was however mandatory for everyone with a positive antigen test during our study period. Moreover, all parcitipants in our study had a PCR test in a period characterized by great uncertainty regarding the severity of the new SARS-CoV-2 omicron variant. It is possible that our population consisted of particularly health-conscious persons who were highly prone to get tested and who were more prone to seek medical care after knowing they had been ill. We believe our methodological approach ensuring comparison of persons who were tested in the same calendar week limits this potential bias arising due to anxiety. Further, we have previously reported that register-based studies comparing persons with positive test with persons with negative test likely will lead to an underestimation of post-covid outcomes’ prevalence, as persons testing themselves may represent a particularly health-conscious sample of t...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.22.22275183: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.23.22275458: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.24.493187: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">The binding affinity energies (ΔG, kcal·mol-1) of Hemin with proteins were calculated with blind docking (supplementary material, DockingRawData.zip).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cells were harvested as control, solvent control and drug treatment groups with Trypsin-EDTA (2X) and single cell suspensions were stained using an antibody against TMPRSS2 (Santa Cruz, sc-515727).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TMPRSS2</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-515727, RRID:AB_2892118)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The monoclonal anti-ACE2 antibody (ProSci, Poway, CA,1:750 diluted in 5% BSA blocking buffer) and the goat anti-rabbit IgG-horseradish peroxidase (HRP)-conjugated antibody (Santa Cruz Biotechnology, Dallas, TX, 1:2500) were used as primary and secondary antibodies, respectively, for ACE2 protein expression.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG-horseradish</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The monoclonal anti-β-actin antibody (SantaCruz,1:1500) and the goat anti-mouse HRP conjugated (Pierce, Rockford, IL) were used as primary and secondary antibodies, respectively, for β-actin expression.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-β-actin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse HRP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell and Virus Culture: The cell culture media used for Vero E6 (African green monkey, kidney epithelial) cells consisted of high glucose Dulbecco’s modified Eagle medium (DMEM) (Capricorn) with 10 % fetal bovine serum (FBS) (Biolegend), 100 U/mL of penicillin (Lonza) and 0.1 mg/mL of streptomycin (Lonza).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Results were evaluated statistically using the Two-way ANOVA (ordinary) technique (Prism 8 v8.2.1, GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis was performed using NovoExpress</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NovoExpress</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.24.22275411: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The trial protocol was approved by UT Southwestern Institutional Review Board and was overseen by an independent data safety and monitoring board, and all patients provided written informed consent.<br>Consent: The trial protocol was approved by UT Southwestern Institutional Review Board and was overseen by an independent data safety and monitoring board, and all patients provided written informed consent.<br>Field Sample Permit: RNA Isolation: Saliva was collected using the DNA/RNA Shield Saliva Collection Kit (Zymo Research) following the manufacturer’s protocol.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Patients were excluded if they met any of the following criteria: enrolled in another COVID-19 antiviral therapy, breastfeeding women, known hypersensitivity to atovaquone, treatment with rifampin, patients with AIDS who required treatment for Pneumocystis jirovecii or Toxoplasma gondii, not expected to survive for 72 hours, >14 days from symptom onset.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Design: This is a randomized, double-blind, placebo-controlled trial of atovaquone therapy in adult participants hospitalized with COVID-19.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">All investigators remained blinded to study assignment until completion of follow-up and database lock.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04456153</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Atovaquone for Treatment of COVID-19</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.23.22275364: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.24.22275544: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The Children’s Hospital of Philadelphia’s Institutional Review Board designated this study as not human subjects’ research and waived informed consent.<br>Consent: The Children’s Hospital of Philadelphia’s Institutional Review Board designated this study as not human subjects’ research and waived informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Our findings have limitations that warrant discussion. This EHR-based study identified symptoms, signs, and diagnoses that were significant enough to prompt health service use and be coded by clinicians as a reason for an encounter. Our approach may have missed some findings that may be stored in laboratory, procedural, radiological and other unstructured text data. The true burden of PASC may be underestimated from EHR data, with data from open health systems, with the potential for infrequent follow-up visits to academic centers of excellence for milder symptoms. For this reason, we limited our cohort to at least one visit in the prior three years, to identify active patients within the health system; similar strategies have been employed in other PEDSnet studies of COVID-19;39,40 the benefits of such approaches have been reported previously.41 However, this may underestimate the burden of PASC by excluding previously healthy children who did not have prior health encounters. Next, our test negative cohort may include individuals with SARS-CoV-2 infection who may have had testing conducted outside our health systems. These limitations may have biased results towards the null. Further, we did not identify specific race/ethnic groups as a risk factor for PASC despite the fact that SARS-CoV-2 disproportionally affects minority communities, which may reflect differences in care seeking behavior and access to care. Finally, children who tested positive may be more likely to seek...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.23.22275439: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The US Centers for Disease Control and Prevention (CDC) institutional review board provided non-research determination approval.<br>Consent: Written informed consent was obtained for all enrolled participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Sample size calculation: To evaluate the diagnostic performance of the Panbio™ Ag RDT device, we assumed a prevalence of 10% among symptomatic individuals and 5% in asymptomatic contacts of laboratory-confirmed persons based on current SARS CoV 2 local surveillance data.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Limitation: The number of persons enrolled in the two groups, symptomatic and asymptomatic, may not reflect the true prevalence in the general population as we evaluated the Ag RDT during a period of high COVID-19 prevalence.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      General Statements [optional]

      We are grateful for the very kind, thoughtful, and detailed comments of the reviewers, which we have strived to fully integrate into the revised manuscript.

      Of note are the concerns with the data from stages S21 and S22, which we acknowledge do appear to be qualitatively and quantitatively distinct from the other samples. While we are unable to completely disambiguate meaningful biological variation from technical or experimental noise using our data, we hope a few additional analyses and visualization tools we have included can provide greater confidence in the reliability of our findings.

      Additionally, while attempting to evaluate Reviewer #2’s suggestions about examining the distribution of intergenic peaks along the genome, we discovered an error in our code that resulted in the improper assignment of peak categories. The error resulted in the improper assignment of intronic and exonic peaks as intergenic peaks. While the largest group of peaks in our dataset remains distal intergenic peaks (30.2%), and distal intergenic peaks remain a larger proportion of our intergenic peaks than proximal intergenic peaks, many of the peaks originally assigned to the intergenic categories have been reclassified as exonic or intronic peaks. We have updated our code and figures upon reanalysis of our data and have revised our findings and discussion accordingly.

      Description of the planned revisions

      Reviewer #3, Comment #3 of 11_

      “In general, I thought that the bioinformatic methods (i.e., the code or the options used for each program) would have been helpful for my understanding in some cases. The authors say that these will be published on an accompanying GitHub repository, which should be fine if this is sufficient for journal policy.”_

      We are still at work compiling the code for our analyses into a more reader-friendly form and setting up a GitHub repository to enable easy access to more detailed methods for interested readers. Some of the most important settings have been included in the Methods and Supplementary Methods sections, but we hope to include more thorough detailing of our pipelines in the GitHub repository. The raw data for portions of the RNA-Seq and all of the ATAC-Seq data have been uploaded to the Sequence Read Archive, and we are finalizing additional raw data submission. We are also in the process of determining what data to include in our Gene Expression Omnibus submission, which we hope to include all pertinent final data analysis files as well as any intermediate or accompanying datasets which would facilitate downstream analyses. The large size and number of our final analysis files has resulted in some challenges with data transfer and storage, which has delayed the upload and submission process.

      We are also collating several of the data visualization scripts built for this manuscript into a Jupyter notebook. This tool will enable the visualization of ImpulseDE2 models and peak classifications for arbitrary genes and genome regions of a user’s choice, alongside additional functions which are discussed in this revision plan.

      Description of the revisions that have already been incorporated in the transferred manuscript

      We have addressed the following substantive concerns with the manuscript:

      Reviewer #2, Comment #2 of 3:_

      “Authors have repeatedly used S21 and S22 throughout the manuscript to support their claims with clustering etc. May authors shed some light on the differences in replicates for these timepoints. Furthermore, I could not find Fig 3J, perhaps author would like to point out Fig 3H.”_

      Reviewer #3, Cross-comment #2 of 3:_

      “Focus on stages S21/S22: This might indeed be somewhat problematic. The libraries from these two stages (particularly S21) seem to be very different from those from the other stages. In the PCA (Fig. 1C), S21 doesn't cluster well with anything, and the difference between the two replicates is massive compared to other stages. The accessibility pattern (Fig. 1D) also looks odd. The libraries also have the lowest scores for % of mapped reads (Fig. S2B), fragment size distribution (S2E), and Spearman correlation (S2I). All this could be biologically sound and be due to a major developmental transition at this point, but maybe it justifies revisiting the data and testing whether leaving out S21 (and/or S22) makes a big difference for the clustering analyses.”_

      1. Reviewers #2 and #3 discussed concerns with the outlying nature of libraries S21 and S22. We had also previously held concerns about these samples and had performed some analyses to examine whether the global properties of our dataset are dramatically changed upon removing those samples. We did not observe dramatic changes to the structure of our data in the absence of the S21/S22 samples.

        • a. Samples S21 and S22 appear to be highly separated from the rest of our data using Principal Components Analysis. We had also previously believed that this suggested that these samples might be problematic. However, a colleague indicated to us that researchers in microbiome ecology had observed similar phenomena, often caused by strong single axes of variation (or “linear gradients”) in the datasets. In “Uncovering the Horseshoe Effect in Microbial Analyses” (mSystems, 2017) by Morton et al., the authors describe how a strong linear gradient can create a “horseshoe effect” or “Guttman effect”, where PCA results in the two ends of a linear gradient appearing to come together in ordinal space. The authors also describe a similar “arch effect” which strongly resembles the general shape of our PCA curve. We suggest that the strong apparent “outlier” appearance of S21 and S22 may be exaggerated or induced by the technical “arch effect” phenomenon, and may be caused by a strong single biological gradient – a developmental timecourse – which our data aimed to capture.
        • b. We also performed PCA on our dataset with the S21 and S22 time points removed prior to performing the analysis (see right panel, bottom). When we did so, we observed that the relative positions of the remaining libraries remains largely similar, with time points closer to the middle of development showing a positive loading in PC2, and time points closer to the beginning and end of development showing a negative loading. This suggests that the second major axis of variation in our dataset would remain a contrast between middle vs. terminal timepoints, even without the S21/S22 data, and that the relative positioning of the remaining data within PC-space is not entirely driven by S21/S22.
        • c. To further assess the degree of the S21/S22 samples’ outlying effects, we also performed ImpulseDE2 analysis to generate model fits without S21/S22 data. Doing so allowed us to determine to what degree the S21/S22 stages are necessary for driving the accessibility trajectory of individual peaks, and of the data more broadly. We performed IDE2 with either all data, or the S21/S22 data removed prior to input into IDE2. This generated two sets of model fits to the “cloud” of accessibility vs. time measurements: one that included the S21/S22 data, and one without. We evaluated, for each peak in our dataset, the time point at which the IDE2 model achieved maximum accessibility (the “IDE2 max fit”), and plotted both the “all” and “noS21S22” data as a histogram (see right panel, top graph). The presence of peaks that achieve predicted maximum accessibility in the S21/S22 stages in the “no S21/S22” data is a result of how we calculate “max fit”, which does not require that there is a known accessibility value at a given timepoint; only that the time point during which the model fit is maximum is closest to the timing of that developmental stage. Overall, we still observed early, middle, and late enrichment of IDE2 max fit even when the S21/S22 data are removed. We do see a rightward shift in the middle timepoint histogram in the direction of later stages, although this may be expected given the absence of concrete accessibility values at S21/S22 in the “no S21/S22” data. This indicates that our data globally retain the general trends of early, middle, and late enrichment of accessibility in the absence of the S21/S22 data. Moreover, this suggests that, even without the S21/S22 data, the remaining data from early and late stages result in a model fit that still predicts maximum accessibility at middle developmental stages for many peaks.
        • d. To further measure the influence of the S21/S22 data in IDE2 model fit, we also evaluated the degree of change in the global behavior of a peak when the S21/S22 stages were removed. This analysis aimed to assess whether removing S21/S22 data resulted in an IDE2 model with the same general trajectory as with all data, as opposed to the more stringent requirement of evaluating whether the exact developmental stage of the peak was changed. To perform this analysis, we grouped developmental stages into five quintiles, each representing three stages of development. We asked, for each peak in our dataset, whether that peak’s IDE2 max fit was “stable” when the S21/S22 data were removed; that is, if the quintile of the IDE2 max fit was altered when the S21/S22 data were removed (i.e. if a peak moved more than 3 developmental stages away from its original position), a peak was considered “unstable”. We observed that over 80% of peaks in each quintile remained “stable” after removing the S21/S22 data, suggesting that the vast majority peaks show the same general trajectory of accessibility even without the S21/S22 data. Peaks within the middle time points appeared to be more unstable than peaks at the terminal timepoints, which could be expected given that the S21/S22 timepoints constituted the middle-most timepoints in our dataset.

      We acknowledge that the S21/S22 timepoints still appear to be qualitatively different in other ways. Moreover, we acknowledge that some of the peaks in our dataset are “dependent” on the S21/S22 stages, given that their accessibility trajectory changes when these stages are removed. It is difficult to determine whether a change in accessibility trajectory for a given peak caused by the removal of S21/S22 data is indicative of technical differences in sample preparation, such as batch effects; biological variation, such as a potentially unknown mutant or sick embryo; or due to genuine wildtype biological processes that occur at the S21/S22 stages.

      These caveats acknowledged, a comparative analysis of the data in the absence of the S21/S22 stages suggests that much of the global picture of development remains the same. In the interest of providing the data we generated as a resource, we decided to include the S21/S22 data in the final manuscript we have prepared for submission.

      We have included an additional supplementary figure (Supp. Fig. 2.2) highlighting these further analyses, which we hope future readers will consider when performing their own analyses with these timepoints, as well as a summary of the ways we evaluated this potential concern in the Supplementary Methods. To facilitate future users of this dataset, we will include the model parameters calculated from IDE2 using both the full dataset and the data with S21/S22 removed in the GEO accession data, as well as a Jupyter notebook (ParhyaleATACExplorer.ipynb) that allows users to plot the raw accessibility data and IDE2 model fits for individual peaks of interest (C, example on right panel), so that downstream experiments can consider the potential differences with the S21/S22 samples.

      Reviewer #2, Comment #3:_

      “The majority of ATAC-seq peaks in the distal intergenic regions is a very surprising result. Authors defend this result by suggesting that this organism has big genome. May author perform a short analysis that shows that these peaks are indeed represent nearby genes or may point towards 3D genome organisation. For example, I see that this genome might have regions in the genomes that are densely organised in gene clusters, in those cases does the pattern remains same i.e he majority of the genes are very distant from each other and hence use vital regulatory elements?”_

      Reviewer #3, Cross-comment #3 of 3:_

      Peaks in distal intergenic regions: I agree that this could be elaborated on. It might also be that >10 kb is not actually that distal for Parhyale. I would suggest to split the "distal peaks" further (e.g., in 10 kb or 2-log steps, or whatever makes most sense) and try to understand if >10 kb is mostly <20 kb, or if most of them are hundreds of kb from the nearest gene?_

      1. Reviewers #2 and #3 expressed interest in understanding the absolute distribution of distal intergenic peak distances from nearby genes in our dataset. In generating the analyses to address this question, we stumbled upon an error in our code that reveals that the true number of intergenic peaks is much lower than we had originally reported. We discuss the nature of the error below. Moreover, we address the previous question using the new data, which overall still indicates that distal intergenic peaks remain a large portion of the Parhyale genome.
        • a. To address Reviewer #2’s comments with respect to the presence of potential clusters of intergenic regions, we built a Python tool (included in ParhyaleATACExplorer.ipynb) enabling the visualization of different cis-regulatory element categories along a genomic coordinate. Upon plotting our data with this tool, we observed problems with the categorization of the peaks – namely, that intronic and exonic peaks were erroneously classified as intergenic peaks (see right panel, top). We analyzed our script for classifying annotations more carefully and realized that we had erroneously used “bedtools closest” instead of “bedtools intersect” to try to identify all peaks overlapping with gene annotations in our genome. We corrected this error and observed the expected distribution and categories of peaks in our data (right panel, bottom).
        • b. The revised peak categories have been added to the updated manuscript in Fig. 3H and Fig. 5C. The categories of peaks we observed differ substantially from our previous results, in that we observe a much higher representation of exonic and intronic peaks in our dataset, with intronic peaks now representing 28.2% of all peaks (increased from <1%), and distal intergenic peaks representing 30.2% (decreased from 51.2%). While distal intergenic peaks remain the largest category over time, the proportion is relatively equal to the fraction of intronic peaks. Intergenic peaks (distal and proximal combined) now make up only a slightly larger fraction of peaks (37.2%) than gene body peaks (exon, intron; total 34.4%). This updated result is a significant departure from our previous report, and we have updated the text of the manuscript to correct this mistake.-
        • c. While intergenic and distal intergenic peaks constitute a much smaller portion of our data, we still wanted to address Reviewer #2 and #3’s questions about the distribution of distances between intergenic peaks and nearby genes. We generated a plot to illustrate the number of intergenic peaks at variable distances to the nearest gene (B, right panel). As illustrated in the plot, there are a very large number of distal intergenic peaks, including many peaks >100kb away from the nearest gene. The average distance of intergenic peaks from the nearest gene was 73,351bp. We neglected to mention in the original manuscript that one of the rationales for choosing a 10kb cutoff as “distal intergenic” was that peaks beyond this distance would be considerably more difficult to isolate as single fragments combined with a proximal promoter using PCR, agnostic of their orientation with respect to the promoter element. Such peaks could not have been easily identified using previous transgenic approaches, and are thus distinguished from “proximal” peaks by their necessary identification using techniques such as ATAC-Seq. We have updated the text to reflect this distinction.
        • d. Given that both intergenic and gene body peaks appeared to comprise large fractions of our revised data, we also examined the relative enrichment of intergenic and gene body peaks with respect to time (after normalizing for the fraction of “unknown” peaks, as suggested by Reviewer #3). We observed that the proportion of peaks belonging to intergenic and promoter regions declined slightly as development progressed, while the proportion of gene body peaks increased (E, below). There appeared to be slightly more intergenic peaks than gene body peaks at all developmental time points, and the ratio of intergenic peaks to gene body peaks declined very slightly over time (F, below). These data indicate that intergenic and gene body peaks have different enrichment trajectories over time. As development progresses, gene body peaks are increasingly enriched, and may have a greater impact on gene regulation. We have added these additional observations to the text and to a new Supplementary Figure 2.3.

      We have also addressed the following textual and conceptual concerns with the manuscript:

      Reviewer #3, Comment #1 of 11_

      I felt that the first paragraph of the introduction is not necessary._

      1. We believe the introductory paragraph helps frame the paper in the context of the broader scope of advances in technologies for emerging research organisms – currently, it has become straightforward to both generate a genome sequence and to identify and manipulate coding genes of interest across diverse taxa, but the identification of gene regulatory mechanisms remains more difficult. We have edited the introduction to better reflect this perspective and to link the first paragraph to the rest of the paper.

      Reviewer #2, Comment #1 of 3_

      “In Introductory paragraph 2, sentence one, authors suggest that gene regulation plays more important role in evolutionary process than genes. Although a significant amount of research has been dedicated to gene regulation based evolution still this field is in nascent form. For example evidence of inheritance of the gene regulation pattern across generation is scarce and requires more evidence. I suggest authors to modulate the claim that still gene based evolution is the main paradigm instead otherwise.”_

      Reviewer #3, Cross-comment #1 of 3_

      Evolution via gene regulation vs. coding sequence: While (to my understanding) it is largely accepted in the field that changes to the CDS will often have more deleterious effects than changes to the expression of a gene, I agree that this could be elaborated on a bit.

      1. As requested by Reviewers #2 and #3, we have clarified the language surrounding the debate between gene functional and gene regulatory evolution to indicate that both mechanisms appear to be important for evolutionary processes, with the importance of the latter more recently revealed.

      Reviewer #3, Comment #2 of 11_

      Use of Genrich: I presume this was run on both duplicates simultaneously? This is not clear from the methods section. It might have implications for downstream analyses (e.g., differential accessibility between time points) because running on both sequencing library replicates simultaneously leads to a single "replicate" of peaks per time point, while running it individually leads to two. However, I have never tested if this actually does make a difference. Maybe the authors have and can comment on this?

      1. In response to Reviewer #3’s inquiry about Genrich, we have added additional clarifying information into the Methods section. “Genrich analysis was run on both duplicate libraries simultaneously; Genrich performs peak calling on each peak individually, and then merges the p-values of the replicates using Fisher’s method to generate a q-value, obviating the need to calculate an Irreproducible Discovery Rate (IDR).” We did not test running Genrich on individual libraries, opting for the more conservative approach of using the combined q-value as a filtering score for peak quality. For further information, the reviewer can see the Genrich Github repository section here: < [https://github.com/jsh58/Genrich#multiple-replicates]

      Reviewer #3, Comment #4 of 11_

      The section on the IDE2 models (the paragraph at the end of page 4/beginning of page 5) was unclear to me but appears sound. (The only instance where I didn't quite understand what the program actually does.) Maybe this can be explained a bit easier?_

      1. As requested by Reviewer #3, we have attempted to explain the methods and logic of using ImpulseDE2 a bit more clearly:

      “To identify regions of dynamically accessible chromatin, we used the ImpulseDE2 (IDE2) pipeline (Fischer et al., 2018). IDE2 differs from other software for differential expression analysis in that it allows the investigation of trajectories of dynamic expression over large numbers of timepoints. It does so by modeling a gene expression trajectory as an “impulse” function that is the product of two sigmoid functions (Chechik and Koller, 2009; Yosef and Regev, 2011). This approach enables the modeling of a trajectory of gene expression in three parts: an initial value, a peak value, and a steady state value, thus summarizing an expression trajectory using a fixed number of parameters. With the ability to capture the differences between early, middle, and late expression values for each gene in a dataset, IDE2 also enables the detection of transient changes in gene expression or accessibility during a time course. Identifying differential expression over large numbers of timepoints is difficult for more categorical differential expression software such as edgeR and DESeq2, which generally use pairwise comparisons between timepoints to assess change over time (Love et al., 2014; Robinson et al., 2010).”

      Reviewer #2, Comment #2 of 3_

      2-2) Authors have repeatedly used S21 and S22 throughout the manuscript to support their claims with clustering etc. May authors shed some light on the differences in replicates for these timepoints. Furthermore, I could not find Fig 3J, perhaps author would like to point out Fig 3H.

      Reviewer #3, Comment #5 of 11_

      On page 7, Fig.3J needs changing to 3H. This figure should, in my opinion, also contain the absolute number of peaks for each time point to set the individual proportions into context.

      1. As requested by Reviewer #3, we have added a bar charts representing the number of peaks found at each time point (Fig. 3H) and the number of peaks found in each cluster (Fig. 5C) to the peak type proportion plots. We have also fixed references to Fig. 3J to instead refer to Fig. 3H – we apologize for the confusion.

      Reviewer #3, Comment #6 of 11_

      Last paragraph of the "Improving the Parhyale genome annotation" section: I think this needs to focus on those regions of the genome for which the location is known - after all, the "unknown" regions" could all be "distal transgenic", which would significantly change the relative proportions._

      1. We have revised our analysis of this topic with our updated peak type proportions, as described above in point 2d above under “substantive concerns”.

      Reviewer #3, Comment #7 of 11_

      “On page 9, t-SNE is mentioned but doesn't seem to be cited.”

      1. As requested by Reviewer #3, we have added citations for the t-SNE method, as well as scikit-learn, the software we used for t-SNE visualization.

      Reviewer #3, Comment #8 of 11_

      “The third paragraph on page 9 ("We evaluated the differences...") should mention the fact that clusters 1 and 2 are the only ones with significant proportions of exonic and intronic peaks. In the accompanying figure (5C), the total number of peaks would again be helpful.”_

      1. After identifying the error in our peak category classification pipeline, this observation was no longer true. However, upon examining the new distributions by cluster, we observed that in Clusters 3–7, for which we observed GO enrichment for developmental processes, there appeared to be slightly higher enrichment of intronic regulatory elements than distal intergenic regulatory elements. These results resemble the observation from recent work showing that tissue-specific enhancers are enriched in intronic regions in various human cell types (e.g. Borsari et al. 2021, Genome Research). We have noted this new observation in the text.

      Reviewer #3, Comment #9 of 11_

      In figure 5D, I can't quite make out at which stage the dip in the peak of Cluster 8 occurs. This is quite an unusual pattern of accessibility change, and I can't help but wonder if it has something to do with the quality of one of the libraries? Also, the fact that half of the peaks fall into unmapped regions of the genome is unusual, and I feel this deserves more discussion._

      1. In Figure 5D, Reviewer #3 asks about a dip in accessibility for Cluster 8 peaks. The dip in accessibility was actually observed for Cluster 9 peaks and is marked by the asterisk in that panel. We have updated the figure legend to clarify the significance of the asterisk and have referred readers to examine Supp. Fig. 5.1B, where the IDE2 model fits more clearly show a collective dip in accessibility for Cluster 9 peaks. Upon examining the size distribution of the clusters, we have also noticed that Cluster 8 is the smallest cluster. We have noted the small cluster size and high “unknown” peak enrichment for Cluster 8 in the text.

      Reviewer #3, Comment #10 of 11_

      “On page 10, the abbreviation PFM appears, but it is only explained in the legend of Fig.4. This should appear in the text.”_

      1. Reviewer #3 mentions that on page 10, we use the abbreviation for position frequency matrices (PFMs) without previous reference. We first introduce the abbreviation on page 8, but given the repeated use of “PFM” on page 10, we have added an additional explanation of the abbreviation on page 10, for ease of reading.

      Reviewer #3, Comment #11 of 11_

      “The section on "Concordant and discordant expression and accessibility" is the one I disagree most with. The authors seem to suggest that a repressive cis-regulatory module should become less accessible when the gene is activated. However, they leave trans-acting factors completely out of their conceptualisation here. It is in general likely the availability of transcription factors that leads to repression, while the "silencer" can be well accessible in all cells. Moreover, it has become clear in recent years that CRMs are not just repressors or enhancers per se but can act as either depending on the availability of transcription factors. I think these facts could partially explain the weak correlation and should be discussed.”_

      1. We appreciate the comments from Reviewer #3, which alerted us to the more recent literature around the bifunctional potential of regulatory elements. We have revised our claims to clarify that concordance and discordance analysis cannot be used to directly assign “enhancer” or “silencer” identity to given regulatory elements. Instead, we suggest that evaluating concordance and discordance can be useful for downstream users of our data, such as those aiming to build reporter constructs for a given gene of interest. To facilitate such tool development, we have built additional functions into a Jupyter notebook to enable the visualization of accessibility, gene expression, fold change of accessibility and gene expression, significance of fold change, and concordance/discordance assignment for arbitrary peak-gene pairs. An example of this visualization is shown on the following page. Panel A shows the region around the Engrailed-1 and Engrailed-2 loci in Parhyale (text labels within the plot region were added manually in Illustrator). Panel B shows visualization of the En1 promoter peak alongside En1 expression. Significant log fold changes (DESeq2 padj < 0.05) are marked by asterisks in the bar plots, and concordance/discordance assignment at each time point is indicated by the color of the comparison text (red = concordant, blue = discordant). Panels C and D show accessibility and expression visualization for a single peak (En1 peak5) compared to two nearby genes (En1 and En2). We hope to include sufficient documentation in our GitHub repository such that using these tools is accessible for most researchers, even with limited programming knowledge.

      Description of analyses that authors prefer not to carry out

      We were unable to easily visualize the distribution of regulatory elements across the whole genome as suggested by Reviewer #2. One challenge of working with the Parhyale genome is the lack of complete chromosomes. The genome is distributed across ~290,000 contigs of variable size. We were unable to find any software that could be easily and quickly set up to visualize our data, although we will provide in a Jupyter notebook the tools for local visualization of peak types that we developed.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #3

      Evidence, reproducibility and clarity

      In this study, Sun et al. use RNAseq and ATAC-seq in 15 stages of embryonic development of the amphipod crustacean Parhyale hawaiensis to analyse gene regulation genome-wide. They assess the data in multiple ways to provide a more complete genome annotation, understand temporal changes in gene regulation, and identify different classes of cis-regulatory elements including associated GO terms and putative transcription factor binding site enrichment. The authors have made a great effort to account for potential biases in their datasets (one impressive example is the comparison of multiple transcriptome assemblies and the following quality assessment) and I enjoyed reading this manuscript for its great explanations of method usage (i.e., what each bioinformatic package does, why it was used etc.) and the overall style.

      I want to make a few suggestions that would make the study - in my opinion - even better:

      • I felt that the first paragraph of the introduction is not necessary.
      • Use of Genrich: I presume this was run on both duplicates simultaneously? This is not clear from the methods section. It might have implications for downstream analyses (e.g., differential accessibility between time points) because running on both sequencing library replicates simultaneously leads to a single "replicate" of peaks per time point, while running it individually leads to two. However, I have never tested if this actually does make a difference. Maybe the authors have and can comment on this?
      • In general, I thought that the bioinformatic methods (i.e., the code or the options used for each program) would have been helpful for my understanding in some cases. The authors say that these will be published on an accompanying GitHub repository, which should be fine if this is sufficient for journal policy.
      • The section on the IDE2 models (the paragraph at the end of page 4/beginning of page 5) was unclear to me but appears sound. (The only instance where I didn't quite understand what the program actually does.) Maybe this can be explained a bit easier?
      • On page 7, Fig.3J needs changing to 3H. This figure should, in my opinion, also contain the absolute number of peaks for each time point to set the individual proportions into context.
      • Last paragraph of the "Improving the Parhyale genome annotation" section: I think this needs to focus on those regions of the genome for which the location is known - after all, the "unknown" regions" could all be "distal transgenic", which would significantly change the relative proportions.
      • On page 9, t-SNE is mentioned but doesn't seem to be cited.
      • The third paragraph on page 9 ("We evaluated the differences...") should mention the fact that clusters 1 and 2 are the only ones with significant proportions of exonic and intronic peaks. In the accompanying figure (5C), the total number of peaks would again be helpful.
      • In figure 5D, I can't quite make out at which stage the dip in the peak of Cluster 8 occurs. This is quite an unusual pattern of accessibility change, and I can't help but wonder if it has something to do with the quality of one of the libraries? Also, the fact that half of the peaks fall into unmapped regions of the genome is unusual, and I feel this deserves more discussion.
      • On page 10, the abbreviation PFM appears, but it is only explained in the legend of Fig.4. This should appear in the text.
      • The section on "Concordant and discordant expression and accessibility" is the one I disagree most with. The authors seem to suggest that a repressive cis-regulatory module should become less accessible when the gene is activated. However, they leave trans-acting factors completely out of their conceptualisation here. It is in general likely the availability of transcription factors that leads to repression, while the "silencer" can be well accessible in all cells. Moreover, it has become clear in recent years that CRMs are not just repressors or enhancers per se but can act as either depending on the availability of transcription factors. I think these facts could partially explain the weak correlation and should be discussed.

      Significance

      This manuscript will greatly advance research in the emerging model organism Parhyale through a more complete genome annotation and vast amounts of gene expression and chromatin accessibility data (and accompanying analyses) at various stages of development. However, the impact goes far beyond the Parhyale community, and I believe this paper can be seen as a blueprint for similar studies in other organisms. The excellent documentation and comparison of their bioinformatic methods makes their re-use straightforward and much of the authors' pipeline can be used for a "standard" ATAC-seq data analysis - I am likely to use many of their methods myself. Therefore, I think the audience can range from the "classic" evo-devo community to developmental biologists, scientists interested in gene regulation in general, and bioinformaticians.

      My own expertise is in gene regulation through transcriptional control, and I use different seq approaches (ATAC, CUT&RUN, RNAseq) to study this process.

      Referees cross-commenting

      Thank you to my colleagues for their comments. Since Reviewer 1 was happy with the manuscript as it is, I'll only add my views to the points raised by Reviewer 2: - Evolution via gene regulation vs. coding sequence: While (to my understanding) it is largely accepted in the field that changes to the CDS will often have more deleterious effects than changes to the expression of a gene, I agree that this could be elaborated on a bit. - Focus on stages S21/S22: This might indeed be somewhat problematic. The libraries from these two stages (particularly S21) seem to be very different from those from the other stages. In the PCA (Fig. 1C), S21 doesn't cluster well with anything, and the difference between the two replicates is massive compared to other stages. The accessibility pattern (Fig. 1D) also looks odd. The libraries also have the lowest scores for % of mapped reads (Fig. S2B), fragment size distribution (S2E), and Spearman correlation (S2I). All this could be biologically sound and be due to a major developmental transition at this point, but maybe it justifies revisiting the data and testing whether leaving out S21 (and/or S22) makes a big difference for the clustering analyses. - Peaks in distal intergenic regions: I agree that this could be elaborated on. It might also be that >10 kb is not actually that distal for Parhyale. I would suggest to split the "distal peaks" further (e.g., in 10 kb or 2-log steps, or whatever makes most sense) and try to understand if >10 kb is mostly <20 kb, or if most of them are hundreds of kb from the nearest gene?

    1. a constellation already described in 1805 by Heinrich von Kleist in his fascinat-ing analysis of the “Midwifery of Thought”: “If you want to know something and cannotfind it through meditation, I advise you, my dear, clever friend, to speak about it withthe next acquaintance who bumps into you.” 43 The positive tension that such a conversa-tion immediately elicits through the expectations of the Other obliges one to producenew thought in the conversation. The idea develops during speech. There, the sheeravailability of such a counterpart, who must do nothing further (i.e., offer additionalstimulus through keen contradiction of the speaker) is already enough; “There is a specialsource of excitement, for him who speaks, in the human face across from him; and agaze which already announces a half-expressed thought to be understood often givesexpression to the entire other half.”44
      1. Heinrich von Kleist, “Ü ber die allm ä hliche Verfertigung der Gedanken beim Reden,” in Sämtliche Werke und Briefe. Zweiter Band, ed. Helmut Sembdner (M ü nchen: dtv, 1805/2001), 319 – 324, at 319.
      2. Ibid., 320.

      in 1805 Heinrich von Kleist noted that one can use conversation with another person, even when that person is silent, to come up with solutions or ideas they may not have done on their own.

      This phenomena is borne out in modern practices like the so-called "rubber duck debugging", where a programmer can talk to any imagined listener, often framed as a rubber duck sitting on their desk, and talk through the problem in their code. Invariably, talking through all the steps of the problem will often result in the person realizing what the problem is and allow them to fix it.

      This method of verbal "conversation" obviously was a tool which indigenous oral cultures frequently used despite the fact that they didn't have literacy as a tool to fall back on.

    1. SciScore for 10.1101/2022.05.24.493348: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All animal experiments were performed in accordance with the Guide for Animal Experiments Performed at the National Institute of Infectious Diseases (NIID) and were approved by the Animal Care and Use Committee of NIID.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Immunization and sampling: Female BALB/c mice (20-24 weeks old) (Japan SLC Inc., Hamamatsu, Shizuoka, Japan) were maintained in specific pathogen-free facilities.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2 challenge was performed in a biosafety level 3 facility according to the Guidelines for Animal Experiments performed at NIID. 2.4. Estimation of SARS-CoV-2 S-specific antibody responses: SARS-CoV-2 S-specific antibodies were estimated using ELISA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 S-specific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IgG antibodies were detected using biotin-conjugated goat anti-mouse IgG antibody (Jackson Immunoresearch, West Grove, PA), followed by alkaline phosphatase-conjugated streptavidin (Invitrogen, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The S-specific IgG antibody titer was defined as the reciprocal of the highest dilution of the test sample, giving a higher absorbance than the cut-off value obtained as 2-fold mean absorbance of serial dilutions of control naive mouse serum set in each plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S-specific IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantification of S-specific IgG1 or IgG2a antibodies in the serum and IgA antibodies in nasal or lung washes was performed as previously described [23].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG2a</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Chimeric human-mouse monoclonal IgG1, IgG2a, and IgA antibodies bearing variable regions of the S-specific human monoclonal antibody S309 [33] were used as standard antibodies for quantification.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Horseradish peroxidase (HRP)-conjugated polyclonal anti-mouse IgG1 antibody (Bethyl Laboratories, Montgomery, TX), anti-mouse IgG2a antibody (Bethyl Laboratories), or polyclonal anti-mouse IgA antibody (Bethyl Laboratories) were used as detection antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG2a</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, in plates pre-coated with anti-mouse IFN-γ, IL-4, or IL-5 antibodies, 3 × 105 cells harvested from the spleen or cervical lymph nodes were incubated for 16 h in the presence of a peptide pool derived from the S protein of SARS-CoV-2 (a mixture of PepTivator SARS-CoV-2 Prot_S, S1, and S+; Miltenyi Biotec, Bergisch Gladbach, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IFN-γ</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IL-4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IL-5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing the cells with PBS, biotin-conjugated anti-IFN-γ, IL-4, or IL-5 detection antibodies were added and incubated at RT for 2 h, followed by incubation with ALP-conjugated streptavidin at RT for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IFN-γ</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One million cells were stained with FVD506 (Thermo Fisher Scientific) for dead cell removal and blocked with anti-mouse CD16/CD32 monoclonal antibody (BD Pharmingen, San Jose, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse CD16/CD32</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 50uL of QHmusX (100TCID50) and 50uL of heat-inactivated serum serially diluted by two-fold were mixed and incubated in 96-well microtiter plates for 1h at 37□, followed by the addition of 100 µL of VeroE6-TMPRSS2 cells (JCRB1819, Japanese Collection of Research Bioresources Cell Bank) [35, 36].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunization and sampling: Female BALB/c mice (20-24 weeks old) (Japan SLC Inc., Hamamatsu, Shizuoka, Japan) were maintained in specific pathogen-free facilities.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Horseradish peroxidase (HRP)-conjugated polyclonal anti-mouse IgG1 antibody (Bethyl Laboratories, Montgomery, TX), anti-mouse IgG2a antibody (Bethyl Laboratories), or polyclonal anti-mouse IgA antibody (Bethyl Laboratories) were used as detection antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bethyl Laboratories</div><div>suggested: (Bethyl, RRID:SCR_013554)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spots formed by cytokine-secreting cells were counted and analyzed using ELISpot reader S6 Universal with ImmunoSpot 7.0 software (Cellular Technology, Ltd., Shaker Heights, OH). 2.7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImmunoSpot</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were analyzed with CantoII (BD Biosciences), and data were analyzed using FlowJo software version 10.8.0 (Tree Star Inc., Ashland, OR). 2.8. Quantification of SARS-CoV-2 subgenomic RNA: Total RNA was extracted from 125 µL of nasal or lung wash using ISOGEN-LS (Nippon gene, Toyko, Japan) and purified using a Maxwell RSC 48 Instrument (Promega, Madison, WI) with a Maxwell RSC miRNA Plasma and Serum Kit (Promega).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Biosciences</div><div>suggested: (BD Biosciences, RRID:SCR_013311)</div></div><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Data analysis and visualization were performed using GraphPad Prism 7.0 software (GraphPad Software Inc., San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.22.492976: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.


