PMID: 23384228

Gene: VHL

StandardizedReferenceSequence: NM_000551.3

Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Higher risk of pheochromocytoma was associated with missense mutations that result in substitution of a surface amino acid (p<=0.004) than for patients with missense mutations that disrupt the structural integrity of the VHL gene product (pVHL) or other loss of function mutations (either germline deletions or truncating mutations). This missense mutation (c.332G>A), affecting surface residue of pVHL, was found in 3 VHL type 1 families with 10 affected individuals altogether. Four of 10 individuals had retinal angioma, 6 had cerebellar hemangioblastoma, and 2 had renal cell carcinoma.

GroupID: 5

DiseaseAssertion: assumed VHL

GroupSize: 5

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: 5 of the 573 patients discussed in this paper were found to the mutation belonging to 1 family. This mutation (c.176delC) was found in 1 VHL family with 5 patients.

GroupPresentingHPOs: HP:0006880; HP:0005584; HP:0009711 (cerebellar hemangioblastoma, renal cell carcinoma; retinal capillary hemangioma)

GroupHPOFreeText: 3 patients had retinal angiomas diagnosed at a mean age of 22Y, 4 patients had cerebellar hemangioblastomas diagnosed at a mean age of 24Y, and 2 patients had RCCs with a mean age of diagnosis of 60Y.

GroupNotHPOs: HP:0002666 (pheochromocytoma)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table S1.

Variant: p.P59Rfs*8 (c.176delC)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: CA432536374 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.176delC

gnomAD: N/A

VariantEvidence: N/A

MutationType: minus_1_frameshift_variant

CivicName: P59fs (c.176delC)

MultipleGeneVariants: N/A

GroupID: 7

DiseaseAssertion: assumed VHL

GroupSize: 7

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: 7 of the 573 patients discussed in this paper were found to the mutation belonging to 1 family. This mutation (c.194delC) was found in 1 VHL family with 7 patients.

GroupPresentingHPOs: HP:0006880; HP:0005584; HP:0009711; HP:0002666 (cerebellar hemangioblastoma, renal cell carcinoma; retinal capillary hemangioma, pheochromocytoma)

GroupHPOFreeText: 3 patients had retinal angiomas diagnosed at a mean age of 18Y, 2 patients had cerebellar hemangioblastomas diagnosed at a mean age of 33Y, and 2 patients had RCCs with a mean age of diagnosis of 30Y and one single patient had pheos diagnosed at age 20Y.

GroupNotHPOs: N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table S1.

Variant: p.S65Wfs*2 (c.194delC)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: CA432536395 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.194del

gnomAD: N/A

VariantEvidence: N/A

MutationType: minus_1_frameshift_variant

CivicName: S65FS (c.194delC)

MultipleGeneVariants: N/A

Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amino acid or that disrupt the structural integrity of the VHL gene product (pVHL). Age-related risks of retinal hemangoblastomas and renal cell carcinoma were higher in patients with nonsense or frameshift mutations. Southern blot and/or MLPA analysis by whole blood detected this mutation. This c.166dupG mutation was found in a VHL patient with retinal angiomas at 24Y old and cerebellar hemangioblastoma at 15Y old.

GroupID: None

DiseaseAssertion: VHL

GroupSize:2

GroupNumberMales:N/A

GroupNumberFemales:N/A

GroupEthnicity: N/A

GroupAgeRange: ≥12

GroupInfo: The two patients were grouped by mutation.

GroupPresentingHPOs: HP:0001732 (abnormality of the pancreas)

GroupHPOFreeText: N/A

GroupNotHPOs:N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167L(c.500G>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 526685 https://www.ncbi.nlm.nih.gov/clinvar/variation/526685/

CAID:N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName:R167L(c.500G>T)

MultipleGeneVariants: N/A

GroupID: None

DiseaseAssertion: VHL

GroupSize: 2

GroupNumberMales:N/A

GroupNumberFemales:N/A

GroupEthnicity: N/A

GroupAgeRange: ≥12

GroupInfo: The two patients were grouped by mutation.

