552 Matching Annotations
  1. Mar 2019
    1. Anything below permanent residence is even harder to compare, as visa statuses have many restrictions and in the past decade had gotten more restricting laws and limitations of how people can come here, whether that is through work or higher education studies. The study simply acknowledges the obvious statements such as that most naturalized citizens — “…nearly half of America’s roughly 40 million immigrants — arrived by choice, found employer sponsors, navigated visas and green cards and situations, where immigrants who never reach citizenship, and generally have harder lives than American citizens, native- or foreign-born, are not considered.” as the article would state.

      Read Ivy's post, she talks about the trends of immigration applications in the last four years.

    1. Research indicates that nearly half of the plastic that flows into the world’s oceans each year — an estimated 8 million metric tons — escapes from waste streams in just five fast-growing economies in Asia. The extent of plastic pollution in Indonesia, one of the five targeted countries where around 130,000 tons of plastic and solid waste are produced every day, was recently highlighted in a short video posted on YouTube by British diver Rich Horner. The video, which was filmed at Manta Point, a mere 20 km away from Bali, shows a submerged Horner surrounded by innumerable plastic bags, bottles, cups, sachets, straws and other items, which appear to drastically outnumber the fish and other marine life in the area. “Solving the problem of ocean-bound plastics will require significant investment and partnership from brands and supply chain leaders. Partnership with our coalition of companies who have operations in these markets and with PEMSEA, a regional intergovernmental body with local knowledge and experience in SE Asia will help us bring in additional investors, understand the local market and supply chain dynamics and develop an investment strategy that unlocks the key bottlenecks holding back the recycling system in SE Asia and India,” said Rob Kaplan, Managing Director of Closed Loop Partners.
    1. Across the planet, the number of people living in extreme poverty has dropped by more than half since 1990, when 1.9 billion people lived under $1.25 a day, compared to 836 million in 2015, according to the United Nations.

      The number of people living in severe poverty has declined by more than half since 1990 compared to 2015.

    1. Uber has attracted dramatically increased the number of new “driver-partners” for the basic ridesharing service, from fewer than 1,000 in January 2013 to almost 40,000 new drivers starting in December 2014 (Hall and Krueger, 2015).5Currently, more than half of American adults have heard of ridesharing apps like Uber and Lyft, with 15% actuallyusingthe services (Smith, 2016). In China, Didi facilitates 7 million rides per day (Floyd, 2016)

      facts and figures

  2. Feb 2019
    1. Peter Thiel’s Secretive Data Giant Palantir Finally Raking in Cash Maureen Farrell February 07, 2019 Palantir Technologies Inc., the secretive data firm co-founded by investor Peter Thiel, posted a jump in business in 2018 as it prepares for a long-awaited public offering, according to people briefed on the figures. Palantir pulled in about $880 million in revenue, up from about $600 million one year earlier, the people say. The cash boost is a relief to Palantir investors and employees, who have been waiting years on an initial public offering. Palantir is in advanced conversations with investment bankers about an IPO expected for as soon this year. The potential offering is among the most closely watched in a slew of expected Silicon Valley technology company debuts this year. Palantir is in advanced conversations with investment bankers about an IPO it is planning to launch in the second half of 2019, according to people familiar with the company’s plans. The potential offering is among the most closely watched in a slew of expected Silicon Valley technology company debuts this year. While the 15-year old company hasn’t yet turned an annual profit, its executives have said they expect one this year, according to investors. Palo Alto, Calif.-based Palantir has attempted in fits and starts to transform its business. Once known primarily for its government software work—its analytics were credited with helping track down Osama bin Laden—Palantir is now branching into outright for-profit corporate work. Palantir is one of a host of technology companies valued at over $1 billion in the private markets—“unicorns”—looking to prove the long-term worth of their businesses ahead of an IPO. The investor Peter Thiel co-founded Palantir, which has expanded from government software analytics to for-profit corporate work.Photo: Stephanie Keith/Getty Images Ride-hailing firms Uber Technologies Inc. and Lyft Inc. and workplace-messaging company Slack Technologies Inc. recently filed confidential offerings with the Securities and Exchange Commission. These companies, like Palantir, earlier opted to raise money privately in an era of easy money for startups of all stripes. Palantir has raised around $2.5 billion in total, and was most recently valued at $20 billion in a private fundraising round in 2015. The company’s revenue results for last year exceed the roughly $750 million figure it told investors and employees to expect. Cash received, one of the company’s preferred metrics, was up 42%, one person briefed on the results said. Technology investors expect strong growth in a company’s early days; seven-year old Snap Inc. this week posted a 36% year-over-year rise in revenue this year. The reasons for Palantir’s success are twofold: The corporate side, with clients like Fiat Chrysler Automobiles NV and Credit Suisse Group AG , has rebounded. Palantir’s new, off-the-rack software system, dubbed Foundry, makes it easier and cheaper for the company to serve big businesses. In recent presentations to staff, company executives said that corporate business constituted roughly two-thirds of total revenue, from around half a year ago. Palantir’s government arm separately continues to make money, in part thanks to a tradition of dismissing internal and external criticism about its affiliation with unpopular agencies worldwide. The company late last year signed a $42 million contract with U.S. Immigration and Customs Enforcement, a filing shows. Some Palantir staffers and civil rights advocates have criticized Palantir’s ICE ties, but the company has responded that it won’t let short-term politics sway its business decisions. Its largest investor, PayPal Holdings Inc. co-founder Mr. Thiel, is an outspoken supporter of libertarian causes and President Trump. The better-than-projected financial results are a buoy to Palantir’s executives and advisers as they finalize IPO plans, people briefed on the matter say. While Palantir is still not likely to go public before the second half of this year, it may file confidential paperwork beginning the process earlier, the people say. That would be an acceleration of a time frame that earlier looked to stretch into 2020. Write to Rob Copeland at rob.copeland@wsj.com and Maureen Farrell at maureen.farrell@wsj.com

      ipo

    1. The much-discussed cost of college doesn’t change this fact. According to a paper by Mr. Autor published Thursday in the journal Science, the true cost of a college degree is about negative $500,000. That’s right: Over the long run, college is cheaper than free. Not going to college will cost you about half a million dollars.

      The problem for many students, is that they are in debt. After they graduate, they find themselves with too much them and struggling to pay it off. This is the issue for many students, they are trying to figure how they are going to pay the debt the accumulated in their college years.

    1. To add a sense of perspective, consider this: Of the best selling albums in 2011, only three cracked the one million mark, while no position lower than 23 on the list enjoyed sales of more than a half-million.

      A third and final (for now?) paragraph establishing the commercial dominance of boy bands.

  3. Jan 2019
    1. the credit monitoring firm Equifax disclosed a massive breach at the beginning of September, which exposed personal information for 147.9 million people. The data included birth dates, addresses, some driver's license numbers, about 209,000 credit card numbers, and Social Security numbers—meaning that almost half the US population potentially had their crucial secret identifier exposed. Because the information stolen from Equifax was so sensitive, it's widely considered the worst corporate data breach ever. At least for now. Equifax also completely mishandled its public disclosure and response in the aftermath. The site the company set up for victims was itself vulnerable to attack, and it asked for the last six digits of people's Social Security numbers to check if their data had been impacted by the breach. This meant that Equifax was asking Americans to trust them with their data all over again. Equifax also made the breach-response page a stand-alone site, rather than part of its main corporate domain—a decision that invited imposter sites and aggressive phishing attempts. The official Equifax Twitter account even mistakenly tweeted the same phishing link four times. Four. Luckily, in that case, it was just a proof-of-concept research page and not an actual malicious site. There have since been numerous indications that Equifax had a dangerously lax security culture and lack of response procedures in place. Former Equifax CEO Richard Smith told Congress in October 2017 that he usually only met with security and IT representatives once a quarter to review the company's security posture. And hackers got into Equifax's systems for the breach through a known web framework vulnerability for which a patch had been available for months. A digital platform used by Equifax employees in Argentina was even protected by the ultra-guessable credentials "admin, admin"—a truly rookie mistake.

      EQUIFAX BREACH AND CORPORATE MISCONDUCT

    1. Compression is important, however, when it comes to costs. The material for the microfilm Britannica would cost a nickel, and it could be mailed anywhere for a cent. What would it cost to print a million copies? To print a sheet of newspaper, in a large edition, costs a small fraction of a cent. The entire material of the Britannica in reduced microfilm form would go on a sheet eight and one-half by eleven inches. Once it is available, with the photographic reproduction methods of the future, duplicates in large quantities could probably be turned out for a cent apiece beyond the cost of materials. The preparation of the original copy? That introduces the next aspect of the subject.

      Here, it sounds as though Bush is describing the framework for a modern-day printer. Currently, we are able to print mass quantities of documents at a time. We have also branched out into using copy machines and scanners to upload, edit, and print documents. Printers are widely available and are used by people of every age, from children in elementary school to elders.

    1. Can you afford to hire staff? The Council on Foundations has developed three basic examples to help you decide whether you can afford paid staff. The scenarios below roughly demonstrate the relationship between asset amounts, grant distribution, and staffing expenses. You make grants and do not provide direct charitable services. You want a permanent endowment. Your charitable budget is going to be in the range of 5 to 6 percent of assets The IRS mandated minimum annual charitable expenditure is 5 percent of assets. This includes grants and administrative expenses, but does not include investment management expenses. In the formulas below, we use the median foundation expenditure percentage of 5.5 percent for your charitable budget. No more than 15 percent of your annual charitable budget will be used for administrative expenses. Research by the Council on Foundations shows that the median charitable administrative expense level in relation to the total charitable budget for all private foundations is 8.6 percent. However, smaller foundations don't have the same economies of scale as larger foundations. Therefore, for smaller foundations we suggest that you assume that administrative expenses will be about 15 percent of your annual charitable budget. Annual legal and accounting fees will total $5,000. Depending upon the assets you have available, you may want to think about alternatives that can help you maximize your charitable dollars and choices for giving (see the "Additional Options" section below). Example 1: $1 Million Foundation (No Staff) Because of the small amount of money that should be devoted to administrative expenses (usually no more than 15 percent of your annual charitable budget), the option of hiring part-time staff is not financially prudent with a foundation of this size. Total Annual Charitable Budget $1,000,000 x .055 = $55,000 Assets x 5.5 percent = total annual charitable budget (grants + expenses) Administrative Costs $55,000 x .15 = $8,250 Total annual charitable budget x 15 percent = administrative budget Without paid staff, your administrative costs will reflect only your legal and accounting fees (estimated at $5,000), which in this case is 9 percent of your annual charitable budget. Volunteer Responsibilities Because in this scenario the foundation cannot realistically afford staff, it will be the responsibility of the donor and volunteer board to review all grant requests, go on site visits (as necessary), and handle all grantee correspondence, grantmaking investigations, and governance responsibilities of the foundation. If your grantmaking is focused and the grants are few in number, these responsibilities will be easier for you. These responsibilities can be extremely fulfilling when willingly undertaken. In preliminary responses to the Council's 2002 Foundation Management Survey, 93 percent of family foundation respondents reported that they feel inspired by their philanthropy. Example 2: $5 Million Foundation (Half-time CEO) Council on Foundations research shows the majority of private foundations with assets of $5 million to $9.9 million have part-time staff only. The following calculations assume your half-time CEO salary and benefits are $38,7501 and your annual legal and accounting fees are $5,000: Total Annual Charitable Budget $5,000,000 x .055 = $275,000 Assets x 5.5 percent = total annual charitable budget (grants + expenses) Administrative Costs $275,000 x .15 = $41,250 Total annual charitable budget x 15 percent = administrative budget In this case, because your total charitable budget is significantly larger than the previous example, you might consider the option of a half-time staff person. With your half-time CEO salary and benefits at $38,750 and your legal and accounting costs at approximately $5,000, administrative costs total $43,750, which exceeds the recommended 15 percent administrative ceiling. Therefore, you might consider hiring a lower-compensated staff person such as a program officer or administrative assistant, with the board retaining many responsibilities, or hiring a CEO with legal or accounting skills so that the $5,000 fee is reduced. Example 3: $10 Million Foundation (Half-Time CEO and Half-Time Administrative Assistant) In this case, your annual charitable budget is an amount that realistically allows you to consider the option of hiring a half-time CEO and a half-time administrative assistant. Assuming that your half-time CEO and half-time administrative assistant salary/benefits are $68,7502 and your annual legal and accounting fees are $5,000: Total Annual Charitable Budget $10,000,000 x .055 = $550,000 Assets x 5.5 percent = total annual charitable budget (grants + expenses) Administrative Costs $550,000 x .15 = $82,500 Total annual charitable budget x 15 percent = administrative budget Adding personnel and legal and accounting costs gives you a total of $73,750 for administrative costs. In this example, your administrative costs will be 13.4 percent of your annual charitable budget, which is below the 15 percent recommended ceiling. As noted above, there are many options available to manage a private foundation. Our research indicates that many families opt for more than one philanthropic tool, each fulfilling a different goal. For example, in preliminary data from the 2002 Foundation Management Survey, 11 percent of the family foundations responding also had donor advised funds at community foundations. The costs related to starting a foundation on the state level will vary from one state to the next and depend on the type of structure (e.g., trust or corporation, public charity, or private foundation) chosen for the foundation. State fees are paid with submission of required documents to the state office that is responsible for regulating charities; usually this is the secretary of state or the attorney general’s office. In addition, there are fees associated with seeking recognition of charity status with the IRS. Finally, there may be licensing or other fees required for operation of any business in a particular area.
    1. The Wild quietly dangled him as trade bait, then made a half-hearted attempt to re-sign him for about $1 million a year.

      I like how the author used the word "dangled" instead of held or hung. Dangled makes the sentence more dramatic.

    2. The Wild quietly dangled him as trade bait, then made a half-hearted attempt to re-sign him for about $1 million a year.

      I think that this shows at that point in time some people around him knew what was going on, or some of the possible struggles he was facing, and knew that it was probably best if he was to be let go, or if not much attention was brought to him.

  4. Dec 2018
    1. Panama

      Panama (/ˈpænəmɑː/ (About this soundlisten) PAN-ə-mah; Spanish: Panamá [panaˈma]), officially the Republic of Panama (Spanish: República de Panamá), is a country in Central America,[8] bordered by Costa Rica to the west, Colombia to the southeast, the Caribbean Sea to the north and the Pacific Ocean to the south. The capital and largest city is Panama City, whose metropolitan area is home to nearly half the country's 4 million people.[3]

      Panama was inhabited by indigenous tribes before Spanish colonists arrived in the 16th century. It broke away from Spain in 1821 and joined the Republic of Gran Colombia, a union of Nueva Granada, Ecuador, and Venezuela. After Gran Colombia dissolved in 1831, Panama and Nueva Granada eventually became the Republic of Colombia. With the backing of the United States, Panama seceded from Colombia in 1903, allowing the construction of the Panama Canal to be completed by the US Army Corps of Engineers between 1904 and 1914. The 1977 Torrijos–Carter Treaties led to the transfer of the Canal from the United States to Panama on December 31, 1999.[9]

      Revenue from canal tolls continues to represent a significant portion of Panama's GDP, although commerce, banking, and tourism are major and growing sectors. In 2015 Panama ranked 60th in the world in terms of the Human Development Index.[10] Since 2010, Panama has been the second-most competitive economy in Latin America, according to the World Economic Forum's Global Competitiveness Index. Covering around 40 percent of its land area, Panama's jungles are home to an abundance of tropical plants and animals – some of them found nowhere else on the planet.[11] Panama is a founding member of the United Nations and other international organizations such as OAS, LAIA, G77, WHO and NAM.

  5. Nov 2018
    1. a few months later the mayor found $55 million to subsidize a Hyatt Hotel and a private university’s basketball stadium, almost half of which came from (and should have been spent on) Chicago public schools

      This goes to show where on the list of priorities the "education of our black children" lie. Money seems to appear when it is in the interest of the elite or those in power but is scarce when it comes to helping the impoverished community they are suppose to be protecting.

    1. Simplicity, simplicity, simplicity! I say, let your affairs be as two or three, and not a hundred or a thousand; instead of a million count half a dozen, and keep your accounts on your thumb-nail

      Simplify, don't complicate it and only keep the things that you must need, find what is right

  6. Oct 2018
    1. Another investor, the UK-based Woodford Funds, reports that it conducted ‘a rigorous due-diligence process that has taken two and half years’.)

      "Due diligence" for what? We now know that Woodford representatives visited the 1 MW reactor (in Doral, Florida), and that they invested $50 million in Industrial Heat, and committed $150 million more if needed. Where did that money go? None of it went to Rossi, Industrial Heat was supporting many researchers. What Industrial Heat had actually done was to confirm that Rossi was deceptive and that his reactor could not possibly be working as claimed. Many, at the time, knowing that Industrial Heat had been working with Rossi, and that Woodford had invested, assumed that the investment was in Rossi and that this confirmed that Rossi claims were real. Nope. The opposite, it turned out.

  7. Sep 2018
    1. In thirty-five years the city of less than a hundred thousand came to harbor half a million souls,

      For New York City to grow from less than a hundred thousand people to half a million in just 35 years shows how many immigrants are moving to big cities to find jobs. However this shows that there most likely is not enough space for people or jobs for them if so many are coming in at such a fast rate. The city is obviously going to get overcrowded as it can not support these people so fast.

    1. Filthy Lucre' Is A Modern Remix Of The Peacock Room's Wretched Excess 'Filthy Lucre' Is A Modern Remix Of The Peacock Room's Wretched Excess Listen· 7:267:26Queue Toggle more options Download Embed Embed <iframe src="https://www.npr.org/player/embed/408226983/408407242" width="100%" height="290" frameborder="0" scrolling="no" title="NPR embedded audio player"> Transcript Facebook Twitter Flipboard Email May 21, 20153:34 AM ET Heard on Morning Edition Susan Stamberg James McNeill Whistler lavishly decorated the Peacock Room — an actual London dining room — for shipping magnate Frederick Leyland in 1876. Freer Gallery of Art, Smithsonian hide caption toggle caption Freer Gallery of Art, Smithsonian An artist has just converted a legendary piece of 19th-century art into an utter ruin. And two Smithsonian institutions — the Freer and Sackler galleries of Asian art — have given their blessings. The Peacock Room at the Freer Gallery is an actual dining room from London, decorated by James McNeill Whistler in 1876. Its blue-green walls are covered with golden designs and painted peacocks. Gilded shelves hold priceless Asian ceramics. It's an expensive, lavish cocoon, rich in beauty with a dab of menace. Freer security guard Shaquan Harper spends hours at a time in the Peacock Room — and says it's a peaceful, meditative experience. "Blue is my favorite color, and whenever I wear jewelry it's gold," he says. "So I kind of make a personal connection with the room. This is one of my favorite galleries in the Smithsonian." "Even though it's a room, it's really a six-sided painting that you literally walk into. ... You have no sense whatsoever of the outside world. It's a world in which art has completely overtaken life." Curator Lee Glazer Curator Lee Glazer agrees that the Peacock Room is a completely immersive experience. "Even though it's a room, it's really a six-sided painting that you literally walk into," she says. The Peacock Room is a gorgeous, gilded cage. "You have no sense whatsoever of the outside world," says Glazer. "It's a world in which art has completely overtaken life." It was shipping magnate Frederick Leyland's world. It was created in the Victorian era when self-made men with new fortunes were buying their way into British society through fine houses and important works of art. Whistler paints his wealthy patron as a golden peacock, at one end of the dining room. Nearby, another peacock — representing the "poor" artist. "They're actually in a face-off," Glazer says. Article continues after sponsorship Fighting, for reasons to be revealed in a bit. It's a dispute about art and money — although Whistler named the room Harmony in Blue and Gold. Next door, in the Sackler Museum of Asian Art, painter Darren Waterston has reproduced and re-interpreted Whistler's dining room in an installation called Filthy Lucre — which means "dirty money." This "Peacock Room Remix" looks as if a wrecking ball has been slammed into Whistler's work. The priceless Asian vases in the original are smashed — their shards litter the floor. "The shelves are all broken," Waterston says. "The gold gild is either melting off or puddling on the floor." Enlarge this image In Darren Waterston's Filthy Lucre it looks as if a wrecking ball has been slammed into Whistler's lavish work. Hutomo Wicaksono/Freer Sackler Gallery hide caption toggle caption Hutomo Wicaksono/Freer Sackler Gallery In Darren Waterston's Filthy Lucre it looks as if a wrecking ball has been slammed into Whistler's lavish work. Hutomo Wicaksono/Freer Sackler Gallery The original room feels claustrophobic in its excess. The remix feels scary as if there's been an earthquake and another tremor is coming any minute. "There's a sense of danger," says Waterston. He seems cheerful and sweet, but don't be fooled: "My work absolutely has a perversity," he says. "There's always an underbelly to it." Enlarge this image Shards of smashed Asian vases litter the floor of Waterston's Filthy Lucre. Amber Gray/Freer Sackler Gallery hide caption toggle caption Amber Gray/Freer Sackler Gallery Shards of smashed Asian vases litter the floor of Waterston's Filthy Lucre. Amber Gray/Freer Sackler Gallery Here, Waterston says he wanted to show the volatility of beauty. The big, cancerous, gilded cysts he's blobbed onto Whistler's reproduced golden shelves, the spilled paint oozing onto the rug — these are his reactions to what's happening between art and money these days. "This is what it means to be a living artist in this contemporary art world," Waterston says. "It is so filled with excess and this incredible consumption, this insatiable consumption of the object and of aesthetics." The most vivid, even yuck-making example is what Waterston's done to Whistler's two golden peacocks; in this remix, the birds aren't just fighting, they're eviscerating each other. They're "literally disemboweling each other," he describes. "One has the other's entrails being pulled out — talons are out." The golden peacocks in Filthy Lucre are "literally disemboweling each other," Waterston says. Hutomo Wicaksono/Freer Sackler Gallery hide caption toggle caption Hutomo Wicaksono/Freer Sackler Gallery They hate each other's guts! Which is exactly what happened between Whistler and Leyland. The patron asked the artist to just make some modest adjustments in his new dining room. Glazer says Whistler put a few wavy dabs of gold paint here, some metal color there, "and everyone was very happy with that." Leyland and his family left London for the summer. And that, Glazer says, is when Whistler's imagination took flight. He transformed the room, covering every surface with blue and gold paint. He worked like a madman. "Whistler talks about being up on the scaffolding at 6 in the morning and not coming down until 9 at night," says Glazer. " 'I'm blind with sleep and blue peacock feathers,' he says." He kept his friend and patron more or less informed about what he was doing: "All through the summer Leyland received letters from Whistler talking about the gorgeous surprise that Whistler was preparing for him and the family," Glazer explains. Well, Leyland comes home, sees the extent of work — and the 2,000 pounds that Whistler wanted to be paid for it (about a quarter of a million dollars today) — and, as they used to say in Victorian days: Leyland blew a gasket. In the middle of the dispute, with Leyland paying half of what Whistler requested, the artist went back to the dining room to finish up. "And that was really when he exacted his vengeance," says Glazer. Enlarge this image James McNeill Whistler's mother — immortalized in his 1871 painting Arrangement in Grey and Black No. 1: Portrait of the Artist's Mother — worried about all the time and energy her son was pouring into the Peacock Room. "A gentleman's house isn't an exhibition," she told him. Detroit Institute of Arts via Getty Images hide caption toggle caption Detroit Institute of Arts via Getty Images James McNeill Whistler's mother — immortalized in his 1871 painting Arrangement in Grey and Black No. 1: Portrait of the Artist's Mother — worried about all the time and energy her son was pouring into the Peacock Room. "A gentleman's house isn't an exhibition," she told him. Detroit Institute of Arts via Getty Images He painted those fighting peacocks — the just-plain-angry ones, not Waterston's gut-wrenching birds — and laid on even more blue paint. Then Whistler left, and never saw the Peacock Room again. Now, we can't end this story without talking about Whistler's mother — that iconic profiled figure in gray and black. What did Mama Whistler think of the whole thing — the frenzied work, the manic effort? Glazer reports that Anna Whistler was worried about her son; she thought he was working too hard, not eating, not sleeping: "She chides him about that and says, 'You know, Jimmy, a gentleman's house isn't an exhibition' — meaning: Get out there and make some money and make some things that are going to sell," says Glazer. "And so, always listening to his mother — Whistler was kind of a Momma's boy — he did invite the press in to watch him work in the Peacock Room." Yet another thing he forgot to tell Frederick Leyland! The results of this delicious dispute can be seen on the National Mall in Washington, D.C. — at the Freer, site of the original Peacock Room, and the Sackler, where Filthy Lucre, Darren Waterston's remix, is on display until January 2017.

      The struggle of an artist who is aprreciated by the audience but not able to recive the amount that is supposedly what must come after as a reward. The article also tells the corruption and no exchange of artist from the buyers.

    2. 'Filthy Lucre' Is A Modern Remix Of The Peacock Room's Wretched Excess 'Filthy Lucre' Is A Modern Remix Of The Peacock Room's Wretched Excess Listen· 7:267:26Queue Toggle more options Download Embed Embed <iframe src="https://www.npr.org/player/embed/408226983/408407242" width="100%" height="290" frameborder="0" scrolling="no" title="NPR embedded audio player"> Transcript Facebook Twitter Flipboard Email May 21, 20153:34 AM ET Heard on Morning Edition Susan Stamberg James McNeill Whistler lavishly decorated the Peacock Room — an actual London dining room — for shipping magnate Frederick Leyland in 1876. Freer Gallery of Art, Smithsonian hide caption toggle caption Freer Gallery of Art, Smithsonian An artist has just converted a legendary piece of 19th-century art into an utter ruin. And two Smithsonian institutions — the Freer and Sackler galleries of Asian art — have given their blessings. The Peacock Room at the Freer Gallery is an actual dining room from London, decorated by James McNeill Whistler in 1876. Its blue-green walls are covered with golden designs and painted peacocks. Gilded shelves hold priceless Asian ceramics. It's an expensive, lavish cocoon, rich in beauty with a dab of menace. Freer security guard Shaquan Harper spends hours at a time in the Peacock Room — and says it's a peaceful, meditative experience. "Blue is my favorite color, and whenever I wear jewelry it's gold," he says. "So I kind of make a personal connection with the room. This is one of my favorite galleries in the Smithsonian." "Even though it's a room, it's really a six-sided painting that you literally walk into. ... You have no sense whatsoever of the outside world. It's a world in which art has completely overtaken life." Curator Lee Glazer Curator Lee Glazer agrees that the Peacock Room is a completely immersive experience. "Even though it's a room, it's really a six-sided painting that you literally walk into," she says. The Peacock Room is a gorgeous, gilded cage. "You have no sense whatsoever of the outside world," says Glazer. "It's a world in which art has completely overtaken life." It was shipping magnate Frederick Leyland's world. It was created in the Victorian era when self-made men with new fortunes were buying their way into British society through fine houses and important works of art. Whistler paints his wealthy patron as a golden peacock, at one end of the dining room. Nearby, another peacock — representing the "poor" artist. "They're actually in a face-off," Glazer says. Article continues after sponsorship Fighting, for reasons to be revealed in a bit. It's a dispute about art and money — although Whistler named the room Harmony in Blue and Gold. Next door, in the Sackler Museum of Asian Art, painter Darren Waterston has reproduced and re-interpreted Whistler's dining room in an installation called Filthy Lucre — which means "dirty money." This "Peacock Room Remix" looks as if a wrecking ball has been slammed into Whistler's work. The priceless Asian vases in the original are smashed — their shards litter the floor. "The shelves are all broken," Waterston says. "The gold gild is either melting off or puddling on the floor." Enlarge this image In Darren Waterston's Filthy Lucre it looks as if a wrecking ball has been slammed into Whistler's lavish work. Hutomo Wicaksono/Freer Sackler Gallery hide caption toggle caption Hutomo Wicaksono/Freer Sackler Gallery In Darren Waterston's Filthy Lucre it looks as if a wrecking ball has been slammed into Whistler's lavish work. Hutomo Wicaksono/Freer Sackler Gallery The original room feels claustrophobic in its excess. The remix feels scary as if there's been an earthquake and another tremor is coming any minute. "There's a sense of danger," says Waterston. He seems cheerful and sweet, but don't be fooled: "My work absolutely has a perversity," he says. "There's always an underbelly to it." Enlarge this image Shards of smashed Asian vases litter the floor of Waterston's Filthy Lucre. Amber Gray/Freer Sackler Gallery hide caption toggle caption Amber Gray/Freer Sackler Gallery Shards of smashed Asian vases litter the floor of Waterston's Filthy Lucre. Amber Gray/Freer Sackler Gallery Here, Waterston says he wanted to show the volatility of beauty. The big, cancerous, gilded cysts he's blobbed onto Whistler's reproduced golden shelves, the spilled paint oozing onto the rug — these are his reactions to what's happening between art and money these days. "This is what it means to be a living artist in this contemporary art world," Waterston says. "It is so filled with excess and this incredible consumption, this insatiable consumption of the object and of aesthetics." The most vivid, even yuck-making example is what Waterston's done to Whistler's two golden peacocks; in this remix, the birds aren't just fighting, they're eviscerating each other. They're "literally disemboweling each other," he describes. "One has the other's entrails being pulled out — talons are out." The golden peacocks in Filthy Lucre are "literally disemboweling each other," Waterston says. Hutomo Wicaksono/Freer Sackler Gallery hide caption toggle caption Hutomo Wicaksono/Freer Sackler Gallery They hate each other's guts! Which is exactly what happened between Whistler and Leyland. The patron asked the artist to just make some modest adjustments in his new dining room. Glazer says Whistler put a few wavy dabs of gold paint here, some metal color there, "and everyone was very happy with that." Leyland and his family left London for the summer. And that, Glazer says, is when Whistler's imagination took flight. He transformed the room, covering every surface with blue and gold paint. He worked like a madman. "Whistler talks about being up on the scaffolding at 6 in the morning and not coming down until 9 at night," says Glazer. " 'I'm blind with sleep and blue peacock feathers,' he says." He kept his friend and patron more or less informed about what he was doing: "All through the summer Leyland received letters from Whistler talking about the gorgeous surprise that Whistler was preparing for him and the family," Glazer explains. Well, Leyland comes home, sees the extent of work — and the 2,000 pounds that Whistler wanted to be paid for it (about a quarter of a million dollars today) — and, as they used to say in Victorian days: Leyland blew a gasket. In the middle of the dispute, with Leyland paying half of what Whistler requested, the artist went back to the dining room to finish up. "And that was really when he exacted his vengeance," says Glazer. Enlarge this image James McNeill Whistler's mother — immortalized in his 1871 painting Arrangement in Grey and Black No. 1: Portrait of the Artist's Mother — worried about all the time and energy her son was pouring into the Peacock Room. "A gentleman's house isn't an exhibition," she told him. Detroit Institute of Arts via Getty Images hide caption toggle caption Detroit Institute of Arts via Getty Images James McNeill Whistler's mother — immortalized in his 1871 painting Arrangement in Grey and Black No. 1: Portrait of the Artist's Mother — worried about all the time and energy her son was pouring into the Peacock Room. "A gentleman's house isn't an exhibition," she told him. Detroit Institute of Arts via Getty Images He painted those fighting peacocks — the just-plain-angry ones, not Waterston's gut-wrenching birds — and laid on even more blue paint. Then Whistler left, and never saw the Peacock Room again. Now, we can't end this story without talking about Whistler's mother — that iconic profiled figure in gray and black. What did Mama Whistler think of the whole thing — the frenzied work, the manic effort? Glazer reports that Anna Whistler was worried about her son; she thought he was working too hard, not eating, not sleeping: "She chides him about that and says, 'You know, Jimmy, a gentleman's house isn't an exhibition' — meaning: Get out there and make some money and make some things that are going to sell," says Glazer. "And so, always listening to his mother — Whistler was kind of a Momma's boy — he did invite the press in to watch him work in the Peacock Room." Yet another thing he forgot to tell Frederick Leyland! The results of this delicious dispute can be seen on the National Mall in Washington, D.C. — at the Freer, site of the original Peacock Room, and the Sackler, where Filthy Lucre, Darren Waterston's remix, is on display until January 2017.

      Filthy Lucre composes of fragments from the original Peacock room and overall of the article it explains not the comparison but the interpretation of why Filthy Lucre is as it is in addition to extra research.

    1. The 2010 launch of the “Boris Bike” - London’s cycle hire scheme, named after mayor Boris Johnson – was the clearest indication to date that cycling was no longer just for a minority of fanatics but a healthy, efficient and sustainable mode of transport that city planners wanted in their armoury. There are now more than 8,000 Boris Bikes and 550+ docking stations in Central London. And the trend’s not anomalous to London: Wikipedia reports that there are 535 cycle-share schemes in 49 countries, employing more than half a million bikes worldwide.

      Bicycles are a healthy way to travel and many people are passionate about bicycles.

  8. Aug 2018
  9. inst-fs-iad-prod.inscloudgate.net inst-fs-iad-prod.inscloudgate.net
    1. The thinking behind the assumption is both ahistorical and illogical in that Europe itself lost a third to one-half of its population to infec­tious disease during medieval pandemics. The principal reason the consensus view is wrong and ahistorical is that it erases the effects of settler colonialism with its antecedents in the Spanish "Reconquest" and the English conquest of Scotland, Ireland, and Wales. By the time Spain, Portugal, and Britain arrived to colonize the Americas, their methods of eradicating peoples or forcing them into depen­dency and servitude were ingrai�ed, streamlined, and effective. If disease could have done the job, it is not clear why the European colonizers in America found it necessary to carry out unrelenting wars against Indigenous communities in order to gain every inch of land they took from them-nearly three hundred years of colonial warfare, followed by continued wars waged by the independent re­publics of the hemisphere.

      We will discuss this paragraph on Wednesday. Hint: This gets to Isabella's question about the 80 million people who died. Was it because of disease alone? This author her is saying NO! Europeans were particularly efficient in killing, and if disease would kill Natives off anyway, why did they have to kill and plunder? Her answer: disease was just part of the problem.

    1. The 2010 launch of the “Boris Bike” - London’s cycle hire scheme, named after mayor Boris Johnson – was the clearest indication to date that cycling was no longer just for a minority of fanatics but a healthy, efficient and sustainable mode of transport that city planners wanted in their armoury. There are now more than 8,000 Boris Bikes and 550+ docking stations in Central London. And the trend’s not anomalous to London: Wikipedia reports that there are 535 cycle-share schemes in 49 countries, employing more than half a million bikes worldwide.

      Bike is healthy and sustainable way for transport in the city, many people believe cycle-share bike will reduce the damages of global climate issues. Those data shows that bike also is the supported transport way by govenment

    2. “Boris Bike” - London’s cycle hire scheme, named after mayor Boris Johnson – was the clearest indication to date that cycling was no longer just for a minority of fanatics but a healthy, efficient and sustainable mode of transport that city planners wanted in their armoury. There are now more than 8,000 Boris Bikes and 550+ docking stations in Central London. And the trend’s not anomalous to London: Wikipedia reports that there are 535 cycle-share schemes in 49 countries, employing more than half a million bikes worldwide.

      This proposal is more like a way of influence for the people in the city to have a healthier way of living

    3. The 2010 launch of the “Boris Bike” - London’s cycle hire scheme, named after mayor Boris Johnson – was the clearest indication to date that cycling was no longer just for a minority of fanatics but a healthy, efficient and sustainable mode of transport that city planners wanted in their armoury. There are now more than 8,000 Boris Bikes and 550+ docking stations in Central London. And the trend’s not anomalous to London: Wikipedia reports that there are 535 cycle-share schemes in 49 countries, employing more than half a million bikes worldwide.

      Having the city more or less replace cars and other vehicles into bicycles might not be possible but that would be the choice of a person as well as the change in lifestyle

    4. And the trend’s not anomalous to London: Wikipedia reports that there are 535 cycle-share schemes in 49 countries, employing more than half a million bikes worldwide.

      Even if Wikipedia is not a reliable sources, this gives the picture of how cycles cities are getting more well-known. This also questions ArchDaily for citing Wikipedia. It is either there are no other source or ArchDaily may be working with Wikipedia.

    5. Wikipedia reports that there are 535 cycle-share schemes in 49 countries, employing more than half a million bikes worldwide.

      535 this is a very big number. So many share bike management is so difficult. Government departments should hedge and intensify management to ensure the rational use of resources.

    1. The main scientific objection to the GTE is not that changes occur through time, and neither is it about the size of the change (so I would discourage use of the terms micro- and macro-Evolution—see the appendix to this book). The key issue is the type of change required—to change microbes into men requires changes that increase the genetic information content. The three billion DNA ‘letters’ stored in each human cell nucleus convey a great deal more information (known as ‘specified complexity’) than the over half a million DNA ‘letters’ of the ‘simplest’ self-reproducing organism. The DNA sequences in a ‘higher’ organism, such as a human being or a horse, for instance, code for structures and functions unknown in the sort of ‘primitive first cell’ from which all other organisms are said to have evolved.

      I'm glad you brought up micro and macro. Evolution is a very large theory, encompassing many fields of science. Micro and macro dictate scale of evolution. Micro happens within the species, or a single population, while macro is the speciation. You spoke of equivocation and complained about evolutionsists doing this, then do so here, It would be better to say that particles-to-people Evolution is an unsubstantiated hypothesis or conjecture and now The key issue is the type of change required—to change microbes into men requires changes that increase the genetic information content. I thought it was molecules/particles to man? Which is it? Looks like a bait and switch to me. Also, change microbes to man? That would falsify the Theory of Evolution in one fell swoop! You would need many, many, many generations between microbe and man (homo sapien). Perhaps you mean to get from microbes to an eukaryote? You would need more than just DNA there for your examples, you would also need other parts to that cell, like a nucleus, mitochondira, and other membrane-bound organelle. But more improtantly here, you need to define information. DNA is not information. DNA stands for Deoxyribonucleic Acid. It is a dual helix structure comprised of Adenine, Guanine, Cytosine, and Thymine. If by information you mean how genes are created/expanded, then that would be in mutation, as can see in the accompanying pdf. A frameshift encode error on DNA can be the addition of new information in the form of new gene creation.  The other aspect of this is. If this is not qualified as information then I would say your use of the word is ambiguous and should be redefined. http://evolution.berkeley.edu/evolibrary/article/evoscales_01 https://ghr.nlm.nih.gov/primer/basics/dna https://www.nature.com/scitable/topicpage/dna-deletion-and-duplication-and-the-associated-331# http://www.life.umd.edu/classroom/bsci410-liu/BSCI410-S09/Lecture4.pdf

    1. Start is a new model of company building which enables the world’s best technical and entrepreneurial talent to create companies from the ground up.

      Might it be best to get the de-risked / problem-first USP in the headline? That it THE key takeaway from the programme (the rest focusing on exclusivity and great talent can be mentioned in the section below and implicit through the branding...)

      Something along the lines of (just ideas):

      "The Start Programme enables grants the world's most impressive entrepreneurial and technical talent access to real, immediate problems faced by large corporates"

      "Start a company by fixing a real problem, from day one. The Start Programme gives you unparalleled access to large corporate's real pain points, from day one".

      "Half of all entrepreneurs can't find a market for their product. We've you several multi-million dollar markets with huge capital available to the winners: do you have what it takes?"

      "Build a company that addresses a real problem. Just Start and gain access to large corporate's pain points, expertise and rich data-sets."

      "Build a company that works. We're here to give access to large corporate's real pain points, for brilliant technical and entrepreneurial talent"

      "Start with the problem".

  10. Jul 2018
    1. Researchers have found time and time again that more guns mean more deaths. And Americans have a lot of guns, and easy access to them. Americans own almost half of the 650 million civilian-owned guns there are in the entire world, and gun homicide rates in the US are 25 times higher than in other high-income countries. States and developed countries with more guns have more gun deaths.
    1. On 2017 Apr 11, Yu-Chen Liu commented:

      The authors appreciate the insightful feedbacks and agree with prospect that hypothesis derived from small RNA-seq data analysis deserve examination in skeptical views and further experimental validation. Regarding the skeptical view of Prof. Witwer on this issue, whether a specific sequence were indeed originate from plant can be validated through examining the 2’-O-methylation on their 3’ end (Chin, et al., 2016; Yu, et al., 2005). The threshold of potential copy per cell for plant miRNAs to affect human gene expression was also discussed in previous researches (Chin, et al., 2016; Zhang, et al., 2012).

      Some apparent misunderstandings are needed to be clarified:

      In the commentary of Prof. Witwer:

      “A cross-check of the source files and articles shows that the plasma data evaluated by Liu et al were from 198 plasma samples, not 410 as reported. Ninomiya et al sequenced six human plasma samples, six PBMC samples, and 11 cultured cell lines 19. Yuan et al sequenced 192 human plasma libraries (prepared from polymer-precipitated plasma particles). Each library was sequenced once, and then a second time to increase total reads.”

      Authors’ response:

      First of all, the statement "410 samples" within the article was meant to the amount of runs of small RNA-seq run conducted in the referred researches. Whether multiple NGS runs conducted on same plasma sample should be count as individual experiment replicates is debatable. The analysis of each small RNA-seq run was conduct independently. The authors appreciate the kind comments for the potential confusion that can be made in this issue.

      In the commentary of Prof. Witwer:

      “Strikingly, the putative MIR2910 sequence is not only a fragment of plant rRNA; it has a 100% coverage, 100% identity match in the human 18S rRNA (see NR 003286.2 in GenBank; Table 3). These matches of putative plant RNAs with human sequences are difficult to reconcile with the statement of Liu et al that BLAST of putative plant miRNAs "resulted in zero alignment hit", suggesting that perhaps a mistake was made, and that the BLAST procedure was performed incorrectly.”

      Authors’ response:

      The precursor sequences of the plant miRNAs, including the stem loop sequences (precursor sequences) were utilized in the BLAST sequence alignment in this work. The precursor sequence of peu-MIR2910, “UAGUUGGUGGAGCGAUUUGUCUGGUUAAUUCCGUUAACGAACGAGACCUCAGCCUGCUA” was used. The alignment was not performed merely with the mature sequence, “UAGUUGGUGGAGCGAUUUGUC”. The stem loop sequences, as well as the alignment of the sequences against the plant genomes, was taken into consideration by using miRDeep2 (Friedländer, et al., 2012). As illustrated in the provided figures, sequencing reads were mapped to the precursor sequences of MIR2910 and MIR2916. As listed in the table below, a lot of sequencing reads can be aligned to other regions within the precursor sequences except the sequencing reads aligned to mature sequences. For instance, in small RNA-seq data of DRR023286, 5369 reads were mapped to peu-MIR2910, and 4010 reads were mapped to the other regions in the precursor sequences.  

      miRNA | Run |Total reads | on Mature | on precursor

      peu-MIR2910 | DRR023286 | 9370 | 5369 | 4010

      peu-MIR2910 | SRR2105454 | 3013 | 1433 | 1580

      peu-MIR2914 | DRR023286 | 1036 | 19 | 1017

      peu-MIR2916 |SRR2105342 | 556 | 227 | 329

      (Check the file MIR2910_in_DRR023286.pdf, MIR2910_in_SRR2105454.pdf, MIR2914_in_DRR023286 and MIR2916_in_SRR2105342.pdf)

      The pictures are available in the URL:

      https://www.dropbox.com/sh/9r7oiybju8g7wq2/AADw0zkuGSDsTI3Aa_4x6r8Ua?dl=0

      As described in the article, all reported reads mapped onto the plant miRNA sequences were also mapped onto the five conserve plant genomes. Within the provided link a compressed folder file “miRNA_read.tar.gz” is available. Results of the analysis through miRDeep2, were summarized in these pdf files. Each figure file was named according to the summarized reads, sequence run and the mapped plant genome. For example, reads from the run SRR2105181 aligned onto both Zea mays genome and peu-MIR2910 precursor sequences are summarized in the figure file “SRR2105181_Zea_mays_peu-MIR2910.pdf”.

      In the commentary of Prof. Witwer:

      “Curiously, several sequences did not map to the species to which they were ascribed by the PMRD. Unfortunately, the PMRD could not be accessed directly during this study; however, other databases appear to provide access to its contents.”

      Authors’ response:

      All the stem loop sequences of plant miRNAs were acquired from the 2016 updated version of PMRD (Zhang, et al., 2010), which was not properly referred. The used data were provided in the previously mentioned URL.

      In the commentary of Prof. Witwer:

      “Counts were presented as reads per million mapped reads (rpm). In contrast, Liu et al appear to have reported total mapped reads in their data table. Yuan et al also set an expression cutoff of 32 rpm (log2 rpm of 5 or above). With an average 12.5 million reads per sample (the sum of the two runs per library), and, on average, about half of the sequences mapped, the 32 rpm cutoff would translate to around 200 total reads in the average sample as mapped by Liu et al.”

      Authors’ response:

      Regarding the concern of reads per million mapped reads (rpm) threshold, the author appreciate the kind remind of the need to normalize sequence reads count into the unit in reads per million mapped reads (rpm) for proper comparison between samples of different sequence depth. However the comparison was unfortunately not conducted in this work. Given the fact that the reads were mapped onto plant genome instead of human genome, the normalization would be rather pointless, considering the overall mapped putative plant reads only consist of ~3% of the overall reads. On the other hand, the general amount of cell free RNA present in plasma samples was meant to be generally lower than within cellar samples (Schwarzenbach, et al., 2011).

      Reference

      Chin, A.R., et al. Cross-kingdom inhibition of breast cancer growth by plant miR159. Cell research 2016;26(2):217-228.

      Friedländer, M.R., et al. miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades. Nucleic acids research 2012;40(1):37-52.

      Schwarzenbach, H., Hoon, D.S. and Pantel, K. Cell-free nucleic acids as biomarkers in cancer patients. Nature Reviews Cancer 2011;11(6):426-437.

      Yu, B., et al. Methylation as a crucial step in plant microRNA biogenesis. Science 2005;307(5711):932-935.

      Zhang, L., et al. Exogenous plant MIR168a specifically targets mammalian LDLRAP1: evidence of cross-kingdom regulation by microRNA. Cell research 2012;22(1):107-126.

      Zhang, Z., et al. PMRD: plant microRNA database. Nucleic acids research 2010;38(suppl 1):D806-D813.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Sep 26, Valter Silva commented:

      This article discusses the Brazilian science based on a new resource for scientometrics called Nature Index, as well as the SJR. The 2012–2015 change in the main metric of Nature Index showed an increase of 18.9% for Brazil and currently is ranked 24th globally. From 1996 to 2015 (SJR) Brazilian science has produced more than 600 thousand citable papers, obtained more than 5 million citations, having over 400 papers with at least 400 citations and is responsible by half of Latin America publication output. Despite such numbers, there are flows in its internationalization. Much of the Brazilian science is produced by graduate students and professors gazetted, since the profession of scientist in Brazil is not a recognized position by the Ministry of Labor and Employment.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Aug 01, Gary Goldman commented:

      The study by Kawail et al demonstrates that HZ incidence has increased over a 60 year period from “0.76 per 1000 person-years (PY) (95% confidence interval [CI], .63–.89) in 1945–1949 to 3.15 per 1000 PY (95% CI, 3.04–3.26) in 2000–2007” with a 2.5% per year rate over the time period after adjusting for age and sex (adjusted incidence rate ratio, 1.025 [95% CI, 1.023–1.026]; P < .001). [1] The authors do not provide an explanation for this increase, yet state, “This increase is unlikely to be due to the introduction of varicella vaccination….”

      Unfortunately, Kawail et al do not report details of how widespread the uptake of varicella vaccine was in Olmstead County during 2000-2007. In fact, there were still substantial outbreaks of varicella during 2000 and 2001 (with a period of 9 months that the vaccine was unavailable). Minnesota did not require varicella vaccination for students entering kindergarten and 7th grade who lacked proof of having had chickenpox until 2004. In 1999, based on a CDC National Immunization Survey, varicella vaccine coverage was 61.6% among children aged 19-35 in Minnesota. [2] Approximately 50% of children aged less than 10 years must be vaccinated to effectively reduce exogenous boosting to initiate a noticeable increase in HZ incidence. Likely, only during 2003 through 2007 was varicella vaccination sufficiently widespread in Olmstead County to begin influencing (increasing) HZ incidence rates.

