On 2024-07-22 12:47:53, user Simon Crouzet wrote:
This article has been now published in CSBJ. Link to the publication: https://doi.org/10.1016/j.csbj.2024.06.029
On 2024-07-22 12:47:53, user Simon Crouzet wrote:
This article has been now published in CSBJ. Link to the publication: https://doi.org/10.1016/j.csbj.2024.06.029
On 2024-07-21 18:44:35, user Terri Mitchell wrote:
While the idea of AI condensing 500 million years of evolution into a few minutes sounds very grandiose, a protein mutated in isolation is not fast forward evolution--it's just a mutated protein. AI has provided the blue print for an artificial protein situated outside of evolved life. The marine organisms that actually evolved molecules to transduce blue wavelengths of light into longer wavelengths of other colors and reemit them for a reason having to do with natural selection have done it already. They evolved the fluorescent molecules. ESM3's value is solely commercial, and no doubt it will be a hop, skip and jump from making the sequence available to researchers to commercializing it as contrast dye. Its origins will soon be forgotten, but its effects on the environment, and therefore life, will undoubtedly be persistent and deleterious.
Wrapping the report in intellectual arguments about evolution doesn't scientifically validate the claim that an AI-generated mutant is "evolved". Even if the AI endgame was reached--replacing all life with a human-devised approximation, and it was somehow achieved by pseudo-evolution--ESM3 would still have no evolutionary value since it was synthesized in isolation. AI mutated a protein: it didn't evolve a protein. Making scientifically invalid claims doesn't advance the case for AI. Just the opposite.
On 2024-07-21 16:01:56, user Min Zhu wrote:
The full version of this manuscript is online in Science Advances. https://www.science.org/doi/10.1126/sciadv.adl6366
On 2024-07-21 00:09:37, user Meet Zandawala wrote:
Manuscript title: TRPγ regulates lipid metabolism through Dh44 neuroendocrine cells
Summary: This manuscript from Youngseok Lee lab examines the role of TRP gamma channel in regulating metabolic physiology. Specifically, it focuses on the regulation of lipid metabolism via DH44 neuroendocrine cells. It is a follow-up on the work from the same lab where they showcased the importance of TRP gamma in DH44 cells in regulating post-ingestive food selection (Dhakal et al 2022: https://doi.org/10.7554/eLife.56726 ). Overall, this work adds to the growing body of work on DH44 neuroendocrine cells which appear to be crucial internal metabolic sensors. We have a few major comments and suggestions on the preprint which could help clarify the mechanisms by which TRP gamma regulates lipid metabolism.
Minor comment:<br /> 1. Stock numbers for fly strains have not been provided.
Signed by,<br /> Meet Zandawala <br /> Jayati Gera<br /> (Zandawala lab members)
On 2024-07-20 14:19:32, user Zach Hensel wrote:
The cluster described in Malaysia (C3) jumped out as having identical collection dates that are earlier than those typically associated with GISAID accessions this high (and consistent with those for Malaysia sequence circa November 2023) and also differ at multiple, overlapping positions despite being sampled on the same day.
Briefly, further investigation (using cov-spectrum and UShER phyloplace) identified four sequences from Mayasia with March 2022 collection dates containing both M:D3H and M:T30A:
EPI_ISL_18821484 (in C3)<br /> EPI_ISL_18821485 (in C3)<br /> EPI_ISL_18821546<br /> EPI_ISL_18821638
These all share G19677T, which is a mutation characterizing BA.2.40 in Malaysia which was common in March 2022 (760 out of 855 sequences worldwide with G19677T were found in Malaysia that month; 52% of sequences from from Sarawak, Malaysia collected in March 2022 have this mutation).
Further, the three sequences that are placed by phyloplace are found together with other sequences from Malaysia. This identifies another sequence with M:D3H and M:T30A sampled in Malaysia, EPI_ISL_18821317. Other mutations in these sequences are shared with various other lineages prevalent in Malaysia in March 2022.
One sequence with M:D3H and M:T30A, EPI_ISL_18821638, could not be placed by phyloplace, but NextClade calls it as BA.1.1 because it contains the BA.1-defining EPE insert in S.
The manuscript notes, regarding the period of Omicron emergence, "South Africa and Botswana, where genomic surveillance was more robust than in many other parts of Africa." BA.2.86 emergence in Southern Africa is well supported: <br /> https://www.nature.com/articles/s41467-023-43703-3
It is implausible that an intermediate between BA.2 and BA.2.86 would recombine with multiple lineages circulating in Malaysia and only be detected in Malaysia without leaving a trace in southern Africa given that this surveillance continued. Rather, I suspect that these observations are likely artifacts arising from processing samples collected in March 2022 together with samples collected in late 2023.
This can be tested by comparing mutations in these sequences to those observed in BA.2.86* strains common in Malaysia in late 2023. The most common of these is JN.1, which contains S:L455S as well as the S deletion shown for the C3 sequences here.
On 2024-07-19 19:06:04, user Maryam Foroozani wrote:
May I ask where I can find the supplementary figures?
On 2024-07-16 22:58:40, user Jim T wrote:
My congratulations to the authors on this impressive work! Your estimated 300kya date for the divergence of the ancestry of Khoe-San seems like a relatively good fit for the newer dates for the emergence of the Lupemban culture. Has this possible match been considered?
“Early Stone Age (ESA) archaeology is effectively absent from the rainforest zone, with the early Middle Stone Age (MSA) Lupemban industry representing the earliest sustained archaeological signature. Uranium-series dates of approximately 265 ka BP for the Lupemban at Twin Rivers (Zambia), although queried, suggest a precocious late Middle Pleistocene dispersal of early Homo sapiens into the equatorial rainforest belt.” - Taylor 2021
https://royalsocietypublishing.org/doi/full/10.1098/rstb.2020.0484
On 2024-07-16 09:31:08, user Sudin Bhattacharya wrote:
Very interesting work. However, analyzing distances in high-D space is problematic. Couldn't these findings be attributed to the curse of dimensionality, where far-away points all appear equidistant?
On 2024-07-15 17:30:04, user priyanka.bajaj3193@gmail.com wrote:
Reviewed by Priyanka Bajaj and Christian B. Macdonald (UCSF)
Summary:
Fusion oncoproteins occurring from genomic rearrangements are commonly observed in cancers and often drive oncogenesis. Although these fusions frequently involve kinases or transcription factors, they are a diverse group at both molecular and functional levels, and a unified description of their oncogenetic properties is lacking. Robust methods for predicting oncogenicity of unknown fusions would be immediately clinically useful, making this an important gap. At a more basic level, this points to a gap in our ability to describe a key biological phenomenon. Some recent work has tackled this problem by examining the physicochemical properties of fusion oncoproteins, notably [1], but this is essentially still an open question.
In this manuscript, the authors present a language model of fusion oncoproteins, FusOn-pLM, by fine-tuning ESM-2 with two recent databases of human fusion oncoproteins. They compare random masking vs. one using their previous fine-tuned ESM-2 model SaLT&PepPr and benchmark their results on a number of tasks, demonstrating reasonably increased specificity on specific tasks and improvement with non-random masking. The model training and benchmarking are sound and convincingly demonstrate the improvement.
Despite this, the lack of clarity about what unifies fusion oncogenes is a major challenge. Language models can be powerful ways to learn these sorts of definitions in a less biased way, and in that light this is an important step towards clarifying this basic gap. However, as written, the work uses a working definition of fusion oncogene that is based on physicochemical properties that may or may not be specific to oncogenes. Examining the benchmarking tasks the authors use makes this clearer: they are almost entirely predictions of condensate and IDR properties rather than oncogenetic ones. The one truly cancer-specific benchmark, differentiating carcinoma classes, is fairly narrow and no model performs particularly well here. As a result, we are unsure how strongly this model will perform in discrimination or generalization tasks.
Another general problem for the field is the lack of negative controls. Gene fusions are relatively common mutations, but bona fide oncogenic fusions are a small fraction of all fusions, making this a class imbalance problem. Even within tumors, the majority of fusions are thought to be passengers rather than driver mutations. Any predictor should be able to discriminate between these, but the lack of good data on non-oncogenetic fusions makes this challenging. This is evident in this work, where the model’s discrimination is not strongly tested.
In summary, we believe this is technically strong work which addresses a pressing need, and which also presents some general strategies for domain-specific language model fine-tuning, but which is unfortunately hamstrung by defects in the available data and conceptualization of the field that are outside of the authors’ control. As presented, it will be of interest to AI practitioners and oncofusion researchers, but the clinical utility is unclear.
Major points:
1) As discussed, we think the concept of an “oncofusion” is somewhat diffuse, as it describes an extremely heterogeneous set of proteins. This makes the prediction task particularly difficult. While the introduction discusses the barriers to prediction of fusion oncoproteins due to their intrinsically disordered regions and large size, we believe a bit more care with the effective definition they are using is warranted. Related to this is the choice of FOdb to train their model, which is essentially a database of condensate properties of oncofusions rather than oncogenetic ones. The implications of this choice also warrant a bit more discussion.
2) We wonder if there is a class imbalance problem. The databases used to fine-tune their model have a small fraction of possible fusion proteins, and don’t contain large amounts of negative training information. We are thus unsure if FusOn-pLM’s significant improvements over ESM-2 are specific to driver fusion oncogenes.
3) The method is not contextualized with respect to prior work in computational oncofusion prediction and characterization. Such methods are few ([2],[3],[4],[5],[6] among others) but important to understand FusOn-pLM’s performance.
4) Several experimental datasets for fusion oncogenes have been published, including [7], [5], and [8]. FusON-pLM’s performance on these would be a compelling way to show its utility, as well as a more specific oncogenetic task.
Minor points:
1) Figure 2D: Although FusON-pLM is doing a slightly better job at distinguishing carcinoma prediction into two classes (BRCA vs. STAD), the performance metrics are the worst across the board. What does this mean for the prediction problem overall? Does the fact that IDR and condensate properties are much better predicted mean that the model is actually not learning an oncogenetic task? This seems worthy of more discussion.
2) Figure 4A: The authors present a FusOn-pLM embedding visualization of fusion oncoproteins, along with the corresponding head and tail protein sequences. It would be beneficial to clarify whether the protein sequences used for the head and tail counterparts are full-length sequences or only up to the exon breakpoint that forms the chimeric fusion protein. This information can be included in the Materials and Methods section.
3) Figure 4A: The authors demonstrate that FusON-pLM is able to separate out fusions from their head and tail components. To demonstrate that it is learning more specific embeddings for fusion oncoproteins, a comparison of the embeddings with untuned ESM-2 would be appropriate.
4) Figure 4B: In the main text of results section the authors write “FusOn-pLM largely clusters sequences by key properties such as the fraction of polar, charged, and disordered residues as well as the propensity to form pi-pi and pi-cation interactions and prion-like domains, via the PLAC NLLR score.” From the data shown in Figure 4B, this conclusion seems fine for polar residues and NLLR scores, but not for disordered residues and pi-pi/pi-cation interaction propensity by eye. Without quantification of the clustering, we are not sure this statement is supported.
References:<br /> 1. Tripathi S, Shirnekhi HK, Gorman SD, Chandra B, Baggett DW, Park C-G, et al. Defining the condensate landscape of fusion oncoproteins. Nat Commun. 2023;14: 6008.<br /> 2. Shugay M, Ortiz de Mendíbil I, Vizmanos JL, Novo FJ. Oncofuse: a computational framework for the prediction of the oncogenic potential of gene fusions. Bioinformatics. 2013;29: 2539–2546.<br /> 3. Abate F, Zairis S, Ficarra E, Acquaviva A, Wiggins CH, Frattini V, et al. Pegasus: a comprehensive annotation and prediction tool for detection of driver gene fusions in cancer. BMC Syst Biol. 2014;8: 97.<br /> 4. Lovino M, Montemurro M, Barrese VS, Ficarra E. Identifying the oncogenic potential of gene fusions exploiting miRNAs. J Biomed Inform. 2022;129: 104057.<br /> 5. Li J, Lu H, Ng PK-S, Pantazi A, Ip CKM, Jeong KJ, et al. A functional genomic approach to actionable gene fusions for precision oncology. Sci Adv. 2022;8: eabm2382.<br /> 6. Liu J, Tokheim C, Lee JD, Gan W, North BJ, Liu XS, et al. Genetic fusions favor tumorigenesis through degron loss in oncogenes. Nat Commun. 2021;12: 6704.<br /> 7. Frenkel M, Hujoel MLA, Morris Z, Raman S. Discovering chromatin dysregulation induced by protein-coding perturbations at scale. bioRxiv. 2023. doi:10.1101/2023.09.20.555752<br /> 8. Kobayashi Y, Oxnard GR, Cohen EF, Mahadevan NR, Alessi JV, Hung YP, et al. Genomic and biological study of fusion genes as resistance mechanisms to EGFR inhibitors. Nat Commun. 2022;13: 5614.
On 2024-07-14 15:14:50, user Dd wrote:
Great work! <br /> We always wonder if the size of EVs is interfering with the binding capacity of the beads? Thus result in a lower detection maybe? Can you also share some images from the bead based flow cytometry? Thanks!
On 2024-07-13 07:51:37, user alexander_zlobin wrote:
Hi, I commented on the same issue before, but there is still one figure in the SI that retain the confusion between HID and HIE states of the catalytic His in serine triad proteases. This is figure S49, and it should be corrected.
On the unrelated topic, are you planning to provide your datasets later? I am particularly interested in all PDB entries you found and classified into GSA/TSA. As you of coarse are familiar, PDB searches are quite tiresome, and having this data already available would help tremendously.
Sincerely yours,<br /> Alexander Zlobin<br /> MeilerLab Leipzig, Germany
On 2024-07-12 23:46:41, user Alex wrote:
I hate myself for doing this, but apparently this is the only way to point this out: why doesn’t this benchmark include singleCellHaystack? Haystack was published in Nat Commun in 2020, has >75 citations now, is easy to install and run. An updated was published last year In Scientific Rep. Still, a part of this field that has apparently decided that it is completely fine to ignore this method.
On 2024-07-12 14:18:11, user Prof. T. K. Wood wrote:
DarT/DarG is better characterized as a type V TA system; this category is based on the fact that antitoxin DarG is an enzyme but does not alter the toxin (type VII). The first member of this group is GhoT/GhoS (please cite doi: 10.1038/NChemBio.1062).
Toxin/antitoxin systems were first shown to inhibit phage in 1996 (please cite doi: 10.1128/jb.178.7.2044-2050.1996).
On 2024-07-12 04:36:28, user Sam Buckberry wrote:
Our response to this preprint, titled ‘Transient Naive Treatment (TNT) iPS cells do not feature Sendai virus expression: Response to Sendai virus persistence questions the transient naive reprogramming method for iPSC generation’ is available here: https://www.biorxiv.org/content/10.1101/2024.07.10.602807v1
On 2024-07-11 13:25:32, user Pookey532 wrote:
A small correction in Table 1.<br /> CRISPR gRNA vector wrongly including PAM sequence, the consequence should say "gRNA plasmid becomes target of CRISPR cleavage" with the caveat that this would only be the case if the wrongly included PAM is followed by another PAM, which is not the case in many CRISPR plasmids such as the pX330 derived ones. This would obviously affect cleaving at the target if its PAM is not followed by a second PAM.
While some errors in the table are almost certainly errors in design (ex stop codons before a 2A sequence, mutations in ITRs, etc...) I'm curious why some of the other design "errors" are deemed errors. For example, using CMV in AAV vectors can be a perfectly acceptable choice depending on the use of the virus, especially if it isn't intended for long term expression. Likewise, use of "unstable" sequences in high copy plasmids can be a problem, however if those plasmids are maintained in bacteria that maintain plasmids at a low copy (Epi400, Stbl2, etc...), the replication origin of the plasmid becomes less relevant as the copy number becomes more dependent on the host strain. Similar to this, "Vectors containing toxic genes to E. coli host" is not necessarily a design error. Sometimes this simply the only option.
On 2024-07-10 18:49:28, user Björn Reumont wrote:
This preprint is published since Oct 2023 in BMC Biology, Open Access: Prevalent bee venom genes evolved before the aculeate stinger and eusociality, Link https://bmcbiol.biomedcentral.com/articles/10.1186/s12915-023-01656-5
On 2024-07-10 03:40:12, user Zach Hensel wrote:
This article does not match my experience in Okinawa and the caricature of Okinawa here is not necessary to make the point.
Some of the claims are simply wrong (e.g. the description of civil marriage registration). Others are caricatures for rhetorical effect (e.g. "14 cans of SPAM" is not what the reference says). In general, the list of supposed ills in Okinawa today has no direct connection to the longevity of today's 100-or-so-year-olds.
I hope that the author can speak with people in Okinawa and perhaps reconsider this approach.
On 2024-07-08 22:32:03, user Tara wrote:
This manuscript is now published at the Journal of Infectious Diseases<br /> https://doi.org/10.1093/inf...
On 2024-07-08 16:13:36, user Agnieszka Lipinska wrote:
Just to clarify, the data provided for Fucus serratus does not correspond to 'released sperm and eggs'. We sequenced vegetative tissue as well as reproductive tissue (whole receptacles) containing sperm or eggs, but not isolated gametes. Please see https://doi.org/10.1111/nph... for reference.
On 2024-07-05 12:57:48, user Thomas BN Jensen wrote:
Please see https://zenodo.org/records/... for the additional datafiles (metagenome assemblies, metagenome bins).
On 2024-07-04 17:58:15, user Dhiman Pal wrote:
This preprint has been published recently.<br /> Please use following link to the final published version:<br /> Lin, Y., Pal, D.S., Banerjee, P. et al. Ras suppression potentiates rear actomyosin contractility-driven cell polarization and migration. Nat Cell Biol (2024). https://doi.org/10.1038/s41...
On 2024-07-04 16:16:55, user Michael F Miles wrote:
This article is now published in Neuropsychopharmacology. There is a change in the order of the first 2 authors and the first name of Jeremy Nguyen (Angel Nguyen) in the final published version.
Mignogna KM, Tatom Z, Macleod L, Sergi Z, Nguyen A, Michenkova M, Smith ML, Miles MF. Identification of novel genetic loci and candidate genes for progressive ethanol consumption in diversity outbred mice. Neuropsychopharmacology. 2024 Jun 29. doi: 10.1038/s41386-024-01902-6. Epub ahead of print. PMID: 38951586.
On 2024-07-04 13:19:42, user Gyawali, Rajan wrote:
Hi,
Could you please link this preprint to the published journal in Briefings in Bioinformatics titled "CryoSegNet: accurate cryo-EM protein particle picking by integrating the foundational AI image segmentation model and attention-gated U-Net". The link to the published version is https://academic.oup.com/bi...
Thank you!
On 2024-07-03 16:05:42, user Jeffrey Duncan-Lowey wrote:
Congratulations on this interesting and important work establishing phage defense systems as a widespread and abundant source of gene cassettes of unknown function in functional mobile integrons.
Some work relevant to these findings -- a group has recently studied the type I CBASS system studied here (pic135AB) demonstrating that pic135B homologs, called Cap15 (interpro entries: PF18153/IPR041208), are cyclic di-nucleotide-activated beta-barrels that embed in and disrupt the bacterial membrane to cause cell death, validating the predicted role in membrane translocation (line 148). https://pubmed.ncbi.nlm.nih...
On 2024-07-03 15:10:50, user Peter Cattini wrote:
Our preprint manuscript on bioRxiv (doi: https://doi.org/10.1101/202... has now been published in final form in the Journal of Molecular Endocrinology under the title "Increased capacity to maintain glucose homeostasis in a transgenic mouse expressing human but not mouse growth hormone with developing high-fat diet-related insulin resistance, hepatic steatosis and adipose dysfunction". This paper can be found at: https://doi.org/10.1530/JME....
On 2024-07-03 13:55:44, user Jennifer Oyler-Yaniv wrote:
Hello, this paper has since been published in PNAS. Please see the accompanying link: https://www.pnas.org/doi/fu...
On 2024-07-02 23:49:22, user Brian wrote:
It has been reasonably well-established that if there is sufficient water, transpiration rate must not be restricted for the purpose of conserving water early season to gain benefits late-season. Even the current study shows "Early-season water use was positively correlated with above-ground biomass, challenging the assumption that early-season water conservation can be leveraged for late-season benefits". This study explores three treatments, all fully or partially irrigated. As authors' concluded that "We question the efficacy of LT traits, highlighting the physiological link between water use and carbon gain, and the potential opportunity costs of reduced early-season growth", I am unsure whether such treatments were the best choice. LT trait has been proved beneficial when soil moisture is scarce, and/or soil profile is deep enough to store sufficient water to be used late-season.
On 2024-07-02 15:48:40, user Donald R. Forsdyke wrote:
James Mallet's comments on an earlier version of this paper, noted the authors' claim that "This theory offers a level of parsimony and generality rarely seen in biology," and excused the absence of citation of his laboratory's study because it had come out "very recently, probably after you'd done most of this work."
However, the subjects of dosage compensation, Haldane's rule and speciation was covered together in the 1990s with some level of "parsimony and generality," which also included taking into account the immunological significance of collective gene functions (1-4). The growing evidence consistent with this viewpoint was more recently summarized in a textbook (5).
Perhaps, as part of their paper, the authors might more critically evaluate earlier work that so closely matches their own.
(1) Forsdyke, D. R. (1994) J. Theor. Biol. 167, 7-12 Relationship of X chromosome dosage compensation to intracellular self/not-self discrimination: a resolution of Muller's paradox?
(2) Forsdyke, D.R. (1995) J. Theoret. Biol. 172, 335-345. Fine-tuning of intracellular protein concentrations, a collective protein function involved in aneuploid lethality, sex determination and speciation?
(3) Forsdyke, D. R. (1996) J. Theoret. Biol. 178, 405-417. Different biological species "broadcast" their DNAs at different (G+C)% "wavelengths"
(4) Forsdyke, D. R. (2000) J. Theor. Biol. 204, 443-452. Haldane's rule: hybrid sterility affects the heterogametic sex first because sexual differentiation is on the path to species differentiation
(5) Forsdyke, D. R. (2016) Evolutionary Bioinformatics, 3rd edition. Springer, New York.
On 2024-07-02 11:48:52, user Hervé Acloque wrote:
The revised and peer-reviewed version of this paper is now available in the special issue of Genomics dedicated to FAANG:<br /> https://doi.org/10.1016/j.y...
On 2024-07-01 21:00:22, user Frank Koopmans wrote:
The manuscript has been published in Nature Communications and is available at https://doi.org/10.1038/s42...
On 2024-06-28 16:26:14, user Yat Ho Chan wrote:
Hi everyone,
We are excited to share that our article has been peer-reviewed and published in Nature Communications! You can find the article at the link below.
On 2024-06-28 13:20:02, user Jo Wolfe wrote:
Interesting preprint! Regarding the intro, indeed the oldest direct fossil evidence is Jurassic...but we recently found that the crown group of Brachyura are probably Triassic<br /> https://academic.oup.com/sy...
Also, in our 2021 Bioessays paper, we did suggest the pleon folding in metamorphosis may be due to Abd-A repression, so it's cool that you found support for that result
On 2024-06-27 16:17:06, user Ivana Jerkovic wrote:
The scripts from this study can be found at:<br /> https://github.com/MarcoDiS...
On 2024-06-25 00:34:52, user Jiazheng Miao wrote:
This manuscript has been published in Scientific Reports. Please access the latest published version.
Miao, J., Chen, T., Misir, M. et al. Deep learning for predicting 16S rRNA gene copy number. Sci Rep 14, 14282 (2024). https://doi.org/10.1038/s41...
On 2024-06-24 14:14:02, user Flo Débarre wrote:
Following up on my previous comment about the pangolin datasets featured in Figure 2:
As mentioned previously, according to INSDC medatadata, SRR11119760 and SRR11119761 were made public again on June 16, 2021. However, because the data were pushed to the cloud on June 18 only, which is the day the preprint was submitted to bioRxiv and shared via email with officials, it had been suggested that the data release could still be linked to the preprint submission. Careful inspection of the exact times of the different events on June 18 shows that this suggestion does not hold.
The preprint PDF was indeed generated at 17:52 EST (cf. pdf metadata), which corresponds to the time of the last Github commit on the preprint's associated repository. Communication of the results to NCBI/NIH officials took place at 19:00 EST ( source ). SRR11119760 was however public on the cloud at 14:00 EST ( source ), i.e. before the preprint's final version was compiled.
On 2024-06-21 10:40:11, user JamminOnTheOne wrote:
The materials and methods section regarding the production of mRNA is insufficient: "Subsequently, the mRNA and circular RNA (circRNA) were synthesized as described previously (10; 23)." The cited reference for mRNA production (Ref 10) gives two alternative types of protocols for mRNA production (post-transcriptional and co-transcriptional capping) and it is unclear which method was used. In the discussion section, it is also indicated that "GEMORNA-generated elements exhibit enhanced translation capacity with m1Ψ modification", however there is no mention in the text or in Ref 10 of the mRNAs being tested carrying this modification. It would be preferable to include the complete mRNA sequences and all of the reagents and procedures required to produce them.
On 2024-06-20 16:05:39, user Kishore Babu wrote:
SEC- MALLS experiment (Supplementary Fig1a) appears strange: (a) While Nictaba is eluting much later than BSA monomer (Mr = 66,000) the authors claim Nictaba to be a tetramer in solution (Mr = 76,000; subunit mol.wt. = 19,000 Da), so that they can claim a difference in their protein from that of PP2 gene family of proteins all of which have been shown in at least dozen other studies to exist as dimers only. (b) Only two molecular weight markers have been used as the standards for calibrating the column. (c) Nictaba a PP2 gene family protein is expected to be impeded on the gel media of their column as in a number of studies in the past on PP2 gene family of proteins they have been shown to get retarded on on gel media ranging from Sephadex, Acrylamide, Superdex etc.(Read, SM and Northcote, DH (1983) Planta 158, 119-127; Anantharam, V. et al. (1986) J. Biol.Chem. 261,14621-27 and Bobbili, KB et al. (2023) Structure 31,1-16).