GroupPresentingHPOs: HP:0001732 (abnormality of the pancreas)

GroupHPOFreeText: N/A

GroupNotHPOs:N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.S65W(c.194C>G)

GroupProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID:43597 https://www.ncbi.nlm.nih.gov/clinvar/variation/43597/

CAID:N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType:missense_variant;transversion

CivicName: S65W(c.194C>G)

MultipleGeneVariants: N/A

A study of 103 patients with VHL retinal manifestations and 108 patients without VHL retinal manifestations extracted from the French VHL database revealed that the number of hemangioblastomas appeared higher in patients who had a substitution when compared with patients with a truncated protein. Detected by PCR and SSCP, this mutation was found in a 1 patient, without retinal hemangioblastomas, but other manifestations are not clearly stated. No family information or relation was provided. Recorded in paper as c.417_418delTC, this automaps to NM_000551.3:c.419_420delTC (p.L140fs). This is possibly previously published in PMID: 15300849

A study of 103 patients with VHL retinal manifestations and 108 patients without VHL retinal manifestations extracted from the French VHL database revealed that the number of hemangioblastomas appeared higher in patients who had a substitution when compared with patients with a truncated protein. Detected by PCR and SSCP, this mutation p.R108L*52 (c.322_323insTG) was found in a 1 patient, without retinal hemangioblastomas, but other manifestations are not clearly stated. No family information or relation was provided. This is possibly previously published in PMID: 15300849

GroupID/ KindredID: VHL 65

Case: Sex unknown, Age unknown, Iranian

DiseaseAssertion: assumed VHL

FamilyInfo: One patient with the given mutation is stated to belong to VHL family 65

CasePresentingHPOs: HP:0009711; HP:0010797; HP:0001737; HP:0000107; HP:0005584; HP:0008261 (retinal capillary hemangioma, hemangioblastoma, pancreatic cysts, renal cyst, renal cell carcinoma, pancreatic islet cell adenoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Q164* (c.490C>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: p.Q164* (c.703C>T)

ClinVarID: 223228 https://www.ncbi.nlm.nih.gov/clinvar/variation/223228/

CAID: CA357060 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.490C%3ET

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: Q164* (c.490C>T)

MultipleGeneVariants: N/A

GroupID/ KindredID: VHL 13

Case: Sex unknown, Age unknown, German

DiseaseAssertion: assumed VHL

FamilyInfo: One patient with the given mutation is stated to belong to VHL family 13

CasePresentingHPOs: HP:0009711; HP:0010797; HP:0002666; HP:0000107; HP:0005584 (retinal capillary hemangioma, hemangioblastoma, pheochromocytoma, renal cyst, renal cell carcinoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R161G (c.481C>G)

CaseProblemVariantFreeText: N/A

LegacyVariant: p.R161G (c.694C>G)

ClinVarID: 618484 https://www.ncbi.nlm.nih.gov/clinvar/variation/618484

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: R161G (c.481C>G)

MultipleGeneVariants: N/A

GroupID/ KindredID: VHL 55

DiseaseAssertion: assumed VHL

GroupSize: 2

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: German

GroupAgeRange: N/A

GroupInfo: 2 patients with the given mutation belonging to VHL family 55

GroupPresentingHPOs: HP:0009711; HP:0010797 (retinal capillary hemangioma, hemangioblastoma)

GroupHPOFreeText: Both (2) patients have retinal angiomas (retinal capillary hemangioma) and CNS hemangioblastomas

GroupNotHPOs: N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R113* (c.337C>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: p.R113* (c.550C>T)

ClinVarID: 220414 https://www.ncbi.nlm.nih.gov/clinvar/variation/220414/

CAID: CA348491 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.337C%3ET

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: R113* (c.337C>T)

MultipleGeneVariants: N/A

Of 65 VHL families from central Europe, 53 were identified with germline mutations. This missense mutation was found in 2 unrelated, German families. The mutation of V74G (c.221T>G) was referred to in the paper by c.434T>G due to a difference in transcript sequence. The VHL type 1 family of 4 affected individuals had 2 patients with retinal angiomas, 5 with hemangioblastomas of the central nervous system, and one with renal cyst and noted with a primitive neuroectodermal tumor (family VHL 53). The VHL type 2B family of 3 affected individuals had one patient with retinal angioma, 3 with hemangioblastomas of the central nervous system, one with pheochromocytoma, one with renal cell carcinoma and renal cysts, one with pancreatic cysts, and one with cystadenomas of the epididymis (family VHL 9). This study contains supporting evidence of pathogenicity due to cosegregation with disease in multiple affected family members in a gene definitively known to cause the disease (ACMG code: PP1).

Medical records of 26 patients with germline mutations of the VHL gene who had been diagnosed with VHL disease in Severance Hospital (Seoul, Republic of Korea) and Samsung Medical Center (Seoul, Republic of Korea) between 2003 and 2012 were respectively reviewed. Peripheral blood leukocytes were isolated and directly sequenced using the BigDye Terminator Cycle Sequencing Ready Reaction kit on an ABI Prism 3130 genetic analyzer (Applied Biosystems). One patient presented with the c.173insC germline variant of the VHL gene. Patient 1, 17Y female previously reported in PMID 19270817, presented with CNS hemangioblastoma and a family history positive for VHL.

PatientID: None

KindredID: 48

Case: M, 25Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CohortInfo: A total of 190 patients recruited by the COMETE network over 15 years were included in the study.