      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.23.493138: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Polarization Anisotropy: Fluorescent RNA was ordered from IDT as a 10-nt degenerate sequence (random nucleotide at every position) with a 3’-FAM modification.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, a codon-optimized synthetic DNA (Integrated DNA Technologies, IDT) was inserted into a pET28 expression vector by Gibson assembly, fused to DNA encoding an N-terminal 6xHis-SUMO tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET28</div><div>suggested: RRID:Addgene_21766)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The template for in vitro transcription of 5’-600 RNA was a synthetic DNA (IDT), inserted by Gibson assembly into a pUC18 vector with a 5’ T7 promoter sequence.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pUC18</div><div>suggested: RRID:Addgene_50004)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data from three independent N protein titrations were fit to a one-site binding curve using GraphPad Prism to determine KD.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.22.492693: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After blocking with 3% albumin (Sigma-Aldrich) and primary antibody incubation RAGE (ab3611, Abcam), ACE2 (XXX), ADAM17 (ab2051, Abcam)), TMPRSS2 (ab109131, Abcam), the membranes were incubated with an anti-rabbit peroxidase-conjugated secondary antibody (GE healthcare).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ADAM17</div><div>suggested: (Abcam Cat# ab2051, RRID:AB_302796)</div></div><div style="margin-bottom:8px"><div>TMPRSS2</div><div>suggested: (Abcam Cat# ab109131, RRID:AB_10863728)</div></div><div style="margin-bottom:8px"><div>anti-rabbit peroxidase-conjugated secondary</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">500 μg of protein lysate was incubated with Anti-6X His tag® antibody [HIS.H8] (ab18184, Abcam) overnight at 4°C, anti-Mouse IgG (Invitrogen) was used as isotype control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-6X</div><div>suggested: (Abcam Cat# ab18184, RRID:AB_444306)</div></div><div style="margin-bottom:8px"><div>anti-Mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">P4417-100TAB-Sigma-Aldrich) plus 1% Bovine Serum Albumin (BSA) (Cat.A9647-500G-Sigma-Aldrich) and 0,02% NP-40 alternative (Cat.492016-100ML) for 1h at room temperature prior to overnight incubation at 4°C with primary antibody 1:100 (6xHisTag clone#HIS.H8 Cat.ab18184-Abcam or SARS-CoV-2 spike polyclonal antibody, GeneTex).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>6xHisTag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were collected and stained using primary RAGE antibody 1:100 (PA5-24787, Thermo Scientific) for FACS analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RAGE</div><div>suggested: (Thermo Fisher Scientific Cat# PA5-24787, RRID:AB_2542287)</div></div><div style="margin-bottom:8px"><div>PA5-24787</div><div>suggested: (Thermo Fisher Scientific Cat# PA5-24787, RRID:AB_2542287)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1 × 105 THP-1 cells were seeded on a 24-well plate in their culture medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>THP-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">THP1 and Monocytes infection with SARS-CoV-2: THP1 cells were plated at 5×105 cell/ml in 48-well plates in 200 μl of RPMI-1640 supplemented with 1% fetal bovine serum (FBS) (Euroclone).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>THP1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture supernatants were collected 24, 48, 72 and 144 h post-infection and stored at – 80°C until the determination of the viral titers by a plaque-forming assay in Vero cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following day, cells were pretreated or not with 2μM Azeliragon (Cat.S6415-Selleckchem) for 30 minutes before adding 100 ng/mL of Sars-CoV-2 spike protein (RBD, HisTag) (Cat. ZO3483-1-GenScript) or infected using Heat-inactivated SARS-CoV-2 (VR-1986HK, ATCC) at 4 TCID50/mL for 2h at 37°C 5%CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VR-1986HK</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequencing: Different library types were pooled at different ratios based on their targeted reads per cell and the nanomolarity of the library pools was confirmed using the Agilent Bioanalyzer 2100.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Agilent Bioanalyzer</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Separately for the two selected categories of disease severity (mild vs severe/critical), the pseudo-bulk counts were then fitted with a generalised linear model using the EdgeR package, to identify those genes characterised by a well-defined decreasing or increasing trend of the expression over the sample time-points.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EdgeR</div><div>suggested: (edgeR, RRID:SCR_012802)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Among these sets, the GO:0050786 genelist was then expanded using the Cytoscape ‘stringApp’ (81) in order to identify among the nearest neighbours with confidence score > 0.7 the ones showing the highest absolute FC values in Myeloid cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cytoscape</div><div>suggested: (Cytoscape, RRID:SCR_003032)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The GSEA has been done with the clusterProfiler library (82, 83), using gene lists ranked by the FDR of the differential analysis and the sign of the logFC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GSEA</div><div>suggested: (SeqGSEA, RRID:SCR_005724)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The gating strategy and the relative analysis were performed with FlowJo software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.18.22275112: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Both studies were approved by the Ethics Committee of Eastern Switzerland.<br>Consent: The first study was exempt from patient consent, because only minimal data were included and it would have been impossible to obtain consent from all patients, while inclusion of all cases was essential to calculate true incidence.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Because the availability of serologic testing for anti-PLA2R autoantibodies may have influenced biopsy practice over time,16 we performed a sensitivity analysis excluding MN.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-PLA2R</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      This study has several limitations. First, due to the limited population size of Switzerland and the low incidence of glomerulonephritis, we cannot exclude a small effect of vaccinations, in particularly for MCD, as discussed above. Second, due to the decentralized health care system in Switzerland, patients were cared for by a variety of hospital-based and private practice nephrologists. Patient evaluation and care were thus not standardized and the study relied on patient- and physician-reported data. Third, due to the retrospective design of the study, patient-reported symptoms were subject to potential recall bias and onset of symptom dates were not precise in some patient questionnaires. Therefore, we chose biopsy proven glomerulonephritis as the primary outcome. Fourth, we were not able to include all patients with biopsy-proven glomerulonephritis in the second study and cannot exclude selection bias. However, the major reason for non-inclusion of patients was non-participation of their treating nephrology divisions or practices due to time constraints, which should not introduce bias. Finally, our results are limited to new-onset glomerulonephritis and cannot answer the question, whether SARS-CoV-2 vaccination could trigger relapses in patients with previously diagnosed glomerulonephritis, because relapses are usually diagnosed clinically without repeat biopsy. In conclusion, combining two complementary approaches, we did not find an association between mRNA-based vacc...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.24.493068: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: Cells were seeded in 24-well tissue culture plates and incubated at 37 °C in media and densities (cells per well) for the given times as indicated below; human nasal epithelial cells (HNECs) in HNEC medium at 4.5×104 (72 h) and HeLa Ohio cells in HeLa Ohio medium at 2×105 (16-20 h).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">LLC-MK2 and MRC-5 cells were cultured in T25 cell culture flasks in the corresponding media at densities of 8×105 and 9×105, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MRC-5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus titration: Samples from SARS-CoV-2, HCoV-229E and HCoV-NL63 were titrated on Vero cells, MRC-5 cells, and LLC-MK2 cells, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div><div style="margin-bottom:8px"><div>LLC-MK2</div><div>suggested: BCRJ Cat# 0146, RRID:CVCL_3009)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Titration was performed using eightfold replicates of serial half-log10 (for SARS-CoV-2, HCoV-229E and HCoV-NL63) or log10 (for RV-B14) dilutions of virus-containing samples followed by incubation at 36 °C (SARS-CoV-2, HCoV-229E), 33 °C (HCoV-NL63) and 34 °C (RV-B14) for 5-7 days (SARS-CoV-2, HCoV-229E, RV-B14) or 9-11 days (HCoV-NL63).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-229E</div><div>suggested: JCRB Cat# JCRB1838, RRID:CVCL_B3M4)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      As conventional RT-PCR holds limitations to detect the negative strand in excess of positive strand copies, we employed a recently published strategy by Wiehler and Proud [32] to analyze the negative strand level. We observed that 2-DG significantly reduced the genomic (+)ssRNA as well as the template (-)ssRNA, a likely cause for the measured significant reduction in detectable extracellular viral RNA (Figure 4A&B). These findings point at a 2-DG-mediated impairment in viral RNA replication and amount of released virus. In line with this, titration of the released virus on HeLa Ohio cells showed a reduction in viral load (Figure 4C). To be noted, HeLa Ohio cells used in this experimental setup, due to their cancerous origin, have a high glucose demand and are especially sensitive to glucose starvation and 2-DG treatment. Therefore, low amounts of 2-DG were used, and the cells were treated only once after the start of the RV infection. This could explain the relatively small difference in viral load (Figure 4C) in contrast to the significant difference in released extracellular viral RNA (Figure 4B). In our subsequent analysis, we found that 2-DG exerted a protective effect by significantly reducing virus-induced cell death in HeLa Ohio cells (Figure 4D). In contrast, RV infection does not cause cell lysis in cultures of healthy bronchial epithelial cells [39]. Interestingly, the same study reported increased viral replication and cell lysis after RV infection in asthmatic bro...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. So, to fix the issue with the phone codes, we can “cheat” by making the codes non-integer. Adding a plus "+" sign before each code is enough.

      how to sort integers by creation time in objets

    1. All these trends — isomorphic code, compile-to-js languages, node.js — come from a desire to run the same code in two places. That very goal is wrong.

      Everything can be treated as a database! We shouldn't have to worry about "replicating" the data - backups are good, but storing temporary sources of truth in some places with more permanent sources of truth in others is a little silly... what gives them that privilege and why is all the data constrained to the backend?

    1. SciScore for 10.1101/2022.05.21.492554: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: A blood sample was taken following consent at least 14 days after symptom onset.<br>IRB: Sera from Beta, Gamma and Delta and BA.1 infected cases: Beta and Delta samples from UK infected cases were collected under the “Innate and adaptive immunity against SARS-CoV-2 in healthcare worker family and household members” protocol affiliated to the Gastro-intestinal illness in Oxford: COVID sub study discussed above and approved by the University of Oxford Central University Research Ethics Committee.<br>Field Sample Permit: The study was approved by the Human Research Ethics Committee of the University of the Witwatersrand (reference number 200313) and conducted in accordance with Good Clinical Practice guidelines.<br>IACUC: Gamma samples were provided by the International Reference Laboratory for Coronavirus at FIOCRUZ (WHO) as part of the national surveillance for coronavirus and had the approval of the FIOCRUZ ethical committee (CEP 4.128.241) to continuously receive and analyse samples of COVID-19 suspected cases for virological surveillance.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">The mean age of vaccinees was 37 years (range 22-66), 21 male and 35 female.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">AstraZeneca-Oxford vaccine study procedures and sample processing: Full details of the randomized controlled trial of ChAdOx1 nCoV-19 (AZD1222), were previously published (PMID: 33220855/PMID: 32702298).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">EXPERIMENTAL MODEL AND SUBJECT DETAILS: Bacterial Strains and Cell Culture: Vero (ATCC CCL-81) and VeroE6/TMPRSS2 cells were cultured at 37 °C in Dulbecco’s Modified Eagle medium (DMEM) high glucose (Sigma-Aldrich) supplemented with 10% fetal bovine serum (FBS), 2 mM GlutaMAX (Gibco, 35050061) and 100rnU/ml of penicillin– streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>VeroE6/TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T (ATCC CRL- 11268) cells were cultured in DMEM high glucose (Sigma-Aldrich) supplemented with 10% FBS, 1% 100X Mem Neaa (Gibco) and 1% 100X L-Glutamine (Gibco) at 37 °C with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting S gene-carrying pcDNA3.1 was used for generating pseudoviral particles together with the lentiviral packaging vector and transfer vector encoding luciferase reporter.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The gene fragment was amplified with pNeoRBD333Omi_F (5’- GGTTGCGTAGCTGAAACCGGTCATCACCATCACCATCACACCAATCTGTGCCCTTTCGAC-3’) and pNeoRBD333_R (5’-GTGATGGTGGTGCTTGGTACCTTATTACTTCTTGCCGCACACGGTAGC-3’), and cloned into the pNeo vector (Supasa et al., 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNeo</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate the BA.4/5 RBD construct containing a BAP- His tag, the gene fragment was amplified with RBD333_F (5’- GCGTAGCTGAAACCGGCACCAATCTGTGCCCTTTCGAC-3’) and RBD333_BAP_R (5’-GTCATTCAGCAAGCTCTTCTTGCCGCACACGGTAGC-3’), and cloned into the pOPINTTGneo-BAP vector (Huo et al., 2020a).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pOPINTTGneo-BAP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To express biotinylated RBDs, the RBD-BAP plasmid was co-transfected with pDisplay-BirA-ER (Addgene plasmid 20856; coding for an ER-localized biotin ligase), in the presence of 0.8 mM D-biotin (Sigma-Aldrich).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RBD-BAP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pDisplay-BirA-ER</div><div>suggested: RRID:Addgene_20856)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sensorgrams were plotted using Prism9 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The percentage reduction was calculated and IC50 determined using the probit program from the SPSS package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04324606</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Study of a Candidate COVID-19 Vaccine (COV001)</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04400838</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Investigating a Vaccine Against COVID-19</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.21.492922: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(iv) Wash the cells 3 times with PBS. (v) Dilute the TRITC-labeled donkey anti-mouse IgG secondary antibody in blocking solution to a final concentration of 1 µg/mL, and incubate with the cells (1 mL/well) at 37°C for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(iv) Wash the cells 3 times with PBS. (v) Dilute the biotinylated horse anti-mouse secondary antibody in blocking solution, and incubate with the cells (1 mL/well) at 37°C for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Rescue of rSARS-CoV-2 using the pBeloBAC-FL: Transfection of the pBeloBAC-FL into Vero E6 cells: 33.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CRITICAL The pBeloBAC plasmids that are used for cloning must be purified.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBeloBAC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The PCR-positive clone is further confirmed by sanger sequencing using the CMV/F and bGH/R primers (Table 2) and designated as pBeloBAC-F1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBeloBAC-F1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Set up a restriction digestion of PacI and MluI to linearize the purified pBAC-F1, similar to step 13.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBAC-F1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, assemble F4 (using MluI and BstBI), F2 (using KasI and PacI), and F5 (using BstBI and BamHI) into pBeloBAC-F13 one by one as previously described for F3 into pBeloBAC-F1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBeloBAC-F13</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resultant plasmids are named, respectively, pBeloBAC-F134, pBeloBAC-F1342, and finally pBeloBAC-FL, which contains F1, F2, F3, F4 and F5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBeloBAC-F134</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pBeloBAC-F1342</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CAUTION Transfection to generate rSARS-CoV-2 using the pBeloBAC-FL must be performed in a biosafety level (BSL) 3 laboratory following institutional biosafety guidelines.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>rSARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cloning of the Venus reporter gene into the pBeloBAC-FL: Cloning of Venus into the pUC57-F1: 47.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBeloBAC-FL</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Set up a PCR reaction in a 0.2 mL tube according to the list below to amplify pUC57F1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pUC57F1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The positive plasmid is designated as pUC57-F1/Venus-2A.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pUC57-F1/Venus-2A</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The positive clone is named as pBeloBAC-FL/Venus-2A.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBeloBAC-FL/Venus-2A</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.23.493121: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was performed in compliance with all relevant ethical regulations and the study protocols were approved by the Ethical Committee of the Canton Ticino (ECCT): CE-3428 and CE-3960.<br>Consent: Written informed consent was obtained from all participants, and all samples were coded to remove identifiers at the time of blood withdrawal.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">All assays were done in triplicate, and for each well the migrated cells were counted at 100-fold magnification in 5 randomly selected high-power fields (5HPF).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Chemotaxis was performed with preB 300.19 expressing CCR2, at a final IgG concentration of 200 µg/ml, in the presence of the chemokine concentration resulting in peak migration when no antibodies were added (CCL2 [10nM], CCL7 [100nM], CCL8 [100nM]).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CCR2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CCL2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CCL7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CCL8</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were subsequently washed 4 times with washing buffer and incubated with anti-human IgG secondary antibody conjugated to horseradish peroxidase (HRP) (GE Healthcare, NA933) at a 1:5000 dilution in PBS + 0.05% Tween-20.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (GE Healthcare Cat# NA933-1ml, RRID:AB_772208)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Kinetic of signature anti-chemokine IgG antibodies (fig.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-chemokine IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single cell sorting by flow cytometry: B cells were enriched from PBMCs of uninfected controls or of COVID-19 convalescent individuals 6 months after COVID-19 (participant CLM9 for anti-CCL8 antibodies; CLM64 for anti-CCL20 antibodies; CLM5, CLM7 and CLM33 for anti-CXCL13 antibodies; and CLM8 and CLM30 for anti-CXCL16 antibodies), using the pan-B-cell isolation kit according to manufacturer’s instructions (Miltenyi Biotec, 130-101-638).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CCL20</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CXCL13</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CXCL16</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The enriched B cells were subsequently stained in FACS buffer (PBS + 2% FCS + 1mM EDTA) with the following antibodies/reagents (all 1:200 diluted) for 30 min on ice: anti-CD20-PE-Cy7 (BD Biosciences, 335828), anti-CD14-APC-eFluor 780 (Thermo Fischer Scientific, 47-0149-42), anti-CD16-APC-eFluor 780 (Thermo Fischer Scientific, 47-0168-41), anti-CD3-APC-eFluor 780 (Thermo Fischer Scientific, 47-0037-41), anti-CD8-APC-eFluor 780 (Invitrogen, 47-0086-42)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD20-PE-Cy7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD14-APC-eFluor 780</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD16-APC-eFluor 780</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD3-APC-eFluor 780</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD8-APC-eFluor 780</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Amplicons from this first PCR reaction served as templates for sequence and ligation independent cloning (SLIC) into human IgG1 antibody expression vectors.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Where indicated, the anti-Zika virus monoclonal antibody Z021 (75) was used as an isotype control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Zika</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 pseudotyped reporter virus and neutralization assay: To generate (HIV-1/NanoLuc2AEGFP)-SARS-CoV-2 particles, HEK293T cells were co- transfected with the three plasmids pHIVNLGagPol, pCCNanoLuc2AEGFP, and SARS- CoV- 2 S as described elsewhere (47, 80)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, threefold serially diluted plasma samples (from 1:50 to 1:328’050) were incubated with SARS-CoV- 2 pseudotyped virus for 1h at 37 °C, and the virus-plasma mixture was subsequently incubated with 293TACE2 cells for 48 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293TACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 pseudotyped reporter virus and neutralization assay: To generate (HIV-1/NanoLuc2AEGFP)-SARS-CoV-2 particles, HEK293T cells were co- transfected with the three plasmids pHIVNLGagPol, pCCNanoLuc2AEGFP, and SARS- CoV- 2 S as described elsewhere (47, 80)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHIVNLGagPol</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCCNanoLuc2AEGFP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S5E): Experiments were performed with plasma samples assayed at a 1:50 dilution side-by-side on the same plate, and the average optical density at 450 nm obtained from two independent experiments was plotted with GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Live single Zombie-NIR−CD14−CD16−CD3−CD8−CD20+Ova−N-loop-PE+N-loop- AF647+ B cells were single-cell sorted into 96-well plates containing 4 μl of lysis buffer (0.5× PBS, 10 mM DTT, 3,000 units/ml RNasin Ribonuclease Inhibitors [Promega, N2615]) per well using a FACS Aria III, and the analysis was performed with FlowJo software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1 was generated from the structure of inactive CCR2 (PDB code: 5T1A) (81), together with the electron microscopy structures of CCR5 and CCR6 (PDB codes: 6MEO and 6WWZ, respectively (82, 83) by using SWISS-MODEL (84) server and the molecular graphics program PyMOL 2.5.0 for modeling the N- and C-terminus of the receptor.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">t-SNE: t-SNE analysis was performed using the Rtsne R package v 0.15 (https://CRAN.R-project.org/package=Rtsne) using the AUC values for all chemokines.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Rtsne</div><div>suggested: (Rtsne, RRID:SCR_016342)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.21.492903: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical statement: The study protocol was approved by the Ethics Committee of the Institute of Beijing Ditan Hospital, Capital Medical University (IRB#2021-(024)-02).<br>Consent: Written informed consent was obtained from all participants before the enrollment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK-293T cells were transfected with the plasmids expressing different S protein respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell transfection and pseudotyped virus production: The pSectag2 vector was used to construct recombinant plasmid of codon optimized spike proteins of SARS-CoV-2 prototype (Wuhan-1 reference strain containing D614G mutation) and variants, with a 19 amino acid truncation at the C-terminus of the spike protein1 (with mutations shown in Fig.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSectag2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pVNT50 was interpolated from the neutralization curves determined using the log(inhibitor) vs. normalized response -- Variable slope fit using automatic outlier detection in GraphPad Prism Software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.21.492928: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      We now briefly mention several caveats pertaining to our study. At the current stage, we have intentionally used a relatively simple model that focuses on the magnitude of the antibody response following WU- and OM-vaccination. This is because at present, data on the dynamics following immunization and boosting is largely limited to titers of antibodies (6, 8, 37–40), serum biomarkers (8, 37, 38), and the virus inoculum (41, 42). We have much more limited data on the dynamics of different populations of cells responsible for the generation of humoral immune responses in the lymph nodes (39, 43). These would include different populations of dendritic cells, follicular CD4 T cells, as well as different populations of B cells and plasma cells (33, 34, 44–50). Further complexities specific to CoV-2 include the spatial aspect of infections of the respiratory tract (51–54) as well as the dynamics of production and distribution of antigen by mRNA based vaccines (55) as well as infections. As more data becomes available, it will be possible to construct more nuanced and refined models of the dynamics of humoral immunity as well as affinity maturation (56–62). Other directions that could be taken include modeling how protection is lost as the antibody titers elicited by the different immunizations wane. Gagne et al. showed that shortly after vaccination #3, both vaccines elicited similar levels of protection following virus challenge, and it will be important to know if and how this p...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.21.22274939: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Sampling and Study Size: Convenience sampling was used given the logistical constraints to conduct field data collection during the pandemic.<br>IRB: Ethics Statement: This research was given ethical approval by the Ateneo University Research Ethics Committee<br>Consent: Digital written informed consent was obtained from participants prior to the interview.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">We described participants according to their age in years, sex (male or female), setting of residence (urban or rural), residence by island group (Luzon, Visayas, Mindanao), educational attainment (secondary or lower, college, post-graduate), employment status (full-time employment, part-time employment, unemployed, student, retired), monthly household income, monthly household health expenditure, and monthly individual health expenditure, membership to any health insurance (yes, no), overall health rating measured as a 5-point Likert scale.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data Analysis: Quantitative Analysis: We analyzed our quantitative data using descriptive statistics: percentage for categorical variables, and median for continuous variables using SPSS Statistics version 25.0 (20).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      However, the inherent limitations of telemedicine restrict its utility, especially for health conditions that require physical assessments and laboratory tests. We found that telemedicine use and satisfaction are influenced by a number of factors including: safety during the pandemic, privacy, affordability, convenience and accessibility, and availability of more avenues of communication. Safety was a major concern that prompted participants to use telemedicine. Telemedicine enables patients to avoid situations that would expose them to SARS-CoV-2, the causative agent of COVID-19, such as traveling and staying for long periods in high-risk environments. These safety concerns, together with lockdown restrictions, resulted to significant declines in hospital admissions for non-urgent procedures (2). Innovative solutions through telemedicine have been introduced including video visits (25). Participants also mentioned that telemedicine assisted in maintaining privacy. The benefits of anonymity are especially important with regards to sensitive and potentially stigmatizing health issues such as mental or sexual health conditions (29). Because telemedicine removes the need to travel, participants also viewed it as more affordable and convenient. This was noted by participants as an enabling factor to use telemedicine, especially since a third of our participants are full-time employees, while a quarter are students. Traveling for healthcare purposes could mean missing work or scho...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.17.22275005: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Inclusion criteria were having registered in a database for at least one dose of BNT162b2 that was administered before reaching the age of 5 years, and informed consent of a parent/legal representative to participate in the survey of the current study.<br>IRB: The present study protocol was approved by the Ethics Committee of the University of Rostock, Germany (ID: A 2022-0065).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using MATLAB R2020a and STATA version 15. Chi-Square or Fisher’s exact tests were used to compare categorical variables over pre-defined strata of age groups and BNT162b2 dosage.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      The present study contains some limitations. First, the study relies on retrospective self-reported data by proxy, which i) may not directly reflect what a child had experienced and ii) underlies a risk of recall bias i.e. not recalling some not life-threatening symptoms several months later. However, the extensive public debate about SARS-CoV-2 vaccinations including their potential side effects, the off-label use investigated, and the study results showing dosage-dependent associations between vaccination and local reactions in ≥24 to <60 months old children suggest that symptoms were adequately reported. The retrospective design did not allow for a structured real-time documentation of symptoms nor an estimation of causality and severity to infer the frequency of vaccine-related serious adverse reactions, but such data should be expected from the ongoing prospective manufacturer-sponsored BNT162b2 studies (5). As vaccinations themselves were not directly part of the study, the study relied on vaccination information as reported by the respondents. However, a potential risk of manipulation by individual respondents was minimized by dispensing study participation codes only via vaccinating centers/initiatives, and the availability of BNT162b2 lot numbers. Moreover, potential duplicate entries were identified by overlap in demographic data and were removed. The reported post-vaccination symptoms could potentially be unrelated to the vaccine. To mitigate this problem, a non-BN...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.20.22275319: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.


      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.20.22275396: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.20.22275407: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.


      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.23.22275442: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Participants were included in this study if they were aged 18-65 years, willing and able to give informed consent, and capable of taking part in the assessment.<br>IRB: The study was approved by the ethics committee of the Friedrich-Schiller-University [amendment to 5082-02/17].</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      The study has certain strengths and multiple limitations. Strengths include a large sample of well-defined post-COVID patient group, a socio-demograpically matched control group and the use of an innovative and sensitive tablet-based assessment tool with automated scoring. The most critical limitation is that our study cannot inform about whether the identified deficits pre-existed prior to infection. This is true even though we excluded patients with known relevant neurological disorders. Our study is furthermore prone to selection bias. As we tested a clinically referred sample of post-COVID patients, findings might not generalize to all post-COVID patients, but only to those who have symptoms severe enough to visit a specialized clinic. The OCS-Plus testing identified subtle long-term cognitive deficits persisting for more than 3 months in patients with post-COVID syndrome. A relevant next step will be obtain longitudinal data on memory, attention and executive functions from the presented cohort, in order to differentiate between deficits that might improve and those that might become chronic. This will provide specific information on targets for interventions, such as cognitive training. As many patients affected by post-COVID syndrome are living in medically underserved, rural areas, the mobile, cost-effective and highly scalable OCS-Plus assessment could be used for testing patients outside specialized facilities.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.21.492920: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: , Radiation Safety, and Animal Care and Use Committees.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Male golden Syrian hamsters (7 to 8 weeks of age) were purchased from Envigo (Haslett, MI).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The wells were washed and then incubated with rabbit anti-ERα (1:2000, 1 h, RT) and horseradish-conjugated secondary antibody (1:2000, 1 h, RT) that were provided with the kit.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ERα</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-542, RRID:AB_631470)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were then incubated at 4°C overnight with 2 μg/ml each of anti-ERα(H222) rat IgG1 monoclonal antibody (mAb) (Santa Cruz Biotech, sc-5349, 1:100) and HA-probe (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ERα(H222</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>rat IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Afterwards, the cells were washed 4 times with PBS + 0.1% Tween-20 (PBS-T) for 5 minutes and incubated at room temperature for 1 hour in the dark with a fluorescent secondary antibody mixture contaning mouse IgGk BP-CFL594 (Santa Cruz Biotech, sc-516178, 1:100) and anti-rat IgG AF488 (ThermoFisher Scientific, cat no. A-11006, 1:500).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rat IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, cells were washed and were incubated with detector anti-BrdU antibody for 1 hour at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-BrdU</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the incubation cells were washed and incubated with the horseradish peroxidase conjugated goat anti-mouse antibody for 30 minutes at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 50 μl of standard were added to standard wells and 40 μl of sample-to-sample wells and then added 10 μl of anti-TRAP antibody to sample wells and 50 μl of streptavidin-HRP to sample wells and standard wells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-TRAP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 72 hours, cells were washed, fixed with 4% formaldehyde, permeabilized with 0.1% Triton X-100 in PBS and stained overnight at 4°C with ACE2 protein-specific antibody (Abcam Ab15348).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then incubated with anti-rabbit secondary antibody (Alexa Fluor 536 anti-rabbit, Invitrogen Life Technologies) for 1 hour at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sections were then incubated with cocktails of primary antibodies: rabbit anti-SARS-CoV-2 Spike Protein (1:100, Invitrogen, #MA5-36087) + rat anti-ERα H222 (1:100, Santa Cruz Biotechnology, #sc53492) overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 Spike Protein ( 1:100 , Invitrogen , #MA5-36087 )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sections were then incubated with the primary antibodies rat anti-ERα H222(1:100, Santa Cruz Biotechnology, #sc53492), diluted in 1% normal goat serum (NGS), 4% BSA, 0.02% saponin in PB at 4°C overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ERα H222</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sections were rinsed and incubated overnight at 4°C in the secondary antibody Nanogold-Fab’ goat anti-rat-IgG (1:100</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rat-IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">On day one, slides were blocked with a peroxidase blocker (Bio SB Catalog No. BSB 0054), washed with an immunoDNA washer buffer (Bio SB, Catalog No. BSB 0150); then, incubated with 0.2 μg/mL of anti-SARS-CoV-2 spike glycoprotein antibody (abcam, Catalog No. ab272504) for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 spike glycoprotein</div><div>suggested: (Abcam Cat# ab272504, RRID:AB_2847845)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, MCF-7 nuclear extracts (5 μg; ab14860, Abcam) were treated with either S (0.01-300 nM; Acro Biosystems)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MCF-7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proliferation assays: MCF-7 and MDA-MB-23 cells were obtained from ATCC and growth in DMEM without phenol red, supplemented with 10% fetal bovine serum (FBS), penicillin/streptomycin at 37 °C in a 5% CO2 and 95% humidified atmosphere.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDA-MB-23</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TRAP activity by ELISA assay in RAW-OCs: RAW264.7 (murine macrophages ATCC, USA) were cultured as manufacturer’s protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RAW264.7</div><div>suggested: CLS Cat# 400319/p462_RAW-2647, RRID:CVCL_0493)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2 expression in Calu-3 cells: Calu-3 cell line was obtained from ATCC and maintained in Eagle’s Minimum Essential Medium(EMEM; Lonza) supplemented with 10% fetal bovine serum (FBS), 1% L-glutamine and 1% penicillin/streptomycin solution at 37°C in a humidified atmosphere of 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The next day, cells in each well were transfected with 1.5 μl of ViaFect reagent (Promega, cat no. E498A) and 0.5 μg of empty pcDNA3.1 vector, or an expression vector for the wild-type (WT) SARS-CoV2 S with a C-terminal hemagglutinin (HA) epitope tag (pBOB-CAG-SARS-CoV2-S-HA) or the double mutant (R682S,R685S) SARS-CoV2 S with a C-terminal flag epitope tag (pCAGGS-SARS2-S-FKO).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div><div style="margin-bottom:8px"><div>pBOB-CAG-SARS-CoV2-S-HA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pBOB-CAG-SARS-CoV2-S-HA was a gift from Gerald Pao (Addgene plasmid # 141347; http://n2t.net/addgene:141347; RRID:Addgene_141347).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_141347)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pCAGGS-SARS2-S-FKO (C-flag) was a gift from Hyeryun Choe & Michael Farzan (Addgene plasmid # 159364; http://n2t.net/addgene:159364; RRID:Addgene_159364).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_159364)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were fitted using the non-linear curve fitting routines in Prism® (Graphpad Software Inc).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The digitized images were also analyzed using ProtoArray Prospector v5.2 and potential hits were identified using the software’s algorithm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ProtoArray Prospector</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein binding responses were analyzed using BiaEval software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BiaEval</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Interactome analysis: The STRING database52, that integrates all known and predicted associations between proteins, including both physical interactions as well as functional associations has been used to analyses functional associations between biomolecules.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STRING</div><div>suggested: (STRING, RRID:SCR_005223)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were prepared for presentation using ImageJ v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After three washes, the Mouse/Rabbit PolyDetector Plus link &HRP label (Bio SB, Catalog No. BSB 0270) were applied.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Mouse/Rabbit PolyDetector Plus</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>PolyDetector</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.19.22274968: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics statement: The study was conducted under a public health surveillance program that was reviewed by the UCSF Committee on Human Research and determined to be exempt and waived from IRB oversight.<br>Consent: All participants provided informed consent in their preferred language prior to survey administration and COVID-19 testing.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Our study had certain limitations. Although it was cross-sectional, our data provide an important synthesis of symptomatology within a diverse population of people seeking community testing. Second, symptoms and timing of onset were self-reported which, may introduce bias; however, symptom data were collected prior to persons knowing their COVID-19 test result and thus would not be expected to result in differential bias between those who were COVID-19 positive and negative. Additionally, we did not characterize the severity of COVID-19 symptoms across waves, and even a single very severe symptom can cause substantially greater morbidity in an individual than multiple mild symptoms. Finally, testing was undertaken with rapid antigen tests, and thus may have resulted in misclassification of individuals during the earliest phases of their illness. Nonetheless, strict quality control measures were implemented to ensure accuracy of results and the use of rapid antigen tests. In summary, the clinical presentation of symptomatic persons changed over time during several COVID surges characterized by increasing population immunity and different SARS CoV-2 variants. During Omicron, when population immunity was higher, persons with symptoms often did not see improvement after 5 days and antigen tests frequently remained positive. These findings highlight the importance of work assurances to protect workers and requirements for rapid antigen testing to shorten isolation to protect the w...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.22.22275417: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Software and reproducibility: Data management was performed using Python, with analysis carried out using Stata 16.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Strengths and weaknesses: The key strengths of this study are the scale, level of detail and completeness of the underlying primary care EHR data and the linkage to multiple COVID-19 relevant national databases within the OpenSAFELY-TPP platform. In addition, the concurrent national rollout of sotrovimab and molnupiravir under similar indications between December 16, 2021 and February 10, 2022 enables us to make direct head-to-head comparisons for their effectiveness. Several limitations of this study need to be considered. Since the Omicron BA.1 variant was the dominant variant during the treatment period (December 2021-February 2022) [13], it is likely that our results can mainly be applied to this variant [14,15]. Whether the beneficial effect of sotrovimab persists for other variant subtypes warrants further investigation [14-17]. For instance, the Omicron BA.2 sublineage was shown to exhibit marked resistance to sotrovimab in in vitro experiments [18,19], whereas an in vivo experiment found both molnupiravir and sotrovimab can restrict viral replication in the lungs of BA.2- infected hamsters [20]. In addition, the patients included in this study are assumed to be only those who met the eligibility criteria made by NHS England [3], thus limiting further generalisation of our findings to people not in a known high-risk group. The possibility of residual confounding or measurement error cannot be ruled out in this real-world observational study, in particular related to di...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.21.22275412: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">With these considerations, we set the final number of topics as 10 for both INSIGHT and OneFlorida+ cohorts as it achieved the best topic coherence and reasonable data likelihood (we do not want the data likelihood to be too perfect as that may suggests overfitting).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>OneFlorida+</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For determining the optimal number of clusters (subphenotypes), we applied NbClust R package25, which includes 21 cluster indices to evaluate the quality of clusters.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NbClust</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">On both ISNIGHT and OneFlorida cohort, we found that all confounders on all subphenotypes were balanced.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>OneFlorida</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used the python package GENSIM (https://radimrehurek.com/gensim/) to calculate the topic coherence.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Our study is not without limitations. First, our analysis is based on longitudinal observational patient data, which cannot explain the biological mechanisms behind PASC directly. Second, the PASC diagnoses we investigated were encoded as CCSR categories, which may not reflect the co-incidence patterns of fine-grained diagnosis conditions in the context of PASC. Third, we focused on new incidences of conditions in the post-acute infection period for COVID-19 patients and did not consider pre-existing conditions that are persistent or exacerbated due to the acute SARS-CoV-2 infection. Finally, our study period did not represent the recent wave dominated by the Omicron variants of SARS-CoV-2. To summarize, our study dissects the complexity and heterogeneity of newly incident conditions in 30-180 days after SARS-CoV-2 infection confirmation into four reproducible subphenotypes based on the EHR repositories from two large CRNs using machine learning. These four subphenotypes included a severe one involving problems with the blood and circulatory system and associated with high baseline comorbidity burden and disease severity in its acute phase, a milder one in younger people mainly with respiratory problems, and two pain-dominated ones (musculoskeletal/nervous system pain and abdominal pain respectively). Overall, patients in each subphenotype tend to have higher rates of related conditions in the baseline period. Our study provides the first systematic study on the co-incidence ...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.21.22275368: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.