The location, geometry of the binding site, the stereochemistry of the bound chitotriose and its interaction in Nictaba are identical to that reported for Cus17- the founding member of the PP2 gene family fold (Ref. Structure (2023) vol 31 pp1-16). Moreover ,the key residues tethering chitotriose to Nictaba are Thr14, Trp15, Tyr21, Val39, Ala40 and Trp151 are identical and correspond with Thr18, Trp19, Tyr25, Val46, Ser47, Trp48 and Trp141. Given this remarkably striking level of identities of the binding residues and the groups in the sugar one fails to see any novelty in Nictaba-sugar interactions as compared to the fold founding member of the family, namely Cus17. In this context, the authors should discuss their results in comparison with the structure of Cus17.
Even the backbone Cα atoms of the subunit of Nictaba overlap within 1.06A of the Cα atoms of Cus17 indicating that Nictaba fold is not new and is a faithful copy of Cus17. This should be stated in the Results and Discussion sections of the manuscript as appropriate.
The InterPro site that curates protein folds has created a separate folder for PP2 gene family of proteins since the appearance of Cus17 structure recognising it as a novel fold. It is therefore not surprising that Nictaba fold is curated and subsequent to the fold of Cus17.
Authors do not report on study on the stoichiometry of binding by any method including ITC but they claim Nictaba has a single binding site per subunit for the sugar perhaps based on crystal structure which is not a conclusive evidence for their assumption as there are numerous examples of differences for the number of binding sites seen in crystal structure or modeling vis-a-vis what are found in solution. Extensive ITC studies on several PP2 type lectins have given a wealth of information on the binding constants and thermodynamic factors associated with the binding of chitooligosaccharides to them as well as on the binding stoichiometry (see Nareddy, PK et al. (2017) Int. J. Biol. Macromol. 95, 910-919; Bobbili, KB et al. (2018) Int. J. Biol. Macromol. 108, 1227-1236; Bobbili, KB et al. (2019) Int. J. Biol. Macromol. 137, 774-782).
Nearly 40% of the 60 references cited in this manuscript are citations to the publications of the corresponding author! On the other hand many important, relevant publications of other scientists (mentioned above) are not cited.
On 2024-06-07 04:15:26, user Swamy wrote:
This study reports the crystal structure of Nictaba, the Nicotiana tabacum lectin which is specific for chitooligosaccharides and also binds N-linked glycans. The tertiary structure of this protein is essentially the same as that of Cus17, the 17 kDa phloem exudate lectin from Cucumis sativus (Bobbili et al. (2023) Structure 31, 1-16). Hence the term “archetypal” used in the title is misleading and hence it should be removed.
Nictaba is homologous to PP2 family proteins from Cucurbitaceae and other species. Some background information about PP2 proteins is relevant here. Two major proteins, phloem proteins 1 and 2 (short form PP1 and PP2) in the sieve elements of plants were studied since early 1970s by several groups (Sabnis and Hart (1973) Planta, 142, 97-101; Allen (1979) Biochem. J. 183, 133-137; Read & Northcote (1983) Planta 158, 119-127; Read & Northcote (1983) Eur. J. Biochem. 134, 561-567). That PP2 is a lectin was well established in these studies and its activity was clearly shown to be inhibited by oligomers of GlcNAc and by N-linked glycopeptides by Allen (Biochem. J. (1979) 183, 133-137). The PP2 proteins have been found in a wide variety of plant species, both monocots and dicots. In 1986 Anantharam et al. (J. Biol. Chem. 261, 14621-14627) clearly established that the chitobiosyl core of N-linked glycopeptides is crucial for binding of the phloem exudate lectin from Luffa acutangula (ridge gourd) as treatment of the N-linked glycans with endo-β-N-acetylglucosaminidase H completely abrogated their binding. While some of these early workers did not consistently use the designation PP2 protein while describing these lectins, over the last 30 years the term ‘PP2 proteins’ is commonly used by scientists working on these proteins. In fact, Gary Thompson’s group, who have extensively investigated the PP2 family genes referred to these proteins as a Superfamily (Dinant et al. (2003) Plant Physiol. 131, 115-131) and also referred to the Nicotiana tabacum lectin as a PP2-like agglutinin. Now Els Van Damme’s group, which has been working on plant lectins for over 3 decades refers to other PP2 family lectins that were investigated from much earlier as Nictaba-related lectins. This is a gross violation of scientific propriety and Nictaba should be referred to as a member of the PP2 Superfamily of proteins.
Since the high-resolution crystal structure of Cus17 is already known, and the structure of Nictaba is highly similar to it, the same should be mentioned in the Abstract, Introduction and Discussion sections in an appropriate manner. In particular, in Discussion section (para 2) the sentence “A similar crystal structure was reported recently for the phloem lectin from Cucumis sativus (Cus17), a member of the Nictaba-related lectin family” should be modified to indicate that “the first crystal structure of the PP2 fold to which Nictaba belongs”. In fact, the narrative of referring to all PP2 family lectins as Nictaba-related lectins at various places in the manuscript should be changed and Nictaba should be referred to as PP2 family protein.
In the light of the fact that the structural fold of Nictaba is quite similar to that of Cus17, it would be appropriate to give a detailed comparison of the Nictaba structure with Cus17 structure. <br /> Since the glycan array investigations on Nictaba have been reported earlier by the same group (Lannoo et al. (2006) FEBS Lett. 580, 6329-6337; Schouppe et al. (2010) Glycoconj. J. 27, 613–623) the discussion on this aspect should be condensed. Importantly, the glycan array data is at best semi-quantitative and the authors should have used a method like ITC (Isothermal Titration Calorimetry) which gives reliable and quantitative information on not only the association (binding) constants, but also important additional information on the carbohydrate binding by the lectin, viz., stoichiometry, enthalpy and entropy associated with the binding.
Although extensive studies on the binding of chitooligosaccharides to phloem exudate lectins have been reported, especially employing ITC, the authors cited just one paper published in 2011 (Narahari et al. (2011) J. Phys. Chem. B. 115, 4110–4117). Since then several ITC studies on chitooligosaccharide binding to PP2 family lectins have been reported (reviewed by Swamy et al. (2022) Phytochemistry, Article No. 113251.) This information should be suitably cited. Also, the study of Bobbili et al. (2023) on Cus17 also reports extensive ITC studies on the binding of various chitooligosaccharides and the N-linked glycan, Man3GlcNAc2 to the lectin. It is important to cite this work while discussing the carbohydrate binding characteristics of Nictaba.
On 2024-06-19 16:20:06, user John wrote:
Where are the Supplementary Tables 1-7?
On 2024-06-19 07:46:07, user Guillermo del Angel wrote:
I was trying to see the actual list of variants referenced in Table S1 but there doesn't seem to be any link to view and download these?
On 2024-06-19 00:31:10, user Rajan K C wrote:
This article has been published. Please update the article.
K. C. R, Patel NR, Shenoy A, Scallan JP, Chiang MY, et al. (2024) Zmiz1 is a novel regulator of lymphatic endothelial cell gene expression and function. PLOS ONE 19(5): e0302926. https://doi.org/10.1371/jou...
Thank you!
On 2024-06-17 03:46:27, user mittimithai wrote:
I thought this sentence was odd:
"Excluding Physics, the highest presence of EP authors<br /> 300 after adjusting for the total number of authors in each country is seen in Arab countries<br /> 301 (Saudi Arabia, Iraq, United Arab Emirates, Pakistan) and in Malaysia and Philippines."
Pakistan is not an Arab country.
On 2024-06-16 07:52:20, user James wrote:
The tidyverse isn't exactly good and promotes truly awful coding practice. Why continue expanding it? It's also hard to understand what this adds besides bloat to these analyses.
On 2024-06-15 11:45:28, user Jiashun wrote:
Great works!Cogratulations, Dr Cheng. While I found there may be a small mistake. "Of the sixteen F1 double heterozygotes we derived from the cross between gpgp and the TILLING mutant heterozygotes, half had yellow pods, and all of these yellow podded F1s carried the ChlGW121* null allele (Fig. 3i-j)". I checked the figures and found 10 yellow pods rather than the half of sixteen (8). Please let me know if I misunderstood.
On 2024-06-15 08:59:37, user Marc RobinsonRechavi wrote:
In the manuscript you write:
"Supplementary information including the Python code used for the simulations is available at https://10.5281/zenodo.11562472"
but this link does not work and I did not find this data in Zenodo. Can you please provide the correct link?
On 2024-06-15 06:00:47, user Yongheng Wang wrote:
Pease check the demo here: https://youtu.be/3-RSjPakGH...
On 2024-06-11 13:08:39, user wonderfulponderfulponds wrote:
I feel the research design and some conclusion drawn is premature due to an overlook of the following aspects:
Lacking data on Fatty acids analysis of some representative wild capelin testis, semen or centrifuged spermatozoa: The regeneration of sperm and endurance of males largely relate to absence/ presence of enough "raw materials" (i.e., high quality lipids, phospholipids and long-chain polyunsaturated fatty acids to be precise). The original hypothesis tested would be dubious, irrespective of any male sub-cohorts or phenotypes, if the above basic requirement is missing.
Lacking data on a gastrosomatic index (gut/ visceral weight divided by body weight and expressed in %) or gut content analysis: if some capelins are not feeding in between their spawning, it is highly unlikely they would replenish depleted energy reserves, and bioenergetically channel 50% of such intake energy in food to invest in gamete/ milt production. As such the original experimental design does not take into account a careful bioenergetics point of view either. Some whole-body carcass analysis of some representative capelin would have been beneficial as an alternative.
I urge the authors to consider these in future work and good luck with the revisions.
On 2024-06-09 05:52:19, user Barend de Graaf wrote:
I found a level of confusion about the ‘SPH protein family’, and the working mechanism of the SI system in Papaver specifically, in this very interesting MS …..
In the introduction, authors mention:
“In poppy, when two members of the SPH protein family (PrsS1 and PrpS1) are cognate, they confer sporophytic self-incompatibility (Foote et al., 1994; Wheeler et al., 2009; de Graaf et al., 2012)”
This is not correct, poppy does not express ‘sporophytic SI’ but ‘gametophytic SI’.
Furthermore, authors also state ‘when two members of the SPH protein family (PrsS1 and PrpS1) are cognate’.
This is not correct either, PrpS proteins are not part of the SPH protein family, instead these are classified as the poppy SI membrane ‘receptor’ proteins that are essential for SI signalling in pollen, male component of SI system in poppy.
On 2024-06-08 16:21:26, user Reviewer 6 wrote:
I have read Gainey et al, the response by Coleen Murphy in the comments as well as the preprint here. I previously made a detailed assessment of these which are found in the comments of Gainey et al., bioRxiv 2024.
In my opinion the debate to whether the effect can be triggered under highly specific lab conditions is not particularly relevant. But I think the point is that if the effect is so sensitive to such artificial conditions (or one sRNA that is only expressed under even more specific conditions), then how physiologically important can it be in nature? CM's group points to their 2024 (Sengupta et al, plos genet) paper testing various bacteria C. elegans may be exposed to the wild. However, it seems that worms naively avoid OP50 (i.e. ‘prefer’ test bacteria) in essentially every comparison made by CM. This is contrary to reports by other labs (PMID: 38228683, PMID: 38228683) and potentially a more serious concern with the assay.
Furthermore, in the 2024 Sengupta paper, it seems that both pathogenic and non-pathogenic bacteria can trigger avoidance (or not), which is odd and makes me think the effect is rather random. If this is really something so specific or adaptive that prevents worms from infection or confers fitness - I believe CM refers to the effect as the worms "reading" bacterial sRNAs in their Nature papers (is there any evidence that the recognition sequence on maco-1 mRNA co-evolves with bacterial preference in wild nematode isolates?) - then wouldn't the worms have evolved at least some preference for avoiding pathogenic vs non pathogenic bacteria from their habitat?
To me it just seems that random bacterial sRNAs that may be complementary to some worm genes that regulate behavior (I mean, you would expect to see some matches among a panel of total bacterial small RNAs from many species worms are exposed to versus total worm mRNAs...) are being silenced through an RNAi like mechanism... It's not news that RNAi can be inherited, which was described nearly two decades ago and is a well understood process.
Perhaps Hunter et al should visit CM's lab to learn the technique, but given how meaningful the assay/readout is in my view (and how already overstudied/saturated sRNA based inheritance is), perhaps it is not the best investment of time and effort.
On 2024-06-07 16:53:51, user Reviewer 6 wrote:
I am a C. elegans researcher with some familiarity with the topics discussed. I do not personally know, nor have I interacted with any of the authors involved. I have read in detail both the preprint and the response in the comments. Below I provide some comments in the hope that they will hone arguments from both sides. For brevity, I refer to the authors of this preprint as “the authors” and Dr. Coleen Murphy as “CM”.
Summary:<br /> In my view, there are two issues here (1): the technical reproducibility of the choice assay; and (2) the physiological importance of CM’s results in a natural setting given the points raised by the authors. While CM makes some valid arguments on (1) – the authors should really have shown at least a few assays that attempted to follow the protocol exactly as stated by CM – the deviations here are in my view minor enough to raise significant questions about the choice assay and its interpretation. I believe the authors are justified in stating that (2) if the variables discussed here indeed significantly obscure detection of the phenotype, then the ecological significance of the inherited learned avoidance in a natural setting is in question. This is especially important given that, contrary to CM’s response, the authors do in fact see learned avoidance of PA14 as well as daf-7 expression at P0 and F1 in some experiments (indicating that the learning was induced) but not beyond in the F2 progeny of these same worms which displayed learned avoidance. Below is a detailed discussion of these points.
Specific comments:<br /> - CM states that the lack of naïve PA14 preference seen by the authors is a “serious cause for concern”. In CM’s 2024 paper (Fig 1, https://journals.plos.org/p... , worms are tested for bacterial food choice between OP50 (the lab food) versus bacterial species C. elegans may be exposed to in the wild. However, it seems that worms naively avoid OP50 (i.e. ‘prefer’ test bacteria) in essentially every comparison made by CM. This is contrary to reports by other labs (PMID: 38228683, PMID: 38228683) and in my view potentially a more serious concern with the assay. Contrary to CM’s assertion, while CM’s group and others see *mild* PA14 preference in naïve worms, other groups also do not observe such a preference in naïve worms or report more variable results (e.g., PMID: 21172617, PMID: 28877481, PMID: 31371455). Overall, the authors did replicate P0 and F1 learned avoidance in some runs and had a “learning index” consistent with prior reports in these experiments, so I do not see how the lack of purported naïve PA14 preference (which is quite minor and variable to begin with) is a significant concern here. <br /> - Looking at the authors’ raw data (table S2) for individual experiments, it seems the authors used <200 worms as advised by CM for most of their plates. The “up to 770 on a spot” was from a single plate, so I do not think this would change the conclusions of the authors. The authors compared worm density with choice index and found that there is no correlation within the ranges tested here.<br /> - “no azide or other paralytic used” (CM) – the authors claim to have tested this and state that addition of azide did not affect their results. They also claim that worms make a choice within 15 minutes and do not leave the respective lawn in the first hour of the assay. But none of this data is shown (it should be). <br /> - It seems that CM’s group counts worms in proximity to lawns “if they are within a few millimeters of the bacterial spot.” (STAR protocol). This may introduce systemic bias given the OP50 and PA14 lawns are clearly visibly distinct. Again, this raises questions to me regarding the reliability of this assay for interpreting minute effects and making broad generalizations.<br /> - Aspirating worms for counting would be unlikely to affect results.<br /> - The fact that conditions tested by the authors are varied between experiments is in my view a strength of this study given they did not observe F2 effects in any of their tests (you would normally change parameters rather than keep repeating the same protocol if you were unable to reproduce something, no?). However, testing variables/conditions such as temperature, light/dark etc. are informative only in a context where the authors have first fully followed through on the exact CM protocol with no deviations. So, I do think it is crucial to show a few attempts where the protocol is followed exactly as stated by CM.<br /> - The use of Triton X after bleaching may be a concern as CM points out. Though seemingly low (0.01%), this may hypothetically make bleached (i.e. already somewhat stressed) embryos or newly hatched L1s more vulnerable to pathogenic bacteria or alter their physiology. I do not see a point in including Triton X during or after bleaching, it is not standard nor required and is certainly a confounding variable. However, given the CMC of Triton X is 0.02% and the authors use below this concentration and only during plating, I would be surprised if this led to a dramatic change in the phenotype observed.<br /> - I do not find CM’s critique on daf-7 expression to be substantive. CM asserts that the authors do not see elevated daf-7p::gfp expression. Except they do! Which is especially evident with the single copy (SC) construct Fig 2 under SC at both 20 and 25oC. The magnitude of P0 daf-7 increase with the SC construct (~2 fold) is similar to what other groups observe at this generation (albeit with the multicopy strain, so it is hard to compare). I think the use of a single copy reporter is a strength of this paper, but in the future assays of daf-7 expression should really be done using endogenous CRISPR/Cas9 reporters. That an F2 response is not observed in runs where there is a high upregulation in the F1 generation is consistent with the authors’ interpretation.<br /> - The authors should show representative images of what is being quantified as CM states, as without this we do not know which neurons are being assayed. I do not think averaging both ASI neurons in a worm is a concern – even if there is an increase in one ASI, it would still be reflected in the average (as long as the correct neuron is being quantified). It may even reduce variability or bimodality to average the two, given the brightness of reporters on a confocal image can depend on the depth of the imaging plane as the authors state. <br /> - CM states that chunking is an unusual way to maintain the fluorescent strain. But this is a genomically INTEGRATED multi copy array (ksIs2), no? The point of the authors is that the fluorescence expression and associated Rol marker are unstable in their expression, which is not unusual for such integrated repetitive multicopy arrays. This is not an extrachromosomal array wherein fluorescent worms need to be picked to maintain the array, so CM’s statement that it is “standard accepted practice” to do so is simply wrong. In fact I find it quite concerning if CM’s group picks fluorescent worms to maintain this strain as it biases the worms for an epigenetic state in which the integrant is poised for expression, which may indicate other epigenetic issues in the strain’s background (i.e., lack of silencing of repetitive sequences). The instability of this strain I assume is why the authors obtained a single copy daf-7 reporter, which in any case would supersede any results obtained from a multicopy array. CM says nothing about the single copy integrant results, and I believe that given the authors observe P0 and F1 upregulation with the single copy integrant, I think the case is solid that there is no response observed in F2 worms from F1s showing daf-7 upregulation. An endogenous CRISPR/Cas9 reporter (e.g., transcriptional/SL2::GFP if a translational fusion is not possible) would really push home this point. <br /> - CM states that the authors replicates show poor “consistency”. However, we can only see this because the authors, unlike CM, show each experiment independently! We have no idea whether every experiment CM performed actually displayed learned avoidance behaviour, given the source data for CM’s choice assays is apparently not public. CM’s reports only show all learning experiments in aggregate, and I believe if the authors aggregated all their runs herein to a single plot, they would indeed see a seemingly ‘consistent’ avoidance effect. CM could easily address this by releasing raw/source data for choice/learning assays.<br /> - CM claims that in their hands behaviour from a set of training plates is ‘always’ consistent, but data are not shown. Both sides need to avoid making important claims without showing data.<br /> - CM states that the authors use of the same population to assay and then maintain for the next generation may confound the results. Again, the authors need to do the assay exactly as stated by CM, but if a few extra minutes of suspension in buffer really so obscures the phenotype beyond any detection, then how ecologically relevant can it possibly be? To my knowledge, there is no major phenotype that is completely ablated by a few minutes additional incubation in buffer. By this standard nothing involving washing off worms in a buffer would be interpretable.<br /> - It is interesting that sid-1 and 2 mutants do not show a learned F1 avoidance, but daf-7 expression is still elevated. It may be sufficient to have one SID protein for elevated daf-7 expression in progeny but require both for the behavior. Given both sid-1 and 2 are RNA transport channels, without double mutants and reliable daf-7 readout from an endogenous reporter, it is difficult for either group to infer any epistatic relationships between these genes. <br /> - I read the protocol file with notes from CM. I did not find any changes that are severe enough to cause concern and it seems that these are more clarifications/updates than changes to the fundamental principles of the assay. I also did not find the authors’ statements on this disingenuous, as there were clearly differences between the original STAR protocol and the updates provided. It is important for both parties here to refrain from personal attacks and address the substance of the arguments made.<br /> - I did find that some details in the STAR protocol were excessive, e.g., the height of plate stacks. I appreciate the detail but again, this raises the question that if such artificial variables really influence the phenotype so severely that it is no longer at all detectable, how physiologically relevant or robust can the phenotype be? <br /> - The statistical error in the STAR protocol pointed out by the authors: it seems either CM is misinterpreting a two-way ANOVA or that this was an oversight. I did not find this point too important overall as correcting such a statistical error would not change the conclusion of CM’s papers given the magnitude of effects previously described. <br /> - CM states that expression of P11 is essential for TEI. In CM’s 2020 paper (Kaletsky et al) it is stated that: “moreover, training on a P11 mutant that disrupts the perfect match to maco-1 but conserves P11 secondary structure induced no avoidance (Fig. 4e)”. As written, it seems essential not just for TEI (F2 effect) but also the P0 learning itself (unless CM can clarify that it is only required for the F2+ effect and that in Fig 4e only F2+ are being tested). So as I understand it, if lack of P11 expression is the issue, then there should be no P0 or F1 avoidance at all in any of these runs. Given the authors do not see an F2 effect in worms with robust P0 and F1 responses, it seems that this point is moot. I also do not think the authors can be blamed for any putative lack of P11 expression as it seems that for this portion (PA14 growth) they adhered to the protocol quite closely and explored various PA14 lines including those obtained from CM’s and other labs.
In summary, I think CM’s response is insufficient to alleviate many of the key concerns raised by the authors herein. I do not believe the lack of naïve PA14 attraction is a major concern, as there are literature examples where (a quite minor) naïve PA14 attraction is not observed. Furthermore, this is also confounded by CM’s recent (2024) paper wherein their worms prefer essentially every bacterium among a panel over OP50 in a naïve test, again contrary to prior reports from other labs. This makes me question the robustness as well as any broad conclusions that can be drawn from this assay.
The authors do also observe P0/F1 learned avoidance and elevated daf-7 expression contrary to CM’s rebuttal. I agree that the effects shown are not consistent between experiments here, but we cannot say whether this is simply because we are seeing here individual runs of inherently inconsistent assays whereas looking at an aggregate of data in CM’s papers (since the source data for the choice assays are not public). The major concern is that in those populations with P0/F1 responses (meaning the learning has been successfully induced), there is no further inheritance of avoidance beyond F1, and similarly for daf-7 wherein populations expressing high daf-7 at P0 and F1 do not transmit this to progeny. I believe this precludes “basic concerns about [the authors’] bacterial and C. elegans growth conditions, assay conditions, and assay techniques”. Overall, while it is important for the authors to show a few runs where the protocol is followed exactly as described by CM, I believe the deviations here are minor enough that even if they were able to replicate the transgenerational effect successfully, the sensitivity of the effect to such minutia would greatly diminish its physiological relevance to the worms - and its importance as an adaptive paradigm of transgenerational epigenetic inheritance - in a natural setting.
I also do not find it constructive for any party involved to address anything other than the scientific substance of arguments or engage in personal attacks. Given the attention and broad reach these studies have garnered, as well as the important implications, it is essential – and the normal course of the scientific endeavor – for such claims to be rigorously tested.
I also very much appreciate that the authors have shared these observations, and find it very commendable that CM has responded in a timely and comprehensive manner (as well as been responsive to the authors in refining their protocol).
On 2024-06-06 14:21:54, user Coleen Murphy wrote:
Gainey et al. failed to use experimental and assay conditions specified in the Murphy lab's protocols and added extraneous, damaging steps; together, these resulted in the Hunter lab's failure not only to test TEI, but also their failure to replicate previous, well-established preference of C. elegans for PA14, learned avoidance of PA14 in the P0 generation, increased daf-7 expression in the ASI and ASJ, and intergenerational avoidance of PA14. To summarize, Hunter and colleagues have not in fact attempted to faithfully replicate our protocols in a manner that would have tested transgenerational epigenetic inheritance of learned pathogen avoidance, and therefore cannot make any claims about reproducibility.
On 2024-06-05 18:16:30, user Coleen Murphy wrote:
Point-by-point critique of Gainey et al. 2024:
Figure 1: <br /> 1. (A-C) It has been reported by many groups that PA14 is mildly attractive to C. elegans, that is, given a choice between PA14 and OP50, worms choose PA141,2. However, in almost every assay shown in this paper, the worms prefer OP50 over PA14 – that is, they are already avoiding PA14 - prior to training (naïve preference), which is odd. This suggests that the authors are not using conditions that are standard, either in PA14 or OP50 growth or in choice assays (see note about choice assay performance). This is a serious cause for concern that is independent of any training conditions. In fact, as far as we can see, in only one case (Fig. 1C, F1) did their experiments replicate the naïve choice results observed by other groups. <br /> 2. Choice assays: their “choice assays” involve putting 3-4x the recommended number of worms on a plate (up to 770 on a spot!), letting them roam for variable amounts of time (“30-60 minutes”) without trapping them (no azide or other paralytic used), and then putting them in a 4°C incubator (which does not immediately halt worm movement), then counting them. None of this follows our published choice assay protocols, or the standard chemotaxis assay protocol3–6. Putting more than 200 worms on a single plate can lead to altered choice because of crowding. In the absence of a paralytic, worms change their preference due to various factors, including adaptation; therefore, in this case, the worms’ first choice (which is what we measure in all our assays) is not being measured. They also count the worms by “aspirating” the worms off of the plate, which is not standard in any behavioral assays, as far as we know.<br /> 3. Table 2 and Figure 1: There are almost no true replicates, as in each experiment, at least one or more condition is changed. (For example, the authors only tested the PA14 we sent them in one replicate - Exp 3). <br /> 4. daf-7p::GFP imaging experiments (Fig. 1D, F, H) – Hunter and colleagues do not report seeing increased daf-7p::gfp expression in the P0 generation. Increased daf-7p::gfp expression after exposure to PA14 has been reported by multiple groups7, not just ours, and is usually not small or highly variable, as it is due to the combination of bacterial cues and P11 small RNA; if they cannot replicate this basic result, it suggests that something is seriously wrong with their protocols or technique, or their worms are very sick, even before trying to use our protocol to train worms. <br /> 5. Additionally, they do not report the expression of daf-7p::gfp in the ASJ neuron7, which is very strange, since we have been able to reliably replicate Meisel, et al.’s finding in the P0 generation. Therefore, it is not clear from which neuron the authors are quantifying daf-7p::gfp levels. <br /> 6. Instead of imaging and reporting fluorescence levels in individual neurons, the authors averaged fluorescence intensity/worm, which is explicitly not what we did or others have done, because different neurons in each worm can have different intensities – particularly if they are the ASI rather than ASJ neurons. <br /> 7. While we see modest decreases in fertility after PA14 training, the authors report severe decreases in fertility: about one fifth of normal egg production, and a severe developmental delay) in their F1 generation that we do not observe. Both facts indicate that their worms are very sick, even the worms that have not been exposed to PA14. If their worms are extremely sick, it might account for the small number of progeny, poor imaging results, and a developmental delay that shifted the training times. This could be a result of overbleaching, which causes developmental delays; the bleaching protocol described in Gainey et al. deviates from our published protocol. Additionally, they add Triton X100 to their final M9 wash, which is used (although at a higher concentration) to permeabilize embryos in other protocols. We are not aware of any bleaching protocols that include Triton in a wash step, and our lab certainly does not; this addition might also damage the progeny.