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: The patient had one benign pheochromocytoma.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET, SDHB, SDHC, SDHD

PreviouslyPublished: N/A

SupplementalData: Patient information was extracted from Table 1 of Supplementary.

Variant: p.R167Q (c.500G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVar: 2216 https://www.ncbi.nlm.nih.gov/clinvar/variation/2216/

CAID: N/A

gnomAD: 0.000003977 https://gnomad.broadinstitute.org/variant/3-10191507-G-A

VariantEvidence:N/A

MutationType: missense_variant;transition

CivicName: R167Q (c.500 G >A)

MultipleGeneVariants: N/A

PatientID: None

KindredID: VHL1

Case: M, 22Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CohortInfo: A total of 190 patients recruited by the COMETE network over 15 years were included in the study.

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: The patient had one benign pheochromocytoma.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET/SDHB/SDHC/SDHD

PreviouslyPublished: N/A

SupplementalData: Table 1 of Supplementary

Variant: p.S80N (c.239G>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 1070179, https://www.ncbi.nlm.nih.gov/clinvar/variation/1070179/

CAID: N/A

gnomAD: N/A

VariantEvidence: Somatic VHL variant c.1-?_642+?del (complete deletion) was found in the tumor tissue.

MutationType: missense_variant;transversion

CivicName: S80N (c.239G>A)

MultipleGeneVariants: N/A

PatientID: None (Brother 2)

KindredID: ASP (L63P)

Case: M, Age Unknown, Hungarian

DiseaseAssertion: Asymptomatic

FamilyInfo: Family screening showed the presence of the L63P mutation in two out of the three clinically healthy brothers, whereas the mutation was absent in a clinically healthy son. Proband of this family presented with an apparently sporadic pheochromocytoma and the L63P germline mutation of the VHL gene.

CasePresentingHPOs: N/A

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.L63P (c.188T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2227, https://www.ncbi.nlm.nih.gov/clinvar/variation/2227/

CAID: N/A

gnomAD: N/A

VariantEvidence: Variant reported as L63P and cDNA change was mapped to c.188T>C.

MutationType: missense_variant;transition

CivicName: L63P (c.188T>C)

MultipleGeneVariants: N/A

PatientID: IP (Proband)

KindredID: C

Case: M, 35Y0M, Hungarian

DiseaseAssertion: VHL

FamilyInfo: Index patient presented with cerebellar hemangioblastoma, renal cysts, pancreatic cyst and bilateral renal cell carcinomas. Family members were not available for clinical and genetic screening except a brother whose screening revealed no abnormality.

CasePresentingHPOs: HP:0006880; HP:0005562; HP:0005584; HP:0001737 (Cerebellar hemangioblastoma, Multiple renal cysts, Renal cell carcinoma, Pancreatic cysts)

CaseHPOFreeText: Patient was operated for cerebellar hemangioblastoma at the age of 33 years. Preoperative clinical screening also showed renal cysts. Two years later, a pancreatic cyst and bilateral renal cell carcinomas were found and the patients underwent bilateral nephrectomy with subsequent chronic hemodialysis. Diagnosed with VHL Type 1.

CaseNotHPOs: HP:0002666; HP:0009711 (Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: Exon 3 Deletion (c.464-?_642+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Heterozygous deletion of Exon 3.

MutationType: exon_loss_variant

CivicName: Exon 3 Deletion

MultipleGeneVariants: N/A

PatientID: Daughter

KindredID: 1

Case: F, 35Y0M, Korean

DiseaseAssertion: VHL

FamilyInfo: Father and brother presented with the same VHL mutation. Brother presented with a meningioma, pancreatic lesions and bilateral renal cysts all at 38Y. Father presented with cerebellar hemangioblastoma 49Y, retinal hemangioblastoma 64Y, bilateral renal cell carcinoma 51Y and multiple pancreatic neuroendocrine tumors 64Y.

CohortInfo: Thirteen unrelated patients with germline VHL mutations who were diagnosed with VHL disease were evaluated.

CasePresentingHPOs: HP:0006880; HP:0005584; HP:0030405; HP:0000107 (Cerebellar hemangioblastoma, Renal cell carcinoma, Pancreatic endocrine tumor, Renal cyst)

CaseHPOFreeText: Cerebellar hemangioblastoma, renal cell carcinoma, multiple pancreatic neuroendocrine tumors and bilateral renal cysts all at 35Y. Diagnosed with VHL Type 1.

CaseNotHPOs: HP:0002666; HP:0009711 (Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.M54Gfs*77 (c.160_161del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA913189210, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.160_161del

gnomAD: N/A

VariantEvidence: N/A

MutationType: deletion; minus_2_frameshift_variant

CivicName: M54Gfs*77 (c.160_161delAT)

MultipleGeneVariants: N/A

PatientID: 9

KindredID: 8

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: No family information provided.