      It was first hypothesized by Hope-Simpson [3] that “The peculiar age distribution of zoster may in part reflect the frequency with which the different age groups encounter cases of varicella and because of the ensuing boost to their antibody protection have their attacks of zoster postponed” [3]. However, prior to 1999, only limited studies existed that supported this hypothesis. For example, in 1983, Arvin et al. noted a boost in cell-mediated immunity (CMI) in 71% of adults who were exposed to varicella patients in the family [4]. In 1995, Terada et al. reported that Japanese pediatricians aged 50–69 who received multiple VZV exposures, demonstrated HZ incidence rates one-half to one-eighth that of the general population [5]. Gershon et al. in 1996 showed an immunologic boost that reduced the risk of HZ among leukemic children by reexposure to VZV, either by vaccination or by close exposure to varicella [6]. A 1998 study by Solomon found that pediatricians who had a greater incidence of exposure to VZV had lower rates of HZ than psychiatrists who had the lowest VZV exposure rates [7]. More recent studies by Thomas et al. [8] and Salleras et al. [9] have also demonstrated that re-exposure to VZV via contacts with children was associated with reduction in the risk of HZ in adults. In more recent times, during the varicella vaccination era, additional studies, including those derived from the Antelope Valley Varicella Active Surveillance Project (VASP) in a community with widespread varicella vaccination, have emerged that have provided data that validates Hope-Simpson’s hypothesis. [10-12]. In support of the VASP trends [10-11] between 2000 and 2006, a more recent 2013 study by Guzzetta et al suggests that each episode of exposure to VZV increases protection against HZ and that ‘‘this mechanism may be critical in shaping HZ patterns’’. [12]

      Thus, while Kawail et al is unable to provide an explanation for the mean 2.5% annual increase in HZ incidence over six decades, one logical hypothesis for the increase is related to societal changes. Living conditions have gradually changed during the past six decades from multiple generations of families residing in a single household, to more independent living as children aged 18 years and over have increasingly moved out of their parent's home and elderly and sedentary individuals are placed in care facilities. Interesting, a Census Bureau reports, “In 2010, there were 40.3 million people aged 65 and above, comprising 13% of the overall population. (This total is 12 times the number it was in 1900, when this group constituted only 4.1% of the population.)” [13] Thus, due to changing trends in society structure and increases in the elderly population, parents and grandparents generally have fewer opportunities for exogenous boosting of their cell-mediated immunity due to reduced contact to children infected with varicella—giving rise to the steady increase in HZ incidence—especially in decades prior to the varicella vaccination era.

      In the Antelope Valley VASP, varicella vaccination was widespread in the community with approximately 50% of children aged <10 years vaccinated by 2000. By 2000, exogenous exposures to natural varicella (producing immunologic boosts) were dramatically reduced, especially after a marked decline in varicella seasonality in 1999. After 2 years of active HZ surveillance (2000 and 2001), the number of HZ case reports had maintained or increased in every adult age category except elderly adults aged 70 years and older. Using the paired t-test, there was a statistically significant (p < 0.042; t = 2.95, dF = 4) 28.5% increase in HZ case reports from 158 to 203 from 2000 to 2001 for the population aged 20–69 years. [10] Moreover, the 2007 VASP annual summary to the CDC presents data (not ascertainment corrected) demonstrating a statistically significant increase in HZ incidence rates, from 3.90 to 4.70 per 1,000 p-y in from 2006 to 2007 among adults aged 50 years and older. [11]

      Finally, there is a further worrying reason to suspect future increases in HZ incidence. When a child is administered the varicella (or Oka-) strain and then later is exposed to either a child with natural chickenpox or an adult with herpes zoster (almost always due to the reactivation of the natural or wild-type strain), the child harbors two similar but possibly sufficiently heterologous strains--that now are both subject to reactivation. This could potentially double the chances for the reactivation of herpes zoster, or at a minimum, at least increase the chances for reactivation of shingles relative to the pre-varicella vaccination era. [14]

      [1] Kawai K, 2016 [2] http://www.cdc.gov/vaccines/imz-managers/coverage/nis/child/index.html [3] HOPE-SIMPSON RE, 1965 [4] Arvin AM, 1983 [5] Terada K, 1995 [6] Gershon AA, 1996 [7] Solomon BA, 1998 [8] Thomas SL, 2002 [9] Salleras M, 2011 [10] Goldman GS, 2013 [11] Goldman GS, 2014 [12] Guzzetta G, 2013 [13] Raphel A. Trends and statistics relating to U.S. seniors, elderly: Census Bureau 2014 report. August 5, 2014. http://journalistsresource.org/studies/society/public-health/trends-statistics-relating-us-seniors-elderly-census-bureau-2014-report [last accessed 07/26/2016] [14] Weinmann S, 2013


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2015 Sep 03, Kenneth Witwer commented:

      We recently published a small comparison of several validated miRNA-target databases (Lee YJ, 2015)--that is, catalogs of miRNA-target interactions with published experimental evidence. A "validated target" module is one part of miRWalk2.0, so this database and its predecessor (1.0) were included in our study. We queried 50 genes at different times. 82 miRNA-target interactions were returned by miRWalk1.0, 5468 by miRWalk2.0 in January, 2015, and 91 by miRWalk2.0 in May, June, and August, 2015, with only 5 from the original 82. As of August, 2015, the final set of 91 interactions was identical to that returned by miRTarBase (Hsu SD, 2014, Hsu SD, 2011), down to the sort order. Although miRTarBase is cited as one of numerous sources of information for miRWalk output, it was not clear from the methods that it would be the only source for the genes we queried. Experimental validation databases have the potential to provide useful information, but in light of the stability and accuracy issues we seem to have observed over time, users and reviewers are encouraged to 1) consult multiple sources of information (we found Diana TarBase to be among the most comprehensive and best-curated of those we tested, Vlachos IS, 2015); 2) at the same time be aware that different databases may rely entirely or to some extent on other databases; and 3) check the strength of interaction evidence in the primary literature.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Apr 02, GREGORY CROWTHER commented:

      The following is an edited version of an entry in my personal blog (gregcrowther.com).

      Calculations of bees’ impact on strawberries’ market value

      This paper by Klatt et al. documents how strawberries benefit from pollination by bees, as opposed to pollination by wind or self-fertilization. It turns out that, on average, bee-pollinated strawberries are larger than others and also have fewer odd shapes, better color, and superior firmness. This detailed look at strawberry quality is a useful extension of past studies showing that insect pollination often boosts crop quantity (i.e., yield).

      In making their case for the agricultural importance of bees, Klatt et al. say that bee pollination accounts for at least $1.44 billion of the value of the $2.90 billion strawberry market in the European Union (EU). While I accept the take-home message that bees add a lot of value, I sure wish the authors had explained their calculations better.

      The $1.44 billion estimate is the sum of two factors: $1.12 billion in market value of the fresh berries, and another $0.32 billion corresponding to improved shelf life. Let’s consider each of these in turn.

      The figure of $1.12 billion is introduced in this section of the Results:

      "Bee pollination resulted in strawberry fruits with the highest commercial value (figure 1a). On average, bee pollination increased the commercial value per fruit by 38.6% compared with wind pollination and by 54.3% compared with self-pollination. Fruits resulting from wind pollination had a 25.5% higher market value than self-pollinated fruits. Pollination treatments were stronger than differences between varieties and thus had a main effect across all varieties (see table 2 for AICc and likelihood values). Our results suggest that altogether, bee pollination contributed 1.12 billion US$ to a total of 2.90 billion US$ made with commercial selling of 1.5 million tonnes of strawberries in the EU in 2009 [1]—but so far without consideration of the monetary value provided by enhanced shelf life (see below)."

      Figure 1 indicates that the mean value of 1000 wind-pollinated berries was ~$13.80 and the mean value of 1000 bee-pollinated berries was ~$22.40. The value of the wind-pollinated berries thus represents a ~38.6% DECREASE in value relative to the bee-pollinated berries; alternatively, the value of the bee-pollinated berries is a 62.9% INCREASE over the value of the wind-pollinated ones. A 62.9% increase takes us from $1.78 billion (the hypothetical value of strawberries only pollinated by wind) up to $2.9 billion, giving us the reported $1.12 billion boost from bees. The authors’ mention of a 38.6% increase when they meant a 38.6% decrease is not exactly a big deal, but initially made their math baffling to me and my students.

      Perhaps more significantly, the reported market values reflect the classification of strawberries into commercial grades by the first author. Ideally, the first author would have rated the berries while “blinded,” i.e., without knowing which ones came from which treatments (bees, wind, or self). The paper doesn’t mention blinding, so I fear that there was the potential for a pro-bee bias.

      Now for the $0.32 billion due to improved shelf life:

      "Bee pollination strongly impacted the shelf life of strawberries by improving their firmness (figure 2a). The firmness values of each treatment and variety were related to shelf life, measured as the number of days until 50% of fruits had been lost owing to surface and fungal decay (see the electronic supplementary material, S3). Higher firmness resulting from bee pollination potentially elongated the shelf life of strawberry fruits by about 12 h compared with wind pollination, and by more than 26 h compared with self-pollination. After 4 days in storage, only 29.4% of the wind-pollinated fruits and none self-pollinated fruit were still marketable, whereas, at the same time, 40.4% of the bee-pollinated fruits remained in a marketable condition. Thus, bee pollination accounted for a decrease of at least 11.0% in fruit losses during storage. These findings suggest that the value for bee pollination calculated in section 3a(i) has to be increased to accommodate this impact on the shelf life of strawberries. Hence, pollination benefits on the shelf life of strawberries potentially added another 0.32 billion US$ to the commercial value of strawberry pollination."

      Here it’s clear that the authors got $0.32 billion by multiplying 11% by $2.9 billion. What’s less clear is the meaning of “storage” (did the unspecified storage conditions simulate those typically used by strawberry farmers/distributors/vendors?) and the reason(s) why a duration of 4 days was used in this calculation (is this a typical time between harvesting and consumers’ purchases?).

      Such details aside, here’s a more general question relevant to both components of the $1.44 billion estimate. To what extent are commercial strawberries pollinated by bees in the wild?

      The calculations assumes that the study site — a field in Germany — is representative of most or all commercial strawberry farms in Europe. The study site was intentionally set up near well-established bee hives and nests; are most or all European strawberry farms situated similarly? Perhaps the answer is obvious to people with relevant expertise, but the paper doesn’t say. It’s worth noting that if only half of commercial strawberry fields enjoy bee pollination, the estimates of bees’ economic impact would need to be cut in half.

      Considering that the paper trumpets a billion-dollar claim in its abstract, more information on the calculations underlying that claim would have been helpful.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2015 Feb 04, Tamás Ferenci commented:

      Dear Dr. Miller,

      Thanks for your remark.

      Let me note, however (as you submitted your comment as a reply to mine), that my 2nd comment and the second half of my 1st comment is in no way dependent on the size of the background population, so they remain completely intact, even if your criticism is correct. The first half of my first comment indeed depends on the background size, but - as I have pointed out - the discrepancy is in excess to two magnitudes, so a factor of 3, even if you are correct, doesn't affect qualitatively my conclusion.

      As a side note, I also can't completely agree with your logic. You are correct that this way, the same child is counted several times in the background population, but don't forget that the same child - save for those who die, but their number is of course negligible even compared to 18 million - is also exposed several times! (All of which can result in an SIDS and those results are counted together in Table 36.) Well, strictly speaking "all of which can result in an SIDS" is only true if these events are independent, which might not be the case, but assuming that such event can only and exclusively occur after the first vaccination (and the probability at the further vaccinations is zero, conditional on surviving the first), which would give rise to your calculation, is no less irrealistic in my opinion.

      Nevertheless, I agree with you that this issue would have worthed at least a discussion in the PSUR, it'd have been elegant to discuss it, but at this point, I don't see that it is "plain wrong", as suggested by your comment.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Sep 16, Christopher Southan commented:

      Unfortunately Google has now become capricious in matching either part of the Key and thus producing false positives from just the second half. It is therfore more effective to try the inner 14-characters of the Key (the connectivity layer) first. The overall utility still stands and the better news is that, even though the full InChI strings are truncated to 32 caracters in a search, they can give useful partial matches.

      In reply (Oct 2015) to Egons Q above. As we know, rankings move so its difficult to know what (legitimate) SEO steps are making the difference (exepting traffic per se). Yes, databases could do more, in particular PubChem has a backlog problem (i.e. new entries not indexed). It would also be geat if UniChem and SureChEMBL contrived to get fully crawled. Then we really could check the global 100+ million in a ~0.3 sec pop


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2015 Oct 27, Peter Gøtzsche commented:

      The authors report that escitalopram was significantly more effective than citalopram but caution against the “potential for overestimation of treatment effect due to sponsorship bias.” Indeed. Both substances were patented by Lundbeck, and the rejuvenated “me-again” drug, escitalopram, is merely the active half of the “old me” stereoisomer drug, citalopram.

      One would not expect a molecule to be better than itself. I therefore suggest that the Cochrane review mention the results of a 2012 meta-analysis (1), also in the abstract and plain language summary. Independent researchers confirmed the Cochrane review’s findings that escitalopram was better than citalopram in head-to-head trials. All seven trials found this, apart from the single one that was not sponsored by Lundbeck or its affiliates. These researchers also did an indirect comparison of the two drugs based on 10 citalopram and 12 escitalopram placebo controlled trials (1), and now the effect of “me-again” and “old me” was very similar (odds ratio 1.03; 0.82 to 1.30).

      Usually, direct comparisons are more reliable than indirect comparisons, but the drug industry routinely distorts its research to such an extent (2) that the indirect comparisons are sometimes the most reliable ones, which I believe is the case here. Lundbeck did not have any particular incentive to manipulate its placebo controlled studies more with escitalopram than with citalopram.

      The Cochrane authors note that cost-effectiveness information is also needed in the field of antidepressant trials. Indeed. Even if we take Lundbeck’s results in its head-to-head trials at face value, there is no meaningful difference between the two versions of the drug. In one of Lundbeck’s own meta-analyses, the difference after eight weeks was 1 on a scale that goes up to 60 (2,3), which is totally irrelevant (4).

      When I checked the Danish prices in 2009, Cipralex (escitalopram) cost 19 times as much for a daily dose as Cipramil (citalopram). This enormous price difference should have deterred the doctors from using Cipralex, but it didn’t. The sales of Cipralex were six times higher in monetary terms than the sales of citalopram both at hospitals and in primary care. I have calculated that if all patients had received the cheapest citalopram instead of Cipralex or other SSRIs, Danish taxpayers could have saved around €30 million a year, or 87% of the total amount spent on SSRIs.

      1 Alkhafaji AA, Trinquart L, Baron G, et al. Impact of evergreening on patients and health insurance: a meta analysis and reimbursement cost analysis of ci¬talopram/escitalopram antidepressants. BMC Med 2012;10:142.

      2 Gøtzsche PC. Deadly medicines and organised crime: How big pharma has corrupted health care. London: Radcliffe Publishing; 2013.

      3 Gorman JM, Korotzer A, Su G. Efficacy comparison of escitalopram and citalopram in the treatment of major depressive disorder: pooled analysis of placebo-controlled trials. CNS Spectr. 2002; 7(4 Suppl. 1): 40–4.

      4 Leucht S, Fennema H, Engel R, et al. What does the HAMD mean? J Affect Disord 2013;148:243-8


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

  11. Jun 2018
    1. There are currently about 42 million Americans living below the poverty line, almost half of whom are children, who rely on SNAP to purchase food

      This means that about 21 million are adults which means a majority of this amount would need to get jobs to still be able to get their food stamps. this would require so many more jobs to be created

    2. There are currently about 42 million Americans living below the poverty line, almost half of whom are children, who rely on SNAP to purchase food.

      That's so sad. To think that some children aren't able to have regular meals each day is so sad.

  12. May 2018
    1. Nearly 100 Americans died in “The Great Upheaval.” Workers destroyed nearly $40 million worth of property. The strike galvanized the country. It convinced laborers of the need for institutionalized unions, persuaded businesses of the need for even greater political influence and government aid, and foretold a half-century of labor conflict in the United States

      It is equally sad and inspiring that so many other American workers fought for what they believed in, so much so that they literally died in hopes that future generations may work towards equality and fair working conditions.

    1. There are now more than 8,000 Boris Bikes and 550+ docking stations in Central London. And the trend’s not anomalous to London: Wikipedia reports that there are 535 cycle-share schemes in 49 countries, employing more than half a million bikes worldwide.

      This promotion has both advantages and disadvantages. It is advantageous to facilitate people's daily life. What is not good is that some people who have no quality take bicycles as their own, or are arbitrarily damaged. When the next person goes to use it, it is not so convenient. At the same time adding maintenance trouble for this operator.

      https://www.theguardian.com/australia-news/2017/jun/25/dockless-bike-share-privacy-and-safety-concerns-voiced-ahead-of-sydney-launch

    2. was the clearest indication to date that cycling was no longer just for a minority of fanatics but a healthy, efficient and sustainable mode of transport that city planners wanted in their armoury. There are now more than 8,000 Boris Bikes and 550+ docking stations in Central London. And the trend’s not anomalous to London: Wikipedia reports that there are 535 cycle-share schemes in 49 countries, employing more than half a million bikes worldwide.

      Cycling is a healthy, efficient and sustainable mode compared to cars. And these numbers show how Boris Bikes are popular in London, and even the world.

    3. The 2010 launch of the “Boris Bike” - London’s cycle hire scheme, named after mayor Boris Johnson – was the clearest indication to date that cycling was no longer just for a minority of fanatics but a healthy, efficient and sustainable mode of transport that city planners wanted in their armoury. There are now more than 8,000 Boris Bikes and 550+ docking stations in Central London. And the trend’s not anomalous to London: Wikipedia reports that there are 535 cycle-share schemes in 49 countries, employing more than half a million bikes worldwide.

      It's great to see that cycling is becoming more popular as it results in better health for individuals and doesn't harm the environment.

    4. The 2010 launch of the “Boris Bike” - London’s cycle hire scheme, named after mayor Boris Johnson – was the clearest indication to date that cycling was no longer just for a minority of fanatics but a healthy, efficient and sustainable mode of transport that city planners wanted in their armoury. There are now more than 8,000 Boris Bikes and 550+ docking stations in Central London. And the trend’s not anomalous to London: Wikipedia reports that there are 535 cycle-share schemes in 49 countries, employing more than half a million bikes worldwide.

      It can be seen that the sharing bike program has already begun to be planned in 2010, but the actual widespread application has only begun in the last two years.

    1. Students have taken the technology and used it for what the technology is able to do."

      Ok, so here are the real points I was trying to make:

      1) Quizlet (which I see in use in college quite a bit, but which I am more intimately familiar with because my kiddo is a first-year public high school student and Quizlet is probably about half of her homework and study time) is a banking model technology. Yeah, I am pulling out the Freire for this stupid story. Because if you want to pretend to talk about teaching, at least really try to TALK ABOUT TEACHING. What's cool is that students have taken that regurgative software and shifted it into a communication and collaboration tool. This seems compelling to me because "digital" stuff is much more interesting for how it can connect students and allow them to creatively contribute to architectures and ideas than it is for how it can enable notetaking or flashcards or whatever (this is why the laptop ban "research" is so annoying, right?). So first off, cool hacking done by students to show how the web connects them.

      2) the "cheating" thing has nothing to do with Quizlet, really. I mean, THE GOOGLE (the Duck Duck Go, whatever) can retrieve all the factual information on the planet. Then it can also retrieve all the WRONG FACTS on the planet (Quizlet does this too, which is funny). Punishing students for retrieving facts using the net is way less helpful than showing students how to improve their search and retrieval skills, their critical evaluative skills, and their general digital literacy.

      3) Quizlet may have been founded by a student who wanted to study French more effectively. Love that! But hey, it's funded by like 12+ million dollars of venture capital companies, most of which have no real mission related to education. So sit around and talk about how students are naughty if you want. I'd rather ask larger questions about what the end game is for these venture capitalists who want to scale quizlet so that instead of 1 in every 2 high school students using it, it is 1 in 1 high school students. I think Quizlet has like 20 million users a month (don't quote me. I'm not writing an article, I'm DOING HOTHEADED MARGINALIA!). Please exaplin to me what the end game is. Do we think there is no expected return on investment for all the millions sunk into this app? Do we think there is no real reason these "disruptive" companies focus so much on scaling? Who is the product if we can't easily see the product or understand where the money flows here. The problem with Quizlet is not students. The problem with Quizlet is that it's part of a larger commercial edtech trend that is becoming ubiquitous and which we don't question because we are too busy casting side-eye on small-potatoes distractions like DO THEY SHARE EXAM ANSWERS (like they have done since the first caveman exam BTW).

      4) Watch how Quizlet proliferates cheaters. Demonize said cheaters. Create software programs to catch cheaters funded by same venture capitalists who proliferate them. TRACK EYEBALLS OF CHEATERS. Get bad cheaters and their families to send their taxpayer dollars to the venture capitalists to pay for all of it. Begin again. (Don't make me whip out Foucault, people.)

      That is what I was trying to say.

  13. Apr 2018
    1. Wikipedia reports that there are 535 cycle-share schemes in 49 countries, employing more than half a million bikes worldwide.

      Many people began to choose to ride a bicycle rather than drive, which also shows that people start to notice protection of the environment.

    2. There are now more than 8,000 Boris Bikes and 550+ docking stations in Central London. And the trend’s not anomalous to London: Wikipedia reports that there are 535 cycle-share schemes in 49 countries, employing more than half a million bikes worldwide.

      The numbers such as '550', 'more than 8000', '535 cycle-share', '49 countries‘, the data shows that 'Boris Bike' is very popular.

    3. Wikipedia reports that there are 535 cycle-share schemes in 49 countries, employing more than half a million bikes worldwide.

      this shows the how important to keep the environment cycle and cleanly, also shows that global is all focusing on the environmental problems.

    4. here are now more than 8,000 Boris Bikes and 550+ docking stations in Central London. And the trend’s not anomalous to London: Wikipedia reports that there are 535 cycle-share schemes in 49 countries, employing more than half a million bikes worldwide.

      It is already a huge amount of data, representing the correctness of such an action.

    5. Wikipedia reports that there are 535 cycle-share schemes in 49 countries, employing more than half a million bikes worldwide.

      In Australia we have the 'oBike' which is a scheme to use an app on your phone to track the nearest bike and use it as transportation from A-B. This not only encourages people to cycle but can help someone if they're in a tricky situation. It provides an environmentally friendly option. https://www.o.bike/au/about/

    1. Women all over the world represent a special group of people living with HIV because of their large number and their unique experiences as women, mothers and care-givers with the disease (Hackl et al., 1997; Kralik et al., 2001; Liamputtong, 2013)

      <br>

      Analytic Note (Source 1): Living with HIV places huge demands on physical, mental and psychological resources. Many HIV-infected women are young and mothers. Many others become mothers and have to continue mothering despite their HIV infection. Most face the dual challenge of being a mother and a patient. This descriptive qualitative article discusses HIV-infected women in their dual role of mothers and patients. Stigma emerges as one of the main findings of the study. Stigma is still very present in 2016 (year of our study) as it was in 1997 when the article referred to was written.

      Analytic Note (Source 2): The sexuality of women with chronic diseases is often impacted by diseases like cancer, diabetes, mental disorder or HIV. This article illuminates sexuality as an important health issue for women living with a chronic illness and also offers ways to facilitate sexuality issues for this women. The paper reveals the construction of sexuality articulated by women living with chronic illness with regards to concerns on changes in their bodies, meeting the needs of others and communicating sexuality. It is relevant to support our claim that women wherever they may be found still perform their roles as mothers and caregivers despite having HIV/AIDS or other chronic illnesses.

      Analytic Note (Source 3): Presently, there are about 37 million people worldwide living with HIV/AIDS and about half are women. This book is about women living with HIV/AIDS. It provides a background understanding about women living with HIV/AIDS. It discusses salient issues concerning women who are mothers and the essence of having children as well as infant feeding practices. A gender lens perspective is also introduced as all chapters in the volume are argued to be situated within this approach. The book details information on the experiences of women with HIV/AIDS which is relevant to our paper.

      Source Excerpt (Source 1): More than 60,000 women in the US have been diagnosed with AIDS, and millions of women worldwide are infected with HIV. Most of these women will die at an early age, leaving their children motherless. During their HIV illness, these women confront the challenge of being both patient and family caregiver. The authors conducted semi-structured interviews with 8 HIV-positive women (aged 23–47 yrs), focusing on primary life concerns in their lives. Significant factors emerging from the interviews included the impact of stigma associated with HIV/AIDS, disbelief of the diagnosis, the lack of a guardian for their children, the paucity of women's support groups, and barriers associated with seeking services. All women exhibited evidence of clinical depression. A model for multidisciplinary intervention is proposed that focuses on women's needs within their family systems.

      Source Excerpt (Source 2): Whilst we acknowledge that sexuality has multiple meanings, in this paper we describe the way in which women themselves have constructed and articulated their sexuality. We found that sexuality incorporated women's desires, appearance, sexual feelings and expression and imposed on aspects of their lives that they had not needed to acknowledge before illness intruded. Three concerns are discussed; the changing body, meeting the needs of others and communicating sexuality. This paper reveals that issues of sexuality are an important health concern for women who live with long-term illness and should be acknowledged in sensitive and responsive health practices. The paper concludes that it is important for nurses to provide women opportunity for open and genuine communications about sexuality. In this way, a foundation of acceptance for the whole person is established which provides women permission to ask questions and seek assistance with sexuality issues.

      Source Excerpt (Source 3): There are about 34 million people worldwide living with HIV/AIDS. Half are women. There has been a dramatic global increase in the rates of women living with HIV/AIDS. Among young women, especially in developing countries, infection rates are rapidly increasing. Many of these women are also mothers with young infants. When a woman is labelled as having HIV, she is treated with suspicion and her morality is being questioned. Previous research has suggested that women living with HIV/AIDS can be affected by delay in diagnosis, inferior access to health care services, internalized stigma and a poor utilization of health services. This makes it extremely difficult for women to take care of their own health needs. Women are also reluctant to disclose their HIV-positive status as they fear this may result in physical feelings of shame, social ostracism, violence, or expulsion from home. Women living with HIV/AIDS who are also mothers carry a particularly heavy burden of being HIV-infected. This unique book attempts to put together results from empirical research and focuses on issues relevant to women, motherhood and living with HIV/AIDS which have occurred to individual women in different parts of the globe. The book comprises chapters written by researchers who carry out their projects in different parts of the world, and each chapter contains empirical information based on real life situations. This can be used as evidence for health care providers to implement socially and culturally appropriate services to assist individuals and groups who are living with HIV/AIDS in many societies. The book is of interest to scholars and students in the domains of anthropology, sociology, social work, nursing, public health & medicine and health professionals who have a specific interest in issues concerning women who are mothers and living with HIV/AIDS from cross-cultural perspective. (Book summary on back cover page)

      Full Citation (Source 1): Hackl, K. L., Somlai, A. M., Kelly, J. A. & Kalichman, S. C. (1997) Women living with HIV/AIDS: the dual challenge of being a patient and caregiver. Health & Social Work 22(1), 53–62. https://doi.org/10.1093/hsw/22.1.53

      Full Citation (Source 2): Kralik, D., Koch, T. & Telford, K. (2001) Constructions of sexuality for midlife women living with chronic illness. Journal of Advances Nursing 35(2), 180–187. doi:10.1046/j.1365-2648.2001.01835.x

      Full Citation (Source 3): Liamputtong, P. (2013) Women, Motherhood and Living with HIV/AIDS: A Cross-Cultural Perspective. Springer, Bundoora, Australia, doi:10.1007/978-94-007-5887-2.

    1. As to the representation in the Confederated Legislative Council, it was proposed to give Upper Canada and Lower Canada twenty-four members each, and to the Lower Provinces twenty-eight. That is, the 780,000 souls in the Lower Provinces would have four members more than Upper Canada with its million and a half. This proved that though Canada had talented men in the Conference, they either forgot our interests or sat there powerless. When the Legislative Council of Canada was made elective, his honourable friend near him (Hon. Mr. CHRISTIE) had stood up for the right of Upper Canada, as the Delegates should have done in the Conference. On the second reading of the bill to change the constitution of the Legislative Council, on the 14th March, 1856,—

      §.24 of the Constitution Act, 1867.

    1. More than half of the people in this country say that racism is a big problem i  this country, that’s 322 million, that’s a big number.

      okay: thanks for this data--it's important. Can you cite the source? Also note the need to edit for comma splices (using commas like periods) and typos

  14. Mar 2018
    1. The 2010 launch of the “Boris Bike” - London’s cycle hire scheme, named after mayor Boris Johnson – was the clearest indication to date that cycling was no longer just for a minority of fanatics but a healthy, efficient and sustainable mode of transport that city planners wanted in their armoury. There are now more than 8,000 Boris Bikes and 550+ docking stations in Central London. And the trend’s not anomalous to London: Wikipedia reports that there are 535 cycle-share schemes in 49 countries, employing more than half a million bikes worldwide. However, the real question is: will cycling actually change the city? Will it result in new urban forms or, as the title of Australian academic Dr Steven Fleming’s new book predicts, a “Cycle Space”? Like Fleming, I believe so. I believe that cycling might just be the catalyst for a 21st Century urban renaissance.

      London uses cycling as both a way of transportation, and health, and is hopeful that it'll change the urban environment

    1. overhalfacroreofrupees

      A crore was used to denote 10 million rupees. The exchange rate between rupees and pounds in the late 19th century was roughly 15 rupees to 1 pound; therefore 5 million rupees would be £333,333. The Bank of England inflation calculator assumes a 3.8% inflation rate between 1889 and 2017, therefore half a crore of rupees would be almost £41million pounds today.

    1. “The changes we are setting in motion today will reach a half-million New Yorkers, in every community, and from every walk of life. They will make our families and our city stronger.”

      Impacting change, certainly, but they are not making our communities or city stronger.. they are weakening us through tearing apart our communities and relinquishing any power we have through ownership of public property and good to private entities.

    1. udicrous to argue that the Power 5 programs cannot afford this; the combined $3.65 million is barely half the $7 million that Michigan Coach Jim Harbaugh made this season.

      The data shows how much these coaches make... a ridiculous amount. Using a salary cap would allow for these players to get paid.

    1. All these are but passing incidents; but they show clearly that a discrimination practiced in the United States against her own citizens and to a large extent a contravention of her own laws, cannot be persisted in, without infringing upon the rights of the peoples of the world and especially upon the ideals and the work of the United Nations. This question then, which is without doubt primarily an internal and national question, becomes inevitably an international question and will in the future become more and more international, as the · nations draw together, In this great attempt to find common ground and to maintain peace, it is therefore, fitting and proper that the thirteen million American citizens of Negro descent should appeal to the United Nat ions and ask that organization in the proper way to take cognizance of a situation which deprives this group of their rights as men and citizens, and by so doing makes the functioning of the United Nations more difficult, if not in many cases impossible.

      I found this section to be particularly intriguing and a confusing place to end his argument. While I can understand the rhetorical choice in terms of his audience, it seems at best a loose and half-hearted appeal to UN member countries based in the notion of self-interest instead of solidarity and justice, which seemed to be the more prevalent themes underlying Du Bois' argument.

  15. Feb 2018
    1. The smoke from wildfires remains in the air for a long time and can travel long distances, Kinney said. This type of air pollution kills nearly half a million people prematurely every year, worldwide