      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Our study has limitations. Response rates varied between 11.7% and 26.5% for rounds 2–19, so the samples may not be fully representative of, or results fully generalisible to, the population. Nevertheless, our random community sampling procedure included individuals from all of the 315 lower tier local authority areas in England in each round, ensuring wide geographical coverage and socio-economic and demographic diversity. Of those who provided valid swabs and consented to linkage in rounds 1–19 of REACT-1 (2,191,597 people in total), approximately 3% (65,915 people) participated in more than one round. On this basis, a correction factor of 1.015 could therefore be applied to the standard error estimates. We are not able to definitively identify instances of participation in more than one round among those who did not consent to linkage. However, because the consent-based estimate of the correction factor is so close to one, we feel confident reporting uncorrected SEs and confidence intervals. The symptoms surveyed were not exhaustive but, while not specific to COVID-19, were all shown to be predictive of SARS-CoV-2 swab positivity. Our analysis covers a period of 22 months, during which time background levels of natural and vaccine-acquired immunity varied substantially, making it difficult to differentiate the effect of viral mutations from the impact of vaccines and prior infection.18 As REACT-1 data collection was non-continuous, we may have captured different stages of ...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.21.22275420: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The use of the INSIGHT data was approved by the Institutional Review Board (IRB) of Weill Cornell Medicine following NIH protocol 21-10-95-380 with protocol title: Adult PCORnet-PASC Response to the Proposed Revised Milestones for the PASC EHR/ORWD Teams (RECOVER).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">The collected baseline covariates included age (categorized into 20-39 years, 40-54 years, 55-4 years, 65-74 years, 75-84 years, 85 years and older), gender (female, male, other/missing), race (Asian, Black or African American, White, other, missing), ethnicity (Hispanic, not Hispanic, other/missing).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      There are also several limitations. First, our study was based on observational data analysis, assignment to a particular exposure group was not randomized. However, we balanced high-dimensional hypothetical confounders and got consistent results from several negative outcome control analyses across two datasets, suggesting little confounding. Second, our study included the patient population from the NYC and Florida areas, which may not be representative of other geographical regions of the US or other countries. Third, the PASC is currently defined in the RECOVER protocols as “ongoing, relapsing, or new symptoms, or other health effects occurring after the acute phase of SARS-CoV-2 infection”. 27 Our study only studied incident events, and the worsening and relapsing conditions were left for future investigations. Fourth, the way these CCSR categories were defined may not reflect the actual co-occurring risk of the individual conditions contained in each in the context of PASC. In addition, our study period was from March 2020 to November 2021, which did not include patients infected during the phase dominated by the Omicron variants of SARS-CoV-2. Lastly, our analyses did not include information on vaccination status. In conclusion, this study demonstrated that adult patients surviving beyond 30 days of their SARS-CoV-2 infection exhibited high incident risks and burdens across a broad range of conditions and signs. Our findings verified that PASC is a complex condition in...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.23.492800: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the other three donors (Leu163, Leu158. Leu184), naive and effector/memory CD8+ T cells were isolated by Fluorescence-activated Cell Sorting (FACS) upon staining with anti-CD8 antibody (344710 BioLegend), anti-CCR7 antibody (353227 BioLegend) and anti-CD45RA antibody (304108 BioLegend) for 30 min at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Leu184</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD8</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CCR7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD45RA</div><div>suggested: (BioLegend Cat# 304108, RRID:AB_314412)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) fluorophore-conjugated anti-human antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human antibodies.</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For TCR transfection, 1×106 Jurkat cells were co-electroporated with 3 μg of each TCR chain using a Neon Transfection System 100μl kit (Thermo Fisher Scientific) with the following parameters: 1325V, 10ms, 3 pulses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Jurkat</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.20.22275409: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. C- Programmable text interfaces are the future C- Programmable text interfaces are the future Authored By:: [[P- Rob Haisfield]] Programmable text interfaces are the future, not GUIs People who don’t code are accustomed to interacting with apps with Graphical User Interfaces (GUI) . In order to give instructions to a GUI app, users need... 5/24/2022 .

      yes, but if you get that right "programming" will be hidden in primitives and what people will need to do is learn about, extend if need be existing capabilities and simply compose them to suit their needs" very much like the idea progamming in the large"" which ceases to be programming*

    1. Forinstance, source code is not as homogeneous as NL: it is com-posed of both the code in a function body, which is written inprogramming language (PL), as well as optional commentswritten in NL

      代码的异质性

    1. SciScore for 10.1101/2022.05.19.22275214: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">ALSPAC is a prospective population-based cohort of pregnant women with expected delivery dates between April 1991 and December 1992 who lived in Bristol, UK and the nearby surrounding area; with follow-up of these women and their partners (collectively known as Generation 0, G0), and their children (Generation 1, G1), ever since [34,35].</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In addition to the above criteria, for analysis of variables associated with post-vaccination infection within TwinsUK, individuals must have participated in Q2 antibody testing followed by either Q4 antibody testing and/or concurrent COVID-19 questionnaire.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Q4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Questionnaires administered during the COVID-19 pandemic: TwinsUK COVID-19 questionnaires were administered in April-May 2020 [51], July-August 2020, October-December 2020, April-July 2021 (approximating first round of antibody testing, Q2), and November 2021-February 2022 (approximating second round of antibody testing, Q4).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Q2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantitative IgG anti-Spike SARS-CoV-2 antibody levels and qualitative IgG anti-Nucleocapsid antibody status were assayed using CE-marked capillary blood Roche Elecsys Anti-SARS-CoV-2 immunoassays [59].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Spike SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantitative enzyme-linked immunosorbent (ELISA) assays testing anti-Nucleocapsid and anti-Spike antibody levels were performed using previously published methods [4].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Nucleocapsid</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Multivariable models testing associations with low anti-Spike antibody levels used the following set of adjustment variables: age, sex, most recent vaccine received and number of weeks since most recent vaccination.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Spike</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ALSPAC analyses were performed using python v3.9.7 and packages: numpy v1.20.3, pandas v1.3.4, matplotlib v3.4.3, and seaborn v0.11.2, and R v4.1.2 [81] and packages: plyr v1.8.6, dplyr v1.0.7 and broom v0.7.11.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div><div style="margin-bottom:8px"><div>matplotlib</div><div>suggested: (MatPlotLib, RRID:SCR_008624)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      This exposes a limitation to our analytical approach, as we have limited scale and power to examine the intersection of likely risk factors in combination. Further, of the several variables associated with antibody levels, only serology-based evidence of prior SARS-CoV-2 infection was directly associated (here, negatively associated) with subsequent post-vaccination infection between April-May 2021 and November 2021-January 2022 (with the majority sampled before the peak of the current Omicron wave). We found no consistent associations of lower antibody levels with age or employment status, but a very strong age gradient (lower incidence with older age) and lower likelihood among retired (vs. employed) individuals of post-vaccination infection. These results again are consistent with risk of infection being a complex combination of SARS-CoV-2 case prevalence, individual immune response to vaccination, and individual level of exposure (i.e., behaviour). Such aspects often oppose each other by design (for example, higher shielding behaviours by more elderly individuals). Nevertheless, given the ongoing relaxation of measures across many countries, groups previously less exposed may become more at risk. Consequently, our findings regarding factors associated with post-vaccination infection may change over time, to align more closely with variables identified as associated with lower antibody levels. Longitudinal antibody testing within TwinsUK at Q4 highlighted the effectiveness...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.21.22275413: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      We also acknowledge several limitations of our study. First, the GWAS data for COVID-19 and VTE used in this study were derived from the European population, so the associations may not be applicable to other ancestries. Second, although GWAS summary statistics conducted study-specific quality control, misclassification of COVID-19 might exist. Third, the summary statistics limit us to assess sex and age-specific genetic effects. Fourth, the GWAS of COVID-19 related traits might be conducted at different time periods, so there might be differences in the SARS-COV-2 infection strain. However, our study does not aim to assess the association with specific strain of SARS-COV-2 infection. Finally, although our study provides evidence of genetic correlation and genetic overlap between COVID-19 and VTE, the underlying biological mechanisms are still unclear, and further studies are still needed for validation. In conclusion, our findings provided novel evidence of genetic correlations between severe COVID-19, COVID-19 hospitalization, SARS-CoV-2 infection and VTE, and highlighted their common genetic architecture, with shared genes closely related to coagulation and immunity. Our works contribute to the understanding of COVID-19 and VTE etiology, and open up new insights into the prevention and comorbidity management of COVID-19.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.18.22275240: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Participants were eligible if they were living in the UK, identified with one or more of the target groups, had good understanding of English and were willing and able to provide informed consent (or parental consent was given for adolescents).<br>IRB: Ethical approval was provided by the University College London (UCL) research ethics committee ((project identifier 14895/005), and all participants provided informed written consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Interviewers were male and female postgraduate researchers who had prior experience of conducting qualitative interviews with people experiencing physical and mental health difficulties, and vulnerable groups.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Then, initial codes were generated inductively from a randomly selected sub-set of six transcripts, second coded by AB and AF.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Therefore, coding and the subsequent processes of thematic analysis; generation, reviewing and grouping of themes (Braun & Clarke, 2006; Braun & Clarke, 2021) were conducted for the remaining interviews by CR using Microsoft Excel and NVIVO12.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Finally, it is important to consider the merits and limitations of this study. Particularly, this study had a large sample size of 116 semi-structured interviews, which enabled inclusion of a broad range of views and experiences. Furthermore, three researchers met regularly throughout data analysis to discuss themes and to ensure that thematic analysis was applied appropriately. Thirdly, this study gives context to the quantitative findings relating to PA during the COVID-19 pandemic. Fourthly, in conjunction with the COM-B model (Michie et al., 2011), this study can be used to consider intervention components for increasing PA in future lockdowns and pandemics. However, this study also has several limitations. Firstly, the interviews were with individuals who were predominantly female, white British and educated to degree level, which limits the range of perspectives represented. The use of online and telephone interviews may also have excluded those who did not have online access. Additionally, as the CSS focused on broader mental health effects of the pandemic on several aspects of life, the depth of reflections relating to PA may be limited, however all participants were explicitly asked to reflect on their PA both before and during the pandemic. In conclusion, this study is the first to explore barriers and facilitators to PA for different demographic groups during the COVID-19 pandemic, and to map these onto a theoretical framework to aid understanding of PA behaviours ...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.18.22275283: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All individuals or their legal guardian gave informed consent prior to enrollment.<br>IRB: This study was overseen and approved by the MassGeneralBrigham Institutional Review Board (</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary natural killer cells for the antibody-dependent natural killer activation (ADNKA) assays were isolated from buffy coats from health donors using the RosetteSep NK cell enrichment kit (STEMCELL Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-dependent natural killer activation ( ADNKA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody Isotype and Fc Receptor Binding: Antigen-specific antibody isotype, subclass, and Fc receptor binding profiles were analyzed using a custom multiplex Luminex assay as previously described 35.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antigen-specific antibody isotype , subclass ,</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following overnight incubation, non-specific antibodies were washed off and the immune complexes were incubated with Ig isotypes or subclasses with a 1:100 diluted PE-conjugated secondary antibody for IgG1 (clone: HP6001), IgG2 (clone: 31-7-4), IgG3 (clone: HP6050), IgG4 (clone: HP6025), IgM (clone: SA-DA4), IgA1 (clone: B3506B4), or IgA2 (clone: A9604D2) (all Southern Biotech).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following incubation, excessive antibodies were washed off and relative antigen-specific antibody levels were determined on an iQue analyzer (Intellicyt)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">C3 deposited on beads were stained with anti-guinea pig C3-FITC antibody (MP Biomedicals, 1:100</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-guinea pig C3-FITC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody-Dependent Neutrophil Phagocytosis (ADNP) Assays: ADNP assays were performed as previously described 37.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antibody-Dependent Neutrophil Phagocytosis ( ADNP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell Lines and Primary Cells: THP-1 cells, a human leukemia monocyte cell line, were maintained in RPMI-1640 Medium (Sigma-Aldrich) with 10% fetal bovine serum (FBS, Sigma-Aldrich), 1% L-glutamine (Corning), 2% of 5000 IU/mL of Penicillin and 5,000 ug/ml of Streptomycin Solution (Pen-Strep, Corning), 1% of 1M HEPES (Corning), and 5mM 2-Mercaptoethanol (Gibco).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>THP-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human embryonic kidney (HEK) 293T cells expressing ACE2 for neutralization assays were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM, Corning) with 10% FBS (VWR) and 1% Pen-Strep (Corning) and incubated in 37°C with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Three-fold serial dilutions of plasma samples starting at 1:12 or 1:30 were performed before adding pseudovirus expressing either SARS-CoV-2 wild-type spike or omicron variant spike to HEK293T expressing ACE-2 cells for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: RRID:CVCL_HA71)</div></div><div style="margin-bottom:8px"><div>ACE-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary neutrophils for antibody-dependent neutrophil phagocytosis (ADNP) assays were isolated from whole blood from healthy donors using Ammonium-Chloride-Potassium (ACK) Lysing Buffer (Quality Biological) followed by centrifugation and multiple wash steps prior to assay usage.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Quality Biological</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data Analysis and Statistics: Data analysis was performed on GraphPad Prism (v.9.3) and RStudio (v.1.3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.18.22275217: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The first-stage logistic regression modeled the probability of parental hesitancy as a function of fixed effects for documented gender (male, female), age group (18-24, 25-34, 35-44, 45-54, 55-64, 65+), education (high school or fewer years of education, some college or a two-year degree, four-year degree, graduate degree), and race/ethnicity (Hispanic, non-Hispanic American Indian or Alaska Native, non-Hispanic Asian, non-Hispanic Black, non-Hispanic Native Hawaiian or Other Pacific Islander, non-Hispanic White, non-Hispanic multiracial or other race), and age group of child (unknown, 12 to 17, and 5 to 11), and nested random intercepts on state and county: We did not perform a weighted regression to include the CTIS survey weights, instead adjusting for the probability of inclusion and non-response through post-stratification.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>non-Hispanic White</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      The results of our study should be interpreted in the context of several limitations. First, to predict plateau coverage for children ages 5 to 11 years we assumed that the relationship between hesitancy and coverage observed for children ages 12 to 17 applies to this younger age group. Our three-month validation supports this assumption, which is necessary for prospective estimation. Second, estimates of hesitancy for children of different age groups only became available in Wave 12 of the CTIS survey, and respondents are only asked about intentions to vaccinate their oldest child. Third, we rely on historical relationships between hesitancy and observed coverage, which will not capture the evolving COVID-19 policy and epidemiologic landscape. Fourth, our analytic framework is designed to capture geographic variation in coverage but not variation by other important population characteristics such as race/ethnicity within small geographic areas. Despite these limitations, our estimates reflect a principled approach to generating bias-adjusted estimates of vaccination coverage that can be used to inform decisions and evaluate actual progress against a reference scenario.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.18.22275234: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Procedures: Until April 11, 2022, eligibility for outpatient COVID therapy required adjudication and approval by an institutional committee which included an infectious diseases physician (MM).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      This study does have limitations. Most importantly, this is not a randomized controlled trial, and we do not have controls for comparison. Comparing these data with historical controls would be biased, given changing vaccination status, variants, and therapeutic options over time. A comparison with patients who did not receive nirmatrelvir/ritonavir also would be biased, as these patients would be importantly different from the treated group.. Lastly, the purpose of this case series is not to demonstrate the efficacy of nirmatrelvir/ritonavir, rather to report that a modified dose is well tolerated in this population. The importance of our experience is to allow faster implementation of modified dose protocol of nirmatrelvir/ritonavir for dialysis patients and shorten the period of therapeutic nihilism. Though monoclonal antibodies are easier and considered safer to use in the dialysis population, since there is no need for dose adjustment, their efficacy also changes as newer and resistant variants arise with mutations in the receptor binding domain (RBD) of the spike protein. This is less likely to happen with antiviral drugs, and the experience we describe will be useful for management of dialysis patients in the next few waves. We do not have robust evidence in the form of a randomized controlled trial. It should be noted that the phase 3 trial which led to the drug approval included 2246 patients, and to do such a large trial specifically in dialysis patients may not be ...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.19.22275316: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The University of Alberta Research Ethics board approved this study (Pro00111835).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Our study had several limitations. Due to the heterogeneity of our populations tested, it is difficult to exclude confounders that may have contributed to ID NOW performance. However, we previously observed no differences in sensitivity based on common patient, collecting and testing characteristics, including age, gender, and swab type.2 Our current study also did not demonstrate any difference in performance with these characteristics, though the sample size was not large enough to make any concrete conclusions. Another limitation is the inability to exclusively study Omicron by itself. While the Delta variant only represented 0.7% of variants detected from the assessment centres during our study period, there was still a moderately high proportion (14.5%) of delta variant still circulating within our hospitals. This study did not assess the Omicron BA.2 sublineage, as it was not circulating in our population during the study period. Other limitations include missing parallel RT-PCR results that could affect the sensitivity observed in our study. As previously mentioned, many (45.5%) ID NOW positive samples did not undergo variant testing which would affect our calculated specificity. ID NOW sensitivity may be slightly lower than we calculated due to the exclusion of 398 ID NOW negative samples that subsequently did not have a second sample tested with RT-PCR. Reasons behind missing parallel RT-PCR are multifactorial and include sample lost or discarded prior to testing, te...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.18.22275242: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the Ethics Committee of Hyogo Medical College (registration number 3866) and was described in line with the SQIURE (Quality Improvement Reporting Excellence) 2.0 checklist[15].</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      There are some limitations to this study. The setting and description of each “Function” has a high degree of freedom, and the reproducibility and universality of the model may be poor. In addition, since the scope of each function acting on the entire system is infinitely broad and can be infinitely subdivided, it is essential to examine the validity of the breadth and fineness of the descriptions in this report. Although we have attempted to formulate some prospective functions, the analysis of disturbances that occur suddenly and without warning must be performed retrospectively. The usefulness of FRAM from a predictive perspective is an important issue for the future. In this study, we conducted FRAM system analysis of the process of establishing a safe and uninterrupted system to provide rehabilitation for COVID-19 patients and attempted to develop a strategy to deal with foreseeable problems. The presentation of “Functions” and the analysis of the elements of each “Function” are useful for constructing a system can be modified from time to time, and may be applied to the operation of different systems in different situations. From our results, we conclude that the analysis of our medical rehabilitation provision system by FRAM allows the prediction of necessary measures in the future and contributes to the establishment of a safe and uninterrupted system for providing rehabilitation.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.19.22275026: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Ethics approval: All participants provided written informed consent.<br>IRB: This study was approved by the University of British Columbia/Providence Health Care and Simon Fraser University Research Ethics Boards (protocol H20-03906).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">At each visit, serum was tested for the presence of SARS-CoV-2 anti-nucleocapsid (N) antibodies, which indicate seroconversion following infection, using the Elecsys Anti-SARS-CoV-2 assay on a Cobas e601 module analyzer (Roche Diagnostics).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nucleocapsid (N)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding antibody assays: We quantified anti-Spike Receptor Binding Domain (RBD) binding IgG concentrations in serum using the V-plex SARS-CoV-2 (IgG) Panel 22 ELISA kit (Meso Scale Diagnostics), which features wild-type and Omicron BA.1 RBD antigens.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Spike Receptor Binding Domain (RBD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2 (IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Data visualization and statistical analysis was conducted in Prism v9.2.0 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      A limitation of our study is that it did not assess T cell responses, which can reduce disease severity but may have less impact on virus transmission (53, 54), and thus we may be underestimating the protection that results from infection and reinfection in this case. Indeed, the participant’s symptoms following both infections were not severe enough to require hospitalization, demonstrating that vaccination was effective in its primary goal of preventing disease. Our results nevertheless illustrate the potentially limited ability of current vaccines to prevent recurrent infections and symptomatic disease caused by Omicron variants.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.18.22275293: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Oracle Crystal Ball (Version 11.1.2.4.900) and IBM SPSS Statistics (Version 28) were used for the analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      This study has some limitations. First, the target population was employees of companies and their dependent family members. The findings of this study cannot be generalized to the entire population and other countries. Furthermore, only the population aged 74 years and below were included in this study. Although COVID-19 isolation measures are known to worsen cognitive and mental health among people with dementia [36], this study was unable to assess the secondary health effects among the population aged 75 years and older. Second, we could not fully examine the possibility of changes in accessibility to healthcare facilities after the Fukushima disaster or the COVID-19 outbreak compared to accessibility to health care before the disaster and outbreak. However, it is unlikely that NCDs were overlooked before the disaster or outbreak, since employees of companies, the target population of this study, generally receive regular health checkups. Third, this study was based on an ecological study design and did not identify the causes of changes in the prevalence of various diseases. Long-term cohort studies based on individuals exposed to disasters and pandemics are expected to assess the impact of disasters and pandemics on secondary health and identify the factors that influence this impact. Despite these limitations, this study provided unique insights into the secondary health effects of the Fukushima disaster and COVID-19 outbreak and identified age and sex groups that were...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.18.22275203: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants provided informed consent after the purpose and objectives of the study were thoroughly explained to them.<br>IRB: 2.7 Ethics: The present study was carried out in accordance with Institutional Research Ethics and the Helsinki Declaration.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">In the present study, the WEMWBS showed content reliability (Cronbach’s alpha =0.89) 2.5 Sampling procedure: The sample size was calculated using the following equation: The calculated sampling size was 384.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Limitations: There are several limitations to the study that should be considered. The main limitation of this study is that participation in the study required access to a smartphone/computer, implying that respondents from the lower socioeconomic subgroup could not be included. Second, because this study relied on self-reported data, it was not completely free of recall or reporting bias. Third, because the study was conducted online using a convenience sampling technique, the possibility of selection bias should be considered. Finally, the study’s cross-sectional design includes method bias because a causal relationship cannot be accurately elucidated in this design. Future qualitative and longitudinal studies will be required to determine the true scenario in the context of the COVID-19 pandemic.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.19.22275325: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Due to the time-sensitive nature of this research topic, a rapid review was conducted in accordance with the interim guidance from the Cochrane Rapid Reviews Group.(17) Compared to a traditional systematic review, abbreviated steps in a rapid review include searching fewer databases, double screening 20% of titles and abstracts, single screening of full texts, and synthesising evidence narratively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cochrane Rapid Reviews Group.</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data extraction form was piloted with members of the screening team (LG, MF, FM), data extraction then carried out using Microsoft Excel.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Strengths and Limitations: Due to the emerging nature of the review topic, a rapid review was carried out which, according to the Cochrane Rapid Reviews Methods Group, ‘accelerates the process of conducting a traditional systematic review through streamlining or omitting specific methods to produce evidence for stakeholders in a resource-efficient manner’.(17) A strength of this review was the timely provision of high-quality evidence. This rapid review followed guidance from the Cochrane Rapid Reviews Methods Group and included a search strategy developed with input from a wide group of experts, including a librarian and a systematic reviews expert. Although study selection, data abstraction and risk of bias assessment performed were not performed in duplicate, each step was verified by a second reviewer. However, as with any review, there were also some limitations. Results were limited to English language studies published since the year 2000, and the search was limited to two online databases. The majority of the included studies were conducted in the US, which could limit the generalisability of the review findings. Finally, Ireland has implemented a system for the electronic transfer of prescriptions, as opposed to a comprehensive e-prescribing system, therefore the findings of this study may not accurately reflect the issues currently encountered in the Irish healthcare system. Further Research: This review has highlighted a number of important areas for further resear...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.19.22275317: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics and data collection: The study was reviewed and approved by the Ethical Review Boards ATS Sardegna - Prot. N° 2492/CE.<br>Consent: The patients/participants provided their written informed consent to participate in this study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantification of SARS-CoV-2 antibodies direct against the proteins Spike (S) or Nucleocapsid (N) in human serum was performed using the electrochemiluminescence immunoassays Elecsys® Anti-SARS-CoV-S and Elecsys® Anti-SARS-CoV-N (Roche).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-SARS-CoV-N</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differences between patient groups - stratified according to therapy and selected for Anti-N antibody negativity - were assessed with a negative binomial generalized linear mixed-effects model, which takes into account the nature of the outcome variable (anti-S, non-negative count data); in addition to therapy, the models also consider the contribution of other variables such as age, smoke, sex, Expanded Disability Status Scale (EDSS), disease duration, and clinical sampling center.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-N</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.18.22275292: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study participants: This study was approved by the SingHealth Centralized Institutional Review Board (CIRB/F 2021/2014).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      There are limitations in this study; in addition to the small sample size, phenotypic analysis of the nasal T cells and analysis of their SARS-CoV-2 specificity was limited to few markers of tissue residency (CD69 and CD103) and memory (CD45RA and CCR7) and to selected SARS-CoV-2 proteins (NP, membrane, Spike and NSP-12). The limited number of T cells collected impose these limitations. To better define the breath of the nasal resident T cell response against SARS-CoV-2 it will be necessary to analyze their ability to recognize epitopes derived from others structural, non-structural proteins or out-of-frame Open Reading Frames that have been shown to induce robust CD8 T cell response in circulation(Weingarten-Gabbay et al., 2021). The potential distinct functionality of Nasal SARS-CoV-2 T cells will need also to be analyzed by analysis of their transcriptomic profile, in addition their ability to produce IFN-γ and degranulate. Finally, as already mentioned, study of the durability of the nasal resident SARS-CoV-2 T cells over 3 months are warranted to understand the long-term impact of nasal resident T cells in SARS-CoV-2 protection.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.20.492779: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Animal research was carried out under a United Kingdom Home Office License, P48DAD9B4.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Stably transduced ACE2-expressing 293T cells were produced as previously described (32), and maintained with the addition of 1 μg/ml puromycin to growth medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: KCB Cat# KCB 200744YJ, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All viral stocks used in this study were grown in the VeroE6-ACE2-TMPRSS2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-ACE2-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral particles were produced in a 10 cm dish seeded the day prior with 5×106 HEK293T/17 cells in 10 ml of complete Dulbecco’s Modified Eagle’s Medium (DMEM-C, 10% FBS and 1% Pen/Strep) containing 10% (vol/vol)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T/17</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, Hela cells stably expressing the ACE2 receptor were added (10,000 cells/25μL per well) and the plates were left for 72 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Hela</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analysis was performed using Graphpad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.20.492834: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics statement: This study was approved by the Virginia Polytechnic Institute & State University Institutional Animal Care and Use Committee (Protocol # 20-228, approved 02/01/2021).<br>Field Sample Permit: Tissue types collected, methods of collection, and downstream assays were the same as described for the mice.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mouse infections: Eight to ten-week-old male and female B6.Cg-Tg(K18-ACE2)2Prlmn/J mice (Stock # 034860; Jackson Laboratory; n=12, 2 groups of 6 mice), and their wild-type C57BL/6J counterparts (n=12, 2 groups of 6 mice) were inoculated intranasally with SARS-CoV-2 isolate USA-WA1/2020 (Extended Data Fig 1a).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animals were randomly assigned to either inoculum group or control group ensuring the groups were age-matched.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 N protein was visualized using an Alexa Fluor® 488 conjugated rabbit monoclonal anti-SARS-CoV-2 nucleocapsid antibody at a 1:1000 concentration (NBP2-90988AF488; Novus Biologicals).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">hACE2 was visualized using an Alexa Fluor® 594 conjugated mouse monoclonal anti-ACE2 antibody at a 1:1000 concentration (sc-390851 AF594; Santa Cruz Biotechnology).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-7385 AF594, RRID:AB_2847914)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">NeuN was visualized using an Alexa Fluor® 647 conjugated rabbit monoclonal anti-NeuN antibody at a 1:1000 concentration (ab190565; Abcam).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-NeuN</div><div>suggested: (Abcam Cat# ab190565, RRID:AB_2732785)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tyrosine hydroxylase was visualized using an Alexa Fluor® 594 conjugated mouse monoclonal anti-TH antibody at a 1:500 concentration (818004; Biolegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-TH</div><div>suggested: (LSBio (LifeSpan Cat# LS-C40052-500, RRID:AB_972074)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Glutamine synthetase was visualized using a mouse monoclonal anti-GS antibody at a 1:100 concentration (MA5-27750; Invitrogen) followed by an Alexa Fluor® 594 conjugated goat anti-mouse monoclonal antibody at a 1:1000 concentration (A11005; Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-GS</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Molecular Probes Cat# A-11005, RRID:AB_141372)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neuropilin-1 was visualized using a goat polyclonal anti-NRP1 antibody at a 15 μg/mL concentration (AF566; R&D Systems) followed by an Alexa Fluor® 647 conjugated donkey anti-goat monoclonal antibody at a 1:1000 concentration (ab150135; Abcam).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-NRP1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-goat</div><div>suggested: (Abcam Cat# ab150135, RRID:AB_2687955)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The undiluted tissue homogenate as well as a ten-fold dilution of homogenate was inoculated in duplicate onto confluent monolayers of Vero E6 cells in 24-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neurons were pretreated with 100 μM of the NRP-1 antagonist EG00229 (6986; Tocris) dissolved in DMSO prior to infection as described for Caco-2 cells24.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse infections: Eight to ten-week-old male and female B6.Cg-Tg(K18-ACE2)2Prlmn/J mice (Stock # 034860; Jackson Laboratory; n=12, 2 groups of 6 mice), and their wild-type C57BL/6J counterparts (n=12, 2 groups of 6 mice) were inoculated intranasally with SARS-CoV-2 isolate USA-WA1/2020 (Extended Data Fig 1a).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6.Cg-Tg(K18-ACE2)2Prlmn/J</div><div>suggested: RRID:IMSR_JAX:034860)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Uninfected K18-hACE2 control mice (n=2) and C57BL/6J wild-type control mice (n=2) were housed in a separate on campus ABSL-1 facility.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: RRID:IMSR_JAX:000664)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were imported into ImageJ and contrast and brightness was adjusted identically across all images within tissue types.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were performed in JMP Pro 16 (SAS Institute) and confirmed in GraphPad Prism version 8 during figure creation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.16.491922: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: All of the data was generated from public available database and did not required ethics committee approval.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.19.22275149: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: This study received approval from the Ethical Review Committee, The Aga Khan University (<br>Field Sample Permit: The first 10 positive specimens were identified and collected through consecutive convenience sampling.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.19.22275126: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics: The EDSAB-HOME study was approved by NHS Research Ethics Committee (Health Research Authority, IRAS 284980) on 02/06/2020 and PHE Research Ethics and Governance Group (REGG, NR0198) on 21/05/2020.<br>Consent: All participants gave written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Study participants: The study population consisted of key workers recruited to the Evaluating Detection of SARS-CoV-2 AntiBodies at HOME (EDSAB-HOME) prospective cohort study (ISRCTN56609224) (27).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ISRCTN56609224</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The AbC-19, OrientGene, and SureScreen devices detect anti-Spike protein antibodies while the Biomerica device detects anti-Nucleoprotein antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Spike protein</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Nucleoprotein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The OrientGene, SureScreen, Biomerica devices contain separate bands to detect IgG and IgM antibodies, while AbC-19 detects IgG antibodies only.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For each antibody test, we describe the number of participants who tested positive for SARS-CoV-2, and observed rate per 100 person years, in each of these three periods, stratified by baseline test result.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Kaplan-Meier survival curves were also produced, to describe the development of SARS-CoV-2 positivity over time in those who were antibody-positive or antibody-negative according to each test.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-negative</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      While this study shows a strong association between lateral flow device results and subsequent SARS-CoV-2 infection, it has several limitations. Firstly, it applies to a historical cohort of unvaccinated individuals. Secondly, lateral flow devices were applied and read using stored plasma, obtained by venesection, in a laboratory setting by trained professionals, rather than relying on measurement in the field by the public using finger-prick technology. This arrangement had the advantage that the subjects did not know their lateral flow device results, minimising potential bias, but leaves open the possibility that performance on finger prick samples might differ from that in the laboratory setting we used. This concern has been addressed for the SureScreen device,, for which data has now been published showing very similar accuracy of the SureScreen device on finger-prick samples taken from individuals and serum samples analysed in a laboratory (24). Finally, some healthcare workers in the cohort received a single vaccine dose in late December 2020 and early January 2021 in the UK, in the final weeks of our follow-up period; it is possible that some individuals acquired protection through vaccination in the last weeks of follow-up, so the true protection associated with LFIA positive tests may be higher than we observed. Lateral flow devices have very different reported accuracy. This is likely to be explicable in part by device design, and in part by selection of samples u...