CasePresentingHPOs: HP:0002666; HP:0002668 (Pheochromocytoma; paraganglioma)

CaseHPOFreeText: Patient had pheochromocytoma and/or paraganglioma (table 2).

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.TF136C (c.407G>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 496065, https://www.ncbi.nlm.nih.gov/clinvar/variation/496065/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant, transversion

CivicName: F136C (c.407T>G)

MultipleGeneVariants: N/A

Description This report studied the prevalence of germline variants in Japanese PPGL patients. Of the 370 PPGL original Japanese probands, this cohort consisted of 15 patients with pheochromocytoma and/or paragangliomas with germline VHL varaints. Blood samples were used to examine 7 genes: MAX, SDHB, SDHC, SDHD, TMEM127, VHL, and RET, using Sanger sequencing. Of these 15 VHL patients: 10 had bilateral PCC, 4 had PCC with abdominal/thoracic PGL, and one had metastatic PPGL. The variant R161Q (c.482G>A) was one of the 15 found in a patient with PPGL. Their family history or further manifestations were not detailed.

A cohort of 36 PCCs and four functional PGL tumours were analysed by exome-seq and high-density SNP-array analysis using tumor paired blood. This specified germline VHL mutation (tumor ID: V-PH-29T) belonged to a female diagnosed with bilateral phaeochromocytoma at age 8Y, surgery at 10Y. She also had a personal history including extra adrenal abdominal phaeochromocytoma and lymph node involvement at age 8yrs. The p.V84L (c.250G>C) VHL mutation was also accompanied by an additional germline variant: MEN1: c.512G>C (p.Arg171Pro). It was stated that there were no familial cancers/syndromic illnesses with this patient. Additionally, this patient was likely previously published in PMID: 26796762 (ID: WM02).

PatientID: V-PH-29T

KindredID: 5

Case: F, 10Y0M, Ethnicity Unknown

DiseaseAssertion: assumed VHL

FamilyInfo: No familial cancers/syndromic illnesses

CasePresentingHPOs: HP:0002666; HP:0006737; HP:0002733 (pheochromocytoma, extraadrenal pheochromocytoma, abnormality of the lymph nodes)

CaseHPOFreeText: diagnosed with bilateral phaeochromocytoma at age 8Y, surgery at 10Y. She also had a personal history including extra adrenal abdominal phaeochromocytoma and lymph node involvement at age 8yrs

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET, SDHA, SDHB, SDHC, TMEM127

PreviouslyPublished: Possibly; 26796762 (ID: WM02)

SupplementalData: Yes (see table S1 and S10)

Variant: p.V84L (c.250G>C)

LegacyVariant: Given as ENSP00000256474.2:p.Val84Leu (G>C)

CaseProblemVariantFreeText: N/A

ClinVarID: 229860 https://www.ncbi.nlm.nih.gov/clinvar/variation/229860/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: V84L (c.250G>C)

MultipleGeneVariants: Germline, MEN1, c.512G>C (p.Arg171Pro)

37 Danish patients diagnosed with VHL before 18 years from a prospective cohort study from Denmark's National vHL Research Database (Binderup et al., 2013) were assessed. One family with 3 patients (Family ID 5) was found with a germline truncating mutation in the VHL gene (Q145*; c.433C>T). Patient 1 was diagnosed at 0Y and had 1 retinal hemangioblastoma at 17Y. Patient 2 was diagnosed at 3Y and had 13 CNS hemangioblastomas at 11Y, 13Y, 15Y, and 17Y, 1 retinal hemangioblastoma at 13Y, and 2 pancreatic cysts at 16Y. Patient 3 was diagnosed at 9Y and had 1 retinal hemangioblastoma at 12Y, 1 pancreatic cyst at 12Y, 1 CNS hemangioblastoma at 15Y, and kidney disease at 12Y. They were 28Y, 20Y and 22Y respectively at the end of the study.

PatientID: None

KindredID: 1

Case: M, 66Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: The patient’s elder sister died of a cerebellar tumor of unknown pathology at 30Y. As well, the patient’s son presented with cerebellar hemangioblastoma and was diagnosed with VHL disease.