      Wildfire last long in atmosphere and kills half million people every year

    1. I put it in the coffin.  It was in there when you was crying there, away in the night.  I was behind the door, and I was mighty sorry for you, Miss Mary Jane.” It made my eyes water a little to remember her crying there all by herself in the night, and them devils laying there right under her own roof, shaming her and robbing her; and when I folded it up and give it to her I see the water come into her eyes, too; and she shook me by the hand, hard, and says: “Good-bye.  I'm going to do everything just as you've told me; and if I don't ever see you again, I sha'n't ever forget you and I'll think of you a many and a many a time, and I'll pray for you, too!”—and she was gone. Pray for me!  I reckoned if she knowed me she'd take a job that was more nearer her size.  But I bet she done it, just the same—she was just that kind.  She had the grit to pray for Judus if she took the notion—there warn't no back-down to her, I judge.  You may say what you want to, but in my opinion she had more sand in her than any girl I ever see; in my opinion she was just full of sand.  It sounds like flattery, but it ain't no flattery.  And when it comes to beauty—and goodness, too—she lays over them all.  I hain't ever seen her since that time that I see her go out of that door; no, I hain't ever seen her since, but I reckon I've thought of her a many and a many a million times, and of her saying she would pray for me; and if ever I'd a thought it would do any good for me to pray for her, blamed if I wouldn't a done it or bust. Well, Mary Jane she lit out the back way, I reckon; because nobody see her go.  When I struck Susan and the hare-lip, I says: “What's the name of them people over on t'other side of the river that you all goes to see sometimes?” They says: “There's several; but it's the Proctors, mainly.” “That's the name,” I says; “I most forgot it.  Well, Miss Mary Jane she told me to tell you she's gone over there in a dreadful hurry—one of them's sick.” “Which one?” “I don't know; leastways, I kinder forget; but I thinks it's—” “Sakes alive, I hope it ain't Hanner?” “I'm sorry to say it,” I says, “but Hanner's the very one.” “My goodness, and she so well only last week!  Is she took bad?” “It ain't no name for it.  They set up with her all night, Miss Mary Jane said, and they don't think she'll last many hours.” “Only think of that, now!  What's the matter with her?” I couldn't think of anything reasonable, right off that way, so I says: “Mumps.” “Mumps your granny!  They don't set up with people that's got the mumps.” “They don't, don't they?  You better bet they do with these mumps.  These mumps is different.  It's a new kind, Miss Mary Jane said.” “How's it a new kind?” “Because it's mixed up with other things.” “What other things?” “Well, measles, and whooping-cough, and erysiplas, and consumption, and yaller janders, and brain-fever, and I don't know what all.” “My land!  And they call it the mumps?” “That's what Miss Mary Jane said.” “Well, what in the nation do they call it the mumps for?” “Why, because it is the mumps.  That's what it starts with.” “Well, ther' ain't no sense in it.  A body might stump his toe, and take pison, and fall down the well, and break his neck, and bust his brains out, and somebody come along and ask what killed him, and some numskull up and say, 'Why, he stumped his toe.'  Would ther' be any sense in that? No.  And ther' ain't no sense in this, nuther.  Is it ketching?” “Is it ketching?  Why, how you talk.  Is a harrow catching—in the dark? If you don't hitch on to one tooth, you're bound to on another, ain't you? And you can't get away with that tooth without fetching the whole harrow along, can you?  Well, these kind of mumps is a kind of a harrow, as you may say—and it ain't no slouch of a harrow, nuther, you come to get it hitched on good.” “Well, it's awful, I think,” says the hare-lip.  "I'll go to Uncle Harvey and—” “Oh, yes,” I says, “I would.  Of course I would.  I wouldn't lose no time.” “Well, why wouldn't you?” “Just look at it a minute, and maybe you can see.  Hain't your uncles obleegd to get along home to England as fast as they can?  And do you reckon they'd be mean enough to go off and leave you to go all that journey by yourselves?  you know they'll wait for you.  So fur, so good. Your uncle Harvey's a preacher, ain't he?  Very well, then; is a preacher going to deceive a steamboat clerk? is he going to deceive a ship clerk?—so as to get them to let Miss Mary Jane go aboard?  Now you know he ain't.  What will he do, then?  Why, he'll say, 'It's a great pity, but my church matters has got to get along the best way they can; for my niece has been exposed to the dreadful pluribus-unum mumps, and so it's my bounden duty to set down here and wait the three months it takes to show on her if she's got it.'  But never mind, if you think it's best to tell your uncle Harvey—” “Shucks, and stay fooling around here when we could all be having good times in England whilst we was waiting to find out whether Mary Jane's got it or not?  Why, you talk like a muggins.” “Well, anyway, maybe you'd better tell some of the neighbors.” “Listen at that, now.  You do beat all for natural stupidness.  Can't you see that they'd go and tell?  Ther' ain't no way but just to not tell anybody at all.” “Well, maybe you're right—yes, I judge you are right.” “But I reckon we ought to tell Uncle Harvey she's gone out a while, anyway, so he won't be uneasy about her?” “Yes, Miss Mary Jane she wanted you to do that.  She says, 'Tell them to give Uncle Harvey and William my love and a kiss, and say I've run over the river to see Mr.'—Mr.—what is the name of that rich family your uncle Peter used to think so much of?—I mean the one that—” “Why, you must mean the Apthorps, ain't it?” “Of course; bother them kind of names, a body can't ever seem to remember them, half the time, somehow.  Yes, she said, say she has run over for to ask the Apthorps to be sure and come to the auction and buy this house, because she allowed her uncle Peter would ruther they had it than anybody else; and she's going to stick to them till they say they'll come, and then, if she ain't too tired, she's coming home; and if she is, she'll be home in the morning anyway.  She said, don't say nothing about the Proctors, but only about the Apthorps—which 'll be perfectly true, because she is going there to speak about their buying the house; I know it, because she told me so herself.” “All right,” they said, and cleared out to lay for their uncles, and give them the love and the kisses, and tell them the message. Everything was all right now.  The girls wouldn't say nothing because they wanted to go to England; and the king and the duke would ruther Mary Jane was off working for the auction than around in reach of Doctor Robinson.  I felt very good; I judged I had done it pretty neat—I reckoned Tom Sawyer couldn't a done it no neater himself.  Of course he would a throwed more style into it, but I can't do that very handy, not being brung up to it. Well, they held the auction in the public square, along towards the end of the afternoon, and it strung along, and strung along, and the old man he was on hand and looking his level pisonest, up there longside of the auctioneer, and chipping in a little Scripture now and then, or a little goody-goody saying of some kind, and the duke he was around goo-gooing for sympathy all he knowed how, and just spreading himself generly. But by and by the thing dragged through, and everything was sold—everything but a little old trifling lot in the graveyard.  So they'd got to work that off—I never see such a girafft as the king was for wanting to swallow everything.  Well, whilst they was at it a steamboat landed, and in about two minutes up comes a crowd a-whooping and yelling and laughing and carrying on, and singing out: “Here's your opposition line! here's your two sets o' heirs to old Peter Wilks—and you pays your money and you takes your choice!” CHAPTER XXIX. THEY was fetching a very nice-looking old gentleman along, and a nice-looking younger one, with his right arm in a sling.  And, my souls, how the people yelled and laughed, and kept it up.  But I didn't see no joke about it, and I judged it would strain the duke and the king some to see any.  I reckoned they'd turn pale.  But no, nary a pale did they turn. The duke he never let on he suspicioned what was up, but just went a goo-gooing around, happy and satisfied, like a jug that's googling out buttermilk; and as for the king, he just gazed and gazed down sorrowful on them new-comers like it give him the stomach-ache in his very heart to think there could be such frauds and rascals in the world.  Oh, he done it admirable.  Lots of the principal people gethered around the king, to let him see they was on his side.  That old gentleman that had just come looked all puzzled to death.  Pretty soon he begun to speak, and I see straight off he pronounced like an Englishman—not the king's way, though the king's was pretty good for an imitation.  I can't give the old gent's words, nor I can't imitate him; but he turned around to the crowd, and says, about like this: “This is a surprise to me which I wasn't looking for; and I'll acknowledge, candid and frank, I ain't very well fixed to meet it and answer it; for my brother and me has had misfortunes; he's broke his arm, and our baggage got put off at a town above here last night in the night by a mistake.  I am Peter Wilks' brother Harvey, and this is his brother William, which can't hear nor speak—and can't even make signs to amount to much, now't he's only got one hand to work them with.  We are who we say we are; and in a day or two, when I get the baggage, I can prove it. But up till then I won't say nothing more, but go to the hotel and wait.” So him and the new dummy started off; and the king he laughs, and blethers out: “Broke his arm—very likely, ain't it?—and very convenient, too, for a fraud that's got to make signs, and ain't learnt how.  Lost their baggage! That's mighty good!—and mighty ingenious—under the circumstances!” So he laughed again; and so did everybody else, except three or four, or maybe half a dozen.  One of these was that doctor; another one was a sharp-looking gentleman, with a carpet-bag of the old-fashioned kind made out of carpet-stuff, that had just come off of the steamboat and was talking to him in a low voice, and glancing towards the king now and then and nodding their heads—it was Levi Bell, the lawyer that was gone up to Louisville; and another one was a big rough husky that come along and listened to all the old gentleman said, and was listening to the king now. And when the king got done this husky up and says: “Say, looky here; if you are Harvey Wilks, when'd you come to this town?” “The day before the funeral, friend,” says the king. “But what time o' day?” “In the evenin'—'bout an hour er two before sundown.” “How'd you come?” “I come down on the Susan Powell from Cincinnati.” “Well, then, how'd you come to be up at the Pint in the mornin'—in a canoe?” “I warn't up at the Pint in the mornin'.” “It's a lie.” Several of them jumped for him and begged him not to talk that way to an old man and a preacher. “Preacher be hanged, he's a fraud and a liar.  He was up at the Pint that mornin'.  I live up there, don't I?  Well, I was up there, and he was up there.  I see him there.  He come in a canoe, along with Tim Collins and a boy.” The doctor he up and says: “Would you know the boy again if you was to see him, Hines?” “I reckon I would, but I don't know.  Why, yonder he is, now.  I know him perfectly easy.” It was me he pointed at.  The doctor says: “Neighbors, I don't know whether the new couple is frauds or not; but if these two ain't frauds, I am an idiot, that's all.  I think it's our duty to see that they don't get away from here till we've looked into this thing. Come along, Hines; come along, the rest of you.  We'll take these fellows to the tavern and affront them with t'other couple, and I reckon we'll find out something before we get through.” It was nuts for the crowd, though maybe not for the king's friends; so we all started.  It was about sundown.  The doctor he led me along by the hand, and was plenty kind enough, but he never let go my hand. We all got in a big room in the hotel, and lit up some candles, and fetched in the new couple.  First, the doctor says: “I don't wish to be too hard on these two men, but I think they're frauds, and they may have complices that we don't know nothing about.  If they have, won't the complices get away with that bag of gold Peter Wilks left?  It ain't unlikely.  If these men ain't frauds, they won't object to sending for that money and letting us keep it till they prove they're all right—ain't that so?” Everybody agreed to that.  So I judged they had our gang in a pretty tight place right at the outstart.  But the king he only looked sorrowful, and says: “Gentlemen, I wish the money was there, for I ain't got no disposition to throw anything in the way of a fair, open, out-and-out investigation o' this misable business; but, alas, the money ain't there; you k'n send and see, if you want to.” “Where is it, then?” “Well, when my niece give it to me to keep for her I took and hid it inside o' the straw tick o' my bed, not wishin' to bank it for the few days we'd be here, and considerin' the bed a safe place, we not bein' used to niggers, and suppos'n' 'em honest, like servants in England.  The niggers stole it the very next mornin' after I had went down stairs; and when I sold 'em I hadn't missed the money yit, so they got clean away with it.  My servant here k'n tell you 'bout it, gentlemen.” The doctor and several said “Shucks!” and I see nobody didn't altogether believe him.  One man asked me if I see the niggers steal it.  I said no, but I see them sneaking out of the room and hustling away, and I never thought nothing, only I reckoned they was afraid they had waked up my master and was trying to get away before he made trouble with them.  That was all they asked me.  Then the doctor whirls on me and says: “Are you English, too?” I says yes; and him and some others laughed, and said, “Stuff!” Well, then they sailed in on the general investigation, and there we had it, up and down, hour in, hour out, and nobody never said a word about supper, nor ever seemed to think about it—and so they kept it up, and kept it up; and it was the worst mixed-up thing you ever see.  They made the king tell his yarn, and they made the old gentleman tell his'n; and anybody but a lot of prejudiced chuckleheads would a seen that the old gentleman was spinning truth and t'other one lies.  And by and by they had me up to tell what I knowed.  The king he give me a left-handed look out of the corner of his eye, and so I knowed enough to talk on the right side.  I begun to tell about Sheffield, and how we lived there, and all about the English Wilkses, and so on; but I didn't get pretty fur till the doctor begun to laugh; and Levi Bell, the lawyer, says: “Set down, my boy; I wouldn't strain myself if I was you.  I reckon you ain't used to lying, it don't seem to come handy; what you want is practice.  You do it pretty awkward.” I didn't care nothing for the compliment, but I was glad to be let off, anyway. The doctor he started to say something, and turns and says: “If you'd been in town at first, Levi Bell—” The king broke in and reached out his hand, and says: “Why, is this my poor dead brother's old friend that he's wrote so often about?” The lawyer and him shook hands, and the lawyer smiled and looked pleased, and they talked right along awhile, and then got to one side and talked low; and at last the lawyer speaks up and says: “That 'll fix it.  I'll take the order and send it, along with your brother's, and then they'll know it's all right.” So they got some paper and a pen, and the king he set down and twisted his head to one side, and chawed his tongue, and scrawled off something; and then they give the pen to the duke—and then for the first time the duke looked sick.  But he took the pen and wrote.  So then the lawyer turns to the new old gentleman and says: “You and your brother please write a line or two and sign your names.” The old gentleman wrote, but nobody couldn't read it.  The lawyer looked powerful astonished, and says: “Well, it beats me”—and snaked a lot of old letters out of his pocket, and examined them, and then examined the old man's writing, and then them again; and then says:  "These old letters is from Harvey Wilks; and here's these two handwritings, and anybody can see they didn't write them” (the king and the duke looked sold and foolish, I tell you, to see how the lawyer had took them in), “and here's this old gentleman's hand writing, and anybody can tell, easy enough, he didn't write them—fact is, the scratches he makes ain't properly writing at all.  Now, here's some letters from—” The new old gentleman says: “If you please, let me explain.  Nobody can read my hand but my brother there—so he copies for me.  It's his hand you've got there, not mine.” “Well!” says the lawyer, “this is a state of things.  I've got some of William's letters, too; so if you'll get him to write a line or so we can com—” “He can't write with his left hand,” says the old gentleman.  "If he could use his right hand, you would see that he wrote his own letters and mine too.  Look at both, please—they're by the same hand.” The lawyer done it, and says: “I believe it's so—and if it ain't so, there's a heap stronger resemblance than I'd noticed before, anyway.  Well, well, well!  I thought we was right on the track of a solution, but it's gone to grass, partly.  But anyway, one thing is proved—these two ain't either of 'em Wilkses”—and he wagged his head towards the king and the duke. Well, what do you think?  That muleheaded old fool wouldn't give in then! Indeed he wouldn't.  Said it warn't no fair test.  Said his brother William was the cussedest joker in the world, and hadn't tried to write—he see William was going to play one of his jokes the minute he put the pen to paper.  And so he warmed up and went warbling and warbling right along till he was actuly beginning to believe what he was saying himself; but pretty soon the new gentleman broke in, and says: “I've thought of something.  Is there anybody here that helped to lay out my br—helped to lay out the late Peter Wilks for burying?” “Yes,” says somebody, “me and Ab Turner done it.  We're both here.” Then the old man turns towards the king, and says: “Perhaps this gentleman can tell me what was tattooed on his breast?” Blamed if the king didn't have to brace up mighty quick, or he'd a squshed down like a bluff bank that the river has cut under, it took him so sudden; and, mind you, it was a thing that was calculated to make most anybody sqush to get fetched such a solid one as that without any notice, because how was he going to know what was tattooed on the man?  He whitened a little; he couldn't help it; and it was mighty still in there, and everybody bending a little forwards and gazing at him.  Says I to myself, now he'll throw up the sponge—there ain't no more use.  Well, did he?  A body can't hardly believe it, but he didn't.  I reckon he thought he'd keep the thing up till he tired them people out, so they'd thin out, and him and the duke could break loose and get away.  Anyway, he set there, and pretty soon he begun to smile, and says: “Mf!  It's a very tough question, ain't it!  yes, sir, I k'n tell you what's tattooed on his breast.  It's jest a small, thin, blue arrow—that's what it is; and if you don't look clost, you can't see it.  now what do you say—hey?” Well, I never see anything like that old blister for clean out-and-out cheek. The new old gentleman turns brisk towards Ab Turner and his pard, and his eye lights up like he judged he'd got the king this time, and says: “There—you've heard what he said!  Was there any such mark on Peter Wilks' breast?” Both of them spoke up and says: “We didn't see no such mark.” “Good!” says the old gentleman.  "Now, what you did see on his breast was a small dim P, and a B (which is an initial he dropped when he was young), and a W, with dashes between them, so:  P—B—W”—and he marked them that way on a piece of paper.  "Come, ain't that what you saw?” Both of them spoke up again, and says: “No, we didn't.  We never seen any marks at all.” Well, everybody was in a state of mind now, and they sings out: “The whole bilin' of 'm 's frauds!  Le's duck 'em! le's drown 'em! le's ride 'em on a rail!” and everybody was whooping at once, and there was a rattling powwow.  But the lawyer he jumps on the table and yells, and says: “Gentlemen—gentlemen!  Hear me just a word—just a single word—if you please!  There's one way yet—let's go and dig up the corpse and look.” That took them. “Hooray!” they all shouted, and was starting right off; but the lawyer and the doctor sung out: “Hold on, hold on!  Collar all these four men and the boy, and fetch them along, too!” “We'll do it!” they all shouted; “and if we don't find them marks we'll lynch the whole gang!” I was scared, now, I tell you.  But there warn't no getting away, you know. They gripped us all, and marched us right along, straight for the graveyard, which was a mile and a half down the river, and the whole town at our heels, for we made noise enough, and it was only nine in the evening. As we went by our house I wished I hadn't sent Mary Jane out of town; because now if I could tip her the wink she'd light out and save me, and blow on our dead-beats. Well, we swarmed along down the river road, just carrying on like wildcats; and to make it more scary the sky was darking up, and the lightning beginning to wink and flitter, and the wind to shiver amongst the leaves. This was the most awful trouble and most dangersome I ever was in; and I was kinder stunned; everything was going so different from what I had allowed for; stead of being fixed so I could take my own time if I wanted to, and see all the fun, and have Mary Jane at my back to save me and set me free when the close-fit come, here was nothing in the world betwixt me and sudden death but just them tattoo-marks.  If they didn't find them— I couldn't bear to think about it; and yet, somehow, I couldn't think about nothing else.  It got darker and darker, and it was a beautiful time to give the crowd the slip; but that big husky had me by the wrist—Hines—and a body might as well try to give Goliar the slip.  He dragged me right along, he was so excited, and I had to run to keep up. When they got there they swarmed into the graveyard and washed over it like an overflow.  And when they got to the grave they found they had about a hundred times as many shovels as they wanted, but nobody hadn't thought to fetch a lantern.  But they sailed into digging anyway by the flicker of the lightning, and sent a man to the nearest house, a half a mile off, to borrow one. So they dug and dug like everything; and it got awful dark, and the rain started, and the wind swished and swushed along, and the lightning come brisker and brisker, and the thunder boomed; but them people never took no notice of it, they was so full of this business; and one minute you could see everything and every face in that big crowd, and the shovelfuls of dirt sailing up out of the grave, and the next second the dark wiped it all out, and you couldn't see nothing at all. At last they got out the coffin and begun to unscrew the lid, and then such another crowding and shouldering and shoving as there was, to scrouge in and get a sight, you never see; and in the dark, that way, it was awful.  Hines he hurt my wrist dreadful pulling and tugging so, and I reckon he clean forgot I was in the world, he was so excited and panting. All of a sudden the lightning let go a perfect sluice of white glare, and somebody sings out: “By the living jingo, here's the bag of gold on his breast!” Hines let out a whoop, like everybody else, and dropped my wrist and give a big surge to bust his way in and get a look, and the way I lit out and shinned for the road in the dark there ain't nobody can tell. I had the road all to myself, and I fairly flew—leastways, I had it all to myself except the solid dark, and the now-and-then glares, and the buzzing of the rain, and the thrashing of the wind, and the splitting of the thunder; and sure as you are born I did clip it along! When I struck the town I see there warn't nobody out in the storm, so I never hunted for no back streets, but humped it straight through the main one; and when I begun to get towards our house I aimed my eye and set it. No light there; the house all dark—which made me feel sorry and disappointed, I didn't know why.  But at last, just as I was sailing by, flash comes the light in Mary Jane's window! and my heart swelled up sudden, like to bust; and the same second the house and all was behind me in the dark, and wasn't ever going to be before me no more in this world. She was the best girl I ever see, and had the most sand. The minute I was far enough above the town to see I could make the towhead, I begun to look sharp for a boat to borrow, and the first time the lightning showed me one that wasn't chained I snatched it and shoved. It was a canoe, and warn't fastened with nothing but a rope.  The towhead was a rattling big distance off, away out there in the middle of the river, but I didn't lose no time; and when I struck the raft at last I was so fagged I would a just laid down to blow and gasp if I could afforded it.  But I didn't.  As I sprung aboard I sung out: “Out with you, Jim, and set her loose!  Glory be to goodness, we're shut of them!” Jim lit out, and was a-coming for me with both arms spread, he was so full of joy; but when I glimpsed him in the lightning my heart shot up in my mouth and I went overboard backwards; for I forgot he was old King Lear and a drownded A-rab all in one, and it most scared the livers and lights out of me.  But Jim fished me out, and was going to hug me and bless me, and so on, he was so glad I was back and we was shut of the king and the duke, but I says: “Not now; have it for breakfast, have it for breakfast!  Cut loose and let her slide!” So in two seconds away we went a-sliding down the river, and it did seem so good to be free again and all by ourselves on the big river, and nobody to bother us.  I had to skip around a bit, and jump up and crack my heels a few times—I couldn't help it; but about the third crack I noticed a sound that I knowed mighty well, and held my breath and listened and waited; and sure enough, when the next flash busted out over the water, here they come!—and just a-laying to their oars and making their skiff hum!  It was the king and the duke. So I wilted right down on to the planks then, and give up; and it was all I could do to keep from crying. CHAPTER XXX. WHEN they got aboard the king went for me, and shook me by the collar, and says: “Tryin' to give us the slip, was ye, you pup!  Tired of our company, hey?” I says: “No, your majesty, we warn't—please don't, your majesty!” “Quick, then, and tell us what was your idea, or I'll shake the insides out o' you!” “Honest, I'll tell you everything just as it happened, your majesty.  The man that had a-holt of me was very good to me, and kept saying he had a boy about as big as me that died last year, and he was sorry to see a boy in such a dangerous fix; and when they was all took by surprise by finding the gold, and made a rush for the coffin, he lets go of me and whispers, 'Heel it now, or they'll hang ye, sure!' and I lit out.  It didn't seem no good for me to stay—I couldn't do nothing, and I didn't want to be hung if I could get away.  So I never stopped running till I found the canoe; and when I got here I told Jim to hurry, or they'd catch me and hang me yet, and said I was afeard you and the duke wasn't alive now, and I was awful sorry, and so was Jim, and was awful glad when we see you coming; you may ask Jim if I didn't.” Jim said it was so; and the king told him to shut up, and said, “Oh, yes, it's mighty likely!” and shook me up again, and said he reckoned he'd drownd me.  But the duke says: “Leggo the boy, you old idiot!  Would you a done any different?  Did you inquire around for him when you got loose?  I don't remember it.” So the king let go of me, and begun to cuss that town and everybody in it. But the duke says: “You better a blame' sight give yourself a good cussing, for you're the one that's entitled to it most.  You hain't done a thing from the start that had any sense in it, except coming out so cool and cheeky with that imaginary blue-arrow mark.  That was bright—it was right down bully; and it was the thing that saved us.  For if it hadn't been for that they'd a jailed us till them Englishmen's baggage come—and then—the penitentiary, you bet! But that trick took 'em to the graveyard, and the gold done us a still bigger kindness; for if the excited fools hadn't let go all holts and made that rush to get a look we'd a slept in our cravats to-night—cravats warranted to wear, too—longer than we'd need 'em.” They was still a minute—thinking; then the king says, kind of absent-minded like: “Mf!  And we reckoned the niggers stole it!” That made me squirm! “Yes,” says the duke, kinder slow and deliberate and sarcastic, “we did.” After about a half a minute the king drawls out: “Leastways, I did.” The duke says, the same way: “On the contrary, I did.” The king kind of ruffles up, and says: “Looky here, Bilgewater, what'r you referrin' to?” The duke says, pretty brisk: “When it comes to that, maybe you'll let me ask, what was you referring to?” “Shucks!” says the king, very sarcastic; “but I don't know—maybe you was asleep, and didn't know what you was about.” The duke bristles up now, and says: “Oh, let up on this cussed nonsense; do you take me for a blame' fool? Don't you reckon I know who hid that money in that coffin?” “Yes, sir!  I know you do know, because you done it yourself!” “It's a lie!”—and the duke went for him.  The king sings out: “Take y'r hands off!—leggo my throat!—I take it all back!” The duke says: “Well, you just own up, first, that you did hide that money there, intending to give me the slip one of these days, and come back and dig it up, and have it all to yourself.” “Wait jest a minute, duke—answer me this one question, honest and fair; if you didn't put the money there, say it, and I'll b'lieve you, and take back everything I said.” “You old scoundrel, I didn't, and you know I didn't.  There, now!” “Well, then, I b'lieve you.  But answer me only jest this one more—now don't git mad; didn't you have it in your mind to hook the money and hide it?” The duke never said nothing for a little bit; then he says: “Well, I don't care if I did, I didn't do it, anyway.  But you not only had it in mind to do it, but you done it.” “I wisht I never die if I done it, duke, and that's honest.  I won't say I warn't goin' to do it, because I was; but you—I mean somebody—got in ahead o' me.” “It's a lie!  You done it, and you got to say you done it, or—” The king began to gurgle, and then he gasps out: “'Nough!—I own up!” I was very glad to hear him say that; it made me feel much more easier than what I was feeling before.  So the duke took his hands off and says: “If you ever deny it again I'll drown you.  It's well for you to set there and blubber like a baby—it's fitten for you, after the way you've acted. I never see such an old ostrich for wanting to gobble everything—and I a-trusting you all the time, like you was my own father.  You ought to been ashamed of yourself to stand by and hear it saddled on to a lot of poor niggers, and you never say a word for 'em.  It makes me feel ridiculous to think I was soft enough to believe that rubbage.  Cuss you, I can see now why you was so anxious to make up the deffisit—you wanted to get what money I'd got out of the Nonesuch and one thing or another, and scoop it all!” The king says, timid, and still a-snuffling: “Why, duke, it was you that said make up the deffisit; it warn't me.” “Dry up!  I don't want to hear no more out of you!” says the duke.  "And now you see what you GOT by it.  They've got all their own money back, and all of ourn but a shekel or two besides.  G'long to bed, and don't you deffersit me no more deffersits, long 's you live!” So the king sneaked into the wigwam and took to his bottle for comfort, and before long the duke tackled HIS bottle; and so in about a half an hour they was as thick as thieves again, and the tighter they got the lovinger they got, and went off a-snoring in each other's arms.  They both got powerful mellow, but I noticed the king didn't get mellow enough to forget to remember to not deny about hiding the money-bag again.  That made me feel easy and satisfied.  Of course when they got to snoring we had a long gabble, and I told Jim everything. CHAPTER XXXI. WE dasn't stop again at any town for days and days; kept right along down the river.  We was down south in the warm weather now, and a mighty long ways from home.  We begun to come to trees with Spanish moss on them, hanging down from the limbs like long, gray beards.  It was the first I ever see it growing, and it made the woods look solemn and dismal.  So now the frauds reckoned they was out of danger, and they begun to work the villages again. First they done a lecture on temperance; but they didn't make enough for them both to get drunk on.  Then in another village they started a dancing-school; but they didn't know no more how to dance than a kangaroo does; so the first prance they made the general public jumped in and pranced them out of town.  Another time they tried to go at yellocution; but they didn't yellocute long till the audience got up and give them a solid good cussing, and made them skip out.  They tackled missionarying, and mesmerizing, and doctoring, and telling fortunes, and a little of everything; but they couldn't seem to have no luck.  So at last they got just about dead broke, and laid around the raft as she floated along, thinking and thinking, and never saying nothing, by the half a day at a time, and dreadful blue and desperate. And at last they took a change and begun to lay their heads together in the wigwam and talk low and confidential two or three hours at a time. Jim and me got uneasy.  We didn't like the look of it.  We judged they was studying up some kind of worse deviltry than ever.  We turned it over and over, and at last we made up our minds they was going to break into somebody's house or store, or was going into the counterfeit-money business, or something. So then we was pretty scared, and made up an agreement that we wouldn't have nothing in the world to do with such actions, and if we ever got the least show we would give them the cold shake and clear out and leave them behind. Well, early one morning we hid the raft in a good, safe place about two mile below a little bit of a shabby village named Pikesville, and the king he went ashore and told us all to stay hid whilst he went up to town and smelt around to see if anybody had got any wind of the Royal Nonesuch there yet. (“House to rob, you mean,” says I to myself; “and when you get through robbing it you'll come back here and wonder what has become of me and Jim and the raft—and you'll have to take it out in wondering.”) And he said if he warn't back by midday the duke and me would know it was all right, and we was to come along. So we stayed where we was.  The duke he fretted and sweated around, and was in a mighty sour way.  He scolded us for everything, and we couldn't seem to do nothing right; he found fault with every little thing. Something was a-brewing, sure.  I was good and glad when midday come and no king; we could have a change, anyway—and maybe a chance for the change on top of it.  So me and the duke went up to the village, and hunted around there for the king, and by and by we found him in the back room of a little low doggery, very tight, and a lot of loafers bullyragging him for sport, and he a-cussing and a-threatening with all his might, and so tight he couldn't walk, and couldn't do nothing to them.  The duke he begun to abuse him for an old fool, and the king begun to sass back, and the minute they was fairly at it I lit out and shook the reefs out of my hind legs, and spun down the river road like a deer, for I see our chance; and I made up my mind that it would be a long day before they ever see me and Jim again.  I got down there all out of breath but loaded up with joy, and sung out: “Set her loose, Jim! we're all right now!” But there warn't no answer, and nobody come out of the wigwam.  Jim was gone!  I set up a shout—and then another—and then another one; and run this way and that in the woods, whooping and screeching; but it warn't no use—old Jim was gone.  Then I set down and cried; I couldn't help it. But I couldn't set still long.  Pretty soon I went out on the road, trying to think what I better do, and I run across a boy walking, and asked him if he'd seen a strange nigger dressed so and so, and he says: “Yes.” “Whereabouts?” says I. “Down to Silas Phelps' place, two mile below here.  He's a runaway nigger, and they've got him.  Was you looking for him?” “You bet I ain't!  I run across him in the woods about an hour or two ago, and he said if I hollered he'd cut my livers out—and told me to lay down and stay where I was; and I done it.  Been there ever since; afeard to come out.” “Well,” he says, “you needn't be afeard no more, becuz they've got him. He run off f'm down South, som'ers.” “It's a good job they got him.” “Well, I reckon!  There's two hunderd dollars reward on him.  It's like picking up money out'n the road.” “Yes, it is—and I could a had it if I'd been big enough; I see him first. Who nailed him?” “It was an old fellow—a stranger—and he sold out his chance in him for forty dollars, becuz he's got to go up the river and can't wait.  Think o' that, now!  You bet I'd wait, if it was seven year.” “That's me, every time,” says I.  "But maybe his chance ain't worth no more than that, if he'll sell it so cheap.  Maybe there's something ain't straight about it.” “But it is, though—straight as a string.  I see the handbill myself.  It tells all about him, to a dot—paints him like a picture, and tells the plantation he's frum, below Newrleans.  No-sirree-bob, they ain't no trouble 'bout that speculation, you bet you.  Say, gimme a chaw tobacker, won't ye?” I didn't have none, so he left.  I went to the raft, and set down in the wigwam to think.  But I couldn't come to nothing.  I thought till I wore my head sore, but I couldn't see no way out of the trouble.  After all this long journey, and after all we'd done for them scoundrels, here it was all come to nothing, everything all busted up and ruined, because they could have the heart to serve Jim such a trick as that, and make him a slave again all his life, and amongst strangers, too, for forty dirty dollars. Once I said to myself it would be a thousand times better for Jim to be a slave at home where his family was, as long as he'd got to be a slave, and so I'd better write a letter to Tom Sawyer and tell him to tell Miss Watson where he was.  But I soon give up that notion for two things: she'd be mad and disgusted at his rascality and ungratefulness for leaving her, and so she'd sell him straight down the river again; and if she didn't, everybody naturally despises an ungrateful nigger, and they'd make Jim feel it all the time, and so he'd feel ornery and disgraced. And then think of me!  It would get all around that Huck Finn helped a nigger to get his freedom; and if I was ever to see anybody from that town again I'd be ready to get down and lick his boots for shame.  That's just the way:  a person does a low-down thing, and then he don't want to take no consequences of it. Thinks as long as he can hide it, it ain't no disgrace.  That was my fix exactly. The more I studied about this the more my conscience went to grinding me, and the more wicked and low-down and ornery I got to feeling. And at last, when it hit me all of a sudden that here was the plain hand of Providence slapping me in the face and letting me know my wickedness was being watched all the time from up there in heaven, whilst I was stealing a poor old woman's nigger that hadn't ever done me no harm, and now was showing me there's One that's always on the lookout, and ain't a-going to allow no such miserable doings to go only just so fur and no further, I most dropped in my tracks I was so scared.  Well, I tried the best I could to kinder soften it up somehow for myself by saying I was brung up wicked, and so I warn't so much to blame; but something inside of me kept saying, “There was the Sunday-school, you could a gone to it; and if you'd a done it they'd a learnt you there that people that acts as I'd been acting about that nigger goes to everlasting fire.” It made me shiver.  And I about made up my mind to pray, and see if I couldn't try to quit being the kind of a boy I was and be better.  So I kneeled down.  But the words wouldn't come.  Why wouldn't they?  It warn't no use to try and hide it from Him.  Nor from me, neither.  I knowed very well why they wouldn't come.  It was because my heart warn't right; it was because I warn't square; it was because I was playing double.  I was letting on to give up sin, but away inside of me I was holding on to the biggest one of all.  I was trying to make my mouth say I would do the right thing and the clean thing, and go and write to that nigger's owner and tell where he was; but deep down in me I knowed it was a lie, and He knowed it.  You can't pray a lie—I found that out. So I was full of trouble, full as I could be; and didn't know what to do. At last I had an idea; and I says, I'll go and write the letter—and then see if I can pray.  Why, it was astonishing, the way I felt as light as a feather right straight off, and my troubles all gone.  So I got a piece of paper and a pencil, all glad and excited, and set down and wrote: Miss Watson, your runaway nigger Jim is down here two mile below Pikesville, and Mr. Phelps has got him and he will give him up for the reward if you send. Huck Finn. I felt good and all washed clean of sin for the first time I had ever felt so in my life, and I knowed I could pray now.  But I didn't do it straight off, but laid the paper down and set there thinking—thinking how good it was all this happened so, and how near I come to being lost and going to hell.  And went on thinking.  And got to thinking over our trip down the river; and I see Jim before me all the time:  in the day and in the night-time, sometimes moonlight, sometimes storms, and we a-floating along, talking and singing and laughing.  But somehow I couldn't seem to strike no places to harden me against him, but only the other kind.  I'd see him standing my watch on top of his'n, 'stead of calling me, so I could go on sleeping; and see him how glad he was when I come back out of the fog; and when I come to him again in the swamp, up there where the feud was; and such-like times; and would always call me honey, and pet me and do everything he could think of for me, and how good he always was; and at last I struck the time I saved him by telling the men we had small-pox aboard, and he was so grateful, and said I was the best friend old Jim ever had in the world, and the only one he's got now; and then I happened to look around and see that paper. It was a close place.  I took it up, and held it in my hand.  I was a-trembling, because I'd got to decide, forever, betwixt two things, and I knowed it.  I studied a minute, sort of holding my breath, and then says to myself: “All right, then, I'll go to hell”—and tore it up. It was awful thoughts and awful words, but they was said.  And I let them stay said; and never thought no more about reforming.  I shoved the whole thing out of my head, and said I would take up wickedness again, which was in my line, being brung up to it, and the other warn't.  And for a starter I would go to work and steal Jim out of slavery again; and if I could think up anything worse, I would do that, too; because as long as I was in, and in for good, I might as well go the whole hog. Then I set to thinking over how to get at it, and turned over some considerable many ways in my mind; and at last fixed up a plan that suited me.  So then I took the bearings of a woody island that was down the river a piece, and as soon as it was fairly dark I crept out with my raft and went for it, and hid it there, and then turned in.  I slept the night through, and got up before it was light, and had my breakfast, and put on my store clothes, and tied up some others and one thing or another in a bundle, and took the canoe and cleared for shore.  I landed below where I judged was Phelps's place, and hid my bundle in the woods, and then filled up the canoe with water, and loaded rocks into her and sunk her where I could find her again when I wanted her, about a quarter of a mile below a little steam sawmill that was on the bank. Then I struck up the road, and when I passed the mill I see a sign on it, “Phelps's Sawmill,” and when I come to the farm-houses, two or three hundred yards further along, I kept my eyes peeled, but didn't see nobody around, though it was good daylight now.  But I didn't mind, because I didn't want to see nobody just yet—I only wanted to get the lay of the land. According to my plan, I was going to turn up there from the village, not from below.  So I just took a look, and shoved along, straight for town. Well, the very first man I see when I got there was the duke.  He was sticking up a bill for the Royal Nonesuch—three-night performance—like that other time.  They had the cheek, them frauds!  I was right on him before I could shirk.  He looked astonished, and says: “Hel-lo!  Where'd you come from?”  Then he says, kind of glad and eager, “Where's the raft?—got her in a good place?” I says: “Why, that's just what I was going to ask your grace.” Then he didn't look so joyful, and says: “What was your idea for asking me?” he says. “Well,” I says, “when I see the king in that doggery yesterday I says to myself, we can't get him home for hours, till he's soberer; so I went a-loafing around town to put in the time and wait.  A man up and offered me ten cents to help him pull a skiff over the river and back to fetch a sheep, and so I went along; but when we was dragging him to the boat, and the man left me a-holt of the rope and went behind him to shove him along, he was too strong for me and jerked loose and run, and we after him.  We didn't have no dog, and so we had to chase him all over the country till we tired him out.  We never got him till dark; then we fetched him over, and I started down for the raft.  When I got there and see it was gone, I says to myself, 'They've got into trouble and had to leave; and they've took my nigger, which is the only nigger I've got in the world, and now I'm in a strange country, and ain't got no property no more, nor nothing, and no way to make my living;' so I set down and cried.  I slept in the woods all night.  But what did become of the raft, then?—and Jim—poor Jim!” “Blamed if I know—that is, what's become of the raft.  That old fool had made a trade and got forty dollars, and when we found him in the doggery the loafers had matched half-dollars with him and got every cent but what he'd spent for whisky; and when I got him home late last night and found the raft gone, we said, 'That little rascal has stole our raft and shook us, and run off down the river.'” “I wouldn't shake my nigger, would I?—the only nigger I had in the world, and the only property.” “We never thought of that.  Fact is, I reckon we'd come to consider him our nigger; yes, we did consider him so—goodness knows we had trouble enough for him.  So when we see the raft was gone and we flat broke, there warn't anything for it but to try the Royal Nonesuch another shake. And I've pegged along ever since, dry as a powder-horn.  Where's that ten cents? Give it here.” I had considerable money, so I give him ten cents, but begged him to spend it for something to eat, and give me some, because it was all the money I had, and I hadn't had nothing to eat since yesterday.  He never said nothing.  The next minute he whirls on me and says: “Do you reckon that nigger would blow on us?  We'd skin him if he done that!” “How can he blow?  Hain't he run off?” “No!  That old fool sold him, and never divided with me, and the money's gone.” “Sold him?”  I says, and begun to cry; “why, he was my nigger, and that was my money.  Where is he?—I want my nigger.” “Well, you can't get your nigger, that's all—so dry up your blubbering. Looky here—do you think you'd venture to blow on us?  Blamed if I think I'd trust you.  Why, if you was to blow on us—” He stopped, but I never see the duke look so ugly out of his eyes before. I went on a-whimpering, and says: “I don't want to blow on nobody; and I ain't got no time to blow, nohow. I got to turn out and find my nigger.” He looked kinder bothered, and stood there with his bills fluttering on his arm, thinking, and wrinkling up his forehead.  At last he says: “I'll tell you something.  We got to be here three days.  If you'll promise you won't blow, and won't let the nigger blow, I'll tell you where to find him.” So I promised, and he says: “A farmer by the name of Silas Ph—” and then he stopped.  You see, he started to tell me the truth; but when he stopped that way, and begun to study and think again, I reckoned he was changing his mind.  And so he was. He wouldn't trust me; he wanted to make sure of having me out of the way the whole three days.  So pretty soon he says: “The man that bought him is named Abram Foster—Abram G. Foster—and he lives forty mile back here in the country, on the road to Lafayette.” “All right,” I says, “I can walk it in three days.  And I'll start this very afternoon.” “No you wont, you'll start now; and don't you lose any time about it, neither, nor do any gabbling by the way.  Just keep a tight tongue in your head and move right along, and then you won't get into trouble with us, d'ye hear?” That was the order I wanted, and that was the one I played for.  I wanted to be left free to work my plans. “So clear out,” he says; “and you can tell Mr. Foster whatever you want to. Maybe you can get him to believe that Jim is your nigger—some idiots don't require documents—leastways I've heard there's such down South here.  And when you tell him the handbill and the reward's bogus, maybe he'll believe you when you explain to him what the idea was for getting 'em out.  Go 'long now, and tell him anything you want to; but mind you don't work your jaw any between here and there.” So I left, and struck for the back country.  I didn't look around, but I kinder felt like he was watching me.  But I knowed I could tire him out at that.  I went straight out in the country as much as a mile before I stopped; then I doubled back through the woods towards Phelps'.  I reckoned I better start in on my plan straight off without fooling around, because I wanted to stop Jim's mouth till these fellows could get away.  I didn't want no trouble with their kind.  I'd seen all I wanted to of them, and wanted to get entirely shut of them. CHAPTER XXXII. WHEN I got there it was all still and Sunday-like, and hot and sunshiny; the hands was gone to the fields; and there was them kind of faint dronings of bugs and flies in the air that makes it seem so lonesome and like everybody's dead and gone; and if a breeze fans along and quivers the leaves it makes you feel mournful, because you feel like it's spirits whispering—spirits that's been dead ever so many years—and you always think they're talking about you.  As a general thing it makes a body wish he was dead, too, and done with it all. Phelps' was one of these little one-horse cotton plantations, and they all look alike.  A rail fence round a two-acre yard; a stile made out of logs sawed off and up-ended in steps, like barrels of a different length, to climb over the fence with, and for the women to stand on when they are going to jump on to a horse; some sickly grass-patches in the big yard, but mostly it was bare and smooth, like an old hat with the nap rubbed off; big double log-house for the white folks—hewed logs, with the chinks stopped up with mud or mortar, and these mud-stripes been whitewashed some time or another; round-log kitchen, with a big broad, open but roofed passage joining it to the house; log smoke-house back of the kitchen; three little log nigger-cabins in a row t'other side the smoke-house; one little hut all by itself away down against the back fence, and some outbuildings down a piece the other side; ash-hopper and big kettle to bile soap in by the little hut; bench by the kitchen door, with bucket of water and a gourd; hound asleep there in the sun; more hounds asleep round about; about three shade trees away off in a corner; some currant bushes and gooseberry bushes in one place by the fence; outside of the fence a garden and a watermelon patch; then the cotton fields begins, and after the fields the woods. I went around and clumb over the back stile by the ash-hopper, and started for the kitchen.  When I got a little ways I heard the dim hum of a spinning-wheel wailing along up and sinking along down again; and then I knowed for certain I wished I was dead—for that is the lonesomest sound in the whole world. I went right along, not fixing up any particular plan, but just trusting to Providence to put the right words in my mouth when the time come; for I'd noticed that Providence always did put the right words in my mouth if I left it alone. When I got half-way, first one hound and then another got up and went for me, and of course I stopped and faced them, and kept still.  And such another powwow as they made!  In a quarter of a minute I was a kind of a hub of a wheel, as you may say—spokes made out of dogs—circle of fifteen of them packed together around me, with their necks and noses stretched up towards me, a-barking and howling; and more a-coming; you could see them sailing over fences and around corners from everywheres. A nigger woman come tearing out of the kitchen with a rolling-pin in her hand, singing out, “Begone you Tige! you Spot! begone sah!” and she fetched first one and then another of them a clip and sent them howling, and then the rest followed; and the next second half of them come back, wagging their tails around me, and making friends with me.  There ain't no harm in a hound, nohow. And behind the woman comes a little nigger girl and two little nigger boys without anything on but tow-linen shirts, and they hung on to their mother's gown, and peeped out from behind her at me, bashful, the way they always do.  And here comes the white woman running from the house, about forty-five or fifty year old, bareheaded, and her spinning-stick in her hand; and behind her comes her little white children, acting the same way the little niggers was doing.  She was smiling all over so she could hardly stand—and says: “It's you, at last!—ain't it?” I out with a “Yes'm” before I thought. She grabbed me and hugged me tight; and then gripped me by both hands and shook and shook; and the tears come in her eyes, and run down over; and she couldn't seem to hug and shake enough, and kept saying, “You don't look as much like your mother as I reckoned you would; but law sakes, I don't care for that, I'm so glad to see you!  Dear, dear, it does seem like I could eat you up!  Children, it's your cousin Tom!—tell him howdy.” But they ducked their heads, and put their fingers in their mouths, and hid behind her.  So she run on: “Lize, hurry up and get him a hot breakfast right away—or did you get your breakfast on the boat?” I said I had got it on the boat.  So then she started for the house, leading me by the hand, and the children tagging after.  When we got there she set me down in a split-bottomed chair, and set herself down on a little low stool in front of me, holding both of my hands, and says: “Now I can have a good look at you; and, laws-a-me, I've been hungry for it a many and a many a time, all these long years, and it's come at last! We been expecting you a couple of days and more.  What kep' you?—boat get aground?” “Yes'm—she—” “Don't say yes'm—say Aunt Sally.  Where'd she get aground?” I didn't rightly know what to say, because I didn't know whether the boat would be coming up the river or down.  But I go a good deal on instinct; and my instinct said she would be coming up—from down towards Orleans. That didn't help me much, though; for I didn't know the names of bars down that way.  I see I'd got to invent a bar, or forget the name of the one we got aground on—or—Now I struck an idea, and fetched it out: “It warn't the grounding—that didn't keep us back but a little.  We blowed out a cylinder-head.” “Good gracious! anybody hurt?” “No'm.  Killed a nigger.” “Well, it's lucky; because sometimes people do get hurt.  Two years ago last Christmas your uncle Silas was coming up from Newrleans on the old Lally Rook, and she blowed out a cylinder-head and crippled a man.  And I think he died afterwards.  He was a Baptist.  Your uncle Silas knowed a family in Baton Rouge that knowed his people very well.  Yes, I remember now, he did die.  Mortification set in, and they had to amputate him. But it didn't save him.  Yes, it was mortification—that was it.  He turned blue all over, and died in the hope of a glorious resurrection. They say he was a sight to look at.  Your uncle's been up to the town every day to fetch you. And he's gone again, not more'n an hour ago; he'll be back any minute now. You must a met him on the road, didn't you?—oldish man, with a—” “No, I didn't see nobody, Aunt Sally.  The boat landed just at daylight, and I left my baggage on the wharf-boat and went looking around the town and out a piece in the country, to put in the time and not get here too soon; and so I come down the back way.” “Who'd you give the baggage to?” “Nobody.” “Why, child, it 'll be stole!” “Not where I hid it I reckon it won't,” I says. “How'd you get your breakfast so early on the boat?” It was kinder thin ice, but I says: “The captain see me standing around, and told me I better have something to eat before I went ashore; so he took me in the texas to the officers' lunch, and give me all I wanted.” I was getting so uneasy I couldn't listen good.  I had my mind on the children all the time; I wanted to get them out to one side and pump them a little, and find out who I was.  But I couldn't get no show, Mrs. Phelps kept it up and run on so.  Pretty soon she made the cold chills streak all down my back, because she says: “But here we're a-running on this way, and you hain't told me a word about Sis, nor any of them.  Now I'll rest my works a little, and you start up yourn; just tell me everything—tell me all about 'm all every one of 'm; and how they are, and what they're doing, and what they told you to tell me; and every last thing you can think of.” Well, I see I was up a stump—and up it good.  Providence had stood by me this fur all right, but I was hard and tight aground now.  I see it warn't a bit of use to try to go ahead—I'd got to throw up my hand.  So I says to myself, here's another place where I got to resk the truth.  I opened my mouth to begin; but she grabbed me and hustled me in behind the bed, and says: “Here he comes!  Stick your head down lower—there, that'll do; you can't be seen now.  Don't you let on you're here.  I'll play a joke on him. Children, don't you say a word.” I see I was in a fix now.  But it warn't no use to worry; there warn't nothing to do but just hold still, and try and be ready to stand from under when the lightning struck. I had just one little glimpse of the old gentleman when he come in; then the bed hid him.  Mrs. Phelps she jumps for him, and says: “Has he come?” “No,” says her husband. “Good-ness gracious!” she says, “what in the warld can have become of him?” “I can't imagine,” says the old gentleman; “and I must say it makes me dreadful uneasy.” “Uneasy!” she says; “I'm ready to go distracted!  He must a come; and you've missed him along the road.  I know it's so—something tells me so.” “Why, Sally, I couldn't miss him along the road—you know that.” “But oh, dear, dear, what will Sis say!  He must a come!  You must a missed him.  He—” “Oh, don't distress me any more'n I'm already distressed.  I don't know what in the world to make of it.  I'm at my wit's end, and I don't mind acknowledging 't I'm right down scared.  But there's no hope that he's come; for he couldn't come and me miss him.  Sally, it's terrible—just terrible—something's happened to the boat, sure!” “Why, Silas!  Look yonder!—up the road!—ain't that somebody coming?” He sprung to the window at the head of the bed, and that give Mrs. Phelps the chance she wanted.  She stooped down quick at the foot of the bed and give me a pull, and out I come; and when he turned back from the window there she stood, a-beaming and a-smiling like a house afire, and I standing pretty meek and sweaty alongside.  The old gentleman stared, and says: “Why, who's that?” “Who do you reckon 't is?” “I hain't no idea.  Who is it?” “It's Tom Sawyer!” By jings, I most slumped through the floor!  But there warn't no time to swap knives; the old man grabbed me by the hand and shook, and kept on shaking; and all the time how the woman did dance around and laugh and cry; and then how they both did fire off questions about Sid, and Mary, and the rest of the tribe. But if they was joyful, it warn't nothing to what I was; for it was like being born again, I was so glad to find out who I was.  Well, they froze to me for two hours; and at last, when my chin was so tired it couldn't hardly go any more, I had told them more about my family—I mean the Sawyer family—than ever happened to any six Sawyer families.  And I explained all about how we blowed out a cylinder-head at the mouth of White River, and it took us three days to fix it.  Which was all right, and worked first-rate; because they didn't know but what it would take three days to fix it.  If I'd a called it a bolthead it would a done just as well. Now I was feeling pretty comfortable all down one side, and pretty uncomfortable all up the other.  Being Tom Sawyer was easy and comfortable, and it stayed easy and comfortable till by and by I hear a steamboat coughing along down the river.  Then I says to myself, s'pose Tom Sawyer comes down on that boat?  And s'pose he steps in here any minute, and sings out my name before I can throw him a wink to keep quiet? Well, I couldn't have it that way; it wouldn't do at all.  I must go up the road and waylay him.  So I told the folks I reckoned I would go up to the town and fetch down my baggage.  The old gentleman was for going along with me, but I said no, I could drive the horse myself, and I druther he wouldn't take no trouble about me. CHAPTER XXXIII. SO I started for town in the wagon, and when I was half-way I see a wagon coming, and sure enough it was Tom Sawyer, and I stopped and waited till he come along.  I says “Hold on!” and it stopped alongside, and his mouth opened up like a trunk, and stayed so; and he swallowed two or three times like a person that's got a dry throat, and then says: “I hain't ever done you no harm.  You know that.  So, then, what you want to come back and ha'nt me for?” I says: “I hain't come back—I hain't been gone.” When he heard my voice it righted him up some, but he warn't quite satisfied yet.  He says: “Don't you play nothing on me, because I wouldn't on you.  Honest injun now, you ain't a ghost?” “Honest injun, I ain't,” I says. “Well—I—I—well, that ought to settle it, of course; but I can't somehow seem to understand it no way.  Looky here, warn't you ever murdered at all?” “No.  I warn't ever murdered at all—I played it on them.  You come in here and feel of me if you don't believe me.” So he done it; and it satisfied him; and he was that glad to see me again he didn't know what to do.  And he wanted to know all about it right off, because it was a grand adventure, and mysterious, and so it hit him where he lived.  But I said, leave it alone till by and by; and told his driver to wait, and we drove off a little piece, and I told him the kind of a fix I was in, and what did he reckon we better do?  He said, let him alone a minute, and don't disturb him.  So he thought and thought, and pretty soon he says: “It's all right; I've got it.  Take my trunk in your wagon, and let on it's your'n; and you turn back and fool along slow, so as to get to the house about the time you ought to; and I'll go towards town a piece, and take a fresh start, and get there a quarter or a half an hour after you; and you needn't let on to know me at first.” I says: “All right; but wait a minute.  There's one more thing—a thing that nobody don't know but me.  And that is, there's a nigger here that I'm a-trying to steal out of slavery, and his name is Jim—old Miss Watson's Jim.” He says: “What!  Why, Jim is—” He stopped and went to studying.  I says: “I know what you'll say.  You'll say it's dirty, low-down business; but what if it is?  I'm low down; and I'm a-going to steal him, and I want you keep mum and not let on.  Will you?” His eye lit up, and he says: “I'll help you steal him!” Well, I let go all holts then, like I was shot.  It was the most astonishing speech I ever heard—and I'm bound to say Tom Sawyer fell considerable in my estimation.  Only I couldn't believe it.  Tom Sawyer a nigger-stealer! “Oh, shucks!”  I says; “you're joking.” “I ain't joking, either.” “Well, then,” I says, “joking or no joking, if you hear anything said about a runaway nigger, don't forget to remember that you don't know nothing about him, and I don't know nothing about him.” Then we took the trunk and put it in my wagon, and he drove off his way and I drove mine.  But of course I forgot all about driving slow on accounts of being glad and full of thinking; so I got home a heap too quick for that length of a trip.  The old gentleman was at the door, and he says: “Why, this is wonderful!  Whoever would a thought it was in that mare to do it?  I wish we'd a timed her.  And she hain't sweated a hair—not a hair. It's wonderful.  Why, I wouldn't take a hundred dollars for that horse now—I wouldn't, honest; and yet I'd a sold her for fifteen before, and thought 'twas all she was worth.” That's all he said.  He was the innocentest, best old soul I ever see. But it warn't surprising; because he warn't only just a farmer, he was a preacher, too, and had a little one-horse log church down back of the plantation, which he built it himself at his own expense, for a church and schoolhouse, and never charged nothing for his preaching, and it was worth it, too.  There was plenty other farmer-preachers like that, and done the same way, down South. In about half an hour Tom's wagon drove up to the front stile, and Aunt Sally she see it through the window, because it was only about fifty yards, and says: “Why, there's somebody come!  I wonder who 'tis?  Why, I do believe it's a stranger.  Jimmy” (that's one of the children) “run and tell Lize to put on another plate for dinner.” Everybody made a rush for the front door, because, of course, a stranger don't come every year, and so he lays over the yaller-fever, for interest, when he does come.  Tom was over the stile and starting for the house; the wagon was spinning up the road for the village, and we was all bunched in the front door.  Tom had his store clothes on, and an audience—and that was always nuts for Tom Sawyer.  In them circumstances it warn't no trouble to him to throw in an amount of style that was suitable.  He warn't a boy to meeky along up that yard like a sheep; no, he come ca'm and important, like the ram.  When he got a-front of us he lifts his hat ever so gracious and dainty, like it was the lid of a box that had butterflies asleep in it and he didn't want to disturb them, and says: “Mr. Archibald Nichols, I presume?” “No, my boy,” says the old gentleman, “I'm sorry to say 't your driver has deceived you; Nichols's place is down a matter of three mile more. Come in, come in.” Tom he took a look back over his shoulder, and says, “Too late—he's out of sight.” “Yes, he's gone, my son, and you must come in and eat your dinner with us; and then we'll hitch up and take you down to Nichols's.” “Oh, I can't make you so much trouble; I couldn't think of it.  I'll walk—I don't mind the distance.” “But we won't let you walk—it wouldn't be Southern hospitality to do it. Come right in.” “Oh, do,” says Aunt Sally; “it ain't a bit of trouble to us, not a bit in the world.  You must stay.  It's a long, dusty three mile, and we can't let you walk.  And, besides, I've already told 'em to put on another plate when I see you coming; so you mustn't disappoint us.  Come right in and make yourself at home.” So Tom he thanked them very hearty and handsome, and let himself be persuaded, and come in; and when he was in he said he was a stranger from Hicksville, Ohio, and his name was William Thompson—and he made another bow. Well, he run on, and on, and on, making up stuff about Hicksville and everybody in it he could invent, and I getting a little nervious, and wondering how this was going to help me out of my scrape; and at last, still talking along, he reached over and kissed Aunt Sally right on the mouth, and then settled back again in his chair comfortable, and was going on talking; but she jumped up and wiped it off with the back of her hand, and says: “You owdacious puppy!” He looked kind of hurt, and says: “I'm surprised at you, m'am.” “You're s'rp—Why, what do you reckon I am?  I've a good notion to take and—Say, what do you mean by kissing me?” He looked kind of humble, and says: “I didn't mean nothing, m'am.  I didn't mean no harm.  I—I—thought you'd like it.” “Why, you born fool!”  