Figure 2 <br /> 1. P0 imaging data suggest that the daf-7p::gfp response to PA14 is not reproducible in their hands; again, this has nothing to do with our paper or protocols, but rather appears that they cannot replicate previous results in the field that precedes our work. <br /> 2. Does “25°C” mean that the worms were grown at or assayed at 25°C, or both? This high temperature is generally hard on the worms. <br /> 3. Technical note: it appears that instead of consistently picking fluorescent daf-7p::gfp animals, the authors “chunked” large groups of worms, resulting in populations of non-fluorescent animals in their experiments. <br /> 4. Scale of P0 and F1 are extremely different (due to sickness of the P0s?).
Figure 3 <br /> 1. Notes that panels A, C, and D are repeated from Figure 1.<br /> 2. The authors discuss “OP50 aversion” but this does not make sense, since both trained and untrained animals are placed on HGs after bleaching. <br /> 3. Their naïve in F1 is sometimes even lower than in the P0 (Fig. 3D).<br /> 4. There is no consistency in their results across replicates, within experiments, or across figures of the paper – not just the inability to see an F2 effect, but in their naïve chemotaxes, P0 trained choice indices, and F1 results; the authors claim that their F1 assays are reproducible, but only 3 out of the 9 assays in this figure show F1 learned avoidance. <br /> 5. In 3J, data that are not replicates, as they have been performed using different conditions, have been pooled. <br /> 6. Gainey et al. observe substantial variation in behavior between training plates (Figure 3, table 2, S2 annotated protocol), and incorrectly treat each training plate as a biological replicate, rather than a technical replicate. (Each training plate is seeded and grown in the same conditions, and worms from the same bleached population are added onto the plates, therefore these are not biological replicates but rather technical replicates; biological replicates require starting with different worm populations and carrying out the whole experiment independently.) In our hands, behavior from a set of training plates is always consistent. <br /> 7. Additionally, we note that the authors use the same population of worms for the choice assays and subsequently for bleaching, meaning that worms are held in liquid for an extended time before bleaching; this may cause worms additional stress which may interfere with behavior.
Figure 4 <br /> 1. OP50 growth conditions: this would only matter if the controls and experimentals were grown on different plate types, which is not the case (but if the authors are in fact putting the controls on different plates from experimentals, then the experiment is done incorrectly).
Figure 5 <br /> 1. We also found that sid-1 and sid-2 are required, but since their controls are inconsistent (Fig. 3) in the first place, it is hard to know how to interpret their data. <br /> 2. Other mutants (rde-1, hrde-1, sid-1, sid-2) – still show increased daf-7p::gfp in F1 – again, these data are hard to interpret since they do not show a wild-type control that worked here. This also has little bearing on our work since other training paradigms (e.g., 4- and 8-hour training that engages small RNA-independent pathways) also induce daf-7p::gfp. It is also unclear which neuron (ASI vs ASJ) they are imaging.
Discussion <br /> 1. daf-7p::gfp - Picking fluorescent worms or rollers is standard worm husbandry; it is not a “result” to say that they noticed that Rol can be lost – but it does indicate that they should have discarded any results that they obtained before noticing that the array might have been lost in the worms they assayed. The fact that they have brought this up more than once suggests that they are not using standard accepted practices to maintain transgenic lines. <br /> 2. Dennis Kim’s work on phenazine-induced avoidance has been oddly neglected in this work7. Kim’s group found that phenazine-1-carboxamide induces Pdaf-7::gfp expression in the ASJ neuron, which we see quite reliably in our assays as well. No Pdaf-7::gfp imaging of the ASJ neuron is presented in this work, suggesting that either the PA14 they grew also did not make phenazines, or their image analysis is unreliable. <br /> 3. They made a lot of changes to our protocol (temperatures, light/dark, etc). We cannot find in this paper a single example of an experiment that followed our protocol entirely. <br /> 4. The authors make a point of calling OP50 a pathogen, which is odd; C. elegans grown on OP50 typically live for 2-3 weeks. They cite Garigan et al. 20028, which showed that when worms get old (past 15 days) eventually the pharynx stops grinding up bacteria and the gut will start to fill up with OP50, and killing bacteria does slightly extend lifespan - but this is not an effect observed in young (Day 1) animals on the short timescales used in the experiments here. In any case, since both control and trained animals are grown on HG plates with OP50, it cannot explain the behavior of the control animals. <br /> 5. The authors also never replicate the “bias towards Pseudomonas in choice assays ((Ha et al., 2010; Lee et al., 2017; Moore et al., 2019)” – Those papers also used OP50 vs PA14 to demonstrate this bias towards Pseudomonas, so it is unclear how the author think that their failure to replicate this basic finding is somehow supportive of any of their arguments. It is more likely that there is something fundamentally wrong in their initial conditions that have prevented the replication of all other groups’ findings, not just ours. Moreover, in our experiments, other than the 24 hrs of training on PA14 vs OP50, our control and trained animals are always on the same plates. This argument makes no sense, unless the authors have introduced an additional variable of plating control worms on one kind of plate/bacteria and their trained animals on a different plate/bacteria (which we do not do). <br /> 6. It is unclear why the authors grew worms at different temperatures. 20°C is the standard temperature for worm growth and assays. <br /> 7. In our hands, naïve OP50-PA14 choice index is not significantly different between P0 (when NGM plates are used) and the subsequent generations (when HG plates are used). The survival assay correlates well with the idea that their worms are very sick, much sicker than we see in our assays, although the sparse intervals in both assays make it difficult to draw any conclusions – not possible to draw the conclusion that the bacteria are “more lethal” since they are trying to compare two lifespans from different labs etc. - but if they are, it might be due to their PA14 cultivation conditions or the health of their worms. But the fact that they see massive leaving and desiccation of worms, they might indeed be growing PA14 under much more pathogenic conditions. <br /> 8. The authors state: “Near the conclusion of these experiments, we received an updated protocol that included several clarifying edits and additional deviations from the published protocols (C. Murphy, Personal communication).”
We clarified our protocols, we didn’t “deviate” from them. This is a concerning way to present our email communications in which we tried to correct errors in their protocol and offer constructive advice; we even extended an invitation to Hunter to visit our lab to learn the assay. We are happy to provide these emails if necessary.
In order to help others, we continuously update our lab’s protocols to make clarifications that will help future users. Any note from the Murphy lab is an example of this type of updating. For example, later we made a new bacterial construct that used a Kan marker and constitutive promoter instead of an Ara inducible promoter and Carb marker to streamline experiments. This is not a deviation, it is a natural progression of the research in our lab and our practice of continuously improving our assays and updating protocols.
It is disingenuous for the authors to present our updates to our protocols as if we have “deviated” from them – in every instance, we gave the authors all of the information that we had available to us at the time. Our suggestions were made genuinely and in good faith, with the assumption that the authors wanted to get the assay working rather than using it to point out changes in our protocol.
Moreover, this statement corroborates our assertion that all or most of the data in this paper seem to have been generated using a protocol that differs significantly from our lab’s, as the bulk of their experiments appear to have been done before contacting us: “Incorporating these changes into our procedures did not reliably alter our results.” (no data shown)
Together, Hunter and colleagues’ failure to replicate the basic naïve attraction to PA14 over OP50 demonstrated by other labs, their failure to replicate the P0 daf-7 expression published by other labs, and their failure to reliably replicate the P0 and F1 behaviors shown by other labs suggests to us that there are more basic concerns about their bacterial and C. elegans growth conditions, assay conditions, and assay techniques independent of any of the attempts to replicate the findings from our work.
References <br /> 1. Zhang, Y., Lu, H., and Bargmann, C.I. (2005). Pathogenic bacteria induce aversive olfactory learning in Caenorhabditis elegans. Nature 438, 179–184. https://doi.org/10.1038/nat....<br /> 2. Ha, H., Hendricks, M., Shen, Y., Gabel, C.V., Fang-Yen, C., Qin, Y., Colón-Ramos, D., Shen, K., Samuel, A.D.T., and Zhang, Y. (2010). Functional Organization of a Neural Network for Aversive Olfactory Learning in Caenorhabditis elegans. Neuron 68, 1173–1186. https://doi.org/10.1016/j.n....<br /> 3. Moore, R.S., Kaletsky, R., and Murphy, C.T. (2019). Piwi/PRG-1 Argonaute and TGF-β Mediate Transgenerational Learned Pathogenic Avoidance. Cell 177, 1827-1841.e12. https://doi.org/10.1016/j.c....<br /> 4. Moore, R.S., Kaletsky, R., and Murphy, C.T. (2021). Protocol for transgenerational learned pathogen avoidance behavior assays in Caenorhabditis elegans. STAR Protoc. 2, 100384. https://doi.org/10.1016/j.x....<br /> 5. Kauffman, A.L., Ashraf, J.M., Corces-Zimmerman, M.R., Landis, J.N., and Murphy, C.T. (2010). Insulin Signaling and Dietary Restriction Differentially Influence the Decline of Learning and Memory with Age. PLoS Biol. 8, e1000372. https://doi.org/10.1371/jou....<br /> 6. Kauffman, A., Parsons, L., Stein, G., Wills, A., Kaletsky, R., and Murphy, C. (2011). C. elegans Positive Butanone Learning, Short-term, and Long-term Associative Memory Assays. J. Vis. Exp., 2490. https://doi.org/10.3791/2490.<br /> 7. Meisel, J.D., Panda, O., Mahanti, P., Schroeder, F.C., and Kim, D.H. (2014). Chemosensation of Bacterial Secondary Metabolites Modulates Neuroendocrine Signaling and Behavior of C. elegans. Cell 159, 267–280. https://doi.org/10.1016/j.c....<br /> 8. Garigan, D., Hsu, A.-L., Fraser, A.G., Kamath, R.S., Ahringer, J., and Kenyon, C. (2002). Genetic analysis of tissue aging in Caenorhabditis elegans: a role for heat-shock factor and bacterial proliferation. Genetics 161, 1101–1112. https://doi.org/10.1093/gen....<br /> 9. Kaletsky, R., Moore, R.S., Vrla, G.D., Parsons, L.R., Gitai, Z., and Murphy, C.T. (2020). C. elegans interprets bacterial non-coding RNAs to learn pathogenic avoidance. Nature 586, 445–451. https://doi.org/10.1038/s41....<br /> 10. Moore, R.S., Kaletsky, R., Lesnik, C., Cota, V., Blackman, E., Parsons, L.R., Gitai, Z., and Murphy, C.T. (2021). The role of the Cer1 transposon in horizontal transfer of transgenerational memory. Cell 184, 4697-4712.e18. https://doi.org/10.1016/j.c....<br /> 11. Sengupta, T., St. Ange, J., Kaletsky, R., Moore, R.S., Seto, R.J., Marogi, J., Myhrvold, C., Gitai, Z., and Murphy, C.T. (2024). A natural bacterial pathogen of C. elegans uses a small RNA to induce transgenerational inheritance of learned avoidance. PLOS Genet. 20, e1011178. https://doi.org/10.1371/jou....
On 2024-06-07 13:43:51, user marodon wrote:
Great job in line with works from other teams. May I suggest that the authors include two publications related to the subject in their discussion? <br /> Midavaine É, Moraes BC, Benitez J, Rodriguez SR, Braz JM, Kochhar NP, Eckalbar WL, Domingos AI, Pintar JE, Basbaum AI, Kashem SW. 2024. Regulatory T cell-derived enkephalin imparts pregnancy-induced analgesia. doi:10.1101/2024.05.11.593442<br /> Aubert N, Purcarea M, Fornier M, Cagnet L, Naturel M, Casrouge A, Dietrich G, Dieu-Nosjean M-C, Marodon G. 2024. Enkephalin-mediated modulation of basal somatic sensitivity by regulatory T cells in mice. eLife 13. doi:10.7554/eLife.91359.1<br /> Some other omments:<br /> -p3 Treg cells restrain exacerbated activation of peripheral neurons during early during inflammatory challenge<br /> -p6 CarboxypeptidaseE (Cpe) has been shown to process proenkephalin (Hook VYH, Eiden LE, Brownstein MJ. 1982. A carboxypeptidase processing enzyme for enkephalin precursors. Nature 295:341–342. doi:10.1038/295341a0)<br /> -Ref 50 is incomplete
On 2024-06-07 03:54:29, user Mohamed Hoballa wrote:
This preprint has been reviewed and published under the DOI: https://doi.org/10.30491/ja...
On 2024-06-06 17:27:56, user Prof. T. K. Wood wrote:
The first TA system found to inhibit phage was Hok/Sok in 1996 (that makes it seminal). So 26 years before retrons (your ref 47) and 25 years before ToxIN (your ref 48), Hok/Sok set the precedent of stopping phage by interpreting a phage process (transcription shutoff), rather than reacting to a specific phage protein. Curious as to why this discovery does not merit citation.
On 2024-06-06 12:01:12, user Elli wrote:
I am unable to see the suplementary tables the preprint refers to, where can I find these?
On 2024-06-06 12:00:30, user Elli wrote:
I am unable to see the supplementary tables the preprint refers to, where can I find these?
On 2024-06-06 09:51:33, user Asaf Levy wrote:
The paper is now published following peer review:<br /> https://academic.oup.com/is...<br /> Please cite this one.
Asaf Levy
On 2024-06-06 05:37:37, user Brian Junglen Jr wrote:
Can you please advise on the appropriate sample size required for a research study to conclusively determine the correlation between the spider gene and its impact on the snake's equilibrium?
On 2024-06-05 13:08:01, user Simon wrote:
This is an interesting analysis. I have two short comments/suggestions.
First, I wonder why authors made the more extreme Gly mutations for the binding site removal instead of the more conservative Ala mutations. Because of the special role of Glycine the quality of the input MSA is probably a lot worse for Gly instead of Ala mutations.
Second, I think authors should also report RMSD/pLDDT/PAE for the predicted structures itself and not just the ligand. Since AF3 performs the combined objective of structure prediction and docking mutation of the input has consequences for both objectives. It might be that it performs worse for docking because the overall quality of the structure prediction is reduced.
We've looked into the related problem of metal-protein interaction and there AF3 does a bit better to capture realistic physicochemical effects: https://x.com/simonduerr/st...
On 2024-06-05 07:04:18, user Si Hoffmann wrote:
The revised version of this article is published in Autophagy Reports.<br /> "Highlighting the hidden: monitoring the avidity-driven association of a fluorescent GABARAP tandem with microtubules in living cells"<br /> https://doi.org/10.1080/276...
On 2024-06-04 17:49:18, user phillip kyriakakis wrote:
Cool paper!
A few thoughts:
1) It would be great to see how this compares to the PhyB-PIF version<br /> 2) Blue light should activate PhyB/PhyA, it would be great to see different blue light doses to see how sensitive it is to blue light, not if it is sensitive to blue light. (See "Multi-chromatic control of mammalian gene expression and signaling" and "Multichromatic Control of Signaling Pathways in Mammalian Cells")<br /> 3) I am not sure what biological replicates means. Where three independent experiments done, or just three biological replicates, one experiment? If a single experiment, this should be made explicit and perhaps written as N = 1.<br /> 4) PhyA could be written as PhyA-NT instead of delta. Delta implies it is a knock out or something. Peter Quail used the "NT" notation and that has been used a lot since, so it would be easy for others to follow. <br /> 5) What are the effects of far-red light, perhaps with and without blue light? (See "Multi-chromatic control of mammalian gene expression and signaling" and "Multichromatic Control of Signaling Pathways in Mammalian Cells")<br /> 6) Would be nice to see blue and red systems multiplexed. Perhaps using DRE as in "Efficient photoactivatable Dre recombinase for cell type-specific spatiotemporal control of genome engineering in the mouse"
I am not suggesting these experiments or changes are needed to be published, but could improve the usefulness.
On 2024-06-04 07:43:30, user Wolfram Klapper wrote:
Excellent work! Congratulations! I wonder if you have checked the interdependence of HLA-I and EBV association and the effect on the microenvironment. Our own data show that TARC is a major driver and HLA-I is also an independent factor that associated with microenvironment features (see: https://onlinelibrary.wiley...<br /> Regards Wolfram
On 2024-06-03 17:49:15, user Joseph Wade wrote:
The following is a review compiled by graduate students participating in the Infectious Disease Journal Club, Department of Biomedical Sciences, University at Albany, SUNY:
This paper addresses differences in bacterial, archaeal, and fungal microbiomes within certain body sites as a function of pregnancy status. Prior to this work, changes in the maternal bacterial, archaeal, and fungal microbiomes in body sites other than the vaginal cavity and gut were poorly understood. The authors characterize the oral, urinary, stool, and vaginal microbiomes, and the urinary metabolome of non-pregnant, as well as pre- and postpartum women. They conclude that the microbiome of the oral cavity quickly rebounds after birth, whereas the vaginal microbiome takes longer to return to its pre-pregnancy state. The authors also conclude that the archaeal content of the oral microbiome correlates strongly with pregnancy status. We feel that most of the conclusions put forth in the paper are well supported. However, we have concerns about conclusions involving archaeal microbiome differences, and we have suggestions for changes in data presentation that may improve clarity.
Major Comments
Minor Comments
Suggestion for a Future Experiment
A further experiment may include collection of stool samples postpartum as well to look at multiple time-points postpartum. It would be particularly interesting to include later postpartum samples to observe how long it takes to return to the prepregnancy microbiome in each body site.
On 2024-06-03 17:29:27, user Joseph Wade wrote:
The following is a review compiled by graduate students participating in the Infectious Disease Journal Club, Department of Biomedical Sciences, University at Albany, SUNY:
This manuscript looks at the role of the TofI/R and QsmR regulators on virulence in Burkholderia glumae. Previous work suggested that TofI/R was the dominant regulator over QsmR in B. glumae quorum sensing. Here, the authors identify independent roles of TofI/R, distinct from QsmR, and suggest a regulatory effect of QsmR on TofI/R. Moreover, the authors conclude that the QsmR variant T50K substantially reduces B. glumae virulence. The conclusions regarding the hierarchy of TofI/R and QsmR are generally well-supported across multiple independent assays, although there are some inconsistencies between the RT-qPCR and the RNA-seq data. The conclusions regarding the importance of the genotype of qsmR rely heavily on control data that are not shown; in the absence of these data, it is impossible to draw a strong conclusion on the contribution of qsmR to virulence.
Major Comments
Minor Comments
Suggestion for a Future Experiment
Are strain phenotypes specific to the species of rice being used in experiments, i.e., is the hypervirulent strain more of a generalist whereas the “wild-type” strain is a specific pathogen for this rice species?
On 2024-06-03 08:51:10, user Texugo wrote:
Can I have access to the raw data ?
On 2024-05-31 18:55:39, user Julio Neto wrote:
Could you provide additional references that support the adverse outcomes of metaplasia in endothelial cells and the transformation of these cells to have connective and contractile properties? Also, I'd like to know if the relaxation of endothelium-dependent from isolated blood vessels is impaired in hypertensive animals. What are the basal blood pressure values of these awake animals? Are SOX-2 and KLF-4 transcription factors related to pluripotent-induced stem cells so, among these, how play a major role in determining endothelial drive instead of other cell types? (cardiac, for example). Preliminary data presented here could be from the transcriptome of single-cell RNA, which led to the sequence of the study. Lastly, I suggest reducing the range of graphs in Figure 6 (e.g., U46619 from 30 pM to 10 µM) to generate the best fit Hill sigmoid with more reliable efficacy and potency values. Congratulations and good luck!
Mark Johanson. Can your boss read your work messages? BBC, February 2022. URL: https://www.bbc.com/worklife/article/20210813-are-your-work-messages-as-private-as-you-think (visited on 2023-12-06).
Mark Johanson in this source as a main idea states that the messages employees send and receive on company work devices are always very accessible and monitored by their employers. Employees overall need to be very cautious when using their work devices for personal use. One key detail that Johanson mentions is that particular workplace platforms like Slack and Microsoft Teams often allow companies that use them to closely monitor their employees by allowing them to record and keep track of employees' activities and messages.
On 2024-05-30 23:46:19, user Clashing_titans wrote:
Cogent, clear, well-written and an interesting piece to the Legionella effector story:<br /> Chadha et al should be proud of this work!
On 2024-05-30 19:17:48, user Sharath Tippur Narayana Iyenga wrote:
Hi,<br /> Interesting work for rapid separation and detection of bacteria from blood. However, the 2nd step of ''Selective cell lysis'' is used from the work which is already published and has a patent approval in progress. This original work has not been cited in this pre-print. This has to be added in the original paper before publishing. It is highly important to properly cite the original paper if their method is utilized in another work. The original paper citation details is below:
Narayana Iyengar S, Dietvorst J, Ferrer-Vilanova A, Guirado G, Muñoz-Berbel X, Russom A. Toward Rapid Detection of Viable Bacteria in Whole Blood for Early Sepsis Diagnostics and Susceptibility Testing. ACS Sens. 2021 Sep 24;6(9):3357-3366. doi: 10.1021/acssensors.1c01219. Epub 2021 Aug 19. PMID: 34410700; PMCID: PMC8477386.
On 2024-05-30 17:30:49, user Pawan wrote:
Where is the supplementary material of this paper?
On 2024-05-30 16:57:13, user sanalkumar rajendran wrote:
Dear Authors, this quite interesting and great effort to bring published HiChip work in one single platform. We, Riggi lab has published couple of articles in sarcoma models which includes HiChIP profiling from relevant cell lines, mesenchymal stem cells and specific oncogene knock-down condition. It would be nice to have those datasets also included in the Loop Catalogue. <br /> 1. Nature Communications volume 13, Article number: 2267 (2022). https://www.nature.com/arti...<br /> 2. SCIENCE ADVANCES, 31 Mar 2023, Vol 9, Issue 13, DOI: 10.1126/sciadv.abo3789<br /> Thanks
On 2024-05-30 16:51:25, user Djo Hasan wrote:
Dear authors of the article, entitled: “Molecular Mimicry as a Mechanism of Viral Immune Evasion and Autoimmunity” (https://doi.org/10.1101/202....
Thank you for sharing this very interesting article.
In this article, you stated that “Molecular mimicry explains portions of the multiple sclerosis auto-antibodyome”. I suggest that you should take the findings of Martins, et al. (2023) [1] into consideration. These authors pointed out that although the amount of antigenic sharing between hosts and both pathogenic and non-pathogenic parasites and bacteria is massive, molecular mimicry by itself is not a sufficient factor to disrupt intact self-tolerance mechanisms.
In this context, in my recent paper (https://www.aimspress.com/a... [2], I provided the missing link between molecular mimicry and the activation of autoimmune responses. I figured out that activation of the purinergic P2X7R expressed on regulatory T cells is potentially required for molecular mimicry to activate autoimmune responses. This occurs only after repeated or high-dose microbe infection and not after a single low-dose infection. I also presented a novel model of immune responses in mammals to foreign antigens, self-antigens and antigens with molecular mimicry.
I hope that these comments will help to improve the quality of your paper.
Kind regards,<br /> Djo Hasan
References
On 2024-05-30 10:18:07, user Prof. T. K. Wood wrote:
Again, growth on methane was achieved by reversing methanogenesis in 2016 by obtaining active Mcr for the first time in a pure culture (ref 20), so the Introduction remains misleading (line 48, 'in their natural state') and line 323 is misleading:
"...ANME-1 MCR may allow Methanosarcina to perform AOM (20 )." We used multiple lines of evidence to demonstrate growth in 2016 and subsequent papers converted methane to lactate and even created a microbial fuel cell using methane, hence both uncited works again confirm active Mcr so it is not appropriate to write "may allow" growth. Should the field refer to all of your results as "may be' valid?
Moreover, in effect, the recombinant strain we produced was the way Nature created ANME, according to your work here (by altering Mcr) so our work is relevant to your report here as validation of this study, and the Introduction in this second version is still misleading.
On 2024-05-26 21:40:46, user Prof. T. K. Wood wrote:
Line 47: this statement is false: "Though there is not yet strong evidence that backwards carbon flow can be coupled to growth in either methanogens or ANME,.." as ref 20 was seminal in reversing methanogenesis in a methanogen by cloning Mcr and showing growth for the first time on methane in the engineered methanogen.
On 2024-05-30 09:18:41, user Sam Calis wrote:
Is there list of the peptides identified with the subtiligase biotin-assay availlable somewhere?