CasePresentingHPOs: HP:0002666; HP:0006880; HP:0100009; HP:0005584 (Pheochromocytoma, cerebellar hemangioblastoma, intracranial meningioma, renal cell carcinoma)

CaseHPOFreeText: The 66Y male patient presented with mild dementia, and was found to have multiple tumours in the cerebellum; the tumours were resected, and histological examination determined that the tumours included meningothelial meningioma and a capillary hemangioblastoma. The patient was also found to have renal cell carcinoma, and underwent nephrectomy. The patient had also previously undergone resection for a giant pheochromocytoma associated with malignant hypertension 20 years prior at 46Y. The patient died of multiple cerebral infarctions and RCC three years after the surgery to remove the cerebellar tumours.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.L158V(c.472C>G)

LegacyVariant: p.L158V(c.685C>G)

ClinVarID: 567944, https://www.ncbi.nlm.nih.gov/clinvar/variation/567944/

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: L158V(c.472C>G)

MultipleGeneVariants: N/A

A cohort of VHL patients from the Greater Toronto Area in Canada were retrospectively reviewed. Patient ID 49 was found with this germline mutation (c.461C>T) and pheochromocytoma/paraganglioma. Whether patients were related, age, and sex data was not reported.

PatientID: 13

KindredID: 13

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797 (hemangioblastoma)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0006770; HP:0100634; HP:0030405; HP:0009711; HP:0030421 (clear cell renal cell carcinoma; Neuroendocrine neoplasm, pancreatic neuroendocrine neoplasm, retinal capillary hemangioma, Epididymal neoplasm)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Yes; see table S1 for VHL subject genetic and manifestation information.

Variant: c.463+37_463+39del

LegacyVariant: N/A

CaseProblemVariantFreeText: recorded in paper as: Intron 2 +37-39 del TGT. Contacted authors for clarification and confirmation of c.463+37_463+39del

ClinVarID: 223218 https://www.ncbi.nlm.nih.gov/clinvar/variation/223218/

CAID: N/A

gnomAD: 0.0003606 https://gnomad.broadinstitute.org/variant/3-10188351-GGTT-G

VariantEvidence: N/A

MutationType: inframe_insertion


CivicName: c.463+37_463+39del

MultipleGeneVariants: N/A

PatientID: None (X)

KindredID: 7

Case: Sex and Ethnicity unknown; Age <18Y0M

DiseaseAssertion: Asymptomatic

FamilyInfo: Total of 13 family members belonging to Family 7 (see Table 2; or follow KindredID 7)

CasePresentingHPOs: None

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 16572651

SupplementalData: N/A

Variant: p.G34Rfs*98 (c.99_100insA)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: CA2018007671 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2018007671

gnomAD: N/A

VariantEvidence: N/A

MutationType: plus_1_frameshift_variant

CivicName: G34Rfs (c.99_100insA)

MultipleGeneVariants: N/A

PatientID: Unknown

KindredID: 4

Case: M, 20Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: This is the proband. 3 members of this family were found to have the mutation and pheochromocytoma. Other declared diseases in this family are: hemangioblastoma, parathyroid nodule, and esophageal carcinoma but the presenting patient is unclear. Relationship between these family members is unclear.

CohortInfo: Patients with the diagnosis of familial or sporadic PHEO and their relatives.

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: Follow-up 25 years later but it is unclear if this pertained to all affected family members. Pheochromocytoma diagnosed at age 20. VHL type 2C.

CaseNotHPOs: HP:0005584 (Renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Table 1

Variant: p.P138= (c.414A>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223206, https://www.ncbi.nlm.nih.gov/clinvar/variation/223206/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: P138= (c.414A>G)

MultipleGeneVariants: N/A

PatientID: Unknown

KindredID: 2

Case: Sex Unknown, 53Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: This is the proband. 5 members of this family were found to have the mutation and pheochromocytoma. Other declared diseases in this family are: paraganglioma, hemangioblastoma, lung metastases and spinal hemangioblastoma but the presenting patient is unclear.Relationship between these family members is unclear.

CohortInfo: Patients with the diagnosis of familial or sporadic PHEO and their relatives.

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: Follow-up 18 years later but it is unclear if this pertained to all affected family members.

CaseNotHPOs: HP:0005584 (Renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Table 1

Variant: p.P138= (c.414A>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223206, https://www.ncbi.nlm.nih.gov/clinvar/variation/223206/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: P138= (c.414A>G)

MultipleGeneVariants: N/A

PatientID: III:2

KindredID: 1

Case: M, 34Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Look to proband (III:3) for extensive family info.

CohortInfo: Patients with the diagnosis of familial or sporadic PHEO and their relatives.

CasePresentingHPOs: HP:0002666; HP:0000107 (Pheochromocytoma, Renal cyst)

CaseHPOFreeText: Unilateral pheochromocytoma diagnosed at age 34.

CaseNotHPOs: HP:0005584 (Renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Figure 1

Variant: p.P138= (c.414A>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223206, https://www.ncbi.nlm.nih.gov/clinvar/variation/223206/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: P138= (c.414A>G)

MultipleGeneVariants: N/A

GroupID: 4325

DiseaseAssertion: assumed VHL

GroupSize: 4

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: Familial VHL stated; 4 family members recorded with this mutation.