She took up the spinning stick, and it looked like it was all she could do to keep from giving him a crack with it.  "What made you think I'd like it?” “Well, I don't know.  Only, they—they—told me you would.” “They told you I would.  Whoever told you's another lunatic.  I never heard the beat of it.  Who's they?” “Why, everybody.  They all said so, m'am.” It was all she could do to hold in; and her eyes snapped, and her fingers worked like she wanted to scratch him; and she says: “Who's 'everybody'?  Out with their names, or ther'll be an idiot short.” He got up and looked distressed, and fumbled his hat, and says: “I'm sorry, and I warn't expecting it.  They told me to.  They all told me to.  They all said, kiss her; and said she'd like it.  They all said it—every one of them.  But I'm sorry, m'am, and I won't do it no more—I won't, honest.” “You won't, won't you?  Well, I sh'd reckon you won't!” “No'm, I'm honest about it; I won't ever do it again—till you ask me.” “Till I ask you!  Well, I never see the beat of it in my born days!  I lay you'll be the Methusalem-numskull of creation before ever I ask you—or the likes of you.” “Well,” he says, “it does surprise me so.  I can't make it out, somehow. They said you would, and I thought you would.  But—” He stopped and looked around slow, like he wished he could run across a friendly eye somewheres, and fetched up on the old gentleman's, and says, “Didn't you think she'd like me to kiss her, sir?” “Why, no; I—I—well, no, I b'lieve I didn't.” Then he looks on around the same way to me, and says: “Tom, didn't you think Aunt Sally 'd open out her arms and say, 'Sid Sawyer—'” “My land!” she says, breaking in and jumping for him, “you impudent young rascal, to fool a body so—” and was going to hug him, but he fended her off, and says: “No, not till you've asked me first.” So she didn't lose no time, but asked him; and hugged him and kissed him over and over again, and then turned him over to the old man, and he took what was left.  And after they got a little quiet again she says: “Why, dear me, I never see such a surprise.  We warn't looking for you at all, but only Tom.  Sis never wrote to me about anybody coming but him.” “It's because it warn't intended for any of us to come but Tom,” he says; “but I begged and begged, and at the last minute she let me come, too; so, coming down the river, me and Tom thought it would be a first-rate surprise for him to come here to the house first, and for me to by and by tag along and drop in, and let on to be a stranger.  But it was a mistake, Aunt Sally.  This ain't no healthy place for a stranger to come.” “No—not impudent whelps, Sid.  You ought to had your jaws boxed; I hain't been so put out since I don't know when.  But I don't care, I don't mind the terms—I'd be willing to stand a thousand such jokes to have you here. Well, to think of that performance!  I don't deny it, I was most putrified with astonishment when you give me that smack.” We had dinner out in that broad open passage betwixt the house and the kitchen; and there was things enough on that table for seven families—and all hot, too; none of your flabby, tough meat that's laid in a cupboard in a damp cellar all night and tastes like a hunk of old cold cannibal in the morning.  Uncle Silas he asked a pretty long blessing over it, but it was worth it; and it didn't cool it a bit, neither, the way I've seen them kind of interruptions do lots of times.  There was a considerable good deal of talk all the afternoon, and me and Tom was on the lookout all the time; but it warn't no use, they didn't happen to say nothing about any runaway nigger, and we was afraid to try to work up to it.  But at supper, at night, one of the little boys says: “Pa, mayn't Tom and Sid and me go to the show?” “No,” says the old man, “I reckon there ain't going to be any; and you couldn't go if there was; because the runaway nigger told Burton and me all about that scandalous show, and Burton said he would tell the people; so I reckon they've drove the owdacious loafers out of town before this time.” So there it was!—but I couldn't help it.  Tom and me was to sleep in the same room and bed; so, being tired, we bid good-night and went up to bed right after supper, and clumb out of the window and down the lightning-rod, and shoved for the town; for I didn't believe anybody was going to give the king and the duke a hint, and so if I didn't hurry up and give them one they'd get into trouble sure. On the road Tom he told me all about how it was reckoned I was murdered, and how pap disappeared pretty soon, and didn't come back no more, and what a stir there was when Jim run away; and I told Tom all about our Royal Nonesuch rapscallions, and as much of the raft voyage as I had time to; and as we struck into the town and up through the the middle of it--it was as much as half-after eight, then—here comes a raging rush of people with torches, and an awful whooping and yelling, and banging tin pans and blowing horns; and we jumped to one side to let them go by; and as they went by I see they had the king and the duke astraddle of a rail—that is, I knowed it was the king and the duke, though they was all over tar and feathers, and didn't look like nothing in the world that was human—just looked like a couple of monstrous big soldier-plumes.  Well, it made me sick to see it; and I was sorry for them poor pitiful rascals, it seemed like I couldn't ever feel any hardness against them any more in the world.  It was a dreadful thing to see.  Human beings can be awful cruel to one another. We see we was too late—couldn't do no good.  We asked some stragglers about it, and they said everybody went to the show looking very innocent; and laid low and kept dark till the poor old king was in the middle of his cavortings on the stage; then somebody give a signal, and the house rose up and went for them. So we poked along back home, and I warn't feeling so brash as I was before, but kind of ornery, and humble, and to blame, somehow—though I hadn't done nothing.  But that's always the way; it don't make no difference whether you do right or wrong, a person's conscience ain't got no sense, and just goes for him anyway.  If I had a yaller dog that didn't know no more than a person's conscience does I would pison him. It takes up more room than all the rest of a person's insides, and yet ain't no good, nohow.  Tom Sawyer he says the same. CHAPTER XXXIV. WE stopped talking, and got to thinking.  By and by Tom says: “Looky here, Huck, what fools we are to not think of it before!  I bet I know where Jim is.” “No!  Where?” “In that hut down by the ash-hopper.  Why, looky here.  When we was at dinner, didn't you see a nigger man go in there with some vittles?” “Yes.” “What did you think the vittles was for?” “For a dog.” “So 'd I. Well, it wasn't for a dog.” “Why?” “Because part of it was watermelon.” “So it was—I noticed it.  Well, it does beat all that I never thought about a dog not eating watermelon.  It shows how a body can see and don't see at the same time.” “Well, the nigger unlocked the padlock when he went in, and he locked it again when he came out.  He fetched uncle a key about the time we got up from table—same key, I bet.  Watermelon shows man, lock shows prisoner; and it ain't likely there's two prisoners on such a little plantation, and where the people's all so kind and good.  Jim's the prisoner.  All right—I'm glad we found it out detective fashion; I wouldn't give shucks for any other way.  Now you work your mind, and study out a plan to steal Jim, and I will study out one, too; and we'll take the one we like the best.” What a head for just a boy to have!  If I had Tom Sawyer's head I wouldn't trade it off to be a duke, nor mate of a steamboat, nor clown in a circus, nor nothing I can think of.  I went to thinking out a plan, but only just to be doing something; I knowed very well where the right plan was going to come from.  Pretty soon Tom says: “Ready?” “Yes,” I says. “All right—bring it out.” “My plan is this,” I says.  "We can easy find out if it's Jim in there. Then get up my canoe to-morrow night, and fetch my raft over from the island.  Then the first dark night that comes steal the key out of the old man's britches after he goes to bed, and shove off down the river on the raft with Jim, hiding daytimes and running nights, the way me and Jim used to do before.  Wouldn't that plan work?” “Work?  Why, cert'nly it would work, like rats a-fighting.  But it's too blame' simple; there ain't nothing to it.  What's the good of a plan that ain't no more trouble than that?  It's as mild as goose-milk.  Why, Huck, it wouldn't make no more talk than breaking into a soap factory.” I never said nothing, because I warn't expecting nothing different; but I knowed mighty well that whenever he got his plan ready it wouldn't have none of them objections to it. And it didn't.  He told me what it was, and I see in a minute it was worth fifteen of mine for style, and would make Jim just as free a man as mine would, and maybe get us all killed besides.  So I was satisfied, and said we would waltz in on it.  I needn't tell what it was here, because I knowed it wouldn't stay the way, it was.  I knowed he would be changing it around every which way as we went along, and heaving in new bullinesses wherever he got a chance.  And that is what he done. Well, one thing was dead sure, and that was that Tom Sawyer was in earnest, and was actuly going to help steal that nigger out of slavery. That was the thing that was too many for me.  Here was a boy that was respectable and well brung up; and had a character to lose; and folks at home that had characters; and he was bright and not leather-headed; and knowing and not ignorant; and not mean, but kind; and yet here he was, without any more pride, or rightness, or feeling, than to stoop to this business, and make himself a shame, and his family a shame, before everybody.  I couldn't understand it no way at all.  It was outrageous, and I knowed I ought to just up and tell him so; and so be his true friend, and let him quit the thing right where he was and save himself. And I did start to tell him; but he shut me up, and says: “Don't you reckon I know what I'm about?  Don't I generly know what I'm about?” “Yes.” “Didn't I say I was going to help steal the nigger?” “Yes.” “Well, then.” That's all he said, and that's all I said.  It warn't no use to say any more; because when he said he'd do a thing, he always done it.  But I couldn't make out how he was willing to go into this thing; so I just let it go, and never bothered no more about it.  If he was bound to have it so, I couldn't help it. When we got home the house was all dark and still; so we went on down to the hut by the ash-hopper for to examine it.  We went through the yard so as to see what the hounds would do.  They knowed us, and didn't make no more noise than country dogs is always doing when anything comes by in the night.  When we got to the cabin we took a look at the front and the two sides; and on the side I warn't acquainted with—which was the north side—we found a square window-hole, up tolerable high, with just one stout board nailed across it.  I says: “Here's the ticket.  This hole's big enough for Jim to get through if we wrench off the board.” Tom says: “It's as simple as tit-tat-toe, three-in-a-row, and as easy as playing hooky.  I should hope we can find a way that's a little more complicated than that, Huck Finn.” “Well, then,” I says, “how 'll it do to saw him out, the way I done before I was murdered that time?” “That's more like,” he says.  "It's real mysterious, and troublesome, and good,” he says; “but I bet we can find a way that's twice as long.  There ain't no hurry; le's keep on looking around.” Betwixt the hut and the fence, on the back side, was a lean-to that joined the hut at the eaves, and was made out of plank.  It was as long as the hut, but narrow—only about six foot wide.  The door to it was at the south end, and was padlocked.  Tom he went to the soap-kettle and searched around, and fetched back the iron thing they lift the lid with; so he took it and prized out one of the staples.  The chain fell down, and we opened the door and went in, and shut it, and struck a match, and see the shed was only built against a cabin and hadn't no connection with it; and there warn't no floor to the shed, nor nothing in it but some old rusty played-out hoes and spades and picks and a crippled plow.  The match went out, and so did we, and shoved in the staple again, and the door was locked as good as ever. Tom was joyful.  He says; “Now we're all right.  We'll dig him out.  It 'll take about a week!” Then we started for the house, and I went in the back door—you only have to pull a buckskin latch-string, they don't fasten the doors—but that warn't romantical enough for Tom Sawyer; no way would do him but he must climb up the lightning-rod.  But after he got up half way about three times, and missed fire and fell every time, and the last time most busted his brains out, he thought he'd got to give it up; but after he was rested he allowed he would give her one more turn for luck, and this time he made the trip. In the morning we was up at break of day, and down to the nigger cabins to pet the dogs and make friends with the nigger that fed Jim—if it was Jim that was being fed.  The niggers was just getting through breakfast and starting for the fields; and Jim's nigger was piling up a tin pan with bread and meat and things; and whilst the others was leaving, the key come from the house. This nigger had a good-natured, chuckle-headed face, and his wool was all tied up in little bunches with thread.  That was to keep witches off.  He said the witches was pestering him awful these nights, and making him see all kinds of strange things, and hear all kinds of strange words and noises, and he didn't believe he was ever witched so long before in his life.  He got so worked up, and got to running on so about his troubles, he forgot all about what he'd been a-going to do.  So Tom says: “What's the vittles for?  Going to feed the dogs?” The nigger kind of smiled around gradually over his face, like when you heave a brickbat in a mud-puddle, and he says: “Yes, Mars Sid, A dog.  Cur'us dog, too.  Does you want to go en look at 'im?” “Yes.” I hunched Tom, and whispers: “You going, right here in the daybreak?  that warn't the plan.” “No, it warn't; but it's the plan now.” So, drat him, we went along, but I didn't like it much.  When we got in we couldn't hardly see anything, it was so dark; but Jim was there, sure enough, and could see us; and he sings out: “Why, Huck!  En good lan'! ain' dat Misto Tom?” I just knowed how it would be; I just expected it.  I didn't know nothing to do; and if I had I couldn't a done it, because that nigger busted in and says: “Why, de gracious sakes! do he know you genlmen?” We could see pretty well now.  Tom he looked at the nigger, steady and kind of wondering, and says: “Does who know us?” “Why, dis-yer runaway nigger.” “I don't reckon he does; but what put that into your head?” “What put it dar?  Didn' he jis' dis minute sing out like he knowed you?” Tom says, in a puzzled-up kind of way: “Well, that's mighty curious.  Who sung out? when did he sing out?  what did he sing out?” And turns to me, perfectly ca'm, and says, “Did you hear anybody sing out?” Of course there warn't nothing to be said but the one thing; so I says: “No; I ain't heard nobody say nothing.” Then he turns to Jim, and looks him over like he never see him before, and says: “Did you sing out?” “No, sah,” says Jim; “I hain't said nothing, sah.” “Not a word?” “No, sah, I hain't said a word.” “Did you ever see us before?” “No, sah; not as I knows on.” So Tom turns to the nigger, which was looking wild and distressed, and says, kind of severe: “What do you reckon's the matter with you, anyway?  What made you think somebody sung out?” “Oh, it's de dad-blame' witches, sah, en I wisht I was dead, I do.  Dey's awluz at it, sah, en dey do mos' kill me, dey sk'yers me so.  Please to don't tell nobody 'bout it sah, er ole Mars Silas he'll scole me; 'kase he say dey ain't no witches.  I jis' wish to goodness he was heah now—den what would he say!  I jis' bet he couldn' fine no way to git aroun' it dis time.  But it's awluz jis' so; people dat's sot, stays sot; dey won't look into noth'n'en fine it out f'r deyselves, en when you fine it out en tell um 'bout it, dey doan' b'lieve you.” Tom give him a dime, and said we wouldn't tell nobody; and told him to buy some more thread to tie up his wool with; and then looks at Jim, and says: “I wonder if Uncle Silas is going to hang this nigger.  If I was to catch a nigger that was ungrateful enough to run away, I wouldn't give him up, I'd hang him.”  And whilst the nigger stepped to the door to look at the dime and bite it to see if it was good, he whispers to Jim and says: “Don't ever let on to know us.  And if you hear any digging going on nights, it's us; we're going to set you free.” Jim only had time to grab us by the hand and squeeze it; then the nigger come back, and we said we'd come again some time if the nigger wanted us to; and he said he would, more particular if it was dark, because the witches went for him mostly in the dark, and it was good to have folks around then. CHAPTER XXXV. IT would be most an hour yet till breakfast, so we left and struck down into the woods; because Tom said we got to have some light to see how to dig by, and a lantern makes too much, and might get us into trouble; what we must have was a lot of them rotten chunks that's called fox-fire, and just makes a soft kind of a glow when you lay them in a dark place.  We fetched an armful and hid it in the weeds, and set down to rest, and Tom says, kind of dissatisfied: “Blame it, this whole thing is just as easy and awkward as it can be. And so it makes it so rotten difficult to get up a difficult plan.  There ain't no watchman to be drugged—now there ought to be a watchman.  There ain't even a dog to give a sleeping-mixture to.  And there's Jim chained by one leg, with a ten-foot chain, to the leg of his bed:  why, all you got to do is to lift up the bedstead and slip off the chain.  And Uncle Silas he trusts everybody; sends the key to the punkin-headed nigger, and don't send nobody to watch the nigger.  Jim could a got out of that window-hole before this, only there wouldn't be no use trying to travel with a ten-foot chain on his leg.  Why, drat it, Huck, it's the stupidest arrangement I ever see. You got to invent all the difficulties.  Well, we can't help it; we got to do the best we can with the materials we've got. Anyhow, there's one thing—there's more honor in getting him out through a lot of difficulties and dangers, where there warn't one of them furnished to you by the people who it was their duty to furnish them, and you had to contrive them all out of your own head.  Now look at just that one thing of the lantern.  When you come down to the cold facts, we simply got to let on that a lantern's resky.  Why, we could work with a torchlight procession if we wanted to, I believe.  Now, whilst I think of it, we got to hunt up something to make a saw out of the first chance we get.” “What do we want of a saw?” “What do we want of it?  Hain't we got to saw the leg of Jim's bed off, so as to get the chain loose?” “Why, you just said a body could lift up the bedstead and slip the chain off.” “Well, if that ain't just like you, Huck Finn.  You can get up the infant-schooliest ways of going at a thing.  Why, hain't you ever read any books at all?—Baron Trenck, nor Casanova, nor Benvenuto Chelleeny, nor Henri IV., nor none of them heroes?  Who ever heard of getting a prisoner loose in such an old-maidy way as that?  No; the way all the best authorities does is to saw the bed-leg in two, and leave it just so, and swallow the sawdust, so it can't be found, and put some dirt and grease around the sawed place so the very keenest seneskal can't see no sign of it's being sawed, and thinks the bed-leg is perfectly sound. Then, the night you're ready, fetch the leg a kick, down she goes; slip off your chain, and there you are.  Nothing to do but hitch your rope ladder to the battlements, shin down it, break your leg in the moat—because a rope ladder is nineteen foot too short, you know—and there's your horses and your trusty vassles, and they scoop you up and fling you across a saddle, and away you go to your native Langudoc, or Navarre, or wherever it is. It's gaudy, Huck.  I wish there was a moat to this cabin. If we get time, the night of the escape, we'll dig one.” I says: “What do we want of a moat when we're going to snake him out from under the cabin?” But he never heard me.  He had forgot me and everything else.  He had his chin in his hand, thinking.  Pretty soon he sighs and shakes his head; then sighs again, and says: “No, it wouldn't do—there ain't necessity enough for it.” “For what?”  I says. “Why, to saw Jim's leg off,” he says. “Good land!”  I says; “why, there ain't no necessity for it.  And what would you want to saw his leg off for, anyway?” “Well, some of the best authorities has done it.  They couldn't get the chain off, so they just cut their hand off and shoved.  And a leg would be better still.  But we got to let that go.  There ain't necessity enough in this case; and, besides, Jim's a nigger, and wouldn't understand the reasons for it, and how it's the custom in Europe; so we'll let it go.  But there's one thing—he can have a rope ladder; we can tear up our sheets and make him a rope ladder easy enough.  And we can send it to him in a pie; it's mostly done that way.  And I've et worse pies.” “Why, Tom Sawyer, how you talk,” I says; “Jim ain't got no use for a rope ladder.” “He has got use for it.  How you talk, you better say; you don't know nothing about it.  He's got to have a rope ladder; they all do.” “What in the nation can he do with it?” “Do with it?  He can hide it in his bed, can't he?”  That's what they all do; and he's got to, too.  Huck, you don't ever seem to want to do anything that's regular; you want to be starting something fresh all the time. S'pose he don't do nothing with it? ain't it there in his bed, for a clew, after he's gone? and don't you reckon they'll want clews?  Of course they will.  And you wouldn't leave them any?  That would be a pretty howdy-do, wouldn't it!  I never heard of such a thing.” “Well,” I says, “if it's in the regulations, and he's got to have it, all right, let him have it; because I don't wish to go back on no regulations; but there's one thing, Tom Sawyer—if we go to tearing up our sheets to make Jim a rope ladder, we're going to get into trouble with Aunt Sally, just as sure as you're born.  Now, the way I look at it, a hickry-bark ladder don't cost nothing, and don't waste nothing, and is just as good to load up a pie with, and hide in a straw tick, as any rag ladder you can start; and as for Jim, he ain't had no experience, and so he don't care what kind of a—” “Oh, shucks, Huck Finn, if I was as ignorant as you I'd keep still—that's what I'D do.  Who ever heard of a state prisoner escaping by a hickry-bark ladder?  Why, it's perfectly ridiculous.” “Well, all right, Tom, fix it your own way; but if you'll take my advice, you'll let me borrow a sheet off of the clothesline.” He said that would do.  And that gave him another idea, and he says: “Borrow a shirt, too.” “What do we want of a shirt, Tom?” “Want it for Jim to keep a journal on.” “Journal your granny—Jim can't write.” “S'pose he can't write—he can make marks on the shirt, can't he, if we make him a pen out of an old pewter spoon or a piece of an old iron barrel-hoop?” “Why, Tom, we can pull a feather out of a goose and make him a better one; and quicker, too.” “Prisoners don't have geese running around the donjon-keep to pull pens out of, you muggins.  They always make their pens out of the hardest, toughest, troublesomest piece of old brass candlestick or something like that they can get their hands on; and it takes them weeks and weeks and months and months to file it out, too, because they've got to do it by rubbing it on the wall.  They wouldn't use a goose-quill if they had it. It ain't regular.” “Well, then, what'll we make him the ink out of?” “Many makes it out of iron-rust and tears; but that's the common sort and women; the best authorities uses their own blood.  Jim can do that; and when he wants to send any little common ordinary mysterious message to let the world know where he's captivated, he can write it on the bottom of a tin plate with a fork and throw it out of the window.  The Iron Mask always done that, and it's a blame' good way, too.” “Jim ain't got no tin plates.  They feed him in a pan.” “That ain't nothing; we can get him some.” “Can't nobody read his plates.” “That ain't got anything to do with it, Huck Finn.  All he's got to do is to write on the plate and throw it out.  You don't have to be able to read it. Why, half the time you can't read anything a prisoner writes on a tin plate, or anywhere else.” “Well, then, what's the sense in wasting the plates?” “Why, blame it all, it ain't the prisoner's plates.” “But it's somebody's plates, ain't it?” “Well, spos'n it is?  What does the prisoner care whose—” He broke off there, because we heard the breakfast-horn blowing.  So we cleared out for the house. Along during the morning I borrowed a sheet and a white shirt off of the clothes-line; and I found an old sack and put them in it, and we went down and got the fox-fire, and put that in too.  I called it borrowing, because that was what pap always called it; but Tom said it warn't borrowing, it was stealing.  He said we was representing prisoners; and prisoners don't care how they get a thing so they get it, and nobody don't blame them for it, either.  It ain't no crime in a prisoner to steal the thing he needs to get away with, Tom said; it's his right; and so, as long as we was representing a prisoner, we had a perfect right to steal anything on this place we had the least use for to get ourselves out of prison with.  He said if we warn't prisoners it would be a very different thing, and nobody but a mean, ornery person would steal when he warn't a prisoner.  So we allowed we would steal everything there was that come handy.  And yet he made a mighty fuss, one day, after that, when I stole a watermelon out of the nigger-patch and eat it; and he made me go and give the niggers a dime without telling them what it was for. Tom said that what he meant was, we could steal anything we needed. Well, I says, I needed the watermelon.  But he said I didn't need it to get out of prison with; there's where the difference was.  He said if I'd a wanted it to hide a knife in, and smuggle it to Jim to kill the seneskal with, it would a been all right.  So I let it go at that, though I couldn't see no advantage in my representing a prisoner if I got to set down and chaw over a lot of gold-leaf distinctions like that every time I see a chance to hog a watermelon. Well, as I was saying, we waited that morning till everybody was settled down to business, and nobody in sight around the yard; then Tom he carried the sack into the lean-to whilst I stood off a piece to keep watch.  By and by he come out, and we went and set down on the woodpile to talk.  He says: “Everything's all right now except tools; and that's easy fixed.” “Tools?”  I says. “Yes.” “Tools for what?” “Why, to dig with.  We ain't a-going to gnaw him out, are we?” “Ain't them old crippled picks and things in there good enough to dig a nigger out with?”  I says. He turns on me, looking pitying enough to make a body cry, and says: “Huck Finn, did you ever hear of a prisoner having picks and shovels, and all the modern conveniences in his wardrobe to dig himself out with?  Now I want to ask you—if you got any reasonableness in you at all—what kind of a show would that give him to be a hero?  Why, they might as well lend him the key and done with it.  Picks and shovels—why, they wouldn't furnish 'em to a king.” “Well, then,” I says, “if we don't want the picks and shovels, what do we want?” “A couple of case-knives.” “To dig the foundations out from under that cabin with?” “Yes.” “Confound it, it's foolish, Tom.” “It don't make no difference how foolish it is, it's the right way—and it's the regular way.  And there ain't no other way, that ever I heard of, and I've read all the books that gives any information about these things. They always dig out with a case-knife—and not through dirt, mind you; generly it's through solid rock.  And it takes them weeks and weeks and weeks, and for ever and ever.  Why, look at one of them prisoners in the bottom dungeon of the Castle Deef, in the harbor of Marseilles, that dug himself out that way; how long was he at it, you reckon?” “I don't know.” “Well, guess.” “I don't know.  A month and a half.” “Thirty-seven year—and he come out in China.  That's the kind.  I wish the bottom of this fortress was solid rock.” “Jim don't know nobody in China.” “What's that got to do with it?  Neither did that other fellow.  But you're always a-wandering off on a side issue.  Why can't you stick to the main point?” “All right—I don't care where he comes out, so he comes out; and Jim don't, either, I reckon.  But there's one thing, anyway—Jim's too old to be dug out with a case-knife.  He won't last.” “Yes he will last, too.  You don't reckon it's going to take thirty-seven years to dig out through a dirt foundation, do you?” “How long will it take, Tom?” “Well, we can't resk being as long as we ought to, because it mayn't take very long for Uncle Silas to hear from down there by New Orleans.  He'll hear Jim ain't from there.  Then his next move will be to advertise Jim, or something like that.  So we can't resk being as long digging him out as we ought to.  By rights I reckon we ought to be a couple of years; but we can't.  Things being so uncertain, what I recommend is this:  that we really dig right in, as quick as we can; and after that, we can let on, to ourselves, that we was at it thirty-seven years.  Then we can snatch him out and rush him away the first time there's an alarm.  Yes, I reckon that 'll be the best way.” “Now, there's sense in that,” I says.  "Letting on don't cost nothing; letting on ain't no trouble; and if it's any object, I don't mind letting on we was at it a hundred and fifty year.  It wouldn't strain me none, after I got my hand in.  So I'll mosey along now, and smouch a couple of case-knives.” “Smouch three,” he says; “we want one to make a saw out of.” “Tom, if it ain't unregular and irreligious to sejest it,” I says, “there's an old rusty saw-blade around yonder sticking under the weather-boarding behind the smoke-house.” He looked kind of weary and discouraged-like, and says: “It ain't no use to try to learn you nothing, Huck.  Run along and smouch the knives—three of them.”  So I done it. CHAPTER XXXVI. AS soon as we reckoned everybody was asleep that night we went down the lightning-rod, and shut ourselves up in the lean-to, and got out our pile of fox-fire, and went to work.  We cleared everything out of the way, about four or five foot along the middle of the bottom log.  Tom said he was right behind Jim's bed now, and we'd dig in under it, and when we got through there couldn't nobody in the cabin ever know there was any hole there, because Jim's counter-pin hung down most to the ground, and you'd have to raise it up and look under to see the hole.  So we dug and dug with the case-knives till most midnight; and then we was dog-tired, and our hands was blistered, and yet you couldn't see we'd done anything hardly.  At last I says: “This ain't no thirty-seven year job; this is a thirty-eight year job, Tom Sawyer.” He never said nothing.  But he sighed, and pretty soon he stopped digging, and then for a good little while I knowed that he was thinking. Then he says: “It ain't no use, Huck, it ain't a-going to work.  If we was prisoners it would, because then we'd have as many years as we wanted, and no hurry; and we wouldn't get but a few minutes to dig, every day, while they was changing watches, and so our hands wouldn't get blistered, and we could keep it up right along, year in and year out, and do it right, and the way it ought to be done.  But we can't fool along; we got to rush; we ain't got no time to spare.  If we was to put in another night this way we'd have to knock off for a week to let our hands get well—couldn't touch a case-knife with them sooner.” “Well, then, what we going to do, Tom?” “I'll tell you.  It ain't right, and it ain't moral, and I wouldn't like it to get out; but there ain't only just the one way:  we got to dig him out with the picks, and let on it's case-knives.” “Now you're talking!”  I says; “your head gets leveler and leveler all the time, Tom Sawyer,” I says.  "Picks is the thing, moral or no moral; and as for me, I don't care shucks for the morality of it, nohow.  When I start in to steal a nigger, or a watermelon, or a Sunday-school book, I ain't no ways particular how it's done so it's done.  What I want is my nigger; or what I want is my watermelon; or what I want is my Sunday-school book; and if a pick's the handiest thing, that's the thing I'm a-going to dig that nigger or that watermelon or that Sunday-school book out with; and I don't give a dead rat what the authorities thinks about it nuther.” “Well,” he says, “there's excuse for picks and letting-on in a case like this; if it warn't so, I wouldn't approve of it, nor I wouldn't stand by and see the rules broke—because right is right, and wrong is wrong, and a body ain't got no business doing wrong when he ain't ignorant and knows better.  It might answer for you to dig Jim out with a pick, without any letting on, because you don't know no better; but it wouldn't for me, because I do know better.  Gimme a case-knife.” He had his own by him, but I handed him mine.  He flung it down, and says: “Gimme a case-knife.” I didn't know just what to do—but then I thought.  I scratched around amongst the old tools, and got a pickaxe and give it to him, and he took it and went to work, and never said a word. He was always just that particular.  Full of principle. So then I got a shovel, and then we picked and shoveled, turn about, and made the fur fly.  We stuck to it about a half an hour, which was as long as we could stand up; but we had a good deal of a hole to show for it. When I got up stairs I looked out at the window and see Tom doing his level best with the lightning-rod, but he couldn't come it, his hands was so sore.  At last he says: “It ain't no use, it can't be done.  What you reckon I better do?  Can't you think of no way?” “Yes,” I says, “but I reckon it ain't regular.  Come up the stairs, and let on it's a lightning-rod.” So he done it. Next day Tom stole a pewter spoon and a brass candlestick in the house, for to make some pens for Jim out of, and six tallow candles; and I hung around the nigger cabins and laid for a chance, and stole three tin plates.  Tom says it wasn't enough; but I said nobody wouldn't ever see the plates that Jim throwed out, because they'd fall in the dog-fennel and jimpson weeds under the window-hole—then we could tote them back and he could use them over again.  So Tom was satisfied.  Then he says: “Now, the thing to study out is, how to get the things to Jim.” “Take them in through the hole,” I says, “when we get it done.” He only just looked scornful, and said something about nobody ever heard of such an idiotic idea, and then he went to studying.  By and by he said he had ciphered out two or three ways, but there warn't no need to decide on any of them yet.  Said we'd got to post Jim first. That night we went down the lightning-rod a little after ten, and took one of the candles along, and listened under the window-hole, and heard Jim snoring; so we pitched it in, and it didn't wake him.  Then we whirled in with the pick and shovel, and in about two hours and a half the job was done.  We crept in under Jim's bed and into the cabin, and pawed around and found the candle and lit it, and stood over Jim awhile, and found him looking hearty and healthy, and then we woke him up gentle and gradual.  He was so glad to see us he most cried; and called us honey, and all the pet names he could think of; and was for having us hunt up a cold-chisel to cut the chain off of his leg with right away, and clearing out without losing any time.  But Tom he showed him how unregular it would be, and set down and told him all about our plans, and how we could alter them in a minute any time there was an alarm; and not to be the least afraid, because we would see he got away, sure.  So Jim he said it was all right, and we set there and talked over old times awhile, and then Tom asked a lot of questions, and when Jim told him Uncle Silas come in every day or two to pray with him, and Aunt Sally come in to see if he was comfortable and had plenty to eat, and both of them was kind as they could be, Tom says: “Now I know how to fix it.  We'll send you some things by them.” I said, “Don't do nothing of the kind; it's one of the most jackass ideas I ever struck;” but he never paid no attention to me; went right on.  It was his way when he'd got his plans set. So he told Jim how we'd have to smuggle in the rope-ladder pie and other large things by Nat, the nigger that fed him, and he must be on the lookout, and not be surprised, and not let Nat see him open them; and we would put small things in uncle's coat-pockets and he must steal them out; and we would tie things to aunt's apron-strings or put them in her apron-pocket, if we got a chance; and told him what they would be and what they was for.  And told him how to keep a journal on the shirt with his blood, and all that. He told him everything.  Jim he couldn't see no sense in the most of it, but he allowed we was white folks and knowed better than him; so he was satisfied, and said he would do it all just as Tom said. Jim had plenty corn-cob pipes and tobacco; so we had a right down good sociable time; then we crawled out through the hole, and so home to bed, with hands that looked like they'd been chawed.  Tom was in high spirits. He said it was the best fun he ever had in his life, and the most intellectural; and said if he only could see his way to it we would keep it up all the rest of our lives and leave Jim to our children to get out; for he believed Jim would come to like it better and better the more he got used to it.  He said that in that way it could be strung out to as much as eighty year, and would be the best time on record.  And he said it would make us all celebrated that had a hand in it. In the morning we went out to the woodpile and chopped up the brass candlestick into handy sizes, and Tom put them and the pewter spoon in his pocket.  Then we went to the nigger cabins, and while I got Nat's notice off, Tom shoved a piece of candlestick into the middle of a corn-pone that was in Jim's pan, and we went along with Nat to see how it would work, and it just worked noble; when Jim bit into it it most mashed all his teeth out; and there warn't ever anything could a worked better. Tom said so himself. Jim he never let on but what it was only just a piece of rock or something like that that's always getting into bread, you know; but after that he never bit into nothing but what he jabbed his fork into it in three or four places first. And whilst we was a-standing there in the dimmish light, here comes a couple of the hounds bulging in from under Jim's bed; and they kept on piling in till there was eleven of them, and there warn't hardly room in there to get your breath.  By jings, we forgot to fasten that lean-to door!  The nigger Nat he only just hollered “Witches” once, and keeled over on to the floor amongst the dogs, and begun to groan like he was dying.  Tom jerked the door open and flung out a slab of Jim's meat, and the dogs went for it, and in two seconds he was out himself and back again and shut the door, and I knowed he'd fixed the other door too. Then he went to work on the nigger, coaxing him and petting him, and asking him if he'd been imagining he saw something again.  He raised up, and blinked his eyes around, and says: “Mars Sid, you'll say I's a fool, but if I didn't b'lieve I see most a million dogs, er devils, er some'n, I wisht I may die right heah in dese tracks.  I did, mos' sholy.  Mars Sid, I felt um—I felt um, sah; dey was all over me.  Dad fetch it, I jis' wisht I could git my han's on one er dem witches jis' wunst—on'y jis' wunst—it's all I'd ast.  But mos'ly I wisht dey'd lemme 'lone, I does.” Tom says: “Well, I tell you what I think.  What makes them come here just at this runaway nigger's breakfast-time?  It's because they're hungry; that's the reason.  You make them a witch pie; that's the thing for you to do.” “But my lan', Mars Sid, how's I gwyne to make 'm a witch pie?  I doan' know how to make it.  I hain't ever hearn er sich a thing b'fo'.” “Well, then, I'll have to make it myself.” “Will you do it, honey?—will you?  I'll wusshup de groun' und' yo' foot, I will!” “All right, I'll do it, seeing it's you, and you've been good to us and showed us the runaway nigger.  But you got to be mighty careful.  When we come around, you turn your back; and then whatever we've put in the pan, don't you let on you see it at all.  And don't you look when Jim unloads the pan—something might happen, I don't know what.  And above all, don't you handle the witch-things.” “Hannel 'M, Mars Sid?  What is you a-talkin' 'bout?  I wouldn' lay de weight er my finger on um, not f'r ten hund'd thous'n billion dollars, I wouldn't.” CHAPTER XXXVII. THAT was all fixed.  So then we went away and went to the rubbage-pile in the back yard, where they keep the old boots, and rags, and pieces of bottles, and wore-out tin things, and all such truck, and scratched around and found an old tin washpan, and stopped up the holes as well as we could, to bake the pie in, and took it down cellar and stole it full of flour and started for breakfast, and found a couple of shingle-nails that Tom said would be handy for a prisoner to scrabble his name and sorrows on the dungeon walls with, and dropped one of them in Aunt Sally's apron-pocket which was hanging on a chair, and t'other we stuck in the band of Uncle Silas's hat, which was on the bureau, because we heard the children say their pa and ma was going to the runaway nigger's house this morning, and then went to breakfast, and Tom dropped the pewter spoon in Uncle Silas's coat-pocket, and Aunt Sally wasn't come yet, so we had to wait a little while. And when she come she was hot and red and cross, and couldn't hardly wait for the blessing; and then she went to sluicing out coffee with one hand and cracking the handiest child's head with her thimble with the other, and says: “I've hunted high and I've hunted low, and it does beat all what has become of your other shirt.” My heart fell down amongst my lungs and livers and things, and a hard piece of corn-crust started down my throat after it and got met on the road with a cough, and was shot across the table, and took one of the children in the eye and curled him up like a fishing-worm, and let a cry out of him the size of a warwhoop, and Tom he turned kinder blue around the gills, and it all amounted to a considerable state of things for about a quarter of a minute or as much as that, and I would a sold out for half price if there was a bidder.  But after that we was all right again—it was the sudden surprise of it that knocked us so kind of cold. Uncle Silas he says: “It's most uncommon curious, I can't understand it.  I know perfectly well I took it off, because—” “Because you hain't got but one on.  Just listen at the man!  I know you took it off, and know it by a better way than your wool-gethering memory, too, because it was on the clo's-line yesterday—I see it there myself. But it's gone, that's the long and the short of it, and you'll just have to change to a red flann'l one till I can get time to make a new one. And it 'll be the third I've made in two years.  It just keeps a body on the jump to keep you in shirts; and whatever you do manage to do with 'm all is more'n I can make out.  A body 'd think you would learn to take some sort of care of 'em at your time of life.” “I know it, Sally, and I do try all I can.  But it oughtn't to be altogether my fault, because, you know, I don't see them nor have nothing to do with them except when they're on me; and I don't believe I've ever lost one of them off of me.” “Well, it ain't your fault if you haven't, Silas; you'd a done it if you could, I reckon.  And the shirt ain't all that's gone, nuther.  Ther's a spoon gone; and that ain't all.  There was ten, and now ther's only nine. The calf got the shirt, I reckon, but the calf never took the spoon, that's certain.” “Why, what else is gone, Sally?” “Ther's six candles gone—that's what.  The rats could a got the candles, and I reckon they did; I wonder they don't walk off with the whole place, the way you're always going to stop their holes and don't do it; and if they warn't fools they'd sleep in your hair, Silas—you'd never find it out; but you can't lay the spoon on the rats, and that I know.” “Well, Sally, I'm in fault, and I acknowledge it; I've been remiss; but I won't let to-morrow go by without stopping up them holes.” “Oh, I wouldn't hurry; next year 'll do.  Matilda Angelina Araminta Phelps!” Whack comes the thimble, and the child snatches her claws out of the sugar-bowl without fooling around any.  Just then the nigger woman steps on to the passage, and says: “Missus, dey's a sheet gone.” “A sheet gone!  Well, for the land's sake!” “I'll stop up them holes to-day,” says Uncle Silas, looking sorrowful. “Oh, do shet up!—s'pose the rats took the sheet?  where's it gone, Lize?” “Clah to goodness I hain't no notion, Miss' Sally.  She wuz on de clo'sline yistiddy, but she done gone:  she ain' dah no mo' now.” “I reckon the world is coming to an end.  I never see the beat of it in all my born days.  A shirt, and a sheet, and a spoon, and six can—” “Missus,” comes a young yaller wench, “dey's a brass cannelstick miss'n.” “Cler out from here, you hussy, er I'll take a skillet to ye!” Well, she was just a-biling.  I begun to lay for a chance; I reckoned I would sneak out and go for the woods till the weather moderated.  She kept a-raging right along, running her insurrection all by herself, and everybody else mighty meek and quiet; and at last Uncle Silas, looking kind of foolish, fishes up that spoon out of his pocket.  She stopped, with her mouth open and her hands up; and as for me, I wished I was in Jeruslem or somewheres. But not long, because she says: “It's just as I expected.  So you had it in your pocket all the time; and like as not you've got the other things there, too.  How'd it get there?” “I reely don't know, Sally,” he says, kind of apologizing, “or you know I would tell.  I was a-studying over my text in Acts Seventeen before breakfast, and I reckon I put it in there, not noticing, meaning to put my Testament in, and it must be so, because my Testament ain't in; but I'll go and see; and if the Testament is where I had it, I'll know I didn't put it in, and that will show that I laid the Testament down and took up the spoon, and—” “Oh, for the land's sake!  Give a body a rest!  Go 'long now, the whole kit and biling of ye; and don't come nigh me again till I've got back my peace of mind.” I'D a heard her if she'd a said it to herself, let alone speaking it out; and I'd a got up and obeyed her if I'd a been dead.  As we was passing through the setting-room the old man he took up his hat, and the shingle-nail fell out on the floor, and he just merely picked it up and laid it on the mantel-shelf, and never said nothing, and went out.  Tom see him do it, and remembered about the spoon, and says: “Well, it ain't no use to send things by him no more, he ain't reliable.” Then he says:  "But he done us a good turn with the spoon, anyway, without knowing it, and so we'll go and do him one without him knowing it—stop up his rat-holes.” There was a noble good lot of them down cellar, and it took us a whole hour, but we done the job tight and good and shipshape.  Then we heard steps on the stairs, and blowed out our light and hid; and here comes the old man, with a candle in one hand and a bundle of stuff in t'other, looking as absent-minded as year before last.  He went a mooning around, first to one rat-hole and then another, till he'd been to them all.  Then he stood about five minutes, picking tallow-drip off of his candle and thinking.  Then he turns off slow and dreamy towards the stairs, saying: “Well, for the life of me I can't remember when I done it.  I could show her now that I warn't to blame on account of the rats.  But never mind—let it go.  I reckon it wouldn't do no good.” And so he went on a-mumbling up stairs, and then we left.  He was a mighty nice old man.  And always is. Tom was a good deal bothered about what to do for a spoon, but he said we'd got to have it; so he took a think.  When he had ciphered it out he told me how we was to do; then we went and waited around the spoon-basket till we see Aunt Sally coming, and then Tom went to counting the spoons and laying them out to one side, and I slid one of them up my sleeve, and Tom says: “Why, Aunt Sally, there ain't but nine spoons yet.” She says: “Go 'long to your play, and don't bother me.  I know better, I counted 'm myself.” “Well, I've counted them twice, Aunty, and I can't make but nine.” She looked out of all patience, but of course she come to count—anybody would. “I declare to gracious ther' ain't but nine!” she says.  "Why, what in the world—plague take the things, I'll count 'm again.” So I slipped back the one I had, and when she got done counting, she says: “Hang the troublesome rubbage, ther's ten now!” and she looked huffy and bothered both.  But Tom says: “Why, Aunty, I don't think there's ten.” “You numskull, didn't you see me count 'm?” “I know, but—” “Well, I'll count 'm again.” So I smouched one, and they come out nine, same as the other time.  Well, she was in a tearing way—just a-trembling all over, she was so mad.  But she counted and counted till she got that addled she'd start to count in the basket for a spoon sometimes; and so, three times they come out right, and three times they come out wrong.  Then she grabbed up the basket and slammed it across the house and knocked the cat galley-west; and she said cle'r out and let her have some peace, and if we come bothering around her again betwixt that and dinner she'd skin us.  So we had the odd spoon, and dropped it in her apron-pocket whilst she was a-giving us our sailing orders, and Jim got it all right, along with her shingle nail, before noon.  We was very well satisfied with this business, and Tom allowed it was worth twice the trouble it took, because he said now she couldn't ever count them spoons twice alike again to save her life; and wouldn't believe she'd counted them right if she did; and said that after she'd about counted her head off for the next three days he judged she'd give it up and offer to kill anybody that wanted her to ever count them any more. So we put the sheet back on the line that night, and stole one out of her closet; and kept on putting it back and stealing it again for a couple of days till she didn't know how many sheets she had any more, and she didn't care, and warn't a-going to bullyrag the rest of her soul out about it, and wouldn't count them again not to save her life; she druther die first. So we was all right now, as to the shirt and the sheet and the spoon and the candles, by the help of the calf and the rats and the mixed-up counting; and as to the candlestick, it warn't no consequence, it would blow over by and by. But that pie was a job; we had no end of trouble with that pie.  We fixed it up away down in the woods, and cooked it there; and we got it done at last, and very satisfactory, too; but not all in one day; and we had to use up three wash-pans full of flour before we got through, and we got burnt pretty much all over, in places, and eyes put out with the smoke; because, you see, we didn't want nothing but a crust, and we couldn't prop it up right, and she would always cave in.  But of course we thought of the right way at last—which was to cook the ladder, too, in the pie.  So then we laid in with Jim the second night, and tore up the sheet all in little strings and twisted them together, and long before daylight we had a lovely rope that you could a hung a person with.  We let on it took nine months to make it. And in the forenoon we took it down to the woods, but it wouldn't go into the pie.  Being made of a whole sheet, that way, there was rope enough for forty pies if we'd a wanted them, and plenty left over for soup, or sausage, or anything you choose.  We could a had a whole dinner. But we didn't need it.  All we needed was just enough for the pie, and so we throwed the rest away.  We didn't cook none of the pies in the wash-pan—afraid the solder would melt; but Uncle Silas he had a noble brass warming-pan which he thought considerable of, because it belonged to one of his ancesters with a long wooden handle that come over from England with William the Conqueror in the Mayflower or one of them early ships and was hid away up garret with a lot of other old pots and things that was valuable, not on account of being any account, because they warn't, but on account of them being relicts, you know, and we snaked her out, private, and took her down there, but she failed on the first pies, because we didn't know how, but she come up smiling on the last one.  We took and lined her with dough, and set her in the coals, and loaded her up with rag rope, and put on a dough roof, and shut down the lid, and put hot embers on top, and stood off five foot, with the long handle, cool and comfortable, and in fifteen minutes she turned out a pie that was a satisfaction to look at. But the person that et it would want to fetch a couple of kags of toothpicks along, for if that rope ladder wouldn't cramp him down to business I don't know nothing what I'm talking about, and lay him in enough stomach-ache to last him till next time, too. Nat didn't look when we put the witch pie in Jim's pan; and we put the three tin plates in the bottom of the pan under the vittles; and so Jim got everything all right, and as soon as he was by himself he busted into the pie and hid the rope ladder inside of his straw tick, and scratched some marks on a tin plate and throwed it out of the window-hole. CHAPTER XXXVIII. MAKING them pens was a distressid tough job, and so was the saw; and Jim allowed the inscription was going to be the toughest of all.  That's the one which the prisoner has to scrabble on the wall.  But he had to have it; Tom said he'd got to; there warn't no case of a state prisoner not scrabbling his inscription to leave behind, and his coat of arms. “Look at Lady Jane Grey,” he says; “look at Gilford Dudley; look at old Northumberland!  Why, Huck, s'pose it is considerble trouble?—what you going to do?—how you going to get around it?  Jim's got to do his inscription and coat of arms.  They all do.” Jim says: “Why, Mars Tom, I hain't got no coat o' arm; I hain't got nuffn but dish yer ole shirt, en you knows I got to keep de journal on dat.” “Oh, you don't understand, Jim; a coat of arms is very different.” “Well,” I says, “Jim's right, anyway, when he says he ain't got no coat of arms, because he hain't.” “I reckon I knowed that,” Tom says, “but you bet he'll have one before he goes out of this—because he's going out right, and there ain't going to be no flaws in his record.” So whilst me and Jim filed away at the pens on a brickbat apiece, Jim a-making his'n out of the brass and I making mine out of the spoon, Tom set to work to think out the coat of arms.  By and by he said he'd struck so many good ones he didn't hardly know which to take, but there was one which he reckoned he'd decide on.  He says: “On the scutcheon we'll have a bend or in the dexter base, a saltire murrey in the fess, with a dog, couchant, for common charge, and under his foot a chain embattled, for slavery, with a chevron vert in a chief engrailed, and three invected lines on a field azure, with the nombril points rampant on a dancette indented; crest, a runaway nigger, sable, with his bundle over his shoulder on a bar sinister; and a couple of gules for supporters, which is you and me; motto, Maggiore Fretta, Minore Otto.  Got it out of a book—means the more haste the less speed.” “Geewhillikins,” I says, “but what does the rest of it mean?” “We ain't got no time to bother over that,” he says; “we got to dig in like all git-out.” “Well, anyway,” I says, “what's some of it?  What's a fess?” “A fess—a fess is—you don't need to know what a fess is.  I'll show him how to make it when he gets to it.” “Shucks, Tom,” I says, “I think you might tell a person.  What's a bar sinister?” “Oh, I don't know.  But he's got to have it.  All the nobility does.” That was just his way.  If it didn't suit him to explain a thing to you, he wouldn't do it.  You might pump at him a week, it wouldn't make no difference. He'd got all that coat of arms business fixed, so now he started in to finish up the rest of that part of the work, which was to plan out a mournful inscription—said Jim got to have one, like they all done.  He made up a lot, and wrote them out on a paper, and read them off, so: 1.  Here a captive heart busted. 2.  Here a poor prisoner, forsook by the world and friends, fretted his sorrowful life. 3.  Here a lonely heart broke, and a worn spirit went to its rest, after thirty-seven years of solitary captivity. 4.  Here, homeless and friendless, after thirty-seven years of bitter captivity, perished a noble stranger, natural son of Louis XIV. Tom's voice trembled whilst he was reading them, and he most broke down. When he got done he couldn't no way make up his mind which one for Jim to scrabble on to the wall, they was all so good; but at last he allowed he would let him scrabble them all on.  Jim said it would take him a year to scrabble such a lot of truck on to the logs with a nail, and he didn't know how to make letters, besides; but Tom said he would block them out for him, and then he wouldn't have nothing to do but just follow the lines.  Then pretty soon he says: “Come to think, the logs ain't a-going to do; they don't have log walls in a dungeon:  we got to dig the inscriptions into a rock.  We'll fetch a rock.” Jim said the rock was worse than the logs; he said it would take him such a pison long time to dig them into a rock he wouldn't ever get out.  But Tom said he would let me help him do it.  Then he took a look to see how me and Jim was getting along with the pens.  It was most pesky tedious hard work and slow, and didn't give my hands no show to get well of the sores, and we didn't seem to make no headway, hardly; so Tom says: “I know how to fix it.  We got to have a rock for the coat of arms and mournful inscriptions, and we can kill two birds with that same rock. There's a gaudy big grindstone down at the mill, and we'll smouch it, and carve the things on it, and file out the pens and the saw on it, too.” It warn't no slouch of an idea; and it warn't no slouch of a grindstone nuther; but we allowed we'd tackle it.  It warn't quite midnight yet, so we cleared out for the mill, leaving Jim at work.  We smouched the grindstone, and set out to roll her home, but it was a most nation tough job. Sometimes, do what we could, we couldn't keep her from falling over, and she come mighty near mashing us every time.  Tom said she was going to get one of us, sure, before we got through.  We got her half way; and then we was plumb played out, and most drownded with sweat.  We see it warn't no use; we got to go and fetch Jim. So he raised up his bed and slid the chain off of the bed-leg, and wrapt it round and round his neck, and we crawled out through our hole and down there, and Jim and me laid into that grindstone and walked her along like nothing; and Tom superintended.  He could out-superintend any boy I ever see.  He knowed how to do everything. Our hole was pretty big, but it warn't big enough to get the grindstone through; but Jim he took the pick and soon made it big enough.  Then Tom marked out them things on it with the nail, and set Jim to work on them, with the nail for a chisel and an iron bolt from the rubbage in the lean-to for a hammer, and told him to work till the rest of his candle quit on him, and then he could go to bed, and hide the grindstone under his straw tick and sleep on it.  Then we helped him fix his chain back on the bed-leg, and was ready for bed ourselves.  But Tom thought of something, and says: “You got any spiders in here, Jim?” “No, sah, thanks to goodness I hain't, Mars Tom.” “All right, we'll get you some.” “But bless you, honey, I doan' want none.  I's afeard un um.  I jis' 's soon have rattlesnakes aroun'.” Tom thought a minute or two, and says: “It's a good idea.  And I reckon it's been done.  It must a been done; it stands to reason.  Yes, it's a prime good idea.  Where could you keep it?” “Keep what, Mars Tom?” “Why, a rattlesnake.” “De goodness gracious alive, Mars Tom!  Why, if dey was a rattlesnake to come in heah I'd take en bust right out thoo dat log wall, I would, wid my head.” “Why, Jim, you wouldn't be afraid of it after a little.  You could tame it.” “Tame it!” “Yes—easy enough.  Every animal is grateful for kindness and petting, and they wouldn't think of hurting a person that pets them.  Any book will tell you that.  You try—that's all I ask; just try for two or three days. Why, you can get him so, in a little while, that he'll love you; and sleep with you; and won't stay away from you a minute; and will let you wrap him round your neck and put his head in your mouth.” “Please, Mars Tom—doan' talk so!  I can't stan' it!  He'd let me shove his head in my mouf—fer a favor, hain't it?  I lay he'd wait a pow'ful long time 'fo' I ast him.  En mo' en dat, I doan' want him to sleep wid me.” “Jim, don't act so foolish.  A prisoner's got to have some kind of a dumb pet, and if a rattlesnake hain't ever been tried, why, there's more glory to be gained in your being the first to ever try it than any other way you could ever think of to save your life.” “Why, Mars Tom, I doan' want no sich glory.  Snake take 'n bite Jim's chin off, den whah is de glory?  No, sah, I doan' want no sich doin's.” “Blame it, can't you try?  I only want you to try—you needn't keep it up if it don't work.” “But de trouble all done ef de snake bite me while I's a tryin' him. Mars Tom, I's willin' to tackle mos' anything 'at ain't onreasonable, but ef you en Huck fetches a rattlesnake in heah for me to tame, I's gwyne to leave, dat's shore.” “Well, then, let it go, let it go, if you're so bull-headed about it.  We can get you some garter-snakes, and you can tie some buttons on their tails, and let on they're rattlesnakes, and I reckon that 'll have to do.” “I k'n stan' dem, Mars Tom, but blame' 'f I couldn' get along widout um, I tell you dat.  I never knowed b'fo' 't was so much bother and trouble to be a prisoner.” “Well, it always is when it's done right.  You got any rats around here?” “No, sah, I hain't seed none.” “Well, we'll get you some rats.” “Why, Mars Tom, I doan' want no rats.  Dey's de dadblamedest creturs to 'sturb a body, en rustle roun' over 'im, en bite his feet, when he's tryin' to sleep, I ever see.  No, sah, gimme g'yarter-snakes, 'f I's got to have 'm, but doan' gimme no rats; I hain' got no use f'r um, skasely.” “But, Jim, you got to have 'em—they all do.  So don't make no more fuss about it.  Prisoners ain't ever without rats.  There ain't no instance of it.  And they train them, and pet them, and learn them tricks, and they get to be as sociable as flies.  But you got to play music to them.  You got anything to play music on?” “I ain' got nuffn but a coase comb en a piece o' paper, en a juice-harp; but I reck'n dey wouldn' take no stock in a juice-harp.” “Yes they would they don't care what kind of music 'tis.  A jews-harp's plenty good enough for a rat.  All animals like music—in a prison they dote on it.  Specially, painful music; and you can't get no other kind out of a jews-harp.  It always interests them; they come out to see what's the matter with you.  Yes, you're all right; you're fixed very well.  You want to set on your bed nights before you go to sleep, and early in the mornings, and play your jews-harp; play 'The Last Link is Broken'—that's the thing that 'll scoop a rat quicker 'n anything else; and when you've played about two minutes you'll see all the rats, and the snakes, and spiders, and things begin to feel worried about you, and come.  And they'll just fairly swarm over you, and have a noble good time.” “Yes, dey will, I reck'n, Mars Tom, but what kine er time is Jim havin'? Blest if I kin see de pint.  But I'll do it ef I got to.  I reck'n I better keep de animals satisfied, en not have no trouble in de house.” Tom waited to think it over, and see if there wasn't nothing else; and pretty soon he says: “Oh, there's one thing I forgot.  Could you raise a flower here, do you reckon?” “I doan know but maybe I could, Mars Tom; but it's tolable dark in heah, en I ain' got no use f'r no flower, nohow, en she'd be a pow'ful sight o' trouble.” “Well, you try it, anyway.  Some other prisoners has done it.” “One er dem big cat-tail-lookin' mullen-stalks would grow in heah, Mars Tom, I reck'n, but she wouldn't be wuth half de trouble she'd coss.” “Don't you believe it.  We'll fetch you a little one and you plant it in the corner over there, and raise it.  And don't call it mullen, call it Pitchiola—that's its right name when it's in a prison.  And you want to water it with your tears.” “Why, I got plenty spring water, Mars Tom.” “You don't want spring water; you want to water it with your tears.  It's the way they always do.” “Why, Mars Tom, I lay I kin raise one er dem mullen-stalks twyste wid spring water whiles another man's a start'n one wid tears.” “That ain't the idea.  You got to do it with tears.” “She'll die on my han's, Mars Tom, she sholy will; kase I doan' skasely ever cry.” So Tom was stumped.  But he studied it over, and then said Jim would have to worry along the best he could with an onion.  He promised he would go to the nigger cabins and drop one, private, in Jim's coffee-pot, in the morning. Jim said he would “jis' 's soon have tobacker in his coffee;” and found so much fault with it, and with the work and bother of raising the mullen, and jews-harping the rats, and petting and flattering up the snakes and spiders and things, on top of all the other work he had to do on pens, and inscriptions, and journals, and things, which made it more trouble and worry and responsibility to be a prisoner than anything he ever undertook, that Tom most lost all patience with him; and said he was just loadened down with more gaudier chances than a prisoner ever had in the world to make a name for himself, and yet he didn't know enough to appreciate them, and they was just about wasted on him.  So Jim he was sorry, and said he wouldn't behave so no more, and then me and Tom shoved for bed. CHAPTER XXXIX. IN the morning we went up to the village and bought a wire rat-trap and fetched it down, and unstopped the best rat-hole, and in about an hour we had fifteen of the bulliest kind of ones; and then we took it and put it in a safe place under Aunt Sally's bed.  But while we was gone for spiders little Thomas Franklin Benjamin Jefferson Elexander Phelps found it there, and opened the door of it to see if the rats would come out, and they did; and Aunt Sally she come in, and when we got back she was a-standing on top of the bed raising Cain, and the rats was doing what they could to keep off the dull times for her.  So she took and dusted us both with the hickry, and we was as much as two hours catching another fifteen or sixteen, drat that meddlesome cub, and they warn't the likeliest, nuther, because the first haul was the pick of the flock.  I never see a likelier lot of rats than what that first haul was. We got a splendid stock of sorted spiders, and bugs, and frogs, and caterpillars, and one thing or another; and we like to got a hornet's nest, but we didn't.  The family was at home.  We didn't give it right up, but stayed with them as long as we could; because we allowed we'd tire them out or they'd got to tire us out, and they done it.  Then we got allycumpain and rubbed on the places, and was pretty near all right again, but couldn't set down convenient.  And so we went for the snakes, and grabbed a couple of dozen garters and house-snakes, and put them in a bag, and put it in our room, and by that time it was supper-time, and a rattling good honest day's work:  and hungry?—oh, no, I reckon not!  And there warn't a blessed snake up there when we went back—we didn't half tie the sack, and they worked out somehow, and left.  But it didn't matter much, because they was still on the premises somewheres.  So we judged we could get some of them again.  No, there warn't no real scarcity of snakes about the house for a considerable spell.  You'd see them dripping from the rafters and places every now and then; and they generly landed in your plate, or down the back of your neck, and most of the time where you didn't want them.  Well, they was handsome and striped, and there warn't no harm in a million of them; but that never made no difference to Aunt Sally; she despised snakes, be the breed what they might, and she couldn't stand them no way you could fix it; and every time one of them flopped down on her, it didn't make no difference what she was doing, she would just lay that work down and light out.  I never see such a woman.  And you could hear her whoop to Jericho.  You couldn't get her to take a-holt of one of them with the tongs.  