On 2024-05-30 05:42:05, user cong wrote:
We are trying to install Nanomotif in our server. We tried all of the install methods, and the major install looks good. However, when we tried nanomotif MTase-linker install, the following error was shown. It seems that module 'snakemake' had some issues. We then checked the 'snakemake' install and found we had snakemake==8.12.0. Is there any method to solve the problem for MTase-linker install?
Thank you very much!
$ nanomotif MTase-linker install<br /> /home/miniconda3/envs/nanomotif/lib/python3.12/site-packages/nanomotif/mtase_linker/setup.smk<br /> Traceback (most recent call last):<br /> File "/home/miniconda3/envs/nanomotif/bin/nanomotif", line 10, in <module><br /> sys.exit(main())<br /> ^^^^^^<br /> File "/home/miniconda3/envs/nanomotif/lib/python3.12/site-packages/nanomotif/main.py", line 513, in main<br /> mtase_linker(args)<br /> File "/home/miniconda3/envs/nanomotif/lib/python3.12/site-packages/nanomotif/main.py", line 475, in mtase_linker<br /> snakemake_create_environments(args)<br /> File "/home/miniconda3/envs/nanomotif/lib/python3.12/site-packages/nanomotif/mtase_linker/dependencies.py", line 24, in snakemake_create_environments<br /> status = snakemake.snakemake(snakefile,<br /> ^^^^^^^^^^^^^^^^^^^<br /> AttributeError: module 'snakemake' has no attribute 'snakemake'
On 2024-05-02 21:22:33, user Alex Crits-Christoph wrote:
Nanomotif looks like a fine tool, especially for metagenomics, and I have no doubt it will push the prokaryotic methylation nanopore field further!
I was curious if you would be able to benchmark it more, as the benchmark presented in Fig 1C is quite limited in scope, and could be expanded. We have shared R10.4.1 data for a variety of microbes that you might be interested in benchmarking on, include some with paired PacBio data in REBASE (which is not ground truth, but a good comparision):
aws s3 cp --recursive s3://cultivarium-sequencing/MICROBEMOD-DATA-NOV2023/mapped_bams/ .
aws s3 cp --recursive s3://cultivarium-sequencing/MICROBEMOD-DATA-NOV2023/reference_genomes/ .
aws s3 cp --recursive s3://cultivarium-sequencing/MICROBEMOD-DATA-NOV2023/pod5/ .
It is also worth noting that the comparison to MicrobeMod is a bit limited due to the reason that you note here: "The low motif recall of MicrobeMod, at high coverage and high motif occurrence settings, primarily stems from identification of similar motifs that are not identical to the benchmarking motif, e.g. SNGAm6TC instead of GAm6T".
Despite this, overall my sense is very that nanomotif's motif calling will be likely superior in many circumstances to STREME in the context of prokaryotic methylation. Probably the best way to evaluate methylation motifs would be with some manual inspection after running multiple tools (and parameters).
On 2024-05-30 05:18:38, user Severin Lechner wrote:
Thanks for looking into the downstream effects of HDAC inhibitors in various cells and on several levels.
It would be interesting to compare the results to recently published data on proteomics and phosphoproteomics response to a broad panel of HDAC inhibitors, such as: <br /> - Decrypting lysine deacetylase inhibitor action and protein modifications by dose-resolved proteomics, Cell Rep. 2024<br /> - Decrypting the molecular basis of cellular drug phenotypes by dose-resolved expression proteomics, Nat Biotech. 2024
Further, the Abexinostat selectivity data in the main text lacks a reference. The statement also does not fully agree with the recently updated target selectivity landscape of HDAC inhibitors, where Abexinostat is shown to bind HDAC10 and the off-target MBLAC2 with substantially higher affinity than HDAC1: <br /> - Target deconvolution of HDAC pharmacopoeia reveals MBLAC2 as common off-target, 2022. Nat Chem Bio
On 2024-05-29 13:09:14, user Alex Crits-Christoph wrote:
KrakenUniq reports the coverage ("breadth of coverage", the percentage of the reference genome that is covered by sequencing reads) of each reference genome that may be present in the sample. Breadth information is a key way of determining true positive from false positive hits in metagenomics: almost all false positives are characterized by low breadth of coverage, as in these cases, reads only mapped to a fraction of the reference.
The authors should report coverage from KrakenUniq for their analyses; only counts are provided in the supplementary, but coverage values would be more informative for determining whether a microbial genome is present in a sample. For a brief discussion of this see:
https://instrain.readthedoc...
Further, the authors could then consider employing a minimum breadth cutoff to further separate true from false positives.
Finally the authors could also consider comparing to approaches that incorporate breadth automatically, such as:
https://github.com/bluenote...<br /> https://sourmash.readthedoc...<br /> https://instrain.readthedoc...
On 2024-05-29 08:20:26, user Alexey Belogurov Jr. wrote:
Manuscript has been published Chernov AS, Rodionov MV, Kazakov VA, Ivanova KA, Meshcheryakov FA, Kudriaeva AA, Gabibov AG, Telegin GB, Belogurov AA Jr. CCR5/CXCR3 antagonist TAK-779 prevents diffuse alveolar damage of the lung in the murine model of the acute respiratory distress syndrome. Front Pharmacol. 2024 Feb 21;15:1351655. doi: 10.3389/fphar.2024.1351655. PMID: 38449806; PMCID: PMC10915062.
On 2024-05-29 07:40:40, user PengLong li wrote:
Dear professor Bahlburg,
Hello. I'm very sorry to bother you in your busy schedule.
My name is Penglong Li, and I am a master's student at Dalian Ocean University in China. I have been focusing on the analysis of Antarctic krill resources using echogram images, a topic that greatly interests me. I recently came across your paper titled "An open and lightweight method to analyze the vertical distribution of pelagic organisms using echogram screenshots," which has been immensely inspiring for my research.
I am currently attempting to replicate the methodology presented in your paper. However, I have encountered some difficulties, particularly with accessing the source code. The link provided in your paper (https://sandbox.zenodo.org/... appears to be inactive.
I would be extremely grateful if you could share the echogram color matching program and other source code mentioned in the paper. Having access to these resources would greatly assist me in my research and help me better understand and apply your methods.
Regardless of your decision, I wish you the very best. Thank you for your time and consideration. Your help would be immensely appreciated, and I am deeply grateful for any assistance you can provide.
Wishing you good health and continued success in your work.
Best regards,<br /> li.pen.long0506@gmail.com<br /> Penglong Li<br /> Dalian Ocean University
On 2024-05-29 06:50:45, user theNiessingLabs wrote:
The authors show in Figures 3 - 4 and in Table 2 in silico-docking studies with an alphafold2-model of PURA as template. In this model, PUR-repeat III is shown as a monomer with an awkward-looking fold. The authors use this docking to suggest a direct interaction between PURA and GLUT1. <br /> Unfortunately, the authors seem to ignore that PUR repeats do not exist as single, monomeric repeats but require dimerization. For repeat III of Drosophila PURA, a high-resolution structure of its homodimeric domain has been reported already in 2016:<br /> https://elifesciences.org/a...<br /> PDB-ID: 5FGO<br /> For repeat III of the human PURA (as used in this study), more recently the homodimeric high-resolution domain structure has also been published:<br /> https://elifesciences.org/a...<br /> PDB-ID: 8CHW<br /> Considering these experimental structures, Figures 3-4 and Table 2 refer to unphysiological folds. As a result, conclusions drawn from these figures have to be considered as entirely wrong.
On 2024-05-28 03:20:10, user Samuel W. James wrote:
As a specialist in earthworm phylogenetics and taxonomy, I would really like to see an expanded taxon set within earthworms, including several cases where aquatic to terrestrial (and back) habitat shifts have taken place. There are even some where earthworms have colonized marine shore habitats. My colleague Christer Erseus who works on non-earthworm clitellates could also make some intelligent suggestions for future work on lineages that have transitioned from fresh to marine water environments or vice versa, as well as aquatic / terrestrial shifts. <br /> Nevertheless, terrestrial soils are basically aquatic environments, in that earthworms and Enchytraeidae ( and the soil-dwelling polychaete Hrabiella (I think) depend on free water and water films on soil particles and their body surfaces.
On 2024-05-25 13:05:40, user Leando Cruz wrote:
Very intersting work. I would like to know the opinion of the author on the paper "Modulation of alpha-synuclein phase separation by biomolecules", since the authors were the first to propose the formation of biomolecular condensates of the protein mediated by spermine
On 2024-05-24 11:13:50, user Marcelo R. S. Briones wrote:
This paper was peer reviewed and published (May 27, 2024) in the journal "Viruses" https://www.mdpi.com/1999-4...
On 2024-05-22 17:31:24, user lf wrote:
A version of this paper is now published in the journal Epigenetic at the following link https://www.tandfonline.com...
On 2024-05-22 15:01:07, user Donald R. Forsdyke wrote:
The authors cite a paper in PLOS Biology that was first posted as a preprint paper here in bioRxiv see Johri et al. 2021. The four comments I added to the Johri preprint paper have now been updated, noting the intriguing new k-mer analysis of Roberts and Josephs (2024).
On 2024-05-22 14:43:59, user Donald R. Forsdyke wrote:
The SSRN preprint mentioned previously (see four comments) has now (2024) been formally published under the same ("three historians") title in Theory in Biosciences (143(1): 1-26). One of the three (William J. Provine) having died in 2015, I now sadly report the passing of Mark Boyer Adams (May 9th, 2024). The paper included the work of the remaining historian (myself). This built on the DNA studies of Erwin Chargaff and my k-mer and nucleic structure analyses.
The formally published final version of Johri et al. is available in PLOS Biology. Their admonition to "carefully define ... underlying uncertainties" has resurfaced regarding "Lewontin's paradox." Citing this, Roberts and Josephs have posted a new bioRxiv preprint (May 19th 2024) entitled: "Previously unmeasured genetic diversity explains part of Lewontin’s paradox in a k-mer-based meta-analysis of 112 plant species" (see: Roberts and Josephs 2024).
On 2024-05-22 06:46:04, user Marc RobinsonRechavi wrote:
In the methods, you write<br /> "HDF5 files with the approximations for each organism are available on FigShare at https://figshare.com/accoun...."
But the figshare link doesn't work :(
On 2024-05-21 11:13:03, user dirkfaltin wrote:
Interesting paper. However, I'm afraid you are mixing up a lot of concepts that should be kept separate. Ethnonyms like Goths, Langobards and Frisians are political terms. They are not biological categories. Terms like "Wielbark Goths" (847) are entirely nonsensical. We simply don't know how the people of the Wielbark culture identified or were identified by others. Most likely they had never heard the name Goths and were not called so by outsiders. The name Goths appears only later in an entirely different region. We also don't know of the earlier "Gutans" had anything to do with the Wielbark-people or the later historical Goths. If you investigate the remains of a person buried in a cemetary that may have belonged to the Langobards, you still don't know how the individual identified whose DNA you extracted. Historians have been very careful to workout the problems that arise from mixing up ethnic/political terminology with archaeology. This paper revives the old mistakes by mixing up ethnic/political terms with archaeological material culture and biology.
On 2024-03-22 13:47:09, user Georg wrote:
As for the identification of the so-called East Scandinavian cluster associated with the I1 Y haplogroup, conclusions about the Baltic source are premature - the isolated autosomal complex is characteristic of groups of hunter-gatherers found from the Mesolithic Iron Gates, Neolithic Northern Germany ostorf003 and possibly EastBaltic
On 2024-05-20 00:22:12, user Alexis Rohou wrote:
I was asked to review a version of the manuscript for a journal. Below are my comments to the authors.
In this manuscript Shub and colleagues present MIC, a new tool for the analysis of three-dimensional macromolecular structures obtained using x-ray diffraction or cryogenic electron microscopy (cryoEM). Given an atomic model featuring water molecules and/or ions, and the corresponding 3D map data, MIC automatically labels each putative water and/or ion location with a guess water or ion identity.
Thanks to improvements in cryoEM instrumentation and data analysis, 3D maps can now frequently be obtained at resolutions better than 2.7Å, so that the problem of correctly labeling small map features as either water or ion presents itself more frequently to practictioners, myself included. In that context the availability of a well-characterized, open-source and highly performant classifier of ion/water density features is timely and most welcome.
I found the manuscript to be well written, the description of the method and how it was tested clear (though as a non-expert I had trouble following the description of the network architecture and of the feature attribution methodology), and the results convincing. Most questions that arose as I was reading early parts of the manuscript (e.g. regarding the influence of slight errors in modeling of protein atoms on the labeling of ions/water) were answered in later parts. I only have minor feedback & suggestions for the authors and otherwise am supportive of publication.
Here's the feedback I have:<br /> - lines 47-48: Perhaps... but I wonder if the authors are aware of Ravera et al (Nature, 2022)... and there may be a few other reports I'm unaware of myself... I wonder whether a radial average profile could be used as part of the fingerprint in future versions of MIC to improve the quality of the labeling by the network. Perhaps the authors could comment (in the discussion?) about whether incorporating experimental map features could be possible in future work?<br /> - lines 189-190: "this simple metric showed statistically significant separation between<br /> test set predictions that agreed and disagreed with the deposited PBD label": I found this sentence confusing at first, and still do to an extent. To me the syntax did not convey the meaning of the figure unambiguously. To spell it out: <br /> -- My understanding on first reading was: when a site lands near a boundary (i.e. the model is uncertain), the model's prediction tends to disagree with the deposited PDB label. Doesn't that mean that if the user gets a result that is assigned low confidence, they should actually assume that the identity assigned by MIC is wrong? That would seem to be problematic... wouldn't it?<br /> -- Having reviewed Fig 2e, I now think the text was a bit confusing. My interpretation of the figure: at low confidence scores, say around 0.5, it's only slighlty more likely than not that there's a disagreement with the PDB; this is more in line with the behavior I would have hoped for... i.e. when there's uncertainty, it's a close call - not necessarily was the wrong label given...<br /> - line 213: "The revised overall test set accuracy following manual annotation is 83.3%". This is impressive. How will this translate to lower-resolution structures, where there will be more error in atom positions... I am thinking back to the fact that they authors found that fingerprinting worked best when using very fine shells... Perhaps this should be discussed somewhere [I think this is touched on in the paragraph ending line 269]<br /> - line 269: Right. That touches on my earlier question. When you get to the ~3Å range, unless you happen to have your coordinating side chains modeled really well, MIC is going to be quite prone to error. [I still think this topic of accuracy as a function of resolution should be returned to in the discussion]<br /> - line 432: "MIC achieves incredible accuracy". Hah! I think the authors should aim for the readers to actually believe the claimed accuracy, and it is unhelpful to characterize the accuracy as "incredible". I found the manuscript credible overall ;)<br /> - line 495-498: "limiting all calculated (...) to be identity agnostic" - I don't understand this. Might be worth spelling things out for non-specialists like myself<br /> - line 512: "non/prune-fifp" I think should be "non-prune/fifp"<br /> - line 513: "prune-eifp" I think should be "prune/eifp"
Alexis Rohou<br /> May 2024
On 2024-05-16 13:44:41, user Jiri Hulcr wrote:
Nice article, we are hoping that we could use the genome sequence for our current work. <br /> I would recommend that the authors do not replicate the standard adage of how we have to study this beetle because it is a pest that is difficult to control. There are piles of literature on this topic, including two comprehensive compendia by the Forest Service, dedicated to the biology and management of this species. Foresters know very well how to manage forests to avoid outbreaks of the Southern pine beetle. There is a multi-state program for monitoring the population of the species, and predicting its local outbreaks. Case in point - the beetle was pretty much eradicated from the state of Texas, which is presumably why the authors had to use material from Mississippi. <br /> Studying genetics in order to "kill the pest" seems mistargeted. We know nearly all bark beetle outbreaks are a symptom of excessive stand density, warming climate, or introductions of invasive species, i.e., human-caused. So justifying this great research by the need to control the insects is not very convincing. The many incredible biological features of this insect would make a much more interesting justification.
On 2024-05-15 13:15:57, user Ruben Perez wrote:
This preprint has been published in Virus Evolution (10.1093/ve/veae031). The title has been slightly modified: “Highly pathogenic avian influenza H5N1 virus infections in pinnipeds and seabirds in Uruguay: implications for bird-mammal transmission in South America”.
On 2024-05-14 04:54:31, user Erick Nedd wrote:
Limited Sample Size: In Figure 1A-E, I noticed that only 18 out of the 54 subjects were included in the comparison of biological age versus chronological age in EL subjects. Due to the already limited nature of having a large sample size of centenarians for research studies, it may be more effective to include more participants because having a smaller sample size may limit the generalizability of findings and necessitate caution in applying results to broader populations or conclusions about aging.
Including more controls: In Figure 3 where the forward programming of EL-specific iPSCs into cortical neurons was analyzed, I noticed that there was no control of an established cortical neuron cell line. Including this control, would be helpful in comparing the differences and similarities between the differentiated iPSCs and the cortical neurons, and would further help to confirm the pluripotency of the iPSCs created in this experiment.
Inclusion of Demographic Information: Including the demographic information of centenarians or the countries from which they come from would be helpful in contextualizing the study and understanding the possible influences on biological age. Considering that factors such as, geographical location, lifestyle habits and access to healthcare can all influence the aging process, including the demographic information of participants may illustrate environmental or genetic factors that may lead to exceptional longevity. Furthermore, having iPSCs from diverse populations may lead to more robust findings in that they would better represent the genetic variation across the globe.
Supplemental figures: While the inclusion of the supplemental figures was interesting in seeing the different population of immune cells in centenarians, there was not sufficient information for readers to see how these immune cell populations compared to offspring or their spouses. Having a control of an offsprings’ spouse would help your audience understand how the population of immune cells in centenarians may have lead them to living a longer life, and provide a clearer picture of the role of immune cells in longevity.
On 2024-05-13 11:39:30, user Alice Risely wrote:
This is a great experiment for looking at changes in serum metabolites over migratory stages. This is valuable information. However, it is a shame that the gut microbiome part of the study is only rudimentary - the study would be much stronger if it could link changes to metabolites with gut microbiota variation, which requires measuring the gut microbiota across all stages and using metagenomics or universal primers. As such, I think the 'gut microbiome adaptions' in the title is misleading.
On 2024-05-10 21:05:06, user disqus_gM8nbME1Vj wrote:
In discussion, para 2, 19th line, the author mentioned that the expression of "the induction of Fe uptake related genes such as FRO2, IRT1 was also not compromised in the pye mutant unlike hy5 mutant" and refered to the "Figure S2".<br /> But, in "Figure S2", it appears that FRO2 and IRT1 levels are lower in pye than in hy5 mutant as compared to the WT.
On 2024-05-10 08:11:47, user Stefano Vianello wrote:
Dear Dr. Blotenburg,
I'm Stefano, the author of REF 20 re endoderm-rich gastruloids. In the Discussion section of your manuscript you write that
[REF20] maintained mESCs in 2i-medium and reported faithful emergence of endoderm cells
. Given the importance of mESC culture conditions in your analyses and possible future interpretations (at least, re endoderm), I wanted to point out that — following the practice of the lab I was working in at the time — mESCs were not grown in the classic 2i medium (2i in N2B27), but in fact in a 2i in ES+LIF medium (exact recipe in REF20's Materials & Methods > Cell culture). Based on gastruloid end-phenotype alone (of those shown in FigS1), I would guess this atypical mESCs culture medium is most closely matched by your culture condition 3 (and possibly condition 4), and that those conditions (though they were not selected for scRNAseq) are giving rise to endoderm-rich gastruloids.
Sincerely,<br /> Stefano Vianello
On 2024-05-09 13:09:41, user Peter Ellis wrote:
Fascinating work but it doesn’t complicate the central dogma in any way regardless of what inaccurate textbooks say.
https://www.researchgate.ne...
Crick was quite specific: the central dogma simply says that translation is irreversible.
On 2024-05-09 08:52:36, user Mihail Halachev wrote:
Apologies for the late reply. The variant in the LOXHD1 gene<br /> (as all other enriched variants listed in Tables 1-5) can be found in ClinVar by searching for AlleleID = 176561, rather than by variation ID.
On 2024-05-08 16:54:50, user Jorge Soberon wrote:
Many people have used ellipsoids (Mahalanobis distance) for niche modelling in the past. I think you need to consult, at least:
Farber, O. and Kadmon, R., 2003. Assessment of alternative approaches for bioclimatic modeling with special emphasis on the Mahalanobis distance. Ecological modelling, 160(1-2), pp.115-130.
Jiménez, L., Soberón, J., Christen, J.A. and Soto, D., 2019. On the problem of modeling a fundamental niche from occurrence data. Ecological Modelling, 397, pp.74-83.
Drake, J.M., 2015. Range bagging: a new method for ecological niche modelling from presence-only data. Journal of the Royal Society Interface, 12(107), p.20150086.
Hirzel, A.H., Hausser, J., Chessel, D. and Perrin, N., 2002. Ecological‐niche factor analysis: how to compute habitat‐suitability maps without absence data?. Ecology, 83(7), pp.2027-2036.
On 2024-05-08 12:59:32, user Yuri Pavlov wrote:
"The artifacts of the dataset were removed by the authors while publishing the dataset" statement is false. The data you downloaded are raw EEG data (as stated in the dataset description. All analyses are therefore performed on data containing a lot of eye movement and muscle artifacts making your classification algorithm useless.
On 2024-05-07 17:57:42, user Dimitrius Santiago P. S. F. Gu wrote:
Hi, the manuscript has just been published with open access in the Journal of Sarcopenia, Cachexia and Muscle! Please access https://onlinelibrary.wiley... for the latest version.
On 2024-05-07 17:37:12, user Julian C wrote:
(From the author) To appear as a book chapter in: Ruiz Romero C, Calamia V and Lourido L (Eds), Protein Arrays: Methods and Applications, Electronic ISSN 1940-6029, Print ISSN 1064-3745, Springer Nature.
On 2024-05-07 17:33:00, user Julian C wrote:
(From the corresponding author) To appear in PLOS ONE.
On 2024-05-06 11:02:33, user Roman wrote:
There is already another CRISPR method out there, called CREATE (https://pubmed.ncbi.nlm.nih... so maybe the authors want to pick a different acronym so that readers don't get confused.
On 2024-05-06 08:20:36, user Liheng Luo wrote:
Your work, CRISPR-GPT is groundbreaking, bridging the gap between complex gene-editing technology and researchers from various fields. The potential for accelerating biological discovery is immense, and I’m excited to see its impact on future research. <br /> I am eager to see this technology in action and would greatly appreciate the opportunity to explore a demo of the author’s website. Such hands-on experience would provide invaluable insight into the practical applications of CRISPR-GPT.
On 2024-05-06 08:02:44, user Daniel Guzman Llorens wrote:
Congratulations to the team, it is a great article. I found the results very insightful.<br /> While reading, I seem to have found an error in the insulin intensity histogram in Figure 3, as both A and C seem to be the same histogram.
On 2024-05-04 01:52:43, user priyanka.bajaj3193@gmail.com wrote:
In this study the authors comprehensively examined the mutational effects on PLpro proteolytic activity and stability. The authors have designed a FRET-based assay composed of N-terminal mClover3 donor and C-terminal m-Ruby3 acceptor fluorophores separated by a linker containing the Nsp2/3 PLpro cleavage motif to measure the proteolytic activity of PLpro. From DMS data the authors infer PLpro active site mutations ablates activity. Their study also revealed residues required for cleavage of the Nsp2/3 site, identified features of substrate binding pocket and the sequence requirements of the blocking loop. The authors have given explanations for their observations in the Discussion section. Overall, the paper is supported with follow-up enzymology and crystallography experiments of key residues. The major limitation of this study is leaky expression of mutations can mask clinically relevant mutations that can arise due to viral evolution and might have the potential to evade inhibitor treatment. Study of such mutations can provide more information about the potential escape routes open to the virus to evade developing therapeutics. Moreover, incorporation of statistical analysis could strengthen the confidence in inferences drawn from the deep sequencing data and improve the quality of the manuscript. <br /> The following points can improve the quality of the manuscript:<br /> Major points<br /> 1. In Figure 1f, it is unclear that why is the PLpro activity increasing with increase in inhibitor concentration? Perhaps the Y axis is mislabeled as while inhibitor concentration is increasing, PLpro activity should decrease. However, FRET signal would increase (and maybe should be the axis label), since there will be no cleavage. <br /> 2. Line 175 – 178 - What does 0 represent in the normalized dataset? What is the rationale used for selecting minimum 10 reads in the unselected library as the read cut-off. 10 reads is pretty low cut-off. From the data, it seems the distribution tails off before cut-off chosen for the s.d.- by eye. 0.3 s.d and 20 as read cut-off might be a better option to eliminate sequencing artifacts.<br /> 3. Line 187-190 – What is the number of reads for the mutants that showed lower activity scores? There is a possibility that due to low read cutoff, these mutants might be lying in the range with low reads in the unselected library.<br /> 4. Line 223-224 – Authors mention they find a good correlation between activity and abundance score. Although this is noticeable from the scatter plot but supporting high-throughput data with statistical parameters like pearson correlation coefficient, a metric that provides comparison between 2 datasets will make this data reporting more quantitative and informative.<br /> 5. Line 1340- Figure 3b- What do authors mean by variants with small enough error? Please be precise.<br /> 6. Line 315-319/ Line 1550-1556- Extended data Fig 15c – It is difficult to interpret the inference reported that is based on the data in Extended Fig 15. There is no data reported for Normalized AMC cleavage for Y268W. Interpretation can be more comprehensible by plotting a scatter plot between the Normalized Activity Fitness Scores obtained from DMS data and Normalized AMC cleavage (%). Through this plot, the reader can easily make out the outlier.<br /> 7. Line 364-367 – Authors mention “M208W strikingly increases the protein melting temperature by over 5C, indicating a substantial improvement in thermal stability. Increased stability, and thus reduced turnover in cells, may provide a mechanism to explain leaky expression in our cellular assay and increased yield of recombinant protein for E.coli expression.” Since, leaky expression is a different issue, it is confusing why will leaky expression be a plausible reason for increased stability but less activity? <br /> 8. Since Extended data Fig 11a shows that variants display substantial amount of leaky expression, how have the authors taken this information into account while inferring results from DMS activity scores, especially since they are quantifying at the RNA level and not at the DNA level? Can the activity scores obtained for the mutants be normalized to leaky expression scores in some way, for example by subtracting the scores obtained from the leaky expression dataset in order to measure the true activity of each mutant?<br /> 9. Solvents are known to affect an enzyme’s activity, selectivity and stability. In Figure 5, authors should consider and comment about the role of solvent in understanding the mechanism of Michelis-Menten kinetics of M208 variants using substrates Z-RLRGG-AMC, Ubiquitin-Rhodamine and ISG15-Rhodamine.<br /> Minor points<br /> 1. Figure numbers need to be reformatted. Figure 3 onwards they are incorrectly labelled. For eg. ‘Fig 3’ is labelled as ‘Fig 1’.<br /> 2. Line 426-429 – In Figure 3b, L and R domains of papain should be labelled or highlighted in separate colors for the ease of understanding for the reader.<br /> 3. Overall, different DMS datasets obtained from different assays in the paper have different read cut-offs such as 10, 13 and 18. A consistent statistical logic for obtaining different read cut-offs across different DMS datasets will be helpful. Also, increasing the read cut-off might improve the data quality and minimize sequencing artefacts.