GroupPresentingHPOs: HP:0010797; HP:0009711 (hemangioblastoma, retinal capillary hemangioma)

GroupHPOFreeText: 1 of the 4 (1/4) patients were recorded with a hemangioblastoma; 3/4 with retinal angiomas

GroupNotHPOs: HP:0002666; HP:0005584 (Pheochromocytoma, renal cell carcinoma)

GroupNotHPOFreeText: None of the patients were recorded to have RCC or pheos

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.S65W (c.194C>G)

CaseProblemVariantFreeText: N/A

LegacyVariant: p.S65W (c.407C>G)

ClinVarID: 43597 https://www.ncbi.nlm.nih.gov/clinvar/variation/43597/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: S65W (c.194C>G)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 1

Case: M, 36Y0M, Danish

DiseaseAssertion: Asymptomatic

FamilyInfo: The patient's half brothers both carried the mutation, one was asymptomatic and one had renal cell carcinoma. The patient's mother was found to carry the mutation and had breast cancer. The maternal grandmother also harboured the mutation but was asymptomatic. See Figure 1 for family pedigree.

CasePresentingHPOs: N/A

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.P81S (c.241C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2233 https://www.ncbi.nlm.nih.gov/clinvar/variation/2233/

CAID: N/A

gnomAD: 0.0002179 https://gnomad.broadinstitute.org/variant/3-10183772-C-T

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName:P81S (c.241C>T)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 1

Case: F, 52Y0M, Danish

DiseaseAssertion: Breast carcinoma

FamilyInfo: The patient had three sons all of whom carried the VHL mutation. Two of the sons were asymptomatic and one had renal cell carcinoma. The affected son also had a P2P mutation and he had a child who was found to have the VHL mutation (P2P). The patient's mother had the mutation but was also asymptomatic. See Figure 1 for family pedigree.

CasePresentingHPOs: HP:0003002 (Breast carcinoma)

CaseHPOFreeText: The patient had breast cancer at age 34.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.P81S (c.241C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2233 https://www.ncbi.nlm.nih.gov/clinvar/variation/2233/

CAID: N/A

gnomAD: 0.0002179 https://gnomad.broadinstitute.org/variant/3-10183772-C-T

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName:P81S (c.241C>T)

MultipleGeneVariants: N/A

A case series described 3 patients with endolymphatic sac tumor and VHL disease. Case #2 showed a female patient who was previously diagnosed with VHL at 30Y and previously had cerebellar hemangioblastomas, (unspecified) renal cancer, retinal hemangioblastoma. At 46Y, the patient was found with endolymphatic sac tumour. Genetic testing confirmed a VHL germline mutation in the patient (c.473T>C) but not in the patient's family, suggesting a de novo mutation.

Medical records of 31 Asian Indian genetically proven VHL patients with pheochromocytoma/paraganglioma were studied. Two unrelated patients were genetically confirmed (PCR and Sanger sequencing) to have a germline frameshift mutation at c.224_226delTCT of the VHL gene. Patient 21 (M): presented with unilateral pheochromocytoma (29Y), pancreatic cysts (29Y), renal cell carcinoma (29Y) and a central nervous system hemangioblastoma (29Y). He has a negative family history. Patient 26 (F): presented with unilateral pheochromocytoma (45Y) and a negative family history.

PatientID: 19

KindredID: 9

Case: F, 13Y0M, Indian

DiseaseAssertion: VHL

FamilyInfo: No relevant family history.

CohortInfo: This retrospective study was conducted at Department of Endocrinology of a tertiary care health centre in Western India. Patients presented to our institute between 2008 and 2016 were included in the study. During the study period a total of 33 patients were suspected to have VHL syndrome based on clinical features among whom 31 patients were found to have mutation in VHL gene. All patients are of Asian Indian descent.

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: Bilateral pheochromocytoma.

CaseNotHPOs: HP:0009711; HP:0010797; HP:0001737; HP:0005584; HP:0030405; HP:0002668 (Retinal capillary hemangioma, Hemangioblastoma, Pancreatic cysts, Renal cell carcinoma, Pancreatic endocrine tumor, Paraganglioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R167Q (c.500G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2216, https://www.ncbi.nlm.nih.gov/clinvar/variation/2216/

CAID: N/A

gnomAD: 0.000003977, https://gnomad.broadinstitute.org/variant/3-10191507-G-A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: R167Q (c.500G>A)

MultipleGeneVariants: N/A

PatientID: 10

KindredID: 4

Case: F, 40Y0M, Indian

DiseaseAssertion: VHL

FamilyInfo: 2 other members of this family presented with the same variant. Patient 9 (Gen 2) and bilateral pheochromocytoma and sympathetic paraganglioma and PNET. Another member of the family (relation unclear) presented with the same variant and bilateral pheochromocytoma and sympathetic paraganglioma, retinal angioma, neural hemangioblastomas and PNET.