And if she turned over and found one in bed she would scramble out and lift a howl that you would think the house was afire.  She disturbed the old man so that he said he could most wish there hadn't ever been no snakes created.  Why, after every last snake had been gone clear out of the house for as much as a week Aunt Sally warn't over it yet; she warn't near over it; when she was setting thinking about something you could touch her on the back of her neck with a feather and she would jump right out of her stockings.  It was very curious.  But Tom said all women was just so.  He said they was made that way for some reason or other. We got a licking every time one of our snakes come in her way, and she allowed these lickings warn't nothing to what she would do if we ever loaded up the place again with them.  I didn't mind the lickings, because they didn't amount to nothing; but I minded the trouble we had to lay in another lot.  But we got them laid in, and all the other things; and you never see a cabin as blithesome as Jim's was when they'd all swarm out for music and go for him.  Jim didn't like the spiders, and the spiders didn't like Jim; and so they'd lay for him, and make it mighty warm for him.  And he said that between the rats and the snakes and the grindstone there warn't no room in bed for him, skasely; and when there was, a body couldn't sleep, it was so lively, and it was always lively, he said, because they never all slept at one time, but took turn about, so when the snakes was asleep the rats was on deck, and when the rats turned in the snakes come on watch, so he always had one gang under him, in his way, and t'other gang having a circus over him, and if he got up to hunt a new place the spiders would take a chance at him as he crossed over. He said if he ever got out this time he wouldn't ever be a prisoner again, not for a salary. Well, by the end of three weeks everything was in pretty good shape.  The shirt was sent in early, in a pie, and every time a rat bit Jim he would get up and write a little in his journal whilst the ink was fresh; the pens was made, the inscriptions and so on was all carved on the grindstone; the bed-leg was sawed in two, and we had et up the sawdust, and it give us a most amazing stomach-ache.  We reckoned we was all going to die, but didn't.  It was the most undigestible sawdust I ever see; and Tom said the same. But as I was saying, we'd got all the work done now, at last; and we was all pretty much fagged out, too, but mainly Jim.  The old man had wrote a couple of times to the plantation below Orleans to come and get their runaway nigger, but hadn't got no answer, because there warn't no such plantation; so he allowed he would advertise Jim in the St. Louis and New Orleans papers; and when he mentioned the St. Louis ones it give me the cold shivers, and I see we hadn't no time to lose. So Tom said, now for the nonnamous letters. “What's them?”  I says. “Warnings to the people that something is up.  Sometimes it's done one way, sometimes another.  But there's always somebody spying around that gives notice to the governor of the castle.  When Louis XVI. was going to light out of the Tooleries, a servant-girl done it.  It's a very good way, and so is the nonnamous letters.  We'll use them both.  And it's usual for the prisoner's mother to change clothes with him, and she stays in, and he slides out in her clothes.  We'll do that, too.” “But looky here, Tom, what do we want to warn anybody for that something's up?  Let them find it out for themselves—it's their lookout.” “Yes, I know; but you can't depend on them.  It's the way they've acted from the very start—left us to do everything.  They're so confiding and mullet-headed they don't take notice of nothing at all.  So if we don't give them notice there won't be nobody nor nothing to interfere with us, and so after all our hard work and trouble this escape 'll go off perfectly flat; won't amount to nothing—won't be nothing to it.” “Well, as for me, Tom, that's the way I'd like.” “Shucks!” he says, and looked disgusted.  So I says: “But I ain't going to make no complaint.  Any way that suits you suits me. What you going to do about the servant-girl?” “You'll be her.  You slide in, in the middle of the night, and hook that yaller girl's frock.” “Why, Tom, that 'll make trouble next morning; because, of course, she prob'bly hain't got any but that one.” “I know; but you don't want it but fifteen minutes, to carry the nonnamous letter and shove it under the front door.” “All right, then, I'll do it; but I could carry it just as handy in my own togs.” “You wouldn't look like a servant-girl then, would you?” “No, but there won't be nobody to see what I look like, anyway.” “That ain't got nothing to do with it.  The thing for us to do is just to do our duty, and not worry about whether anybody sees us do it or not. Hain't you got no principle at all?” “All right, I ain't saying nothing; I'm the servant-girl.  Who's Jim's mother?” “I'm his mother.  I'll hook a gown from Aunt Sally.” “Well, then, you'll have to stay in the cabin when me and Jim leaves.” “Not much.  I'll stuff Jim's clothes full of straw and lay it on his bed to represent his mother in disguise, and Jim 'll take the nigger woman's gown off of me and wear it, and we'll all evade together.  When a prisoner of style escapes it's called an evasion.  It's always called so when a king escapes, f'rinstance.  And the same with a king's son; it don't make no difference whether he's a natural one or an unnatural one.” So Tom he wrote the nonnamous letter, and I smouched the yaller wench's frock that night, and put it on, and shoved it under the front door, the way Tom told me to.  It said: Beware.  Trouble is brewing.  Keep a sharp lookout. Unknown Friend. Next night we stuck a picture, which Tom drawed in blood, of a skull and crossbones on the front door; and next night another one of a coffin on the back door.  I never see a family in such a sweat.  They couldn't a been worse scared if the place had a been full of ghosts laying for them behind everything and under the beds and shivering through the air.  If a door banged, Aunt Sally she jumped and said “ouch!” if anything fell, she jumped and said “ouch!” if you happened to touch her, when she warn't noticing, she done the same; she couldn't face noway and be satisfied, because she allowed there was something behind her every time—so she was always a-whirling around sudden, and saying “ouch,” and before she'd got two-thirds around she'd whirl back again, and say it again; and she was afraid to go to bed, but she dasn't set up.  So the thing was working very well, Tom said; he said he never see a thing work more satisfactory. He said it showed it was done right. So he said, now for the grand bulge!  So the very next morning at the streak of dawn we got another letter ready, and was wondering what we better do with it, because we heard them say at supper they was going to have a nigger on watch at both doors all night.  Tom he went down the lightning-rod to spy around; and the nigger at the back door was asleep, and he stuck it in the back of his neck and come back.  This letter said: Don't betray me, I wish to be your friend.  There is a desprate gang of cutthroats from over in the Indian Territory going to steal your runaway nigger to-night, and they have been trying to scare you so as you will stay in the house and not bother them.  I am one of the gang, but have got religgion and wish to quit it and lead an honest life again, and will betray the helish design. They will sneak down from northards, along the fence, at midnight exact, with a false key, and go in the nigger's cabin to get him. I am to be off a piece and blow a tin horn if I see any danger; but stead of that I will baa like a sheep soon as they get in and not blow at all; then whilst they are getting his chains loose, you slip there and lock them in, and can kill them at your leasure.  Don't do anything but just the way I am telling you, if you do they will suspicion something and raise whoop-jamboreehoo. I do not wish any reward but to know I have done the right thing. Unknown Friend. CHAPTER XL. WE was feeling pretty good after breakfast, and took my canoe and went over the river a-fishing, with a lunch, and had a good time, and took a look at the raft and found her all right, and got home late to supper, and found them in such a sweat and worry they didn't know which end they was standing on, and made us go right off to bed the minute we was done supper, and wouldn't tell us what the trouble was, and never let on a word about the new letter, but didn't need to, because we knowed as much about it as anybody did, and as soon as we was half up stairs and her back was turned we slid for the cellar cupboard and loaded up a good lunch and took it up to our room and went to bed, and got up about half-past eleven, and Tom put on Aunt Sally's dress that he stole and was going to start with the lunch, but says: “Where's the butter?” “I laid out a hunk of it,” I says, “on a piece of a corn-pone.” “Well, you left it laid out, then—it ain't here.” “We can get along without it,” I says. “We can get along with it, too,” he says; “just you slide down cellar and fetch it.  And then mosey right down the lightning-rod and come along. I'll go and stuff the straw into Jim's clothes to represent his mother in disguise, and be ready to baa like a sheep and shove soon as you get there.” So out he went, and down cellar went I. The hunk of butter, big as a person's fist, was where I had left it, so I took up the slab of corn-pone with it on, and blowed out my light, and started up stairs very stealthy, and got up to the main floor all right, but here comes Aunt Sally with a candle, and I clapped the truck in my hat, and clapped my hat on my head, and the next second she see me; and she says: “You been down cellar?” “Yes'm.” “What you been doing down there?” “Noth'n.” “Noth'n!” “No'm.” “Well, then, what possessed you to go down there this time of night?” “I don't know 'm.” “You don't know?  Don't answer me that way. Tom, I want to know what you been doing down there.” “I hain't been doing a single thing, Aunt Sally, I hope to gracious if I have.” I reckoned she'd let me go now, and as a generl thing she would; but I s'pose there was so many strange things going on she was just in a sweat about every little thing that warn't yard-stick straight; so she says, very decided: “You just march into that setting-room and stay there till I come.  You been up to something you no business to, and I lay I'll find out what it is before I'M done with you.” So she went away as I opened the door and walked into the setting-room. My, but there was a crowd there!  Fifteen farmers, and every one of them had a gun.  I was most powerful sick, and slunk to a chair and set down. They was setting around, some of them talking a little, in a low voice, and all of them fidgety and uneasy, but trying to look like they warn't; but I knowed they was, because they was always taking off their hats, and putting them on, and scratching their heads, and changing their seats, and fumbling with their buttons.  I warn't easy myself, but I didn't take my hat off, all the same. I did wish Aunt Sally would come, and get done with me, and lick me, if she wanted to, and let me get away and tell Tom how we'd overdone this thing, and what a thundering hornet's-nest we'd got ourselves into, so we could stop fooling around straight off, and clear out with Jim before these rips got out of patience and come for us. At last she come and begun to ask me questions, but I couldn't answer them straight, I didn't know which end of me was up; because these men was in such a fidget now that some was wanting to start right NOW and lay for them desperadoes, and saying it warn't but a few minutes to midnight; and others was trying to get them to hold on and wait for the sheep-signal; and here was Aunty pegging away at the questions, and me a-shaking all over and ready to sink down in my tracks I was that scared; and the place getting hotter and hotter, and the butter beginning to melt and run down my neck and behind my ears; and pretty soon, when one of them says, “I'M for going and getting in the cabin first and right now, and catching them when they come,” I most dropped; and a streak of butter come a-trickling down my forehead, and Aunt Sally she see it, and turns white as a sheet, and says: “For the land's sake, what is the matter with the child?  He's got the brain-fever as shore as you're born, and they're oozing out!” And everybody runs to see, and she snatches off my hat, and out comes the bread and what was left of the butter, and she grabbed me, and hugged me, and says: “Oh, what a turn you did give me! and how glad and grateful I am it ain't no worse; for luck's against us, and it never rains but it pours, and when I see that truck I thought we'd lost you, for I knowed by the color and all it was just like your brains would be if—Dear, dear, whyd'nt you tell me that was what you'd been down there for, I wouldn't a cared.  Now cler out to bed, and don't lemme see no more of you till morning!” I was up stairs in a second, and down the lightning-rod in another one, and shinning through the dark for the lean-to.  I couldn't hardly get my words out, I was so anxious; but I told Tom as quick as I could we must jump for it now, and not a minute to lose—the house full of men, yonder, with guns! His eyes just blazed; and he says: “No!—is that so?  ain't it bully!  Why, Huck, if it was to do over again, I bet I could fetch two hundred!  If we could put it off till—” “Hurry!  Hurry!”  I says.  "Where's Jim?” “Right at your elbow; if you reach out your arm you can touch him.  He's dressed, and everything's ready.  Now we'll slide out and give the sheep-signal.” But then we heard the tramp of men coming to the door, and heard them begin to fumble with the pad-lock, and heard a man say: “I told you we'd be too soon; they haven't come—the door is locked. Here, I'll lock some of you into the cabin, and you lay for 'em in the dark and kill 'em when they come; and the rest scatter around a piece, and listen if you can hear 'em coming.” So in they come, but couldn't see us in the dark, and most trod on us whilst we was hustling to get under the bed.  But we got under all right, and out through the hole, swift but soft—Jim first, me next, and Tom last, which was according to Tom's orders.  Now we was in the lean-to, and heard trampings close by outside.  So we crept to the door, and Tom stopped us there and put his eye to the crack, but couldn't make out nothing, it was so dark; and whispered and said he would listen for the steps to get further, and when he nudged us Jim must glide out first, and him last.  So he set his ear to the crack and listened, and listened, and listened, and the steps a-scraping around out there all the time; and at last he nudged us, and we slid out, and stooped down, not breathing, and not making the least noise, and slipped stealthy towards the fence in Injun file, and got to it all right, and me and Jim over it; but Tom's britches catched fast on a splinter on the top rail, and then he hear the steps coming, so he had to pull loose, which snapped the splinter and made a noise; and as he dropped in our tracks and started somebody sings out: “Who's that?  Answer, or I'll shoot!” But we didn't answer; we just unfurled our heels and shoved.  Then there was a rush, and a Bang, Bang, Bang! and the bullets fairly whizzed around us! We heard them sing out: “Here they are!  They've broke for the river!  After 'em, boys, and turn loose the dogs!” So here they come, full tilt.  We could hear them because they wore boots and yelled, but we didn't wear no boots and didn't yell.  We was in the path to the mill; and when they got pretty close on to us we dodged into the bush and let them go by, and then dropped in behind them.  They'd had all the dogs shut up, so they wouldn't scare off the robbers; but by this time somebody had let them loose, and here they come, making powwow enough for a million; but they was our dogs; so we stopped in our tracks till they catched up; and when they see it warn't nobody but us, and no excitement to offer them, they only just said howdy, and tore right ahead towards the shouting and clattering; and then we up-steam again, and whizzed along after them till we was nearly to the mill, and then struck up through the bush to where my canoe was tied, and hopped in and pulled for dear life towards the middle of the river, but didn't make no more noise than we was obleeged to. Then we struck out, easy and comfortable, for the island where my raft was; and we could hear them yelling and barking at each other all up and down the bank, till we was so far away the sounds got dim and died out.  And when we stepped on to the raft I says: “Now, old Jim, you're a free man again, and I bet you won't ever be a slave no more.” “En a mighty good job it wuz, too, Huck.  It 'uz planned beautiful, en it 'uz done beautiful; en dey ain't nobody kin git up a plan dat's mo' mixed-up en splendid den what dat one wuz.” We was all glad as we could be, but Tom was the gladdest of all because he had a bullet in the calf of his leg. When me and Jim heard that we didn't feel so brash as what we did before. It was hurting him considerable, and bleeding; so we laid him in the wigwam and tore up one of the duke's shirts for to bandage him, but he says: “Gimme the rags; I can do it myself.  Don't stop now; don't fool around here, and the evasion booming along so handsome; man the sweeps, and set her loose!  Boys, we done it elegant!—'deed we did.  I wish we'd a had the handling of Louis XVI., there wouldn't a been no 'Son of Saint Louis, ascend to heaven!' wrote down in his biography; no, sir, we'd a whooped him over the border—that's what we'd a done with him—and done it just as slick as nothing at all, too.  Man the sweeps—man the sweeps!” But me and Jim was consulting—and thinking.  And after we'd thought a minute, I says: “Say it, Jim.” So he says: “Well, den, dis is de way it look to me, Huck.  Ef it wuz him dat 'uz bein' sot free, en one er de boys wuz to git shot, would he say, 'Go on en save me, nemmine 'bout a doctor f'r to save dis one?'  Is dat like Mars Tom Sawyer?  Would he say dat?  You bet he wouldn't!  well, den, is Jim gywne to say it?  No, sah—I doan' budge a step out'n dis place 'dout a doctor, not if it's forty year!” I knowed he was white inside, and I reckoned he'd say what he did say—so it was all right now, and I told Tom I was a-going for a doctor.  He raised considerable row about it, but me and Jim stuck to it and wouldn't budge; so he was for crawling out and setting the raft loose himself; but we wouldn't let him.  Then he give us a piece of his mind, but it didn't do no good. So when he sees me getting the canoe ready, he says: “Well, then, if you're bound to go, I'll tell you the way to do when you get to the village.  Shut the door and blindfold the doctor tight and fast, and make him swear to be silent as the grave, and put a purse full of gold in his hand, and then take and lead him all around the back alleys and everywheres in the dark, and then fetch him here in the canoe, in a roundabout way amongst the islands, and search him and take his chalk away from him, and don't give it back to him till you get him back to the village, or else he will chalk this raft so he can find it again. It's the way they all do.” So I said I would, and left, and Jim was to hide in the woods when he see the doctor coming till he was gone again. CHAPTER XLI. THE doctor was an old man; a very nice, kind-looking old man when I got him up.  I told him me and my brother was over on Spanish Island hunting yesterday afternoon, and camped on a piece of a raft we found, and about midnight he must a kicked his gun in his dreams, for it went off and shot him in the leg, and we wanted him to go over there and fix it and not say nothing about it, nor let anybody know, because we wanted to come home this evening and surprise the folks. “Who is your folks?” he says. “The Phelpses, down yonder.” “Oh,” he says.  And after a minute, he says: “How'd you say he got shot?” “He had a dream,” I says, “and it shot him.” “Singular dream,” he says. So he lit up his lantern, and got his saddle-bags, and we started.  But when he sees the canoe he didn't like the look of her—said she was big enough for one, but didn't look pretty safe for two.  I says: “Oh, you needn't be afeard, sir, she carried the three of us easy enough.” “What three?” “Why, me and Sid, and—and—and the guns; that's what I mean.” “Oh,” he says. But he put his foot on the gunnel and rocked her, and shook his head, and said he reckoned he'd look around for a bigger one.  But they was all locked and chained; so he took my canoe, and said for me to wait till he come back, or I could hunt around further, or maybe I better go down home and get them ready for the surprise if I wanted to.  But I said I didn't; so I told him just how to find the raft, and then he started. I struck an idea pretty soon.  I says to myself, spos'n he can't fix that leg just in three shakes of a sheep's tail, as the saying is? spos'n it takes him three or four days?  What are we going to do?—lay around there till he lets the cat out of the bag?  No, sir; I know what I'll do.  I'll wait, and when he comes back if he says he's got to go any more I'll get down there, too, if I swim; and we'll take and tie him, and keep him, and shove out down the river; and when Tom's done with him we'll give him what it's worth, or all we got, and then let him get ashore. So then I crept into a lumber-pile to get some sleep; and next time I waked up the sun was away up over my head!  I shot out and went for the doctor's house, but they told me he'd gone away in the night some time or other, and warn't back yet.  Well, thinks I, that looks powerful bad for Tom, and I'll dig out for the island right off.  So away I shoved, and turned the corner, and nearly rammed my head into Uncle Silas's stomach! He says: “Why, Tom!  Where you been all this time, you rascal?” “I hain't been nowheres,” I says, “only just hunting for the runaway nigger—me and Sid.” “Why, where ever did you go?” he says.  "Your aunt's been mighty uneasy.” “She needn't,” I says, “because we was all right.  We followed the men and the dogs, but they outrun us, and we lost them; but we thought we heard them on the water, so we got a canoe and took out after them and crossed over, but couldn't find nothing of them; so we cruised along up-shore till we got kind of tired and beat out; and tied up the canoe and went to sleep, and never waked up till about an hour ago; then we paddled over here to hear the news, and Sid's at the post-office to see what he can hear, and I'm a-branching out to get something to eat for us, and then we're going home.” So then we went to the post-office to get “Sid”; but just as I suspicioned, he warn't there; so the old man he got a letter out of the office, and we waited awhile longer, but Sid didn't come; so the old man said, come along, let Sid foot it home, or canoe it, when he got done fooling around—but we would ride.  I couldn't get him to let me stay and wait for Sid; and he said there warn't no use in it, and I must come along, and let Aunt Sally see we was all right. When we got home Aunt Sally was that glad to see me she laughed and cried both, and hugged me, and give me one of them lickings of hern that don't amount to shucks, and said she'd serve Sid the same when he come. And the place was plum full of farmers and farmers' wives, to dinner; and such another clack a body never heard.  Old Mrs. Hotchkiss was the worst; her tongue was a-going all the time.  She says: “Well, Sister Phelps, I've ransacked that-air cabin over, an' I b'lieve the nigger was crazy.  I says to Sister Damrell—didn't I, Sister Damrell?—s'I, he's crazy, s'I—them's the very words I said.  You all hearn me: he's crazy, s'I; everything shows it, s'I.  Look at that-air grindstone, s'I; want to tell me't any cretur 't's in his right mind 's a goin' to scrabble all them crazy things onto a grindstone, s'I?  Here sich 'n' sich a person busted his heart; 'n' here so 'n' so pegged along for thirty-seven year, 'n' all that—natcherl son o' Louis somebody, 'n' sich everlast'n rubbage.  He's plumb crazy, s'I; it's what I says in the fust place, it's what I says in the middle, 'n' it's what I says last 'n' all the time—the nigger's crazy—crazy 's Nebokoodneezer, s'I.” “An' look at that-air ladder made out'n rags, Sister Hotchkiss,” says old Mrs. Damrell; “what in the name o' goodness could he ever want of—” “The very words I was a-sayin' no longer ago th'n this minute to Sister Utterback, 'n' she'll tell you so herself.  Sh-she, look at that-air rag ladder, sh-she; 'n' s'I, yes, look at it, s'I—what could he a-wanted of it, s'I.  Sh-she, Sister Hotchkiss, sh-she—” “But how in the nation'd they ever git that grindstone in there, anyway? 'n' who dug that-air hole? 'n' who—” “My very words, Brer Penrod!  I was a-sayin'—pass that-air sasser o' m'lasses, won't ye?—I was a-sayin' to Sister Dunlap, jist this minute, how did they git that grindstone in there, s'I.  Without help, mind you—'thout help!  that's wher 'tis.  Don't tell me, s'I; there wuz help, s'I; 'n' ther' wuz a plenty help, too, s'I; ther's ben a dozen a-helpin' that nigger, 'n' I lay I'd skin every last nigger on this place but I'd find out who done it, s'I; 'n' moreover, s'I—” “A dozen says you!—forty couldn't a done every thing that's been done. Look at them case-knife saws and things, how tedious they've been made; look at that bed-leg sawed off with 'm, a week's work for six men; look at that nigger made out'n straw on the bed; and look at—” “You may well say it, Brer Hightower!  It's jist as I was a-sayin' to Brer Phelps, his own self.  S'e, what do you think of it, Sister Hotchkiss, s'e? Think o' what, Brer Phelps, s'I?  Think o' that bed-leg sawed off that a way, s'e?  think of it, s'I?  I lay it never sawed itself off, s'I—somebody sawed it, s'I; that's my opinion, take it or leave it, it mayn't be no 'count, s'I, but sich as 't is, it's my opinion, s'I, 'n' if any body k'n start a better one, s'I, let him do it, s'I, that's all.  I says to Sister Dunlap, s'I—” “Why, dog my cats, they must a ben a house-full o' niggers in there every night for four weeks to a done all that work, Sister Phelps.  Look at that shirt—every last inch of it kivered over with secret African writ'n done with blood!  Must a ben a raft uv 'm at it right along, all the time, amost.  Why, I'd give two dollars to have it read to me; 'n' as for the niggers that wrote it, I 'low I'd take 'n' lash 'm t'll—” “People to help him, Brother Marples!  Well, I reckon you'd think so if you'd a been in this house for a while back.  Why, they've stole everything they could lay their hands on—and we a-watching all the time, mind you. They stole that shirt right off o' the line! and as for that sheet they made the rag ladder out of, ther' ain't no telling how many times they didn't steal that; and flour, and candles, and candlesticks, and spoons, and the old warming-pan, and most a thousand things that I disremember now, and my new calico dress; and me and Silas and my Sid and Tom on the constant watch day and night, as I was a-telling you, and not a one of us could catch hide nor hair nor sight nor sound of them; and here at the last minute, lo and behold you, they slides right in under our noses and fools us, and not only fools us but the Injun Territory robbers too, and actuly gets away with that nigger safe and sound, and that with sixteen men and twenty-two dogs right on their very heels at that very time!  I tell you, it just bangs anything I ever heard of. Why, sperits couldn't a done better and been no smarter. And I reckon they must a been sperits—because, you know our dogs, and ther' ain't no better; well, them dogs never even got on the track of 'm once!  You explain that to me if you can!—any of you!” “Well, it does beat—” “Laws alive, I never—” “So help me, I wouldn't a be—” “House-thieves as well as—” “Goodnessgracioussakes, I'd a ben afeard to live in sich a—” “'Fraid to live!—why, I was that scared I dasn't hardly go to bed, or get up, or lay down, or set down, Sister Ridgeway.  Why, they'd steal the very—why, goodness sakes, you can guess what kind of a fluster I was in by the time midnight come last night.  I hope to gracious if I warn't afraid they'd steal some o' the family!  I was just to that pass I didn't have no reasoning faculties no more.  It looks foolish enough now, in the daytime; but I says to myself, there's my two poor boys asleep, 'way up stairs in that lonesome room, and I declare to goodness I was that uneasy 't I crep' up there and locked 'em in!  I did.  And anybody would. Because, you know, when you get scared that way, and it keeps running on, and getting worse and worse all the time, and your wits gets to addling, and you get to doing all sorts o' wild things, and by and by you think to yourself, spos'n I was a boy, and was away up there, and the door ain't locked, and you—” She stopped, looking kind of wondering, and then she turned her head around slow, and when her eye lit on me—I got up and took a walk. Says I to myself, I can explain better how we come to not be in that room this morning if I go out to one side and study over it a little.  So I done it.  But I dasn't go fur, or she'd a sent for me.  And when it was late in the day the people all went, and then I come in and told her the noise and shooting waked up me and “Sid,” and the door was locked, and we wanted to see the fun, so we went down the lightning-rod, and both of us got hurt a little, and we didn't never want to try that no more.  And then I went on and told her all what I told Uncle Silas before; and then she said she'd forgive us, and maybe it was all right enough anyway, and about what a body might expect of boys, for all boys was a pretty harum-scarum lot as fur as she could see; and so, as long as no harm hadn't come of it, she judged she better put in her time being grateful we was alive and well and she had us still, stead of fretting over what was past and done.  So then she kissed me, and patted me on the head, and dropped into a kind of a brown study; and pretty soon jumps up, and says: “Why, lawsamercy, it's most night, and Sid not come yet!  What has become of that boy?” I see my chance; so I skips up and says: “I'll run right up to town and get him,” I says. “No you won't,” she says.  "You'll stay right wher' you are; one's enough to be lost at a time.  If he ain't here to supper, your uncle 'll go.” Well, he warn't there to supper; so right after supper uncle went. He come back about ten a little bit uneasy; hadn't run across Tom's track. Aunt Sally was a good deal uneasy; but Uncle Silas he said there warn't no occasion to be—boys will be boys, he said, and you'll see this one turn up in the morning all sound and right.  So she had to be satisfied.  But she said she'd set up for him a while anyway, and keep a light burning so he could see it. And then when I went up to bed she come up with me and fetched her candle, and tucked me in, and mothered me so good I felt mean, and like I couldn't look her in the face; and she set down on the bed and talked with me a long time, and said what a splendid boy Sid was, and didn't seem to want to ever stop talking about him; and kept asking me every now and then if I reckoned he could a got lost, or hurt, or maybe drownded, and might be laying at this minute somewheres suffering or dead, and she not by him to help him, and so the tears would drip down silent, and I would tell her that Sid was all right, and would be home in the morning, sure; and she would squeeze my hand, or maybe kiss me, and tell me to say it again, and keep on saying it, because it done her good, and she was in so much trouble.  And when she was going away she looked down in my eyes so steady and gentle, and says: “The door ain't going to be locked, Tom, and there's the window and the rod; but you'll be good, won't you?  And you won't go?  For my sake.” Laws knows I wanted to go bad enough to see about Tom, and was all intending to go; but after that I wouldn't a went, not for kingdoms. But she was on my mind and Tom was on my mind, so I slept very restless. And twice I went down the rod away in the night, and slipped around front, and see her setting there by her candle in the window with her eyes towards the road and the tears in them; and I wished I could do something for her, but I couldn't, only to swear that I wouldn't never do nothing to grieve her any more.  And the third time I waked up at dawn, and slid down, and she was there yet, and her candle was most out, and her old gray head was resting on her hand, and she was asleep. CHAPTER XLII. THE old man was uptown again before breakfast, but couldn't get no track of Tom; and both of them set at the table thinking, and not saying nothing, and looking mournful, and their coffee getting cold, and not eating anything. And by and by the old man says: “Did I give you the letter?” “What letter?” “The one I got yesterday out of the post-office.” “No, you didn't give me no letter.” “Well, I must a forgot it.” So he rummaged his pockets, and then went off somewheres where he had laid it down, and fetched it, and give it to her.  She says: “Why, it's from St. Petersburg—it's from Sis.” I allowed another walk would do me good; but I couldn't stir.  But before she could break it open she dropped it and run—for she see something. And so did I. It was Tom Sawyer on a mattress; and that old doctor; and Jim, in her calico dress, with his hands tied behind him; and a lot of people.  I hid the letter behind the first thing that come handy, and rushed.  She flung herself at Tom, crying, and says: “Oh, he's dead, he's dead, I know he's dead!” And Tom he turned his head a little, and muttered something or other, which showed he warn't in his right mind; then she flung up her hands, and says: “He's alive, thank God!  And that's enough!” and she snatched a kiss of him, and flew for the house to get the bed ready, and scattering orders right and left at the niggers and everybody else, as fast as her tongue could go, every jump of the way. I followed the men to see what they was going to do with Jim; and the old doctor and Uncle Silas followed after Tom into the house.  The men was very huffy, and some of them wanted to hang Jim for an example to all the other niggers around there, so they wouldn't be trying to run away like Jim done, and making such a raft of trouble, and keeping a whole family scared most to death for days and nights.  But the others said, don't do it, it wouldn't answer at all; he ain't our nigger, and his owner would turn up and make us pay for him, sure.  So that cooled them down a little, because the people that's always the most anxious for to hang a nigger that hain't done just right is always the very ones that ain't the most anxious to pay for him when they've got their satisfaction out of him. They cussed Jim considerble, though, and give him a cuff or two side the head once in a while, but Jim never said nothing, and he never let on to know me, and they took him to the same cabin, and put his own clothes on him, and chained him again, and not to no bed-leg this time, but to a big staple drove into the bottom log, and chained his hands, too, and both legs, and said he warn't to have nothing but bread and water to eat after this till his owner come, or he was sold at auction because he didn't come in a certain length of time, and filled up our hole, and said a couple of farmers with guns must stand watch around about the cabin every night, and a bulldog tied to the door in the daytime; and about this time they was through with the job and was tapering off with a kind of generl good-bye cussing, and then the old doctor comes and takes a look, and says: “Don't be no rougher on him than you're obleeged to, because he ain't a bad nigger.  When I got to where I found the boy I see I couldn't cut the bullet out without some help, and he warn't in no condition for me to leave to go and get help; and he got a little worse and a little worse, and after a long time he went out of his head, and wouldn't let me come a-nigh him any more, and said if I chalked his raft he'd kill me, and no end of wild foolishness like that, and I see I couldn't do anything at all with him; so I says, I got to have help somehow; and the minute I says it out crawls this nigger from somewheres and says he'll help, and he done it, too, and done it very well.  Of course I judged he must be a runaway nigger, and there I was! and there I had to stick right straight along all the rest of the day and all night.  It was a fix, I tell you! I had a couple of patients with the chills, and of course I'd of liked to run up to town and see them, but I dasn't, because the nigger might get away, and then I'd be to blame; and yet never a skiff come close enough for me to hail.  So there I had to stick plumb until daylight this morning; and I never see a nigger that was a better nuss or faithfuller, and yet he was risking his freedom to do it, and was all tired out, too, and I see plain enough he'd been worked main hard lately.  I liked the nigger for that; I tell you, gentlemen, a nigger like that is worth a thousand dollars—and kind treatment, too.  I had everything I needed, and the boy was doing as well there as he would a done at home—better, maybe, because it was so quiet; but there I was, with both of 'm on my hands, and there I had to stick till about dawn this morning; then some men in a skiff come by, and as good luck would have it the nigger was setting by the pallet with his head propped on his knees sound asleep; so I motioned them in quiet, and they slipped up on him and grabbed him and tied him before he knowed what he was about, and we never had no trouble. And the boy being in a kind of a flighty sleep, too, we muffled the oars and hitched the raft on, and towed her over very nice and quiet, and the nigger never made the least row nor said a word from the start.  He ain't no bad nigger, gentlemen; that's what I think about him.” Somebody says: “Well, it sounds very good, doctor, I'm obleeged to say.” Then the others softened up a little, too, and I was mighty thankful to that old doctor for doing Jim that good turn; and I was glad it was according to my judgment of him, too; because I thought he had a good heart in him and was a good man the first time I see him.  Then they all agreed that Jim had acted very well, and was deserving to have some notice took of it, and reward.  So every one of them promised, right out and hearty, that they wouldn't cuss him no more. Then they come out and locked him up.  I hoped they was going to say he could have one or two of the chains took off, because they was rotten heavy, or could have meat and greens with his bread and water; but they didn't think of it, and I reckoned it warn't best for me to mix in, but I judged I'd get the doctor's yarn to Aunt Sally somehow or other as soon as I'd got through the breakers that was laying just ahead of me—explanations, I mean, of how I forgot to mention about Sid being shot when I was telling how him and me put in that dratted night paddling around hunting the runaway nigger. But I had plenty time.  Aunt Sally she stuck to the sick-room all day and all night, and every time I see Uncle Silas mooning around I dodged him. Next morning I heard Tom was a good deal better, and they said Aunt Sally was gone to get a nap.  So I slips to the sick-room, and if I found him awake I reckoned we could put up a yarn for the family that would wash. But he was sleeping, and sleeping very peaceful, too; and pale, not fire-faced the way he was when he come.  So I set down and laid for him to wake.  In about half an hour Aunt Sally comes gliding in, and there I was, up a stump again!  She motioned me to be still, and set down by me, and begun to whisper, and said we could all be joyful now, because all the symptoms was first-rate, and he'd been sleeping like that for ever so long, and looking better and peacefuller all the time, and ten to one he'd wake up in his right mind. So we set there watching, and by and by he stirs a bit, and opened his eyes very natural, and takes a look, and says: “Hello!—why, I'm at home!  How's that?  Where's the raft?” “It's all right,” I says. “And Jim?” “The same,” I says, but couldn't say it pretty brash.  But he never noticed, but says: “Good!  Splendid!  Now we're all right and safe! Did you tell Aunty?” I was going to say yes; but she chipped in and says:  "About what, Sid?” “Why, about the way the whole thing was done.” “What whole thing?” “Why, the whole thing.  There ain't but one; how we set the runaway nigger free—me and Tom.” “Good land!  Set the run—What is the child talking about!  Dear, dear, out of his head again!” “No, I ain't out of my head; I know all what I'm talking about.  We did set him free—me and Tom.  We laid out to do it, and we done it.  And we done it elegant, too.”  He'd got a start, and she never checked him up, just set and stared and stared, and let him clip along, and I see it warn't no use for me to put in.  "Why, Aunty, it cost us a power of work—weeks of it—hours and hours, every night, whilst you was all asleep. And we had to steal candles, and the sheet, and the shirt, and your dress, and spoons, and tin plates, and case-knives, and the warming-pan, and the grindstone, and flour, and just no end of things, and you can't think what work it was to make the saws, and pens, and inscriptions, and one thing or another, and you can't think half the fun it was.  And we had to make up the pictures of coffins and things, and nonnamous letters from the robbers, and get up and down the lightning-rod, and dig the hole into the cabin, and made the rope ladder and send it in cooked up in a pie, and send in spoons and things to work with in your apron pocket—” “Mercy sakes!” “—and load up the cabin with rats and snakes and so on, for company for Jim; and then you kept Tom here so long with the butter in his hat that you come near spiling the whole business, because the men come before we was out of the cabin, and we had to rush, and they heard us and let drive at us, and I got my share, and we dodged out of the path and let them go by, and when the dogs come they warn't interested in us, but went for the most noise, and we got our canoe, and made for the raft, and was all safe, and Jim was a free man, and we done it all by ourselves, and wasn't it bully, Aunty!” “Well, I never heard the likes of it in all my born days!  So it was you, you little rapscallions, that's been making all this trouble, and turned everybody's wits clean inside out and scared us all most to death.  I've as good a notion as ever I had in my life to take it out o' you this very minute.  To think, here I've been, night after night, a—you just get well once, you young scamp, and I lay I'll tan the Old Harry out o' both o' ye!” But Tom, he was so proud and joyful, he just couldn't hold in, and his tongue just went it—she a-chipping in, and spitting fire all along, and both of them going it at once, like a cat convention; and she says: “Well, you get all the enjoyment you can out of it now, for mind I tell you if I catch you meddling with him again—” “Meddling with who?”  Tom says, dropping his smile and looking surprised. “With who?  Why, the runaway nigger, of course.  Who'd you reckon?” Tom looks at me very grave, and says: “Tom, didn't you just tell me he was all right?  Hasn't he got away?” “Him?” says Aunt Sally; “the runaway nigger?  'Deed he hasn't.  They've got him back, safe and sound, and he's in that cabin again, on bread and water, and loaded down with chains, till he's claimed or sold!” Tom rose square up in bed, with his eye hot, and his nostrils opening and shutting like gills, and sings out to me: “They hain't no right to shut him up!  SHOVE!—and don't you lose a minute.  Turn him loose! he ain't no slave; he's as free as any cretur that walks this earth!” “What does the child mean?” “I mean every word I say, Aunt Sally, and if somebody don't go, I'll go. I've knowed him all his life, and so has Tom, there.  Old Miss Watson died two months ago, and she was ashamed she ever was going to sell him down the river, and said so; and she set him free in her will.” “Then what on earth did you want to set him free for, seeing he was already free?” “Well, that is a question, I must say; and just like women!  Why, I wanted the adventure of it; and I'd a waded neck-deep in blood to—goodness alive, Aunt Polly!” If she warn't standing right there, just inside the door, looking as sweet and contented as an angel half full of pie, I wish I may never! Aunt Sally jumped for her, and most hugged the head off of her, and cried over her, and I found a good enough place for me under the bed, for it was getting pretty sultry for us, seemed to me.  And I peeped out, and in a little while Tom's Aunt Polly shook herself loose and stood there looking across at Tom over her spectacles—kind of grinding him into the earth, you know.  And then she says: “Yes, you better turn y'r head away—I would if I was you, Tom.” “Oh, deary me!” says Aunt Sally; “Is he changed so?  Why, that ain't Tom, it's Sid; Tom's—Tom's—why, where is Tom?  He was here a minute ago.” “You mean where's Huck Finn—that's what you mean!  I reckon I hain't raised such a scamp as my Tom all these years not to know him when I see him.  That would be a pretty howdy-do. Come out from under that bed, Huck Finn.” So I done it.  But not feeling brash. Aunt Sally she was one of the mixed-upest-looking persons I ever see—except one, and that was Uncle Silas, when he come in and they told it all to him.  It kind of made him drunk, as you may say, and he didn't know nothing at all the rest of the day, and preached a prayer-meeting sermon that night that gave him a rattling ruputation, because the oldest man in the world couldn't a understood it.  So Tom's Aunt Polly, she told all about who I was, and what; and I had to up and tell how I was in such a tight place that when Mrs. Phelps took me for Tom Sawyer—she chipped in and says, “Oh, go on and call me Aunt Sally, I'm used to it now, and 'tain't no need to change”—that when Aunt Sally took me for Tom Sawyer I had to stand it—there warn't no other way, and I knowed he wouldn't mind, because it would be nuts for him, being a mystery, and he'd make an adventure out of it, and be perfectly satisfied.  And so it turned out, and he let on to be Sid, and made things as soft as he could for me. And his Aunt Polly she said Tom was right about old Miss Watson setting Jim free in her will; and so, sure enough, Tom Sawyer had gone and took all that trouble and bother to set a free nigger free! and I couldn't ever understand before, until that minute and that talk, how he could help a body set a nigger free with his bringing-up. Well, Aunt Polly she said that when Aunt Sally wrote to her that Tom and Sid had come all right and safe, she says to herself: “Look at that, now!  I might have expected it, letting him go off that way without anybody to watch him.  So now I got to go and trapse all the way down the river, eleven hundred mile, and find out what that creetur's up to this time, as long as I couldn't seem to get any answer out of you about it.” “Why, I never heard nothing from you,” says Aunt Sally. “Well, I wonder!  Why, I wrote you twice to ask you what you could mean by Sid being here.” “Well, I never got 'em, Sis.” Aunt Polly she turns around slow and severe, and says: “You, Tom!” “Well—what?” he says, kind of pettish. “Don't you what me, you impudent thing—hand out them letters.” “What letters?” “Them letters.  I be bound, if I have to take a-holt of you I'll—” “They're in the trunk.  There, now.  And they're just the same as they was when I got them out of the office.  I hain't looked into them, I hain't touched them.  But I knowed they'd make trouble, and I thought if you warn't in no hurry, I'd—” “Well, you do need skinning, there ain't no mistake about it.  And I wrote another one to tell you I was coming; and I s'pose he—” “No, it come yesterday; I hain't read it yet, but it's all right, I've got that one.” I wanted to offer to bet two dollars she hadn't, but I reckoned maybe it was just as safe to not to.  So I never said nothing. CHAPTER THE LAST THE first time I catched Tom private I asked him what was his idea, time of the evasion?—what it was he'd planned to do if the evasion worked all right and he managed to set a nigger free that was already free before? And he said, what he had planned in his head from the start, if we got Jim out all safe, was for us to run him down the river on the raft, and have adventures plumb to the mouth of the river, and then tell him about his being free, and take him back up home on a steamboat, in style, and pay him for his lost time, and write word ahead and get out all the niggers around, and have them waltz him into town with a torchlight procession and a brass-band, and then he would be a hero, and so would we.  But I reckoned it was about as well the way it was. We had Jim out of the chains in no time, and when Aunt Polly and Uncle Silas and Aunt Sally found out how good he helped the doctor nurse Tom, they made a heap of fuss over him, and fixed him up prime, and give him all he wanted to eat, and a good time, and nothing to do.  And we had him up to the sick-room, and had a high talk; and Tom give Jim forty dollars for being prisoner for us so patient, and doing it up so good, and Jim was pleased most to death, and busted out, and says: “Dah, now, Huck, what I tell you?—what I tell you up dah on Jackson islan'?  I tole you I got a hairy breas', en what's de sign un it; en I tole you I ben rich wunst, en gwineter to be rich agin; en it's come true; en heah she is!  dah, now! doan' talk to me—signs is signs, mine I tell you; en I knowed jis' 's well 'at I 'uz gwineter be rich agin as I's a-stannin' heah dis minute!” And then Tom he talked along and talked along, and says, le's all three slide out of here one of these nights and get an outfit, and go for howling adventures amongst the Injuns, over in the Territory, for a couple of weeks or two; and I says, all right, that suits me, but I ain't got no money for to buy the outfit, and I reckon I couldn't get none from home, because it's likely pap's been back before now, and got it all away from Judge Thatcher and drunk it up. “No, he hain't,” Tom says; “it's all there yet—six thousand dollars and more; and your pap hain't ever been back since.  Hadn't when I come away, anyhow.” Jim says, kind of solemn: “He ain't a-comin' back no mo', Huck.” I says: “Why, Jim?” “Nemmine why, Huck—but he ain't comin' back no mo.” But I kept at him; so at last he says: “Doan' you 'member de house dat was float'n down de river, en dey wuz a man in dah, kivered up, en I went in en unkivered him and didn' let you come in?  Well, den, you kin git yo' money when you wants it, kase dat wuz him.” Tom's most well now, and got his bullet around his neck on a watch-guard for a watch, and is always seeing what time it is, and so there ain't nothing more to write about, and I am rotten glad of it, because if I'd a knowed what a trouble it was to make a book I wouldn't a tackled it, and ain't a-going to no more.  But I reckon I got to light out for the Territory ahead of the rest, because Aunt Sally she's going to adopt me and sivilize me, and I can't stand it.  I been there before. THE END. YOURS TRULY, HUCK FINN. End of the Project Gutenberg EBook of Adventures of Huckleberry Finn, Complete, by Mark Twain (Samuel Clemens) *** END OF THIS PROJECT GUTENBERG EBOOK HUCKLEBERRY FINN *** ***** This file should be named 76-h.htm or 76-h.zip ***** This and all associated files of various formats will be found in: http://www.gutenberg.net/7/76/ Produced by David Widger. Previous editions produced by Ron Burkey and Internet Wiretap Updated editions will replace the previous one--the old editions will be renamed. Creating the works from public domain print editions means that no one owns a United States copyright in these works, so the Foundation (and you!) can copy and distribute it in the United States without permission and without paying copyright royalties. Special rules, set forth in the General Terms of Use part of this license, apply to copying and distributing Project Gutenberg-tm electronic works to protect the PROJECT GUTENBERG-tm concept and trademark. Project Gutenberg is a registered trademark, and may not be used if you charge for the eBooks, unless you receive specific permission. If you do not charge anything for copies of this eBook, complying with the rules is very easy. You may use this eBook for nearly any purpose such as creation of derivative works, reports, performances and research. They may be modified and printed and given away--you may do practically ANYTHING with public domain eBooks. Redistribution is subject to the trademark license, especially commercial redistribution. *** START: FULL LICENSE *** THE FULL PROJECT GUTENBERG LICENSE PLEASE READ THIS BEFORE YOU DISTRIBUTE OR USE THIS WORK To protect the Project Gutenberg-tm mission of promoting the free distribution of electronic works, by using or distributing this work (or any other work associated in any way with the phrase “Project Gutenberg”), you agree to comply with all the terms of the Full Project Gutenberg-tm License (available with this file or online at http://gutenberg.net/license). Section 1. General Terms of Use and Redistributing Project Gutenberg-tm electronic works 1.A. By reading or using any part of this Project Gutenberg-tm electronic work, you indicate that you have read, understand, agree to and accept all the terms of this license and intellectual property (trademark/copyright) agreement. If you do not agree to abide by all the terms of this agreement, you must cease using and return or destroy all copies of Project Gutenberg-tm electronic works in your possession. If you paid a fee for obtaining a copy of or access to a Project Gutenberg-tm electronic work and you do not agree to be bound by the terms of this agreement, you may obtain a refund from the person or entity to whom you paid the fee as set forth in paragraph 1.E.8. 1.B. “Project Gutenberg” is a registered trademark. It may only be used on or associated in any way with an electronic work by people who agree to be bound by the terms of this agreement. There are a few things that you can do with most Project Gutenberg-tm electronic works even without complying with the full terms of this agreement. See paragraph 1.C below. There are a lot of things you can do with Project Gutenberg-tm electronic works if you follow the terms of this agreement and help preserve free future access to Project Gutenberg-tm electronic works. See paragraph 1.E below. 1.C. The Project Gutenberg Literary Archive Foundation (“the Foundation” or PGLAF), owns a compilation copyright in the collection of Project Gutenberg-tm electronic works. Nearly all the individual works in the collection are in the public domain in the United States. If an individual work is in the public domain in the United States and you are located in the United States, we do not claim a right to prevent you from copying, distributing, performing, displaying or creating derivative works based on the work as long as all references to Project Gutenberg are removed. Of course, we hope that you will support the Project Gutenberg-tm mission of promoting free access to electronic works by freely sharing Project Gutenberg-tm works in compliance with the terms of this agreement for keeping the Project Gutenberg-tm name associated with the work. You can easily comply with the terms of this agreement by keeping this work in the same format with its attached full Project Gutenberg-tm License when you share it without charge with others. 1.D. The copyright laws of the place where you are located also govern what you can do with this work. Copyright laws in most countries are in a constant state of change. If you are outside the United States, check the laws of your country in addition to the terms of this agreement before downloading, copying, displaying, performing, distributing or creating derivative works based on this work or any other Project Gutenberg-tm work. The Foundation makes no representations concerning the copyright status of any work in any country outside the United States. 1.E. Unless you have removed all references to Project Gutenberg: 1.E.1. The following sentence, with active links to, or other immediate access to, the full Project Gutenberg-tm License must appear prominently whenever any copy of a Project Gutenberg-tm work (any work on which the phrase “Project Gutenberg” appears, or with which the phrase “Project Gutenberg” is associated) is accessed, displayed, performed, viewed, copied or distributed: This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Project Gutenberg License included with this eBook or online at www.gutenberg.net 1.E.2. If an individual Project Gutenberg-tm electronic work is derived from the public domain (does not contain a notice indicating that it is posted with permission of the copyright holder), the work can be copied and distributed to anyone in the United States without paying any fees or charges. If you are redistributing or providing access to a work with the phrase “Project Gutenberg” associated with or appearing on the work, you must comply either with the requirements of paragraphs 1.E.1 through 1.E.7 or obtain permission for the use of the work and the Project Gutenberg-tm trademark as set forth in paragraphs 1.E.8 or 1.E.9. 1.E.3. If an individual Project Gutenberg-tm electronic work is posted with the permission of the copyright holder, your use and distribution must comply with both paragraphs 1.E.1 through 1.E.7 and any additional terms imposed by the copyright holder. Additional terms will be linked to the Project Gutenberg-tm License for all works posted with the permission of the copyright holder found at the beginning of this work. 1.E.4. Do not unlink or detach or remove the full Project Gutenberg-tm License terms from this work, or any files containing a part of this work or any other work associated with Project Gutenberg-tm. 1.E.5. Do not copy, display, perform, distribute or redistribute this electronic work, or any part of this electronic work, without prominently displaying the sentence set forth in paragraph 1.E.1 with active links or immediate access to the full terms of the Project Gutenberg-tm License. 1.E.6. You may convert to and distribute this work in any binary, compressed, marked up, nonproprietary or proprietary form, including any word processing or hypertext form. However, if you provide access to or distribute copies of a Project Gutenberg-tm work in a format other than “Plain Vanilla ASCII” or other format used in the official version posted on the official Project Gutenberg-tm web site (www.gutenberg.net), you must, at no additional cost, fee or expense to the user, provide a copy, a means of exporting a copy, or a means of obtaining a copy upon request, of the work in its original “Plain Vanilla ASCII” or other form. Any alternate format must include the full Project Gutenberg-tm License as specified in paragraph 1.E.1. 1.E.7. Do not charge a fee for access to, viewing, displaying, performing, copying or distributing any Project Gutenberg-tm works unless you comply with paragraph 1.E.8 or 1.E.9. 1.E.8. You may charge a reasonable fee for copies of or providing access to or distributing Project Gutenberg-tm electronic works provided that - You pay a royalty fee of 20% of the gross profits you derive from the use of Project Gutenberg-tm works calculated using the method you already use to calculate your applicable taxes. The fee is owed to the owner of the Project Gutenberg-tm trademark, but he has agreed to donate royalties under this paragraph to the Project Gutenberg Literary Archive Foundation. Royalty payments must be paid within 60 days following each date on which you prepare (or are legally required to prepare) your periodic tax returns. Royalty payments should be clearly marked as such and sent to the Project Gutenberg Literary Archive Foundation at the address specified in Section 4, “Information about donations to the Project Gutenberg Literary Archive Foundation.” - You provide a full refund of any money paid by a user who notifies you in writing (or by e-mail) within 30 days of receipt that s/he does not agree to the terms of the full Project Gutenberg-tm License. You must require such a user to return or destroy all copies of the works possessed in a physical medium and discontinue all use of and all access to other copies of Project Gutenberg-tm works. - You provide, in accordance with paragraph 1.F.3, a full refund of any money paid for a work or a replacement copy, if a defect in the electronic work is discovered and reported to you within 90 days of receipt of the work. - You comply with all other terms of this agreement for free distribution of Project Gutenberg-tm works. 1.E.9. If you wish to charge a fee or distribute a Project Gutenberg-tm electronic work or group of works on different terms than are set forth in this agreement, you must obtain permission in writing from both the Project Gutenberg Literary Archive Foundation and Michael Hart, the owner of the Project Gutenberg-tm trademark. Contact the Foundation as set forth in Section 3 below. 1.F. 1.F.1. Project Gutenberg volunteers and employees expend considerable effort to identify, do copyright research on, transcribe and proofread public domain works in creating the Project Gutenberg-tm collection. Despite these efforts, Project Gutenberg-tm electronic works, and the medium on which they may be stored, may contain “Defects,” such as, but not limited to, incomplete, inaccurate or corrupt data, transcription errors, a copyright or other intellectual property infringement, a defective or damaged disk or other medium, a computer virus, or computer codes that damage or cannot be read by your equipment. 1.F.2. LIMITED WARRANTY, DISCLAIMER OF DAMAGES - Except for the “Right of Replacement or Refund” described in paragraph 1.F.3, the Project Gutenberg Literary Archive Foundation, the owner of the Project Gutenberg-tm trademark, and any other party distributing a Project Gutenberg-tm electronic work under this agreement, disclaim all liability to you for damages, costs and expenses, including legal fees. YOU AGREE THAT YOU HAVE NO REMEDIES FOR NEGLIGENCE, STRICT LIABILITY, BREACH OF WARRANTY OR BREACH OF CONTRACT EXCEPT THOSE PROVIDED IN PARAGRAPH F3. YOU AGREE THAT THE FOUNDATION, THE TRADEMARK OWNER, AND ANY DISTRIBUTOR UNDER THIS AGREEMENT WILL NOT BE LIABLE TO YOU FOR ACTUAL, DIRECT, INDIRECT, CONSEQUENTIAL, PUNITIVE OR INCIDENTAL DAMAGES EVEN IF YOU GIVE NOTICE OF THE POSSIBILITY OF SUCH DAMAGE. 1.F.3. LIMITED RIGHT OF REPLACEMENT OR REFUND - If you discover a defect in this electronic work within 90 days of receiving it, you can receive a refund of the money (if any) you paid for it by sending a written explanation to the person you received the work from. If you received the work on a physical medium, you must return the medium with your written explanation. The person or entity that provided you with the defective work may elect to provide a replacement copy in lieu of a refund. If you received the work electronically, the person or entity providing it to you may choose to give you a second opportunity to receive the work electronically in lieu of a refund. If the second copy is also defective, you may demand a refund in writing without further opportunities to fix the problem. 1.F.4. Except for the limited right of replacement or refund set forth in paragraph 1.F.3, this work is provided to you 'AS-IS' WITH NO OTHER WARRANTIES OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO WARRANTIES OF MERCHANTIBILITY OR FITNESS FOR ANY PURPOSE. 1.F.5. Some states do not allow disclaimers of certain implied warranties or the exclusion or limitation of certain types of damages. If any disclaimer or limitation set forth in this agreement violates the law of the state applicable to this agreement, the agreement shall be interpreted to make the maximum disclaimer or limitation permitted by the applicable state law. The invalidity or unenforceability of any provision of this agreement shall not void the remaining provisions. 1.F.6. INDEMNITY - You agree to indemnify and hold the Foundation, the trademark owner, any agent or employee of the Foundation, anyone providing copies of Project Gutenberg-tm electronic works in accordance with this agreement, and any volunteers associated with the production, promotion and distribution of Project Gutenberg-tm electronic works, harmless from all liability, costs and expenses, including legal fees, that arise directly or indirectly from any of the following which you do or cause to occur: (a) distribution of this or any Project Gutenberg-tm work, (b) alteration, modification, or additions or deletions to any Project Gutenberg-tm work, and (c) any Defect you cause. Section 2. Information about the Mission of Project Gutenberg-tm Project Gutenberg-tm is synonymous with the free distribution of electronic works in formats readable by the widest variety of computers including obsolete, old, middle-aged and new computers. It exists because of the efforts of hundreds of volunteers and donations from people in all walks of life. Volunteers and financial support to provide volunteers with the assistance they need, is critical to reaching Project Gutenberg-tm's goals and ensuring that the Project Gutenberg-tm collection will remain freely available for generations to come. In 2001, the Project Gutenberg Literary Archive Foundation was created to provide a secure and permanent future for Project Gutenberg-tm and future generations. To learn more about the Project Gutenberg Literary Archive Foundation and how your efforts and donations can help, see Sections 3 and 4 and the Foundation web page at http://www.pglaf.org. Section 3. Information about the Project Gutenberg Literary Archive Foundation The Project Gutenberg Literary Archive Foundation is a non profit 501(c)(3) educational corporation organized under the laws of the state of Mississippi and granted tax exempt status by the Internal Revenue Service. The Foundation's EIN or federal tax identification number is 64-6221541. Its 501(c)(3) letter is posted at http://pglaf.org/fundraising. Contributions to the Project Gutenberg Literary Archive Foundation are tax deductible to the full extent permitted by U.S. federal laws and your state's laws. The Foundation's principal office is located at 4557 Melan Dr. S. Fairbanks, AK, 99712., but its volunteers and employees are scattered throughout numerous locations. Its business office is located at 809 North 1500 West, Salt Lake City, UT 84116, (801) 596-1887, email business@pglaf.org. Email contact links and up to date contact information can be found at the Foundation's web site and official page at http://pglaf.org For additional contact information: Dr. Gregory B. Newby Chief Executive and Director gbnewby@pglaf.org Section 4. Information about Donations to the Project Gutenberg Literary Archive Foundation Project Gutenberg-tm depends upon and cannot survive without wide spread public support and donations to carry out its mission of increasing the number of public domain and licensed works that can be freely distributed in machine readable form accessible by the widest array of equipment including outdated equipment. Many small donations ($1 to $5,000) are particularly important to maintaining tax exempt status with the IRS. The Foundation is committed to complying with the laws regulating charities and charitable donations in all 50 states of the United States. Compliance requirements are not uniform and it takes a considerable effort, much paperwork and many fees to meet and keep up with these requirements. We do not solicit donations in locations where we have not received written confirmation of compliance. To SEND DONATIONS or determine the status of compliance for any particular state visit http://pglaf.org While we cannot and do not solicit contributions from states where we have not met the solicitation requirements, we know of no prohibition against accepting unsolicited donations from donors in such states who approach us with offers to donate. International donations are gratefully accepted, but we cannot make any statements concerning tax treatment of donations received from outside the United States. U.S. laws alone swamp our small staff. Please check the Project Gutenberg Web pages for current donation methods and addresses. Donations are accepted in a number of other ways including including checks, online payments and credit card donations. To donate, please visit: http://pglaf.org/donate Section 5. General Information About Project Gutenberg-tm electronic works. Professor Michael S. Hart is the originator of the Project Gutenberg-tm concept of a library of electronic works that could be freely shared with anyone. For thirty years, he produced and distributed Project Gutenberg-tm eBooks with only a loose network of volunteer support. Project Gutenberg-tm eBooks are often created from several printed editions, all of which are confirmed as Public Domain in the U.S. unless a copyright notice is included. Thus, we do not necessarily keep eBooks in compliance with any particular paper edition. Most people start at our Web site which has the main PG search facility: http://www.gutenberg.net This Web site includes information about Project Gutenberg-tm, including how to make donations to the Project Gutenberg Literary Archive Foundation, how to help produce our new eBooks, and how to subscribe to our email newsletter to hear about new eBooks. 06020000