On 2024-05-03 10:36:51, user Samvid Kurlekar wrote:
Really great and useful work and an astounding tour de force - enjoyed reading it!<br /> I was wondering if the authors might please comment on whether the iPT cells expressed significantly higher levels of lncRNAs such as Neat1 or Malat1 when compared to 'normal' PT cells. We have seen these Neat1/Malat1-rich PT cells in our own scRNA-seq dataset (from mice) but were unable to detect HAVCR1 or VCAMI. However, genes associated with VCAM1-positivity were detected and these PT cells (which we called PT Class A) were present in Control kidneys and were seen in situ by RNAScope too. <br /> I would be quite interested to know if the iPT-VCAM1+ population you have comprehensively described matches the PT Class A cells we saw.
On 2024-05-01 23:26:21, user Guei-Sheung Liu wrote:
The article has published in Hum Gene Ther.<br /> Utility of Self-Destructing CRISPR/Cas Constructs for Targeted Gene Editing in the Retina.<br /> Li F, Hung SSC, Mohd Khalid MKN, Wang JH, Chrysostomou V, Wong VHY, Singh V, Wing K, Tu L, Bender JA, Pébay A, King AE, Cook AL, Wong RCB, Bui BV, Hewitt AW, Liu GS.<br /> Hum Gene Ther. 2019 Nov;30(11):1349-1360. doi: 10.1089/hum.2019.021. Epub 2019 Oct 25. PMID: 31373227
On 2024-05-01 23:23:51, user Guei-Sheung Liu wrote:
The article has now publshed in Nucleic Acid Ther.<br /> An Integrative Multi-Omics Analysis Reveals MicroRNA-143 as a Potential Therapeutic to Attenuate Retinal Angiogenesis.<br /> Wang JH, Chuang YF, Chen J, Singh V, Lin FL, Wilson R, Tu L, Ma C, Wong RCB, Wang PY, Zhong J, Hewitt AW, van Wijngaarden P, Dusting GJ, Liu GS.<br /> Nucleic Acid Ther. 2022 Aug;32(4):251-266. doi: 10.1089/nat.2021.0111. Epub 2022 Mar 31. PMID: 35363088
On 2024-05-01 23:21:11, user Guei-Sheung Liu wrote:
The article has now published in Pharmacol Res. 2023 Jan:187:106617. doi: 10.1016/j.phrs.2022.106617. Epub 2022 Dec 16.
On 2024-05-01 17:47:25, user Kevan Shokat wrote:
Fantastic study of the clamping effects of Rocaglamide analogs across the helicase family. I particularly like the different effects of nucleotide and that ATP rather than AMP-PNP can stabilize different helicases as shown in Figure 5F. I wonder if mixtures of ATP and smaller concentrations of AMP-PNP could let helicases work (ATP) and then trap (AMP-PNP). Great study of so many dimensions of this assay! Congratulations!
On 2024-05-01 16:53:49, user Timothy Tomkins wrote:
This manuscript explores the mechanisms involved with decreased immunity due to aging. It does this by looking at the microbiome found within mice at different ages, then looking at increased inflammation utilizing immunoassays. The results show increased innate immunity and inflammatory signals, showing that an older mice’s microbiome acts differently on the TLR signaling system. The manuscript excels on the immunological side; however, the microbiome side of the study lacks quality control and explanation. I would recommend contacting a microbiome expert to get more insight into the field, as there is much missing from this report.
This review focuses on the microbiome side of the report, which has quite a few problems to work on.
Polymerase Chain Reaction (PCR) details are missing, such as the primers used, the polymerase used, and the procedure used, such as the temperature, timing, number of cycles. The PCR is not repeatable based on what is said in the methods. Refer to the paper ‘The Impact of DNA Polymerase and Number of Rounds of Amplification in PCR on 16S rRNA Gene Sequence Data’ at DIO: https:// doi.org/10.1128/mSphere.001....
When sequencing the PCR data, the number of reads per sample is not stated. This is important to know if the coverage of the communities is measured. The authors also do not include the observed number of taxa to compare to the Chao1 numbers to determine coverage. This is shown in Figure 1B, where the chao1 number is very low. The taxa used for this graph is not stated, leaving the reader confused if it is the number of genera, or phyla. The lower number assumes phyla, while genera is the more commonly used in the field and should be in the hundreds. Showing the number of ASVs/OTUs in each sample is a common measure of alpha diversity.
The method to which the sequenced data was sorted is not given. The authors do not state if ASVs or OTU’s were utilized which leads to confusion in the way the dominant taxa were determined. It is also impossible to know if the sequenced data was corrected for 16S copy number, or for variance in genome size. Refer to ‘The Variability of the 16S rRNA Gene in Bacterial Genomes and Its Consequences for Bacterial Community Analyses’ at DIO: https://doi.org/10.1371/jou...
Next are some more minor issues that can be addressed.
At line 340, the instrument and settings for the zirconia beads are not explained.
No reference is given for the CLR method at line 385.
In the statistical analysis, it states that data was rarefied to the minimum library size, but that size is not mentioned.
Figure 1A states P=0.002, however no statistical test is given to get that P.
Figure 1C utilizes the words upregulated and downregulated which are used with expression data. I believe this is abundance of taxonomic groups, so different word choices would be more accurate, such as more or less represented. Further, you don’t know that age caused that, as implied by the phrase “by age.”
Timothy Tomkins, SHSU biomedical student.
On 2024-04-30 20:15:37, user Austin McIlhany wrote:
Fascinating paper both on the topics of cutting edge field of microbiomes and still-ongoing issues of human-caused environmental crises, specifically oil spillages. Here are a few ideas and questions I have that I think could possibly improve this paper:<br /> 1. Since this study focuses on N and P levels and hydrocarbon degradation, then the levels of N and P in the collected seawater need to be quantified.<br /> 2. I understand that it must not be under lab-ready circumstances to extract AND analyze the samples of the artic waters at the same exact location for a more accurate sampling of the microbiome<br /> 3. The levels in the three growth conditions of high, low, and ambient. It would be helpful to list all ingredients and their final concentrations for the three conditions as well.<br /> 4. Perhaps in the future, the use of transposons could also be used to track the genes that correlate with biodegradation of crude oil, and which strains/taxa of bacteria they originate. Making a isolated, pairwise and community could also help narrow it down.<br /> 5. PCR conditions for the V4 amplification should be described.<br /> 6. In the “differential abundance analysis,” were there adjustments made for different 16S copy numbers in different taxa? Different genome sizes? If not, this must be mentioned as a limitation.
the system achieved this training result more than 20 times faster than conventional synchronization methods.
大多数人认为分布式训练由于需要同步和通信,必然比单机训练慢,但作者认为Decoupled DiLoCo比传统同步方法快20倍以上,这挑战了人们对分布式训练速度的固有认知,展示了异步计算的潜力。
chips from different generations running at different speeds still matched the ML performance of single-chip-type training runs, ensuring that even older hardware can meaningfully accelerate AI training.
大多数人认为混合不同代际的硬件进行训练会降低性能或效率,但作者认为即使不同代际、不同速度的芯片混合使用,仍能达到与单一芯片类型训练相同的机器学习性能,这挑战了硬件必须同质化的行业共识。
By dividing large training runs across decoupled 'islands' of compute, with asynchronous data flowing between them, this architecture isolates local disruptions so that other parts of the system can keep learning efficiently.
大多数人认为分布式AI训练需要高度同步和紧密耦合的系统才能保证效率,但作者认为通过解耦的'计算岛屿'架构,即使局部硬件故障,系统其他部分仍能高效学习,因为故障被隔离了。这挑战了传统分布式训练必须保持同步的主流认知。
On 2024-04-30 14:51:04, user Luca Jovine wrote:
Published on 26 April 2024 as:
Elofsson A., Han L., Bianchi E., Wright G. J. & Jovine L.<br /> Deep learning insights into the architecture of the mammalian egg-sperm fusion synapse <br /> eLife 13:RP93131 (2024)<br /> DOI: https://doi.org/10.7554/eLi...<br /> PubMed: https://pubmed.ncbi.nlm.nih...
On 2024-04-29 21:54:07, user Yeshveer Singh wrote:
Final version of this article is published at MPMI. Here is the link: https://doi.org/10.1094/MPM...
On 2024-04-29 15:59:37, user Amber Gonzalez wrote:
Additional comments<br /> Hello! I am a Sam Houston State University graduate student enrolled in a microbiome course, BIOL5394. My overall impression of the manuscript is that it is excellent, and the information presented is helpful for forensic science. <br /> Abstract and Introduction<br /> The introduction is very clear and to the point. Does this study consider where the individual's death occurred, indoors or outdoors? I believe the environment in which a death occurred could alter the microbial community succession and potentially influence your given results. What ethical guidelines were followed when handling the cadavers?<br /> Methods<br /> Quality control <br /> • Need specific PCR protocol, like # cycles, temps, polymerase, etc. https://journals.asm.org/do... <br /> • There is no mention of the correction of the 16S copy number and variances in genome size for taxa identified ASVs. https://journals.plos.org/p... <br /> • Was coverage of communities measured and representatively sampled equally?<br /> o Include coverage measures such as Good’s coverage or Chao1.<br /> • Line 115 explicitly states the protocol for USA samples. What about the samples from Finland and Italy?<br /> • Lines 113-114 mention sections of the dissected internal organs but fail to mention the specific section. Is there a measured area region that was dissected? This could help with consistency in sampling.<br /> DNA Extraction and Sequencing <br /> • Lines 130-131 state the Greengenes database used to assign taxonomy was last updated in May 2013. More accurate identification results would come from a more recently updated 16S gene database.<br /> Statistical analyses<br /> • Good practice to include the complete list of packages and codes used for the analysis.<br /> Results<br /> Figure 3<br /> • PCoA assumes normal distribution of data. Need to show normality test or use NMDS.<br /> Figure 4<br /> • The taxa in this figure show excessive “unknowns.” I believe updating the database could improve this.<br /> Figure 5<br /> • Lines 256-259 mention the findings of ASV family are in class Bacteroidia, however after reviewing I believe the correct class is Betaproteobacteria.<br /> o Bacteroidia, Betaproteobacteria, and Clostidia are color-coded with very similar colors. Consider making the jump to the next class a bit more distinctive.<br /> Additional comments<br /> • The article mentions the sample size was 265, but when I add up the four category sample sizes, I get a sum of 262. Is this intentional, or a typo?<br /> • Of the 20 Finnish cadavers, why was the liver the only organ supplied?<br /> • Overall, it was a very interesting study!
On 2024-04-29 13:34:46, user Oyinoluwa wrote:
Abstract & Introduction
The abstract is good overall and structured well. It gives a clear insight into the concern at hand and summarizes the key findings to show its significance. However, the research question is not clearly stated. This is something that can be elaborated on in the introductions, but it should also be stated briefly in the abstract. I understand that there is not a lot of research done on the effects of pregnancy to the female microbiota, but it is unclear as to what the research question is. This introduction gives a good background on the issue of pregnancy altering the microbiome. Below are my comments on what could be added or further explained.<br /> 1. Are you trying to determine which organisms are lost/recovered?<br /> 2. Is this study for a general understanding of the effects of pregnancy on women (pre/post birth)?<br /> 3. Are you looking at a specific family of bacteria, fungi or archea that has a meaningful change during both phases (pre- and post-maturation) to see their effects? <br /> 4. Are the women from diverse backgrounds (race)?<br /> 5. Was this study conducted in the same location?<br /> 6. Include more previous studies, if any, stating what others have claimed to be the reasons behind “side effects” of pregnancy <br /> 7. Include your own claims on what you would expect and not expect to see.
Figures and Tables
The table heading and description are good and easy to read. However, make sure to explain all abbreviations.<br /> Table 1. <br /> 1. What is the difference between an t-test and a Fishers exact t-test?<br /> 2. What does SS-days mean? <br /> 3. Also explain why each test was used for the p-value result.<br /> Figure 3. <br /> 1. I am not sure what these diagrams represent.<br /> 2. 3B- What is a vaginal community state type? How were they classified? It is stated that software clusters them, but what are the criteria?<br /> 3. 3A- What do the colors represent? Explain the unknown portion? <br /> General comments for figures<br /> Figures captions need to be clear, like in 1C ii) the title is “Rchress.” Is that observed ASVs? Include clear titles for your figures as well as axis labels. References to the figures from the results section show that the figures support the findings. You can include the reasoning behind choosing these graphical analyses. <br /> Methods, Materials & Analysis
Results, Discussion, Conclusion
In the limitations section, it is mentioned that the samples were not collected from the same women before and after pregnancy. Wouldn’t this affect the results you have presented? It is hard to say whether your results and conclusion support the claims which were made due to this aspect of sample collection. Although your results and conclusions are significant to the study, the validity is questionable.
On 2024-04-25 23:14:15, user Michelle Wille wrote:
This is an important study rapidly presenting key findings of sampling for HPAI in the Antarctic region. We have some concerns around the interpretation of the results - we beleive the diagnostic used is excellent at detecting a broad diversity of H5 viruses and is not specific to HPAI H5 and therefore it is unclear whether the authors detected HPAI H5N1 or LPAI H5Nx. A summary of our concerns has been presented here: https://www.preprints.org/m...
On 2024-04-25 07:12:08, user Rafal Mostowy wrote:
Hi, it’s very interesting work! I was wondering if you could make your supplementary material available? I don’t see it posted with the preprint. Thank you
On 2024-04-24 16:37:09, user Q Li wrote:
Please link this preprint to the published paper https://rdcu.be/dFAvb <br /> Thank you!
On 2024-04-23 21:44:35, user Mattia FM Gerli wrote:
The peer reviewed version of this article has been published on Nature Medicine in March 2024 at the following DOI:
On 2024-04-23 17:09:36, user Moira C wrote:
Hello, the Yadav lab has shown data on a protein structurally similar to SLK in humans called TAOK1, I have linked their paper here https://www.science.org/doi.... Do you have any comment on the similarity between these two proteins especially since this other kinase seems to have an I-bar domain as well.
On 2024-04-23 12:36:47, user Alessandro Popoli wrote:
This paper highlights some valuable genetic elements and offers precise quantifications of subtle effects on fruit shape, which are attributed to a single STM autoregulatory element. While it is commendable that such effects have been observed and quantified with apparent robustness, this aspect alone does not compensate for the overall weaknesses of the study.
The significance of this autoactivation in fruit metamorphosis, as discussed, is exaggerated. Techniques such as imaging quantification and single-cell analysis are utilized, yet they seem to function more as ornamental enhancements rather than providing substantial contributions to the core narrative. For instance, the imaging quantification primarily shows proliferation within the stomatal lineages but fails to delve deeper into the overall growth mechanisms influencing fruit shape. Additionally, the single-cell analysis appears to be inadequately executed in several aspects.
A thorough reporting and discussion on the robustness of observations involving transgenic lines, such as GUS reporters, inducible lines, and mutants, is sorely missing. This is crucial, especially considering the minimal phenotypical effects of the cis-regulatory element under investigation. A detailed analysis is needed to ascertain whether the observed effects are indeed significant or simply artifacts stemming from genetic background noise.
Lastly, the selection analysis presented in Supplementary Figure 26 is conceptually flawed and should be reconsidered. The approach of segregating sequences with and without the binding site (BS) before analysis is fundamentally problematic. Selecting species that carry the BS and then asserting high conservation within this group compared to others is tautological and compromises the scientific integrity of the findings.
On 2024-04-23 10:07:33, user AngelPerezDiz wrote:
The final version of this manuscript has been published in Molecular Ecology journal:
Diz, A.P., & Skibinski, D.O.F. (2024). Patterns of admixture and introgression in a mosaic Mytilus galloprovincialis and Mytilus edulis hybrid zone in SW England. Molecular Ecology, 33, e17233. https://doi.org/10.1111/mec...
On 2024-04-23 07:19:50, user Rashidul Islam wrote:
This manuscript has been officially published in the British Journal of Cancer. We therefore kindly request to review the final published version of the manuscript.
Here is the paper:<br /> Islam, R., Heyer, J., Figura, M. et al. T cells in testicular germ cell tumors: new evidence of fundamental contributions by rare subsets. Br J Cancer (2024). https://doi.org/10.1038/s41...
On 2024-04-19 10:09:16, user RG wrote:
Fascinating analysis & great dataset.
The question of PIE aside, which is a complex social and linguistic matter, there is in fact clear evidence of movement from the Balkan route into Anatolia in in fact clear and unequivocal, despite the claims expressed in this study.
The presence of I2a-L699 in Yassitepe (Lazaridis 2023), and its persistence into the Iron Age is clear testament to this. Contra to the analysis offered in L. et al (2023), that lineage is not a Balkan lineage - missing in all pre Bronze Age samples (Mathieson 2015, Penske 2023, Lazaridis 2023)- but from further north, esp the Dnipro valley, and more proximately Cernavoda C.
This establishes links between southeastern Europe and Anatolia, and exposes the limitations of inferences limited to one particular qpAdm set up.
It also supports the view supported by most linguists- that proto-anatolians arrived via the Balkans (without excluding more complex scenarios entailing convergence).
On 2024-04-18 19:38:40, user Rishav Mitra wrote:
Summary:<br /> Transglutaminase 2 (TG2) is a GTP binding/ protein-crosslinking enzyme with therapeutic potential in various conditions such as cancers, Celiac disease, and neurological disorders. TG2 is thought to have two major conformational states, an inactive GTP-bound closed state and a crosslinking-active Ca2+-bound open state. Other groups have previously reported X-ray structures of TG2 that reveal the structural basis for the regulation of transamidation activity by GTP/GDP and Ca2+. Although these studies have suggested that guanine nucleotides and Ca2+ allosterically regulate TG2 activity by inducing global conformational changes, direct evidence for conformational transitions has been lacking so far. The authors of this paper have previously shown that a small-molecule inhibitor, TTGM 5826, inhibits the protein crosslinking activity of TG2 by stabilizing the open conformation. Interestingly, TTGM 5826 prevented the growth of cancer cells which led the authors to conclude that the open conformation is cytotoxic. Therefore, locking TG2 in the open state by small molecules could lead to new therapeutic strategies. <br /> In this study, the authors have investigated how the binding of guanine nucleotides, calcium, and small-molecule inhibitors affects the open and closed conformational states of TG2 using small- angle X-ray scattering (SAXS) and single-particle cryoelectron microscopy (cryo-EM). Additionally, they focused on the discovery of improved small molecule inhibitors compared to TTGM 5826. The major success of this paper is the finding that TG2 can undergo a reversible conformational transition in solution between closed and open states under physiological GTP and Ca2+ concentrations. In addition, the authors have found a new conformational state inhibitor, LM11, that is more potent than TTGM 5826, although the evidence to support the connection between drug potency and TG2 conformational specificity in cells is weak. The authors show that the LM11-bound state has a different conformation from the Ca2+-bound open state. The major weakness of this paper is the lack of mechanistic information to explain the potency of LM11. Hopefully further structural studies will provide further details on the conformational changes induced by LM11 and other inhibitors. <br /> Major points:
In Figure 3D, the authors explained the different conformations between WT and the R580K mutant under GTP conditions by Kratky plots and fitting using CRYSOL. A Kratky plot normalized by Rg may be a better way to discuss the conformations since normalized Kratky plots emphasize conformational differences. In such a plot the weak shoulder in around q = 0.15Å-1 of “open dimer”, which likely comes from the dimer conformation's symmetry, can then be emphasized and discussed.<br /> In the text regarding Figure 4, the authors mentioned 3DFSC but it is not provided in the figures. 3DFSC is one of most important plots in cryo-EM analysis to verify directional resolution and density isotropy. <br /> In Figure 4A, the authors said that the homology model generated from TG3 was an excellent fit for the map under Ca2+ conditions. Considering Figure S2, the fit looks excellent certainly. But it was just a visual evaluation, and quantitative scores to validate the degree of fitness like the Q score should be provided.<br /> In the text mentioning Figure 4B, the authors said “a homology model of TG2 bound to Ca2+ at the three conserved binding sites and found that it was in good agreement with the cryo-EM map”. However, this sentence does not seem to match the figure because Figure 4B shows the calcium-binding sites and the related residues in the model, not including the cryo-EM map. Therefore, we suggest that Figure S2 which shows how the calcium-binding sites fit the map is included in Figure 4 instead of Figure 4B.<br /> In Figure 4, SAXS and Cryo-EM under Ca2+ conditions showed different conformations based on each protein concentration. Do you have information about the concentration of TG2 in human cells and how this relates to regulation? <br /> The authors explained that TG2 R580K mutant forms higher-order oligomers at lower Ca2+ concentrations compared to WT TG2 from Figure 4. However, at this stage, proof that WT TG2 forms higher-order oligomers seems to be only the I(0) value of the red SAXS profile in Figure 4C. In addition, since the profile is well-fitted to the calculated open-dimer profile, readers might not notice the increased I(0) value. Figure S7B looks like a more direct proof of WT TG2 higher-order oligomers under Ca2+ conditions. Therefore, we suggest that Figure S7B is included in Figure 4 or is mentioned in the text related to Figure 4.<br /> In general, SAXS has technical limitations in confirming the presence of oligomeric species due to the possibility of non-specific aggregates, precipitates, and buffer components scattering at low q values. Addressing these sources of low q scattering either through explicit mention in the text or furnishing more direct evidence of the TG2 oligomers may enhance the strength of the claims.<br /> The authors mention that using 3 μM TG2 in cryo-EM made it possible to capture monomeric TG2. The SAXS experiments required higher concentrations (25 μM) for sufficient signal. Given the importance of TG2 dimers in this study, the authors might consider measuring the affinity constant for self-association to confirm that the stoichiometry (homodimer/monomer) in the different experiments is indeed what they expect based on the solution behavior of TG2.<br /> Can the authors explain the significance of the differences in fluorescence emission at each arrow point for no drug vs. LM11 treatment in the BODIPY-GTP binding assays in Figure 5A?<br /> Some discussion regarding the limitations in using two cell lines that possibly differ in expression levels of genes other than TG2, membrane permeability, metabolic activities etc. to assess LM11 potency, can align the conclusions more closely with the data.
Minor points:
Table S2 is not mentioned in the text. <br /> In Figure 3D, it is better to describe what concentration of GTP the experimental curves have clearly. Certainly, we can read those based on the values of Rg in Figures 2 and 3B but that’s a bit unfriendly.<br /> There seems to be a typo in the text of Figure 4C. “yellow, see Figure S3C” looks like the correct text because Figure 3C does not include SAXS profiles.<br /> Figures 2 and 3 can be combined to make it easier for the reader to compare between TG2 WT and R580K.<br /> The term “saturated conformational state” in the legend for Figure 3B is not meaningful.<br /> Are the % cell viability data for LM11 and TTGM 5826 normalized to vehicle control?
Reviewed by Hiroki Yamamura, Rishav Mitra, and James Fraser (UCSF)
On 2024-04-18 19:30:24, user KL wrote:
Very interesting paper, however I have a concern about Fig 2B. Specifically, your Male/Female assignments are inconsistent between the two plots - see the line of 4 people above the alpha/beta main cluster? In the left panel they are F, M, F, M, while in the right panel they are all female. This is true of other date points between the two panels, just providing one example. The left plot also does not appear to contain any white males or females, despite them being included in the legend, though I think I see the X-with-box symbol in the right panel in a few places (pink, purple, orange).
On 2024-04-18 11:32:12, user Karyn Esser wrote:
I want to note that due to some computer problems in the lab we have lost a significant amount of the real time bioiluminescence recordings for the PER2:LUC tissue clock results reported. As such, we are not confident moving forward with peer review. Thus, we will be repeating and expanding this study moving forward. Karyn Esser
On 2024-04-18 00:42:18, user CommunityScientist wrote:
Work would benefit greatly from a mutation of other zinc fingers and data to suggest there is no DNA binding occurring. Furthermore, I am alarmed by figure 3 as this is not the correct way to report replicates in SMT experiments, arising doubt surrounding the analysis and significance. Figure 4E needs explanation as to why the values overlap yet are shown to be statistically significant. I do not believe the correct statistical tests were used.
On 2024-04-17 20:01:01, user Christopher Hart wrote:
It's great that the authors have put together a manuscript that aims to generate data on an important but often ignored question in cell biology on a neglected clade. I have a few questions regarding their methods listed below, where I could not replicate or understand their choices.