      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">ISRCTN5660922</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">ISRCTN56609224</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.19.22275029: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the Northwestern University Institutional Review Board (IRB).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">a, GA) for 1 hr at room temperature and then exposed to a 1:2,000 concentration of polyclonal anti-ExoU antibodies overnight at 4°C on a slow rocker (29).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ExoU</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The membrane was washed three times with 1x TBS-T at room temperature and then exposed to a goat anti-rabbit secondary antibody (LI-COR Biosciences, Lincoln, NE) at a 1:5,000 concentration in 20 mL of 5% milk buffer in 1x TBS-T for 1 hr at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For certain experiments, P. aeruginosa strains PA14, PA14exoU, and PAO1 were used as controls.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>P. aeruginosa</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequences were trimmed using Trimmomatic v0.32 (17) and then de novo assembly was performed with SPAdes 3.9.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Trimmomatic</div><div>suggested: (Trimmomatic, RRID:SCR_011848)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Illumina reads were aligned to the assembly using BWA v0.7.17 (21), and assembly errors were corrected using Pilon v1.23 (22) with a minimum depth setting of 0.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA</div><div>suggested: (BWA, RRID:SCR_010910)</div></div><div style="margin-bottom:8px"><div>Pilon</div><div>suggested: (Pilon , RRID:SCR_014731)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single nucleotide variants relative to the reference were identified using bcftools v1.9 skipping bases with base quality lower than 25, alignment quality less than 30, and using a haploid model.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>bcftools</div><div>suggested: (SAMtools/BCFtools, RRID:SCR_005227)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.20.22275380: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Local ethical approval was given by the Hull York Medical School Ethics Committee (Reference 20 62).<br>Consent: Only participants who gave their active digital informed consent were allowed to complete the survey and memory quiz.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">First, we assessed the contributions of COVID status (x2 groups: non-COVID, COVID), symptoms (2 groups: symptoms, no symptoms), ongoing symptoms (2 groups: ongoing symptoms, no ongoing symptoms), age (8 groups: 18-24, 25-34, 35-44, 45-54, 55-64, 65-74, 75-84 and 85+) and gender (2 groups: female, male).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">’ The animal category was presented first to encourage participants to engage with the memory task, followed by either the number or fruit categories (randomised).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All images were edited using Adobe Photoshop CC 2015 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Adobe Photoshop</div><div>suggested: (Adobe Photoshop, RRID:SCR_014199)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis: Statistical analysis was performed using SPSS (Version 27.0, IBM Corporation, Armonk, N.Y., USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      One limitation with our survey and memory quiz was that it was not conducted under controlled laboratory conditions. For instance, the presence of a researcher may encourage a participant to take the survey more seriously and answer the questions accurately. However, requiring the presence of a researcher would make the study more practically challenging and would limit the number of participants that could be recruited. Furthermore, the presence of a researcher does not necessarily ensure that participants will complete all aspects of the survey and memory quiz accurately. It is also possible that participants may have been distracted during our memory quiz thereby affecting the scores. We attempted to mitigate against this possibility by instructing participants to complete the quiz in a quiet place without distractions. Nevertheless, the large number of participants in both the COVID and non-COVID groups was able to provide sufficient power to reveal a highly significant difference. In our study, 31.4% of participants reported having had COVID-19 between January 2020 and July 2021. These included those who self-reported, tested positive and were hospitalised with COVID-19. Since COVID-19 tests were not commonly available in the earlier stages of the pandemic, we allowed participants to self-report whether they thought they may have had COVID-19. We cannot be certain whether these participants in fact had COVID-19. However, we found no significant difference in memory score...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.20.22275313: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">We included studies of the babies of pregnant women with a diagnosis of SARS-CoV-2 during pregnancy.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were extracted into Microsoft Excel (Version 2201) by SS or SA using a proforma with the outcomes described above, study type and dates, location, participant definition and numbers, and method of SARS-CoV-2 diagnosis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was completed using Microsoft Excel, SPSS (IBM SPSS Statistics for Macintosh, Version 25, 2017[16]) and R (R Studio Version 2021.09.01[</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Our study has several limitations. Although we identified many studies reporting perinatal outcomes, there was little information reporting neonatal morbidity in depth. Granular detail describing the indirect neonatal consequences of maternal SARS-CoV-2 infection during pregnancy remain unclear. This limitation is particularly pronounced for neurodevelopmental outcomes. With the SARS-CoV-2 declared pandemic two years ago, we hope that more information regarding these crucial outcomes will emerge soon; one trial is currently recruiting (the ASPIRE trial) which will follow up infant outcomes for 1.5 years[40], and another (the SINEPOST study) will examine development from 18 months onwards[41]. Furthermore, we found that studies varied widely on their reporting of severity of maternal disease and maternal symptoms; therefore, we were unable to study the effect of maternal symptomology on neonatal outcomes. Finally, we found limited evidence from middle-, and particularly, low-income countries, and little data regarding infections in early pregnancy. These are key research priorities to allow clinicians to adequately inform expectant families.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.18.22275245: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Informed consent with participation in this study was signed by the participants’ legal guardians in accordance with the Declaration of Helsinki and the study was approved by the Ethical Committee of the University Hospital in Motol, reference no. EK-1376/21.<br>IRB: Informed consent with participation in this study was signed by the participants’ legal guardians in accordance with the Declaration of Helsinki and the study was approved by the Ethical Committee of the University Hospital in Motol, reference no. EK-1376/21.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">In total, 50 MIS-C patients were recruited during the inclusion period between October 2020 and April 2021, 24 female, age 11 months to 18 years (7.8 ± 4.35 years, mean ± SD).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry measurement was performed on BD FACSLyrics (BD Immunocytometry Systems, San Jose, CA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Immunocytometry Systems</div><div>suggested: (South Florida University College of Medicine Fred Wright Jr Flow Cytometry Core Facility, RRID:SCR_017901)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FlowJo software was used for data analysis (TreeStar, Ashland, OR).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: Statistical analysis was performed using using Brown-Forsythe and Welch one-way analysis of variance (ANOVA) and unpaired t-tests with Welch’s correction in GraphPad Prism 8.0 (San Diego, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.20.492832: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All the cell lines were cultured at 37°C under a 5% CO2 atmosphere, and were routinely screened for mycoplasma.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The membrane was blocked with 5% dried milk in PBS Tween 0.1 %, before incubation with three primary antibodies (S1, S2, and p24 Gag or actin) for 1h at room temperature (RT), followed by 3 washes in PBS Tween 0.1 %, and incubation with secondary antibodies for 30 min at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Gag or actin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies consisted in two anti-spike antibodies (rabbit anti-S1 Genetex #GTX135356, 1:1000 and mouse anti-S2 Genetex #GTX632604, 1:1000), and one normalization antibody: mouse anti-p24 Gag (R&D Systems # MAB7360; 1:1000) or mouse anti-actin (Cell Signaling #8H10D10, 1:2000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-p24</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-actin (Cell Signaling #8H10D10</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-rabbit and anti-mouse IgG secondary antibodies, conjugated to DyLight-800 (Bethyl Laboratories, #A80-304D8) and DyLight-680 (ThermoFisher, #SA5-35521), respectively, were used at a 1:5000 dilution each.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-rabbit</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (Thermo Fisher Scientific Cat# SA5-35521, RRID:AB_2556774)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After two PBS washes, cells were stained with a Goat anti-human AF647 antibody (ThermoFisher, #A21445) at 1:500 for 30 min at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human AF647</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To evaluate ACE2 and TMPRSS2 expression in the target cell lines used, cells were surface-labelled with the goat anti-ACE2 antibody (R&D #AF933) at 5 mg/mL for 30 min at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, cells were incubated with the secondary antibody donkey anti-goat-AF647 (ThermoFisher #A21447) at a 1:500 dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-goat-AF647</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were intracellularly stained with a rabbit anti-TMPRSS2 antibody (Atlas antibodies, HPA035787) at 0.3 mg/mL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-TMPRSS2</div><div>suggested: (Sigma-Aldrich Cat# HPA035787, RRID:AB_2674782)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, the secondary staining was done with a donkey anti-rabbit-AF555 antibody (Fisher #16229260) at a 1:500 dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit-AF555</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: HEK 293Tn (purchased from SBI Biosciences) and Calu-3 (ATCC</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: KCLB Cat# 30055, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK 293T-hACE2-TMPRSS2 cells (called herein HEK-ACE2-TMPRSS2) were induced for TPMRSS2 expression by addition of doxycycline (0.5 μg/mL, Sigma) and were maintained in DMEMc with blasticidin (10 μg/mL, InvivoGen) and puromycin (1 μg/mL, Alfa Aesar).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T-hACE2-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">U2OS cells expressing hACE2 and GFP1-10 or hACE2, TMPRSS2, and GFP1-10 were maintained in DMEMc supplemented with blasticidin (10 μg/mL, InvivoGen), puromycin (1 μg/mL</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>U2OS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK 293T and Vero-E6 cells expressing GFP1-10 and GFP11 were maintained in DMEMc supplemented with 1 μg/mL and 4 μg/mL of puromycin, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of spike-pseudotyped lentivectors: GFP lentiviral particles pseudotyped with the SARS-CoV-2 spike were prepared by transfection of HEK 293Tn cells using the CaCl2 method.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293Tn</div><div>suggested: RRID:CVCL_UL49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infection with spike-pseudotyped lentivectors: The day before infection with spike-pseudotyped GFP-lentivectors, 100,000 HEK-ACE2-TMPRSS2 cells were plated in 96-well plates, and TMPRSS2 was induced when needed by the addition of doxycycline.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-ACE2-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK and U2OS were infected with 0.125 μg of p24 Gag equivalent, while Calu-3 were infected with 1 μg of p24 Gag equivalent, all in a final volume of 100 μL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For infection, 50 μL of medium containing 0.065 μg of p24 Gag equivalent was added onto HEK ACE2 +/− TMPRSS2 and U2OS ACE2 +/− TMPRSS2, while 0.5 μg of p24 Gag equivalent in 50 μl added onto Calu-3 cells, resulting in a 2x dilution of the protease inhibitors.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 30 min, transfected cells were washed in DMEMna and spun at 500 g for 5 min before being mixed at a 1:1 ratio with Vero GFP11 cells in DMEMna.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero GFP11</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids: All the spike mutations were inserted into a codon-optimized version of the Wuhan-Hu-1 SARS-CoV-2 spike (GenBank: QHD43416.1) cloned into a phCMV backbone ( GenBank: AJ318514).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>phCMV</div><div>suggested: RRID:Addgene_15802)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids used to produce GFP-lentiviruses were the lentivector backbone pCDH-EF1α-GFP (System Biosciences), the packaging plasmid psPAXII (Addgene), and the pRev plasmid (a gift from P. Charneau).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDH-EF1α-GFP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>psPAXII</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pRev</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transfection of HEK 293Tn cells with spike vectors: Transfection was performed with Lipofectamine 2000 (ThermoFisher, #11668019), using 125 ng of phCMV-Spike plasmid diluted in OptiMem medium in a final volume of 25 μL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>phCMV-Spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The lentiviral vector pCDH-EF1a-GFP, the packaging plasmid psPAXII, the spike expression vector phCMV-Spike and the pRev plasmid were mixed at a 2:2:1:1 ratio, with a total DNA amount of 252 μg used per 175 cm2 flask.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDH-EF1a-GFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pQCXIP-empty plasmid was used to generate a spike-negative control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pQCXIP-empty</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Luciferase lentiviral particles were produced according to the same protocol, but with different plasmid ratios: the lentiviral backbone pHAGE-CMV-Luc2-IRES-ZsGreen, the packaging plasmid pHDM-Hgpm2, the Tat and Rev plasmids pHDM-tat1b and pRC-CMV-rev1b, and the spike plasmid phCMV-Spike were used at ratio 4.4:1:1:1:1.5 to transfect a 175 cm2 flask.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHDM-Hgpm2</div><div>suggested: RRID:Addgene_164441)</div></div><div style="margin-bottom:8px"><div>pHDM-tat1b</div><div>suggested: RRID:Addgene_164442)</div></div><div style="margin-bottom:8px"><div>pRC-CMV-rev1b</div><div>suggested: RRID:Addgene_164443)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed with the FlowJo software v10.7.1 (Becton Dickinson).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: All statistical analyses were carried out with the GraphPad Prism software (v9).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All the graphs were generated in GraphPad Prism, except for the spider plots, which were made using Microsoft Excel (v16.16.27).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.19.22275339: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This work was determined to be a public health surveillance activity by the Yale University Institutional Review Board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Additionally, we generated race/ethnicity-specific (non-Hispanic Black, non-Hispanic White, Hispanic) Kaplan Meier curves and age-adjusted HRs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>non-Hispanic White</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Our analysis was subject to limitations. First, not all vaccine offers are recorded, and our acceptance numbers are based solely on recorded offers. Second, our vaccination rates are based on recorded doses (from the community or facilities). Third, the DOC racial data is subject to missing data and reporting errors. Finally, our selection of residents and at-risk time for the survival analysis may have introduced bias. While the sensitivity analyses highlight the robustness of our findings, the magnitude of the observed association varied by examined sample. Public Health Implications: Despite observing moderate levels of vaccine acceptance among residents of state jails, we found newly incarcerated persons were far more likely to initiate vaccination following incarceration than prior to incarceration. Though our findings highlight the utility of vaccination programs within correctional facilities, they also speak to the need for ongoing, evidence-based vaccination program development within correctional facilities and the community.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.19.22275291: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the institutional review board of the University of Hong Kong / Hospital Authority Hong Kong West Cluster (reference no. UW 20-493).<br>Consent: Given the extraordinary nature of the COVID-19 pandemic, individual patient-informed consent was not required for this retrospective cohort study using anonymized data.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were performed using Stata version 17 (StataCorp LP, College Station, TX).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Nevertheless, several limitations of our study should be acknowledged. Firstly, we cannot exclude the possibility of selection bias or confounding by indication in this observational study, despite our population-based cohort was fully representative of the local COVID-19 patient population who did not require supplemental oxygen on admission. Besides, the clinical profile of our patients who would be deemed at risk of progression to severe COVID-19 might be different from those in the major trials of molnupiravir and nirmatrelvir/ritonavir, for instance, their dominant risk factor was overweight or obesity 22,23, whilst ours was old age. Secondly, since the Ct value was no longer adopted as one of the discharge criteria during our study period, patients might have already been deemed clinically stable for discharge before reaching the specific cutoff. Accordingly, further studies are needed to confirm our findings on viral load reduction and length of hospital stay associated with oral antiviral use. Results from ongoing trials (namely PANORAMIC and RECOVERY) and observational studies are awaiting 35-39, and further research is needed to explore the safety and effectiveness of oral antivirals in different patient populations (especially by COVID-19 vaccination status and VOC), drug combinations, and other healthcare settings such as nursing homes or residential care facilities. As proposed by the medical and research community, logistics and distribution issues should be ade...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.20.22275397: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was vetted and categorized as exempt by the Institutional Research Board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Limitations and future directions: Our study utilized aggregate data on a per-county basis instead of individual patient data; therefore, it is not possible to evaluate factors that contribute to COVID-19 case-fatality on a per case fashion which could help avoid any erroneous generalizations of specific regions. Another limitation of using county level data is that there is significant variability in the size and number of counties across the United States. Some counties may have only a few hundred people, while other counties may have a few million and this may lead, to some extent, representation bias. Future directions of this study include using these results to guide the evaluation of individuals’ factors that contribute directly to illness outcomes. Conclusion: Our study evaluated a multitude of factors that may affect COVID-19 case-fatality rate. Unlike previous studies that evaluated these factors separately, we performed a comprehensive analysis of all these variables together where they interact amongst each other. We identified several unique regionally dependent and independent relationships that highlighted the various factors that might influence COVID-19. Like other studies, we determined that comorbidities and demographic factors together are strong drivers of COVID-19 case fatalities. However, our study presents an assessment that puts them side to side for direct comparison. Our study highlights how any association is often dependent on the regional context...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.18.22275274: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Verbal parental consent and adolescent assent were obtained for adolescents younger than 18 years of age, and oral informed consent was obtained from adolescents aged 18 years and older.<br>IRB: This study was approved by the Institutional Review Board at Harvard T.H.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Within the sampling frame in each area, we interviewed approximately 300 randomly selected households with adolescents between the ages of 10 to 19 years residing in the household.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We conducted all analyses using SAS 9.4 (SAS Institute Inc., Cary, North Carolina) at a two-sided α level of 0.05.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      A potential limitation of the study was that the study areas were selected based on existing connections and infrastructure, and the adolescents in each area were not selected probabilistically. Therefore, the results from this study are not expected to be representative of all adolescents in the country. Nevertheless, we increased the representativeness of the study population by including countries and areas geographically spread across sub-Saharan Africa. Therefore, the results provide important insights into the levels of determinants of COVID-19 vaccine hesitancy in sub-Saharan Africa. Another limitation is that, due to the nature of phone-based interviews, the adolescents included in most areas were those who resided in households with access to a mobile phone. Consequently, the sample might underrepresent adolescents from under-resourced households, which may affect generalizability. The presence of unreachable phone numbers and failures to pick up phone calls may also have impacts on the generalizability of the findings. In conclusion, we show that COVID-19 vaccine hesitancy among adolescents is high across the five sub-Saharan African countries, especially in Tanzania. COVID-19 vaccination campaigns among sub-Saharan African adolescents must address adolescents’ concerns and misconceptions about COVID-19 vaccines, especially regarding vaccination safety and effectiveness. It is unfortunate that, at the time of this survey, a considerable proportion of adolescents in ...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.19.22275337: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: We obtained written permission from the District Administration Office in Humla and verbal consent from each participant prior to the interview.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Subjects with flu like symptoms, pregnant, lactating women, below 18 years were excluded.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Similarly, after collecting the data, we entered, coded and analyzed data in IBM Statistical Package for Social Sciences (SPSS) version 20.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.20.492764: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary commercial antibodies used in this work were from SantaCruz (CD3ζ, clone 6B10.2, #sc-1239), Cell Signaling (P-ZAP-70 Y319/ Syk Y352, #2701S; PTyr, #8954S), Abcam (Pericentrin, #4448) and BD Biosciences (Granzyme B, #560211).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD3ζ</div><div>suggested: (Miltenyi Biotec Cat# 130-127-939, RRID:AB_2904864)</div></div><div style="margin-bottom:8px"><div>P-ZAP-70 Y319/ Syk Y352, #2701S; PTyr, #8954S), Abcam (Pericentrin, #4448)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alexa Fluor 488-and 555-labeled secondary antibodies were from ThermoFisher Scientific (anti-mouse 488, #A11001; anti-rabbit 555, #A21428).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Thermo Fisher Scientific Cat# A-11001, RRID:AB_2534069)</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (Molecular Probes Cat# A-21428, RRID:AB_141784)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alternatively, CD8+ T cells (0.5×106) were incubated for 30 min at 20°C in 50 μl RPMI-HEPES in the absence of BCS with 2 μg/ml anti-ACE2 antibody (R&D Systems, #AF933) (Hoffmann et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: (Thermo Fisher Scientific Cat# PA5-75453, RRID:AB_2719181)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were stained with primary antibodies ([1:30] CD3ζ; [1:50] P-ZAP70; [1:100] PTyr; [1:200] PCNT; [1:50] GzmB; see above catalogue #) overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>P-ZAP70</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>PCNT</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Burkitt Lymphoma derived B cell line Raji was grown at 37°C, 5% CO2, in RPMI-1640 Medium (Merck, #R8758) supplemented with 7.5% BCS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Raji</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were processed with Zen 2009 image software (Carl Zeiss, Jena, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Zen</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Relative distances (μm) of the centrosome (marked by PCNT) from the center of the contact site with the APC, and of the lytic granules (marked by GzmB) from the centrosome, were measured using ImageJ (FigS2A).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">3D reconstructions were obtained using Fiji (version 2.1.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed with Prism software (GraphPad Software)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.19.492641: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">All testing was conducted in a blinded manner and results were unblinded after completion of all testing.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then washed 4 times with binding buffer followed by staining with appropriate labelled anti-Myc and PE-labelled secondary antibodies (Supplementary Table 1, antibodies and detection reagents).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PE-labelled secondary antibodies ( Supplementary Table 1 ,</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed three times and then stained with appropriate host-specific anti-IgG and anti-Myc antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Using the anti-Myc signal to account for differences in expression, diagonal gates were drawn on anti-Myc vs antibody signal plots to select the cells with the lowest 10-15% antibody signal (Supplementary Figure 2F).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Myc</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: All surface-display experiments were performed using “Viral Production Cells” from the ThermoFisher LV-MAX Lentiviral Production system, a derivative of the HEK 293F cell line.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For validation of individual mutations, HEK293 cells were transfected with Wuhan or mutants plasmids using the protocol optimized in the LV-MAX lentiviral production system (no packaging vectors were supplied in this case).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This sequence was cloned into pLVX-IRES-ZsGreen1 (TakaraBio) at the EcoRI and NotI sites using Gibson assembly (NEB 2x Gibson Assembly Master Mix).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX-IRES-ZsGreen1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting construct was packaged into a lentivirus using the packaging vectors psPAX2 and pMD2G and the LV-MAX lentiviral production system (ThermoFisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMD2G</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting DNA was assmbled into pLVX-IRES-ZsGreen at the EcoRI and NotI sites using Gibson assembly (NEB).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX-IRES-ZsGreen</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting replicate libraries were packaged into a lentiviral library using the packaging vectors psPAX2 and pMD2G and the LV-MAX lentiviral production system (ThermoFisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>psPAX2</div><div>suggested: RRID:Addgene_12260)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequencing data analysis and calculation of escape scores: Sequences were analyzed using custom scripts in Python and R.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      We overcome these limitations by employing mammalian surface-display to directly probe antibody recognition of the full-length antigen and using a mutational library to generate binding measurements for all possible antigen mutations. It is important to note that our approach does not directly determine an antibody’s epitope – the area of physical contact between antibody and antigen. Most escape mutations will be at the binding interface and reduce affinity through direct mechanisms, especially in the case of linear epitopes. Some mutations, however, will reduce binding indirectly through allostery. This is especially important for antibodies recognizing three-dimensional epitopes since mutations far away from the binding site may reduce the stability of the protein or affect local structure at the epitope allosterically. Thus, while escape mutations mapped onto the structure of the antigen identify localized surface patches, they represent a combination of the epitope and additional sites that are important for maintaining the conformational integrity and accessibility of the epitope. This approach thus goes beyond the notion of an epitope and, instead provides a mutational profile reminiscent of a fingerprint of the antibody on the antigen. These fingerprints are highly valuable in the evaluation of antibodies and other detection reagents such as nanobodies or DNA aptamers used in a diagnostic test regarding their ability to detect variants of a rapidly mutating viral anti...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. By 1724, the large number of blacks in Louisiana prompted the institutionalizing of laws governing slavery within the colony.[39] These laws required that slaves be baptized in the Roman Catholic faith, slaves be married in the church, and gave slaves no legal rights. The slave law formed in the 1720s is known as the Code Noir, which would bleed into the antebellum period of the American South as well. Louisiana slave culture had its own distinct Afro-Creole society that called on past cultures and the situation for slaves in the New World.