      Huck feels guilty about taking the money, so he puts the money in the coffin to make himself feel better about lying.

    1. The reason was, that there had been a long Civil Warr in that Kingdom, in which most of the best Timber-trees and Principal Palaces were ruined and destroyed; and my dear Lord and Husband, said she, has lost by it half his Woods, besides many Houses, Land, and movable Goods; so that all the loss out of his particular Estate, did amount to above Half a Million of Pounds.

      Cavendish is greatly exaggerating here--think about the rhetorical strategy of embedding this history into her narrative.

    1. On 2015 Oct 27, Peter Gøtzsche commented:

      The authors report that escitalopram was significantly more effective than citalopram but caution against the “potential for overestimation of treatment effect due to sponsorship bias.” Indeed. Both substances were patented by Lundbeck, and the rejuvenated “me-again” drug, escitalopram, is merely the active half of the “old me” stereoisomer drug, citalopram.

      One would not expect a molecule to be better than itself. I therefore suggest that the Cochrane review mention the results of a 2012 meta-analysis (1), also in the abstract and plain language summary. Independent researchers confirmed the Cochrane review’s findings that escitalopram was better than citalopram in head-to-head trials. All seven trials found this, apart from the single one that was not sponsored by Lundbeck or its affiliates. These researchers also did an indirect comparison of the two drugs based on 10 citalopram and 12 escitalopram placebo controlled trials (1), and now the effect of “me-again” and “old me” was very similar (odds ratio 1.03; 0.82 to 1.30).

      Usually, direct comparisons are more reliable than indirect comparisons, but the drug industry routinely distorts its research to such an extent (2) that the indirect comparisons are sometimes the most reliable ones, which I believe is the case here. Lundbeck did not have any particular incentive to manipulate its placebo controlled studies more with escitalopram than with citalopram.

      The Cochrane authors note that cost-effectiveness information is also needed in the field of antidepressant trials. Indeed. Even if we take Lundbeck’s results in its head-to-head trials at face value, there is no meaningful difference between the two versions of the drug. In one of Lundbeck’s own meta-analyses, the difference after eight weeks was 1 on a scale that goes up to 60 (2,3), which is totally irrelevant (4).

      When I checked the Danish prices in 2009, Cipralex (escitalopram) cost 19 times as much for a daily dose as Cipramil (citalopram). This enormous price difference should have deterred the doctors from using Cipralex, but it didn’t. The sales of Cipralex were six times higher in monetary terms than the sales of citalopram both at hospitals and in primary care. I have calculated that if all patients had received the cheapest citalopram instead of Cipralex or other SSRIs, Danish taxpayers could have saved around €30 million a year, or 87% of the total amount spent on SSRIs.

      1 Alkhafaji AA, Trinquart L, Baron G, et al. Impact of evergreening on patients and health insurance: a meta analysis and reimbursement cost analysis of ci¬talopram/escitalopram antidepressants. BMC Med 2012;10:142.

      2 Gøtzsche PC. Deadly medicines and organised crime: How big pharma has corrupted health care. London: Radcliffe Publishing; 2013.

      3 Gorman JM, Korotzer A, Su G. Efficacy comparison of escitalopram and citalopram in the treatment of major depressive disorder: pooled analysis of placebo-controlled trials. CNS Spectr. 2002; 7(4 Suppl. 1): 40–4.

      4 Leucht S, Fennema H, Engel R, et al. What does the HAMD mean? J Affect Disord 2013;148:243-8


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Sep 16, Christopher Southan commented:

      Unfortunately Google has now become capricious in matching either part of the Key and thus producing false positives from just the second half. It is therfore more effective to try the inner 14-characters of the Key (the connectivity layer) first. The overall utility still stands and the better news is that, even though the full InChI strings are truncated to 32 caracters in a search, they can give useful partial matches.

      In reply (Oct 2015) to Egons Q above. As we know, rankings move so its difficult to know what (legitimate) SEO steps are making the difference (exepting traffic per se). Yes, databases could do more, in particular PubChem has a backlog problem (i.e. new entries not indexed). It would also be geat if UniChem and SureChEMBL contrived to get fully crawled. Then we really could check the global 100+ million in a ~0.3 sec pop


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2014 Apr 02, GREGORY CROWTHER commented:

      The following is an edited version of an entry in my personal blog (gregcrowther.com).

      Calculations of bees’ impact on strawberries’ market value

      This paper by Klatt et al. documents how strawberries benefit from pollination by bees, as opposed to pollination by wind or self-fertilization. It turns out that, on average, bee-pollinated strawberries are larger than others and also have fewer odd shapes, better color, and superior firmness. This detailed look at strawberry quality is a useful extension of past studies showing that insect pollination often boosts crop quantity (i.e., yield).

      In making their case for the agricultural importance of bees, Klatt et al. say that bee pollination accounts for at least $1.44 billion of the value of the $2.90 billion strawberry market in the European Union (EU). While I accept the take-home message that bees add a lot of value, I sure wish the authors had explained their calculations better.

      The $1.44 billion estimate is the sum of two factors: $1.12 billion in market value of the fresh berries, and another $0.32 billion corresponding to improved shelf life. Let’s consider each of these in turn.

      The figure of $1.12 billion is introduced in this section of the Results:

      "Bee pollination resulted in strawberry fruits with the highest commercial value (figure 1a). On average, bee pollination increased the commercial value per fruit by 38.6% compared with wind pollination and by 54.3% compared with self-pollination. Fruits resulting from wind pollination had a 25.5% higher market value than self-pollinated fruits. Pollination treatments were stronger than differences between varieties and thus had a main effect across all varieties (see table 2 for AICc and likelihood values). Our results suggest that altogether, bee pollination contributed 1.12 billion US$ to a total of 2.90 billion US$ made with commercial selling of 1.5 million tonnes of strawberries in the EU in 2009 [1]—but so far without consideration of the monetary value provided by enhanced shelf life (see below)."

      Figure 1 indicates that the mean value of 1000 wind-pollinated berries was ~$13.80 and the mean value of 1000 bee-pollinated berries was ~$22.40. The value of the wind-pollinated berries thus represents a ~38.6% DECREASE in value relative to the bee-pollinated berries; alternatively, the value of the bee-pollinated berries is a 62.9% INCREASE over the value of the wind-pollinated ones. A 62.9% increase takes us from $1.78 billion (the hypothetical value of strawberries only pollinated by wind) up to $2.9 billion, giving us the reported $1.12 billion boost from bees. The authors’ mention of a 38.6% increase when they meant a 38.6% decrease is not exactly a big deal, but initially made their math baffling to me and my students.

      Perhaps more significantly, the reported market values reflect the classification of strawberries into commercial grades by the first author. Ideally, the first author would have rated the berries while “blinded,” i.e., without knowing which ones came from which treatments (bees, wind, or self). The paper doesn’t mention blinding, so I fear that there was the potential for a pro-bee bias.

      Now for the $0.32 billion due to improved shelf life:

      "Bee pollination strongly impacted the shelf life of strawberries by improving their firmness (figure 2a). The firmness values of each treatment and variety were related to shelf life, measured as the number of days until 50% of fruits had been lost owing to surface and fungal decay (see the electronic supplementary material, S3). Higher firmness resulting from bee pollination potentially elongated the shelf life of strawberry fruits by about 12 h compared with wind pollination, and by more than 26 h compared with self-pollination. After 4 days in storage, only 29.4% of the wind-pollinated fruits and none self-pollinated fruit were still marketable, whereas, at the same time, 40.4% of the bee-pollinated fruits remained in a marketable condition. Thus, bee pollination accounted for a decrease of at least 11.0% in fruit losses during storage. These findings suggest that the value for bee pollination calculated in section 3a(i) has to be increased to accommodate this impact on the shelf life of strawberries. Hence, pollination benefits on the shelf life of strawberries potentially added another 0.32 billion US$ to the commercial value of strawberry pollination."

      Here it’s clear that the authors got $0.32 billion by multiplying 11% by $2.9 billion. What’s less clear is the meaning of “storage” (did the unspecified storage conditions simulate those typically used by strawberry farmers/distributors/vendors?) and the reason(s) why a duration of 4 days was used in this calculation (is this a typical time between harvesting and consumers’ purchases?).

      Such details aside, here’s a more general question relevant to both components of the $1.44 billion estimate. To what extent are commercial strawberries pollinated by bees in the wild?

      The calculations assumes that the study site — a field in Germany — is representative of most or all commercial strawberry farms in Europe. The study site was intentionally set up near well-established bee hives and nests; are most or all European strawberry farms situated similarly? Perhaps the answer is obvious to people with relevant expertise, but the paper doesn’t say. It’s worth noting that if only half of commercial strawberry fields enjoy bee pollination, the estimates of bees’ economic impact would need to be cut in half.

      Considering that the paper trumpets a billion-dollar claim in its abstract, more information on the calculations underlying that claim would have been helpful.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2015 Sep 03, Kenneth Witwer commented:

      We recently published a small comparison of several validated miRNA-target databases (Lee YJ, 2015)--that is, catalogs of miRNA-target interactions with published experimental evidence. A "validated target" module is one part of miRWalk2.0, so this database and its predecessor (1.0) were included in our study. We queried 50 genes at different times. 82 miRNA-target interactions were returned by miRWalk1.0, 5468 by miRWalk2.0 in January, 2015, and 91 by miRWalk2.0 in May, June, and August, 2015, with only 5 from the original 82. As of August, 2015, the final set of 91 interactions was identical to that returned by miRTarBase (Hsu SD, 2014, Hsu SD, 2011), down to the sort order. Although miRTarBase is cited as one of numerous sources of information for miRWalk output, it was not clear from the methods that it would be the only source for the genes we queried. Experimental validation databases have the potential to provide useful information, but in light of the stability and accuracy issues we seem to have observed over time, users and reviewers are encouraged to 1) consult multiple sources of information (we found Diana TarBase to be among the most comprehensive and best-curated of those we tested, Vlachos IS, 2015); 2) at the same time be aware that different databases may rely entirely or to some extent on other databases; and 3) check the strength of interaction evidence in the primary literature.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Aug 01, Gary Goldman commented:

      The study by Kawail et al demonstrates that HZ incidence has increased over a 60 year period from “0.76 per 1000 person-years (PY) (95% confidence interval [CI], .63–.89) in 1945–1949 to 3.15 per 1000 PY (95% CI, 3.04–3.26) in 2000–2007” with a 2.5% per year rate over the time period after adjusting for age and sex (adjusted incidence rate ratio, 1.025 [95% CI, 1.023–1.026]; P < .001). [1] The authors do not provide an explanation for this increase, yet state, “This increase is unlikely to be due to the introduction of varicella vaccination….”

      Unfortunately, Kawail et al do not report details of how widespread the uptake of varicella vaccine was in Olmstead County during 2000-2007. In fact, there were still substantial outbreaks of varicella during 2000 and 2001 (with a period of 9 months that the vaccine was unavailable). Minnesota did not require varicella vaccination for students entering kindergarten and 7th grade who lacked proof of having had chickenpox until 2004. In 1999, based on a CDC National Immunization Survey, varicella vaccine coverage was 61.6% among children aged 19-35 in Minnesota. [2] Approximately 50% of children aged less than 10 years must be vaccinated to effectively reduce exogenous boosting to initiate a noticeable increase in HZ incidence. Likely, only during 2003 through 2007 was varicella vaccination sufficiently widespread in Olmstead County to begin influencing (increasing) HZ incidence rates.

      It was first hypothesized by Hope-Simpson [3] that “The peculiar age distribution of zoster may in part reflect the frequency with which the different age groups encounter cases of varicella and because of the ensuing boost to their antibody protection have their attacks of zoster postponed” [3]. However, prior to 1999, only limited studies existed that supported this hypothesis. For example, in 1983, Arvin et al. noted a boost in cell-mediated immunity (CMI) in 71% of adults who were exposed to varicella patients in the family [4]. In 1995, Terada et al. reported that Japanese pediatricians aged 50–69 who received multiple VZV exposures, demonstrated HZ incidence rates one-half to one-eighth that of the general population [5]. Gershon et al. in 1996 showed an immunologic boost that reduced the risk of HZ among leukemic children by reexposure to VZV, either by vaccination or by close exposure to varicella [6]. A 1998 study by Solomon found that pediatricians who had a greater incidence of exposure to VZV had lower rates of HZ than psychiatrists who had the lowest VZV exposure rates [7]. More recent studies by Thomas et al. [8] and Salleras et al. [9] have also demonstrated that re-exposure to VZV via contacts with children was associated with reduction in the risk of HZ in adults. In more recent times, during the varicella vaccination era, additional studies, including those derived from the Antelope Valley Varicella Active Surveillance Project (VASP) in a community with widespread varicella vaccination, have emerged that have provided data that validates Hope-Simpson’s hypothesis. [10-12]. In support of the VASP trends [10-11] between 2000 and 2006, a more recent 2013 study by Guzzetta et al suggests that each episode of exposure to VZV increases protection against HZ and that ‘‘this mechanism may be critical in shaping HZ patterns’’. [12]

      Thus, while Kawail et al is unable to provide an explanation for the mean 2.5% annual increase in HZ incidence over six decades, one logical hypothesis for the increase is related to societal changes. Living conditions have gradually changed during the past six decades from multiple generations of families residing in a single household, to more independent living as children aged 18 years and over have increasingly moved out of their parent's home and elderly and sedentary individuals are placed in care facilities. Interesting, a Census Bureau reports, “In 2010, there were 40.3 million people aged 65 and above, comprising 13% of the overall population. (This total is 12 times the number it was in 1900, when this group constituted only 4.1% of the population.)” [13] Thus, due to changing trends in society structure and increases in the elderly population, parents and grandparents generally have fewer opportunities for exogenous boosting of their cell-mediated immunity due to reduced contact to children infected with varicella—giving rise to the steady increase in HZ incidence—especially in decades prior to the varicella vaccination era.

      In the Antelope Valley VASP, varicella vaccination was widespread in the community with approximately 50% of children aged <10 years vaccinated by 2000. By 2000, exogenous exposures to natural varicella (producing immunologic boosts) were dramatically reduced, especially after a marked decline in varicella seasonality in 1999. After 2 years of active HZ surveillance (2000 and 2001), the number of HZ case reports had maintained or increased in every adult age category except elderly adults aged 70 years and older. Using the paired t-test, there was a statistically significant (p < 0.042; t = 2.95, dF = 4) 28.5% increase in HZ case reports from 158 to 203 from 2000 to 2001 for the population aged 20–69 years. [10] Moreover, the 2007 VASP annual summary to the CDC presents data (not ascertainment corrected) demonstrating a statistically significant increase in HZ incidence rates, from 3.90 to 4.70 per 1,000 p-y in from 2006 to 2007 among adults aged 50 years and older. [11]

      Finally, there is a further worrying reason to suspect future increases in HZ incidence. When a child is administered the varicella (or Oka-) strain and then later is exposed to either a child with natural chickenpox or an adult with herpes zoster (almost always due to the reactivation of the natural or wild-type strain), the child harbors two similar but possibly sufficiently heterologous strains--that now are both subject to reactivation. This could potentially double the chances for the reactivation of herpes zoster, or at a minimum, at least increase the chances for reactivation of shingles relative to the pre-varicella vaccination era. [14]

      [1] Kawai K, 2016 [2] http://www.cdc.gov/vaccines/imz-managers/coverage/nis/child/index.html [3] HOPE-SIMPSON RE, 1965 [4] Arvin AM, 1983 [5] Terada K, 1995 [6] Gershon AA, 1996 [7] Solomon BA, 1998 [8] Thomas SL, 2002 [9] Salleras M, 2011 [10] Goldman GS, 2013 [11] Goldman GS, 2014 [12] Guzzetta G, 2013 [13] Raphel A. Trends and statistics relating to U.S. seniors, elderly: Census Bureau 2014 report. August 5, 2014. http://journalistsresource.org/studies/society/public-health/trends-statistics-relating-us-seniors-elderly-census-bureau-2014-report [last accessed 07/26/2016] [14] Weinmann S, 2013


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Sep 26, Valter Silva commented:

      This article discusses the Brazilian science based on a new resource for scientometrics called Nature Index, as well as the SJR. The 2012–2015 change in the main metric of Nature Index showed an increase of 18.9% for Brazil and currently is ranked 24th globally. From 1996 to 2015 (SJR) Brazilian science has produced more than 600 thousand citable papers, obtained more than 5 million citations, having over 400 papers with at least 400 citations and is responsible by half of Latin America publication output. Despite such numbers, there are flows in its internationalization. Much of the Brazilian science is produced by graduate students and professors gazetted, since the profession of scientist in Brazil is not a recognized position by the Ministry of Labor and Employment.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Apr 11, Yu-Chen Liu commented:

      The authors appreciate the insightful feedbacks and agree with prospect that hypothesis derived from small RNA-seq data analysis deserve examination in skeptical views and further experimental validation. Regarding the skeptical view of Prof. Witwer on this issue, whether a specific sequence were indeed originate from plant can be validated through examining the 2’-O-methylation on their 3’ end (Chin, et al., 2016; Yu, et al., 2005). The threshold of potential copy per cell for plant miRNAs to affect human gene expression was also discussed in previous researches (Chin, et al., 2016; Zhang, et al., 2012).

      Some apparent misunderstandings are needed to be clarified:

      In the commentary of Prof. Witwer:

      “A cross-check of the source files and articles shows that the plasma data evaluated by Liu et al were from 198 plasma samples, not 410 as reported. Ninomiya et al sequenced six human plasma samples, six PBMC samples, and 11 cultured cell lines 19. Yuan et al sequenced 192 human plasma libraries (prepared from polymer-precipitated plasma particles). Each library was sequenced once, and then a second time to increase total reads.”

      Authors’ response:

      First of all, the statement "410 samples" within the article was meant to the amount of runs of small RNA-seq run conducted in the referred researches. Whether multiple NGS runs conducted on same plasma sample should be count as individual experiment replicates is debatable. The analysis of each small RNA-seq run was conduct independently. The authors appreciate the kind comments for the potential confusion that can be made in this issue.

      In the commentary of Prof. Witwer:

      “Strikingly, the putative MIR2910 sequence is not only a fragment of plant rRNA; it has a 100% coverage, 100% identity match in the human 18S rRNA (see NR 003286.2 in GenBank; Table 3). These matches of putative plant RNAs with human sequences are difficult to reconcile with the statement of Liu et al that BLAST of putative plant miRNAs "resulted in zero alignment hit", suggesting that perhaps a mistake was made, and that the BLAST procedure was performed incorrectly.”

      Authors’ response:

      The precursor sequences of the plant miRNAs, including the stem loop sequences (precursor sequences) were utilized in the BLAST sequence alignment in this work. The precursor sequence of peu-MIR2910, “UAGUUGGUGGAGCGAUUUGUCUGGUUAAUUCCGUUAACGAACGAGACCUCAGCCUGCUA” was used. The alignment was not performed merely with the mature sequence, “UAGUUGGUGGAGCGAUUUGUC”. The stem loop sequences, as well as the alignment of the sequences against the plant genomes, was taken into consideration by using miRDeep2 (Friedländer, et al., 2012). As illustrated in the provided figures, sequencing reads were mapped to the precursor sequences of MIR2910 and MIR2916. As listed in the table below, a lot of sequencing reads can be aligned to other regions within the precursor sequences except the sequencing reads aligned to mature sequences. For instance, in small RNA-seq data of DRR023286, 5369 reads were mapped to peu-MIR2910, and 4010 reads were mapped to the other regions in the precursor sequences.  

      miRNA | Run |Total reads | on Mature | on precursor

      peu-MIR2910 | DRR023286 | 9370 | 5369 | 4010

      peu-MIR2910 | SRR2105454 | 3013 | 1433 | 1580

      peu-MIR2914 | DRR023286 | 1036 | 19 | 1017

      peu-MIR2916 |SRR2105342 | 556 | 227 | 329

      (Check the file MIR2910_in_DRR023286.pdf, MIR2910_in_SRR2105454.pdf, MIR2914_in_DRR023286 and MIR2916_in_SRR2105342.pdf)

      The pictures are available in the URL:

      https://www.dropbox.com/sh/9r7oiybju8g7wq2/AADw0zkuGSDsTI3Aa_4x6r8Ua?dl=0

      As described in the article, all reported reads mapped onto the plant miRNA sequences were also mapped onto the five conserve plant genomes. Within the provided link a compressed folder file “miRNA_read.tar.gz” is available. Results of the analysis through miRDeep2, were summarized in these pdf files. Each figure file was named according to the summarized reads, sequence run and the mapped plant genome. For example, reads from the run SRR2105181 aligned onto both Zea mays genome and peu-MIR2910 precursor sequences are summarized in the figure file “SRR2105181_Zea_mays_peu-MIR2910.pdf”.

      In the commentary of Prof. Witwer:

      “Curiously, several sequences did not map to the species to which they were ascribed by the PMRD. Unfortunately, the PMRD could not be accessed directly during this study; however, other databases appear to provide access to its contents.”

      Authors’ response:

      All the stem loop sequences of plant miRNAs were acquired from the 2016 updated version of PMRD (Zhang, et al., 2010), which was not properly referred. The used data were provided in the previously mentioned URL.

      In the commentary of Prof. Witwer:

      “Counts were presented as reads per million mapped reads (rpm). In contrast, Liu et al appear to have reported total mapped reads in their data table. Yuan et al also set an expression cutoff of 32 rpm (log2 rpm of 5 or above). With an average 12.5 million reads per sample (the sum of the two runs per library), and, on average, about half of the sequences mapped, the 32 rpm cutoff would translate to around 200 total reads in the average sample as mapped by Liu et al.”

      Authors’ response:

      Regarding the concern of reads per million mapped reads (rpm) threshold, the author appreciate the kind remind of the need to normalize sequence reads count into the unit in reads per million mapped reads (rpm) for proper comparison between samples of different sequence depth. However the comparison was unfortunately not conducted in this work. Given the fact that the reads were mapped onto plant genome instead of human genome, the normalization would be rather pointless, considering the overall mapped putative plant reads only consist of ~3% of the overall reads. On the other hand, the general amount of cell free RNA present in plasma samples was meant to be generally lower than within cellar samples (Schwarzenbach, et al., 2011).

      Reference

      Chin, A.R., et al. Cross-kingdom inhibition of breast cancer growth by plant miR159. Cell research 2016;26(2):217-228.

      Friedländer, M.R., et al. miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades. Nucleic acids research 2012;40(1):37-52.

      Schwarzenbach, H., Hoon, D.S. and Pantel, K. Cell-free nucleic acids as biomarkers in cancer patients. Nature Reviews Cancer 2011;11(6):426-437.

      Yu, B., et al. Methylation as a crucial step in plant microRNA biogenesis. Science 2005;307(5711):932-935.

      Zhang, L., et al. Exogenous plant MIR168a specifically targets mammalian LDLRAP1: evidence of cross-kingdom regulation by microRNA. Cell research 2012;22(1):107-126.