If I'm reading the methods correctly the authors have used two sets of primers to amplify two transcripts from cDNA: PAPYR_7259 (P7) and PAPYR_8006 (P8). They then clone these into an expression vector to generate antibodies that they've used for some IF and a pulldown. <br /> Importantly PAPYR_7259 has several strong interpro domains corresponding to subunits of ubiquitin activating E1 domains that each hit 4-5 different genes, so the antibody specificity will be dependent on which epitopes were available in the expression vector and their antigenicity. In an effort to understand whether the authors have used a truncated protein with just the SFA domains or the whole protein including the ubiquitin interacting domains I looked for primer binding sites within each gene. I BLASTed the primers against the genome, and found binding sites for the PAPYR_7259 Fwd/Rev primers that would amplify a region from 232645 - 233620 within the genome that is near the start/stop codons of 232642 - 240693. This suggests that they are taking nearly the whole protein including the N-term Ubiquitin activating E1 domains, could the authors confirm this is the case? As for PAPYR_8006 the Fwd primer bind in the region of 147480, however I was entirely unable to find a hit by BLASTn for the listed reverse primer (GCTAGCGGCCGCATGGGTGATGACGTGGAGGCCGTCCTG) against any Paratrimastix genome in Genbank. It’s possible that the authors are using their own genome sequence, however this should be included as data within the paper and should be acknowledged in their methods. It may also be that the authors are using this primer to do a Gibson assembly so we would expect it to be less homologous to the paratrimastix pyriformis genome, however this is not explained in the methods either, and the 6-8bp 5’ non-homologous regions of the other primers suggests to me that this is simple enzyme cloning, and can all be located by BLAST. Could the authors please double check that the sequence in the text is correct and double check where it binds, and which genome version they’re using?<br /> The authors also mention that they validated their antibodies by Western Blot, however the data is not present in the paper, it would be excellent to include that data, even if it’s just as a supplemental figure. <br /> The authors then conduct expansion and Immunofluorescent microscopy to localize the SFAs within this unique organism. While expansion produces very pretty images, the authors do not include non-expanded cells, and given the difficulties of working with expanded cells and how little is known about Paratrimastix sp. it is important that the authors also show any data that they might have to show the same binding pattern is similar in non-expanded cells. I know too in our lab we've had difficulties getting DAPI/hoescht to work well with expansion but no issues with regular IF, so that inclusion would be great. Notably too the authors do not show P7 IF staining, it would be good to look at the localization of both SFAs, not just one, and this may be simpler to do in non-expanded cells.
On 2024-04-16 19:58:42, user Marie-Alda Gilles-Gonzalez wrote:
The much higher affinities you report do not agree with the Wayne model of Mtb. How did you purify your DosT and DosS proteins? Since you are impugning our work, and it does matter very much how the proteins are purified, you should provide information on this. Were your DosT and DosS fusion proteins? Were they tagged? If so, how and where?
On 2024-04-15 08:03:17, user Kazuhito Tabata wrote:
Your reports have been very interesting. The improved efficiency of PURE synthesis is an important finding for the future of synthetic biology and would be an interesting topic for the field of materials production. In this paper you discuss the effect of molecular crowders, but we also tested the effect of TMAO and betaine.
https://pubs.acs.org/doi/fu...
We also tested the effect of TMAO and betaine and found that 100mM or 1M was not as effective, but 0.4M improved protein synthesis by about 2 times. I am very happy to see that the results are the same as what you tested. I am also very interested to see if the conditions we found will further improve your result.
On 2024-04-12 18:10:47, user Luis E. Gimenez wrote:
Regarding Figure 1B, it is incorrect to calculate arithmetic averages for EC50 values, even more so to show scatter measures on an arithmetic scale, given that EC50 values do not typically follow a Gaussian distribution. Instead, The authors should show pEC50 values and apply one-way ANOVA to the transformed data.
On 2024-04-12 16:31:13, user Hisashi Tanaka wrote:
The manuscript has been published online in Nucleic Acids Research Cancer.<br /> https://academic.oup.com/na...
On 2024-04-12 16:25:56, user Lori Passmore wrote:
COMMENTS FROM PASSMORE LAB JOURNAL CLUB:
In this manuscript the authors show how LEA proteins can improve protein behaviour in cryoEM. This has an advantage over using detergents such as CHAPSO, because the target protein concentration can remain lower. It seems like this would be a straightforward method to implement for challenging specimens and therefore should be of broad interest.
We would find it helpful if the authors could provide more methodological detail in the manuscript, especially given it is a methods-based paper. For example, when was LEA added to the samples? What concentration was the stock solution of LEA? Is glycerol necessary for LEA protein stability?
The manuscript would be strengthened by investigation into the mechanistic basis of how LEA proteins improve particle quality. The authors hypothesize that LEA coats the air-water interface and could further investigate this. The orientation bias of the samples in this study suggests that the sample proteins are still interacting with an interface. Tomography could help explain these.
It would also be interesting to know if the authors attempted to reconstruct crosslinked PRC2 in the absence of LEA (as a control, instead of comparing to other laboratories' work).
On 2024-04-12 15:15:07, user Alaina wrote:
I really enjoyed reading this paper. Very exciting results! I am wondering how the results differed between the cultured genomes and the MAGs? MAGs only represent a population average of a genome, lacking that individual-level genome variability which defenses tend to exhibit. Were the results different between MAGs and cultured genomes? Also if available, I'd recommend including SAGs as well to recover that variability / microdiversity.
On 2024-04-12 14:54:46, user Rumiana Dimova wrote:
The manuscript was published: https://doi.org/10.1002/adv...<br /> A. Mangiarotti, M. Aleksanyan, M. Siri, T.-W. Sun, R. Lipowsky, R. Dimova, Photoswitchable Endocytosis of Biomolecular Condensates in Giant Vesicles. Adv. Sci. 2024, 2309864.
On 2024-04-10 13:58:54, user Shelly Peyton wrote:
I teach a professional development course for graduate<br /> students, and we reviewed your paper last week. We loved it! As part of the class, we are providing comments as reviewers, which I've compiled here, and we hope you find them useful!
Introduction and Abstract:<br /> Strengths:<br /> - good summary of current work in the field, well motivated
Potential improvement:<br /> -Could be more clear to introduce cell migration first then explain the impact of the ECM on these processes which is a smoother lead in to the research question. Right now it jumps from ECM to migration back to ECM and reads as choppy and disjointed.
Methodology:<br /> Strengths:<br /> -Thorough throughout, providing replicable description of the work , culturing, and data analysis
Potential Improvement: <br /> -We wanted the same level of detail in the experimental methods as was given in<br /> the cell culture.
Results:<br /> Strengths:<br /> -Easy to follow. Great figures, well organized.
Potential Improvements:<br /> -We suggest moving figure 1a-b to a separate figure.
-It would be more useful to consider cell averages across more replicates. Some experiments only had N=1 biological replicates, which we only found in the legends - these would be appreciated on the figures themselves in cases where we were comparing between groups (figure 3a control and b2-KO, e.g.).<br /> -Sufficient replicates were not always performed to make robust statistical comparisons.
Conclusions:<br /> Strengths:<br /> -explained why they did what they did
-compared their work to previous work
-nice summary flow (first sentence is what was their goal, followed by some<br /> background, etc,)
Potential Improvement: <br /> -would help clarity to refer to their own figures in the conclusions. So it wasn’t always clear if statements were being made to prior work or the work done in this paper.
-Conclusions could use some clarity in writing - Some sentences are confusing (line 377-379).
Amazon is investing $5 billion in Anthropic today, with up to an additional $20 billion in the future. This builds on the $8 billion Amazon has previously invested.
大多数人认为科技巨头对AI公司的投资通常在数亿级别,但Amazon对Anthropic的总投资可能高达330亿美元,这远超行业共识。这种规模的投资表明科技巨头对AI基础设施的重视程度和投入规模正在以前所未有的方式增长,可能重塑AI行业的资本结构和竞争动态。
Claude remains the only frontier AI model available to customers on all three of the world's largest cloud platforms: AWS (Bedrock), Google Cloud (Vertex AI), and Microsoft Azure (Foundry).
大多数人认为AI模型通常会与单一云平台深度绑定,形成生态系统锁定,但Claude同时出现在三大云平台上,这挑战了AI行业平台绑定策略的主流认知。这种多平台策略可能预示着AI模型提供商正寻求更大的市场覆盖和避免单一平台依赖,改变行业竞争格局。
Anthropic will also use incremental capacity for Claude in Amazon Bedrock. The agreement includes expansion of inference in Asia and Europe to better serve Claude's growing international customer base.
大多数人认为AI模型主要在美国市场发展,但Anthropic明确表示正在大力扩展亚洲和欧洲市场,这挑战了AI服务主要集中在美国的共识。这种全球扩张速度表明AI市场的地理分布正在迅速多元化,可能重塑全球AI产业格局。
Our run-rate revenue has now surpassed $30 billion, up from approximately $9 billion at the end of 2025.
大多数人认为AI公司仍处于烧钱阶段,难以实现盈利,但Anthropic的收入在短短几个月内增长了三倍多,达到300亿美元的年化收入。这一惊人的增长速度挑战了AI行业普遍亏损的共识,表明AI模型商业化可能比预期更快、规模更大。
On 2024-04-09 07:36:42, user Gabriel Munar-Delgado wrote:
We want to congratulate the authors for this manuscript addressing what we think is a very interesting and relevant topic. The dataset is impressive, the methods are outstanding, and the results are robust and relevant.
However, in our opinion, the manuscript does not fully clarify whether environmental similarity between relatives affects phenotypic heritability versus phenotypic heritability estimates of the animal model. This clarification is crucial for interpretation of the results obtained by anyone fitting similar models.
In other words, are the estimates after accounting for environmental similarity the 'correct' values for the trait’s heritability (implying that otherwise, they would be overestimated, and environmental similarity only affects heritability estimates but not heritability per se)? Or, when accounting for environmental similarity, do heritability estimates reflect the heritability after controlling for environmental inheritance (i.e., environmental similarity does affect heritability and its effects are statically removed when fitted in the model, resulting in an underestimation of total heritability)?
We believe that this topic could be better addressed, by referring to recent theoretical work presented in Munar-Delgado et al. 2023 (https://doi.org/10.1111/204.... Here we showed how heritability is affected by environmental similarity only when the environment itself is somehow inherited and affects the phenotypic trait via phenotypic plasticity. In such a scenario, the total heritability of the trait is the sum of the direct heritability (the inherited basis for the phenotypic trait) plus the indirect heritability (the direct inherited basis for the focal environment, proportional to the square of the strength of phenotypic plasticity). Thus, accounting for environmental similarity in the animal model statically removes those indirect effects. Both heritability estimates (when not accounting for environmental similarity and when doing so) are statistically 'correct' (unbiased) estimates. However, they do reflect different things biologically, and not considering this can bias their interpretation.
As a side note, we think that the effect of environmental inheritance on the heritability of the phenotypic trait has the same outcome when the environment is genetically inherited (in the ms mentioned as "If it results from a genetically mediated breeding environment choice, then this could actually be considered part of the 'genetic' heritability of the trait") and when it is non-genetically inherited (in the ms mentioned as "by assuming similarity in the environments used by individuals is driven purely by non-genetic"). Animal models estimate the proportion of the variation in the phenotype transmitted across generations. This variation can be both genetically and non-genetically transmitted. In this context, it might be helpful to talk about 'inclusive heritability' (Danchin and Wagner, 2010 - https://doi.org/10.1111/j.1... when referring to the heritability potentially affected by environmental similarity, which can be both genetically and non-genetically inherited (this includes environmental inheritance via limited dispersal).
Overall, we would state that environmental similarity does increase heritability of the phenotypic trait if it is affected by a heritable environment (unlike the title of the ms that states that it decreases heritability).
Once again, congratulations on your work, and we are happy to discuss this further if you wish.
Gabriel Munar-Delgado & Pim Edelaar
On 2024-04-09 07:23:04, user Julien Roux wrote:
Thanks for this useful benchmark!
In the introduction you wrote "In the supervised category, gene set enrichment methods like xCell, MCP-counter, and SaVant can be included. However, these methods use an enrichment-based approach and output enrichment scores that can only be compared within samples, which limits their application for inter-sample comparisons". <br /> Regarding xCell this seems to be contradictory to what the authors claim, see notably their Github page https://github.com/dviraran... (section "Notes for correct usage": "xCell produces enrichment scores, not percentages. It is not a deconvolution method, but an enrichment method. That means that the main usage is for comparing across samples, not across cell types.")
On 2024-04-09 01:06:43, user Shelly Peyton wrote:
I teach a professional development course for graduate students, and we reviewed your paper last week. We loved it! As part of the class, we are providing comments as reviewers, which I've compiled here, and we hope you find them useful!
Introduction and Abstract:<br /> Strengths:<br /> - great illustrations of the two possibilities of how leader and follower cells could be mechanically organized. <br /> - simple, concise and clear language in the abstract + intro<br /> - minimal jargon in abstract<br /> - good summary of current work in the field
Potential improvement:<br /> -Should define Rac1 in the intro
Methodology:<br /> Strengths:<br /> Very clear what they were doing and why.
Potential Improvement: <br /> Too descriptive in explaining simulation functions. This information could be moved to the supplement.
Results:<br /> Strengths:
Straight forward system to explain the results, easy to follow. Great figures, well organized.
Potential Improvements:
A lot of the equations being put in the results, when it’s already in the methodologies. Can remove these to simplify the paper.
Conclusions:<br /> Strengths:<br /> Conclusions correctly respond to the hypothesis of whether leader cells actually direct migration and answers that asymmetric forces generated leads to migration.
Potential Improvement: <br /> Maybe highlight the results again and connect it to some speculation.
additional comments:
Loved the figures! Figure 1 in particular was helpful. Liked that you stayed away from red and green. Figure 5 was a little busy but the rest were nicely organized and clear. Great experimental design!
On 2024-04-08 08:07:16, user Max Shinn wrote:
Let's take time to thank the developers of Scanpy and Seurat. These packages are both incredible endeavours that took lots of time, energy, and passion to pull off. Open source scientific software is hard to fund and even harder to maintain over the course of years. It's not just the code that makes it hard - even more difficult than the initial code release is writing clear documentation, tracking down bugs, interacting with the community, designing ergonomic APIs (and maintaining the old non-ergonomic ones), and fixing regressions as the Python/R ecosystem changes. Scientific progress depends on the people willing to do ALL of these things, despite the fact that few (if any) are paper-worthy, and are not valued in career progression decisions, funding, etc. The authors of Scanpy and Seurat have really gone the extra mile to make sure we researchers have great tools to use, and I hope people will join me in thanking them for their efforts that our work depends on!
On 2024-04-05 20:31:38, user Samir Khleif wrote:
Congrats! i am very happy to see this wonderful manuscript which confirms the findings we published in Verma et al, Nat Imm, 2019. These are very important findings in identifying a resistance mechanism for anti-PD1. Similar to what we reported, this manuscript confirms the following:
In addition to what the authors showed in this manuscript, we also demonstrated that Priming of CD8 T cells with vaccines prevent the induction of these CD38hi cells
Accordingly, we believe that such findings presented in both papers would further strengthen the design of clinical trials to overcome anti-PD1 resistance
On 2024-03-04 18:23:27, user Bilikere Dwarakanath wrote:
It is increasingly becoming clear that resistance to Immune Checkpoint Blockade (ICB) can compromise the efficacy of cancer therapy at large. This has compelled the need to understand mechanisms underlying ICB resistance so that effective therapy can be designed to overcome ICB resistance. In this direction, the pioneering work of Dr. Khleif’s lab showing the role of CD38+PD1+CD8 T cells in ICB resistance was a landmark contribution (Ref #17 of this communication). Using elegantly designed pre-clinical studies (with mouse TC-1 and melanoma tumor models) as well as clinical samples (melanoma patients; pre- and post-therapy) they convincingly established the role of CD38 (high)PD1+CD8 T cells in ICB. This submission by Or-Yam Revach et al., (Dr. Jenkin’s Lab at Harvard Medical School) reinforces the importance of CD38+PD1+CD8 T cells in ICB resistance with CD38 as a marker of exhaustion. These two findings are expected to stimulate further efforts on developing approaches to overcome ICB resistance.
On 2024-04-05 17:40:42, user Adrianna San Roman wrote:
The graduate students of the Duke University Human Genetics course reviewed this pre-print as an assignment. A group of student editors synthesized the individual reviews into this PreReview. We hope that the authors and readers of this paper will find our comments useful!
Introduction <br /> The paper, “Complete chromosome 21 centromere sequences from a Down syndrome family reveal size asymmetry and differences in kinetochore attachment,” delves into the role of centromere structure and epigenetic features of chromosome 21 (chr21) in contributing to Trisomy 21 (T21). Trisomy 21, clinically known as Down syndrome, is the most common autosomal chromosomal aneuploidy in humans, which is caused by the presence of an entire extra chromosome 21 in the affected individual. While there are multiple ways this syndrome can be inherited, the most common path is a nondisjunction of chromosomes during maternal meiosis I (MI) due to an error in segregation of chromosomes. Centromeres are crucial for the correct segregation of chromosomes during meiosis; thus, understanding their role and how their characteristics might contribute to nondisjunction of chromosome 21 is a current gap in knowledge.
The authors hypothesized that genetic and epigenetic variation at the centromere of chromosome 21 can act as risk factors for chromosome 21 nondisjunction. Previously, centromeres sequences were inaccessible using short-read sequencing technologies. To overcome this limitation, the authors employed a variety of sequencing methods including Pacific Biosciences (PacBio) high-fidelity (HiFi) long read sequencing and ultra-long Oxford Nanopore Technologies (UL-ONT) along with ChIP-seq. Utilizing these technologies, the team sequenced and assembled centromeres from a parent-child trio, where the child, diagnosed with Down syndrome, exhibits three distinct chromosome 21 centromere haplotypes with significant size differences. Finally, the centromere variations in the T21 family were compared to a population sampling of 35 completely sequenced chromosome 21 centromeres from diverse ancestry, which revealed unique features of T21 centromeres, especially size asymmetry and epigenetic differences. The authors concluded that these findings suggest an impairment in the kinetochore formation that can lead to nondisjunction and T21; therefore, providing insights into Down syndrome’s molecular mechanism and emphasizing the importance of centromeric structure in chromosomal stability.
Main Limitations<br /> The authors acknowledged several major limitations of the study, including the sampling of only one proband-parent trio and the exclusive use of transformed lymphoblastoid cell lines. Here, we elaborate on the significance of these limitations and introduce additional limitations for consideration by the authors.
1) The sequencing of only one parent-proband trio is a major limitation of the study, given the heterogeneity in higher order repeat (HOR) array length and centromere dip region (CDR) methylation pattern found among the 35 previously assembled chromosome 21 centromeres. Although the results did show that the HOR array of one of the proband's maternally inherited chromosomes was significantly shorter than any HOR array from the control human population, it still cannot be assumed from one parent-child trio that this unusually short length or asymmetry in the mother increases the risk of nondisjunction and trisomy 21. The paternal sequencing data also showed centromere asymmetry, to a lesser extent than that of the mother, and without data from more trios, we are still left with the question of whether paternal asymmetry can also contribute to nondisjunction risk. Furthermore, some individuals, such as HG03710 in Figure 3C, also exhibit centromere HOR asymmetry and differential CDR methylation patterns across chromosome 21 centromere haplotypes. Thus, with the current data, it is difficult to distinguish between normal variation and variation associated with trisomy 21.
Sampling only one trio is accompanied by yet another limitation specific to trisomy 21 – the mother’s age at conception was 29, which is not representative of the increased risk of trisomy 21 at maternal ages greater than 35.
Finally, the of sampling only one trio, while very informative of the most common type of meiotic error leading to trisomy 21 (meiosis I, maternal), does not necessarily explain the mechanism by which other meiotic errors lead to trisomy 21. To make a well-supported conclusion about what genetic factors confer risk for trisomy 21, more parent-child trios would need to be analyzed. While we acknowledge the costs of long-read sequencing and the resources needed to carry it out, obtaining the sequencing data of just one or two additional trios could potentially provide more confidence that these epigenetic differences and asymmetry are conserved across cases of trisomy 21 and contribute to nondisjunction.
2) The authors of the study extracted DNA from transformed lymphoblastoid cell lines rather than primary tissue material collected from the individuals. There is currently limited evidence on the genomic and epigenomic stability of these cells at the centromere. Repeating the analysis on DNA taken from primary culture, if possible, could bring certainty to the fact that the observed genetic and epigenetic features are associated with nondisjunction/trisomy 21, and not with the EBV transformation of these cells, for example. A broader analysis across cell types in the future could also remove epigenetic differences between cell lines as confounding variables.
3) While the authors extensively characterized the centromeres of chromosome 21 in one case of trisomy 21 and identified variations in size, methylation patterns, and CENP-A enrichment, they did not directly demonstrate the functional significance of these differences in promoting chromosome 21 nondisjunction.
To address this limitation, the authors could perform functional assays using cell lines or animal models to assess the impact of altered centromere structure and epigenetics on chromosome segregation and the occurrence of trisomy 21. These additional experiments would strengthen the study's conclusions and provide deeper insights into the mechanisms underlying trisomy 21. However, we understand that these kinds of functional experiments may not be the focus of the research group that carried out the study, and other research groups or collaborators may choose to complement their findings with functional experiments.
4) Although the title of the paper claims that the sequencing of the chromosome 21 centromeres revealed “differences in kinetochore attachment”, there is no functional evidence of differences in kinetochore attachment provided in the paper. At several points throughout the manuscript the authors use more speculative language to refer to what can be gleaned about the kinetochore from their epigenetic results. For example, in the abstract: “these epigenetic signatures suggest less competent kinetochore attachment” and when referring to the CDR on p. 5, “the likely site of kinetochore attachment”, or on p. 7 “thought to define the site of kinetochore attachment”. We recommend that the authors either remove this from the title, incorporate uncertainty into the title, or add additional experiments to the paper that would provide evidence for differences in kinetochore attachment. For example, ChIP-seq for other kinetochore proteins could bolster this claim.
Minor Limitations<br /> While the paper mentioned several major limitations, there are also some minor limitations that we found relevant to the paper. Minor limitations include recommendations for improved clarity and figure presentation.
1) A brief statement elucidating the significance of the AluY retrotransposon insertion highlighted in the text would add clarity to its relevance.
2) Furnishing more details about the controls, such as their geographic origin and diversity, would strengthen the study. We infer that the abbreviations in parenthesis next to the sample names in figure 4 refers to ancestry information, but it would be helpful to add these abbreviations in the figure legend.
3) The large size of the pedigree in Figure 1 made it challenging to discern the epigenetic profiles and heatmaps due to their small size; enlarging these elements or providing clearer delineation could address this issue.
4) Integrating portions of supplemental figures 2 and 5, which compare the proband to the parents, as additional panels in the main figures, would emphasize differences in methylation patterns and CDR more effectively.
5) Figures featuring numerous colors or intricate details, such as figures 2 and 3, could benefit from additional textual labeling or zooming in on key regions of interest to enhance comprehension. It would have been beneficial to strengthen the evolutionary significance portion of their article. Centromeres are complex genomic regions subject to unique evolutionary forces, including concerted evolution, which can lead to rapid turnover and homogenization of repetitive sequences. The evolutionary history of α-satellite HORs may involve intricate processes that are not fully captured by sequence divergence analyses alone. Without additional comparative genomic analyses or experimental validation, it is challenging to accurately infer the evolutionary age of specific α-satellite HORs. While sequence divergence can provide insights into the evolutionary history of genomic regions, it may not always accurately reflect the age of a particular sequence due to factors such as selective pressures, genetic drift, and genomic rearrangements. Therefore, relying solely on sequence identity plots to infer evolutionary age may oversimplify the evolutionary dynamics of α-satellite HORs.
6) In the methods, the authors state that the proband had a mosaic karyotype, and provide the same karyotype information that is given on the Coriell repository website for the cell line. Did the authors perform their own validation of the karyotypes of the trio in their cell line aliquots at a passage close to what they used for their experiments? It would be useful for the authors to comment on how the 58% of cells with the translocated chromosome 21 and 22 in the proband might impact their results, if at all.
Significance<br /> The paper reports significant technical advancements in the study of centromere structure and epigenetics, particularly within the context of trisomy 21 (Down syndrome). Utilizing long-read sequencing technology PacBio HiFi and UL-ONT, combined with ChIP-Seq, the researchers comprehensively examined centromere size and epigenetic differences, overcoming previous limitations associated with conventional methods. This approach not only facilitated the resolution of complex repetitive regions like centromeres but also enabled the integration of genetic sequencing with epigenetic profiling, providing a holistic understanding of centromere biology.
In the broader context of human genetic disorders, the findings of this study offer novel insights into the role of centromere structure and function in the prevalence of Down syndrome. By highlighting the potential contribution of centromere size variability and epigenetic differences to the risk of chromosome nondisjunction, the paper opens new avenues for understanding molecular mechanisms of nondisjunction events, with implications for other aneuploidies beyond Down syndrome. Moreover, further exploration of centromere size variability and epigenetic differences could lead to advancements in diagnostic and therapeutic strategies for genetic disorders, ultimately improving patient outcomes and healthcare practices.
On 2024-04-05 16:12:43, user Mike White wrote:
This paper is now published in the February 2024 Issue of Genome Research at https://genome.cshlp.org/co....