      for me, this is the most interesting part of the article

    1. ! #icon-paper-plane .cls-1{fill:#2ed5c3;opacity:.63}#icon-paper-plane .cls-5{fill:none;stroke:#fac901;stroke-miterlimit:10;stroke-width:1.5px} Skip to Content .Header-header-button-1EE8Y{background-color: #01103B; color: #FFF;}.Header-header-button-active-GnvKh{background-color: #21305B; color: #89D4FA;}.Header-header-button-active-state-3AvBm:focus:not(:active){background-color: #21305B; color: #89D4FA;}.Header-header-button-active-state-3AvBm:hover:not(:active){background-color: #21305B; color: #89D4FA;}.HeaderMenuButton-header-button-small-and-below-2fh3d{background-color: transparent; border-bottom-color: #21305B;}.HeaderMenuButton-header-button-small-and-below-2fh3d:focus{border-bottom-color: #21305B;}.HeaderMenuButton-header-button-small-and-below-2fh3d:hover{border-bottom-color: #21305B;}.Header-header-drop-menu-3SaYV{background-color: #FFFFFF;}.Header-header-drop-menu-item-3d3IZ{color: #0677BA;}.Header-line-divider-3rpA0{border-color: #E1DFE1;}HomeCoursesGroupsResourcesGrade Report2Kade Miller Current Menu ItemCourse ProfileCurrent Menu ItemMaterials DropdownMaterialsFolder.Monday, May 23 - Thursday, May 26 Folder.Monday, May 16 - Friday, May 19 Folder.May Folders Folder.April Folders Folder.March Folders Folder.February Folders Folder.January Folders Folder.December Folders Folder.November Folders Folder.October Weekly Folders Folder.September Weekly Folders Folder.August 26-27 Updates Grades Members Course Profile Actively LearnCanva for EducationConferencesDiscovery EducationExploreLearning GizmosStudyMateGale Health and WellnessGale In Context: BiographyGale In Context: Global IssuesGale In Context: Middle SchoolGale In Context: Opposing ViewpointsGale In Context: ScienceGale OneFile: Informe AcadémicoScholastic Digital ManagerInformationGrading periods2021-22 Full Year, 2021-22 Q1, 2021-22 Q2, 2021-22 Q3, 2021-22 Q4 Enriched English Language Arts: 2 Elizabethtown Area Middle School Announcement:                                                                                                            xThis course is associated with grading periods that will end on May 27, 2022. NotificationsEmail Notification Settings:Switch to another course. Student Progress All MaterialsAll MaterialsAssignmentsTests/QuizzesFilesLinksDiscussionsPagesAlbumsSCORMWeb ContentExternal ToolsAssessmentsManaged Assessments Page. Daily Agenda   Expand folder.Folder.Monday, May 23 - Thursday, May 26 Expand folder.Folder.Monday, May 16 - Friday, May 19 Expand folder.Folder.May Folders Expand folder.Folder.April FoldersComplete Expand folder.Folder.March Folders Expand folder.Folder.February Folders Expand folder.Folder.January Folders Expand folder.Folder.December Folders Expand folder.Folder.November Folders Expand folder.Folder.October Weekly Folders Expand folder.Folder.September Weekly Folders Expand folder.Folder.August 26-27 Web Link Bell Schedule - Zoom at correct times ExportUpcoming ⋅ Calendar CalendarUpcoming No upcoming assignments or events EnglishSupportSchoology BlogPrivacy PolicyTerms of UseSchoology © 2022 window.siteNavigationUiProps={"locales":{"en":{"site-navigation.change_language":"Change Language","site-navigation.your_profile":"Your Profile","site-navigation.settings":"Settings","site-navigation.subscriptions":"Subscriptions","site-navigation.logout":"Logout","site-navigation.resources":"Resources","site-navigation.privacy_policy":"Privacy Policy","site-navigation.terms_of_use":"Terms of Use","site-navigation.home":"Home","site-navigation.my_courses":"My Courses","site-navigation.courses":"Courses","site-navigation.join_course":"Join a Course","site-navigation.create_course":"Create a Course","site-navigation.my_groups":"My Groups","site-navigation.groups":"Groups","site-navigation.join_group":"Join a Group","site-navigation.create_group":"Create a Group","site-navigation.no_groups_joined":"You have not joined any groups","site-navigation.schoology_blog":"Schoology Blog","site-navigation.navigate_to_course":"Navigate to course %{course_title}, %{section_title}.","site-navigation.navigate_to_group":"Navigate to group %{group_title}","site-navigation.course_administrator":"You are the course administrator.","site-navigation.group_administrator":"You are the group administrator.","site-navigation.linked_sections":"This is a course with linked sections.","site-navigation.organization":"Organization: %{organization}.","site-navigation.unread_notifications":"%{smart_count} unread notification |||| %{smart_count} unread notifications","site-navigation.too_many_enrollments_error_message":"This area is unavailable when you are enrolled in more than %{max} courses\/groups","site-navigation.no_notifications":"You currently do not have any notifications.","site-navigation.no_requests":"You currently do not have any requests.","site-navigation.notifications":"Notifications","site-navigation.requests":"Requests","site-navigation.unread_messages":"%{smart_count} unread message |||| %{smart_count} unread messages","site-navigation.grade_report":"Grade Report","site-navigation.attendance":"Attendance","site-navigation.tools":"Tools","site-navigation.advisor_dashboard":"Advisor Dashboard","site-navigation.user_management":"User Management","site-navigation.school_management":"School Management","site-navigation.assessment_reports":"Assessment Reports","site-navigation.assessment_teams":"Assessment Teams","site-navigation.view_more_results":"View More Results","site-navigation.app_center":"App Center","site-navigation.show_apps":"Show Apps","site-navigation.no_apps_installed":"You currently do not have any apps installed.","site-navigation.view_all":"View All","site-navigation.messages":"Messages","site-navigation.new_message":"New Message","site-navigation.unread_message":"Unread Message","site-navigation.no_messages":"You currently do not have any messages.","site-navigation.name_and_others":"%{name} and others","site-navigation.you_sent":"You sent: %{message}","site-navigation.invited_to_join_group":"You have been invited to join group %{group}","site-navigation.wants_to_join":"%{user} wants to join %{courseOrGroup}","site-navigation.invited_to_join_course":"You have been invited to join course %{course}","site-navigation.invited_to_event":"%{user} invited you to event %{event}","site-navigation.would_like_to_connect":"%{user} would like to connect","site-navigation.add_child":"Add Child","site-navigation.something_went_wrong":"Something Went Wrong","site-navigation.reload_the_page_or_try_again":"Reload the page or try again later.","site-navigation.reload_page":"Reload Page","site-navigation.basic_user_thanks":"Thank you for using Schoology Basic.","site-navigation.basic_user_upgrade":"Click below to learn about premium features and how Schoology Enterprise can help transform education for your entire institution.","site-navigation.upgrade":"Upgrade","site-navigation.find_out_more":"Find Out More","site-navigation.admin":"Admin","site-navigation.admin_sgy_manager":"SGY Manager","site-navigation.admin_demo_schools":"Demo Schools","site-navigation.admin_server_info":"Server Info","site-navigation.admin_sgy_lookup":"SGY Lookup","site-navigation.admin_clear_cache":"Clear Cache","site-navigation.enter_user_id":"Enter user id","site-navigation.switch_back":"Switch Back","site-navigation.morph_to_user":"Morph to User","site-navigation.masquerade":"Masquerade","site_navigation.masquerading_as_status":"You are currently masquerading as %{userName}","site-navigation.amp":"AMP","core.admin":"Administrator","core.note":"Note:","core.of":"of","core.to":"to","core.ok":"Ok","core.actions":"Actions","core.add":"Add","core.and":"and","core.added":"Added","core.add_to":"Add to","core.added_to":"Added to","core.confirm":"Confirm","core.continue":"Continue","core.edit":"Edit","core.delete":"Delete","core.deleting":"Deleting","core.print":"Print","core.remove":"Remove","core.delete_content":"Delete Content","core.create":"Create","core.download":"Download","core.copy":"Copy","core.copied":"Copied","core.save":"Save","core.done":"done","core.saving":"Saving...","core.saving_without_ellipsis":"Saving","core.last_saved":"Last saved","core.saved":"Saved","core.go_back":"Go back","core.back":"Back","core.back_to_home":"Back to Home","core.try_again":"Try Again","core.connection_error_title":"Connection Error","core.err_generic":"An error occurred","core.err_unable_to_save":"An error occurred while saving","core.err_unable_to_save_reorder":"Reordering failed to save due to a system error. Please refresh the page and try reordering your content again.","core.err_unable_to_save_try_again":"An error occurred while saving - please try again","core.generic_error.something_went_wrong":"Something Went Wrong!","core.generic_error.try_again_and_contact":"Please try again. If it still doesn't work, contact","core.generic_error.try_again_and_visit_help_center":"Please try again. If it still not working, visit the <link>Help Center<\/link> for support.","core.generic_error.try_again_and_visit_help_center_link":"Please try again. If it's still not working, visit the <a href='https:\/\/support.schoology.com\/hc' target='_blank'>Help Center<\/a> for support.","core.send":"Send","core.apply":"Apply","core.cancel":"Cancel","core.replace":"Replace","core.close":"Close","core.grade_level":"Level","core.save_changes":"Save changes","core.undo_last_change":"Undo last change","core.nothing_to_undo":"There are no changes that can be undone. Undo will be active once you make changes.","core.browse":"Browse","core.browse_or_search":"Browse\/Search","core.manage":"Manage","core.count_selected":"%{count} selected","core.selected_count":"selected (%{count})","core.selected_with_num":"Selected (%{num})","core.associated_with_num":"Associated (%{num})","core.version":"version","core.move":"Move","core.html5_media_error":"Your browser does not support HTML5 media tags","core.today_at":"Today at","core.yesterday_at":"Yesterday at","core.date_at_time":"%{month}, at %{time}","core.publish_to_nobody":"No One","core.publish_to_user":"your Connections","core.publish_to_schoology":"all Schoology Users","core.publish_to_everyone":"Everyone","core.publish_in_all_linked_sections":"Publish for All Sections","core.unpublish_in_all_linked_sections":"Unpublish for All Sections","core.loading_msg":"Loading...","core.title":"Title","core.title_a_z":"Title, A-Z","core.title_z_a":"Title, Z-A","core.description":"Description","core.untitled":"Untitled","core.unnamed_page":"Unnamed Page","core.edit_page":"Edit Page","core.preview_page":"Preview Page","core.file":"File","core.video_file":"Video File","core.video_recording":"Video Recording","core.audio_file":"Audio File","core.audio_recording":"Audio Recording","core.image_file":"Image File","core.document_file":"Document File","core.view_file":"View File","core.link_url":"Link\/URL","core.assignment":"Assignment","core.assignments":"Assignments","core.view_assignment":"View Assignment","core.assignment_submission":"Assignment Submission","core.no_assignments_with_submissions_in_course":"There are no assignments with submissions in this course","core.no_course_enrollment_msg":"You are not currently enrolled in any courses","core.upload":"Upload","core.num_items":"%{smart_count} Item |||| %{smart_count} Items","core.num_selected":"%{num} Selected","core.num_questions":"%{smart_count} question |||| %{smart_count} questions","core.assessment":"Test\/Quiz","core.tests_quizzes":"Tests\/Quizzes","core.tests_quiz.attempt.deleted":"Questions attempted by the user have been deleted so the attempt cannot be viewed.","core.view_assessment":"View Test\/Quiz","core.add_a_link":"Add a link","core.add_link":"Add link","core.unable_to_add_link":"Unable to add link","core.attachments":"Attachments","core.image":"Image","core.upload_image":"Upload image","core.update":"Update","core.color":"Color","core.preview":"Preview","core.no_cover_image":"No cover image","core.red":"Red","core.orange":"Orange","core.yellow":"Yellow","core.green":"Green","core.blue":"Blue","core.purple":"Purple","core.grey":"Grey","core.doc_convert_header":"Document conversion in progress for file:","core.doc_convert_line1":"We are converting your file which may take several minutes.","core.doc_convert_line2":"Once successfully converted your file will be displayed here.","core.doc_convert_fail_header":"Document conversion has failed.","core.doc_convert_fail_line1":"Please check your file and try again.","core.doc_convert_fail_line2":"If you're still experiencing issues please contact customer support for further assistance.","core.contact_support":"Contact Customer Support","core.export_to_pdf":"Export to PDF","core.export_to_zip":"Export to ZIP","core.edit_cover_image":"Edit Cover Image","core.thumb_max_msg":"Max 5MB","core.upload_file_fail_msg":"Unable to upload file","core.retry":"Retry","core.retry_save":"Retry save","core.retry_upload":"Retry upload","core.click_to_retry":"Click to retry","core.revert":"Revert","core.select_new_file":"Select New File","core.upload_file_too_large":"The file is too large to upload","core.send_feedback":"Send Feedback","core.sign_in_to_send_feedback":"Sign In To Send Feedback","core.switch_to_html":"Switch to HTML","core.switch_to_visual":"Switch to Visual","core.image_media":"Image\/Media","core.link":"Link","core.view_link":"View Link","core.symbol":"Symbol","core.symbols":"Symbols","core.equation":"Equation","core.latex":"LaTeX","core.tooltip":"Tooltip","core.strikethrough":"Strikethrough","core.superscript":"Superscript","core.subscript":"Subscript","core.clear_formatting":"Clear Formatting","core.insert_content":"Insert Content","core.formatting":"Formatting","core.subject":"Subject","core.message":"Message","core.page":"Page","core.view_page":"View Page","core.revision":"Revision","core.err_try_add_again":"Error, please try clicking 'Add' again","core.try_it_out":"Try it out!","core.ok_got_it":"Okay, got it!","core.my_courses":"My courses","core.archived_courses":"Archived Courses","core.recent_submissions":"Recent submission","core.add_submission":"Add submission","core.add_a_submission":"Add a submission","core.unable_to_add_submission":"Unable to add submission","core.flash_missing_msg":"To view this page ensure that Adobe Flash Player version 10.0.0 or greater is installed.","core.congratulations":"Congratulations!","core.search_in_this_filter":"Search in this filter","core.clear_search":"Clear Search","core.student":"Student","core.profile_image":"Profile Image","core.students":"Students","core.grading_groups":"Grading Groups","core.school":"School","core.schools":"Schools","core.course_name":"Course Name","core.course_code":"Course Code","core.subject_area":"Subject Area","core.level":"Level","core.section":"Section","core.sections":"Sections","core.section_name":"Section Name","core.section_code":"Section Code","core.grading_period":"Grading Period","core.instructor":"Instructor","core.instructors":"Instructors","core.instructor_last_name":"Instructor Last Name","core.instructor_first_name":"Instructor First Name","core.num_others":"%{smart_count} other |||| %{smart_count} others","core.num_schools":"%{smart_count} School |||| %{smart_count} Schools","core.all_schools":"All Schools","core.num_sections":"%{smart_count} Section |||| %{smart_count} Sections","core.all_sections":"All Sections","core.num_instructors":"%{smart_count} Instructor |||| %{smart_count} Instructors","core.all_instructors":"All Instructors","core.previous":"Previous","core.prev":"Prev","core.first":"First","core.next":"Next","core.last":"Last","core.loading":"Loading","core.displaying_page_result":"Displaying %{start} - %{end} of %{total} results","core.members":"Members","core.add_members":"Add Members","core.edit_members":"Edit Members","core.link_existing_section":"Link Existing Section","core.unlink_existing_section":"Unlink Existing Section","core.copy_section":"Copy Section","core.duplicate":"Duplicate","core.question_bank":"Question Bank","core.question_banks":"Question Banks","core.question_banks_with_num":"Question Bank (%{smart_count}) |||| Question Banks (%{smart_count})","core.content":"Content","core.page_break":"Page Break","core.text":"Text","core.see_more":"see more","core.see_less":"see less","core.total":"Total","core.totals":"Totals","core.show_more":"show more","core.show_less":"show less","core.points":"points","core.criteria":"criteria","core.total_points":"Total Points","core.question":"Question","core.click_to_type_question":"Click to type your question","core.yes":"Yes","core.no":"No","core.yes_with_correct_answers":"Yes with correct answers","core.unlimited":"Unlimited","core.times":"%{smart_count} time |||| %{smart_count} times","core.hide_point_values":"Hide","core.show_point_values":"Display","core.minutes":"minute |||| minutes","core.mins":"%{smart_count} min |||| %{smart_count} mins","core.with_answers":"with correct answers","core.highest_score":"Highest Score","core.average_score":"Average Score","core.last_score":"Last Score","core.none":"none","core.spanish":"Spanish","core.no_search_results_found":"No search results found","core.months_long":"January,February,March,April,May,June,July,August,September,October,November,December","core.days_long":"Sunday,Monday,Tuesday,Wednesday,Thursday,Friday,Saturday","core.questions_label":"questions","core.questions":"%{smart_count} question |||| %{smart_count} questions","core.point":"%{smart_count} point |||| %{smart_count} points","core.short_answer":"Short answer","core.essay_question":"Essay question","core.printing":"Printing","core.excused":"Excused","core.incomplete":"Incomplete","core.missing":"Missing","core.mark_exception":"Mark With an Exception","core.clear_exception":"Clear Exception","core.exception":"Exception","core.in_progress":"In Progress","core.view":"View","core.settings":"Settings","core.setup":"Setup","core.status":"Status","core.status_draft":"Draft","core.status_active":"Active","core.status_retired":"Retired","core.other":"Other","core.last_modified":"Last modified","core.created_by":"Created by","core.date":"Date","core.date_range":"Date Range","core.select_date":"Select Date","core.start_date":"Start Date","core.end_date":"End Date","core.start_date_invalid_date_range":"Start time must occur before the end time","core.end_date_invalid_date_range":"End time must occur after the start time","core.invalid":"Invalid","core.invalidated":"Invalidated","core.course_search.display_current_sections_only":"Display Current Sections Only","core.course_search.search_sections":"Search Sections","core.course_search.show_all_search_options":"Show all search options","core.course_search.show_fewer_search_options":"Show fewer search options","core.course_search.advanced_search":"Advanced Search","core.course_search.sections_in_active":"Sections in Active Grading Periods","core.course_search.curr_section_only_hint":"You must deselect \"Sections in Active Grading Periods\" to select a grading period.","core.course_search.select_school":"Select school","core.course_search.select_subject":"Select a subject area","core.course_search.select_grade_level":"Select a grade level","core.course_search.select_grading_period":"Select a grading period","core.course_search.enter_course_name":"Enter course name","core.course_search.enter_section_name":"Enter section name","core.course_search.enter_course_code":"Enter course code","core.course_search.enter_section_code":"Enter section code","core.course_search.enter_first_name":"Enter instructor first name","core.course_search.enter_last_name":"Enter instructor last name","core.az":"AZ","core.za":"ZA","core.a_to_z":"A to Z","core.z_to_a":"Z to A","core.first_name_a_z":"First Name, A-Z","core.first_name_z_a":"First Name, Z-A","core.last_name_a_z":"Last Name, A-Z","core.last_name_z_a":"Last Name, Z-A","core.least_recent":"Least Recent","core.most_recent":"Most Recent","core.sorting_options":"Sorting Options","core.sorted_by":"Sorted by","core.instructions":"Instructions","core.action":"Action","core.ascending":"Ascending","core.descending":"Descending","core.low_to_high":"Low to High","core.high_to_low":"High to Low","core.correction":"Correction","core.collapse":"Collapse","core.label":"Label","unauthorized.error.insufficient.permissions":"You do not have permission to see results for the current selection","core.no_result_match_search_terms":"No results matched your search terms","core.accept":"Accept","core.dismiss":"Dismiss","core.open":"Open","core.results":"Results","core.sortable.enter_sort_mode":"Entering sort mode","core.sortable.exit_sort_mode":"Exiting sort mode","core.sortable.moved_item":"Moved item from position %{old_position} to %{new_position}","core.view_rubric":"View Rubric","core.recalculating":"Recalculating","core.unsubmit":"Unsubmit","core.submitted":"Submitted","core.late":"Late","core.on_time":"On Time","core.graded":"Graded","core.needs_grading":"Needs Grading","core.grade":"Grade","core.comments":"Comments","core.rating":"Rating","core.shared":"Shared","core.rubric":"Rubric","core.exceptions":"Exceptions","core.no_cancel":"No, cancel","core.true":"True","core.false":"False","core.items":"Items","core.done_capitalized":"Done","core.yes_submit":"Yes, submit","core.nevermind_not_yet":"Nevermind, not yet","core.complete":"Complete","core.display":"Display","core.activity_not_available":"This Activity is Not Available","core.import.auto":"Auto","core.import.manual":"Manual","core.import.type_csv":"Csv","core.import.accepted":"Accepted","core.import.in_progress":"In progress","core.import.completed":"Completed","core.import.failed":"Failed","core.grades":"Grades","core.mastery":"Mastery","core.calendar":"Calendar","core.calendar.delete_event":"Delete Event","core.calendar.delete_this_event":"Delete this event","core.calendar.delete_all_events":"Delete all events","core.calendar.delete_this_and_future_events":"Delete this and future events","core.calendar.delete_series":"Delete Series","core.calendar.delete_this_event_confirmation":"Are you sure you want to delete this event?","core.calendar.delete_all_confirmation":"Are you sure you want to delete all events in this series?","core.calendar.delete_this_and_future_confirmation":"Are you sure you want to delete this event and future events in this series?","core.calendar.this_event":"Just this event","core.calendar.this_and_future_events":"This event and future events","core.calendar.all_events_in_the_series":"All events in the series","core.calendar.save_changes":"Save Changes","core.calendar.error_repeat_until_limit":"Events cannot repeat for more than %{repeat_until_limit} days. Please adjust your start or until date to continue.","core.calendar.events_queued_create":"Events in the series will process through the event queue and appear on the calendar as they get created.","core.calendar.events_queued_edit":"Events in the series will process through the event queue and update on the calendar later.","core.calendar.changes_saved":"Your changes have been saved.","core.calendar.changes_visible_soon":"Your changes will be visible soon.","core.course":"Course","core.more":"More","core.home":"Home","core.and_more":"and %{smart_count} more","core.view_more":"View More","core.view_less":"View Less","core.hide_selected":"Hide Selected","core.select_all":"Select All","core.deselect_all":"Deselect All","core.clear_all":"Clear All","core.no_results_were_found":"Sorry, no results found","core.stepper.active":"Current","core.stepper.completed":"Completed","core.stepper.future":"Future Step","core.stepper.incomplete":"Incomplete","core.something_went_wrong":"Something Went Wrong","core.reload_the_page_or_try_again":"Reload the page or try again later.","core.or":"or","core.assessment_material":"Assessment","core.assessment_materials":"Assessments","core.external_tool":"External Tool","core.discussion":"Discussion","core.discussions":"Discussions","core.media_album":"Media Album","core.scorm":"SCORM","core.web_package":"Web Package","core.usage_analytics":"Usage Analytics","core.show_me":"Show me:","core.average":"Average","core.no_data_for_category":"No data found for this category","core.filters":"Filters","core.clear":"Clear","core.more_filters":"More Filters","core.material_type":"Material Type","core.submissions":"Submissions","core.views":"Views","core.managed_assessment":"Managed Assessment","core.oh_no":"Oh no!","core.lti.disabled.header":"System Error","core.lti.disabled.message":"Submissions are temporarily down. Sorry for the inconvenience.","core.resources":"Resources","core.personal":"Personal","core.group":"Group","core.error":"Error","core.secs":"%{smart_count} sec |||| %{smart_count} secs","core.repeat":"Repeat","core.until":"Until","core.never":"Never","core.every_day":"Every day","core.every_weekday":"Every weekday","core.every_day_of_week":"Every %{day}","core.day_of_month":"Day %{date} of every Month","core.nth_day_of_week_of_every_month":"%{ordinal} %{day} of every Month","core.last_day_of_month":"Last day of every Month","core.week_of_month_ordinals":"Every,First,Second,Third,Fourth,Fifth","core.string":"string","core.users":"Users","core.user_profile_left_nav_menu":"User Profile Left Navigation Menu","core.district":"District","core.custom_url":"Custom URL","core.must_enter_valid_custom_url":"You must enter a valid Custom URL, e.g. https:\/\/myapp.provider.com","core.custom_saml_url":"Custom SAML URL","core.must_enter_valid_custom_saml_url":"You must enter a valid Custom SAML URL, e.g. https:\/\/myapp.provider.com\/login","core.please_note":"Please Note:","core.configuring_app_is_not_same_as_installing":"Configuring the App is not the same as installing it. School Admins have the option to configure the app, giving their instructors the option to install it individually. To do this, do not check any boxes designating which course or school you want the app installed in after you've clicked the Install App button located in Schoology's App Center.","core.save_settings":"Save settings","core.successfully_configured":"You've successfully configured %{app_title}","core.rte_embed_error":"The content selected cannot be embedded","core.custom_domain.invalid_domain_error":"The domain you have entered does not appear to be a valid domain.","core.custom_domain.domain_already_verified_error":"This domain %{domain} has already been verified by the following schools: %{claimed_school_nids}.","core.custom_domain.subdomain_already_in_use_error":"The subdomain %{subdomain} has already been used by school %{subdomain_school_nid}.","core.must_enter_valid_url":"You must enter a valid URL, e.g. https:\/\/myapp.provider.com","core.must_enter_valid_saml_url":"You must enter a valid SAML URL, e.g. https:\/\/myapp.provider.com\/login","core.must_specify_numeric_price":"You must specify a numeric price if payment is required","core.please_choose_at_least_one_category":"Please choose at least one category","core.please_load_config_xml":"Please load configuration xml","core.must_enter_valid_domain_url":"You must enter a valid Domain\/URL, e.g. https:\/\/myapp.provider.com","core.oidc_login_init_url":"OIDC Login Init URL","core.oidc_login_init_url_tooltip":"This is Tool's URL for initiating OpenId Connect third-party login flow","core.must_enter_an_oidc_login_init_url":"You must enter an OIDC Login URL, e.g. https:\/\/myapp.provider.com\/login_initiate","core.must_enter_valid_oidc_login_init_url":"You must enter a valid OIDC Login URL, e.g. https:\/\/myapp.provider.com\/login_initiate","core.redirect_urls":"Redirect URLs","core.redirect_urls_tooltip":"One or more Redirect URLs are required; separate multiple values with commas","core.must_enter_redirect_urls":"You must enter Redirect URLs","core.must_enter_valid_redirect_urls":"You must enter valid Redirect URLs, e.g. (comma separated) https:\/\/myapp.provider1.com, https:\/\/myapp.provider2.com","core.must_enter_acs_endpoint_url_to_use_saml":"You must enter an ACS endpoint URL in order to use SAML SSO with your app","core._must_agree_to_terms_of_service":"You must agree to the terms of service","core.must_enter_only_public_key_or_jwks":"You must enter a value for either Tool Public Key or JWKS URL","core.must_enter_a_valid_public_key":"You must enter a valid RSA public key in PEM format. Your key must begin with %{rsa_public_key_begin} and end with %{rsa_public_key_end}.","core.tool_public_key":"Tool Public Key","core.tool_public_key_tooltip":"This is the Tool's Public Key used for verifying signature of Tool-Originating Messages","core.jwks_url":"JWKS URL","core.jwks_url_tooltip":"This is the Tool's URL where a JSON Web Key Set can be accessed for verifying signature of Tool-Originating Messages","core.must_enter_a_valid_jwks_url":"You must enter a valid JWKS URL, e.g. https:\/\/myapp.jwks.com","core.names_and_roles_services":"Names and Roles Services","core.custom_parameters_instructions":"Custom Parameters: One key value pair per line (e.g. key=value)","core.lti_service_get_tool_info_failed":"Your LTI 1.3 app data did not completely load. Edits to this page will not save successfully, please cancel and try again later.","core.lti_service_save_failed":"Your LTI 1.3 app did not completely save, please retry again later. Unsaved fields include: LTI Advantage Extensions, OIDC Login Init URL, Redirect URLs, Tool Public Key, and JWKS URL.","core.lti_service_being_redirected":"You are being redirected to %{redirectTargetText}","core.lti_service_not_automatically_redirected":"Click here if you are not automatically redirected","core.app_created":"Your app has been created. Your oauth consumer key and secret are listed below. You can access them at any time from the gear dropdown of your application.","core.app_updated":"Your app has been updated","core.app_requires_deep_linking":"Deep Linking is required for apps that can be installed to Course Materials Selection or Rich Text Editor","core.app_requires_configuration":"Require System Administrators to configure settings for this App","core.search_returns_apps_any_criteria":"Search returns apps that meet any of the criteria provided","core.search_app_name":"Search by App Name","core.search_app_nid":"Search by App Nid","core.search_app_url":"Search by App Url","core.submit":"Submit","core.navigate_to_web_browser_for_attendance":"Please navigate to your web browser to record attendance.","core.access_denied":"Access Denied","core.configuration_url_xml":"Configuration URL\/XML","core.form_can_parse_launch_url":"This form will parse 'launch_url', 'custom.property', and 'extensions' elements from XML.","core.unable_to_launch_attendance_app":"We are unable to launch the Attendance App.","core.item_type_not_supported_in_context":"%{item_type} is currently not supported in context %{context}","core.media_type_not_supported_in_context":"%{item_type} with media type %{media_type} is currently not supported in context %{context}","core.graded_items_not_supported_in_rte":"Items with grading content are not supported in Rich Text Editor.","core.my_activities":"My Activities","core.menu":"Menu","core.username":"Username","core.username_validation_error":"Usernames may only contain letters, numbers, periods, dashes, underscores, and tildes.","core.unique_id":"Unique ID","core.email":"email","core.search":"Search","core.select":"Select","core.open_submissions":"Open Submissions","core.exit":"Exit","core.you_are_viewing_as":"You are viewing as %{name}","core.point_scale_validation_error":"You must enter a numeric point value for each level.","core.create_grading_category":"Please create a grading category before you can enable grading","core.add_rubrics":"Please add a rubric before you can enable grading","core.conversion":"Conversion","core.up_to":"up to","core.use_average":"Use average","core.documentation":"Documentation","core.deployment_id":"Deployment ID","core.invalid_oauth_url":"Unable to authenticate, there was no valid return URL found. Please report this to your administrator.","core.captcha.error_incomplete":"Please verify that you are not a robot.","core.captcha.error_unknown":"An unknown error has occurred with reCAPTCHA.","core.access_code_signup_error.invalid_school_nid":"There was a problem validating your access code. Please try again.","core.access_code_signup_error.unified_users":"Sign up through access code is not available for Unified Users.","core.app_remove.description":"Removing this app from the school apps area will also remove any installed realms for this app.","core.app_remove.deep_linking_alert":"Any deep links created by this app will be broken and will need to be recreated if this app is ever reinstalled.","core.external_account_failure_message_powerschool":"There was a problem authenticating your account. Please try again later. If this continues to happen, please report the issue to <a href=%{supportLink}>https:\/\/help.powerschool.com<\/a>.","core.external_account_failure_message_schoology":"There was a problem authenticating your account. Please try again later. If this continues to happen, please report the issue to <a href=%{supportLink}>https:\/\/support.schoology.com\/hc\/en-us\/requests\/new<\/a>.","core.support_modal_product_help_description_powerschool":"Search Schoology online help","core.support_modal_product_help_description_schoology":"Search Schoology user guides, video tutorials, and FAQs","core.support_modal_community_description_powerschool":"Search knowledge base articles, videos, post in forums, and submit a support request","core.support_modal_community_description_schoology":"Share a question or feature idea with the Schoology community","core.assistance_ticket_submission_powerschool":"For additional assistance, please submit a ticket at app.schoology.com\/support.","core.assistance_ticket_submission_schoology":"For additional assistance, please submit a ticket at support.schoology.com.","core.assistance_ticket_submission_powerschool_html":"For additional assistance, please submit a ticket at <a href=%{support_link}>help.powerschool.com<\/a>.","core.assistance_ticket_submission_schoology_html":"For additional assistance, please submit a ticket at <a href=%{support_link}>support.schoology.com<\/a>.","core.language_preference_success_message_schoology":"Your language preference has been successfully changed! If you notice any translation errors, please contact us at support.schoology.com. Thank you!","core.language_preference_success_message_powerschool":"Your language preference has been successfully changed! If you notice any translation errors, please contact us at app.schoology.com\/support. Thank you!","core.student_self_registration_failure":"The school you'd like to join currently does not allow students to register on their own. Please find a Schoology Administrator at your school for further assistance. If you have further questions, please visit <a href=%{support_link}>%{support_link_url}<\/a>.","core.parent_self_registration_failure":"The school you'd like to join currently does not allow parents to register on their own. Please find a Schoology Administrator at your school for further assistance. If you have further questions, please visit <a href=%{support_link}>%{support_link_url}<\/a>.","core.user_self_registration_failure":"The school you'd like to join currently does not allow users to register on their own. Please find a Schoology Administrator at your school for further assistance. If you have further questions, please visit <a href=%{support_link}>%{support_link_url}<\/a>.","core.help_center":"Help Center","core.assessment.support_link":"support page","core.assessment.pre_support_text":"For help with printing, please see our","core.unlink_section.title":"Unlink Section - Step 1 of 3","core.unlink_section.message":"When you unlink, section enrollments will be moved to the original section or to a new section. Materials and grades will not be transferred to the separated section. Please review the %{help_link} article for additional details about unlinking sections.","core.area_description":"Visit the <a href=%{link}>Help Center<\/a> to learn more about these settings","core.microsoft_description":"For more information on how to retrieve your Office 365 Tenant ID, <a href=%{msft-help-center}>click here<\/a> to visit our Help Center.","core.enable_qr_login.title":"Enable QR Code Login","core.enable_qr_login.description":"This will give certain users in your school the ability to login using a QR Code, depending on their role and building association. Visit the <a href=%{link}>Help Center<\/a> to learn more.","core.section_override.description":"Section override roles allow system or course administrators to grant section-specific permissions to a course admin enrolled in a course. Visit the %{link} to learn more.","core.content_removed":"Some content may have been removed for security purposes","core.levels.undergraduate":"Undergraduate","core.levels.graduate":"Graduate","core.levels.pre_kindergarten_abbreviation":"Pre-K","core.levels.kindergarten_abbreviation":"K"}},"csrf":{"key":"SOElL4x5Y4d78bpXZfOVpEnPk5fcbLlr1Aj-tQBhFxQ","token":"98b7ccf43bca1d69d11e164eeae42154"},"props":{"notifications":{"maxAllowedEnrollments":150,"unreadCount":0},"unreadRequestsCount":0,"courses":{"showCreateCourse":false,"showJoinCourse":true},"groups":{"showCreateGroup":false,"showJoinGroup":true},"messages":{"canSend":true,"canReceive":true,"unreadCount":2},"tools":{"showUserManagement":false,"showSchoolManagement":false,"showImportExport":false,"showAdvisorDashboard":false,"showSchoolAnalytics":false,"schoologyAdminTools":{"showSgyManager":false,"showDemoSchools":false,"showServerInfo":false,"showSgyLookup":false,"showEmptyCache":false}},"amp":{"showAssessmentTeams":false,"showAssessmentReports":false},"apps":{"showAppCenterLink":false,"userApps":[{"nid":"1249713986","appTitle":"PBS LearningMedia","logoImgSrc":"https:\/\/asset-cdn.schoology.com\/system\/files\/imagecache\/profile_tiny\/applogos\/logo-_5cd1462a27506.png?1557218858"}]},"masquerade":[],"grades":{"showGradeReport":true,"showMastery":false,"showAttendance":false},"user":{"language":"en","languageNameNative":"English","logoutToken":"70f6f9595682748cf5f0e49b4a09710b","userSessionId":"cae7f715e9792835a24f250caed31138e730e197045074cceba59153007b71e7","uid":74366648,"name":"Kade Miller","profilePictureUrl":"https:\/\/asset-cdn.schoology.com\/system\/files\/imagecache\/profile_tiny\/pictures\/picture-828d6c281d47f29560a89c2414ba1401_5db9c3a59c3dc.jpg","parentUid":74366648,"parentName":"Kade Miller","parentProfilePictureUrl":"https:\/\/asset-cdn.schoology.com\/system\/files\/imagecache\/profile_tiny\/pictures\/picture-828d6c281d47f29560a89c2414ba1401_5db9c3a59c3dc.jpg","blogSubscriptionStatus":false,"buildings":[{"nid":1175936980,"name":"Elizabethtown Area Middle School"}],"linkedAccounts":[],"childrenAccounts":[],"isBasicInstructor":false,"isBasicNonFacultyUser":false},"languageOptions":{"en":"English","en-GB":"English (UK)","fr-corp":"French - Corporate","ja":"Japanese","ms":"Malay","pt":"Portuguese","es":"Spanish"},"supportLink":{"title":"Support"},"branding":{"color1":"#01103B","color2":"#21305B","color3":"#FFF","color4":"#89D4FA","color5":"#FFFFFF","color6":"#0677BA","color7":"#E1DFE1","color8":"#333333","logo":"https:\/\/asset-cdn.schoology.com\/system\/files\/imagecache\/node_themes\/sites\/all\/themes\/schoology_theme\/node_themes\/1108934880\/BrandingElizabethtownAreaSchoolDistrict_596f7afa4cead.png"},"enablePdsNavigation":false,"sentry":{"environment":"production","configUrl":"https:\/\/7100267298a447628f7bf7cff5c7e50a@sentry.io\/1222488","sampleRate":0.1000000000000000055511151231257827021181583404541015625},"breadcrumbs":null,"motuId":null,"apiV2":{"rootUrl":"https:\/\/schoology.etownschools.org\/v2\/root"},"isDetailLayout":false,"termsOfUseUrl":"https:\/\/www.powerschool.com\/MSA_Feb2022\/"}} <!--//--><![CDATA[//><!-- jQuery.extend(Drupal.settings, {"basePath":"\/","s_common":{"csrf_key":"7gQ4PViFOVsi3wRjEFS18dpmRgEMIPFM9MX7nmkdJ1s","csrf_token":"141a003c39ce51b83ed18fe441cea040","logout_token":"70f6f9595682748cf5f0e49b4a09710b","default_realm_profiles":{"group":"https:\/\/schoology.etownschools.org\/sites\/all\/themes\/schoology_theme\/images\/group-default.svg","course":"https:\/\/schoology.etownschools.org\/sites\/all\/themes\/schoology_theme\/images\/course-default.svg","school":"https:\/\/asset-cdn.schoology.com\/system\/files\/imagecache\/profile_tiny\/sites\/all\/themes\/schoology_theme\/images\/school-default.gif"},"date_format_language":"en","language":"en","timezone":"-14400","default_domain":"app.schoology.com","user":{"uid":"74366648","school_nid":"1108934880"}},"extlink":{"extTarget":"_blank","extClass":"ext","extSubdomains":1,"extExclude":"^https?:\/\/[^\/]+\\.schoology\\.com\/i","extInclude":"","extAlert":"_blank","extAlertText":"This link will take you to an external web site. We are not responsible for their content.","mailtoClass":"mailto"},"popups":{"links":{".s-js-locked-resource-link-diff":{"extraClass":"popups-extra-large linked-content-diff-view"},".materials-hide-toggle":{"extraClass":"popups-small"},".s-course-save-all-to-resources":{"extraClass":"popups-small","hijackDestination":true,"updateSource":"final","doneTest":"course\/.+?\/materials","updateMethod":"reload"},".app-uninstall":{"extraClass":"popups-small","targetSelectors":["#menu-s-apps-list"]},"#folder-completion-status":{"extraClass":"popups-large no-buttons popups-student-progress"},".add-item":{"extraClass":"popups-large","targetSelectors":["#s-course-materials-folder-contents-form"]},".add-xlarge-item":{"extraClass":"popups-extra-large","targetSelectors":["#s-course-materials-folder-contents-form"]},".add-item-attachment":{"extraClass":"popups-small popups-add-document","targetSelectors":["#s-course-materials-folder-contents-form"]},".add-item-existing":{"extraClass":"popups-large popups-add-existing","targetSelectors":["#s-course-materials-folder-contents-form"]},".import-library":{"extraClass":"popups-large popups-import-library popups-library","targetSelectors":["#s-course-materials-folder-contents-form"]},".action-edit-availability a":{"extraClass":"popups-small popups-action-item popups-availability","targetSelectors":["#s-course-materials-folder-contents-form"]},".action-completion a":{"extraClass":"popups-large popups-action-item student-completion-popup"},".edit-discussion-tags":{"extraClass":"popups-large"},"li.options-completion a":{"extraClass":"popups-large popups-action-item student-completion-popup"},".ical-popup":{"extraClass":"ical-popup popups-medium"},".ical-popup-import":{"extraClass":"ical-popup popups-medium","updateMethod":"reload","updateSource":"initial"}},"originalPath":"course\/5186181872\/materials","defaultTargetSelector":"div#content-wrapper","modulePath":"sites\/all\/modules\/popups","autoCloseFinalMessage":1},"s_user_ui_settings":{"s_discussion":{"timeline_expanded":false}},"s_realm_info":{"realm":"course","realm_id":5186181872},"theme_js":{"s_course_course_switcher_0":{"template":"s_course_course_switcher","module":[],"args":[]}},"s_course":{"display_mode":2,"display_mode_without_index":2,"reminders":"enable","upcoming":"enable"},"s_accessibility":{"role_main":["content-wrapper","content-wrapper","main"]},"s_app":{"cookie_preload_urls":[]},"s_attachment":{"openLtiRteLinkInNewWindow":true},"s_event_fcalendar_smartbox":{"externals_loaded":false},"s_tinymce":{"language":"en","cache":"628ca0084c981908","s_content_menu_items":[{"id":"s_content_resources_app_67923511","title":"Google Drive Resource App","cmd":"sContentResourcesInsertPopup","icon_src":"https:\/\/asset-cdn.schoology.com\/system\/files\/imagecache\/profile_tiny\/applogos\/logo-67923511.png?1381416833","value":{"nid":"67923511","type":"app"},"class":"s-js-resources-insert-item s-js-resources-insert-apps"},{"id":"s_content_resources_app_230009898","title":"YouTube","cmd":"sContentResourcesInsertPopup","icon_src":"https:\/\/asset-cdn.schoology.com\/system\/files\/imagecache\/profile_tiny\/applogos\/logo-_5eab04ebafad9.png?1588266219","value":{"nid":"230009898","type":"app"},"class":"s-js-resources-insert-item s-js-resources-insert-apps"}],"editors":[]},"s_docviewer_pdftron":{"allow_embedded_javascript":false}}); //--><!]]> <!--//--><![CDATA[//><!-- window._initPendo({"id":"8efaa683c26c91ce4ec1dcd53bb41992","gender":"male","accountCreationDate":"2018-08-21 11:30:08","isFaculty":false,"isParent":false,"isSchoolAdmin":false,"isTeacher":false,"isAdvisor":false,"isStudent":true,"customRole":"student","numCoursesEnrolled":40,"numCoursesTaught":0,"numSchoolGroupsAsMember":2,"numSchoolGroupsAsOwner":0,"numPublicGroupsAsMember":0}, {"country":"US","state":"PA","zip":"17022","schoolType":"k-12","customizedUI":true,"featurePackage":"enterprise","sgyId":130830,"organizationNid":"1108934880","buildingNid":"1108934880","id":"130830"},"9d267eb0-c5a6-41fb-786d-8ec2c4e691cc") //--><!]]> <!--//--><![CDATA[//><!-- function openMaterialAssignModal(props) { props['locales'] = {"en":{"material-assign-ui.individually_assign_folder":"Individually Assign %{title}","material-assign-ui.select_students":"Select Students","material-assign-ui.add_or_search_students":"Add or search for students","material-assign-ui.select_grading_groups":"Select Grading Groups","material-assign-ui.add_or_search_grading_groups":"Add or search for grading groups","material-assign-ui.individually_assign":"Individually Assign","material-assign-ui.make_available_to_everyone":"Make Available to Everyone","material-assign-ui.select_at_least_one_student_or_grading_group_or_make_available_to_everyone":"Select at least one student or grading group to individually assign this folder, or remove existing assignees by making it available to everyone.","material-assign-ui.select_at_least_one_student_or_grading_group":"Select at least one student or grading group to individually assign this folder.","material-assign-ui.confirm_information":"Confirm Your Information","material-assign-ui.assign_folders_to_students":"Assign Folders to Students","material-assign-ui.assign":"Assign","material-assign-ui.assigning":"Assigning","material-assign-ui.success_message":"Success! Your changes have been saved.","material-assign-ui.confirmation_page_message":"This folder will be individually assigned to the following students. If new students join your class or need to be added, you will need to individually assign this folder to them.","material-assign-ui.view_all_students":"View All %{num_students} Students","material-assign-ui.view_all_grading_groups":"View All %{num_grading_groups} Grading Groups","material-assign-ui.error_assigning_folder":"There was an error saving your changes.","material-assign-ui.please_try_again":"Please try again.","material-assign-ui.assigned_groups":"%{smart_count} group |||| %{smart_count} groups","material-assign-ui.assigned_others":"%{smart_count} other |||| %{smart_count} others","material-assign-ui.assigned_groups_and_others":"%{groups} and %{others}","material-assign-ui.available_to_all_message":"This folder will be available to all students in sections where it is published. It will not be individually assigned to anyone.","material-assign-ui.this_folder_is_within_an_individually_assigned_folder":"This folder is in an individually assigned folder. To edit assignees, please change the Individually Assign settings of the folder that contains this folder or move it out of the folder.","material-assign-ui.select_at_least_one_student_or_grading_group_error":"Select at least one student or grading group","material-assign-ui.correct_one_error_to_continue":"Correct 1 Error to Continue","material-assign-ui.no_students_or_grading_groups":"No students or grading groups","material-assign-ui.enroll_students_or_create_a_grading_group":"To individually assign a folder, enroll students in this section or create a grading group.","material-assign-ui.too_many_enrollments_error":"Folders cannot be assigned in sections with more than %{enrollments_limit} students.","material-assign-ui.too_many_assignments_error":"Your changes cannot be saved because you are trying to assign too many materials to too many students. Please remove either materials or students and try again.","core.admin":"Administrator","core.note":"Note:","core.of":"of","core.to":"to","core.ok":"Ok","core.actions":"Actions","core.add":"Add","core.and":"and","core.added":"Added","core.add_to":"Add to","core.added_to":"Added to","core.confirm":"Confirm","core.continue":"Continue","core.edit":"Edit","core.delete":"Delete","core.deleting":"Deleting","core.print":"Print","core.remove":"Remove","core.delete_content":"Delete Content","core.create":"Create","core.download":"Download","core.copy":"Copy","core.copied":"Copied","core.save":"Save","core.done":"done","core.saving":"Saving...","core.saving_without_ellipsis":"Saving","core.last_saved":"Last saved","core.saved":"Saved","core.go_back":"Go back","core.back":"Back","core.back_to_home":"Back to Home","core.try_again":"Try Again","core.connection_error_title":"Connection Error","core.err_generic":"An error occurred","core.err_unable_to_save":"An error occurred while saving","core.err_unable_to_save_reorder":"Reordering failed to save due to a system error. Please refresh the page and try reordering your content again.","core.err_unable_to_save_try_again":"An error occurred while saving - please try again","core.generic_error.something_went_wrong":"Something Went Wrong!","core.generic_error.try_again_and_contact":"Please try again. If it still doesn't work, contact","core.generic_error.try_again_and_visit_help_center":"Please try again. If it still not working, visit the <link>Help Center<\/link> for support.","core.generic_error.try_again_and_visit_help_center_link":"Please try again. If it's still not working, visit the <a href='https:\/\/support.schoology.com\/hc' target='_blank'>Help Center<\/a> for support.","core.send":"Send","core.apply":"Apply","core.cancel":"Cancel","core.replace":"Replace","core.close":"Close","core.grade_level":"Level","core.save_changes":"Save changes","core.undo_last_change":"Undo last change","core.nothing_to_undo":"There are no changes that can be undone. Undo will be active once you make changes.","core.browse":"Browse","core.browse_or_search":"Browse\/Search","core.manage":"Manage","core.count_selected":"%{count} selected","core.selected_count":"selected (%{count})","core.selected_with_num":"Selected (%{num})","core.associated_with_num":"Associated (%{num})","core.version":"version","core.move":"Move","core.html5_media_error":"Your browser does not support HTML5 media tags","core.today_at":"Today at","core.yesterday_at":"Yesterday at","core.date_at_time":"%{month}, at %{time}","core.publish_to_nobody":"No One","core.publish_to_user":"your Connections","core.publish_to_schoology":"all Schoology Users","core.publish_to_everyone":"Everyone","core.publish_in_all_linked_sections":"Publish for All Sections","core.unpublish_in_all_linked_sections":"Unpublish for All Sections","core.loading_msg":"Loading...","core.title":"Title","core.title_a_z":"Title, A-Z","core.title_z_a":"Title, Z-A","core.description":"Description","core.untitled":"Untitled","core.unnamed_page":"Unnamed Page","core.edit_page":"Edit Page","core.preview_page":"Preview Page","core.file":"File","core.video_file":"Video File","core.video_recording":"Video Recording","core.audio_file":"Audio File","core.audio_recording":"Audio Recording","core.image_file":"Image File","core.document_file":"Document File","core.view_file":"View File","core.link_url":"Link\/URL","core.assignment":"Assignment","core.assignments":"Assignments","core.view_assignment":"View Assignment","core.assignment_submission":"Assignment Submission","core.no_assignments_with_submissions_in_course":"There are no assignments with submissions in this course","core.no_course_enrollment_msg":"You are not currently enrolled in any courses","core.upload":"Upload","core.num_items":"%{smart_count} Item |||| %{smart_count} Items","core.num_selected":"%{num} Selected","core.num_questions":"%{smart_count} question |||| %{smart_count} questions","core.assessment":"Test\/Quiz","core.tests_quizzes":"Tests\/Quizzes","core.tests_quiz.attempt.deleted":"Questions attempted by the user have been deleted so the attempt cannot be viewed.","core.view_assessment":"View Test\/Quiz","core.add_a_link":"Add a link","core.add_link":"Add link","core.unable_to_add_link":"Unable to add link","core.attachments":"Attachments","core.image":"Image","core.upload_image":"Upload image","core.update":"Update","core.color":"Color","core.preview":"Preview","core.no_cover_image":"No cover image","core.red":"Red","core.orange":"Orange","core.yellow":"Yellow","core.green":"Green","core.blue":"Blue","core.purple":"Purple","core.grey":"Grey","core.doc_convert_header":"Document conversion in progress for file:","core.doc_convert_line1":"We are converting your file which may take several minutes.","core.doc_convert_line2":"Once successfully converted your file will be displayed here.","core.doc_convert_fail_header":"Document conversion has failed.","core.doc_convert_fail_line1":"Please check your file and try again.","core.doc_convert_fail_line2":"If you're still experiencing issues please contact customer support for further assistance.","core.contact_support":"Contact Customer Support","core.export_to_pdf":"Export to PDF","core.export_to_zip":"Export to ZIP","core.edit_cover_image":"Edit Cover Image","core.thumb_max_msg":"Max 5MB","core.upload_file_fail_msg":"Unable to upload file","core.retry":"Retry","core.retry_save":"Retry save","core.retry_upload":"Retry upload","core.click_to_retry":"Click to retry","core.revert":"Revert","core.select_new_file":"Select New File","core.upload_file_too_large":"The file is too large to upload","core.send_feedback":"Send Feedback","core.sign_in_to_send_feedback":"Sign In To Send Feedback","core.switch_to_html":"Switch to HTML","core.switch_to_visual":"Switch to Visual","core.image_media":"Image\/Media","core.link":"Link","core.view_link":"View Link","core.symbol":"Symbol","core.symbols":"Symbols","core.equation":"Equation","core.latex":"LaTeX","core.tooltip":"Tooltip","core.strikethrough":"Strikethrough","core.superscript":"Superscript","core.subscript":"Subscript","core.clear_formatting":"Clear Formatting","core.insert_content":"Insert Content","core.formatting":"Formatting","core.subject":"Subject","core.message":"Message","core.page":"Page","core.view_page":"View Page","core.revision":"Revision","core.err_try_add_again":"Error, please try clicking 'Add' again","core.try_it_out":"Try it out!","core.ok_got_it":"Okay, got it!","core.my_courses":"My courses","core.archived_courses":"Archived Courses","core.recent_submissions":"Recent submission","core.add_submission":"Add submission","core.add_a_submission":"Add a submission","core.unable_to_add_submission":"Unable to add submission","core.flash_missing_msg":"To view this page ensure that Adobe Flash Player version 10.0.0 or greater is installed.","core.congratulations":"Congratulations!","core.search_in_this_filter":"Search in this filter","core.clear_search":"Clear Search","core.student":"Student","core.profile_image":"Profile Image","core.students":"Students","core.grading_groups":"Grading Groups","core.school":"School","core.schools":"Schools","core.course_name":"Course Name","core.course_code":"Course Code","core.subject_area":"Subject Area","core.level":"Level","core.section":"Section","core.sections":"Sections","core.section_name":"Section Name","core.section_code":"Section Code","core.grading_period":"Grading Period","core.instructor":"Instructor","core.instructors":"Instructors","core.instructor_last_name":"Instructor Last Name","core.instructor_first_name":"Instructor First Name","core.num_others":"%{smart_count} other |||| %{smart_count} others","core.num_schools":"%{smart_count} School |||| %{smart_count} Schools","core.all_schools":"All Schools","core.num_sections":"%{smart_count} Section |||| %{smart_count} Sections","core.all_sections":"All Sections","core.num_instructors":"%{smart_count} Instructor |||| %{smart_count} Instructors","core.all_instructors":"All Instructors","core.previous":"Previous","core.prev":"Prev","core.first":"First","core.next":"Next","core.last":"Last","core.loading":"Loading","core.displaying_page_result":"Displaying %{start} - %{end} of %{total} results","core.members":"Members","core.add_members":"Add Members","core.edit_members":"Edit Members","core.link_existing_section":"Link Existing Section","core.unlink_existing_section":"Unlink Existing Section","core.copy_section":"Copy Section","core.duplicate":"Duplicate","core.question_bank":"Question Bank","core.question_banks":"Question Banks","core.question_banks_with_num":"Question Bank (%{smart_count}) |||| Question Banks (%{smart_count})","core.content":"Content","core.page_break":"Page Break","core.text":"Text","core.see_more":"see more","core.see_less":"see less","core.total":"Total","core.totals":"Totals","core.show_more":"show more","core.show_less":"show less","core.points":"points","core.criteria":"criteria","core.total_points":"Total Points","core.question":"Question","core.click_to_type_question":"Click to type your question","core.yes":"Yes","core.no":"No","core.yes_with_correct_answers":"Yes with correct answers","core.unlimited":"Unlimited","core.times":"%{smart_count} time |||| %{smart_count} times","core.hide_point_values":"Hide","core.show_point_values":"Display","core.minutes":"minute |||| minutes","core.mins":"%{smart_count} min |||| %{smart_count} mins","core.with_answers":"with correct answers","core.highest_score":"Highest Score","core.average_score":"Average Score","core.last_score":"Last Score","core.none":"none","core.spanish":"Spanish","core.no_search_results_found":"No search results found","core.months_long":"January,February,March,April,May,June,July,August,September,October,November,December","core.days_long":"Sunday,Monday,Tuesday,Wednesday,Thursday,Friday,Saturday","core.questions_label":"questions","core.questions":"%{smart_count} question |||| %{smart_count} questions","core.point":"%{smart_count} point |||| %{smart_count} points","core.short_answer":"Short answer","core.essay_question":"Essay question","core.printing":"Printing","core.excused":"Excused","core.incomplete":"Incomplete","core.missing":"Missing","core.mark_exception":"Mark With an Exception","core.clear_exception":"Clear Exception","core.exception":"Exception","core.in_progress":"In Progress","core.view":"View","core.settings":"Settings","core.setup":"Setup","core.status":"Status","core.status_draft":"Draft","core.status_active":"Active","core.status_retired":"Retired","core.other":"Other","core.last_modified":"Last modified","core.created_by":"Created by","core.date":"Date","core.date_range":"Date Range","core.select_date":"Select Date","core.start_date":"Start Date","core.end_date":"End Date","core.start_date_invalid_date_range":"Start time must occur before the end time","core.end_date_invalid_date_range":"End time must occur after the start time","core.invalid":"Invalid","core.invalidated":"Invalidated","core.course_search.display_current_sections_only":"Display Current Sections Only","core.course_search.search_sections":"Search Sections","core.course_search.show_all_search_options":"Show all search options","core.course_search.show_fewer_search_options":"Show fewer search options","core.course_search.advanced_search":"Advanced Search","core.course_search.sections_in_active":"Sections in Active Grading Periods","core.course_search.curr_section_only_hint":"You must deselect \"Sections in Active Grading Periods\" to select a grading period.","core.course_search.select_school":"Select school","core.course_search.select_subject":"Select a subject area","core.course_search.select_grade_level":"Select a grade level","core.course_search.select_grading_period":"Select a grading period","core.course_search.enter_course_name":"Enter course name","core.course_search.enter_section_name":"Enter section name","core.course_search.enter_course_code":"Enter course code","core.course_search.enter_section_code":"Enter section code","core.course_search.enter_first_name":"Enter instructor first name","core.course_search.enter_last_name":"Enter instructor last name","core.az":"AZ","core.za":"ZA","core.a_to_z":"A to Z","core.z_to_a":"Z to A","core.first_name_a_z":"First Name, A-Z","core.first_name_z_a":"First Name, Z-A","core.last_name_a_z":"Last Name, A-Z","core.last_name_z_a":"Last Name, Z-A","core.least_recent":"Least Recent","core.most_recent":"Most Recent","core.sorting_options":"Sorting Options","core.sorted_by":"Sorted by","core.instructions":"Instructions","core.action":"Action","core.ascending":"Ascending","core.descending":"Descending","core.low_to_high":"Low to High","core.high_to_low":"High to Low","core.correction":"Correction","core.collapse":"Collapse","core.label":"Label","unauthorized.error.insufficient.permissions":"You do not have permission to see results for the current selection","core.no_result_match_search_terms":"No results matched your search terms","core.accept":"Accept","core.dismiss":"Dismiss","core.open":"Open","core.results":"Results","core.sortable.enter_sort_mode":"Entering sort mode","core.sortable.exit_sort_mode":"Exiting sort mode","core.sortable.moved_item":"Moved item from position %{old_position} to %{new_position}","core.view_rubric":"View Rubric","core.recalculating":"Recalculating","core.unsubmit":"Unsubmit","core.submitted":"Submitted","core.late":"Late","core.on_time":"On Time","core.graded":"Graded","core.needs_grading":"Needs Grading","core.grade":"Grade","core.comments":"Comments","core.rating":"Rating","core.shared":"Shared","core.rubric":"Rubric","core.exceptions":"Exceptions","core.no_cancel":"No, cancel","core.true":"True","core.false":"False","core.items":"Items","core.done_capitalized":"Done","core.yes_submit":"Yes, submit","core.nevermind_not_yet":"Nevermind, not yet","core.complete":"Complete","core.display":"Display","core.activity_not_available":"This Activity is Not Available","core.import.auto":"Auto","core.import.manual":"Manual","core.import.type_csv":"Csv","core.import.accepted":"Accepted","core.import.in_progress":"In progress","core.import.completed":"Completed","core.import.failed":"Failed","core.grades":"Grades","core.mastery":"Mastery","core.calendar":"Calendar","core.calendar.delete_event":"Delete Event","core.calendar.delete_this_event":"Delete this event","core.calendar.delete_all_events":"Delete all events","core.calendar.delete_this_and_future_events":"Delete this and future events","core.calendar.delete_series":"Delete Series","core.calendar.delete_this_event_confirmation":"Are you sure you want to delete this event?","core.calendar.delete_all_confirmation":"Are you sure you want to delete all events in this series?","core.calendar.delete_this_and_future_confirmation":"Are you sure you want to delete this event and future events in this series?","core.calendar.this_event":"Just this event","core.calendar.this_and_future_events":"This event and future events","core.calendar.all_events_in_the_series":"All events in the series","core.calendar.save_changes":"Save Changes","core.calendar.error_repeat_until_limit":"Events cannot repeat for more than %{repeat_until_limit} days. Please adjust your start or until date to continue.","core.calendar.events_queued_create":"Events in the series will process through the event queue and appear on the calendar as they get created.","core.calendar.events_queued_edit":"Events in the series will process through the event queue and update on the calendar later.","core.calendar.changes_saved":"Your changes have been saved.","core.calendar.changes_visible_soon":"Your changes will be visible soon.","core.course":"Course","core.more":"More","core.home":"Home","core.and_more":"and %{smart_count} more","core.view_more":"View More","core.view_less":"View Less","core.hide_selected":"Hide Selected","core.select_all":"Select All","core.deselect_all":"Deselect All","core.clear_all":"Clear All","core.no_results_were_found":"Sorry, no results found","core.stepper.active":"Current","core.stepper.completed":"Completed","core.stepper.future":"Future Step","core.stepper.incomplete":"Incomplete","core.something_went_wrong":"Something Went Wrong","core.reload_the_page_or_try_again":"Reload the page or try again later.","core.or":"or","core.assessment_material":"Assessment","core.assessment_materials":"Assessments","core.external_tool":"External Tool","core.discussion":"Discussion","core.discussions":"Discussions","core.media_album":"Media Album","core.scorm":"SCORM","core.web_package":"Web Package","core.usage_analytics":"Usage Analytics","core.show_me":"Show me:","core.average":"Average","core.no_data_for_category":"No data found for this category","core.filters":"Filters","core.clear":"Clear","core.more_filters":"More Filters","core.material_type":"Material Type","core.submissions":"Submissions","core.views":"Views","core.managed_assessment":"Managed Assessment","core.oh_no":"Oh no!","core.lti.disabled.header":"System Error","core.lti.disabled.message":"Submissions are temporarily down. Sorry for the inconvenience.","core.resources":"Resources","core.personal":"Personal","core.group":"Group","core.error":"Error","core.secs":"%{smart_count} sec |||| %{smart_count} secs","core.repeat":"Repeat","core.until":"Until","core.never":"Never","core.every_day":"Every day","core.every_weekday":"Every weekday","core.every_day_of_week":"Every %{day}","core.day_of_month":"Day %{date} of every Month","core.nth_day_of_week_of_every_month":"%{ordinal} %{day} of every Month","core.last_day_of_month":"Last day of every Month","core.week_of_month_ordinals":"Every,First,Second,Third,Fourth,Fifth","core.string":"string","core.users":"Users","core.user_profile_left_nav_menu":"User Profile Left Navigation Menu","core.district":"District","core.custom_url":"Custom URL","core.must_enter_valid_custom_url":"You must enter a valid Custom URL, e.g. https:\/\/myapp.provider.com","core.custom_saml_url":"Custom SAML URL","core.must_enter_valid_custom_saml_url":"You must enter a valid Custom SAML URL, e.g. https:\/\/myapp.provider.com\/login","core.please_note":"Please Note:","core.configuring_app_is_not_same_as_installing":"Configuring the App is not the same as installing it. School Admins have the option to configure the app, giving their instructors the option to install it individually. To do this, do not check any boxes designating which course or school you want the app installed in after you've clicked the Install App button located in Schoology's App Center.","core.save_settings":"Save settings","core.successfully_configured":"You've successfully configured %{app_title}","core.rte_embed_error":"The content selected cannot be embedded","core.custom_domain.invalid_domain_error":"The domain you have entered does not appear to be a valid domain.","core.custom_domain.domain_already_verified_error":"This domain %{domain} has already been verified by the following schools: %{claimed_school_nids}.","core.custom_domain.subdomain_already_in_use_error":"The subdomain %{subdomain} has already been used by school %{subdomain_school_nid}.","core.must_enter_valid_url":"You must enter a valid URL, e.g. https:\/\/myapp.provider.com","core.must_enter_valid_saml_url":"You must enter a valid SAML URL, e.g. https:\/\/myapp.provider.com\/login","core.must_specify_numeric_price":"You must specify a numeric price if payment is required","core.please_choose_at_least_one_category":"Please choose at least one category","core.please_load_config_xml":"Please load configuration xml","core.must_enter_valid_domain_url":"You must enter a valid Domain\/URL, e.g. https:\/\/myapp.provider.com","core.oidc_login_init_url":"OIDC Login Init URL","core.oidc_login_init_url_tooltip":"This is Tool's URL for initiating OpenId Connect third-party login flow","core.must_enter_an_oidc_login_init_url":"You must enter an OIDC Login URL, e.g. https:\/\/myapp.provider.com\/login_initiate","core.must_enter_valid_oidc_login_init_url":"You must enter a valid OIDC Login URL, e.g. https:\/\/myapp.provider.com\/login_initiate","core.redirect_urls":"Redirect URLs","core.redirect_urls_tooltip":"One or more Redirect URLs are required; separate multiple values with commas","core.must_enter_redirect_urls":"You must enter Redirect URLs","core.must_enter_valid_redirect_urls":"You must enter valid Redirect URLs, e.g. (comma separated) https:\/\/myapp.provider1.com, https:\/\/myapp.provider2.com","core.must_enter_acs_endpoint_url_to_use_saml":"You must enter an ACS endpoint URL in order to use SAML SSO with your app","core._must_agree_to_terms_of_service":"You must agree to the terms of service","core.must_enter_only_public_key_or_jwks":"You must enter a value for either Tool Public Key or JWKS URL","core.must_enter_a_valid_public_key":"You must enter a valid RSA public key in PEM format. Your key must begin with %{rsa_public_key_begin} and end with %{rsa_public_key_end}.","core.tool_public_key":"Tool Public Key","core.tool_public_key_tooltip":"This is the Tool's Public Key used for verifying signature of Tool-Originating Messages","core.jwks_url":"JWKS URL","core.jwks_url_tooltip":"This is the Tool's URL where a JSON Web Key Set can be accessed for verifying signature of Tool-Originating Messages","core.must_enter_a_valid_jwks_url":"You must enter a valid JWKS URL, e.g. https:\/\/myapp.jwks.com","core.names_and_roles_services":"Names and Roles Services","core.custom_parameters_instructions":"Custom Parameters: One key value pair per line (e.g. key=value)","core.lti_service_get_tool_info_failed":"Your LTI 1.3 app data did not completely load. Edits to this page will not save successfully, please cancel and try again later.","core.lti_service_save_failed":"Your LTI 1.3 app did not completely save, please retry again later. Unsaved fields include: LTI Advantage Extensions, OIDC Login Init URL, Redirect URLs, Tool Public Key, and JWKS URL.","core.lti_service_being_redirected":"You are being redirected to %{redirectTargetText}","core.lti_service_not_automatically_redirected":"Click here if you are not automatically redirected","core.app_created":"Your app has been created. Your oauth consumer key and secret are listed below. You can access them at any time from the gear dropdown of your application.","core.app_updated":"Your app has been updated","core.app_requires_deep_linking":"Deep Linking is required for apps that can be installed to Course Materials Selection or Rich Text Editor","core.app_requires_configuration":"Require System Administrators to configure settings for this App","core.search_returns_apps_any_criteria":"Search returns apps that meet any of the criteria provided","core.search_app_name":"Search by App Name","core.search_app_nid":"Search by App Nid","core.search_app_url":"Search by App Url","core.submit":"Submit","core.navigate_to_web_browser_for_attendance":"Please navigate to your web browser to record attendance.","core.access_denied":"Access Denied","core.configuration_url_xml":"Configuration URL\/XML","core.form_can_parse_launch_url":"This form will parse 'launch_url', 'custom.property', and 'extensions' elements from XML.","core.unable_to_launch_attendance_app":"We are unable to launch the Attendance App.","core.item_type_not_supported_in_context":"%{item_type} is currently not supported in context %{context}","core.media_type_not_supported_in_context":"%{item_type} with media type %{media_type} is currently not supported in context %{context}","core.graded_items_not_supported_in_rte":"Items with grading content are not supported in Rich Text Editor.","core.my_activities":"My Activities","core.menu":"Menu","core.username":"Username","core.username_validation_error":"Usernames may only contain letters, numbers, periods, dashes, underscores, and tildes.","core.unique_id":"Unique ID","core.email":"email","core.search":"Search","core.select":"Select","core.open_submissions":"Open Submissions","core.exit":"Exit","core.you_are_viewing_as":"You are viewing as %{name}","core.point_scale_validation_error":"You must enter a numeric point value for each level.","core.create_grading_category":"Please create a grading category before you can enable grading","core.add_rubrics":"Please add a rubric before you can enable grading","core.conversion":"Conversion","core.up_to":"up to","core.use_average":"Use average","core.documentation":"Documentation","core.deployment_id":"Deployment ID","core.invalid_oauth_url":"Unable to authenticate, there was no valid return URL found. Please report this to your administrator.","core.captcha.error_incomplete":"Please verify that you are not a robot.","core.captcha.error_unknown":"An unknown error has occurred with reCAPTCHA.","core.access_code_signup_error.invalid_school_nid":"There was a problem validating your access code. Please try again.","core.access_code_signup_error.unified_users":"Sign up through access code is not available for Unified Users.","core.app_remove.description":"Removing this app from the school apps area will also remove any installed realms for this app.","core.app_remove.deep_linking_alert":"Any deep links created by this app will be broken and will need to be recreated if this app is ever reinstalled.","core.external_account_failure_message_powerschool":"There was a problem authenticating your account. Please try again later. If this continues to happen, please report the issue to <a href=%{supportLink}>https:\/\/help.powerschool.com<\/a>.","core.external_account_failure_message_schoology":"There was a problem authenticating your account. Please try again later. If this continues to happen, please report the issue to <a href=%{supportLink}>https:\/\/support.schoology.com\/hc\/en-us\/requests\/new<\/a>.","core.support_modal_product_help_description_powerschool":"Search Schoology online help","core.support_modal_product_help_description_schoology":"Search Schoology user guides, video tutorials, and FAQs","core.support_modal_community_description_powerschool":"Search knowledge base articles, videos, post in forums, and submit a support request","core.support_modal_community_description_schoology":"Share a question or feature idea with the Schoology community","core.assistance_ticket_submission_powerschool":"For additional assistance, please submit a ticket at app.schoology.com\/support.","core.assistance_ticket_submission_schoology":"For additional assistance, please submit a ticket at support.schoology.com.","core.assistance_ticket_submission_powerschool_html":"For additional assistance, please submit a ticket at <a href=%{support_link}>help.powerschool.com<\/a>.","core.assistance_ticket_submission_schoology_html":"For additional assistance, please submit a ticket at <a href=%{support_link}>support.schoology.com<\/a>.","core.language_preference_success_message_schoology":"Your language preference has been successfully changed! If you notice any translation errors, please contact us at support.schoology.com. Thank you!","core.language_preference_success_message_powerschool":"Your language preference has been successfully changed! If you notice any translation errors, please contact us at app.schoology.com\/support. Thank you!","core.student_self_registration_failure":"The school you'd like to join currently does not allow students to register on their own. Please find a Schoology Administrator at your school for further assistance. If you have further questions, please visit <a href=%{support_link}>%{support_link_url}<\/a>.","core.parent_self_registration_failure":"The school you'd like to join currently does not allow parents to register on their own. Please find a Schoology Administrator at your school for further assistance. If you have further questions, please visit <a href=%{support_link}>%{support_link_url}<\/a>.","core.user_self_registration_failure":"The school you'd like to join currently does not allow users to register on their own. Please find a Schoology Administrator at your school for further assistance. If you have further questions, please visit <a href=%{support_link}>%{support_link_url}<\/a>.","core.help_center":"Help Center","core.assessment.support_link":"support page","core.assessment.pre_support_text":"For help with printing, please see our","core.unlink_section.title":"Unlink Section - Step 1 of 3","core.unlink_section.message":"When you unlink, section enrollments will be moved to the original section or to a new section. Materials and grades will not be transferred to the separated section. Please review the %{help_link} article for additional details about unlinking sections.","core.area_description":"Visit the <a href=%{link}>Help Center<\/a> to learn more about these settings","core.microsoft_description":"For more information on how to retrieve your Office 365 Tenant ID, <a href=%{msft-help-center}>click here<\/a> to visit our Help Center.","core.enable_qr_login.title":"Enable QR Code Login","core.enable_qr_login.description":"This will give certain users in your school the ability to login using a QR Code, depending on their role and building association. Visit the <a href=%{link}>Help Center<\/a> to learn more.","core.section_override.description":"Section override roles allow system or course administrators to grant section-specific permissions to a course admin enrolled in a course. Visit the %{link} to learn more.","core.content_removed":"Some content may have been removed for security purposes","core.levels.undergraduate":"Undergraduate","core.levels.graduate":"Graduate","core.levels.pre_kindergarten_abbreviation":"Pre-K","core.levels.kindergarten_abbreviation":"K"}}; window.sgyMaterialAssignUi('sgy-material-assign-ui', props); }; //--><!]]> <!--//--><![CDATA[//><!-- (function(){var r = window['sgyReactRenders'];if (!r) return;for(var k in r) r.hasOwnProperty(k) && r[k]();window['sgyReactRenders'] = null;})() //--><!]]> <!--//--><![CDATA[//><!-- jQuery.extend(Drupal.settings, {"aggregated_js":["\/assets\/bundles\/js\/common\/common-16958cbf6a6fcd290085.js?628ca0084c981908","\/assets\/drupal-js-files\/s_extlink_5782474c1a78169542aa37281f63996b.js?628ca0084c981908","\/assets\/drupal-js-files\/popups-skin_c4e818d805fcb9b4673e9ae6392a0e77.js?628ca0084c981908","\/assets\/drupal-js-files\/s_update_e6cd2f33b322d3c24ad43d94e5ea78db.js?628ca0084c981908","\/assets\/drupal-js-files\/s_edge_more_4fe95d5173c4389e6f44d71d1c421b2e.js?628ca0084c981908","\/assets\/drupal-js-files\/s_user_fbc1c7581725cbaa52a6ad567a734af7.js?628ca0084c981908","\/assets\/drupal-js-files\/s_course_switcher_10a3232c153eab95753849d20bc0effc.js?628ca0084c981908","\/assets\/drupal-js-files\/s_course_materials_folders_b9fa7d6438ac3296a62495df54bbd777.js?628ca0084c981908","\/assets\/drupal-js-files\/s_course_3510a6f74cbe6849692f832b0579ace0.js?628ca0084c981908","\/assets\/drupal-js-files\/pendo_2706671c76c068330442ffcf0ee1cba2.js?628ca0084c981908","\/assets\/drupal-js-files\/s_app_launcher_43fa177dcabfb1a07259a664f71b959d.js?628ca0084c981908","\/assets\/drupal-js-files\/s_app_menu_c9528fbd17ccde4ca1cd56d7e97db183.js?628ca0084c981908","\/assets\/drupal-js-files\/s_common_iframe_use_relative_url_890260f5836f2991e0d8f2b8ddf0ee1f.js?628ca0084c981908","\/assets\/drupal-js-files\/s_attachment_9c28b6be590a5917e9ceacc97f1fee78.js?628ca0084c981908","\/assets\/drupal-js-files\/fullcalendar_6810da2258a3e1b903ff9a7b9526fab9.js?628ca0084c981908","\/assets\/drupal-js-files\/s_fcalendar_e7fa403740a5269100ec65f61bbb1e6e.js?628ca0084c981908","\/assets\/drupal-js-files\/calendar_view_30c5c9e5dc9497700d991820ed85464d.js?628ca0084c981908","\/assets\/drupal-js-files\/s_event_upcoming_9bee82029927eb2f8d980637e440697e.js?628ca0084c981908","\/assets\/drupal-js-files\/jquery_6e3c7337b630f48ae497f2aa7e3c8048.maxlength.js?628ca0084c981908","\/assets\/drupal-js-files\/mathquill_8dc54dd4b31b3f128b5c3cf050acd4d7.js?628ca0084c981908","\/assets\/drupal-js-files\/s_tinymce_mathquill_insert_e49e9aada3233716fa5a7eebab2f626e.js?628ca0084c981908","\/assets\/drupal-js-files\/ajaxfileupload_5826ccbad51943ddd9e8738edfdcd1f6.js?628ca0084c981908","\/assets\/drupal-js-files\/s_ajaxfileupload_195bd20de819f19fbb23f3e89216d1a5.class.js?628ca0084c981908","\/assets\/bundles\/js\/react-common\/react-common-9fca2f689083ee34f412.js?628ca0084c981908","\/assets\/drupal-js-files\/jquery_37e34865658194ce733fcbd3af93edab.a_form.packed.js?628ca0084c981908","\/assets\/drupal-js-files\/ajax_fbfcb96e5a6cda833a9d7fde9ebd10b9.js?628ca0084c981908","\/assets\/drupal-js-files\/theme_7d229e9a1db63494773f6d6ad04653b6.js?628ca0084c981908","\/assets\/drupal-js-files\/s_update_ajax_post_079164ca84c78dc96a9c93741f01ec20.js?628ca0084c981908","\/assets\/drupal-js-files\/s_comment_ajax_post_0fd0e4663d79758a7b5724a8739fdb75.js?628ca0084c981908","\/assets\/drupal-js-files\/s_course_course_switcher_e99ebcab4215acfda51e08e4f9cea0ae.tpl.js?628ca0084c981908","\/assets\/drupal-js-files\/s_course_ng_controller_e2598768ef12e2d77b29e04c9661bcde.js?628ca0084c981908","\/assets\/drupal-js-files\/s_grade_item_assignment_submission_247844a727cbb50d9ad1cfbe4c90e62f.js?628ca0084c981908","\/assets\/drupal-js-files\/tiny_mce_constants_fd69484c90657ae2a61a6d5cadf841d5.js?628ca0084c981908","\/assets\/drupal-js-files\/tiny_mce_src_f0a57f11069ad7e32921dbb45610a53a.js?628ca0084c981908","\/assets\/drupal-js-files\/en_ce82bcabf65905b08ba10b9e91bb8b2c.js?628ca0084c981908","\/assets\/drupal-js-files\/editor_template_src_fe5a3ceb64a6e280d6b42ece74b3b547.js?628ca0084c981908","\/assets\/drupal-js-files\/en_7ebb4737c292dfef43c37d5bdbd3b606.js?628ca0084c981908","\/assets\/drupal-js-files\/editor_plugin_97e2cf10a3e4e3fe74f9aaf06d62eb8d.js?628ca0084c981908","\/assets\/drupal-js-files\/editor_plugin_d7c757cd34eb3fc6d5b545c80a9ccdb3.js?628ca0084c981908","\/assets\/drupal-js-files\/editor_plugin_src_ddc4748bc0bd038fae1c08763314012b.js?628ca0084c981908","\/assets\/drupal-js-files\/editor_plugin_src_729d70bc1bcce24e76f7a9c1d7bce42d.js?628ca0084c981908","\/assets\/drupal-js-files\/editor_plugin_src_11f9c5ace9001a158a24faf892c39b5d.js?628ca0084c981908","\/assets\/drupal-js-files\/s_tinymce_c634ba4bb7c8820aa284991834032a75.js?628ca0084c981908","\/assets\/drupal-js-files\/editor_plugin_src_8fc511ee92c9094a33d5bcf794f966fe.js?628ca0084c981908","\/assets\/drupal-js-files\/editor_plugin_src_a3f98589de7075dd56949672f74dad36.js?628ca0084c981908","\/assets\/drupal-js-files\/editor_plugin_src_bfc58d1e3f11c80a88cbd714aea2a065.js?628ca0084c981908","\/assets\/drupal-js-files\/editor_plugin_src_014bc6abc75816e138fe249a96b6293a.js?628ca0084c981908","\/assets\/drupal-js-files\/editor_plugin_src_d11a3db9061c6755d768cf76768a5fa3.js?628ca0084c981908"]}); //--><!]]> sBrowserInfoSetCookie(); .boom-extension-active{cursor: crosshair !important} .boom-extension-active *:hover{cursor: crosshair !important} .boom-extension-hovered-element{outline: 2px solid rgba(130, 170, 210, .6) !important} .boom-extension-expanded-element{background: transparent !important;border: 0 !important;float: none !important;margin-left: auto !important;margin-right: auto !important;padding-left: 0 !important;padding-right: 0 !important;position: relative !important;max-width: initial !important;min-width: initial !important;width: 100% !important;} CaptureDrag to outliner or UploadClose Ok, done!PrivateGroupSaveCancel+Share to a new group+Share to a new groupPostCancelPostCancel Guide Center Help Center Search for articles General Help Quick Start Checklist onboarding guides What's New Feature Announcements 0 Help Center SUGGESTED ARTICLES General Help Kevin's Test - Don't Delete! What's New Quick Start Checklist % ×0