      Zhang, Z., et al. PMRD: plant microRNA database. Nucleic acids research 2010;38(suppl 1):D806-D813.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. The country also tops the world list of children suffering from malnutrition. They also have the highest number of illiterates. 270 million people don’t know how to read and write; 2/3 of them are women.

      important stat- over half of the illiterates are women shows that women arent given the opportunity to read and those that are are very rare (only 1/3)

  16. Jan 2018
    1. Civil-rights leader Andrew Young (left) and others stand on the balcony of the Lorraine Motel pointing in the direction of an assailant after the assassination of civil-rights leader Dr. Martin Luther King Jr., who is lying at their feet, in Memphis, Tennessee, on April 4, 1968. # Joseph Louw / The LIFE Images Collection / Getty Read more This aerial view shows clouds of smoke rising from burning buildings in northeast Washington, D.C., on April 5, 1968. The fires resulted from rioting and demonstrations after the assassination of Dr. Martin Luther King Jr. # AP Read more Firemen battle a blaze on 125th Street in Harlem, New York, on April 4, 1968, after a furniture store and other buildings were set on fire after it was learned that civil-rights leader Dr. Martin Luther King Jr. had been assassinated. # AP Read more President Johnson called federal troops into the nation's capital to restore peace after a day of arson, looting, and violence on April 5, 1968. Here, a trooper stands guard in the street as another (left) patrols a completely demolished building. # Bettmann / Getty Read more Coretta Scott King, the widow of Martin Luther King Jr., walks on the arm of Dr. Ralph Abernathy, her husband's successor as head of the Southern Christian Leadership conference, leading about 10,000 people in a memorial march to the slain Dr. King. The King children, Yolanda, Martin III, and Dexter are at left with Harry Belafonte. Reverend Andrew Young marches next to Dr. Abernathy. # Bettmann / Getty Read more Original caption: Dr. Timothy Leary holds a conference in New York City on February 21, 1968. The LSD advocate said he is tuning in with peaceniks and “Yippies” and hopes to have a million young people in Chicago during the Democratic Party’s convention in August. He said he hopes they will disrupt the convention through “Flower Guerrilla” warfare. At left is Abbie Hoffman, who said he is an organizer and at right is Jerry Rubin, peace movement worker. # AP Read more 1968 was truly a year of protest around the world. Here in Rio de Janeiro, Brazil, state police cavalry charge students attending a memorial mass for Edson Luis de Lima Souto, a student killed by police, at Candelaria Church on April 4, 1968. Edson had been part of an earlier protest over high prices in a restaurant in downtown Rio, and was shot by police who were trying to remove students from premises. # Agencia JB / AP Read more Violent clashes between policeman and students take place during the May 1968 protests in Paris, France. [Editor's note: This photo replaces a previous image in this position that had been mislabeled by the source.] # Jacques Haillot / Apis / Sygma via Getty Read more A massive anti-Vietnam war demonstration in London on March 18, 1968. Hundreds were arrested as they demonstrated outside the United States embassy. # Corbis via Getty Read more Demonstrators march on Washington, D.C., during the Poor Peoples' Campaign Solidarity Day on June 19, 1968. # Charles Tasnadi / AP Read more The Beatles pose together on February 28, 1968. From left are Paul McCartney, John Lennon, Ringo Starr, and George Harrison. This was the year they released the White Album. # AP Read more American actor Gary Lockwood on the set of 2001: A Space Odyssey, written and directed by Stanley Kubrick. The groundbreaking film premiered in April of 1968, and earned the Academy Award for Best Visual Effects. # Sunset Boulevard / Corbis via Getty Read more A propaganda image from China's Cultural Revolution. In 1968, China was in a phase of their Cultural Revolution where Chairman Mao Zedong's cult of personality was still being elevated, and intellectuals and disloyal citizens were being forced into labor camps or exiled to remote farming regions. Original caption: Members of the Sichuan Province Revolving Committee unite with civilians and soldiers to work in the fields on August 26, 1968. # API / Gamma-Rapho via Getty Read more Federal Nigerian troops walk along a road near Ikot Expene, Nigeria, to the frontier with Biafra, a few miles away, on October 13, 1968. On the roadside, two emaciated Nigerian boys slowly die from starvation and malnutrition. Biafra was a breakaway state within Nigeria that fought a war for independence from 1967 to 1970, ending after years of fighting and a crippling blockade by Nigeria resulted in the deaths of between 500,000 and two million Biafran civilians by starvation. # Dennis Lee Royle / AP Read more A street scene from Pittsburgh, Pennsylvania, Grant St. at 5th Ave. on August 24, 1968. See the same scene today in Google Street View. # CC BY David Wilson Read more Original caption: A Feminine First. Mexico City: Mexico's Norma Enriqueta Basilio, the first woman in the history of the modern Olympic Games to light the Olympic Fire, runs up the 90 steps with the Olympic Torch during the opening ceremonies here on October 12, 1968. # Bettmann / Getty Read more Tommie Smith and John Carlos, gold and bronze medalists in the 200-meter run at the 1968 Olympic Games, engage in a victory stand protest against unfair treatment of blacks in the United States. With heads lowered and black-gloved fists raised in the black power salute, they refused to recognize the American flag and national anthem. Australian Peter Norman is the silver medalist. # Bettmann / Getty Read more Senator Robert F. Kennedy is surrounded by hundreds of people as he leans down to shake hands during a presidential campaign appearance at a street corner in central Philadelphia on April 2, 1968. Kennedy had declared his candidacy for the presidency of the United States only weeks earlier, on March 16. # AP Read more Senator Robert Kennedy lies sprawled, semi-conscious in his own blood after being shot in the head and neck while busboy Juan Romero tries to comfort him in kitchen in the Ambassador Hotel in Los Angeles, California, on June 5, 1968. A Palestinian immigrant named Sirhan Sirhan, who was angry with Kennedy over his support for Israel, shot Kennedy three times. Sirhan remains in prison to this day, last denied parole in 2016. # Bill Eppridge / The LIFE Picture Collection / Getty Read more Coretta Scott King, widow of Martin Luther King Jr., walks past the casket containing the body of the assassinated Senator Robert F. Kennedy in St. Patrick's Cathedral in New York City on June 7, 1968. # Bettmann / Getty Read more A large crowd lines railroad tracks as the funeral train of Robert F. Kennedy passes on its way to Arlington National Cemetery in Washington, D.C. # Bettmann / Getty Read more Youths prepare to board buses for Chicago in August of 1968. Peace activists and anti-war groups organized to travel to Chicago to demonstrate outside the 1968 Democratic National Convention. # AP Read more Police and demonstrators clash near the Conrad Hilton Hotel on Chicago's Michigan Avenue August 28, 1968, during the Democratic National Convention. # Bettmann / Getty Read more Mike Wallace, a CBS newsman, is hustled off the Democratic National Convention floor in the aftermath of a row between delegates and security officers during the nominating session on August 28, 1968 in Chicago. He was taken up a ramp to a second-floor room. # AP Read more Vice President Hubert Humphrey and his running mate, Sen. Edmund S. Muskie, with their wives shown at the final session Democratic Convention in Chicago following their nominations for president and vice president, on August 29, 1968. # AP Read more Members of the Black Panthers gather in front of entrance to the Alameda County Courthouse in Oakland, California, on July 15, 1968, to protest the trial of Huey Newton, 26, the founder of the Black Panthers. Newton went on trial for the slaying of an Oakland policeman and for wounding another officer on October 28. # Ernest K. Bennett / AP Read more Original caption: Miami policemen, one holding the man's arm and the other with an arm lock on his neck, drag away a Negro youth during a clash between police and rioters in that city's predominantly Negro Liberty City district on August 8, 1968. # Bettmann / Getty Read more Helicopters fly low during Operation Pegasus in Vietnam on April 5, 1968. They were taking part in the operation to relieve the Khe Sanh marine base, which had been under siege for the previous three months. # Dang Van Phuoc / AP Read more Evidence of the My Lai Massacre. A photograph of Vietnamese women and children in My Lai before they were killed by U.S. soldiers in the massacre on March 16, 1968. According to court testimony, they were killed seconds after the photo was taken. The woman on the right is adjusting her blouse buttons because of a sexual assault that happened before the massacre. Image taken from Volume III, Book 6, of the Report of the Department of the Army Review of the Preliminary Investigations into the My Lai Incident, photographed by United States Army photographer Ronald L. Haeberle. # Ronald L. Haeberle / U.S. Army Read more A U.S. Marine keeps his head low as he drags a wounded buddy from the ruins of the Citadel's outer wall during the Battle of Hue in Vietnam on February 16, 1968. # Bettmann / Getty Read more United States President Lyndon B. Johnson listens to a tape recording from his son-in-law Captain Charles Robb at the White House on July 31, 1968. Robb was a U.S. Marine Corps company commander in Vietnam at the time. Robb was later awarded the Bronze Star and, after returning home, became governor of Virginia in 1982, and later a senator for the same state. # Jack Kightlinger / AP Read more Original caption: Several hundred hippies gathered at "Hippie Hill" in San Francisco's Golden Gate Park for a happening at which several bands played rock 'n' roll music. Most of the hippies sat and listened, but some just couldn't keep from dancing to the rhythms. # Bettmann / Getty Read more Mexican army soldiers crouch with weapons ready in Mexico City's Tlatelolco district, in this October 2, 1968 photo. The truth behind the stunning assault on a peaceful democracy protest known as the Tlatelolco Massacre, in which some 300 people are believed to have been killed, remains largely hidden by government and military secrecy. # AP Read more Soldiers cut a student's hair after he was arrested during the first hour and a half of shooting in the Tlatelolco area in Mexico City on October 3, 1968. Another student stands against the wall. # AP Read more SRI’s Bill English, the engineer who built the first computer mouse prototype, prepares for the December 9, 1968 "mother of all demos." The demonstration is hailed as one of the most significant technological presentations in history, showcasing technologies that have become what we now know as modern computing. He gave the first public demonstration of a computer mouse, a graphical user interface, windowed computing, hypertext, word processing, video conferencing, and much more. # SRI International Read more Richard M. Nixon is mobbed by wildly cheering supporters as he arrives at the Hilton Plaza Hotel, his Miami Beach headquarters. # Bettmann / CORBIS / Getty Read more French Foreign Minister Michel Debre and U.S. President Lyndon Johnson watch television coverage of the flight of the Saturn 1 B Rocket launching from Cape Kennedy, Florida, on on October 11, 1968, in the White House Office in Washington, D.C. # Charles Gorry / AP Read more A heavy beard covers the face of astronaut Walter M. Schirra Jr., Apollo 7 commander, as he looks out the rendezvous window in front of the commander's station on the ninth day of the Apollo 7 mission on October 20, 1968. Apollo 7 was the first Apollo mission to carry a crew, and it made 163 orbits around the Earth in 10 days, setting the stage for Apollo 8, which was heading to the moon. # JSC / NASA Read more Apollo 8, the first manned mission to the moon, entered lunar orbit on Christmas Eve, December 24, 1968. That evening, the astronauts—Commander Frank Borman, Command Module Pilot Jim Lovell, and Lunar Module Pilot William Anders—held a live broadcast from lunar orbit, in which they showed pictures of the earth and moon as seen from their spacecraft. Said Lovell, "The vast loneliness is awe-inspiring and it makes you realize just what you have back there on Earth." They ended the broadcast with the crew taking turns reading from the book of Genesis. # NASA Read more $('.transition-img').click(function () { $(this).toggleClass('active'); }); Jump to Comments Ads by Revcontent From The Web 5 Years From Now, You'll Probably Wish You Grabbed These Stocks The Motley Fool x You Already Have Amazon Prime - Here's How to Make It Even Better Honey x 19 Discounts Seniors Didn't Know They Could Get (#10 Has Cable Companies Angry) Life'd x Robin Williams Final Net Worth Brought Us to Tears Interesticle x .rc-w-12488.rc-p-pt, .rc-w-12488.rc-p-pt > div { padding: 0; margin: 0; position: relative; cursor: pointer; } .rc-w-12488.rc-p-pt > div { list-style-type: none; } .rc-w-12488.rc-p-pt .rc-item { position: relative; overflow: hidden; } .rc-w-12488.rc-p-pt .rc-item { display: block; } .rc-w-12488.rc-p-pt .rc-item-wrapper { position: relative; margin: 3px; } .rc-w-12488.rc-p-pt .rc-row > div { vertical-align: top; } .rc-w-12488.rc-p-pt .rc-cta { text-decoration: none; display: block; } .rc-w-12488.rc-p-pt .rc-cta:hover { text-decoration: none; display: block; } .rc-w-12488.rc-p-pt .rc-cta:hover .rc-headline { text-decoration: underline; } .rc-w-12488.rc-p-pt .rc-photo { width: 100%; height: 150px; background-position: center center; background-repeat: no-repeat; background-size: cover; position: relative; } .rc-w-12488.rc-p-pt .rc-photo-container{ position: relative; } .rc-w-12488.rc-p-pt .rc-fc-video { display: block !important; position: absolute; line-height: 0; border-width: 0px; } .rc-w-12488.rc-p-pt .rc-fc-video img { border-width: 0px; } .rc-w-12488.rc-p-pt .rc-fc-video .rc-fc-icon-video { fill: rgba(96, 96, 96, .85); stroke: #fff; stroke-width: 0; } .rc-w-12488.rc-p-pt .rc-item-wrapper:hover .rc-fc-video .rc-fc-icon-video { fill: rgba(96, 96, 96, .95); } .rc-w-12488.rc-p-pt .rc-fc-video .rc-fc-icon-video .rc-fc-icon-video-arrow { fill: #fff; } .rc-w-12488.rc-p-pt .rc-fc-video .rc-fc-icon-video #circle2 { fill: rgba(0,0,0,0); stroke: #fff; stroke-width: 40; } .rc-w-12488.rc-p-pt .rc-fc-video #tri-video-icon .rc-fc-icon-video-arrow { filter: url(#shadow); } .rc-w-12488.rc-p-pt .rc-fc-video .rc-fc-icon-video #square1 { rx: 10; ry: 10; } .rc-w-12488.rc-p-pt .rc-fc-video.center { top: 50%; left: 50%; width: 30%; transform: translate(-50%, -50%); -ms-transform: translate(-50%, -50%); -webkit-transform: translate(-50%, -50%); } .rc-w-12488.rc-p-pt .rc-fc-video.top_left, .rc-w-12488.rc-p-pt .rc-fc-video.top_right, .rc-w-12488.rc-p-pt .rc-fc-video.bottom_right, .rc-w-12488.rc-p-pt .rc-fc-video.bottom_left { width: 12.5%; min-width: 40px; } .rc-w-12488.rc-p-pt .rc-fc-video.top_left.ie-fix, .rc-w-12488.rc-p-pt .rc-fc-video.top_right.ie-fix, .rc-w-12488.rc-p-pt .rc-fc-video.bottom_right.ie-fix, .rc-w-12488.rc-p-pt .rc-fc-video.bottom_left.ie-fix { height: 20%; } .rc-w-12488.rc-p-pt .rc-fc-video:after { display: block; content: ""; } .rc-w-12488.rc-p-pt .rc-fc-video.top_left, .rc-w-12488.rc-p-pt .rc-fc-video.top_right { top: 10px; } .rc-w-12488.rc-p-pt .rc-fc-video.top_left { left: 10px; } .rc-w-12488.rc-p-pt .rc-fc-video.top_right { right: 10px; } .rc-w-12488.rc-p-pt .rc-fc-video.bottom_right, .rc-w-12488.rc-p-pt .rc-fc-video.bottom_left { bottom: 10px; } .rc-w-12488.rc-p-pt .rc-fc-video.bottom_right { right: 10px; } .rc-w-12488.rc-p-pt .rc-fc-video.bottom_left { left: 10px; } .rc-w-12488.rc-p-pt .rc-photo-left .rc-photo { width: 45%; float: left; } .rc-w-12488.rc-p-pt .rc-photo-left .rc-content { margin-left: 50%; } .rc-w-12488.rc-p-pt .rc-photo-right .rc-photo { width: 45%; float: right; } .rc-w-12488.rc-p-pt .rc-photo-right .rc-content { margin-right: 50%; } .rc-w-12488.rc-p-pt .rc-display-url, .rc-w-12488.rc-p-pt .rc-provider { color: #c6c6c6; font-weight: normal; text-decoration: none; } .rc-w-12488.rc-p-pt .rc-content { margin: 4px 1% 0; } .rc-w-12488.rc-p-pt .rc-content div { padding: 5px 0; } .rc-w-12488.rc-p-pt .rc-item:hover .rc-content { bottom: 0; } .rc-w-12488.rc-p-pt .rc-bp-cta { top: 5px; right: 5px; } .rc-w-12488.rc-p-pt .rc-ct-oo { top: 5px; right: 5px; } .rc-uid-12488 * h3 { font-family: -apple-system,BlinkMacSystemFont,"Helvetica Neue",Arial,sans-serif!important; font-weight: 700!important; font-size: 17px!important; color: #000000!important; } .rc-uid-12488 .rc-headline { font-family: -apple-system,BlinkMacSystemFont,"Helvetica Neue",Arial,sans-serif!important; font-size: 16px!important; line-height: 1.25!important; font-weight: 600!important; color: #000000!important; } .rc-uid-12488 .rc-item .rc-headline { font-family:-apple-system,BlinkMacSystemFont,"Helvetica Neue",Arial,sans-serif!important; font-size:16px!important; line-height:1.25!important; font-weight:600!important; color:#000000!important; } .rc-uid-12488.rc-g-t .rc-item:hover .rc-headline {text-decoration:none!important} .rc-uid-12488.rc-g-p .rc-item:hover .rc-headline {text-decoration:none!important} rc-g-dl .rc-g-dl-1>div{width:100%}.rc-g-dl .rc-g-dl-2>div{width:50%}.rc-g-dl .rc-g-dl-3>div{width:33.33333333333333%}.rc-g-dl .rc-g-dl-4>div{width:25%}.rc-g-dl .rc-g-dl-5>div{width:20%}.rc-g-dl .rc-g-dl-6>div{width:16.66666666666666%}.rc-g-dl .rc-g-dl-7>div{width:14.28%}.rc-g-dl .rc-g-dl-8>div{width:12.5%}.rc-g-dl .rc-g-dl-9>div{width:11.11111111111111%}.rc-g-dl .rc-g-dl-10>div{width:10%}.rc-g-dl.rc-bp .rc-item:hover .rc-bp-cta .rc-ct.oo{display:inline-block;cursor:pointer!important}.rc-g-d .rc-g-d-1>div{width:100%}.rc-g-d .rc-g-d-2>div{width:50%}.rc-g-d .rc-g-d-3>div{width:33.33333333333333%}.rc-g-d .rc-g-d-4>div{width:25%}.rc-g-d .rc-g-d-5>div{width:20%}.rc-g-d .rc-g-d-6>div{width:16.66666666666666%}.rc-g-d .rc-g-d-7>div{width:14.28%}.rc-g-d .rc-g-d-8>div{width:12.5%}.rc-g-d .rc-g-d-9>div{width:11.11111111111111%}.rc-g-d .rc-g-d-10>div{width:10%}.rc-g-d.rc-bp .rc-item:hover .rc-bp-cta .rc-ct.oo{display:inline-block;cursor:pointer!important}.rc-g-t .rc-g-t-1>div{width:100%}.rc-g-t .rc-g-t-2>div{width:50%}.rc-g-t .rc-g-t-3>div{width:33.33333333333333%}.rc-g-t .rc-g-t-4>div{width:25%}.rc-g-t .rc-g-t-5>div{width:20%}.rc-g-t .rc-g-t-6>div{width:16.66666666666666%}.rc-g-t .rc-g-t-7>div{width:14.28%}.rc-g-t .rc-g-t-8>div{width:12.5%}.rc-g-t .rc-g-t-9>div{width:11.11111111111111%}.rc-g-t .rc-g-t-10>div{width:10%}.rc-g-p .rc-g-p-1>div{width:100%}.rc-g-p .rc-g-p-2>div{width:50%}.rc-g-p .rc-g-p-3>div{width:33.33333333333333%}.rc-g-p .rc-g-p-4>div{width:25%}.rc-g-p .rc-g-p-5>div{width:20%}.rc-g-p .rc-g-p-6>div{width:16.66666666666666%}.rc-g-p .rc-g-p-7>div{width:14.28%}.rc-g-p .rc-g-p-8>div{width:12.5%}.rc-g-p .rc-g-p-9>div{width:11.11111111111111%}.rc-g-p .rc-g-p-10>div{width:10%}.rc-wc{position:relative;margin:0 auto;padding:0;visibility:visible;display:block}.rc-row{margin:0}.rc-row:before,.rc-row:after{display:table;content:\" \"}.rc-row:after{clear:both}.rc-row:before,.rc-row:after{display:table;content:\" \"}.rc-row:after{clear:both}.rc-item,.rc-row>div{float:left;width:100%}.rc-item .rc-headline{font-family:'Roboto', sans-serif;font-size:17px;line-height:normal;font-weight:500;color:#000000;padding:0!important;margin:4px 1% 3px;overflow:hidden;width:98%;height: auto}.rc-wc .row-item h3{min-height:12px;cursor:default;font-family:'Roboto', sans-serif;font-size:19px;font-weight:600;color:#000000;text-align:left}.rc-p-pt .rc-photo{margin:0 1%}.rc-text-left{text-align:left}.rc-text-right{text-align:right}.rc-text-center{text-align:center}.rc-text-top{width:100%}.rc-text-top.rc-branding{top:24px}.rc-text-right.rc-branding{float:right;right:10px}.rc-branding{font-family:'Roboto', sans-serif !important;visibility:visible!important;display:inline-block!important;text-decoration:none;z-index:99;width:100%;color:#999;line-height:13px;position:relative}.rc-branding div{font-size:10px;cursor:pointer;display:inline-block}.rc-iab .rc-branding{height:0;overflow:visible;margin:0 auto}.rc-iab .rc-branding div{background-color:#bbb;color:#fff;padding:4px 5px;width:0;overflow:hidden;white-space:nowrap}.rc-bp-cta .rc-ct-oo{display:none!important} Most Recent #recent1 .lead-image { background-image: url(https://cdn.theatlantic.com/assets/media/img/photo/2018/01/photos-from-the-2018-dakar-rally/d01_903490020-1/river_thumb.jpg?1516306944); } Franck Fife / AFP / Getty In Focus 2:46 PM ET 33 Photos Photos From the 2018 Dakar Rally Leaving Lima, Peru, on January 6, 335 competitors started the 40th annual Dakar Rally, which arrives in Córdoba, Argentina, on January 20. #recent2 .lead-image { background-image: url(https://cdn.theatlantic.com/assets/media/img/photo/2018/01/nozawaonsen-dosojin-and-luminarias/f01_0001-1/river_thumb.jpg?1516229316); } Carl Court / Getty, Francisco Seco / AP In Focus Jan 17, 2018 31 Photos A Pair of Fiery Festivals In the past couple of days, festivals were held in two villages separated by language, culture, religion, and great distance, but both centered on the use of fire as a method of purification and blessing. #recent3 .lead-image { background-image: url(https://cdn.theatlantic.com/assets/media/img/photo/2018/01/gorgeous-images-of-the-planet-jupit/j01_25783327168-1/river_thumb.jpg?1516135669); } NASA / SwRI / MSSS / Gerald Eichstädt / Seán Doran In Focus Jan 16, 2018 24 Photos Gorgeous Images of the Planet Jupiter In its 10th orbit around Jupiter, NASA’s Juno spacecraft is returning amazing images of the gas giant that are being made even more incredible by citizen scientists here on Earth. #recent4 .lead-image { background-image: url(https://cdn.theatlantic.com/assets/media/img/photo/2018/01/photos-of-the-week-1/w01_903110512-1/river_thumb.jpg?1515788721); } Geoff Robins / AFP / Getty In Focus Jan 12, 2018 35 Photos Photos of the Week: Snowy Sahara, Dancing Devils, Cryptocurrency J-Pop The Singapore Zoo shows off its babies, ice blankets in the U.S., fog drifts in the U.K., Saudi Arabia opens its first automotive showroom solely for women, and much more. Most Popular on The Atlantic The New Age of Astrology An Exit From Trumpocracy What if H.R. McMaster Is Right About North Korea? The Hollywood Tide Turns on Woody Allen The Humiliation of Aziz Ansari This Is Not a Sex Panic Trump's Quietly Growing List of Victories The House Voted to Avert a Shutdown—But It Might Not Be Enough The 'Underground Railroad' To Save Atheists The Problem With Courting Amazon Newsletter Signup I want to receive updates from partners and sponsors. Back to Top Join the Discussion Home Share Tweet Subscribe Support 160 years of independent journalism. Name Address 1 Address 2 City State State Alabama Alaska Alberta American Samoa APO/FPO-Africa APO/FPO-Canada APO/FPO-Europe APO/FPO-Middle East APO/FPO-Americas APO/FPO-Pacific Arizona Arkansas British Columbia California Colorado Connecticut Delaware District of Columbia Florida Georgia Guam Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Manitoba Marshall Islands Maryland Massachusetts Michigan Micronesia Minnesota Mississippi Missouri Montana Nebraska Nevada New Brunswick New Hampshire New Jersey New Mexico New York Newfoundland Newfoundland-Labrador North Carolina North Dakota Northern Mariana Isles Northwest Territories Nova Scotia Nunavut Ohio Oklahoma Ontario Oregon Palau Pennsylvania Prince Edward Island Puerto Rico Quebec Quebec Rhode Island Saskatchewan South Carolina South Dakota Tennessee Texas Utah Vermont Virgin Islands Virginia Washington West Virginia Wisconsin Wyoming Yukon Territories Zip Code Country Email Address Fraud Alert regarding The Atlantic Newsletters+ The Atlantic The Atlantic Daily This Week This Month New Photo Galleries Top Videos This Week Politics & Policy Daily CityLab Today’s Top Stories This Week's Most Popular Stories I want to receive updates from partners and sponsors. Email Address Follow+ Facebook Twitter LinkedIn Instagram Tumblr Pinterest RSS App Store About+ Masthead FAQ Press Jobs Shop Books Emporium Manage Subscription Contact Us Send a News Tip Privacy Policy Advertise Advertising Guidelines Terms and Conditions Responsible Disclosure Site Map TheAtlantic.com Copyright (c) 2018 by The Atlantic Monthly Group. All Rights Reserved. { "detective": { "url": "/assets/static/theatlantic/img/sherlock.gif" }, "peer39": true, "lazy_load": 3, "adomik": true, "amazon": "3239", "globals": { "report": "1968", "src": "article", "type": "photo", "id": 550208, "title": "50-years-ago-in-photos-a-look-back-at-1968" }, "perfUrl": "https://cdn.atlanticinsights.com/perf.gif", "zone": "/4624/TheAtlanticOnline/channel_international", "adtest_domain": "dctestsite", "patchEventHandlers": true, "headerbidding": true, "criteo": true, "outofpage": true } Close SystemJS.config({ baseURL: "https://cdn.theatlantic.com/assets/static/b/frontend/" }); SystemJS.set('pageInfo', SystemJS.newModule(window.Atlantic.page_info)); SystemJS.set('profilesConfig', SystemJS.newModule({ profiles_url: window.Atlantic.PROFILES_URL, janrain: window.Atlantic.SESSION_URLS })); (function (s) { // Set all mandatory properties that don't change. s.account = "atlanticprod"; s.charSet="UTF-8"; s.currencyCode="USD"; s.trackDownloadLinks=true; s.trackExternalLinks=true; s.trackInlineStats=true; s.linkDownloadFileTypes="exe,zip,wav,mp3,mov,mpg,avi,wmv,doc,pdf,xls"; s.linkInternalFilters="javascript:,thewire.com,citylab.com,theatlantic.com,localhost"; s.linkLeaveQueryString=false; s.linkTrackVars="None"; s.linkTrackEvents="None"; s.visitorNamespace="atlanticmedia"; s.trackingServer="atlanticmedia.122.2o7.net"; // Optimizely Adobe Analytics SiteCatalyst Integration window.optimizely = window.optimizely || []; window.optimizely.push("activateSiteCatalyst"); // We don't want to track page views for iframes loaded on TheAtlantic.com // to prevent pages from being double counted var track_page_views = true; try { if (window.parent !== window && window.parent.location.hostname === "www.theatlantic.com") { track_page_views = false; } } catch(e) {} if (track_page_views && s.t) { /************* DO NOT ALTER ANYTHING BELOW THIS LINE ! **************/ var s_code = s.t(); if (s_code) document.write(s_code) if (navigator.appVersion.indexOf('MSIE') >= 0) document.write(unescape('%3C') + '\!-' + '-'); } })(window.s); <img src="http://atlanticmedia.122.2o7.net/b/ss/atlanticprod/1/H.23.6--NS/0" height="1" width="1" border="0" alt="" /> (function() { // Duplicate a few existing s.props to be passed with linkTrackVars. If // we just reused the existing s.props, data would be recorded twice. s.prop66 = location.pathname; s.prop67 = Atlantic.page_info.view; s.prop68 = s.prop23; // Viewport s.prop69 = ""; // Referring domain. // You can coerce a URL into a URL object by creating a fake <a> // element and setting the href. Newer browsers have a real URL // constructor but this works in IE<10. if (document.referrer !== "") { var tmp = document.createElement("a"); tmp.href = document.referrer; s.prop69 = tmp.hostname; } s.linkTrackVars = "prop37,prop61,prop66,prop67,prop68,prop69,prop43,prop44,eVar21,eVar22,eVar25,eVar26,eVar27,eVar32,eVar33,eVar35,eVar36,eVar37,eVar38,eVar39,eVar40,eVar20,evar41,evar43"; })(); <div><a href="http://www.omniture.com" title="Web Analytics" ><img src="//atlanticmedia.122.2o7.net/b/ss/atlanticprod/1/H.22--NS/0" height="1" width="1" alt="" /></a></div> (function(a,c,d,e){if(!a[c]){var b=a[c]={};b[d]=[];b[e]=function(a){b[d].push(a)}}})(window,'Scroll','_q','do'); Scroll.config = { orientation: 'bottom', detected: document.cookie.indexOf("scroll0=") > -1 }; window.fbAsyncInit = function() { FB.init({ appId: '100770816677686', xfbml : false, version : 'v2.7' }); }; (function(d, s, id){ var js, fjs = d.getElementsByTagName(s)[0]; if (d.getElementById(id)) {return;} js = d.createElement(s); js.id = id; js.src = "//connect.facebook.net/en_US/sdk.js"; fjs.parentNode.insertBefore(js, fjs); }(document, 'script', 'facebook-jssdk')); /** * Route blockers */ (function(){ function redirect() { // Chrome 54-57 has a bug with its extensions that breaks // whitelisting on the first pageview when sent through // a shortened url. We can't detect shorturls reliable, // so let it slide. var chromeFreePV = (function(){ var host = window.location.protocol + "//" + window.location.host; var isFirstPV = (document.referrer.indexOf(host) !== 0); var isChrome = (window.navigator.userAgent.match(/Chrome\//) !== null); return isFirstPV && isChrome; })(); var isCrawler = (function(){ var botsRe = "(Googlebot|Bingbot|Yahoo! Slurp|DuckDuckBot|facebookexternalhit)"; return (window.navigator.userAgent.match(botsRe) !== null); }()); if ((navigator.onLine === false) || isCrawler || chromeFreePV || Atlantic.User.isMember() || Atlantic.User.isAdFree({strict: false})) { return; } var next = encodeURIComponent(window.location.href); var url = window.location.protocol + "//" + window.location.host + "/please-support-us/?next="; window.location.href = url + next; }; // Prevent race condition if (Modernizr["blocker-enabled"]) { redirect(); } else { $(window).one("blocker-detected", redirect); } })(); document.addEventListener("onBoomerangLoaded", function(e) { e.detail.BOOMR.init({ beacon_url: "https://cdn.atlanticinsights.com/rum.gif", log: null }); }); (function(){ var dom,doc,where,iframe = document.createElement('iframe'); iframe.src = "javascript:void(0)"; (iframe.frameElement || iframe).style.cssText = "width: 0; height: 0; border: 0"; var where = document.getElementsByTagName('script')[0]; where.parentNode.insertBefore(iframe, where); try { doc = iframe.contentWindow.document; } catch(e) { dom = document.domain; iframe.src="javascript:var d=document.open();d.domain='"+dom+"';void(0);"; doc = iframe.contentWindow.document; } doc.open()._l = function() { var js = this.createElement("script"); if(dom) this.domain = dom; js.id = "boomr-if-as"; js.src = 'https://cdn.theatlantic.com/assets/static/b/theatlantic/js/boomerang-1.0.1509573276.min.js'; this.body.appendChild(js); }; doc.write('<body onload="document._l();">'); doc.close(); })(); (function(){if(window.Atlantic&&(Atlantic.page_info&&dataLayer.push({page_info:Atlantic.page_info}),window.addEventListener("system:ready",function(a){Atlantic.User&&dataLayer.push({user_entitlements:Atlantic.User.entitlements})},!1),Atlantic.User&&dataLayer.push({user_entitlements:Atlantic.User.entitlements}),Atlantic.GTM)){var a=Atlantic.GTM.simplereach.conf,b=Atlantic.GTM.quantcastLabels.join(", ");a.pid="516eed0e4240cfbf3000002a";Atlantic.page_info&&Atlantic.page_info.is_sponsored&&(a.tags.push(Atlantic.page_info.sponsor), a.tags.push(Atlantic.page_info.campaign_slug),a.tags=a.tags.concat(Atlantic.page_info.tags));dataLayer.push({simplereach_config:a,quantcast_labels:b})}})();(function(){if("subscribe.theatlantic.com"===document.location.hostname){var a="The Atlantic.Subscription Pages";google_tag_manager["GTM-56LJR35"].macro('gtm1')&&(a+=", The Atlantic.Subscription Pages."+google_tag_manager["GTM-56LJR35"].macro('gtm2'));var b={pid:"588a7859736b79b6670006cb",reach_tracking:!1};dataLayer.push({simplereach_config:b,quantcast_labels:a})}})(); (function(){var a=google_tag_manager["GTM-56LJR35"].macro('gtm3');a&&0<a.length&&void 0!==window.atob&&(a=atob(a),dataLayer.push({silverpop_recipient_id:a.substring(0,a.length-1)}))})(); (function(){function a(a){a="kxatlantic_"+a;try{var b=window.localStorage}catch(e){b=null}return b?b[a]||"":navigator.cookieEnabled?(b=document.cookie.match(a+"\x3d([^;]*)"))&&unescape(b[1])||"":""}window.Krux||((Krux=function(){Krux.q.push(arguments)}).q=[]);var b=a("segs");window.Krux.user=a("user");window.Krux.segments=b?b.split(","):[];dataLayer.push({krux_user:window.Krux.user,krux_segments:window.Krux.segments})})(); (function(){window.Blueconic||(Blueconic={segments:[]});try{if(window.localStorage){var a=localStorage.getItem("bcDFPTargetingParams");if(a){var b=JSON.parse(a);a={};for(var c=0;c<b.length;c++)a["blueconic_"+b[c].key]=b[c].value,"audiences"===b[c].key&&(window.Blueconic.segments=b[c].value);0<b.length&&dataLayer.push(a)}}}catch(d){console.warn("Could not parse Blueconic segments:",d)}})();window.Krux||((Krux=function(){Krux.q.push(arguments)}).q=[]);Krux("ns:atlantic","admEvent","LddoOahE",{});dataLayer.push({gtm_loaded:"yes"});window.Krux||((Krux=function(){Krux.q.push(arguments)}).q=[]);window.Atlantic=window.Atlantic||{}; (function(){function f(a,b){if(document.querySelectorAll&&document.addEventListener)for(var e=document.querySelectorAll(a),c=function(a){this.getAttribute&&b(this.getAttribute("data-share"))},d=0;d<e.length;d++)e[d].addEventListener("click",c),e[d].addEventListener("tap",c)}if(window.Atlantic.page_info){var a=window.Atlantic.page_info;window.Atlantic.KruxDataLayer={path:window.location.pathname,domain:window.location.hostname,authors:a.authors,canonical_url:a.canonical_url,channels:a.channels,date:a.date, description:a.description,image:a.image,kicker:a.kicker,original_url:a.original_url,primary_channel:a.primary_channel,report:a.report,tags:a.tags,title:a.title,seo_title:a.seo_title,view:a.view,article_id:a.article_id,article_type:a.article_type,is_sponsored:a.is_sponsored,is_freelance:a.is_freelance}}else window.Atlantic.KruxDataLayer={path:window.location.pathname,domain:window.location.hostname};window.Blueconic&&Blueconic.segments&&(window.Atlantic.KruxDataLayer.blueconic_segments=Blueconic.segments); if(window.Atlantic.User&&(a=window.Atlantic.User,window.Atlantic.KruxDataLayer.user={print:a.isPrintSubscriber()?"yes":"no",ehub:a.isAdFree()?"yes":"no",newsletters:a.isNewsletterSubscriber()?"yes":"no"},!1===a.isLoggedIn()))for(var b in window.Atlantic.KruxDataLayer.user)window.Atlantic.KruxDataLayer.user[b]="signed-out";b=document.createElement("script");b.type="text/javascript";b.async=!0;b.src=("https:"===location.protocol?"https:":"http:")+"//cdn.krxd.net/controltag/qrixx06d0.js";a=document.getElementsByTagName("script")[0]; a.parentNode.insertBefore(b,a);var c={facebook:"KprCnYga",twitter:"KprDGKs_",linkedin:"KprE2Sd6",email:"KprFEE7b",print:"Lcl38W0M"};f("[data-share]",function(a){c[a]&&window.Krux("ns:atlantic","admEvent",c[a],{})});f("a[href^\x3d'mailto:?']",function(a){window.Krux("ns:atlantic","admEvent",c.email,{})})})();Atlantic&&Atlantic.page_info&&Atlantic.page_info.article_id&&""!==Atlantic.page_info.article_id&&(Atlantic.set_metadata=function(a){Atlantic.article_metadata=a;dataLayer.push({article_metadata:a});window.fbq&&a.categories&&fbq("trackCustom","WatsonContentViewed",{article_categories:a.categories})},function(a){var b=document.createElement("script");b.type="text/javascript";b.async=!0;b.src="https://metadata.atlanticinsights.com/"+a+"/metadata.js";a=document.getElementsByTagName("script")[0];a.parentNode.insertBefore(b, a)}(Atlantic.page_info.article_id)); if(window.Atlantic&&Atlantic.page_info){var _sf_async_config=_sf_async_config||{};_sf_async_config.uid=google_tag_manager["GTM-56LJR35"].macro('gtm5');_sf_async_config.domain=function(){var a=window.location.host,b=location.search.match(/utm_(?:campaign|source)=fb\d{4}_\d+/i);null!==b&&(a=a.replace("www.","paid."));return a}();_sf_async_config.flickerControl=!1;var _sf_startpt=(new Date).getTime();if("homepage"===Atlantic.page_info.view){var script=document.createElement("script");script.type="text/javascript";script.async= !0;script.src="https://static.chartbeat.com/js/chartbeat_mab.js";var s=document.getElementsByTagName("script")[0];s.parentNode.insertBefore(script,s)}_sf_async_config.title=Atlantic.page_info.title;_sf_async_config.path=Atlantic.page_info.path||window.location.pathname;Atlantic.opts&&Atlantic.opts.chartbeatOverrides&&(Atlantic.opts.chartbeatOverrides.path&&(_sf_async_config.path=Atlantic.opts.chartbeatOverrides.path),Atlantic.opts.chartbeatOverrides.title&&(_sf_async_config.title=Atlantic.opts.chartbeatOverrides.title)); _sf_async_config.playerdomain="www.theatlantic.com";_sf_async_config.sections=function(a){var b=[];switch(a.article_type){case "note":case "thread":b.push("notes");break;case "blog":case "citylab":case "wire":break;case "":b.push(a.primary_channel);default:b.push(a.article_type)}b=b.concat(a.channels);return b.join(",")}(Atlantic.page_info);_sf_async_config.authors=Atlantic.page_info.authors.join(",");Atlantic.page_info.is_sponsored&&(_sf_async_config.zone="sponsored");Atlantic.page_info.sponsor&& (_sf_async_config.sponsorName=Atlantic.page_info.sponsor);window._sf_endpt=(new Date).getTime();_sf_async_config.ytApikey="AIzaSyDP5dqEZLyedSSUKle2MCEtXyN6ppCmx8Y";var _cbv=window._cbv||(window._cbv=[]);_cbv.push(["autoDetectYouTubeIframes"])}; (function(){"/membership/join/"===google_tag_manager["GTM-56LJR35"].macro('gtm6')?dataLayer.push({masthead_funnel:"landing"}):0<google_tag_manager["GTM-56LJR35"].macro('gtm7').indexOf("flow\x3dmembership")&&"/"===google_tag_manager["GTM-56LJR35"].macro('gtm8')&&"accounts.theatlantic.com"===google_tag_manager["GTM-56LJR35"].macro('gtm9')?dataLayer.push({masthead_funnel:"login"}):"/pubs/A5/ATL/Membership_New.jsp"===google_tag_manager["GTM-56LJR35"].macro('gtm10')||"/pubs/A5/ATL/Membership_Existing.jsp"===google_tag_manager["GTM-56LJR35"].macro('gtm11')?dataLayer.push({masthead_funnel:"order form"}):"/pubs/A5/ATL/Membership_Conf.jsp"===google_tag_manager["GTM-56LJR35"].macro('gtm12')&& dataLayer.push({masthead_funnel:"confirmation"})})();!function(b,e,f,g,a,c,d){b.fbq||(a=b.fbq=function(){a.callMethod?a.callMethod.apply(a,arguments):a.queue.push(arguments)},b._fbq||(b._fbq=a),a.push=a,a.loaded=!0,a.version="2.0",a.queue=[],c=e.createElement(f),c.async=!0,c.src=g,d=e.getElementsByTagName(f)[0],d.parentNode.insertBefore(c,d))}(window,document,"script","https://connect.facebook.net/en_US/fbevents.js");fbq("init","1407501962855831");fbq("track","PageView"); fbq("track","ViewContent",{blueconic_segments:google_tag_manager["GTM-56LJR35"].macro('gtm14'),purchase_confirmation_viewed:google_tag_manager["GTM-56LJR35"].macro('gtm15'),utm_campaign:google_tag_manager["GTM-56LJR35"].macro('gtm16')}); <img height="1" width="1" style="display:none" src="https://www.facebook.com/tr?id=1407501962855831&amp;ev=PageView&amp;noscript=1">__reach_config=google_tag_manager["GTM-56LJR35"].macro('gtm17');google_tag_manager["GTM-56LJR35"].macro('gtm18')&&(__reach_config.ref_url="https://www.facebook.com/",__reach_config.page_url=null,__reach_config.tags&&__reach_config.tags.push("FB_Instant"));

      The sad day where Dr. King himself died and wondering of the whereabouts of the killer, and a possibility that civil rights itself may have lost because of its head figure dying.

      s18practice#Ky'MetriP

  17. Dec 2017
    1. Alaska Native Claims Settlement Act
      The Alaska Native Claims Settlement Act of 1971 (ANCSA) promised 44 million acres of land and $962.5 million to spread across several native Alaskan corporations. When the US purchased Alaska from Russia in 1867, the deal included a clause that required the US to recognize and fulfill Native claims but allowed American legislature to decide the details (Jones 231). This clause remained unfulfilled for nearly a century before US Secretary of the Interior Stewart Udall issued a land freeze that prevented transfer of land in Alaska in order to put pressure on policymakers to address land claims of Natives (Busenburg 17). This land freeze proved an impediment to the proposed trans-Alaska pipeline system; by 1970, the oil industry began supporting legislature to settle Native claims (Busenburg 19). Because the act was influenced by the oil industry, it included a clause preventing Natives from claiming land that would interfere with commercial endeavors, including the land for the proposed trans-Alaska pipeline (Busenburg 21). According to Douglas Jones, the ANCSA was meant to be a “once-and-for-all” resolution of Native claims in the area and was considered by the involved policymakers to be “more than fair” (Jones 232). However, Alaskan natives were unprepared and struggled to adjust to a corporate model. In the period after 1980, almost half the ANCSA corporations were losing money (McNabb 88).
      
      Berger brings up the ANCSA in order to argue that the situation along the Mackenzie River is different from from that of Alaska and suggest that the resolution of Canada and in turn that the Mackenzie Valley Pipeline should be different from the resolution at which the US arrived. This difference is due to the vastly different structures of the two societies. Under a corporate model, Alaskan Natives shifted to a western economic style, doing things like wholesale retail and trade, banking, and real estate (McNabb 89). The location of the Native corporations is insignificant to their success in these kinds of endeavors, so it did not matter financially that they were given land out of the way of the trans-Alaskan pipeline. Native Canadians along the Mackenzie Valley, on the other hand, still practiced aboriginal ways in their native villages. To move from these villages to unfamiliar lands would upset their lifestyle and cause the people of the Mackenzie Valley more significant distress. 
      

      Mackenzie River near Fort Norman, 1921

      Works Cited:

      Busenburg, George J. "The Trans-Alaska Pipeline System." In Oil and Wilderness in Alaska: Natural Resources, Environmental Protection, and National Policy Dynamics, 11-43. Georgetown University Press, 2013. JSTOR.

      Jones, Douglas N. "What We Thought We Were Doing in Alaska, 1965-1972." Journal Of Policy History 22, no. 2 (April 2010): 226-236. America: History and Life with Full Text, EBSCOhost.

      McNabb, Steven. "Native Claims in Alaska: A Twenty-year Review." Études/Inuit/Studies 16, no. 1/2 (1992): 85-95. JSTOR.

    2. Rough Rock Demonstration School

      The Chairman of the Navajo Tribal Education Committee as well as other Navaho leaders sat down in the early 1960s to discuss Indian education. They all felt that the schools currently educating the Indian children were lacking in certain areas. These areas were more specifically “meaningful local school boards, cultural identification, community education and community development, native language learning, home visits, and guidance and counseling.” And thus was built what is now known as Rough Rock Community School, founded on the ideals that “the background for the Rough Rock School is the educational reversal that employed schooling to help reconstruct Indian culture and personality.” Prior to the construction of Rough Rock School, the Indian Bureau opened a boarding school at Fort Defiance. Eight other boarding schools opened on the Navajo reservation following the first. These schools were described as “notorious for their English-only curriculum, militaristic discipline, inadequate food, overcrowded conditions, and a manual labor system that required students to work half-days in the kitchens, boiler rooms, and fields, and allowed the government to operate the schools on a budget of 11 cents per pupil per day.”<br> At the time of World War II, the Navajo school system was entirely crushed. The gas, rubber, and money shortages put the system into a gradual decline. In 1950, Congress approved Public Law 81-474, which was a long-term development plan that would provide $25 million for school reconstruction. Finally, in 1964, The Rough Rock Demonstration School was built. It was the first time that the Navajo people were directly or actively involved in the operation of a school. The Board of Directors, an entirely Navajo school board, establishes the school policies. Parents from the community work in the dormitories. One of the most crucial elements is that “the cultural identification program makes Navajo culture a significant and integral part of the school program.”8 The students are taught in the Navajo language and about the history of their people. Rough Rock also provides adult education opportunities for community members. In 1969, the Board of Directors appointed Dillon Platero, a former chairman of the Navajo Education Committee, as the director. This was an extremely significant step because the Navajo people now entirely control and direct their own education. Rough Rock Community School is still in operation today in Chinle, Arizona, proving that American public education can be controlled by the people it serves.

      Citation:

      Roessel, Robert A. "An Overview of the Rough Rock Demonstration School." Journal of American Indian Education 7, no. 3 (1968): 2-14. http://www.jstor.org/stable/24397380.

      Collier, John. "Survival at Rough Rock: A Historical Overview of Rough Rock Demonstration School." Anthropology & Education Quarterly 19, no. 3 (1988): 253-69. http://www.jstor.org/stable/3195833.

      McCarty, T. L., and Fred Bia. 2002. A Place to Be Navajo : Rough Rock and the Struggle for Self-Determination in Indigenous Schooling. Mahwah, N.J.: Routledge, 2002. eBook Collection (EBSCOhost), EBSCOhost (accessed November 6, 2017).

    3. Alaska Native Claims Settlement Act

      On December 18, 1971 the Alaskan Native Claims Settlement Act granted legal land rights to over forty-five million acres of land in the Alaskan country to native tribes. This act also brought the establishment of the Alaska Native Fund that granted over $962.5 million in compensation for the previous acquisition of traditional land (Berardi, 2005). The territory included 375 million acres of aboriginal land and water claims (Berardi, 2005). The goal of this act was to settle all claims across the land while establishing a system different than the one of the reservations. The Federal government of the United States handed over their position as land holding trustees to natives, “twelve regional and approximately 200 village corporations as owners of the land and recipients of the money” (Berardi, 2005). The new land-owning corporations handed over any claim to other traditional lands at stake. Lands secured were set with no restrictions for the corporations to be used and developed as seen fit. Furthermore, all native inhabitants were encouraged to join multiple corporations (Berardi, 2005). By including this clause into the settlement act the federal government strategically empowered the masses by adding personal responsibility to the corporation and title. However, this system was not followed through with as the corporations only saw “half of the settlement money, sixteen million acres, and subsurface rights to village corporations land.” (Berardi, 2005). The legal amends of this deal were not consistently met and the inexperience of the corporations caused more financial troubles. Economic analyst Steve Colt depicted that “corporations lost more than seventy-five percent of their original cash endowment, with a one-time sale of old-growth timber and other natural assets and a one-time tax windfall allowing them to report positive accounting income.” (Berardi, 2005). The inability to properly commercialize the allocations of natural resources took a tole of the corporations and their members.

      The Native Claim Settlement Act’s catalyst was the discovery of the Prudhoe Bay oil fields. The passing of this eliminated native claims to the land desired by the government to turn Alaska into a highly profitable landscape with the ability to involve private businesses like Alaskan Artic to drill, refine and then transport the gas (U.S. Congress, Senate, Committee, Transportation, part 2). The delay caused by native land claims had the ability to prolong the economic transformation of Alaska from a provider of natural resources like timber and masonry to one of the most efficient internal oil providers (U.S. Congress, Senate, Committee, Transportation, part 2). The lands released from the settlement act include sections of the Artic Gas system route proposal “this right-of-way construction would involve construction of approximately 735 miles of pipeline in Alaska. The first 460 miles would extend south from Prudhoe Bay” (U.S. Congress, Senate, Committee, Transportation, part 3). In addition, the oil fields acquired by the federal government allowed for royalties and taxes to be collected (Berardi, 2005). The Native Claim Settlement Act abolished strategic land claims desired by the federal government in their pursuit of capitalizing on a financial opportunity by any means necessary. The Act did include other clauses to benefit native inhabitants.

      The Alaskan Native Claim Settlement did come with many positive other caveats past securing land for ingenious groups. This has included considerable education, health care, social benefits, and employment through state programs (Berardi, 2005).

      Caption: Map of Regional Corporations Source: US National Park Service

      Berardi, Gigi. “The Alaska Native Claims Settlement Act (ANCSA) – Whose Settlement Was It? An Overview of Salient Issues.” Journal of Land, Resources and Environmental Law 2, no.1 (2005); 131-137. http://Berardi, 2005.wwu.edu/cgi/viewcontent.cgi?article=1000&context=envs_facpubs U.S. Congress. Senate. Committee on Commerce and Interior and Insular Affairs. To Expediate a Decision on the Transportation of Alaskan Natural Gas to Other States: Joint Hearings before the Committee. 94th Cong., 2nd sess., part 2., February 17, 1976. U.S. Congress. Senate. Committee on Commerce and Interior and Insular Affairs. To Expediate a Decision on the Transportation of Alaskan Natural Gas to Other States: Joint Hearings before the Committee. 94th Cong., 2nd sess., part 3., March 24 and March 25, 1976.

  18. Nov 2017
    1. host. The holocaust of war, the terrors of the Ku-Klux Klan, the lies of carpet-baggers, the disorganization of industry, and the contradictory advice of friends and foes, left the bewildered serf with no new watchword beyond the old cry for freedom. As the time flew, however, he began to grasp a new idea. The ideal of liberty demanded for its attainment powerful means, and these the Fifteenth Amendment gave him. The ballot, which before he had looked upon as a visible sign of freedom, he now regarded as the chief means of gaining and perfecting the liberty with which war had partially endowed him. And why not? Had not votes made war and emancipated millions? Had not votes enfranchised the freedmen? Was anything impossible to a power that had done all this? A million black men started with renewed zeal to vote themselves into the kingdom. So the decade flew away, the revolution of 1876 came, and left the half-free serf weary, wondering, but still inspired. Slowly but steadily, in the following years, a new vision began gradually to replace the dream of political power,--a powerful movement, the rise of another ideal to guide the unguided, another pillar of fire by night after a clouded day. It was the ideal of "book-learning";

      To me the Emancipation Proclamation did nothing but free African Americans. They were free physically but not mentally. Having to deal with the kkk and still not being able to vote isn't an example of liberty.

  19. Aug 2017
    1. that blames the news as opposed to the lack of interest in news when it’s not entertaining

      YES! This is SUCH an important point. I am so glad that the podcast addresses this!!! As viewers, we can go on and on about how we "need" to watch the news to "become better global citizens" (which is extremely important, don't get me wrong), but *what if it addressed the same problems every single day*? Think about this-- A new report announces that over half a million Americans are homeless. When the data first comes out, (insert name here) TV station includes a 10-minute story about this on the 6 o'clock news. It's a very pressing issue that doesn't get a lot of media attention, so (insert name here) TV station decides to report about it again the next day. And again. And again. The news station interviews different people in different locations, but the number of viewers quickly drops between 6:00 and 6:10 pm. Why? Because it has lost its dramatic appeal, or as some might say, its quality of "breaking news". I know that this a rather drawn out scenario, but it shows how much of the fault lies not just with "news" and media, but also our own interests as an audience. Something to think about the next time we turn on the TV.

  20. May 2017
    1. Democratic involvement? If this race is close, some Democrats have asked, why hasn’t the national party spent more money here? National Democrats took similar heat for not investing more in Kansas’ 4th District special election last month.The Democratic Congressional Campaign Committee has spent about half a million dollars in Montana, funneling early money through the state party so that Quist could go up on TV, and later bolstering that with additional TV and mail efforts. But the overwhelming majority of outside spending in this race has been for Gianforte and against Quist.“Money is not what’s going to make Rob Quist win or lose this race,” a Democratic operative familiar with the state said. And Quist hasn’t suffered from lack of money. He received $1 million in just five days, his campaign announced this week.But the Democrats’ focus is clearly on Georgia, for which DCCC chairman Ben Ray Luján announced an additional $2 million in spending this week — the same day he acknowledged that “the data shows a tough path forward” in Montana.“You’re seeing investments made district to district that are smart investments, specific to those districts,” Luján said at a Tuesday press conference.