CohortInfo: This retrospective study was conducted at Department of Endocrinology of a tertiary care health centre in Western India. Patients presented to our institute between 2008 and 2016 were included in the study. During the study period a total of 33 patients were suspected to have VHL syndrome based on clinical features among whom 31 patients were found to have mutation in VHL gene. All patients are of Asian Indian descent.

CasePresentingHPOs: HP:0002666; HP:0030405 (Pheochromocytoma, Pancreatic endocrine tumor)

CaseHPOFreeText: Unilateral pheochromocytoma. Cause of death: metastatic PNET.

CaseNotHPOs: HP:0009711; HP:0010797; HP:0001737; HP:0005584; HP:0002668 (Retinal capillary hemangioma, Hemangioblastoma, Pancreatic cysts, Renal cell carcinoma, Paraganglioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Y98S (c.293A>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 219160, https://www.ncbi.nlm.nih.gov/clinvar/variation/219160/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: Y98S (c.293A>C)

MultipleGeneVariants: N/A

PatientID: 14

KindredID: 5

Case: Sex Unknown, 40Y0M, Indian

DiseaseAssertion: VHL

FamilyInfo: 2 other members of this family presented with the same variant. Patient 13 (Gen 2) presented with bilateral pheochromocytoma. Patient 12 (Gen 2) presented with bilateral pheochromocytoma and sympathetic paraganglioma.

CohortInfo: This retrospective study was conducted at Department of Endocrinology of a tertiary care health centre in Western India. Patients presented to our institute between 2008 and 2016 were included in the study. During the study period a total of 33 patients were suspected to have VHL syndrome based on clinical features among whom 31 patients were found to have mutation in VHL gene. All patients are of Asian Indian descent.

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: Bilateral pheochromocytoma and sympathetic paraganglioma.

CaseNotHPOs: HP:0009711; HP:0010797; HP:0001737; HP:0005584; HP:0030405; HP:0002668 (Retinal capillary hemangioma, Hemangioblastoma, Pancreatic cysts, Renal cell carcinoma, Pancreatic endocrine tumor, Paraganglioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.L198P (c.593T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223235, https://www.ncbi.nlm.nih.gov/clinvar/variation/223235/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: L198P (c.593T>C)

MultipleGeneVariants: N/A

Germline mutational data on VHL was gathered from various countries to assess variation in germline mutations that produce disease within different populations. Families were grouped according to three possible outcomes of disease: renal cell carcinoma without pheochromocytoma, renal cell carcinoma with pheochromocytoma, or pheochromocytoma alone. SSCP and denaturing gradient gel electrophoresis identified mutations in 300/469 (63%) of families affected with VHL. This germline familial VHL mutation (A56fs (c.165_166insA)) was taken from the Cambridge, Department of Pathology database, with an unknown number of members belonging to family ID 146CA. It was reported in the paper as c.378insA due to a difference in transcript reference. Table 5 lists all ID and mutations associated with individuals without detailed clinical information. Other phenotypes are possible, however not detailed here.

GroupID/ KindredID: 41F

DiseaseAssertion: VHL

GroupSize: N/A

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: This germline familial VHL mutation was taken from the Neuro Olcologie database in Paris, with an unknown number of members belonging to Family ID 41F. Table 3 lists all ID and mutations associated with individuals possessing renal carcinoma, without pheochromocytoma.

GroupPresentingHPOs: HP:0005548 (renal cell carcinoma)

GroupHPOFreeText: Described as a VHL family with RCC, without pheochromocytoma. Other phenotypes are likely, however not detailed in this publication

GroupNotHPOs: HP:0002666 (pheochromocytoma)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Y156* (c.468T>G)

LegacyVariant: p.Y156* (c.681T>G)

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351756053 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.468T>G

gnomAD: N/A

VariantEvidence: This paper declares this variant is predicted to compromise the Elongin-binding site by truncating the protein.

MutationType: stop_gained

CivicName: Y156* (c.468T>G)

MultipleGeneVariants: N/A

Germline mutational data on VHL was gathered from various countries to assess variation in germline mutations that produce disease within different populations. Families were grouped according to three possible outcomes of disease: renal cell carcinoma without pheochromocytoma, renal cell carcinoma with pheochromocytoma, or pheochromocytoma alone. SSCP and denaturing gradient gel electrophoresis identified mutations in 300/469 (63%) of families affected with VHL. This germline familial VHL mutation (V170D (c.509T>A)) was taken from the Utrecht, The Netherlands database and the Cambridge, Department of Pathology database. It had an unknown number of members belonging to Family ID R-D, reported in Table 4, as being found in VHL families with pheochromocytoma. Additionally, it was reported in table 5, specified as families without detailed clinical information, under family ID 77CA. It was reported in the paper as c.722T>A due to a difference in transcript reference.