      HEHEH HAW

    1. Vail helped Morse develop a practical system for sending and receiving coded electrical signals over a wire, which was successfully demonstrated in 1844.

      Annotation for What hath God wrought? </br>· — — · · · · · — — </br>· · · · · — — · · · · </br>— — · · · — · · </br>· — — · · · · · · · — — — · · · · · — </br> The first long-distance telegraph message, printed in Morse code, was transmitted from Baltimore to Washington, D.C., on this day, May 24th, in 1844. #Annotate22 144/365 Image credit: National Museum of American History.

    1. Knuth recommended getting familiar with the program by picking up one particular part and "navigating" the program to study just that part. (See https://youtu.be/D1jhVMx5lLo?t=4103 at 1:08:25, transcribed a bit at https://shreevatsa.net/tex/program/videos/s04/) He seems to find using the index (at the back of the book, and on each two-page spread in the book) to be a really convenient way of "navigate" the program (and indeed randomly jumping through code, as you said), and he thinks that one of the convenient things about the "web" format is that you can explore it the way you want. This is really strange (to us) as the affordances we're used to from IDEs / code browsers etc are really not there

      I can't help but think that currentgen programmers are misunderstanding Knuth and anachronizing him, with their being a product of the current programming regime where most never lived in a world without structured programming, for example, when we hear "literate programming", we attempt to understand it by building off our conception of current programming practices and try to work out what Knuth could mean given widespread modern affordances as a precondition, when really Knuth is just advocating for something that approximates (with ink and paper) currentgen tooling, and is therefore in fact more primitive than our reference point which we are trying to understand as being capable of being improved upon, but Knuth's LP is an improvement nonetheless of something even more primitive further still.

    1. près avoir reçu en 1889 un brevet (Archives IBM)pour son tabulateur électrique (Electronic Tabulating Machine),Herman Hollerith met son appareil au service du recensementaméricain de 1890.

      Une des plus importantes utilisations des précurseur des ordinateurs du 19ème siècle: le recensement. La documentation et la connaissance d'une population est essentielle à son contrôle (et entre dans le paradigme du code donné par Kittler).

    1. Authorisation Response

      Can we do this with a request and response code block that we user everywhere? A separate section is not needed for both. A simple code block with a section explaining all params is good enough

    1. Songwriters areknown for compiling “hook books” full of lyrics and musical riffs theymay want to use in future songs. Software engineers build “codelibraries” so useful bits of code are easy to access. Lawyers keep“case files” with details from past cases they might want to refer to inthe future. Marketers and advertisers maintain “swipe files” withexamples of compelling ads they might want to draw from

      Nice list of custom names for area specific commonplaces.

    2. CODE is a map for navigating the endless streams of informationwe are now faced with every day. It is a modern approach to creatinga commonplace book, adapted to the needs of the Information Age.

      While he wants to think that CODE is a modern approach, is it really? I'm reasonably sure that most of these steps have been carried out by commonplacers for several hundred years. le sigh...

    3. , I’vedeveloped a simple, intuitive four-part method called “CODE”—Capture; Organize; Distill; Express.

      I'm sort of surprised that Forte hasn't trademarked this "method". Immediately on it's face it looks a lot like the general steps of note taking for a zettelkasten, or let's be honest, almost any note taking method. Nice to see that he's reminding people to do some distillation and expression using their notes however as this is where most people lose the thread.

    1. You can run snippets across an entire multisite network by Network Activating Code Snippets through the Network Dashboard. You can also activate Code Snippets just on the main site, and then individually on other sites of your choice.

      Multisite Guide of Code Snippets

    1. Animals are just a hack these outlier genes came up with—temporary containers designed to carry the genes and help them stay immortal

      But genes can’t talk to their animals, so instead they control them by having them run on specialized survival software.

      In simple animals, the software is an automated program that runs the animal on instinct. In more complex animals, the software also includes a number of feelings—higher-level behavior-manipulation tools like pain punishments, pleasure treats, and emotion manipulations.

      Imagine it as a control panel with 7 vertical sliders: HUNGER, THIRST, EXHAUSTION, HORNINESS, FEAR, PAIN, AGGRESSION.

      By sliding the animal’s feelings up and down, an animal’s software uses the feelings like reins to keep the animal’s goals and the genes’ goals perfectly aligned.

      All that is to say that the only purpose of genes is to survive. And they act as lines of code where each situation lead to certain action carried by the animal, if the hunger slide is up, then he knows he has to eat, if exhaustion is up, he knows he has to rest, and so on, just with the goal of surviving.

    1. Level 5: Stop the line. The highest level of code review comments. Borrowing the term from Toyota's manufacturing process this is when the code reviewer noticed something in the PR that signals a major defect.

      Stop the line - 5th type of MR comments

    1. jQuery-style syntax for manipulating the DOM

      This is 70+% of the reason why I end up ripping out jQuery from old/throwaway projects when I start trying to hack on them. The jQuery object model is really confusing (read: tries too cute/clever), and the documentation sucks, relatively speaking, and the code is an impenetrable blob, which means reading through it to figure out WTF it's supposed to do is a non-option.

    1. SciScore for 10.1101/2022.05.18.22275247: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">AND (randomized controlled trial[pt] OR controlled clinical trial[pt] OR randomized[tiab] OR placebo[tiab] OR drug therapy[sh] OR randomly[tiab] OR trial[tiab] OR groups[tiab] NOT animals[mh] NOT humans[mh]) AND 2020/01/01:2022/03/30</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Type of outcome measurements: Primary outcomes measurements: For anti-spike glycoprotein antibody (IgG) response and neutralizing antibody response, we will report Ratio of Geometric Mean (RoGM) and/or Ratio of Mean (RoM).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike glycoprotein antibody ( IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">anti-spike glycoprotein antibody geometric mean titre (GMT)/geometric mean concentration (GMC)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike glycoprotein</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sources include electronic database such as PubMed, Web of science, Cochrane (CENTRAL), Scopus, Google scholar, the key journals (vaccine and vaccines).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PubMed</div><div>suggested: (PubMed, RRID:SCR_004846)</div></div><div style="margin-bottom:8px"><div>Google scholar</div><div>suggested: (Google Scholar, RRID:SCR_008878)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Key words and syntax: The main search terms are “SARS-CoV-2 vaccine”, vaccine, “COVID-19 vaccine” and COVID-19 and “Coronavirus disease 2019” that will be searched in MeSH databases.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MeSH</div><div>suggested: (MeSH, RRID:SCR_004750)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Risk of bias assessment: Two reviewers independently will conduct quality assessment of primary studies by using checklist of quality assessment for interventional studies (Cochrane risk-of-bias tool).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cochrane risk-of-bias tool</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      As the strengths of this study, we will search several sources without language limitation to achieve the research goal. The sources include electronic databases such as PubMed, Web of Science, Cochrane Central Register of Controlled Trials (CENTRAL), Scopus, Google Scholar, the key journals (vaccine and vaccines). Trial registries, including ClinicalTrials.gov, WHO ICTRP, and ISRCTN, will be searched. In addition, “COVID-19 vaccine tracker and landscape” of WHO, “Cochrane vaccine mapping tool”, and the reference list of included primary will be searched. Also, the publication bias of primary studies will be evaluated. Eventually, we expect that our study notably advances the knowledge about the safety and efficacy of various COVID-19 vaccine platforms.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.16.22274315: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Participants gave informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Commercial (FLOQSwabs, Copan, Italy) and prototype (3D-printed; HP inc, Norway) NP and OP swab pairs were collected from each participant in a random order.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">QuantStudio Real-Time PCR Software (AB) was used for the presentation of the RT-PCR results.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AB</div><div>suggested: RRID:BDSC_203)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">16.1; descriptive statistics and plots were created in SPSS v. 26. P-values <0.05 were considered statistically significant.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      This study has some limitations. Testing was conducted on a low number of participants, and almost all the participants were SARS-CoV-2 positive, thus the study was not suitable for evaluating the specificity of the prototype. Furthermore, the usability of the prototype was not assessed. Thus, further testing is needed to determine the test-accuracy of 3D-printed swabs. One strength of the study is that we repeated testing with both swab types shortly after exposure and later in the course of infection; this enabled us to evaluate the performance of the prototype on samples with different viral loads. Because our study population consisted of a defined group with known exposure to SARS-CoV-2, we were able to include both symptomatic and asymptomatic individuals. Finally, sample collection techniques can affect the clinical sensitivity of the test. In our study, experienced personnel performed sampling, which reduced the risk of false negative results. To prevent swab shortages during future pandemics, or seasonal epidemics, caused by influenza or other viruses, 3D printing of swabs might help to maintain rapid, large scale diagnostic testing.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.19.492649: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animals: All animal studies were carried out under an institute-approved Institutional Animal Care and Use Committee (IACUC) protocol following federal, state, and local guidelines for the care and use of animals.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">For mouse studies, female 6- to 8-week-old C57BL/6J mice were purchased from the Jackson Laboratory (Bar Harbor, ME).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">For NHP studies, 8 outbred, Indian-origin, 4-5 year old female rhesus macaques (Macaca mulatta) were randomly allocated into 3 groups of 2 or 3 animals.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">106 PBMCs/well were resuspended in R10 media supplemented with anti-CD49d monoclonal antibody (clone: 9F10, BD)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD49d</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">anti-CD28 monoclonal antibody (clone: CD28.2, BD), and Golgi inhibitors monensin (Fisher Scientific, cat# NC0176671) and brefeldin A (Fisher Scientific, cat# 50-112-9757) and incubated at 37°C for 8 hours, then maintained at 4°C overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD28</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The next day, cells were surface-stained with antibodies against CD4 (PE-Cy5.5, clone: S3.5, Invitrogen), CD8 (AF647, clone: RPA-T8, BioLegend), CD45RA (FITC, clone: 5H9, BD), CCR7 (BV650, clone: G043H7, BioLegend), and aqua live/dead dye (Invitrogen, L34957), and subsequently fixed with BD CytoFix/CytoPerm (BD, 554714).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD4</div><div>suggested: (SouthernBiotech Cat# 9522-31, RRID:AB_2796861)</div></div><div style="margin-bottom:8px"><div>CD8</div><div>suggested: (SouthernBiotech Cat# 9536-31, RRID:AB_2796896)</div></div><div style="margin-bottom:8px"><div>CD45RA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CCR7</div><div>suggested: (BD Biosciences Cat# 563407, RRID:AB_2738187)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were further stained with antibodies against CD3 (APC-Cy7, clone: SP34-2, BD), CD69 (ECD, clone: TP1.55.3, Beckman Coulter), IFNγ (AF700, clone: B27, BioLegend), IL-2 (BV421, clone: MQ1-17H12, BioLegend), IL-4 (PE, clone: 8D4-8, BioLegend)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD69</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IFNγ</div><div>suggested: (Bio X Cell Cat# BE0245, RRID:AB_2687726)</div></div><div style="margin-bottom:8px"><div>IL-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>BV421</div><div>suggested: (BD Biosciences Cat# 562986, RRID:AB_2737933)</div></div><div style="margin-bottom:8px"><div>IL-4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse antigen-specific tetramer staining of peripheral blood cells: MHC-tetramer staining on mouse samples was performed using an RBD-PE tetramer specific for sequence VNFNFNGL (NIH Tetramer Core Facility at Emory University, cat# 54971), and antibodies against CD8a (APC, clone: 53-6.7, eBioscience), CD3 (APC-Cy7, clone: 17A2, BD), CD44 (PE-Cy7,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibodies against CD8a</div><div>suggested: (GeneTex Cat# GTX111860, RRID:AB_10623584)</div></div><div style="margin-bottom:8px"><div>CD3</div><div>suggested: (Abcam Cat# ab52305, RRID:AB_955118)</div></div><div style="margin-bottom:8px"><div>CD44</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>PE-Cy7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The detection antibody used was horseradish peroxidase (HRP)–conjugated goat anti-human IgG (H+L) (ThermoFisher, cat# SA5-10283) at a 1:2000 dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Thermo Fisher Scientific Cat# SA5-10283, RRID:AB_2868331)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, a HEK293T cell line overexpressing ACE2 and TMPRSS2 was seeded at a density of 1.2×104 cells/well overnight. 3-fold serial dilutions of heat inactivated serum samples were prepared and mixed with 50 µL of pseudovirus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene transcript analysis by Nanostring: For mouse studies, inguinal lymph nodes were harvested from immunized C57BL/6J mice at the indicated time points, processed into single cell suspensions, and lysed with RLT buffer (Qiagen, cat# 79216)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sample acquisition was performed on BD FACS Symphony and data were analyzed with BD FlowJo V10 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD FlowJo</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The next day, cells were surface-stained with antibodies against CD4 (PE-Cy5.5, clone: S3.5, Invitrogen), CD8 (AF647, clone: RPA-T8, BioLegend), CD45RA (FITC, clone: 5H9, BD), CCR7 (BV650, clone: G043H7, BioLegend), and aqua live/dead dye (Invitrogen, L34957), and subsequently fixed with BD CytoFix/CytoPerm (BD, 554714).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD CytoFix/CytoPerm</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells fixed in 1.5% formaldehyde were acquired on a BD FACS Symphony and data were analyzed with BD FlowJo V10</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Red blood cells were lysed in ACK lysis buffer (Quality Biological Inc., cat# no. 118156101).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Quality Biological</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transcriptional responses were assessed with nSolver software v4.0 (NanoString Technologies) and differential gene expression was carried out using ROSALIND software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>nSolver</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">NanoString statistical analysis was performed using Rosalind software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Rosalind</div><div>suggested: (Rosalind, RRID:SCR_006233)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.17.22275187: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To implement the genetic algorithm and solve the differential equations, Python is primarily used, supported by Python libraries, specifically numpy and scipy.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div><div style="margin-bottom:8px"><div>numpy</div><div>suggested: (NumPy, RRID:SCR_008633)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">It may be addressed by adding more genes representing a specific time interval such as [12] but this modification is not pursued for this experiment because of the limitation of scipy.integrate.odeint solver not accepting array of values as parameter.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>scipy</div><div>suggested: (SciPy, RRID:SCR_008058)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      As mentioned in Section 2.2.1, due to the limitation of scipy.integrate.odeint solver of not accepting a time-varying variable, an average trajectory is achieved. Figure 7 shows the actual daily cases against the predicted daily cases. It is noticeable how the trajectory produced by the ASQ-SEIR-NLIR model passes through the average of the actual data. This observation is valid for both country-level and citylevel. 3.3 Dynamics of COVID-19 Spread: The optimal parameters obtained from the genetic algorithm help describe the dynamics of the spread of COVID-19 at the country-level and at city-level. 3.3.1 Transition from Susceptible to Exposed: The parameters involved in this transition are the transmission or contact rate (β) and quarantine factor (Q), together with the nonlinear incidence rates behavioral factor (α) and disease-resistance factor (ϵ). Both regions of interest show relatively low compliance to minimum health standards yet relatively high disease-resistance rates, which may be attributed to increase vaccination efforts. This implies that there is high level of immunity but the high exposure rate is due to low compliance to minimum health standards. Both regions also differ in terms of contact rate but same quarantine factors. Quezon City has an average βQC = 3.12, which means higher probability of getting exposed to the virus, versus the βPH = 2 average for the whole country. However, the quarantine success spells the difference in terms of the total expected exp...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. The initial exchange of QR codes is assumed to be secure against man-in-the-middle attacks because the users can see which screens they are scanning. This allows each user to be sure that the QR code they scanned was provided by the person with whom they intend to exchange keys.

      no remote adds? this may be a dealbreaker, and the workaround will be... exchanging sceenshots, probably, like how people end up doing it for things like signal.