      One analysis on spending by DNC and DCCC on Quist

    1. since the three genera last shared a common ancestor some 4.5 million years ago

      This is now known to be false. We shared a last common ancestor with gorillas about 11 million years ago and about half that timespan will separate us from chimpanzees.

    1. London’s cycle hire scheme, named after mayor Boris Johnson – was the clearest indication to date that cycling was no longer just for a minority of fanatics but a healthy, efficient and sustainable mode of transport that city planners wanted in their armoury. There are now more than 8,000 Boris Bikes and 550+ docking stations in Central London. And the trend’s not anomalous to London: Wikipedia reports that there are 535 cycle-share schemes in 49 countries, employing more than half a million bikes worldwide.

      Municipal bike-rental programs are even better for your personal health, as well as your bank account. the project will save enegryand it is demanded to utilize efficient traffic tool which takes less space for per person trip in order to relieve the traffic crowding to protect the environment and to save energy

  21. Apr 2017
    1. Wikipedia reports that there are 535 cycle-share schemes in 49 countries, employing more than half a million bikes worldwide.
      • the article references wikipedia to show that the launch of boris bike really was a significant event
      • it also supports London as it mentions the number of countries that are also employing bikes
    1. isease and malnutrition resulted in perhaps twenty million to thirty million deaths in 1960–61, the greatest famine of the twentieth century

      It is interesting to see that a famine on this great of a scale could have happened in the second half of a century that was not too long ago.

    1. Overall, department stores employ a third fewer people now than they did in 2001. That’s half a million traditional jobs gone — about eighteen times as many jobs as were lost in coal mining over the same period.

      And this decline is rarely talked about.

    1. because that proof is missing Rossi should somehow be given the benefit of the doubt.

      Given the benefit for what purpose? This is not a criminal trial. However, many are interested only in the excess heat question. Because Rossi has shown that he lies, and because he has shown that he somehow induces scientists -- even established skeptics like Essen -- to make face-palm errors, nothing from Rossi or generated in a zone of high Rossi influence, can be trusted. It's "fake news." And the people who cling to fake news are people who already "know" what it appears to confirm.

      If the Rossi Effect is real, Rossi will, I'd think, show someone his secrets, fully. If he cannot find anyone to trust, then the outcome is Natural Consequences. Paranoia strikes deep.

      Rossi's health may be failing, there are signs in the depositions. I understand why people like Rossi. I feel some substantial sympathy for him, in spite of all that he has done (and in spite of his calling me a paid puppet of IH). If he has a real effect, and if he actually cares about those children with cancer, and about the rest of us and our future, I strongly hope he will make that disclosure, and take steps to insure that the transferred technology actually works. He always said, the proof is in the market, and he was right as to an ultimate proof. So if people want to support him, if they believe him or in him, then .... let them raise the funds and make it so. Nothing could stop them.

      But we now see that Rossi had full opportunity to do this with IH, to make $100 million and then half the world market, which would be many, many billions, and he blew it, badly. Conclusions are obvious, though many details may remain obscure.

  22. Mar 2017
    1. Paragraph 1 : China has hit winter and the pollution make a very deadly smog. It's so bad that it's over 12 times the level of recommended by the world health organization.

      Paragraph 2: Pollution in china it very unstable level that is costing lives. It's just ruining rivers, lakes, skies, and the soil.

      Paragraph 3: That some of the industry don't really care and there just burning dirty coal. When you land in beijing it's cover smog of pollution, and you can barely see anything.

      Paragraph 4 : One percent of urban dwellers breathen safe air. 99 percent don't and the levels danger just keep raising it's get even dangerous just to breath.

      Paragraph 5 : Beijing tried to the pollution and tried to remove automobiles to clear the 2008 olympics. 2013 they measured a smog that was 50 times worse than the daily limit.

      Paragraph 6: That the air being polluted it's causing diseases was respiratory. Number one leading death in china. 1.2 million deaths are caused annually cause of pollution

      Paragraph 7: China knows that the water, supplies worst polluted than their air. Lakes, rivers, streams, and the lack of trying to protect them. Even the lack clean the sewage clean makes it even worse.

      Paragraph 8 : Many of the lakes and river are not even usable cause it's to polluted and industrial uses. and less than half of rivers and lakes are able to swim and for fishing.

      Question 1: The United states because this could happen to us because we have big cities to.

    2. Nor
      1. China declares an emergency national red alert due to the pollution levels. It has caused many of the leading health problems in China. The pollution causes major problems environmentally, and health effects.
      2. Due to industrialization, use of coal and car fumes, all together it has created the world's worst air pollution problem. Visitors are shocked to see how the sky is not blue, but "only filled with dust."
      3. Surprisingly, only 1% of China's "urban dwellers" breathe safe air. The nation, and World Health Organization recommends citizens of China to stay inside because the air is so bad it causes health problems.
      4. China's air has spread to other regions in the world, and just this year, Beijing cleared over one million cars for the beginning of the 2008 Olympic games. It was the first time they saw a stretch of clear weather in 10 years.
      5. The pollution in China impose staggering demographic costs, as it causes major health issues such as respiratory disease. It is one of the country's leading causes of death, statistics show that the air pollution claims 1.2 million lives annually.
      6. Citizens on the ground that use the water are also in trouble, the water may be worse than the air as rivers and lakes have poor sewage treatment and dead pigs floating atop the major river of Shanghai. Some rivers are so polluted, fish cannot survive, and end up dying.
      7. A nonprofit group shows study and statistics that 39% of China's seven main river basins were way to polluted for general use such as swimming and fishing. Only 42% of are deemed fit for swimming and fishing, while 8% was even unfit for industrial/factory use. Overall, this shows that half of China's water sources are too dirty for safe consumption.
    1. Yet for all the hyperventilating, Pruitt’s answer to the question he was asked — whether carbon dioxide is the climate’s “primary control knob” — was entirely sound. “We don’t know that yet,” he said. We don’t. CO2 is certainly a heat-trapping greenhouse gas, but hardly the primary one: Water vapor accounts for about 95 percent of greenhouse gases. By contrast, carbon dioxide is only a trace component in the atmosphere: about 400 ppm (parts per million), or 0.04 percent. Moreover, its warming impact decreases sharply after the first 20 or 30 ppm. Adding more CO2 molecules to the atmosphere is like painting over a red wall with white paint — the first coat does most of the work of concealing the red. A second coat of paint has much less of an effect, while adding a third or fourth coat has almost no impact at all.

      This paragraph is a mixture of irrelevancy and error.

      First, it is true that water vapor constitutes the bulk of Earth's present-day greenhouse effect (measured in terms of infrared absorption). Quantitatively, however, Jacoby is off by quite a bit. In fact, water vapor constitutes ~50% of the terrestrial greenhouse effect, not 95% (see here). Clouds (solid and liquid water that form when the vapor condenses) constitute another ~25%, but CO2 contributes to almost all of the remaining fraction (only ~5% or so from all of the other combined gases). This is because CO2 still absorbs well in spectral regions where water vapor doesn't, and also because the upper troposphere is very dry; the ability to absorb intense surface emission and re-emit it at colder, higher layers of the atmosphere is critical for the maintenance of a planetary greenhouse effect.

      Secondly, the water vapor greenhouse effect is not independent of the CO2 in the atmosphere (see next reply).

      Jacoby stresses that CO2 is only a trace component of the atmosphere, an argument that is irritatingly unoriginal and provides useless context when describing the flow of radiation through the atmosphere. As before, CO2 accounts for ~20% of Earth's greenhouse effect. N2 and O2 account for nearly all of Earth's atmospheric mass. However, if the atmosphere were purely N2 and O2, the planet would likely be in a snowball state due to the lack of greenhouse trapping. This is where the equations of radiative transfer must be applied, rather than a naive intuition about proportions.

      Finally, Jacoby emphasizes the logarithmic nature of how CO2 affects the energy balance of Earth, and hence surface temperature (i.e., going from 10 ppm of CO2 to 11 ppm would have a much larger impact than going from 300 to 301 ppm). This is correct, but has been known for well over half a century now, and is fully accounted for in even simple estimates of future warming. This is therefore a distraction.

      • chris colose
    1. He hath disgraced me and hindered disgrace (v.) insult, dishonour, deny respect [to] MV III.i.50  me half a million, laughed at my losses, mocked at MV III.i.51  my gains, scorned my nation, thwarted my bargains, scorn (v.) 1 mock, jeer, express disdain [at] MV III.i.52  cooled my friends, heated mine enemies; and what's his MV III.i.53  reason? I am a Jew. Hath not a Jew eyes? Hath not a MV III.i.54  Jew hands, organs, dimensions, senses, affections, passions?

      These evil things Shylock references that Antonio said, makes us feel sorry for the guy, this poor old Jew. But when he says ...passions? It makes us question whether Shylock has any or not.

    1. debt forgiveness programs that gen-erate some revenue but are far from cost recovery

      <br> Full Citation: Reforma. (2001b, July 9). Eximen a colonos de multas por agua—Otorgan en Toluca descuentos de hasta el 100 por ciento en multas y recargos a clientes morosos. Click to access full source.

      Analytic Note: This article, dated 2001, reports the conditions of the Toluca water utility approximately one year after the first right of center PAN mayor has taken office and begun exploring whether it is feasible to increase water prices or begin a commercialization strategy. It is interesting to note that the PAN water utility directors begin to asses the financial records of the water utility and find that the number of households that do not pay their water bills (approximately half of clients do not pay). However in order to perform basic maintenance tasks and keep the water utility afloat, functionaries must have some revenue coming in, especially after the lack of subsidies and direct transfers after services were decentralized. In order to have some income, they opt to forgive not the debt owed but the part of consumer debt that comes from interests and fees. They are asking customers to pay their debt balance, or a portion of it, and offering to pardon “late fees.” Although this is a means by which to increase the water utility’s income, it is a minor short-term fix that sidesteps the politically sensitive issue of raising tariffs for poor service.

      Excerpt: Tras dar a conocer que de las casi 120 mil tomas que se tienen registradas en el municpio, 50 mil aun no pagan el uso del vital liquid, el Organismo de Agua Potable de esta ciudad inicio un programa de descuentos de hasta el 100 por ciento en multas y recargos, accion que permitiria al ayuntamiento recaudar recursos por 150 millones de pesos… “nos preocupa que de alguna manera, este dinero, durante anios se ha venido manejando como un rezago que al paso del tiempo se hav uelto una especie de illusion pensar en el hecho de que acudiran a pagar

      Translation: After determining that of almost the 120,000 connections registered with the municipality, 50,000 [homes] don’t pay for water, the water utility of this city began a program of discounts up to 100% of all fines and fees on overdue water bills, policies that will allow the municipality to recuperate up to $150,000 million pesos. …“it is worrisome that in some sense these funds, for years have been managed like a debt that has become an allusion to think that it will some day be paid.

  23. Feb 2017
    1. According to his work, nearly half of all prime working-age male labor-force dropouts—an army now totaling roughly 7 million men—currently take pain medication on a daily basis.

      Seems reasonable. If you're of "prime working-age" and a labor-force dropout, there's a good chance it's because you've suffered from a debilitating injury. Maybe you subsequently got addicted, but that would be some slice of the 7 million man "army" he cites.

    1. Children of color and the poor make up more than half the children in the United States. According to the latest census, 16.4 million children (22 percent) live in poverty), and close to 50 percent of country’s children combined are of African American, Hispanic, American Indian, Asian American heritage. When the Common Core State Standards (CCSS) were introduced in 2009—2010 , the literacy needs of half the children in the United States were neglected. Of 171 texts recommended for elementary children in Appendix B of the CCSS, there are only 18 by authors of color, and few books reflect the lives of children of color and the poor.

      While non-fiction is a good element to have within the CCSS standards, I do think we need to diversify, a 1st - 4th grader isn't going to really care about a non-fiction piece, especially if they can't relate to it. And if we have only 18/171 texts being written by authors of color, and few that reflect poverty conditions then we lose the ability for these novels to connect with our children. If I can't connect with something, I'll zone it out, and considering I teach 3rd - 8th grade math for tier 2 SRBI students, I can say that if they don't care about math, they will easily zone me out and ignore me for the half an hour I'm working with them.

    2. Children of color and the poor make up more than half the children in the United States. According to the latest census, 16.4 million children (22 percent) live in poverty), and close to 50 percent of country’s children combined are of African American, Hispanic, American Indian, Asian American heritage.

      Large portion of the population potentially not incorporated into our classrooms which can send the wrong message to our students.

    3. Children of color and the poor make up more than half the children in the United States. According to the latest census, 16.4 million children (22 percent) live in poverty), and close to 50 percent of country’s children combined are of African American, Hispanic, American Indian, Asian American heritage. When the Common Core State Standards (CCSS) were introduced in 2009—2010 , the literacy needs of half the children in the United States were neglected. Of 171 texts recommended for elementary children in Appendix B of the CCSS, there are only 18 by authors of color, and few books reflect the lives of children of color and the poor.

      Just now I think that it is crazy how people of color or the poor make up half of the children in schools. I think that the underrepresented of them is very hurtful and neglectful. As a major part of the children in the schools they should feel included and valued. !8 out of 171 texts by people of color is extremely unacceptable. It is very important for each child to feel like they are safe, appreciated, and have value throughout their school. When children of color do not see books by authors that they can relate to it can have disastrous affects on their self-esteem.

  24. Jan 2017
    1. A 2004 study found that almost half of the Internet users in the United States have created online content by building websites, creating blogs, and posting and sharing files. An astonishing 13 percent maintain their own websites, and one recent census counts more than seven million blogs.

      I wonder how these percentages have changed in the last 13 years?

    1. For the next half century or so, we will see students learning less in school and economies held back, because in 2017 we allowed more than a million kids to be malnourished just here in southern Africa, collateral damage from our carbon-intensive way of life.

      More new information

  25. Nov 2016
    1. almost half the people didn't vote at all. Of the half that did vote, Hillary got more votes and of the people that voted for Trump, only probably 10 percent of them endorsed all this crazy stuff; the other 40 percent were just giving a middle finger to either Hillary Clinton, DC, or PC stuff run amok, whatever that means to them. That doesn't mean that they all want to privatize Social Security or even build a wall, in fact. If you take the people that didn't vote, cut them in half and assume that some would have voted for Trump and some would have voted for Hillary, then you take her voters, that's like 150 million people. That's a lot of people who cannot be rationally included in the Trump camp at all. Then if you take the half of his voters, or more, probably, the vast majority of his voters who aren’t into a lot of his crazy stuff, you got a lot to work with.

      Reassuring...

  26. Oct 2016
    1. he is asking for two and a half million dollars

      Seems like theres a lot of Copyright issues going on in music these days. Though this has to do with an image, have you guys heard the famous case between Coldplay and Joe Satriani about "Viva la Vida".

    1. “A climber with a rope can hop it in less than half a minute,”

      You would think that a country with 318.9 million people would be more secured so a climber with a rope couldn't hop it in 30 seconds. You can see why there is so many drug trafficking problems with the U.S and Mexico.

    1. The key to America's national and energy security rests with our ability to provide for our own energy needs with our own natural resources, personnel and infrastructure.A proposed $3.7-billion pipeline is planned for a 1,200-mile span from the Bakken oil fields of western North Dakota to Illinois. This will allow North Dakota to export half of its daily crude output to the rest of America.The Dakota pipeline will create over 8,000 immediate jobs in the construction sector. It will be a huge boost to regional employment, especially for welders, mechanics, electricians, pipefitters, heavy equipment operators, truckers and other complimentary trades in the manufacture of the materials needed to build the pipeline.The economic benefit to the construction of the pipeline with the state and local economies is an estimated $129 million annually to property and income taxes. The service industries will also see a benefit through additional income to hotels, restaurants, etc. Once the pipeline is operational, it is estimated that state and local governments can see an estimated $50 million annually in property taxes and $74 million in sales taxes for the states of North Dakota, South Dakota, Iowa and Illinois.

      Blakeman, Bradley A. "Why we must build the Dakota Access pipeline Now." The Hill. 9 Sept. 2016. Web. 11 Oct. 2016.

      Blakeman makes his thesis statement across multiple paragraphs, but it is very clear. He argues that this DAPL will allow for cheaper transport of crude oil to the rest of america, it will allow easier transport, it will create over 8,000 jobs, and it will generate $129 million to property and income taxes. This is a strong argument showing the large economic benefit to this major construction project taking place. This heavy concern for money and economics shows that the author is more of a right leaning author, but he makes a strong argument for his position on the construction of this pipeline. It is true, the construction would generate 8000 plus jobs helping out those who are not currently employed. Also the easier transport of crude oil means less involvement in the middle east and trying to transport from there. The author keeps his conservative pose in this article; he doesn't kindly address the opposing side but instead calls them 'A handful of environmental rabble-rousers with a radical agenda...' This hurts his ethos a bit because he doesn't express that he understands their side of the argument, instead he name calls them and basically says they are uneducated on the issue. Not referring to the other side discredits him and makes his bias heavily shown.

    1. By approving DAPL under NWP 12, the Corps essentially decided to treat it as a series of small wetland crossings instead of a four-state infrastructure project that will transport perhaps a half-million barrels of petroleum products per day, with high risks for spills and a huge contribution to global warming.

      This statement expresses the issues with putting this pipeline in. It would be a huge environmental hazard. Causing an increase in the chance for spills, and increasing global warming existentially.

    1. the Syrian civilwar has produced over 6 million of them, and has displaced roughly 7 million morewithin Syria. Indeed, over half the country’s pre-war population of 21.5 million isdisplaced, either externally or internally.

      This is an insane statistic with good support. More than half of the country has been displaced from their homes, and 6 million of them have left the country.

    1. 11.4 million American

      This is an use of evidence in the purpose of backing up her argument with statistics such as here the amount of Americans who spend more than half their incomes on rent. This shows how big of a deal the issue is for the audience.

    2. but it’s a big deal to the 11.4 million American households that spend more than half their incomes on rent.

      Hillary's op-ed uses other sources that makes her facts and statistics more reliable and believable to her audience.

    3. If we want to get serious about poverty, we also need a national commitment to create more affordable housing. This issue doesn’t get much election-year coverage, but it’s a big deal to the 11.4 million American households that spend more than half their incomes on rent. Too many people are putting off saving for their children or retirement just to keep a roof over their families’ heads. Advertisement Continue reading the main story

      Hillary says that almost 11.4 million american households spend more than half of their incomes on their house rent. She says that there needs to be a national commitment to create more affordable housing.

    1. Under these assumptions we estimate that of the total of $68 million in grants, $43 million has gone to the creation and dissemination of open content and $25 million into reducing barriers, understanding, and/or stimulating use. Of the total, about $12 million has gone to non-U.S. institutions primarily in Europe, Africa, and China for capacity building, translation, and/or stimulation of established institutions such as the Open University in the United Kingdom and Netherlands so they will be more aggressive in providing open content. About half of the $12 million has gone to enhance the ability of developing countries to take advantage of the open content and contribute to it

      It is awesome that this foundation is financially supporting OER! We need more financial supporters.

  27. Sep 2016
    1. Our magazine heritage stretches back to 1953 with the launch of Angling Times and the acquisition in 1956 of Motor Cycle News, both still iconic brands within our portfolio. More recently, Closer was launched in 2002 and Britain’s first weekly glossy, Grazia, was launched in 2005.  Our Women’s Weekly magazines include Take A Break, which has long been the UK’s best-selling women’s weekly title, and TV Choice, the UK’s biggest selling magazine.  In 2015, we created a new niche within the growing gardening market, with the launch of Modern Gardens, for an audience who want to enjoy their outdoor living space, without having to become expert gardeners.   Digital Our digital business is harnessed under the Bauer Xcel umbrella, to leverage our scale and accelerate our digital ambitions, organically and through acquisition. Today we have 40 million unique users accessing Bauer brands globally and in the UK, we have over 100 websites and 50 digital editions of our print brands. In early 2104, we launched our first digital-only brand in the UK, The Debrief.  Created for constantly connected 20-something females, The Debrief delivers totally relevant content at the right time, through the right channels. Radio The seeds of Bauer Media’s radio business were planted in1990 with the acquisition of London dance station KISS FM.  Today we operate 81 commercial local, national and digital stations in the UK, including Absolute Radio, Magic, KISS and the Bauer City Network of 22 iconic local brands, situated in cities across the UK. Bauer Media UK has the biggest commercial digital radio audience, with over half of total Bauer Radio listening taking place via a digital device. In March 2016, Bauer Media began broadcasting six of its national radio stations on the UK’s second national DAB digital radio multiplex network, including two new launches; Mellow Magic and Magic Chilled.  In May 2016, Bauer Media announced the acquisition of the market-leading Midlands-based commercial radio group, Orion Media, which incorporates the Free Radio and Gem radio brands, further strengthening the Bauer City Network across one of the UK’s fastest-growing regions. Bauer Media UK has also expanded its radio operation in to Europe, acquiring Nordic broadcaster SBS Radio in 2015.  Reaching more than 10 million listeners weekly, through 20 highly demanded brands, SBS Radio is the leading commercial radio operator in Sweden and Denmark and is strongly positioned in Norway and Finland.  And in February 2016, the KISS brand launched in Norway and Finland, with KISSTORY now also on-air in Norway. TV In 1996, we acquired digital music TV channel The Box, that has grown into Box Plus Network, a seven-channel joint venture TV business with Channel4.  Reaching 16 million viewers per month and offering more music than any other TV network, Box Plus Network brands include 4Music, KISS, Magic, Boxhits and Kerrang!

      By announcing their full company history, they are showing off all their successes over time. To brands enquiring in joining bauer media group, this is a highly persuasive way to draw them into joining the company as the prospective brands will see what they could achieve when becoming a part of bauer media group.

  28. Aug 2016
    1. And the trend’s not anomalous to London: Wikipedia reports that there are 535 cycle-share schemes in 49 countries, employing more than half a million bikes worldwide.

      In 49 countries employing more than half a million bikes worldwide meas the human to know the importance of environmental problems

    1. Hecomputes the value of the jewels at not less thanhalf a million sterling.

      Half a million sterling sounds like a very large sum of money. However, the current estimated value to be even greater than I believed. Using https://www.measuringworth.com/ukcompare/ the estimated value of £500,000.00 in 1890 would be worth at least £49,630,000.00 and could potentially be worth more. Google estimates £49,630,000.00 is worth around $ 65,516,554.77 in current U.S dollars. In other words, the treasure that was found by Bartholomew and Thaddeus is very valuable.

    1. For the first time, more than half of the members of Congress are millionaires. Nearly 200 are multimillionaires. One hundred are worth more than $5 million; the top-10 deal in nine digits.

      FACT Statements describing current state of congress members incomes. Statement describing problem.

    1. extremely strong cash flow in the period where net debt has reduced from £161.7 million at the start of the year to £74.9 million at the half year, a significant drop of £86.8 million.

      Cash generative business which is great

    2. *Adjusted profit before tax increased 16% to £50.1 million (2015: £43.1 million)

      Full year projected adj PBT is 80m; therefore, already over half way there

    1. An estimate of SiX’s 2015 budget puts it at around $3.5 million — approximately half the revenue commanded by ALEC and only about 2 percent of the recent budgets of Americans for Prosperity.
  29. Jul 2016
    1. Hillary opened my eyes to a whole new world of public service by private citizens. In the summer of 1972, she went to Dothan, Alabama to visit one of those segregated academies that then enrolled over half-a-million white kids in the South. The only way the economics worked is if they claimed federal tax exemptions to which they were not legally entitled. She got sent to prove they weren’t.

      The South, especially black voters in the South, are critical in this election. This story tries to locate midwestern HiIllary in the southern imaginary. Segregated academies, by the way, were a widespread phenomenon. Whites used them to redirect public money to circumvent desegregation. Recent sociological research shows how these academies continue to track to patterns of racial school segregation in the south (http://www.asanet.org/sites/default/files/savvy/journals/SRE/Jan16SREFeature.pdf). And, books like Kristen Green's "Something Must Be Done About Prince Edwards County" reveals how this unfolded.

  30. Jun 2016
    1. In the mid-atlantic they started to carry this cable to each other to create the first trans-atlantic network. Harnassing electricity for communication between 2 countries the UK and the U.S. internationally. It was a way to communicate without sending anything.

      Fast forward to today, and over half a million submarine fiber optic cable connects every continent on earth. This communications network has doubled in size in 5 years.

      200 billion words travel every second through this new network. This network isn't confined to the ocean floor and over 35 million miles laced between the united states. The INTERNET.

    Annotators

    1. In a city where white children are only 15 percent of the more than one million public-school students, half of them are clustered in just 11 percent of the schools, which not coincidentally include many of the city’s top performers.

      Uh... wait a second, shouldn't we be doing numbers for elementary public-school students?

  31. May 2016
    1. It’s estimated that there are around 30 million victims of human trafficking around the world. More than half of the victims (55 percent) are women or girls.

      If prostitution was the be made a legal, women could be HIRED voluntarily, rather than women and young girls being forced into it.

    1. World Vision says, “12 million Syrians have fled their homes because of conflict…four million are refugees.” Over half of the refugees are children. These children have needed to put their lives on hold because escaping the civil war is the most important thing right now. Millions don’t go to school. Many have witnessed terrible acts or are at risk of being exposed, leaving many families that have lost loved ones or orphans. These are children who have had to grow up too fast because of the situation they are placed in with little to no basic resources such as food, water, and clothing. Over 700,000 refugees put their lives in jeopardy by trying to reach Europe with more than 3,200 dying trying to reach there.

      Syrian Refugees are basically trying to run away from the violence.

    1. At the Scott Company, the country's biggest producer of lawn fertilizer, sales have skyrocketed in three years, from $228 million to $442 million.

      The price is increased more than half in three years

    1. However, the real question is: will cycling actually change the city? Will it result in new urban forms or, as the title of Australian academic Dr Steven Fleming’s new book predicts, a “Cycle Space”? Like Fleming, I believe so. I believe that cycling might just be the catalyst for a 21st Century urban renaissance.

      Since the "Boris Bike" have employed more than half a million bikes around the world, there is a real question-"Cycle Space".

    2. There are now more than 8,000 Boris Bikes and 550+ docking stations in Central London. And the trend’s not anomalous to London: Wikipedia reports that there are 535 cycle-share schemes in 49 countries, employing more than half a million bikes worldwide.

      cycle plan been promoted, more and more people use cycle as the main transportation

    3. And the trend’s not anomalous to London: Wikipedia reports that there are 535 cycle-share schemes in 49 countries, employing more than half a million bikes worldwide.

      This sentence indicates the scale of cycling used around the world. These specific numbers illustrate that cycling is getting increasingly popular.

  32. Apr 2016
    1. And yet, in the past five years, the 15 acres of open space have seen plenty of activity. In that time, more than half a dozen farmers have put their hands to a plow in an ill-fated attempt at organic farming. Only one of them is still standing. The same fate of those failed farmers has been repeated all across the county under an agricultural program meant to encourage and support organic farming by providing nearly $1 million in capital expenditures, temporary lease rate reductions, organic certification assistance, weed maintenance and farmer education courses.
    1. Let’s return to our discussion of Amazon Prime pricing in the context of the pricing concepts we’ve discussed. It might be helpful to review the key facts: In 2005, Amazon introduced Amazon Prime for an annual membership fee of $79 The service initially included unlimited 2-day shipping on orders Over the next 8 years, Amazon augmented Prime with a host of new features without changing the price In 2014 Amazon raised the pricing for annual Amazon Prime memberships to $99 Annually, Amazon loses at least $1 billion on Prime-related shipping expenses Amazon spent $1.3 billion on Prime Instant Video in 2014, over and above the shipping costs Amazon Prime has between 40 and 50 million subscribers Prime members spend an average of $538 annually with Amazon, far more than the $320 by non-Prime members[1] Returning to our original question, is it strategic genius or terrible folly for Amazon to lose billions of dollars a year on Amazon Prime on account of its pricing? Is Amazon actually losing money on Prime, or is Prime bringing in enough other sales to cover its costs? Customer Value Amazon was able to clearly articulate benefits to the customer that aligned with the offering and supported the pricing. It did this by Providing shipping that had been a luxury Eliminating delivery risk with predictable fulfillment Offering ease of purchase by combining the cost into one annual purchase These benefits allowed Amazon to create value with the offering. Introductory Pricing It wasn’t completely clear whether Amazon’s initial pricing was penetration pricing. Because it was a completely new offering, it was difficult to know how much it would be used and hard to analyze the cost to Amazon for providing the service. The decision to keep the pricing at $79 while adding significant new services certainly looks like penetration pricing. As a reminder, this is a strategy to drive significant early sales—to penetrate the market. Achieving Pricing Objectives Clearly, Amazon is hoping to draw new customers and increase total sales. Let’s look at some of the assumptions and see whether this is working. If Amazon has 40 million Prime subscribers, and each is spending $218 more annually ($538 – $320 from the data above) because of Prime, then Amazon is bringing in an additional $8.7 billion in revenue annually from increased Prime sales. Perhaps only half of the members truly spend more, but that would still mean $4.36 billion in revenue. Not all of that revenue is profit. If Amazon’s average markup on the sales of the items sold is 25 percent, then $8.7 billion in revenue might result in $2.2 billion in profit. This could then cover some of the losses that the Prime service collects as an independent offering. Based on this simple analysis, it is not immediately clear if Amazon is growing its profitability because of Amazon Prime. It does indicate that Amazon is growing revenue because of Prime. Both revenue growth and profitability growth are common objectives, and Amazon has historically been willing to take losses on the profit side in order to grow product lines and markets with long-term potential. If that is the case here, then Amazon is achieving a key objective. Answering the Strategic Question Is the pricing for Amazon Prime the right decision? Clearly, the answer has to be, “It depends.” That’s not completely satisfying, but it does acknowledge the complexity of pricing an offering that is driving growth, increasing sales per customer, opening new offerings and markets (like video and music streaming), and generating a significant financial loss for the company. Amazon reminds us that pricing is complex, and it doesn’t always have a clear right answer.

      I like the example of Amazon, however I would put all information in one section only.

    1. The number of souls in this kingdom being usually reckoned one million and a half, of these I calculate there may be about two hundred thousand couple whose wives are breeders; from which number I subtract thirty thousand couples who are able to maintain their own children, although I apprehend there cannot be so many, under the present distresses of the kingdom; but this being granted, there will remain an hundred and seventy thousand breeders. I again subtract fifty thousand for those women who miscarry, or whose children die by accident or disease within the year. There only remains one hundred and twenty thousand children of poor parents annually born

      This could fall under both pathos and logos. So many women could be "breeders" and out of all of them such a big amount won't be able to do so due to many reasons. Everyone should be able to have their own children if they want to and it is sad that some people don't really have a choice or that chance gets taken away from them.

  33. Mar 2016
    1. All 24 Republican House members and both senators in the Texas congressional delegation sent a letter to Obama on Thursday that called on him to suspend efforts to expand deportation relief. "Your Deferred Action for Childhood Arrivals (DACA) Executive Order has shielded over half a million illegal immigrants from current law," the letter reads. "And it has sent the regrettable message that illegal immigration will not be punished in the United States."

      an argument that is not backed up by opposing side.

    1. The slave trade brought approximately half a million Africans to the United States. These people arrived, stripped of their material possessions, but possessed of a distinctive cultural heritage, and various talents and skills. One outstanding characteristic was a seemingly innate ability to prepare food well. As Charles Gayarre stated in an 1880 issue of Harpers magazine, “The Negro is a born cook. He could neither read nor write, and therefore he could not learn from books. He was simply inspired; the god of the spit and the saucepan had breathed into him; that was enough.”

      The way we were treated as slaves and the way we ate, shapes how we and other people eat today.

    1. “How could I never have heard of something that kills half a million children every year?”

      This question shows how you and everyone else can live in this world, and not know half of the important things that are happening around us each and everyday!

  34. Feb 2016
    1. This report analyzes the most recent, reliable data about rape and sexual assault in our country. It identifies those most at risk of being victims of these crimes, examines the cost of this violence (both to survivors and our communities), and describes the response, too often inadequate, of the criminal justice system. The report catalogues steps this Administration has taken to combat rape and sexual assault, and identifies areas for further action. An overview of the problem: Women and girls are the vast majority of victims: nearly 1 in 5 women – or nearly 22 million – have been raped in their lifetimes.1Men and boys, however, are also at risk: 1 in 71 men – or almost 1.6 million – have been raped during their lives. Women of all races are targeted, but some are more vulnerable than others:33.5% of multiracial women have been raped, as have 27% of American Indian and Alaska Native women, compared to 15% of Hispanic, 22% of Black, and 19% of White women. Most victims know their assailants. The vast majority (nearly 98%) of perpetrators are male.Young people are especially at risk: nearly half of female survivors were raped before they were 18, and over one-quarter of male survivors were raped before they were 10. College students are particularly vulnerable: 1 in 5 women has been sexually assaulted while in college. Repeat victimization is common: over a third of women who were raped as minors were also raped as adults. Other populations are also at higher risk of being raped or sexually assaulted, including people with disabilities, the LGBT community, prison inmates (of both genders), and the homeless. Undocumented immigrants face unique challenges, because their abusers often threaten to have them deported if they try to get help

      Statistics on rape gathered by the government

    1. In 2015, 57 million children of primary school age were out of school. More than half of them are in sub-Saharan Africa and a further one fifth in South and West Asia.

      Education is key. If rich countries was to really educate the poor than they can teach them how to survive with knowing how to grow food and find/make clean water etc.

    1. More than half a million PA children live in households that would get a boost.

      not only people with the jobs benefit from the increase, their families will feel the impact too

    1. In April 2014, an unelected emergency manager appointed by Michigan Governor Rick Snyder switched the source of Flint’s drinking water from the Detroit system, which they had been using for half a century, to the corrosive Flint River. Officials thought they could save something like $5 million.

      I think it was important because people were getting sick from it and dying.

    1. Approximately two to three percent of Americans meet the criteria for problem gambling. That's around 6 million adults and about a half million teens.

      Gambling affects children also

    1. Because the FBI will not hire anyone with a 24-inch purple mohawk, 10-gauge ear piercings, and a tattooed face who demands to smoke weed while working and won't work for less than a half-million dollars a year. But you bet your ass that the Chinese and Russians are hiring similar people with similar demands and have been for many years. It's why we are decades behind in the cyber race.

      Fascinating.

    1. This article mainly focuses on rising oceans mainly due to the glaciers melting is Iceland. One of the other important things is that if we keep raising the temperature of the plant the permafrost will start melting, which is really bad for everyone. Finally he talks about how CO2 levels are at an all time high than in the past half million years. For my paper i'm going to talk about the rising CO2 levels and how the permafrost is starting to melt.

  35. Jan 2016
    1. Brazil’s GHG emissions in the early 1990s averaged 225 million tons of carbon per year,with about one-third coming from energy-related activitiesand the remainder from land use practices,primarily deforestation(see Figure 1).Brazil ranks relatively low in energy-related carbon emissions because the nation derives almost half ofits energy from hydropower and biomass. Over 90 percent of the country’s electricity comes from hydro-electric plants and about 15 percent of totalenergy from renewable

      Brazil is a great case study for this for their many governmental changes and developments over the past 50 years but I think that a truly developing country like some in the middle east that are still agrarian states, would be more interesting to look at. The United States has put billions of dollars into their renewable technology but almost none of it is being put to use because of unrest in the regions and the corruption and gridlock in the countries. I think it would be very interesting to have the numbers and data from those countries.

    2. Growth in GHG emissions has been slowed to almost half the economicgrowth rate over the past two decades through economic reform,energy efficiency improvements,switching from coal to natural gas,renewable energydevelopment,afforestation,and slowing population growth.Chinese researchers have not comprehensively documented the reductions in emissions growth resulting from these efforts.The following analysis documents reductions of 250 million tons a year—150 million as a result of slowerpopulation growth and 100 million as a result of reduced energy intensity

      I find this outcome connected to the whole militaristic implementation of the one child policy. This case is obviously less intrusive and the effects can be seen immediately but I think that there is a significant amount of value in these pragmatic decisions that they are making. I think the most interesting part of their decisions is that they actually make them, and in a very timely manner.

    1. Nearly half (48.2%) of the 3 million hourly workers who were at or below the federal minimum in 2014 were ages 16 to 24

      we, younger employees receive pay at the wage of 7.25 because we are less educated and experienced than others that are older and are ore certified for these position.

  36. Nov 2015
    1. It costs Florida roughly $19,000 to incarcerate an inmate for a year. So I ask you, dear reader, is keeping non-violent first-time drug offender John Horner locked behind bars in a jumpsuit really the best use of $475,000? For the same price, you could pay a year's tuition for 75 students at Florida State University.

      Logos argument. Almost a half million to keep this man in prison for selling prescription pills to another grown man. It's madness. Someone who is not a threat to society and is merely trying to provide for his children. Sure, maybe he went about it in the wrong way by doing something illegal but at the end of the day he does not deserve to spend the next 2 and a half decades behind bars for such a small mistake.

      rvc190

  37. Oct 2015
    1. Several problems plague the city of Detroit, including an exodus of its residents and business to other cities, regions, and states. This article, written before Detroit declared bankruptcy in 2013, proposes that one of the potential solutions to Detroit’s problems is for the city to merge with its suburbs and surrounding counties.

      Since 1950, 1.2 million people have moved out of Detroit’s city limits, leaving Detroit with a population of 684,799 people in 2013. Meanwhile, the surrounding counties of Oakland, Macomb and Wayne, as well as the city, combine for 3.9 million people.

      Salon writer Edward McCelland proposes that a merger could create a megacity, as seen in the cities of Miami, Indianapolis, and Toronto. The increased tax base would bring in more funding for the various government agencies, from road maintenance to public schools to police and fire departments, while suburbanites would benefit from the efficiency of a single local government and from increased stability in the region, which would make it more attractive to businesses and outsiders looking to move in.

      Detroit is the poorest city in the United States, with a median household income of $27,862 in 2013, half the national average. Although the city has lost 1.2 million people, it is still the same physical size, with the same number of roads and miles of sewer. Residents are few and far between, but the city’s high crime rate indicates that crime still must be solved, necessitating a police force (police and fire services are 60 percent of the city’s budget, McCelland writes). Property tax revenues decreased 20 percent from 2008-2013, even as the city has among the highest tax rates in Michigan.

      Much of the flight out of Detroit has been white people, looking to escape Detroit’s urban problems and racial disparity, leaving the core destitute and heavily populated by black people and other racial and ethnic minorities.

      Among the challenges of combining the surrounding suburbs and the city are racial tensions, remnants of the 1967 race riots. The tension and resentments, which go both ways, would need to be surmounted before the city could evolve to include its surrounding neighborhoods.

      The article ends on a hopeful note, recognizing that the ‘new generation’ seems to exhibit fewer racial biases and be more open to integrating the region. However, there is still a long way to go before the city forgets its scars.

    1. She is asking for two and a half million dollars.

      I am curious how the pricing model works? Is it based on assumptions or does she need to present actual data in order to come up with this number.

    1. The chairman of the Senate’s education committee — Sen. Lamar Alexander, Republican of Tennessee — declined to schedule a vote on renewing the Perkins Loan Program. So the program, which has annually let about a half million students with "exceptional financial need" borrow money through about 1,500 colleges, expired on September 30.

      ugh

    1. Dyce, Cherrel Miller, Cheryll Albold, and Deborah Long. "Moving from College Aspiration to Attainment: Learning from One College Access Program." The High School Journal 96.2 (2013): 152-65. ProQuest. Web. 12 Oct. 2015.

      By 2018 a large majority (around 62%) of jobs in the United States will require some type of post high school education and over half of those jobs will require a four-year degree. If those numbers are accurate there will be a shortage of over 15 million qualified individuals in the workforce. The subset of the population that is most at risk of not being able to compete for these jobs is individuals who come from a disadvantaged background or who have a cycle of disadvantage in their family. These are students of color, first generation college students, and low-income students who lack the financial and social capital to enroll and complete at a post high school institution. The education gap between underserved students and other students continues to grow and much of that is attributed to a lack of resources along with many other life challenges.

      The essay by Cherrel Miller Dyce titled “Moving from College Aspiration to Attainment: Learning from One College Access Program” discusses a small study focusing on low-income, first-generation students and families regarding their aspirations and realities as it pertains to achieving a college education after high school. The study surveyed 75 students and 76 parents regarding their confidence about different aspects of the college entry process such as necessary courses and ability to find financial resources.

      The study found that students’ and family’s confidence of a college education is fairly high, however that does not correlate with actual college entry rates. This means that students are not reaching the goals they aspire to when it comes to their education. The article calls for “long-term support for students and families throughout the high school.” To do so, the author is proposing more college access programs in the K-12 system that are targeted towards first-generation, low-income, minority students. These programs should “celebrate, recognize, and nurture the aspirational capital found in the social networks of potential students.”

    1. The recession that officially ended in June 2009 continues to impact how small businesses acquire financing and support, but some companies are stepping in to fill that void.

      Banks previously held many small business loans, but increasingly those same businesses are turning toward their community and crowdsourcing, including community Sourced Capital (CSC), a Seattle company that aims to raise funds from community members who want to support businesses by providing money for interest-free loan. Projects typically range from $5,000-$50,000, which are the hardest to get bank funding for due to the amount of due diligence required. People who want to support the business can buy squares through the CSC website for $50 each, a zero-interest loan to the business. If the campaign is successfully funded, the business owners start paying back “Squareholders” soon afterward, and have up to three years to repay the full amount.

      Lending was a role that used to be fulfilled by banks, in particular community banks for small businesses. In many areas, community banks have been swallowed up by larger banks, ending the relationship-driven lending model as small businesses have to compete with far-away banks who have many priorities and may not consider a small pasta shop in Seattle to be among them.

      CSC’s Square Model was founded by four classmates getting MBAs at Pinchot University, a Seattle institute that emphasized social justice and sustainability. CSC joins the rapidly growing crowdfunding market, which globally raised $16.2 billion in 2014, according to Massolution, a crowdfunding and crowdsourcing research firm.

      So far, CSC has loaned about $838,000 to 50 local businesses, most of them in the Seattle area — although its new partnership with the state Department of Commerce, Fund Local, aims to address the lack of access to capital for small businesses, particularly in rural and underserved areas. CSC and the Department of Commerce hope to support at least one company from each of Washington’s 39 counties.

      Even if it doesn’t hit all 39, success in just half could be an economic boon for the state, said Maury Forman, the senior manager with the Department of Commerce who’s overseeing the program. If 20 counties participate and the average loan is $25,000, that’s half a million dollars in the state’s local economy, he said.

      Alternative sources to bank funding for small business is important for our policy area (economic policy) in that we will examine the changing economy since the recession and financial crisis — much of it due to loan actions — and the small business economy is a vital part of that equation.

      — Amelia Veneziano, 10/5/2015

  38. Sep 2015
    1. And what that means is just constant, huge volumes of data going up. It's actually staggering. When you look at the numbers, every minute there are 72 more hours of video on YouTube. So that's, every second, more than an hour of video gets uploaded. And in photos, Instagram, 58 photos are uploaded to Instagram a second. More than three and a half thousand photos go up onto Facebook. So by the time I'm finished talking here, there'll be 864 more hours of video on Youtube than there were when I started, and two and a half million more photos on Facebook and Instagram than when I started.

      In this part the speaker is talking about media constantly forming and changing. It is moving at such a rapid progression, not stopping anytime soon!

    1. This is an article from June 11, 2015 edition of the Economist about the future of cities located in the Midwest of the United States that are suffering from post-industrial economic decline. The three cities that are analyzed are Gary, Indiana, South Bend, Indiana, and Galena, Illinois. All three of these cities have historical roots consisting of economic policy centered on industrial employment. However, as U.S. manufacturers have gone out of business or outsourced production to foreign countries, cities all over the nation, but particularly in the Midwest, have seen never before rates of vacant buildings, unemployment, high school drop-out rates, and crime. For survival, industrial cities must reinvent themselves by focusing on economic diversification anchored on fundamentals: geographical location to attract tourism and new business and to fiscally focus on institutions like universities and hospitals. Additionally, dependence on a single employer for a city has proven to be too risky as an economic plan; multiple businesses and new industries must be present in an increasingly volatile, non-heavy manufacturing market.

      Galena, Illinois is an example of a post-industrial city that has reinvented itself as a National historic site that attracts more than one million visitors per year. Galena met its post-industrial decline much earlier than many other Midwestern cities; by the end of the 19th century, it had gone from a busy metropolis competing in size with Chicago, to a ghost town. However, due to some clever economic planning during the 1960’s, city planners invested in historical preservation and put Galena back on the map as a tourist destination.

      South Bend, Indiana is another example of post-industrial survival. The Studebaker headquarters were located in South Bend until the company officially went out of business in 1963; it became a “company town without a company”(Economist, 2015). Fortunately, South Bend had 2 important economical anchors that have kept the city afloat: Notre Dame University and Memorial Hospital of South Bend. Although South Bend has seen huge increases in unemployment and poverty since the 1960s, these 2 key institutions have kept the city viable. Currently, the mayor is trying to lure technology companies to South Bend with tax incentives, inexpensive power, and the geographical location of a cool climate (ideal for manufacturing technological components).

      By comparison, Gary, Indiana has not fared as well as Galena or South Bend; Gary is a smaller version of Detroit, Michigan. Gary has some 5,000 abandoned buildings (about ¼ of all buildings); this is an eyesore and attracts criminals. After a change in Indiana’s property tax rules one year ago, Gary lost more than half its annual budget; this meant the city faced shutting down half of the services it could offer. The current mayor of Gary, Ms. Freeman-Wilson pleaded with the White House for Gary to be a recipient of the “Strong Cities, Strong Communities” initiative, which gave Federal funds to the 7 most distressed cities in the nation. Presently, Gary has received $6 million in state funds for building demolition, and the mayor has applied for a $21 million federal transportation grant. Gary will focus its economic policy to invest in becoming a transportation hub, being located right on Lake Michigan and just 24 miles away from Chicago (America’s third largest city).

      1. How do the English colonists view themselves? what early difficulties do they face and how are they viewed by the Powhatan? English Colonist view themselves civilization was superior the expected native Americans to adopt English customs. Many of the early colonization efforts suffered from a chronic lack of fund which caused dissent within the company's and conflicts with settlers in America who often accused the companies of failing to support them. Powhatan had good cause for this view many of the first English immigrants were.

      2. What role does tobacco play in establishing the Virginia colony? what tension arise due to this crop? A role that tobacco played in establishing the Virginia colony was during the 1630's and a half million pound of tobacco were being exported annually tobacco had become the foundation of Virginia's prosperity. The crop quickly drain the soil nutrients English planters had to gain access to more land there are two possible sources of labors for growing tobacco farms in the Chesapeake region England and Africa.

      3. Who are the Puritans and what is their criticism of the church of England? The Puritans were followers of John Calvin a Swiss cleric and desired to purify of the church. Their criticism of the Church of England was because they thought they were involved in politics

  39. Feb 2015
    1. he addition of Macmillan to libraries that already include big 5 publishers HarperCollins and Simon & Schuster pushes Oyster’s ebook count to 1 million, and Scribd’s to half a million (Plaugic).

      a bit of a convoluted sentence.

    1. With its users scattered across 200 countries and its active cultivation of users from the developing world, Wattpad is more Facebook than Kobo and having received successive infusions of venture capital worth $17.3 million in 2012 and $46 million in 2014, it is more a cash-rich company than a start-up experiment [14].

      This is more interesting than the first half of the essay. It goes to the heart of what you said the essay was going to be about, and it would have been great to see earlier in the piece.

  40. Dec 2014
    1. To prevent a programmer from defecting to Facebook, Google paid him three and a half million dollars in restricted stock options. Facebook has also become known for the “acquihire”: paying millions of dollars to acquire a company in order to poach its tech talent. The company gets shut down, and the engineers work for Facebook.