On 2024-04-05 07:43:17, user Giorgio Cattoretti wrote:
Efforts at improving data meaningful data extraction from spatial hyperplexed proteomics are sorely needed and meritorious and this work fall just into this effort.<br /> The results however are not satisfactory to this observer’s eye.<br /> Taking into account that heat maps can be deceiving (doi.org/10.1038/s41590-021-...:hd0LiwxhxpZXJPGM2sSoP5ETPSQ "doi.org/10.1038/s41590-021-01006-z)"), looking at your Fig. 5C it seems to me that the evidence that the problem is only marginally solved is:<br /> - SMA in lane 15 (Endo): endothelium CD31+ CD14- VIM+ should be SMA-, while you do not have SMA in the stromal clusters, where it should be.<br /> - Macrophages (lane 14) are generally CD20-, except for signal bleeding from adjacent C B cells. And, for what is worth a heat map, CD4 signs should be stronger than CD3.<br /> - CD8 vanished<br /> Your “PD1+ B cells” are probably TCF1+ CD3+ CD4+ T follicular helper cells.<br /> As per the smart strategy to use of a plausibility score from a priori knowledge, the only example I do know of usable markers are PAX5 for B cells, CD3 and CD8 for T cells and CD163 for macrophages.<br /> Maybe one can add CD14, although it has been described on cDC2 and B1 cells.<br /> Everything else is shared by more than one cell type (experience on ~80 markers). <br /> CD68 is Macs + pDC, your CD68 clone, KP1, labels also neutrophils, CD20 is on some T cells, CD31 abundantly labels Macs, etc. etc.<br /> As per your table S1, CD31 labels T cells (doi: 10.3389/fimmu.2019.02434 ), CD20 and CD68 mutual exclusivity is emptied by your cluster 14 data.<br /> Plausibility score should therefore be based on maybe 3-4 hypothetical mutual exclusion.<br /> But dimensionality reduction algorithms are much better at that.<br /> I believe that the problem is somewhere else in the analytical pipeline: data processing.<br /> We developed a pipeline, BRAQUE (Dall’Olio, L.; Bolognesi, M.; Borghesi, S.; Cattoretti, G.; Castellani, G. BRAQUE: Bayesian Reduction for Amplified Quantization in UMAP Embedding. Entropy 2023, 25, 354. https://doi.org/10.3390/e25... in which data pre-processing has a major effect in separating clusters, to be further classified. We found (ms in preparation) that endothelial cells can effortlessly be separated from SMA+ fibroblasts. The “doublets” of CD4 and CD8 are minimized (see Table 2). All this without any of the processing you developed with STARLING. Imagine by combining BRAQUE with STARLING! <br /> Our data are available in the public domain and can be shared for a focused collaboration.<br /> While I do congratulate for the effort and long-standing work in the field, I hope that my observations will further improve the experience in the field. Best
On 2024-04-04 17:09:33, user Steve Gwynne wrote:
Pretty much sums up the Human Overshoot Conundrum with the added need of a cultural revolution.
I've been working on the cultural dimension for some time now and I have reached the conclusion that what is needed is a transition from the growth imperative to the balance imperative.
This accords with the panarchy cycle in terms of shifting from the growth stage to the conservation phase.
https://passel2.unl.edu/vie....
It accords with the necessary transition from a r-selected strategy to a k-selected strategy. It accords with the maximum power principle in that the goal of evolutionary system design is to optimise the balance between the rate of energy transfer with efficiency of energy transfer which means optimising the balance between force functions, resilience functions, adaptability functions and reproductive functions. In other words, maximising survival potential.
https://www.ecologycenter.u...
Finally the transition from the growth imperative to the balance imperative accords with the need for the human species to balance with Earth systems and in particular balance human activity with the natural carbon, oxygen, nitrogen, phosphorus and water cycles to ensure healthy and resilient functioning of these cycles.
It is of course, natural cycle disequilibrium that typifies human ecological overshoot with the exponential growth of high entropy waste associated with an exponentially growing human abiotic environment which cannot be assimilated naturally by nonhuman biotic and abiotic systems.
Therefore I propose that the Post Growth cultural revolution be predicated on the balance imperative with the understanding that nonhuman associated ecological growth needs to be balanced with the human biotic and abiotic enterprise. And that this is a zero sum game between the k-selected strategy and the current r-selected strategy.
I think the meme of 'Post Growth' is more relevant than the meme of Degrowth although degrowth can be seen as sub category of Post Growth. I think Post Growth is more relevant because it better describes what is actually occurring within the panarchy cycle and is therefore more relatable in terms of public education and public discourse in terms of explaining actually existing dynamics regarding human societies hitting per capita limits to economic abiotic growth and human societies hitting per capita ecological carrying capacity limits.
I would suggest limits to economic growth is indelibly linked to breaching carrying capacity limits but further research is needed to qualify that. This hypothesis suggests that capitalism is responsive to both ecological scarcity and ecological carrying capacity breaches through the price mechanism and should be considered as part of the suite of educational tools to inform the public exactly what is going on beyond the false growth narrative being disseminated by politicians, think tanks, the media and business leaders.
Similarly, the capitalist state system does have resilience mechanisms by which economic contraction can be absorbed to some degree. I feel we need to utilise these systems rather than throw the baby out with the bath water.
By educating the public at the same time as leaning on the resilience functions embedded within the state capitalist system, we can help coordinate temporary and long lasting solutions to permanent per capita economic contraction by rerouting energy and material throughput as necessary. Therefore rather than a solely bottom up approach, I think we also need to utilise current top down systems to facilitate bottom up participatory approaches in order to try and create a win win mutualist strategy. This would include allowing maladaptive state capitalist functions to perish.
Thus rather than using post growth dynamics to reject the state capitalist system which I think will make our shared future even more daunting, I suggest we use the state capitalist system to provide ourselves with buffers to deliberate on the next steps.
This would include devising remedial solutions as different parts of the state capitalist system collapses. This means a more gradualist contraction strategy whereby we rationally respond to the changes that are being indicated by the state capitalist system which as I argued above is probably in sync with ecological scarcity and carrying capacity limits via the invisible hand of the market.
This isn't to say that part of the cultural revolution from the growth imperative to the balance imperative is to try and make capitalism more sustainable. It is to recognise that capitalism itself emerged as a bottom up strategy from its mercantile roots and that we can now activate the emergence of another bottom up system from the roots of the capitalist system.
On 2024-04-01 16:08:12, user Ekta Makhija wrote:
This article has now been published in the journal PLOS ONE. https://journals.plos.org/p...
On 2024-03-26 10:53:13, user Gabriel Krouk wrote:
A new version of the paper is published in Genome Biology: https://genomebiology.biome...
On 2024-03-26 10:05:44, user Davidski wrote:
Hello authors,
Your preprint claims that present-day Hungarians are genetically similar to Scythians, and that this is consistent with the arrival of Magyars, Avars and other eastern groups in this part of Europe.
However, present-day Hungarians are overwhelmingly derived from Slavic and German peasants from nearby Hungary. This is not a controversial claim on my part; it's backed up by historical sources and a wide range of genetic analyses.
Hungarians still show some minor ancestry from Hungarian Conquerors (early Magyars), but this signal only reliably shows up in large surveys of Y-chromosome samples.
The Scythians that you used to model the ancestry of present-day Hungarians are of local, Pannonian origin, and they don't show any eastern nomad ancestry. So they're either acculturated Scythians, or, more likely, wrongly classified as Scythians by archeologists.
And since these so-called Scythians lack eastern nomad ancestry, the similarity between them and present-day Hungarians is not a sign of the impact from Avars, Hungarian Conquerors and the like, but rather a lack of significant input from such groups in present-day Hungarians.
I've done a rather long blog post about your analysis of Medieval Poles and present-day Hungarians at the link below. Hopefully you'll find it useful.
On 2024-03-26 03:38:19, user James Mallet wrote:
Congratulations on an interesting theoretical paper which sounds very plausible!
Some comments:
1) Your abstract ends:<br /> "Here, we show that these empirical patterns all emerge from a single theory incorporating the evolution of cis and trans-acting regulators of gene expression. This theory offers a level of parsimony and generality rarely seen in biology."
But you don't say what "THIS THEORY" is! A vague mention of "cis and trans-acting regulators of gene expression" does not well encapsulate your hypothesis, if I understand it correctly. Your problem is to explain chromosome-wide effects, the effect of overall ancestry. You don't mention a key part of your theory, which is DOSAGE COMPENSATION!!! I think you should do this in the abstract.
2) You don't cite our papers, and why should you have done so? -- they came out very recently, probably after you'd done most of this work.
However, I think our recent genomic mapping papers on Haldane's Rule in female heterogametic butterflies are highly relevant and provide circumstantial evidence for the chromosome-wide, polygenic effects required in your dosage-compensation hypothesis, especially on the Z chromosome. The two relevant papers are:
Rosser, N., Edelman, N.B., Queste, L.M., Nelson, M., Seixas, F., Dasmahapatra, K.K., & Mallet, J. 2022. Complex basis of hybrid female sterility and Haldane's rule in Heliconius butterflies: Z-linkage and epistasis. Molecular Ecology 31:959-977. https://doi.org/10.1111/mec...
Xiong, T., Tarikere, S., Rosser, N., Li, X., Yago, M., & Mallet, J. 2023. A polygenic explanation for Haldane’s rule in butterflies. Proceedings of the National Academy of Sciences of the United States of America 120:e2300959120. https://doi.org/10.1073/pna...
The latter paper especially, which re-analyzes inferences made about the weird epistatic sterility effects inferred via QTL analysis in the former paper. A quantitative proportion of ancestry effect is a better fit, according to Xiong et al., than the single locus + (left and right end of the chromosome pairwise epistasis) proposed by Rosser et al.
Of course, it was well known since Dobzhansky 1936 that hybrid sterility in Drosophila was multi-locus. See: Dobzhansky, T. 1936. Studies on hybrid sterility. II. Localization of sterility factors in Drosophila pseudoobscura hybrids. Genetics 21:113-135. https://doi.org/10.1093/gen...
I think our papers suggest, or at least comport with the idea that in two distantly related pairs of butterfly species, female hybrid sterility is also mediated by multilocus effects, at least along the Z chromosome. The fraction of ancestry matters.
As we wrote "The molecular nature of polygenicity is unresolved. In our case, it is tempting to consider epigenetic mechanisms between autosomes and the Z chromosome. For instance, genetic variance of pupal weight in backcross males is much smaller than that in females (SI Appendix, Table S2). This is consistent, for instance, with dosage compensation in Lepidoptera in which both Z chromosomes in<br /> males are partially suppressed (37), which will dampen the effects of introgressed factors."
Anyway, congratulations on a very stimulating idea that certainly seems plausible!
On 2024-03-25 12:29:58, user Pedro H. Oliveira wrote:
This is an interesting study, but the authors fail to mention recent work linking defensome and ecological contexts such as: https://www.nature.com/arti...
Also, the link between lack of DSs and intracellular/parasitic lifestyle is known for several years. Some refs are lacking.
On 2024-03-25 11:20:00, user Vincent Viala wrote:
Great work. Essential for the new era of ab initio transcriptomics. Congratulations. Have you considered basecalling with Dorado and generating Duplex reads with the kit 14 chemistry? Best regards
On 2024-03-24 15:18:31, user smd555 smd555 wrote:
When is the data planned to be published and available?
On 2024-03-20 11:33:13, user Chris Baumann wrote:
Upon reading the recent preprint titled “Dietary reconstructions of Magdalenian canids from SW-Germany do not indicate that the area was a centre of early European wolf domestication” by Bons et al. on BioRxiv, it has come to our attention that certain aspects require clarification to ensure accurate information is conveyed. First and foremost, it is essential to mention that the referenced paper has undergone a rigorous peer-review process and did not meet the acceptance criteria, resulting in its rejection. Maintaining transparency and accuracy in discussions related to the scholarly review process is imperative. In responding to the preprint, our intention is to focus on rectifying any potential misinterpretations within the content of our work. While constructive criticism and scientific discourse are vital components of academic discussion, our emphasis remains on addressing the scientific aspects rather than engaging in personal disputes. Below we address the seven main scientific criticisms of our study.
In our paper, we did not definitely classify the remains as dogs or wolves on purpose. We hypothesize that all Gnirshöhle canids had restricted diet and where at the beginning of the domestication process of wolves leading to dogs, which is why we have chosen the title as "A refined proposal for the origin of dogs". All scientific evidence points out that wolves are the wild ancestors of dogs, so addressing the origin of dogs requires that we investigate some ancient wolves. During the early steps of wolf domestication, it is expected that the first changes will take place in the behavior of some individuals within a larger wolf population and therefore, changes in the isotopic composition of canid bones will occur among individuals with similar genetic background. This is exactly what is documented in our article, as the canids were genetically like wolves at the mitochondrial level, while their diet was very specific and not comparable to the diet of other wolves from the Magdalenian. To us and the reviewers of our study, this was convincing evidence of a restrictive diet, most likely influenced by prehistoric humans, which can be interpreted as pet-keeping. This would be the first step of wolf domestication - hence the title of the article, consistent with recent scientific literature.
As Bons et al. correctly pointed out, the number of clusters can be reduced or increased. To test if the chosen number of clusters leads to a bias in the distinction between the two clusters of large canids, we made another analysis by first excluding the foxes and reducing the number of clusters to two. The result is that the large canids are divided in the same way, as in our three clusters, into two groups of large canids. Only the one wolf from Schussenquelle (SCH-11), formerly in the fox niche, joins the canids from Gnirshöhle, because of its low δ15N value. Nevertheless, the same clear difference can be seen between the large canids with high δ15N values (δ15N = 7.9 ± 0.9 ‰) and the large canids with low δ15N values (δ15N = 5.8 ± 0.3 ‰, which we have called diet-restricted canids). To separate the foxes and use them as a ‘trophic outgroup’, we decided to construct three clusters instead of two in our original article.
Bons et al. compared our measured isotopic values in bone collagen with those of modern wolf hair from the USA. This argument is intended to show that our niche reconstruction is not valid because the intraspecific variability of the isotopes is too large to allow it. However, hair records a snapshot of individual life and therefore are subject to short-term and seasonal dietary fluctuations, leading to potentially high isotopic variability. In contrast, bone collagen records average isotope values over several years of the animal's life. Therefore, the ranges of isotopic variations of bone collagen are not comparable to those from hair. A high variability in hair isotope data comes from seasonal, regional, and other short-term and local variations, while in contrast, high variability in bone collagen can only come from different dietary preferences over a long period of time spanning over a year. Thus, isotopic variations in bone collagen were adequate to show different feeding strategies and are related to trophic behavior and niches.
We used only isotopic data from the Magdalenian (c. 16 to 14 k yrs calBP) to calculate diet and niches, therefore prior to this environmental transition. Only one single wolf from Hohle Fels (c. 13.2 kyrs calBP) could fall into the Late Pleistocene to Holocene transition, which dated from c. 12.4 - 10.8 kyrs BP. However, this potential chronological outlier was not the subject of discussion. All the other 13 canid individuals, as well as the food resources, come from secured archaeological layers of the Magdalenian or have even been directly dated (all dates were published in our article).
Bons et al. questioned our decision to use the TEF values of foxes from Krajcarz et al. (2018) and not using the published wolf’s TEF values. The values calculated by Krajcarz et al. (2018) correspond to a “natural” case study, where canids have to actively forage, catch, and consume their own food, in contrast to the published wolf TEF values, calculated more indirectly. They are thus the most recently published and the closest to the reality of canid’s metabolism. The metabolism of foxes and wolves is very similar because they belong to the same taxonomic family and could feed on the same kind of prey.
We have included all the necessary raw data in our article to allow scientists to replicate our calculations. The most important control factors for good and usable models are the Geweke and Gelman-Rubin tests. Both tests independently indicate the convergence of the model and are essential information that must be given for the models used. The chain length of the Markov chain Monte Carlo (MCMC) must also be reported, as well as the number of chains and the burn-in. The reason that Bons et al. got different results from the model than we did may be that their model did not run convergently, which cannot be verified due to the lack of Geweke and Gelman-Rubin test results.
According to Bons et al.’s interpretation of the CT scans of one individual, GNI-999, this is a subadult individual, which would have significantly changed our interpretation if we had included it. This is incorrect. As Bons et al. also acknowledge, this was not a young puppy, which means that the bone collagen examined was not influenced by consumption of mother’s milk. In fact, the isotopic values of subadult canids should be considered equivalent to those of an adult animal because they do not have a 15N-enriched milk signal after weaning and thus, the δ15N values of their bone collagen are not elevated. According to Geiger et al. (2016), the CT scan of GN-999 shows an age of at least four months, whereas wolves are weaned after three months (Packard 2019). Therefore, this statement does not affect our interpretation of its isotopic values. Moreover, it has also no consequences on the interpretation of the 13 other specimens of large canids considered in the paleogenetic and isotopic investigation presented in our article.
Written on behalf of all co-authors of the Baumann et al. (2021) study,<br /> Dr. Chris Baumann
On 2024-03-19 14:38:24, user Tien Anh Vu wrote:
I am Tien Anh Vu, the co-first author of this manuscript. I would like to provide the following corrections for this preprint as follows:
On 2024-03-18 15:25:25, user McClelland wrote:
Are there any informative sequences that overlap between Paranthropus and Homo antecessor that would allow this additional species to be placed on the tree? It would be expected to clade closer to the other Homo. Or is the data for both so sparse that they can only be mapped relative to complete or near complete genomes?
On 2024-03-18 13:29:40, user Luca Jovine wrote:
Published on 14 March 2024 as:
Nishio S., Emori C., Wiseman B., Fahrenkamp D., Dioguardi E., Zamora-Caballero S., Bokhove M., Han L., Stsiapanava A., Algarra B., Lu Y., Kodani M., Bainbridge R. E., Komondor K. M., Carlson A. E., Landreh M., de Sanctis D., Yasumasu S., Ikawa M. & Jovine L.<br /> ZP2 cleavage blocks polyspermy by modulating the architecture of the egg coat<br /> Cell 187:1440-1459.e24 (2024)<br /> DOI: https://doi.org/10.1016/j.c...<br /> PubMed: https://pubmed.ncbi.nlm.nih...
On 2024-03-18 08:51:51, user Björn Brembs wrote:
I only skimmed the figures for a trace of a model fly flying without visual input. Does the model generate the kind of spontaneous behavior observed in real flies if the input is omitted?<br /> I'd assume it's a bit early, but has learning been implemented in the model, yet? Is it planned? For instance, does the model learn to adapt to inverted coupling between the fly's behavior and, e.g., visual feedback?
On 2024-03-18 03:09:55, user Jason Mears wrote:
This manuscript has been published.
Rochon, K., Bauer, B.L., Roethler, N.A. et al. Structural basis for regulated assembly of the mitochondrial fission GTPase Drp1. Nat Commun 15, 1328 (2024). <br /> https://doi.org/10.1038/s41...
On 2024-03-17 18:53:29, user Tibor Rohacs wrote:
Cool new structures. It is interesting that DiC8 PIP2 can bind to the same site as the endogenous PI (and capsaicin), and results in a partially open state, potentially explaining the positive effects of DiC8 PIP2 in excised patches.
What the paper does not mention is that long-acyl-chain natural PIP2 (PMID: 17596456, 24158445) and diplmitoyl PIP2 (PMID: 17074976) also potentiate TRPV1 in excised patches. This happens in the presence of capsaicin, which is hard to reconcile capsaicin and PIP2 acting on the same binding site.
DiC8 PIP2 binding to the vanilloid (capsaicin) site also does not explain the finding that capsaicin induces a left-shift in the dose-response of DiC8 PIP2 activation of TRPV1 in excised patch experiments (PMID: 17596456: Fig 9), begging the question, where PIP2 bind to the channel in the presence of Capsaicin.
On 2024-03-17 07:37:14, user Hiroshi Mori wrote:
In order to properly use this tool, users must purchase a KEGG FTP license. In the config.yml file of this tool, the following description exist. "KEGG_FTP_DATA_DIR: '/scratch/shared_data_new/KEGG_FTP/2023-10-11/kegg' # Replace with your KEGG FTP data directory".<br /> Authors should mention this restriction (i.e. KEGG FTP license required) in the manuscript.
On 2024-03-16 14:52:40, user Angelika Lahnsteiner wrote:
The article is now published in Methods in Enzymology: <br /> https://doi.org/10.1016/bs....
On 2024-03-12 06:34:01, user Gianna wrote:
This is the link to the published version: https://www.nature.com/arti...
On 2024-03-10 22:43:57, user Alex Crits-Christoph wrote:
This is very interesting work!
1 minor comment upon reading:
"Both MAGs also encoded the restriction enzyme Mrr of the type IV system but not the corresponding modification enzyme"
There is no corresponding modification enzyme for Mrr - because it targets methylated DNA.
On 2024-03-10 08:35:38, user Dmitrii Kriukov wrote:
Thank you for the interesting reading! I have following comments/questions:
Major:<br /> - Definitely the current state of the research suffers from insufficient validation. Please, reproduce your analysis on (Thompson, 2018); (Meer, 2018) datasets as well as other single-cell hepatocytes datasets like (Gravina, 2016.)<br /> - It is not theoretically clear how the exponent in PC-1 component is related to the one in Gompertz law. Provide more theoretical explanation as one, for example, was proposed in (Vural, 2014, Phys. Rev.)<br /> - The exponential fit to PC1 scores seems to be unreliable because I expect a large confidence interval for this parameter due to the small number of data points. Please, add confidence interval for the parameter. <br /> - I also recommend to compare exponential fit with other model families like parabolic or sin or others. AIC criterion could be used here for model comparison.<br /> - "Such a pattern of exponential growth in both mean and variance is indicative of stochastic instability of the organism state..." - this is the key phrase I saw in multiple papers from your group. I assume using this statement you implicitly refer readers to the Wiener process property of increase variance linearly with time. But I do not know which well-known process has exponential increase in variance. Could you please elaborate this explanation more in the text by adding the necessary literature references?<br /> - In your previous paper (Aging clocks, entropy and limits of age reversal) you obtained linear relation for human blood PC1 scores, no relation for PC2 scores and hyperbolic relation for PC3. My question is why PC2 in humans shows no relation with respect to some function?<br /> - I also interested why you changed methodology of CpG-sites pre-selection by comparing with the previous work in humans?<br /> - "The distribution of the loading vector components for the exponential feature, DNAm-PC1, displays heavy tails, indicating the presence of sites significantly associated with this process" - is the order of PCA loadings stable? Did you test the CpG sites with boostrap procedure, by subsampling the dataset and checking the stability of PC-loadings? <br /> - In figure 4b you demonstrate that CR mice demonstrate higher PC2/tBA values than Control. But what if this observations is due to the covariate shift between two datasets which was caught by PC2 and not caught by PC1 axis? This could explain the differences by a pure data distortions without attracting more complex theory.<br /> - No code<br /> - No supplementary info
Minor:<br /> - "...as heavy regularization tends to select a number of features approximately equal to the sample size, based on their correlation to the target phenotype." - could you please add a reference to this theoretical result. My experiences with complexity penalization says other.<br /> - In the regards of problems with clocks, adding remarks on biomarkers paradox, multicollinearity and uncertainty problem would be beneficial.
On 2024-03-10 08:03:03, user ummon wrote:
The Huna invasions only traveled as far as Central India and it's simply implausible to suggest, as this preprint does, that the Huna could have contributed East Asian ancestry to East and North-East regions of India when such ancestry doesn't show up in regions that the Huna actually invaded.
It is unclear from the described ALDER results whether the admixture came from a single event. More plausible is that the East Asian admixture in Bengalis diffused over time from east of Bengal.
On 2024-03-05 05:02:39, user vkfromIndia wrote:
I just want to say, coming from India, that there is not caste as Scheduled Caste or Other backward caste genetically. "Scheduled" caste comes from affirmative action by government of india which is based on British list. On the other hand, Other backward caste gained positive affirmation as a political alternative to Ram temple agitation. Both are collection of several castes. There are "most" backward caste MBC and so forth.
I think "Jati" is the better way to go for genetic analysis. Several years ago, jati was involved with a specific profession and marriages took place inside those jati only.
In my opinion it would be better if comparison was made between various Jati in different regions. Also, inside the same region among various jati.
Also, It would be worthwhile to mention here that the regions marked north/central/east etc are based on political boundaries which came into existence in the 20th century, the main purpose of which was to exercise strict control over the population. It would not be appropriate to club entire 21st century political unit as a homogeneous one for genetic analysis.
So, in summary, i think comparison could be more on the basis of traditional occupation based on jati, like yadav for milkmen, yet at the same time most important beneficiary of positive affirmation or kurmi/patel for vegetable grower etc.
On 2024-03-09 21:05:59, user L Miguel wrote:
This paper shows all-atom simulations can capture all that is already known in the literature about RNA-RRM binding of TDP43.
On 2024-03-08 14:21:12, user Michael Jeltsch wrote:
Anal fin blood vascular network regeneration in zebrafish has been shown to occur indirectly via transdifferentiation of lymphatics into blood vessels (Das et al. 2022). Does this hold true for the caudal fin? If yes, you might consider analyzing also VEGF-C expression!
On 2024-03-08 13:17:33, user Tainara Duarte wrote:
Dear authors,
My name is Tainara, I am an undergraduate student in Biological Sciences at the Federal University of Minas Gerais and affiliated with the Plant Interaction Laboratory (LIVe). My research is focused on studying the interaction between plants and bacteria. Our laboratory has activities that include reading articles related to the areas of knowledge we study, called “Preprint Club”.<br /> For this activity, I selected your preprint called “Culturable approach to rice-root associated bacteria in Burkina Faso: diversity, plant growth-<br /> promoting rhizobacteria properties and cross-comparison with metabarcoding data” for reading and evaluation.<br /> In your manuscript you carried out tests with isolated bacteria and this was very interesting, studies like yours are very important to clarify the processes involved in the plant microbiome.<br /> However, I would like to make some observations about your manuscript:
In the introduction I thought you covered several topics, which are important to the topic, but are not specific to your research so they are not that relevant.<br /> On the other hand, how do you make a direct comparison of your results with the study referring to your bibliographic reference (60) (Barro, et al 2022) I thought I could address aspects of this study in its introduction.
Regarding the captions, in general I would suggest that the authors write more details when describing the figures so that it would be better to understand the results. This is important for the reader.<br /> Specifically in the caption of figure 4, we note that there is no caption for some images (specifically figure 4d)
Regarding the figures in general, I would also like to suggest that the authors increase the size of the details in the figures. Specifically in figure 8, where the species included in the heat map are so close together and because they are very small, it is not possible to read them and this hinders the understanding of their results.<br /> And finally, I would like to suggest more photos and data on the results of the in vivo tests of the two rice cultivars.
These are some notes that I thought were important to write, I hope they are useful for the authors. It was a pleasure to read the preprint of your research.<br /> All the best,
Tainara Duarte.
On 2024-03-06 22:24:50, user Jimmy Weagley wrote:
Hi, great paper overall – very nice insight into the mechanistic and structural basis of PARIS defense.