    1. Rather than a general distinction between the digital and the analogue we define the digital as everything that has been developed by, or can be reduced to, the binary, that is bits consisting of 0s and 1s. The development of binary code radically simplified information and communication creating new possibilities of convergence between what were previously disparate technologies or content.
    1. SciScore for 10.1101/2022.05.17.22275188: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Approval for this study was obtained from the Clinical Research Ethics Committee (02.06.2021, Decision no: 2021-10/14).<br>Field Sample Permit: This study was approved by the Turkish Ministry of Health Scientific studies council (2021-03-21T18_47_42).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.15.22275051: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was reviewed by the UCSF Institutional Review Board and given a designation of public health surveillance according to federal regulations as summarized in 45 CFR 46.102(d)(1)(2).<br>Consent: Written informed consent was obtained from all participants.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero-hACE2-TMPRSS2 cells form characteristic syncytia upon infection with SARS-CoV-2, enabling rapid and specific visual evaluation for CPE.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-hACE2-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All assays were done in the BSL3 facility at Genentech Hall, UCSF, following the study protocol that had received Biosafety Use Authorization.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Genentech</div><div>suggested: (Genentech, RRID:SCR_003997)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Consensus sequences were generated using the nCoV-2019 novel coronavirus bioinformatics protocol using the MinIon Pipeline.43 Lineage determination was done using the online Pangolin COVID-19 Lineage Assigner.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MinIon</div><div>suggested: (MinION, RRID:SCR_017985)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were performed using STATA/IC 16.1 (STATA Corporation, College Station, Texas, USA) and R version 3.3.2 (R Project for Statistical Computing, Vienna, Austria)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>R Project for Statistical</div><div>suggested: (R Project for Statistical Computing, RRID:SCR_001905)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Our study has some limitations. Unvaccinated individuals in our analysis were mostly enrolled prior to the emergence and global spread of the Delta lineage, whereas fully vaccinated individuals were almost exclusively enrolled once Delta was the dominant circulating lineage. Thus, we were unable to control for this as a potential confounder. However, previous studies have indicated that infections with Delta lineage viruses have higher peak viral loads30,39 and longer duration of shedding than pre-Delta lineages40,41. This suggests that we may have underestimated differences between vaccination groups, bringing our results from early infection in line with those from Puhach et al. In addition, index cases were from the list of SARS-CoV-2 positive cases at UCSF-affiliated medical centers in San Francisco and may not be representative of all SARS-CoV-2 infections occurring in the same jurisdiction. Furthermore, we were underpowered to analyze shedding dynamics during the pre-symptomatic and early symptomatic period and thus we may have missed the peak viral RNA load in some individuals and thus underestimated maximum values (Supp. Figure 1). Lastly, our study was likely underpowered to detect differences in overall infectious virus shedding duration between groups, though our comparison when restricted to participants with infectious virus (Table 2) is in line with the regression analysis in Figure 3. In summary, in addition to the protective effect of COVID-19 vaccines against...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.19.22275053: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Strengths and weaknesses: The event acted as a natural experiment whereby one group of individuals by chance experienced delayed contact tracing, enabling a comparison of their outcomes with concurrent, unaffected cases and contacts to assess the impact of contact tracing more generally. Having a a single national system collating all test results and a single national contact tracing system facilitated the study. Through record linkage we could identify successive generations of contacts and cases and describe key health outcomes associated with the delay in contact tracing; however, some of these outcomes were rare and it is possible that we did not have the power to detect a small difference in hospitalisation or mortality. Secondary transmission could only be estimated using the contacts reported by cases who met the contact definition11. These would not include unknown contacts; however, the similarity in the number of reported contacts between the two groups suggests that unknown contacts are also likely to be similar. Contact tracing was not completed for a minority of cases in the delay and control groups, so there are likely to be further transmission events that are unknown and not described. People who do not engage in contact tracing differ from those who do in terms of ethnicity and socioeconomic status; however, this is unlikely to differ between the two groups12,13,14. Completion of contact tracing was slightly lower in the delay group. This could have potentia...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.17.22275210: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Sequencing: Specimens were extracted as previously described [16, 17].</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Oxford Nanopore Technology GridION was used for sequencing, and reads were basecalled with MinKNOW.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MinKNOW</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      There are some limitations to this study. First, there is still a large proportion of genomes that failed sequencing. The reason for this is not always clear, however, successful sequencing is highly dependent on viral RNA load, and thus the failed sequences may be due to lower viral load. However, there is not sufficient evidence to determine the rate at which the failed sequences in the post 90-day positives may be due to reinfections with low viral load or a low-level persistence. It has been shown that residual slowly wanes over approximately a year after an infection [19], which is about the time that sequence proven reinfections spiked after the initial infection. Second, the vast majority of reinfections happened over a small period of time with the Omicron variant. It is clear that the circulating variants have a large impact on the likelihood of reinfection. The Omicron variant is immunologically distinct from prior variants that resulted in incomplete cross protection to Omicron [5]. Thus, as we surveil for reinfections, the likelihood at any given time will likely be dependent on similarity of circulating variants to prior variants. Similarly, although persistence of the initial genome is rare in the post 90-day positives currently, future variants may show a different propensity towards persistence. Continued sequencing is necessary to determine new trends that may arise. Lastly, we cannot obtain a true rate of reinfection compared to total cases with these data, ...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.13.22275049: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Ethical Approval and Informed Consent: The study was designed and performed according to the Helsinki declaration and all participants gave their written informed consent (Study protocol EX-2021-06438339-UBA DME#SSA_FFYB, Ethics committee of the Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires).<br>IRB: Ethical Approval and Informed Consent: The study was designed and performed according to the Helsinki declaration and all participants gave their written informed consent (Study protocol EX-2021-06438339-UBA DME#SSA_FFYB, Ethics committee of the Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-S-RBD antibodies were quantified using the Abbott Diagnostics SARS-CoV-2 IgG II Quant chemiluminescent microparticle immunoassay (CMIA) on an Architect i2000 SR and an Alinity I analyzer (Abbott Diagnostics, Abbott Park, Illinois, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-S-RBD</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To standardize the results to WHO binding antibody units (BAU), a correction factor for Abbott arbitrary units (AU) was applied where 1 BAU/mL equals 0.142 AU, as previously established by Abbott with the WHO international standard NIBSC 20– 136 [13-.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were carried out using the SPSS statistical software package release 23.0 (IBM SPSS Inc., Chicago, IL, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      This study has a limitation. It should be considered that serious adverse effects have been reported in a very low frequency and the small size of the analyzed sample might have influenced this aspect. In conclusion, both analyzed vaccine schemes were immunogenic and showed a high seroconversion rate. In addition, a significant correlation was found between higher anti-S-RBD IgG titers and a confirmed prior infection with SARS-CoV-2 for both schemes. Moreover, the heterologous scheme was also associated with a better humoral response. Finally, local and systemic adverse effects were scarce and mostly mild, demonstrating that both schemes are safe and well-tolerated. These findings should promote patients on dialysis to receive these immunization schemes.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.16.22275151: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The BIDMC institutional review board approved this study (2020P000361).<br>Consent: All participants provided informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, the packaging construct psPAX2 (AIDS Resource and Reagent Program), luciferase reporter plasmid pLenti-CMV Puro-Luc (Addgene) and spike protein expressing pcDNA3.1-SARS-CoV-2 SΔCT were co-transfected into HEK293T cells (ATCC CRL_3216) with lipofectamine 2000 (ThermoFisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: ATCC Cat# CRL-3216, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mixture was incubated at 37 °C for 1 h before adding to HEK293T-hACE2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-hACE2</div><div>suggested: RRID:CVCL_A7UK)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, the packaging construct psPAX2 (AIDS Resource and Reagent Program), luciferase reporter plasmid pLenti-CMV Puro-Luc (Addgene) and spike protein expressing pcDNA3.1-SARS-CoV-2 SΔCT were co-transfected into HEK293T cells (ATCC CRL_3216) with lipofectamine 2000 (ThermoFisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>psPAX2</div><div>suggested: RRID:Addgene_12260)</div></div><div style="margin-bottom:8px"><div>pLenti-CMV Puro-Luc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA3.1-SARS-CoV-2</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.14.22275075: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: An informed consent statement outlining the purpose and process and the right to refuse participation in the study was attached to the first page of the questionnaire.<br>IRB: For the regression analysis, a p-value of less than 0.05 was considered significant. 2.4 Ethical Approval: The study was conducted following the Institutional Research Ethics and Human Involvement Guidelines (Helsinki declaration).<br>IACUC: The Ethical Review Committee gave their approval for the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.3 Statistical analysis: Microsoft Excel 2019 and IBM SPSS Statistics version 25 were used to analyze the data.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Limitations: There is no study outside constraints, and this study has some limitations as well. Firstly, the study was cross-sectional in its nature, therefore, the causality of factors could not be established. In this regard, a longitudinal study is required to better understand the practice of self-medication among COVID-19 recovered patients. Secondly, the study employed an online-based self-reporting method, which could have been influenced by a variety of biases, including perceived benefits and episodic memory biases. Thirdly, due to the inflexibility of reaching out to persons who had recovered from COVID-19 and their refusal to engage in this study freely, the study enrolled only a few participants.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.17.22275034: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Informed consent was verbally obtained from all participants and was documented in their electronic medical record to prevent infection transmission, written informed consent was not obtained.<br>IRB: The ethics board of the University of Tsukuba Hospital approved the study (approval number: R03-042), including the method of obtaining informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      This study has some limitations. First, the samples were collected at one site in Japan, and most samples were collected soon after symptom onset. The sample size for asymptomatic individuals might have been insufficient. Second, the assessment of lateral flow device results can vary among examiners [27]. Third, the reference RT-PCR examinations were performed with frozen samples, and the storage and transportation processes may have affected the test results. In addition, study samples were collected from the nasopharyngeal tract, and anterior nasal samples were not analyzed. In conclusion, the current study showed that the QuickNavi-COVID19 Ag test had a high diagnostic performance for the detection of SARS-CoV-2 Omicron sublineages BA.1 and BA.2 in nasopharyngeal samples.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.18.22275138: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Those households were visited from the end of October to mid-December 2021, and the occupants were invited to participate in a study that involved answering a first questionnaire and providing a blood sample to measure IgG antibodies against SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-Human IgG, HRP-linked antibody was then used to recognize the bound IgG.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Human IgG</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.19.22272842: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Since all data are de-identified and fully compliant with HIPAA, institutional review board/ethics committee approval was not required for this study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The analytic file was created and all analyses were conducted using SAS software (version 9.4, SAS Institute Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Limitations: Limitations of this study include that information on viral load and symptoms, variables that may predict severe COVID-19,49-51 are not captured in claims data. Moreover, a reason that at least some EUA-eligible patients were untreated may be that they had less severe disease, although social and cultural factors have also been reported to play a role in the decision for treatment with mAbs.52 If untreated patients had less severe disease than treated patients, the residual confounding would likely bias results against CAS+IMD. Another limitation is that several important variables such as BMI and COVID-19 vaccination status are not well captured in claims data; when this study was conducted, approximately 70% of the population had received 1 dose and 60% had received 2 doses. Residual confounding is likely, and if unvaccinated patients with higher BMIs are likely to have worse disease requiring treatment, it could result in underestimation of the effectiveness of CAS+IMD. We were also not able to distinguish between the subcutaneous and intravenous administration of CAS+IMD. Finally, the study period did not overlap with emergence of the Omicron variant, although CAS+IMD is not expected to be active against Omicron,53 as in vitro data indicate CAS+IMD has markedly reduced neutralization activity against this variant.54,55


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.18.492546: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed once and incubated with a PE-labelled goat anti-human IgG secondary antibody (Thermo Fisher Scientific 12-4998-92) at a final concentration of 2.5μg/mL of 30 minutes at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Membranes were blocked in 5% non-fat milk for 1 hour, washed twice with TBS-T, incubated with rabbit anti-SARS-2-S at 1:2000 (Sino Biological 40591-T62) in 1% non-fat dry milk for 1 hour, washed twice in TBS-T and incubated in the presence of a goat HRP conjugated anti-rabbit secondary IgG antibody (1:10000; Abcam 6721).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-2-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HRP conjugated anti-rabbit secondary IgG</div><div>suggested: (Abcam Cat# ab6721, RRID:AB_955447)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Membranes were stripped and re-blotted in the presence of an anti-GAPH antibody as a loading control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-GAPH</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometric data was acquired using an LSRII and data analyzed using FlowJo 10.2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A heatmap was generated using GraphPad Prism (GraphPad Software, San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.15.22275071: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We removed the pre-defined English, and Japanese stop words in the Python packages NLTK [28] and SpaCy [29], and tokenized all collected vaccine-related tweets using the Python package SpaCy into unigrams or bigrams for statistical analysis, as in the work of Kwok et al. [26].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A Python package scikit-learn was used to determine the best number of topics.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>scikit-learn</div><div>suggested: (scikit-learn, RRID:SCR_002577)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      We admit that our research might have some potential limitations: (1) the imbalance of the demographics of Twitter users in Japan [49] may cause bias in the results; (2) status of the user on a certain day (at home or not, other events on that day, etc.) may also bias the dataset [50]; (3) due to the lack of a reliable public model for sentiment analysis in the Japanese language, the cloud service AWS was used for sentiment analysis; (4) filtering keywords may include irrelevant or missing related tweets; (5) anti-vaccine tweets, especially rumors, were not distinguished or analyzed separately in this study. However, feature works can be combined with classical surveys to train the sentiment analysis model and model to distinguish rumors from tweets to overcome these limitations. This retrospective study aimed to determine the reasons for the fast vaccination process in Japan, which might be instructive for propelling worldwide vaccination towards infectious diseases. In conclusion, our work indicated that awareness of the danger of COVID-19 increased the willingness to be vaccinated; with a sufficient supply of vaccines, effective reservation information delivery might provide more opportunities for people to be vaccinated. Models measuring vaccine hesitancy might also need to add efficiency in delivering reservation information as a metric. Based on our findings, we recommend public health policymakers and the government to share fair and prompt information about the infect...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.17.22275154: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Participant recruitment and study design: Women at two tertiary care hospitals were approached for enrollment in an Institutional Review Board (IRB)–approved (protocol #2020P003538) COVID-19 pregnancy biorepository study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Participant recruitment and study design: Women at two tertiary care hospitals were approached for enrollment in an Institutional Review Board (IRB)–approved (protocol #2020P003538) COVID-19 pregnancy biorepository study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">mouse anti-human detection antibodies were added to detect antigen-specific isotype titer (Southern Biotech).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>mouse anti-human detection antibodies</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human detection</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antigen-specific isotype titer ( Southern Biotech) .</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">18 A pseudovirus encoding Omicron Spike was produced by transfecting 293T cells with an Omicron Spike expression plasmid, a lentiviral backbone encoding CMV-Luciferase-IRES-ZsGreen and lentiviral helper plasmids.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: KCB Cat# KCB 200744YJ, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: Statistical analysis was performed in R (version 4.0.0) or GraphPad Prism (version 8.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.18.22275209: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics statement: Ethical approval was obtained through The Medical Research Ethics Committee Utrecht for both the 50+ population cohort (NL74843.041.21, EudraCT: 2021-001976-40), and for the adolescent and adult cohort (12-60 years) (NL76440.041.21, EudraCT: 2021-001357-31).<br>Consent: All participants provided written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">A linear mixed effects regression model with a random intercept per participant was used to determine the effect of timepoint, age and sex on S1 IgG concentrations using lme4 (version 1.1.28 [17]).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Persons with serological evidence of a SARS-CoV-2 infection history (i.e., seropositive to Spike S1 at Pre-vacc) and/or a self-reported positive SARS-CoV-2 test performed by local health authorities prior to their vaccination schedule were analysed separately.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunoglobulin G detection: Total immunoglobulin G (IgG) antibody concentrations to Spike S1 and Nucleoprotein were measured simultaneously using a bead-based assay as previously described [12].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Total immunoglobulin G (IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IgG concentrations were expressed as binding antibody units per mL (BAU/ml) using 5-parameter logistic interpolation of the International Standard for human anti-SARS-CoV-2 immunoglobulin (20/136 NIBSC standard) [13].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 immunoglobulin</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses: All statistical analyses were performed in RStudio (version 4.1.3) [16].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RStudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.17.22275235: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the UCSF Committee on Human Research (IRB 20-33000) and all participants provided written informed consent.<br>Consent: The study was approved by the UCSF Committee on Human Research (IRB 20-33000) and all participants provided written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Participants were excluded who were pregnant (to reduce confounding due to expected changes during pregnancy) or had significant cardiopulmonary disease including congenital heart disease, heart failure, myocardial infarction, or heart surgery.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Samples were assayed blinded with respect to patient and clinical information, and assay performance was consistent with the manufacturer’s specifications.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Design: As we have previously reported, we defined a composite symptom variable for cardiopulmonary PASC including chest pain, dyspnea, or palpitations in the preceding 2 weeks prior to the study visit;7 all participants had new symptoms, were more than 3 months after SARS-CoV-2 infection, and did not have alternative cardiac disease to explain their symptoms, consistent with the WHO definition of PASC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PASC</div><div>suggested: (PASC , RRID:SCR_016642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">REDCap was used for data entry.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using STATA version 17.1 and additional visualization was done using R version 4.2.0 using the ggplot2 package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Others have attributed exercise limitations to ventilatory inefficiency from pulmonary vasculopathy,18 respiratory abnormalities,19 obesity and differences in cardiorespiratory fitness29 and deconditioning.20, 21 Impaired oxygen extraction at the peripheral level (assessed using invasive CPET) has also been suggested to explain reduced exercise capacity among those with PASC at 11 months after infection by Singh et al.31 However, they describe stopping CPETs once RER was greater than 1.10 or heart rate was >85% predicted, which is below maximal exercise for most individuals and does not allow evaluation of chronotropic incompetence. They hypothesize that autonomic regulation of microcirculatory function may be one mechanism by which SARS-CoV-2 may alter oxygen extraction during exercise.32 Others have hypothesized that IL-6 (which may be elevated in PASC)33 functions as a myokine that regulates energy allocation during exercise.34 We did not find differences in the VO2 work slope, a noninvasive correlate of peripheral oxygen extraction, but we did not measure peripheral oxygen extraction since we did not perform invasive CPET. Mancini et al and others have found that dysfunctional (rapid, erratic) breathing or exercise hyperventilation may contribute to symptoms of persistent dyspnea in PASC.35–37 In contrast, we did not observe dysfunctional breathing in any participant. Although not a universal finding, several other groups have also reported chronotropic incompetence in PA...


      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04362150</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Long-term Impact of Infection With Novel Coronavirus (COVID-…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.18.492441: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, we extracted the corresponding pathways from Kyoto Encyclopedia of Genes and Genomes dataset (KEGG) for these selected genes [26].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.13.22274960: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was exempt from review by the New England Institutional Review Board (#1-9757—1).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      The results of this study should be interpreted in light of several limitations. First, there remains the potential for residual confounding by unmeasured variables. Second, identifying the primary outcome of medically-attended COVID-19 identified via the ICD-10 U-code for COVID-19 diagnosis in the inpatient or outpatient setting has not been previously validated specifically within the HealthVerity database. However, a recent study in the US Veterans Affairs database estimated the positive predictive value (PPV) of the ICD-10 code U07.1 in all settings (inpatient, outpatient, and emergency department/urgent care) to be 84.2% [36], which supports the robustness of this outcome and also cautiously noting the high PPV dependency associated with high disease prevalence within a pandemic setting. Furthermore, the analysis of an alternative definition of medically-attended COVID-19 requiring the presence of an antigen or polymerase chain reaction test produced an effect estimate slightly further from the null, thereby confirming the hypothesis that misclassification of the primary outcome would be non-differential between vaccine groups, with the resulting bias to be towards the null [37]. The difference in the HR between the base-case U code definition and the alternative definition requiring testing (0.05) is in line with our bias analysis based on the PPV estimate (see supplementary text and Figure S1). Additionally, in a real-world study of Ad26.COV2.S using the HealthVerity d...


      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT05366322</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Study to Compare mRNA-1273 Versus BNT162b2 COVID-19 Vaccin…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. In 1863 he finished the code of the laws of war for which he isprobably best known, published under Lincoln's signature as GeneralOrders, No. 100, of the Union Army.

      LIEBER CODE

    1. SciScore for 10.1101/2022.05.18.492452: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: The animals were infected at the FGBU (Federal State Budgetary Institution) Central Research Institute No. 48 of the Russian Ministry of Defense, Sergiev Posad, Russia.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Reproductive toxicity in female rats: The reproductive toxicity of the vaccine was studied in female (n=60) and male (n=30) outbred rats.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody titers were expressed as log base 2 (Log2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Log2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An immunohistochemical study was performed to immunotype infiltrated cells in the lungs using antibodies against the T-lymphocyte marker (CD3 — Cell Marque, 103-R94, Rocklin, California, USA) and macrophages M2-phenotype (CD163 MsmAb —</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies against vascular endothelial cells (CD31 Mon. mouse – Cell Marque, JC-70, Rocklin, California, USA) were also used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD31</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For immunohistochemical evaluation of the coronavirus proteins (S- and N-proteins), SARS-CoV2 spike (Genetex, GTX135356, Irvine, California, USA) and SARS-CoV2 nucleocapsid (Invitrogen, MA1-7404, Waltham, Massachusetts, USA) antibodies were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GTX135356</div><div>suggested: (GeneTex Cat# GTX135356, RRID:AB_2887482)</div></div><div style="margin-bottom:8px"><div>SARS-CoV2 nucleocapsid</div><div>suggested: (HistoSure by Synaptic Systems Cat# HS-452 111BT, RRID:AB_2891263)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2 accumulation titer in the lungs was determined using the negative colonies method on the Vero C1008 cell culture.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero C1008</div><div>suggested: ECACC Cat# 85020206, RRID:CVCL_0574)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animals & Ethics Statement: BALB/c and C57BL/6 mice used in the study were obtained from the Stolbovaya branch of the FSBI SCBT FMBA (Scientific Center of Biomedical Technologies of Federal Medical and Biological Agency) of Russia.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">C57/ black mice (n=22) were immunized intraperitoneally twice at a dose of 5 or 20 μg or 40 μg /animal (n=7 per group) or PBS (n=8) over a 21-day period.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57/</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animal husbandry was compliant with each facility’s SOPs and sanitary and epidemiological rules SR 2.2.1.3218-14 “Sanitary and Epidemiological Requirements for the Device, Equipment and Maintenance of Experimental Biological Clinics</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Experimental Biological</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Using a computer video system (IBM PC + microscope Leica DM 1000, Leica Camera, Wetzlar, Germany) and the ImageScope-M software package (Systems for Microscopy and Analysis, Moscow, Russia), the “airiness” parameter, specific area of the histological section occupied by air and free from infiltration or exudate from the alveolar space, was determined in a semi-automatic mode.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageScope-M</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: The obtained data were analyzed with Microsoft Office Excel 2010 (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Office Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(Microsoft, Redmond, Washington, USA) and GraphPad Prism v6.01 software (GraphPad Software, San Diego, California, USA) for geometric mean, standard deviation, arithmetic mean, and standard errors.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT05270954</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety, Tolerability and Immunogenicity of Recombinant COVID…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.18.492443: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This dataset contains the physical interactions between proteins that are collected from the Biological General Repository for Interaction Datasets (BioGRID) Chatr-Aryamontri et al (2017), Agile Protein Interactomes Data analyzer (APID) Alonso-Lopez et al (2019), Homologous interactions (Hint) Patil et al (2005), Human Integrated Protein Protein Interaction reference (HIPPIE) Alanis-Lobato. et al (2016) and Huri Luck et al (2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioGRID</div><div>suggested: (BioGrid Australia, RRID:SCR_006334)</div></div><div style="margin-bottom:8px"><div>Human Integrated Protein Protein</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.17.492220: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Dataset collection: The information on antibodies S24-223, P2B-1E4, 2-7, LY-CoV1404, XG005, XG031, and COV2-2268 were compiled in our previous study [12], whereas the information on XGv042, XGv264, XGv265, and XGv266 were compiled in CoV-AbDab [38].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>LY-CoV1404, XG005</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Allele assignment of IGHV2-5/IGLV2-14-encoded RBD antibodies: For antibodies P2B-1E4, XG005, and XG031, the allele information was obtained from the original publications [14, 16].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>XG031</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All “ambiguous” allele assignments in this study came from antibodies that do not have nucleotide sequence information available, namely XGv264, XGv265, and XGv266.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>XGv266</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Somatic hypermutations were identified by IgBlast [25].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgBlast</div><div>suggested: (IgBLAST, RRID:SCR_002873)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis of CDR H3 sequences: Sequence alignment was performed using MAFFT [40].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence logos were generated by WebLogo [42].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>WebLogo</div><div>suggested: (WEBLOGO, RRID:SCR_010236)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. Overall, if speed is your primary concern and you’re on a budget, then Circle CI is the clear choice. If you’re not looking to run a ton of builds each month and your code is already in Github, then Github Actions can offer similar performance with the added convenience of having everything under one service. Even though we liked Travis better, our main criteria was value, and since you can’t use Travis for free after the first month, GitLab was able to grab the third slot, despite it being weaker in almost every other category.

      4 CI free tier comparison: * Quality of Documentation * Compute Power * Available Disk Space * Free Build Minutes * Speed and Performance

    1. “By the way,” she wrote, “in the new code of laws which I suppose it will be necessary for you to make, I desire you would remember the ladies, and be more generous and favorable to them than your ancestors. Do not put such unlimited power into the hands of the husbands. Remember all men would be tyrants if they could.” She went on, “If particular care and attention is not paid to the ladies, we are determined to foment a rebellion, and will not hold ourselves bound by any laws in which we have no voice or representation.”

      —Abigail Adams, March 1776, in a letter to her husband John Adams serving in the Continental Congress

      especially:

      all men would be tyrants if they could.

    1. Manton says owning your domain so you can move your content without breaking URLs is owning your content, whereas I believe if your content still lives on someone else's server, and requires them to run the server and run their code so you can access your content, it's not really yours at all, as they could remove your access at any time.

      This is a slippery slope problem, but people are certainly capable of taking positions along a broad spectrum here.

      The one thing I might worry about--particularly given micro.blog's--size is the relative bus factor of one represented by Manton himself. If something were to happen to him, what recourse has he built into make sure that people could export their data easily and leave the service if the worst were to come to happen? Is that documented somewhere?

      Aside from this the service has one of the most reasonable turn-key solutions for domain and data ownership I've seen out there without running all of your own infrastructure.

    1. SciScore for 10.1101/2022.05.17.22275027: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was reviewed and approved by the institutional review boards of all participating institutions listed in Table S1.<br>Consent: All patients or their legally acceptable representatives provided written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Pregnant, possibly pregnant, or breastfeeding women were also excluded.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Study design: Patients with mild-to-moderate COVID-19 or asymptomatic SARS-CoV-2 infection were randomized (1:1:1) to receive ensitrelvir fumaric acid tablet 125 mg, 250 mg, or matching placebo.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Randomization and blinding: Randomization of patients was performed using an interactive response technology system.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Statistical analyses: To compare change from baseline in SARS-CoV-2 viral titer between each treatment group and the placebo group, 11 patients per group with COVID-19 were required to provide 82.3% power, assuming a difference of 2.5 log, a common SD of 2.2 log, and a 2-sided significance level of 10%.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses were performed using SAS version 9.4 (SAS Institute, Inc., Cary, NC, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SAS Institute</div><div>suggested: (Statistical Analysis System, RRID:SCR_008567)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      This study has some limitations. First, the small sample size and high vaccination rate limit concrete conclusions to be drawn from analyses of the clinical outcomes, such as COVID-19 symptoms including respiratory symptoms and disease exacerbation. Second, most of the enrolled patients were infected with the SARS-CoV-2 Delta variant. Our in vitro study results suggested that ensitrelvir has antiviral activity against the Omicron variant, which is the most predominant SARS-CoV-2 variant at the time of publication (12). Thus, the clinical efficacy of ensitrelvir against the Omicron variant or future variants of concern needs to be assessed in the subsequent part of this study. In addition, statistical analyses in subgroups, such as minor patients and asymptomatic patients, were not feasible owing to the limited number of patients. Further assessment of the safety and clinical efficacy of ensitrelvir in subsequent clinical studies is warranted. In conclusion, treatment with 5-day oral administration of ensitrelvir demonstrated a rapid clearance of SARS-CoV-2 and was well tolerated in patients with mild-to-moderate COVID-19 or asymptomatic SARS-CoV-2 infection. The results support further clinical development of ensitrelvir through large-scale clinical studies for the treatment of mild-to-moderate COVID-19 or asymptomatic SARS-CoV-2 infection.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.17.22274980: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the Mass General Brigham institutional review board (protocol numbers: 2021P001235, 2019P002526 and 2017P000336).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      The limitations of our study include its observational nature, retrospective design, lack of ability to detect asymptomatic breakthrough infections and possible differences between the tixagevimab/cilgavimab and control groups that could have influenced the rate of breakthrough infection. Despite these limitations, our study adds evidence of the efficacy and safety of tixagevimab/cilgavimab for pre-exposure prophylaxis in vaccinated SOTRs during the Omicron wave.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.16.22275165: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The trial is registered at www.clinicaltrials.gov (#NCT03442309), received IRB approval from the New York School of Medicine Institutional Review Board (#i17-00578), and has a published study protocol [9].<br>Consent: All students in enrolled schools were eligible for the study if they provided parental informed consent and child assent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">A cluster randomized trial, schools were randomly allocated to receive each intervention.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT03442309</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Comparative Effectiveness of School-based Caries Prevention</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.16.22274587: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: The process for recruitment, data collection, and sample processing has been described previously [93–95].</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Experimental samples were randomized across the platform run with QC samples spaced evenly among the injections.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For metabolite identification, raw data was extracted, peak-identified and QC processed using Metabolon’s hardware and software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Metabolon’s</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">4.9 Pathway annotation and filtering: Metabolites were annotated using Metabolon’s ‘sub-pathway’ groups, lipids were annotated by lipid classes, and proteins were annotated using signaling pathways from Kyoto Encyclopedia of Genes and Genomes (KEGG) [17].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">4.10 Multi-Omic network inference: A partial correlation-based Gaussian graphical model (GGM) was computed using the GeneNet R package [106] to infer a multi-omic network.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GeneNet</div><div>suggested: (GeneNet, RRID:SCR_007678)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Our findings are based on a study design with several limitations. (1) Samples in each ARDS group were collected years apart, which may cause variation in the molecular profiles due to differences in sample collection protocols and duration of storage. (2) The number of samples in each ARDS group is limited and imbalanced, with 43 COVID-19 samples and 24 bacterial sepsis samples, which reduces statistical power. (3) Our findings are based on molecules measured in plasma; thus, the measurements may not be representative of the site of ARDS, i.e., the lungs. (4) Our results are based on statistical associations, and further experiments are needed for validation as well as mechanistic and causal insights. In summary, we presented a first report on the molecular comparison between two ARDS etiologies – COVID-19 and bacterial sepsis. Our study is a step toward solving two pertinent clinical challenges associated with ARDS: the identification of novel therapeutic options, and the delineation of heterogeneous pathophysiological manifestations within the ARDS [38]. Even though for COVID-19 ARDS, a few partially effective immunotherapeutic options have been identified in anti-IL-6 therapy and JAK inhibitors, treatment remains a challenge for bacterial sepsis-induced ARDS. Using an inter-ARDS comparison, we highlighted therapeutically relevant signaling and metabolic pathways for ARDS of different etiologies. Using an intra-ARDS analysis, we identified molecular signatures characterizi...


      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04280588</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Withdrawn</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Fingolimod in COVID-19</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04467840</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Opaganib, a Sphingosine Kinase-2 (SK2) Inhibitor in COVID-19…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04414618</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Study of Opaganib in Coronavirus Disease 2019 Pneumonia</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.16.22275163: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Individuals provide written, informed consent for collection of demographic and clinical variables as well as blood for biobanking on up to 5 occasions every 6 months</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plate containing the samples and standard curves were then incubated for 30 minutes at room temperature, washed, following which MSD SULFO-TAG-labelled goat anti-human IgG secondary antibody was added at a concentration of 1ug/ml and the plate was further incubated for one hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These kits comprise 96 well plates, precoated with antigens, proprietary blocker, diluent, wash buffer, detection antibody, read buffer, control sera and reference standard.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigens,</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In addition, assay performance was compared with the Abbott SARS-CoV-2 IgG assay and the Abbott SARS-CoV-2 IgG II assay, chemiluminescent microparticle immunoassays (CMIA) (Abbott laboratories, IL, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Although the CEPHR COVID19 Serology Assay has many advantages, it is not without limitations. The assay employs RBD derived from the Wuhan-Hu-1 reference strain of SARS-CoV-2. Although the test has been validated in convalescent plasma from individuals with confirmed SARS-CoV-2, these individuals were infected with the variants circulating in the first wave of infections in early 2020 and the performance of this assay against the different SARS-CoV-2 variants of concern (VOCs) that have emerged since is still under investigation. In addition, the vaccinated population was relatively small, with the majority of individuals less than 3 months from second dose vaccine. Given waning of post vaccine protection22, sensitivity of the assay may alter as time post vaccination increases. Additionally binding assays do not evaluate antibody function, such as neutralising capacity or antibody effector function, although these gold standard assays are time consuming and expensive and do not lend themselves to high throughput. However, correlation of the CEPHR COVID19 Serology Assay with these gold standard functional assays is ongoing. Despite these limitations, the CEPHR SARS-CoV-2 Serology Assay is a robust, customisable, multiplex serologic assay for the detection of several different IgG specific to SARS-CoV-2, with multiple potential real world applications and performance characteristics that support its further development for use in both research and clinical settings.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.17.492310: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We added horseradish peroxidase (HRP)-conjugated goat anti-human IgG (1:5000, SouthernBiotech #2016-05) to detect the binding in COVID-19 patients’ serum samples, HRP-conjugated goat anti-mouse IgG (1:5000, Sigma-Aldrich, #AP124P) to detect the binding in mouse serum samples, HRP-conjugated goat anti-rabbit IgG (1:5000, ThermoFisher Scientific, #31460) to detect the binding in commercial anti-spike antibodies, for 1 h at 37 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (Millipore Cat# AP124P, RRID:AB_90456)</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: (Thermo Fisher Scientific Cat# 31460, RRID:AB_228341)</div></div><div style="margin-bottom:8px"><div>anti-spike</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibody–virus mixture was then added to monolayers of Vero E6 cells (CRL-1586, ATCC, USA) in 96-well microtiter plates and incubated further for 72 h at 5% CO2 at 36 ± 2 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice (strain FVB) were immunized by standard methods using purified epitope-scaffolds admixed with sigma adjuvant (RIBI adjuvant) at a 1:1 ratio as described by the manufacturer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FVB</div><div>suggested: RRID:IMSR_TAC:fvb)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein expression and purification: We obtained the genes encoding the designed proteins in pET28a vectors from GenScript (Genscript.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET28a</div><div>suggested: RRID:Addgene_139598)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We optimized the chimeric structures using Chiron and Gaia.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gaia</div><div>suggested: (GAIA, RRID:SCR_009182)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We solved the crystal structure by the molecular replacement method using the apolipoprotein E amino-terminal domain structure (1BZ4) as a search model in the PHENIX software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PHENIX</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Several iterations of model building in COOT program and refinement in the PHENIX program were done to complete the structure.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pymol software was used for all the structural analysis and figures.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pymol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We subsequently used the program DAMMIN, part of ATSAS suite, for ab initio low resolution shape determination.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ATSAS</div><div>suggested: (ATSAS, RRID:SCR_015648)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, energy minimization of the dimer was done using the YASARA server.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>YASARA</div><div>suggested: (YASARA, RRID:SCR_017591)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics and reproducibility: We performed all statistical analyses by unpaired two-tailed Student’s t-test using GraphPad Prism 8 v8.2.1 software and Microsoft Excel v16.49.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used GraphPad Prism 8 version 8.2.1 and Adobe Illustrator to draw and assemble the figures.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Adobe Illustrator</div><div>suggested: (Adobe Illustrator, RRID:SCR_010279)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      A limitation of our study is that only linear epitopes were included in the design. Conformational epitopes could be included in further optimization and future designs for improved response. Here, we conceptually demonstrated the applicability of these epitope-scaffolds in detecting epitope-specific antibodies from serological samples. ED2-based ELISA was used to detect IgG antibodies in serum samples from RT-PCR confirmed COVID-19 patients and pre-pandemic samples. Most COVID-19 patients showed strong reactivity against ED2. All pre-pandemic serum samples remained unreactive. Some samples in the COVID-19 group showed low OD readouts similar to healthy samples, suggesting a lack of or a weak seroconversion64,68,69. Next steps may involve testing cross reactivity with patient samples of other coronaviruses. When available, studies may also include the COVID-19 positive samples with known times from symptom onset for better analysis of seroconversion. Nonetheless, our results confirm the usefulness of these epitope-scaffolds for ELISA. We also show the extension of the conventional detection assays to a user-friendly, magnetic nanoparticle-based ELISA approach suitable for a rapid detection of epitope specific antibodies by coupling epitope-scaffolds to magnetic beads. Examples are shown to highlight the utility of epitope-scaffolds; assay optimization may be required before adopting it to specific needs. The magnetic nanoparticle-based ELISA assays are simple to perform and v...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.16.22275074: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was approved by the Institutional Ethics Committee of International Center for chemical and biological Sciences (ICCBS) and institutional review board of the Indus Hospital (Sector 39, Karachi, Sindh, Pakistan).<br>Consent: All study participants provided written informed consent before enrolling in the clinical trial.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Patients were excluded if they had any of the following: (1) previous confirmed SARS-CoV-2 infection; (2) moderate or critical COVID-19 infection with (a) respiratory failure and requiring mechanical ventilation, (b) shock, or (c) other organ failure requiring intensive care unit (ICU) support; (3) severe primary health conditions associated with cardiovascular, cerebrovascular, pulmonary, hepatic, renal, endocrine and hematological diseases, hematopoietic system (above grade II of cardiac function; ALT & AST are 1.5 times higher than the normal value; Creatinine above the upper limit of normal value) and mental illness or serious diseases affecting their survival, such as cancer or AIDS; (4) administered other antiviral, antibiotics, cough relieving and antihistamine medications within 3 days prior to the visit (including β2 receptor agonists, anticholinergic agents, theophylline, glucocorticoids, cough expectorant and other TCM); (5) history of drug or food allergy; (6) pregnancy, lactating, or fertile women who were planning to conceive in 3 months; and (7) participated in another clinical study in the past 1 month.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">This phase 2-3, double-blind, randomized, placebo-controlled clinical trial evaluated the efficacy and safety associated with the use of JHQG among nonhospitalized COVID-19 adult Pakistani patients with mild symptoms.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Patients and investigators in this trial were blinded to the treatment allocation until the completion of the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">2.2 Sample Size Calculation: The sample size was based on detecting a 20% difference in recovery from COVID-19 related symptoms.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was performed using SPSS (version 23.0; IBM, NY, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Various limitations of this trial should be noted. The basic reason for dropout was that the subjects were unable or unwilling to continue the clinical trial and voluntarily requested to withdraw The study included only COVID-19 patients of Pakistani race, and may limit the geographic generalizability of the findings. This study also excluded patients with severe underlying medical conditions, who are at particularly heightened risk of COVID-19 disease progression. Future studies of JHQG in COVID-19 shall focus on evaluating the clinical efficacy and safety of this TCM in such group of patients. In conclusion, our data show that JHQG is a safe and effective treatment for COVID-19 patients with mild symptoms.


      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04723524</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Jinhua Qinggan Granules in the Treatment of COVID-19</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.17.22275193: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Participants who refused to give written informed consent, or had contraindication for veni-puncture, were excluded from the study.<br>IRB: Ethics: Ethical permission was taken from the institute ethics committee of All India Institute of Medical Sciences, New Delhi. (Ref.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Detection of SARS-CoV-2-specific IgG antibodies was performed using an ELISA-based test (WANTAI) as per the specified optical density (OD) cut-off value.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2-specific IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-Receptor binding domain (RBD) antibody (IgG) was measured using quantitative RBD ELISA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Receptor binding domain (RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The test reported the Anti-RBD IgG antibodies in ELU/ml.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-RBD IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation, anti-RBD antibodies were captured by immobilized RBD protein while the unbound components were washed away.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">WANTAI SARS-CoV-2 Antibody ELISA: It was an enzyme-linked immunosorbent assay (ELISA) for the qualitative detection of total antibodies to SARS-CoV-2 virus in human serum or plasma specimens (anti-SARS-CoV2 IgA, IgG and IgM antibodies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV2 IgA, IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In wells containing the antigen-antibody-antigen (HRP) “sandwich” immune-complex, the colorless Chromogens are hydrolyzed by the bound HRP conjugate to a blue-colored product.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-antibody-antigen (HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Wells containing specimens negative for SARS-CoV-2 antibodies remained colorless.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plaque Reduction Neutralization Test (PRNT): PRNT for SARS-CoV-2 on Vero E6 cells was done to measure the neutralizing antibodies (SOP No.: THSTI/BL/TEC/039 Version: 1.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Limitations: Symptoms and history of contact were self-reported hence making it vulnerable to recall error.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. Reviewer #1 (Public Review): 

      Alexej Schatz and York Winter wrote "LabNet," a C++ tool to control Raspberry Pi (raspi) GPIO (General Purpose Input-Output) and other hardware using a network messaging protocol using protobuf. The authors were primarily concerned with performance, specifically low execution latencies, as well as extensibility to a variety of hardware. LabNet's network architecture is asymmetrical and treats one or many raspis as servers that can receive control signals from one or more clients. Servers operate as (approximately) stateless "agents" that execute instructions received in message boxes using a single thread or pool of threads. The authors describe several examples of basic functionality like time to write and read GPIO state to characterize the performance of the system, the code for which is available in a linked GitHub repository. 

      The described performance of LabNet is impressive, with near- or sub-millisecond latency across the several tests when conducted over a LAN TCP/IP connection. The demonstrated ability to interact with the server from three programming languages (C++, C#, and Python) also would be quite useful for a tool that intends to be as general-purpose as this one. The design decisions that led to the use of protobuf and SObjectizer seem sound and supportive of the primary performance goal. 

      As far as I'm concerned, the authors accomplished their goals and give a convincing demonstration in their performance tests. 

      The authors compare LabNet to: 

      - Whisker ( https://web.archive.org/web/20200222133946/http://egret.psychol.cam.ac.uk/whisker/index.shtml ), an aging proprietary experimental package typically sold along with purpose-built hardware; <br /> - pyControl and Bpod, both of which are open-source software frameworks for performing behavioral experiments using a specific combination of microcontrollers and an ecosystem of extension parts; <br /> - Autopilot, a software framework for performing behavioral experiments on the raspberry pi as well as modular development of hardware controllers and other common experimental components. 

      Each of these packages has a different enough scope and accompanying differences in design priorities that I think are worth noting to give context to the niche LabNet fills. For example, pyControl and Autopilot emphasize ease of use, pyControl and Bpod are built around state machines for controlling experiments, etc. All have some facility for designing and performing experiments themselves and are thus a bit "higher level" than LabNet, which is intended more as a GPIO and hardware control system specifically. I think LabNet is more aptly compared to something like pigpio (https://web.archive.org/web/20220130033233/https://abyz.me.uk/rpi/pigpio/) which is also a low-level GPIO control library with network control capabilities. In that respect LabNet fills at least two needs that aren't well-served by existing tools: first, it provides a means to extend the server with additional commands that can be exposed to multiple programming languages. Second, that lets users control additional hardware and implement custom logic aside from simple on/off commands (for example, the ability to output sound) - this would be particularly useful as a way of controlling HATs and other devices. LabNet's agent-based concurrency architecture also seems like it will allow the number of simultaneously controlled devices to scale well. LabNet's network-first design positions it well for behavioral experiments that are often better served by a swarm of networked computers rather than a single controlling computer. 

      The largest point of improvement that I expect will unfold over this project's development lifecycle will be its documentation. LabNet has no documentation to speak of, outside a brief description of the build process for a relatively voluminous body of code (~27k lines) with relatively few comments. There is no established norm as to what stage in a scientific software package's development a paper should be written, so I take the lack of documentation at this stage as just a sign that this project is young. The primary barrier for the broader landscape of scientific software is less that of availability of technically proficient packages, but the ease with which they can be adopted and used by people outside the development team. The ability of downstream researchers to use and extend the library to suit their needs will depend on future documentation. For example, at the moment the Python adapter to the client and server is present in the examples folder but relatively un-annotated, so it might be challenging to adapt to differing needs at the moment (https://github.com/WinterLab-Berlin/LabNet/blob/34e71c6827d2feef9b65d037ee5f2e8ca227db39/examples/python/perf_test/LabNetClient_pb2.py and https://github.com/WinterLab-Berlin/LabNet/blob/34e71c6827d2feef9b65d037ee5f2e8ca227db39/examples/python/perf_test/LabNetServer_pb2.py ). Documentation for projects like this that aim to serve as the basis from which to build experimental infrastructure can be quite challenging, as it often needs to spread beyond the package itself to more general concerns like how to use Raspberry Pis, how to set them up to be available over a network, and so on, so I look forward to seeing the authors meet that challenge. 

      I would like to thank the authors for their work and thank them for bringing us a fast way to control experimental hardware over the network.

    2. Reviewer #2 (Public Review): 

      The manuscript introduces LabNet as a network-based platform for the control of hardware in Neuroscience. The authors recognize and attempt to address two fundamental problems in constructing systems neuroscience experiments: on one hand the importance of precise timing measurements of behavior; on the other hand, the need for flexibility in experimental design. These two goals are often at great odds with each other. Precise timing is more easily achieved when using fewer, dedicated homogeneous devices such as embedded microcontrollers. Flexibility can be found in the diversity of devices and programming languages available for commercial personal computers, but this often comes at the cost of a non-real-time operating system, where timing can be much harder to predict accurately. There is also a limitation on the number of devices which can be simultaneously controlled by a single processor, which can be an impediment for high-throughput behavior studies where the ability to run dozens of experiments in parallel is desirable. 

      LabNet proposes to address this tension by focusing on the design of a pure hardware control and instrumentation layer implemented on top of the Raspberry Pi family of microprocessors. The idea is to keep coordination of experimental hardware in a central computer, but keep time-critical components at the edge, each node running the same control software in a Raspberry Pi to provide precise timing guarantees. Flexibility would be provided by the ability to connect an arbitrary number of nodes to the central computer using a unified message-passing protocol by which the computer can receive events and send commands to each node. 

      The authors propose the use of the C++ programming language and the actor-model as a unifying framework for implementing individual nodes and present a series of benchmarks comparing their system against other established hardware control platforms. 

      The idea of keeping time-critical components at the edge, and the use of network communication protocols, and in particular message-passing systems such as the actor-model, to scale up experimental control is reasonable. These principles have undoubtedly been very successful in enabling the creation of massively distributed systems such as web applications connecting millions of devices to each other every second. 

      The Design section then introduces the actor model, the C++ library SObjectivizer used to implement it, and the binary message protocol used for transmission of data across nodes. As currently written, however, this section seems overly technical and hard to grasp for readers who might be interested in experimental neuroscience, but who lack the expertise to understand all mentioned functional constructs and required expertise in the C++ language. Several concepts are mentioned only in passing and without introductory references for the non-expert reader. The level of detail also seems to distract from conveying a more meaningful understanding of the remaining trade-offs involved between network communication, latency, synchronization, and bandwidth. 

      The essence of the actor-model could probably be captured more succinctly, and more time spent discussing some of these critical decisions underlying LabNet's design principles. For example, although each Raspberry Pi device runs a LabNet server, the current implementation allows only one client connection per node. This might be surprising for some readers as it excludes a large number of possible network topologies, and the reason presented for the design decision as currently detailed is hard to understand without further clarification. 

      The main method for evaluating the performance of LabNet is a series of performance tests in the Raspberry Pi comparing clients written in C++, C# and Python, followed by a series of benchmarks comparing LabNet against other established hardware control platforms. While these are undoubtfully useful, especially the latter, the use of benchmarking methods as described in the paper should be carefully revisited, as there are a number of possible confounding factors. 

      For example, in the performance tests comparing clients written in C++, C# and Python, the Python implementation is running synchronously and directly on top of the low-level interface with system sockets, while the C++ and C# versions use complex, concurrent frameworks designed for resilience and scalability. This difference alone could easily skew the Python results in the simplistic benchmarks presented in the paper, which can leave the reader skeptical about all the comparisons with Python in Figure 3. Similarly, the complex nature of available frameworks also raises questions about the comparison between C# and C++. I don't think it is fair to say that Figure 3 is really comparing languages, as much as specific frameworks. In general, comparing the performance of languages themselves for any task, especially compiled languages, is a very difficult topic that I would generally avoid, especially when targeting a more general, non-technical audience. 

      The second set of benchmarks comparing LabNet to other established hardware control platforms is much more interesting, but it doesn't currently seem to allow a fair assessment of the different systems. Specifically, from the authors' description of the benchmarking procedure, it doesn't seem like the same task was used to generate the different latency numbers presented, and the values seem to have been mostly extracted from each of the platform's published results. This unfortunately reduces the value of the benchmarks in the sense that it is unclear what conditions are really being compared. For example, while the numbers for pyControl and Bpod seem to be reporting the activation of simple digital input and output lines, the latency presented for Autopilot uses as reference the start of a sound waveform on a stereo headphone jack. Audio DSP requires specialized hardware in the Pi which is likely to intrinsically introduce higher latency versus simply toggling a digital line, so it is not clear whether these scenarios are really comparable. Similarly, the numbers for Whisker and Bpod being presented without any variance make it hard to interpret the results. 

      One of the stated aims of LabNet was to provide a system where implementing new functionality extensions would be as simple as possible. This is another aspect of experimental neuroscience that is under active discussion and where more contributions are very much needed. Surprisingly, this topic receives very little attention in the paper itself. It is not clear whether the actor model is by itself supposed to make the implementation of new functionality easier, but if this is the case, this is not obvious from the way the design and evaluation sections are currently written, especially given the choice of language being C++. 

      One of the reasons behind the choice of Python for other hardware platforms such as pyControl and Autopilot is the growing familiarity and prevalence of Python within the neuroscience research community, which might assist researchers in implementing new functionality. Other open-hardware projects in neuroscience allowing for community extensions in C++ such as Open-Ephys have informally expressed the difficulty of the C++ language as a point of friction. I feel that the aim of "ease of extensibility" should merit much more discussion in any future revision of the paper. 

      Indeed, they only mention in passing that user extensibility is in the conclusion where it is stated that it is not currently possible to modify LabNet without directly modifying and recompiling the entire code base. A software plug-in system is suggested, and indeed this would be extremely beneficial in achieving the second stated aim. 

      Finally, a set of example experimental applications would have been extremely useful to ground the design of LabNet in practical terms, in addition to the example listings. Even in diagrammatic form, describing how specific experiments have been powered by LabNet would give readers a better sense of the kind of designs that might be currently more appropriate for this platform. For example, video is being increasingly used in behavioral experiments, and Raspberry Pi drivers are available for several camera models, but this important aspect is not mentioned at all in the discussion, so readers interested in video would not know from reading this paper whether LabNet would be appropriate for their goals. 

      As the manuscript currently stands, I don't feel the authors have achieved their second stated aim, and I am unfortunately not fully convinced that the experimental results are adequate to demonstrate the achievement of the first aim. I fully agree, however, that a robust, high-performance and flexible hardware layer for combining neuroscience instruments is desperately needed, and so I do expect that a more thorough treatment of the methods developed in LabNet will in the future have a very positive impact on the field.

    1. SciScore for 10.1101/2022.05.17.22275205: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The simulation is conducted with matlab, and the in build function fminunc is used to minimize the error functions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>matlab</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.15.22275107: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.16.492158: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Demographic information was self-reported, and all subjects provided informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Sera were collected 3-4 weeks post-second vaccine dose for 15 HCWs (7 female and 8 male; median age 37; age range 31-56), which included 4 Moderna mRNA-1273 and 11 Pfizer/BioNTech BNT162b2 vaccinated HCWs.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Once dissociated, cells were fixed in 4% formaldehyde diluted in 1X PBS and stained with primary antibody anti-S1 (Sino Biological, 40150-T62).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then stained with secondary antibody anti-rabbit-IgG-FITC (Sigma, F9887) and processed by a Life Technologies Attune NxT flow cytometer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit-IgG-FITC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Membranes were blotted with anti-S1 (Sino Biological, 40150-T62), anti-p24 (Abcam, ab63917; NIH ARP-1513), and anti-GAPDH (Santa Cruz Biotech, sc-47724).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-GAPDH</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-47724, RRID:AB_627678)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-mouse-IgG-Peroxidase (Sigma, A5278) and anti-rabbit-IgG-HRP (Sigma, A9169) were used as secondary antibodies accordingly.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-mouse-IgG-Peroxidase</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit-IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T (ATCC CRL-11268, RRID: CVCL_1926) and HEK293T-ACE2 (BEI NR-52511, RRID: CVCL_A7UK) cells were maintained in DMEM (Gibco, 11965-092) supplemented with 10% FBS (Sigma, F1051) and 1% penicillin-streptomycin (HyClone, SV30010).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>detected: (ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>detected: ( RRID:CVCL_A7UK)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CaLu-3 cells (RRID: CVCL_0609) were maintained in EMEM (ATCC 30-2003) supplemented with 10% FBS and 1% penicillin-streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CaLu-3</div><div>detected: (ATCC Cat# HTB-55, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pNL4-3-inGluc and spike constructs were transfected into HEK-293T cells in a 2:1 ration using polyethylenimine transfection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudotyped virus for each SARS-CoV-2 spike, produced in parallel, were used to infect target HEK293T-ACE2 or CaLu-3 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CaLu-3</div><div>suggested: KCLB Cat# 30055, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus and serum were incubated for 1 hr at 37°C and then added to HEK293T-ACE2 cells for infection by neutralized virus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike detection by flow cytometry: HEK293T cells used to produce pseudotyped vectors were harvested and fixed 72 hrs after transfection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GenScript Biotech (Piscataway, NJ) produced and cloned SARS-CoV-2 spike constructs with N- and C-terminal flag tags using Kpn I and BamH I restriction enzyme cloning into a pcDNA3.1 vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pNL4-3-inGluc and spike constructs were transfected into HEK-293T cells in a 2:1 ration using polyethylenimine transfection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL4-3-inGluc</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">NT50 values were determined by least-squares-fit, non-linear regression in GraphPad Prism 9 (San Diego, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Results were analyzed using FlowJo v7.6.5 (Ashland, OR).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">NT50 values were determined by least-squares fit non-linear regression in GraphPad Prism 9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western Blot quantification was performed using NIH ImageJ and by setting the ratio of S1/S and S1/p24 of BA.2 to 1.00.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.12.22274953: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: After expressing willingness to participate, the RA asked if the respondent was: 18 years or older; a resident of Arkansas; able to understand and speak English or Spanish; and willing to provide informed consent.<br>IRB: Study procedures were approved by an institutional review board for the protection of human subjects (# 260974).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Land lines were a random sample of all known land lines in Arkansas.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analyses: Data was collected using computer assisted telephone interviews with data stored in a Research Electronic Data Capture (RedCap) database.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RedCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Stata version SE 16.1 (StataCorp LLC, College Station, TX) was used to manage and analyze data.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      This study has some limitations which should be noted. First, the sample includes the population of only one state. Therefore, findings are generalizable only within Arkansas. Even so, given similarities with the populations of other Southern states, our findings are likely more broadly indicative of COVID-19 vaccine acceptance in the South. Although non-response rates were reduced and survey results were weighted, response bias can still impact interpretations due to response patterns. Additionally, the survey was conducted just before the FDA approved the two mRNA vaccines currently available in the U.S. While the media were reporting the imminent emergency approval of the vaccines while the survey was ongoing, we were unable to assess the acceptance after formal approval of the vaccines.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.16.492112: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Euthanasia Agents: Intranasal infection of live SARS-CoV2 (SARS-Related Coronavirus 2, Isolate USA-WA1/2020)105PFU/ 100μl or with DMEM mock control was established with the help of catheter under mild anesthetized by using ketamine (150mg/kg) and xylazine (10mg/kg) intraperitoneal injection inside ABSL3 facility.<br>IACUC: All the experimental protocols involving the handling of virus culture and animal infection were approved by RCGM, institutional biosafety and IAEC (IAEC/THSTI/105) animal ethics committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Isolation of murine BMDNs and human peripheral neutrophils: Murine bone marrow-derived neutrophils were isolated from femur and tibia bones of C57BL/6 wild-type male mice (20–25 g, 12–16 weeks) using the method described previously (71).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Assessment for the histological score was carried out through blind scoring for each sample by a professional histologist on a scale of 0-5 (where 0 indicated absence of histological feature while 5 indicated highest score).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After centrifugation at 1700 x g for 30 min with acceleration 5 m/s2 and deceleration 4 m/s2, band between 81% and 62% were harvested and assessed for their viability by Trypan blue and purity by anti-Ly6G and anti-CD11b antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Ly6G</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD11b</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In a parallel experiment, immunofluorescence staining of BMDNs and PMNs was carried out using mouse anti-MPO and rabbit anti-H4Cit3 antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-MPO</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-H4Cit3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After fixation and blocking, samples were incubated overnight with 1:100 dilution of primary antibodies and were visualized after incubation with the secondary antibodies (1:200, anti-mice AF488 and anti-rabbit AF594) using the confocal microscope (Olympus FV3000) at 100X resolution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mice</div><div>suggested: (AgriSera Cat# AS04 040, RRID:AB_2226396)</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">titration: SARS-Related Coronavirus 2, Isolate USA-WA1/2020 virus was grown and titrated in Vero E6 cell line cultured in Dulbecco’s Modified Eagle Medium (DMEM) complete media containing 4.5 g/L D-glucose, 100,000 U/L Penicillin-Streptomycin, 100 mg/L sodium pyruvate, 25mM HEPES and 2% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Isolation of murine BMDNs and human peripheral neutrophils: Murine bone marrow-derived neutrophils were isolated from femur and tibia bones of C57BL/6 wild-type male mice (20–25 g, 12–16 weeks) using the method described previously (71).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were then taken for flow cytometry using BD FACSCantoII and data was analysed with FlowJo software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Multiple group comparisons have been performed using one-way ANOVA followed by the Bonferroni test using GraphPad Prism 8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04553705</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Omega-3, Nigella Sativa, Indian Costus, Quinine, Anise Seed,…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.17.491668: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Clones with confirmed expression of SARS-CoV-2 and positive control polypeptides were randomly re-arrayed in duplicate along with multiple replicates of the NG negative control into 384-well plates.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Design of the SARS-CoV-2 Plasmid Library: To generate a SARS-CoV-2 plasmid library for use in the ATLAS assay (described below and Fig 1), a consensus sequence was derived by aligning 1676 sequences available on NCBI as of May 2020 to the SARS-CoV-2 reference sequence (NC_045512) using the Geneious Prime software (Biomatters).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: RRID:Addgene_164583)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.16.22274439: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Twenty-three self-referred patients were evaluated between January to September 2021 for new onset of potential symptoms of polyneuropathy (sensory, motor, or autonomic) within 1 month of SARS-CoV-2 vaccination were enrolled after consent to an IRB approved study at the National Institutes of Health (protocol # 15-N-00125).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">12 Multiplex fluorescence immunohistochemistry was performed by incubating sections with 5% normal donkey serum (Jackson ImmunoResearch, West Grove, PA) for 1 hour, then overnight at room temperature using 0.5-5 μg/ml mixtures of immunocompatible antibodies (anti-human IgG, anti-human IgM and anti-CD31 (Leica Biosystems; NCL-L-IgG; NCL-L-IgM and PA0414); anti-C1q (Dako; A0136); anti-C4d (Biomedica; BIRC4D and anti-NFH (Aves Labs), followed by a 1 µg/ml mixture of appropriately cross-adsorbed secondary antibodies raised in donkey (Thermo Fisher, Waltham, MA; Jackson ImmunoResearch) and conjugated to one of the following spectrally compatible fluorophores: Alexa Fluor 488, Alexa Fluor 546, and Alexa Fluor 647.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD31</div><div>suggested: (Bioss Cat# bs-0468R-A488, RRID:AB_2714016)</div></div><div style="margin-bottom:8px"><div>PA0414)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-C1q</div><div>suggested: (Agilent Cat# A0136, RRID:AB_2335698)</div></div><div style="margin-bottom:8px"><div>anti-C4d</div><div>suggested: (Biomedica Cat# BI-RC4D, RRID:AB_1944063)</div></div><div style="margin-bottom:8px"><div>anti-NFH</div><div>suggested: (Antibodies Incorporated Cat# NFH, RRID:AB_2313552)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. nterestingly, if you want to convert raw HTML to R code, there is a Shiny App developed by Alan Dipert from RStudio, namely html2R, shown Figure 2.3. Non-standard attributes (like data-toggle) are not correctly processed, but there are solutions. This will save you precious time! A more recent approach is developed in Chapter 21 and has been used internally to develop some of the RinteRface templates.

      This may be useful for FIGMA to shiny conversion.

    2. When building custom templates, you will be writing a lot of tags. It might seem too much work to always write tags$<TAG_NAME>. There exists a function called withTags(), which allows you to get rid of all tags$. Hence, the whole code is much easier to write and read:

      withTags( ) looks to be a easy way to avoid using tags$<TAG_NAME> too often.

    1. as if the only option we had to eat was factory-farmed fast food, and we didn’t have any way to make home-cooked meals

      See also An app can be a home-cooked meal along with this comment containing RMS's remarks with his code-as-recipe metaphor in the HN thread about Sloan's post:

      some of you may not ever write computer programs, but perhaps you cook. And if you cook, unless you're really great, you probably use recipes. And, if you use recipes, you've probably had the experience of getting a copy of a recipe from a friend who's sharing it. And you've probably also had the experience — unless you're a total neophyte — of changing a recipe. You know, it says certain things, but you don't have to do exactly that. You can leave out some ingredients. Add some mushrooms, 'cause you like mushrooms. Put in less salt because your doctor said you should cut down on salt — whatever. You can even make bigger changes according to your skill. And if you've made changes in a recipe, and you cook it for your friends, and they like it, one of your friends might say, “Hey, could I have the recipe?” And then, what do you do? You could write down your modified version of the recipe and make a copy for your friend. These are the natural things to do with functionally useful recipes of any kind.

      Now a recipe is a lot like a computer program. A computer program's a lot like a recipe: a series of steps to be carried out to get some result that you want. So it's just as natural to do those same things with computer programs — hand a copy to your friend. Make changes in it because the job it was written to do isn't exactly what you want. It did a great job for somebody else, but your job is a different job. And after you've changed it, that's likely to be useful for other people. Maybe they have a job to do that's like the job you do. So they ask, “Hey, can I have a copy?” Of course, if you're a nice person, you're going to give a copy. That's the way to be a decent person.

    1. In addition to being 100% free, 42 has a different duration than bootcamps, does not focus on learning specific languages, and, above all, teaches you how to learn to learn. At 42 Lisboa, we do not want you to “copy-paste” code available on the internet: we want you to understand precisely what you’re writing and what you want to do. We focus on deepening knowledge.

      Review

    1. Never written a line of code in your life? Worry not: the only requirement to apply to 42 Lisboa is to be at least 18 years old. That aside, and regardless of your credentials, 42 doors stand wide open for you.

      Never written a line of code in your life?

      Worry not: the only requirement to apply to 42 Lisboa is to be at least 18 years old.

      That aside, and regardless of your credentials, 42 doors stand wide open for you.

      What are you waiting for?

    1. esides learning how to code, you learn how to solve problems, overcome challenges, how to communicate and work in groups, skills required in any career you want to build. At 42, you learn by doing, by developing projects. You learn how to learn. The growing importance of technology across industries is undeniable, and so is the lack of professionals in this area

      The growing importance of technology across industries in undeniable, as is the lack of well-rounded professionals in this area. At 42, besides learning to code, you will learn how to solve difficult problems without guidance, how to communicate and work in groups, essential skills for any successful career. Here, you learn by doing and you learn how to learn. Elaborate on the future-proof component in learning how to learn

    1. < Do I need to have any experience in coding? > You don’t need to have any coding experience to start learning at 42 Lisboa. 50% of the current students never code before starting their course at 42. You just need a strong will to learn.

      You don't need any coding experience to start studying at 42 Lisboa. 50% of our current students had never coded before joining the course. What you do need is a strong will to learn, the ability to self-organize your studies, and to persist in the face of challenges.

    1. SciScore for 10.1101/2022.05.15.22273842: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Simulations and figure drawings were implemented via Matlab programs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Matlab</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.16.22275147: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.


      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      While our framework can enhance understanding and quantification of surveillance noise, it has several limitations. First, it depends on renewal model descriptions of epidemics [26]. These models assume homogeneous mixing and that the generation time distribution of the disease is known. While the inclusion of more realistic network-based mixing may not improve transmissibility estimates [53] (and this extra complexity may occlude insights), the generation time assumption is a true constraint that may only be ameliorated through the provision of updated, high quality line-list data [54]. Further, our analysis is contingent on having knowledge of the delays, under-ascertainment rates and other noise sources within data. These may be unavailable or themselves highly unreliable. To include this additional uncertainty is an important next step for this work, which will likely involve recomputing our metrics using posterior Fisher information terms [34, 55] that allow prior distributions on the noise parameters. We also assumed that the time scale chosen ensures that Rt parameters are independent. This may be invalid. In such instances we can append non-diagonal terms to Fisher information matrices or use our metric as an upper bound. Last, we defined the reliability or informativeness of a data stream in terms of minimising the joint uncertainty of the entire sequence of reproduction numbers . This is known as a D-optimal design [38]. However, we may instead want to minimise the ...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.16.22275120: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In this process, we included five clinical stakeholders (health care professionals) and five guideline developers from German university hospitals, medical societies and Cochrane Germany to identify both the required information for practical use of clinical guideline recommendations and the metadata that is required to assess e.g. the credibility and strength of recommendations, as well as the information required to connect individual recommendations to their underlying evidence from systematic reviews of primary studies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cochrane Germany</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Cochrane PICO Ontology guided discussions for medical relationships among the recommendation contents [15].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cochrane PICO Ontology</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Automated syntax and code checking were performed using the HL7 FHIR validator as implemented in the FSH validator python package (version 0.2.2; [17]).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Our proposed FHIR-based representation of guideline recommendations has three main limitations: First, it is based on EBMonFHIR resources, which are mostly at a low maturity level and subject to frequent, even breaking, changes. The implementation guide therefore needs to be constantly kept in synchronization with current developments of EBMonFHIR resources. However, this is ensured by our active collaboration and participation in the development of the EBMonFHIR resources. Second, there is currently no execution engine available for our representation format that would allow to automatically integrate the recommended interventions with clinical data to provide clinical decision support. However, a prototype implementation for such an execution engine to be used with clinical data in the OMOP common data model (CDM) format is currently being developed. Additionally, translators may be implemented that translate the FHIR-based representation to other guideline recommendation formalisms that already have an execution engine implemented (e.g. the GLIF3 execution engine or the SAGE execution engine for EON [35,36]). Third, not all information for guideline recommendation execution can be expressed in current FHIR resources: The dependence and relationship between recommendations from the same or different guidelines cannot be modeled in the PlanDefinition resource without the introduction of extensions. We expect that in the maturation process of resources from the Clinical Decis...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.16.492062: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequencing data analysis: The original RNA-seq and Ribo-seq data (Calu3 cells infected with SARS-COV-2 for 7h) were downloaded form Gene Expression Omnibus database (GEO) under accession number GSE149973[9], In brief, all raw sequencing data low quality reads and linker were removed using fastp[10].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.2. Proteomic and RNC-seq expression data: Proteomic (quantitative technique: DIA, A549 cells infected with SARS-COV-2 for 24h) and RNC-seq (human HBE cell line) expression data were extracted from two independent studies supplementary materials, respectively[13,14]. 2.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequencing data analysis: The original RNA-seq and Ribo-seq data (Calu3 cells infected with SARS-COV-2 for 7h) were downloaded form Gene Expression Omnibus database (GEO) under accession number GSE149973[9], In brief, all raw sequencing data low quality reads and linker were removed using fastp[10].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene Expression Omnibus</div><div>suggested: (Gene Expression Omnibus (GEO, RRID:SCR_005012)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lineage assignment using Pangolin lineage command line tool v3.0 (https://github.com/cov-lineages/pangolin) with standard model[15]. 2.4. Ka/Ks and charge evolution analysis: Due to high closely related (identity ∼ 99%) of SARS-COV-2 genomes, we used MAFFT v7 as multiple sequence aligner[16].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PyMol was used to calculate the surface electrostatic potential by Adaptive Poisson Boltzmann solver (APBS), the color scale range was set from −1.0 to 1.0 kT/Å.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.16.22275128: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.11.22274952: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethical approval: The study was approved by the Research Ethics Committee of Santiago de Compostela-Lugo (2020/578).<br>Consent: Informed consent was obtained from all patients for being included in the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Patients were randomly selected from the complete cohort of patients admitted to hospital with SARS-CoV-2 infection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The detection of anti-SARS-CoV-2 IgM antibodies was performed by enzyme-linked immunosorbent assay (ELISA) and results were provided quantitatively [23, 24].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 IgM</div><div>suggested: (Bethyl Cat# E88-302, RRID:AB_2892019)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analysis was performed by using SPSS 22.0 statistical software (SPSS Inc, Chicago, IL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      Limitations and strengths: This was a prospective single-center study of real clinical practice carried out in elderly Caucasian patients with SARS-CoV-2 infection from the northwest region of Spain (Galicia) who exhibited similar features than elderly people from the western European countries. Our results should be interpreted with caution when applying them to other population, race or ethnicity. The sample was not the total population of patients admitted for SARS-CoV-2 in the unit, so the results could be susceptible to a certain sampling error. Although patients were evaluated prospectively, baseline clinical and laboratory data were collected at one point during admission, so some changes in these variables may be relevant and provide more information. Assessing comparability between groups on some variables was complicated because of a low frequency of events of interest in some categories, which could make some results less accurate. Regarding the results, we found that younger patients with lower body weight had higher mortality, although it is known that they were patients with a higher degree of cognitive impairment who were probably in a poorer nutritional status. On the other hand, current or former smokers presented a higher number of non-fatal events in some comparison groups. However, in most cases the smoking abuse was stopped more than 10-15 years ago, so a strong implication of that differences on the results would be unlikely. In another vein, the frequen...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.12.22274989: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The trial and the Investigational New Drug application were approved by the ethics committee of the Faculty of Medicine, Chulalongkorn University, Bangkok, and Thailand’s Food and Drug Administration, respectively.<br>Consent: All participants provided written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was conducted with Stata 15 (Statacorp LLC, College Station, TX, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Statacorp</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      The limitations of this study include: the sample size is small due to the phase 1 uncontrolled dose-finding design. The exploratory comparative immunogenicity analyses with convalescent sera or Pfizer/BNT vaccinees’ sera are not direct head-to-head comparisons and can contain bias. Convalescent sera were collected during the rise of the Delta variant outbreak, and possibly antibody responses are stronger against Delta than WT. To minimize bias, the convalescent and Pfizer/BNT vaccinees’ serum samples were tested at the same laboratories together with the ChulaCov19 vaccinated samples. In addition, a RCT phase 2 study has commenced and a larger scale immune-bridging, non-inferiority phase 3 study is planned. In summary, ChulaCov19 mRNA vaccine is well tolerated and elicited strong SARS-CoV2 specific B- and T-cell immunogenicity and is currently under Phase 2 and later clinical development.


      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04566276</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">ChulaCov19 Vaccine in Healthy Adults</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.11.22274979: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To further account for this possibility, we adda new set of equations as shown below: p denotes antigen-like substances in the environment; q denotes antibodies bound to antigen-like substances in the environment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-like</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Assuming that the number of individuals in the population is N, the antibody virus complex in each individual is represented as xi, the concentration of antibodies is represented as yi, virus concentration is represented as zi, environmental antigenic substances is represented as pi, and the antibody-environment antigen complex is represented as qi.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-environment</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Matlab codes can be accessed at: https://github.com/zhaobinxu23/antibody_dynamics_agent-based_model</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Matlab</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      However, a critical limitation of the Markov chain model is the antibody waning effects does not follow simple mathematical function. As shown in Figure 1B, the declination of protection effects brought by antibodies cannot be represented as simple mathematic equation. Therefore, we developed an antibody dynamic theory and attempted to integrate the antibody information into the prediction of population morbidity. Our antibody dynamics model can well explain the protection cycle of vaccines or primary infection, it can also be used to predict the protection duration of natural infection or vaccination [20]. The application of ordinary differential equations is much more accurate and physically reliable compared to the usage of simple math functions. This model is a deterministic model which could generate a fixed morbidity landscape given specific population contact matrix and the antibody dynamic parameters for each individual within certain group. The antibody concentration together with the virus loading amount within host body can more explicitly and accurately reflect the probability of infection and the number of viruses released to the environment at different time points, which provides a significant improvement toward our previous Markov chain model. Meanwhile, this deterministic agent-based model inherits the benefits of Markov-chain model. Each individual is affected by the state of its surrounding agents by the application of contact matrix. He can spread the viru...


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.11.22274937: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">The following variables in Wave 10 (2018-19) were considered to explore differences in changes over time: 1) sex (male / female), 2) living with a partner (yes / no), 3) having a White UK ethnicity (yes / no), 4) having a university degree (yes / no), 5) their current occupation level based on the 3-category National Statistics Socioeconomic Classification (professional or managerial / intermediate / routine or manual / not currently employed), and 6) their net household monthly income (quintile-based).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">I then test population-average estimates (i.e., pooled Poisson and linear models with clustered standard errors) and subject-specific estimates (i.e., random-intercept Poisson and linear models) to assess changes over time in: 1) smoking prevalence among the full sample of observations (Table 2), and 2) cigarettes smoked per day among the subsample of observations that smoked (Table 3).6 Finally, I tested interactions and their statistical significance to see if changes varied across groups.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      This study is not without limitations. Only 26% of those aged 35-64 with a full interview in 2018-19 were included in our analytic sample, meaning that our analyses are unlikely to be representative despite the use of the survey weights provided by the UKHLS team. The focus on middle-aged adults precludes generalisations to other age groups, particularly younger adults who are still in the process of initiating smoking9,10 and have faced the brunt of the economic consequences of the pandemic.11 Results from the English Smoking Toolkit Study, which recorded a potential increase in smoking prevalence among those aged 16-24 between 2019 and 2021, support the call for better evidence in young adults.12 The findings here may also not align with the reality of other countries in keeping with the intensity of the impact of the pandemic and the government’s response.13 Despite these concerns, the findings represent encouraging results. Since disasters and recessions affect individuals over a long period of time, studies will be needed to understand the long-term effects of the pandemic on smoking trajectories over the next decade.


      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.11.22274949: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.



      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>
    1. SciScore for 10.1101/2022.05.11.22274962: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study received ethical approval from the Diagnostics Investigational Review Board (IRB project #1021-14).<br>Consent: All participants, or parents or guardians of minor participants, provided informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      No key resources detected.


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:


      A limitation of this study was that not all of the collected samples could be sequenced, due to a minimal viral load requirement for sequencing; samples with a Ct>28 could not be sequenced. Of the collected samples, only 23% contained sufficient sample for sequencing. However, during the period of testing, Omicron replaced Delta as the dominant SARS-CoV-2 variant in the state of Massachusetts[15]. State-wide, Omicron accounted for only 1% of sequenced SARS-CoV-2 samples in the week commencing November 29th, 2021. However, this increased to 99% of sequenced cases in the week commencing January 10th, 2022 [15]. Figure 2 highlights the shift in SARS-CoV-2 variant dominance from Delta to Omicron over time, indicating that the tested samples were a mixture of the two variants (Figure 2), as confirmed by the sequenced samples.


      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04557046</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Performance Evaluation of LumiraDx COVID-19 (SARS-CoV-2) Ag …</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.

      Results from rtransparent:


      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>