I am curious about your discrepancy with Rousset et al. (2022) regarding whether PARIS is a toxin-antitoxin system. They state, “We then focused on the system from E. coli B185 for subsequent experiments. Deletion of either ariA or ariB was non-toxic and abolished defense, excluding the hypothesis of a toxin-antitoxin system and showing that both components are required for activity (Figures S4C–S4E).” If ariB encodes a toxin, I expect they would have observed growth inhibition when deleting ariA. They don’t show the growth curves of these two mutants, only lawns with plaques in Figure S4.
Additionally, Burman et al. (2024) state “As opposed to prototypical toxin-antitoxin systems, AriB isn’t toxic when expressed alone. This suggests that AriA activates AriB through a structural modification that enables dimerization or an unidentified posttranslational modification. More work will be necessary to determine the mechanism of AriB release and activation.” And “Expression of AriB alone is not toxic to the cells, nor does it provide phage defense [Rousset et al. (2022)]”.
In your experiments, you only observe toxicity when overexpressing AriB, and not from the native promoter. Do you think this is an accurate representation of the natural/normal toxicity of AriB? Do you think these genes are transcriptionally regulated and only expressed at levels sufficient for toxicity during phage infection? Do you think the basal level of AriB expression from the native promoter is low enough to avoid the toxicity you observe during overexpression? Your results suggest that AriB toxicity doesn’t necessarily depend on “a structural modification that enables dimerization or an unidentified posttranslational modification” as posited by Burman et al. (2024).
Do you think that when overexpressed at a high enough level a fraction of AriB can homodimerize without release from AriA by Ocr? You stated that “while we were initially unable to express and purify soluble AriB, we found that incubating AriA-AriB with Ocr released soluble AriB for further analysis (Figure 4c).” This made me wonder about the necessity of AriA+Ocr for AriB solubility and dimerization/activation. If you were to quantify the cellular/chromosomal abnormalities in the microscopy images presented in Figure 6 and Figure S15, do you think AriB overexpression would exhibit an intermediate phenotype to AriA and AriA+AriB+Ocr? It is hard to tell from the (single) images, but it looks like there is a higher proportion of dead (yellow) and abnormal cells in Figure S15C compared to S15A, perhaps suggesting increased AriB activity/toxicity when released from AriA by Ocr then when expressed on its own.
It's nice that you have similar conclusions regarding the structure of the PARIS-Ocr complex as Burman et al. (2024). Additionally, their work supports your hypothesis of AriB blocking protein synthesis “potentially through cleavage of as-yet unidentified essential cellular tRNAs.”
In short, what do you think underlies the discrepancy in AriB toxicity between your study, Rousset et al. (2022) and Burman et al. (2024)?
Rousset, F., Depardieu, F., Miele, S., Dowding, J., Laval, A.L., Lieberman, E., Garry, D., Rocha, E.P., Bernheim, A. and Bikard, D. (2022). Phages and their satellites encode hotspots of antiviral systems. Cell host & microbe, 30(5), 740-753.
Burman, N., Belukhina, S., Depardieu, F., Wilkinson, R.A., Skutel, M., Santiago-Frangos, A., Graham, A.B., Livenskyi, A., Chechenina, A., Morozova, N. and Zahl, T. (2024). Viral proteins activate PARIS-mediated tRNA degradation and viral tRNAs rescue infection. bioRxiv, 2024-01
On 2024-03-06 07:10:23, user Pawan Singh Rana wrote:
This article is published and can be seen at the link below:
On 2024-03-05 13:36:05, user Witton wrote:
I am wondering if the supplementary table S1 and S2 could be public on bioRxiv?
On 2024-03-04 20:57:10, user Jeffrey Ruberti wrote:
This is a nice piece of work showing collagen dynamics including the fate of endogenous collagen added to the a cell culture system. See the following paper that already demonstrated exogenous collagen incorporation into cell synthesized matrix and for methods to produce an exogeneous labelled collagen that is minimally disruptive to fibril assembly. Siadat, S.M., Silverman, A.A., Susilo, M.E., Paten, J.A., Dimarzio, C.A., Ruberti, J.W., 2022. Development of Fluorescently Labeled, Functional Type I Collagen Molecules. Macromolecular Bioscience 22, 2100144.. https://doi.org/10.1002/mab...
On 2024-03-04 17:13:18, user alexander_zlobin wrote:
Hi!<br /> Please correct Fig.1. These proteases have HID, not HIE. This is a very serious and meaningful distinction. The incorrect tautomer on the scheme undermines the soundness of the study, since it questions the understanding of the enzymology of these enzymes.
On 2024-03-03 18:08:21, user Lenzen Sigurd wrote:
Dear authors and readers of this bioRxiv preprint,
The approval of the anti-CD3 antibody by the FDA in November 2022 now enables a “disease modifying” therapy for the first time, which can delay the manifestation of T1DM by two to three years [1].
And in combination with an anti-TNFα antibody, such a therapy even opens up the prospect of a long-term therapeutic effect with curative potential in the foreseeable future. The successful implementation of such a therapy is based on numerous studies over the last decades, which have shown (not cited in this manuscript) that the proinflammatory cytokine TNFα plays a central role in the destruction of pancreatic beta cells in the pathogenesis of Type 1 Diabetes Mellitus (T1DM) [2, 3].
The authors Alexandra Coomans de Brachène et al. of the current MS now present results that lead them to hypothesize that the interferons IFNα and especially IFNγ play a prominent role in the destruction of beta cells in T1DM. This is in contrast to the situation in the endocrine pancreas in vivo, both in patients with T1DM and in reliable spontaneous animal models of human T1DM [4]. The gene expression and protein expression of IFNγ is only low in infiltrated pancreatic islets of the human T1DM pancreas [4] and in the infiltrated pancreas of the IDDM rat model of T1DM, which is closest to the human situation [5], while the highly expressed TNFalpha is the pro-inflammatory cytokine that is centrally responsible for the destruction of pancreatic beta cells in the infiltrated T1DM pancreas [2].
Combination therapy with anti-TCR in rats (ie, anti-CD3 in mice and humans) and anti-TNFα eliminates the infiltration with proinflammatory cytokines [3, 6], which cannot be achieved with a combination therapy with anti-IFNγ [3]. An exclusive reference to an antidiabetic effect in the NOD mouse model of T1DM is inadequate, as the authors do in the current manuscript. A large number of studies in the NOD mouse showed therapeutic success in this mouse model using a wide variety of preventive therapies, but none of these therapies could be successfully transferred to the situation in patients with T1DM [7]. A successful transfer of such a therapeutic concept into an effective translational therapy for patients with T1DM, which enables a return to a normal metabolic state, is therefore not recognizable based on the facts presented, at least not in the foreseeable future. Therefore, IFNγ does not play a central role in the T1DM pathogenesis. Such a concept lacks the necessary experimental basis.
REFERENCES
[1] Herold KC, Gitelman SE, Gottlieb PA, Knecht LA, Raymond R, Ramos EL (2023) Teplizumab: a disease-modifying therapy for type 1 diabetes that preserves beta-cell function. Diabetes Care
[2] Jörns A, Arndt T, Meyer zu Vilsendorf A, et al. (2014) Islet infiltration, cytokine expression and beta cell death in the NOD mouse, BB rat, Komeda rat, LEW.1AR1-iddm rat and humans with type 1 diabetes. Diabetologia 57: 512-521
[3] Jörns A, Arndt T, Yamada S, et al. (2020) Translation of curative therapy concepts with T cell and cytokine antibody combinations for type 1 diabetes reversal in the IDDM rat. J Mol Med (Berl) 98: 1125-1137
[4] Jörns A, Wedekind D, Jähne J, Lenzen S (2020) Pancreas pathology of latent autoimmune diabetes in adults (LADA) in patients and in a LADA rat model compared with type 1 diabetes. Diabetes 69: 624-633
[5] Lenzen S, Arndt T, Elsner M, Wedekind D, Jörns A (2020) Rat models of human type 1 diabetes. Methods Mol Biol 2128: 69-85
[6] Jörns A, Akin M, Arndt T, et al. (2014) Anti-TCR therapy combined with fingolimod for reversal of diabetic hyperglycemia by beta cell regeneration in the LEW.1AR1-iddm rat model of type 1 diabetes. J Mol Med (Berl) 92: 743-755
[7] Lenzen S (2017) Animal models of human type 1 diabetes for evaluating combination therapies and successful translation to the patient with type 1 diabetes. Diabetes Metab Res Rev 33
Sigurd Lenzen, MD<br /> Professor of Experimental Diabetes Resarch <br /> Institute of Experimental Diabetes Research<br /> Hannover Medical School
On 2024-03-01 15:08:07, user Tianyu Liu wrote:
Hi, it seems that I cannot reply the problem in the community part, so I will write my response here:
Hi, thanks for your checking. scGPT v1 should be trained based on 10M cells rather than the 33 M cells (scGPT). We did observe a better performance of scGPT v1, thus we are doubting the contribution of increasing the number of cells for pre-training. In the discussion part, we share our ideas about doing data ablation via online learning for further improvement.
On 2024-03-01 10:20:33, user Carla Perpiñá-Clérigues wrote:
Published:
Perpiñá-Clérigues, C., Mellado, S., Galiana-Roselló, C. et al. <br /> Novel insight into the lipid network of plasma extracellular vesicles reveal sex-based differences in the lipidomic profile of alcohol use disorder patients.<br /> Biol Sex Differ 15, 10 (2024). https://doi.org/10.1186/s13...
On 2024-03-01 02:07:13, user Jeff Ellis wrote:
I think there are several problems with section 1of the results and the legend of Fig 1.In the results section there are two experiments being described. <br /> In the first differentially tagged Pwl2 and Bas1( presumably an effector known from previous work to localise to the BIC) expressed in the same strain is inoculated onto rice rice and Pwl2 and Bas1 are shown to co-localise, which demonstrates Pwl2 is secreted into the BIC.
In the second experiment two different strains, one carrying Pwl2 marked with GFP and the other carrying Pwl2 marked with RFP are used to co-infect rice.The claim that a BIC contains either RFP or GFP and not both only becomes meaningful if you were to state here that you specifically scanned for individual cells at the infection site that were simultaneously infected by both strains.How many such cells were observed?
In the legend of Fig 1the statement “ confirming that the BIC does not contain Pwl2 transferred from rice cells” occurs. This is very cryptic and no mention of this is idea made in the results section. Presumably the unstated hypothesis is that transfer between BICs in the same rice cell could occur. Although the data support this the hypothesis should be included in an expanded results section. Perhaps this experiment is not necessary in this paper?
In Fig 1 legend line 689 I think the verb should be was not were. The dashed lines in Fig1 A and B are not explained..Line 692. This should be B and D and not C and D?
On 2024-02-27 08:48:43, user Herman van Eck wrote:
This is an interesting manuscript! However, the manuscript typically describes parallelism. It is not about convergent evolution.
On 2024-02-26 20:40:13, user marcinkortylewski wrote:
The final version of this manuscript is published after peer-review at Molecular Therapy Nucleic Acids - doi: 10.1016/j.omtn.2024.102137.
On 2024-02-26 17:03:09, user Amer Alam wrote:
The peer-reviewed version of this preprint has been published in the EMBO Journal (doi doi: 10.15252/embj.2022111065).
On 2024-02-26 16:34:20, user Claudiu Bandea wrote:
The origin of viruses: from hypothesis to fact<br /> Claudiu Bandea (February 26, 2024)
The origin of viruses is one of the greatest mysteries remaining in biology. In previous comments regarding the recent discovery and characterization of Borgs [1, 2], I proposed that Borgs are incipient viral lineages that originated from symbiotic or parasitic archaeal lineages, as predicted by the fusion model of the origin of viruses, by reductive evolution from cellular ancestors [3-6] .
The reduction hypothesis regarding the origin of viruses was proposed in the mid-1930’s [7], during a period when knowledge of the structural and biochemical composition of viruses and of the diversity of cellular organisms was still emerging. However, by the middle of the last century, this growing body of knowledge led to the formalization of the modern concept of viruses [8].
In 1957, Andre Lwoff, one of the founders of modern virology, defined viruses in his famous article “The Concept of Virus” as biological entities that: (i) have only one type of nucleic acid, DNA or RNA, (ii) multiply in the form of their genetic material, (iii) are unable to grow and to undergo binary fission, and (iv) lack energy metabolism [8]. The conceptual identification of viruses with virus particles, or virions - the transmissible, infectious forms in the viral life cycle - and the definition of viruses based on the physical, biochemical, and biological properties of these particles have both endured until recently in virtually all scientific literature and textbooks (discussed in [4, 9-16]).
Not surprisingly, within the conceptual framework of viruses as virus particles, the historical hypotheses for the evolutionary origin of viruses focused on the structure and biochemical composition of virus particles: (i) the Pre-cellular or Virus-first Theory suggesting that viruses originated from precellular, self-replicating nucleic acids, or replicons, encoding for capsid proteins; (ii) the Endogenous or Escape Hypothesis proposing that viruses originated from cellular genomic sequences, or replicons, encoding for capsid proteins; (iii) and the historical Regression or Reduction Hypothesis proposing the reductive transition of parasitic cellular lineages, such as bacteria, into nucleocapsid-like structures.
In context of the view of viruses as particles, the reduction hypothesis was questioned by Salvador Luria and James Darnell, the authors of one of the first textbooks of Virology [17], who wrote: “The strongest argument against the regressive origin of viruses from cellular parasites is the non-cellular organization of viruses. The viral capsids are morphogenetically analogous to cellular organelles made up of protein subunits, such as bacterial flagella, actin filaments, and the like, and not to cellular membranes.” (all quotes in italics) [17].
Two decades later, in concert with a new perspective on the nature of viruses and a new definition based on their properties during the intracellular stage of the viral life cycle, I proposed a fusion hypothesis for the origin of viruses [3-5]. Briefly, according to the fusion hypothesis, viral lineages originated from cellular organisms that fused with their host cells through a process in which their cell membrane fused with the host membrane. By discarding their cell membranes, these novel organisms increased their access to resources present in their special environmental niche, the host cell, including the ribosomes and translation machinery. After synthesizing their specific molecules and replicating their genome using the resources found in the host cell, the parasites produced spore-like, transmissible forms, which started a new life cycle by fusing with other host cells. These incipient viral lineages diversified by reductive evolution into a myriad of viruses with smaller genomes and diverse life cycles. The origin and evolution of viruses ‘molecular organisms,’ overcomes the problems presented by the historical reduction theory.
Nonetheless, unlike the new perspective on the nature of viruses, which, after decades in obscurity, is increasingly used to explain the biology of viruses and their role in shaping the metabolism and the evolution of their hosts [9, 11, 13, 14, 16, 18-27], the fusion model for the origin of incipient viral lineages has received little attention. Possibly, the main reason is the reminiscent scientific argument put forward by Luria and Darnell against the reduction theory, which has been recently re-articulated by Mart Krupovic, Valerian Dolja, and Eugene Koonin in their article “Origin of viruses: primordial replicators recruiting capsids from hosts” [28].
They write: “Thus, the evolution of giant viruses, irrespective of the numerous interesting and puzzling aspects of their genome layout and biology, can be accommodated in the evolutionary scenario proposed here. Also, no evidence exists for the possible origin of viruses from intracellular parasitic bacteria. As intracellular parasitic or symbiotic bacteria have evolved numerous times and have independently given rise to extremely reduced forms, including organelles (119,120), the absence of bacteria-derived viruses suggests that the evolutionary path from a cell to a virus is impracticable.”
Patrick Forterre and Mart Krupovic emphasized the same problem with the historical reduction hypothesis: “virions were so different from any kind of cell (even the most reduced parasitic cells) that the regression hypothesis (the idea that parasitism triggered the reductive evolution from cells to viruses) was discarded as senseless by most biologists (for an exception, see Bandea 1983).” [16].
Indeed, many symbiotic intracellular bacterial lineages evolved by regressive evolution into organelles, and several parasitic bacteria have reduced the number of their genes and proteins to a fraction of those found in their ancestors, or for that matter to a fraction of those found in some viruses. Yet, these organelles do not resemble virus particles. Nevertheless, like in the case of Luria and Darnell’s argument, the rationale used by these authors for questioning the historical reduction theory does not apply to the fusion hypothesis.
Another scientifically sound rationale for dismissing the historical reduction hypothesis emerged from phylogenetic studies refuting the hypothesis that giant viruses originated from a fourth domain of cellular life by reductive evolution [29-31]. These studies support an evolutionary relationship of giant viruses with smaller viruses, which is consistent with the theory that they are polyphyletic and did not originate from a fourth domain. These results, however, are also consistent with the fusion hypothesis, which supports the evolutionary relationship of giant viruses with smaller viruses and contradicts the fourth domain hypothesis.
Indeed, one of the fundamental predictions of the fusion hypothesis is that new giant virus lineages originated from diverse parasitic pre-cellular and cellular lineages throughout the history of life. Another prediction of the fusion hypothesis is that only cellular lineages that parasitize evolutionarily related hosts from the same cellular domain can transition to a viral type of biological organization. This explains the apparent homology of some of their genes with those of their hosts, which has been usually interpreted as evidence for the accretion model for the evolution of viruses towards complexity.
As mentioned above, the current phylogenetic analyses do not exclude the reductive evolutionary diversification of the giant viruses into smaller viruses. Indeed, as recently noted by Natalya Yutin, Yuri Wolf, and Eugene Koonin: “The only alternative, however non-parsimonious, to the massive gene gain scenario appears to be independent early emergence of multiple ancestral giant viruses followed by massive losses in the branches leading to the smaller extant viruses.” [29]. This alternative is exactly what the fusion hypothesis predicts, with the realization that this process has occurred throughout the history of life, which explains the extraordinary diversity of the extant viruses, including thousands of relatively small viruses. It is difficult to envision how these small viruses have evolutionary survived for several billions years since their presumed origin, as postulated in the accretion model [28].
Interestingly, at the other end of the accretion model, we could envision the possibility that some complex viral lineages transition into cellular lineages. That would be, indeed, an extraordinary event, but I’m not aware of any evidence suggesting such a transition. However, as discussed in the following, given the general evolutionary trend of symbiotic and parasitic organisms, the accretion model is questionable.
I find the logic of viral evolution, as recently articulate by Koonin, Dolja and Krupovic, to be the cornerstone for our thinking about the origin and evolution of viruses: “Overall, the logic of virus evolution is defined by the key biological feature of viruses, namely their obligate intracellular parasitism.” [32]. I also find this logic of evolution to be applicable to thousands of parasitic cellular lineages from all cellular domains. In this context, unlike the virus-first hypothesis and the escape hypothesis, or their hybrid formulations, which are based on the principle of viral evolution towards complexity, and which dominate the current scientific literature, the fusion hypothesis is consistent with the well-documented reductive evolution of thousands of intracellular parasitic microorganisms. This prompts the critical question: Why would viruses evolve in the opposite way?
Nevertheless, the holy grail of the fusion model is that it can be addressed experimentally. Even better, because this model predicts that new incipient viruses originated from parasitic cellular lineages throughout the history of life, it is possible that this natural evolutionary process can be observed in real time. Hypothetically, Borgs are incipient viral lineages that originated relatively recently, through a fusion mechanism, from archaeal ancestors evolutionarily related to their hosts [1, 2]. More extraordinary though, as I previously discussed [2, 4] some extant parasitic cellular lineages, such as parasitic red algae, are currently at various stages in their evolutionary transition into viral lineages.
Do the current data and observations regarding the biology and life cycle of parasitic red algae support a scientific transition of the fusion hypothesis into an established fact? The fusion of these parasites with their hosts cells is surely a fact. The use of host cell resources, including, in my assessment, the host cell translation machinery and ribosomes, to synthesize their specific proteins and other components is also a fact. Another fact is that after replicating their genome using host-cell resources, these parasites direct the morphogenesis of their reproductive, spore-like, transmissible forms, which initiate a new life cycle. So, are some parasitic red algae viruses, and has the fusion hypothesis transitioned into a fact?
References:
Bandea, C., Will Borgs Illuminate the Evolutionary Origin of Ancestral Viral Lineages? bioRxiv, 2021: p. https://www.biorxiv.org/con....
Bandea, C., New evidence supports the hypothesis that Borgs are incipient viral lineages. bioRxiv, 2023: p. https://www.biorxiv.org/content/10.1101/2023.08.01.549754v1#comments.
Bandea, C.I., A new theory on the origin and the nature of viruses. J Theor Biol, 1983. 105(4): p. 591-602.
Bandea, C., The Origin and Evolution of Viruses as Molecular Organisms. Nature Precedings, 2009: p. https://www.nature.com/articles/npre.2009.3886.1.
Bandea, C.I., A unifying scenario on the origin and evolution of cellular and viral domains. Nature Precedings, 2009: p. https://doi.org/10.1038/npre.2009.3888.1.
Bandea, C.I., Are Antarctic Nanohaloarchaeota emerging viral lineages? Preprints, 2019: p. https://doi.org/10.20944/preprints201911.0308.v1.
Green, R.G., ON THE NATURE OF FILTERABLE VIRUSES. Science, 1935. 82(2132): p. 443-5.
Lwoff, A., The concept of virus. J Gen Microbiol, 1957. 17(2): p. 239-53.
Forterre, P., Giant viruses: conflicts in revisiting the virus concept. Intervirology, 2010. 53(5): p. 362-78.
Racaniello, V., The virus and the virion. Virology Blog. About Viruses and Viral Diseases, 2010: p. https://www.virology.ws/2010/07/22/the-virus-and-the-virion/.
Forterre, P., Manipulation of cellular syntheses and the nature of viruses: The virocell concept. Comptes rendus. Chimie, 2011. 14(4): p. 392-399.
Claverie, J.M. and C. Abergel, Giant viruses: The difficult breaking of multiple epistemological barriers. Stud Hist Philos Biol Biomed Sci, 2016. 59: p. 89-99.
Nasir, A., E. Romero-Severson, and J.M. Claverie, Investigating the Concept and Origin of Viruses. Trends Microbiol, 2020. 28(12): p. 959-967.
Enquist, L.W. and V. Racaniello, Virology: From Contagium Fluidum to Virome. In: Fields Virology, Vol. 4. Fundamentals, 7th Edition edited by P. M. Howley and D. M. Knipe, Wolters Kluwer. 2024.
Kostyrka, G., La place des virus dans le monde vivant. PhD Thesis, Université Panthéon-Sorbonne-Paris I, 2018: p. https://tel.archives-ouvertes.fr/tel-02359424/document.
Forterre, P. and M. Krupovic, The origin of virions and virocells: the escape hypothesis revisited, in Viruses: essential agents of life. 2012, Springer. p. 43-60.
Luria, S. and J. Darnell, General Virology 1965, New-York: Wiley.
Moniruzzaman, M., et al., Dynamic genome evolution and complex virocell metabolism of globally-distributed giant viruses. Nat Commun, 2020. 11(1): p. 1710.
Correa, A.M.S., et al., Revisiting the rules of life for viruses of microorganisms. Nat Rev Microbiol, 2021. 19(8): p. 501-513.
Rosenwasser, S., et al., Virocell Metabolism: Metabolic Innovations During Host-Virus Interactions in the Ocean. Trends Microbiol, 2016. 24(10): p. 821-832.
Howard-Varona, C., et al., Phage-specific metabolic reprogramming of virocells. Isme j, 2020. 14(4): p. 881-895.
Braga, L.P.P., et al., Novel virocell metabolic potential revealed in agricultural soils by virus-enriched soil metagenome analysis. Environ Microbiol Rep, 2021. 13(3): p. 348-354.
DeLong, J.P., et al., Towards an integrative view of virus phenotypes. Nat Rev Microbiol, 2022. 20(2): p. 83-94.
Depuydt, C.E., et al., Human Papillomavirus (HPV) virion induced cancer and subfertility, two sides of the same coin. Facts Views Vis Obgyn, 2016. 8(4): p. 211-222.
Bandea, C.I., Endogenous viral etiology of prion diseases. Nature Precedings, 2009: p. https://www.nature.com/articles/npre.2009.3887.1.
Bandea, C.I., The Prion Hypothesis at Forty: Enlightening or Deceptive? J Alzheimers Dis, 2022: p. https://www.j-alz.com/editors-blog/posts/prion-hypothesis-forty-enlightening-or-deceptive.
Caetano-Anollés, G., J.M. Claverie, and A. Nasir, A critical analysis of the current state of virus taxonomy. Front Microbiol, 2023. 14: p. 1240993.
Krupovic, M., V.V. Dolja, and E.V. Koonin, Origin of viruses: primordial replicators recruiting capsids from hosts. Nat Rev Microbiol, 2019. 17(7): p. 449-458.
Yutin, N., Y.I. Wolf, and E.V. Koonin, Origin of giant viruses from smaller DNA viruses not from a fourth domain of cellular life. Virology, 2014. 466-467: p. 38-52.
Williams, T.A., T.M. Embley, and E. Heinz, Informational gene phylogenies do not support a fourth domain of life for nucleocytoplasmic large DNA viruses. PLoS One, 2011. 6(6): p. e21080.
Moreira, D. and P. López-García, Evolution of viruses and cells: do we need a fourth domain of life to explain the origin of eukaryotes? Philos Trans R Soc Lond B Biol Sci, 2015. 370(1678): p. 20140327.
Koonin, E.V., V.V. Dolja, and M. Krupovic, The logic of virus evolution. Cell Host Microbe, 2022. 30(7): p. 917-929.
On 2024-02-26 12:11:46, user lemon wrote:
What is the phenotype of HIF1α and VHL double knockout?
On 2024-02-26 08:01:28, user rock dong wrote:
Dear Chenhao zhang, etc, could you share the dataset you used to compare Highfold vs AfCycDesign, with a download link? I hope to self compare your new algorithm vs AfCycDesign on your curated dataset that's 4.1.1/4.1.2/4.1.3. It would be best you can share your data curation methon for 4.1.3. thanks!!
On 2024-02-26 07:07:50, user Ayansh wrote:
This preprint is now published in the Journal of Biomolecular Structure and Dynamics and is available at https://doi.org/10.1080/073....