GroupID/ KindredID: 41CA

DiseaseAssertion: VHL

GroupSize: N/A

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: This germline familial VHL mutation was taken from the Cambridge, Department of Pathology database, with an unknown number of members belonging to Family ID 41CA. Table 3 lists all ID and mutations associated with individuals possessing renal carcinoma, without pheochromocytoma.

GroupPresentingHPOs: HP:0005548 (renal cell carcinoma)

GroupHPOFreeText: Described as a VHL family with RCC, without pheochromocytoma. Other phenotypes are likely, however not detailed in this publication

GroupNotHPOs: HP:0002666 (pheochromocytoma)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.L153Cfs*6 (c.457delC)

LegacyVariant: FS (c.670delC)

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA432421920 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.457delC

gnomAD: N/A

VariantEvidence: This paper declares this variant is predicted to compromise the Elongin-binding site by truncating the protein.

MutationType: minus_1_frameshift_variant

CivicName: L153fs (c.457delC)

MultipleGeneVariants: N/A

GroupID/ KindredID: 49CA

DiseaseAssertion: VHL

GroupSize: N/A

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: This germline familial VHL mutation was taken from the Cambridge, Department of Pathology database, with an unknown number of members belonging to Family ID 49CA. Table 4 lists all ID and mutations associated with individuals with pheochromocytoma.

GroupPresentingHPOs: HP:0002666 (pheochromocytoma)

GroupHPOFreeText: Described as a VHL family with pheochromocytoma. Other phenotypes are likely, including renal cell carcinoma, however not detailed here.

GroupNotHPOs: N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.P154L (c.461C>T)

LegacyVariant: p.P154L (c.674C>T)

CaseProblemVariantFreeText: N/A

ClinVarID: 649525 https://www.ncbi.nlm.nih.gov/clinvar/variation/649525/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: P154L (c.461C>T)

MultipleGeneVariants: N/A

Germline mutational data on VHL was gathered from various countries to assess variation in germline mutations that produce disease within different populations. Families were grouped according to three possible outcomes of disease: renal cell carcinoma without pheochromocytoma, renal cell carcinoma with pheochromocytoma, or pheochromocytoma alone. SSCP and denaturing gradient gel electrophoresis identified mutations in 300/469 (63%) of families affected with VHL. This germline familial VHL mutation (W117C (c.351G>T)) was taken from the Neuro Olcologie database in Paris and the National Cancer Institute databases, with an unknown number of members belonging to Family IDs 13F, 564NCI, 1239NCI. It was reported in the paper as c.564G>T due to a difference in transcript reference. As reported in Table 3, this mutation is found in VHL families without pheochromocytoma, and with renal cell carcinoma. Later publications reference this cohort as being reported in PMIDs: 7728151 and 9829911.

GroupID/ KindredID: 98CA

DiseaseAssertion: VHL

GroupSize: N/A

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: This germline familial VHL mutation was taken from the Cambridge, Department of Pathology database, with an unknown number of members belonging to Family ID 98CA. Table 3 lists all ID and mutations associated with individuals possessing renal carcinoma, without pheochromocytoma.

GroupPresentingHPOs: HP:0005548 (renal cell carcinoma)

GroupHPOFreeText: Described as a VHL family with RCC, without pheochromocytoma. Other phenotypes are likely, however not detailed in this publication

GroupNotHPOs: HP:0002666 (pheochromocytoma)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Q96P (c.287A>C)

LegacyVariant: p.Q96P (c.500A>C)

CaseProblemVariantFreeText: N/A

ClinVarID: 625233 https://www.ncbi.nlm.nih.gov/clinvar/variation/625233/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: Q96P (c.287A>C)

MultipleGeneVariants: N/A

GroupID/ KindredID: 3759NCI, 3760NCI

DiseaseAssertion: VHL

GroupSize: N/A

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: This germline familial VHL mutation was taken from the National Cancer Institute database, with an unknown number of members belonging to Family IDs 3759NCI and 3760NCI. Table 3 lists all ID and mutations associated with individuals possessing renal carcinoma, without pheochromocytoma.

GroupPresentingHPOs: HP:0005548 (renal cell carcinoma)

GroupHPOFreeText: Described as a VHL family with RCC, without pheochromocytoma. Other phenotypes are likely, however not detailed in this publication

GroupNotHPOs: HP:0002666 (pheochromocytoma)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: 7728151

SupplementalData: N/A

Variant: p.Y112* (c.336C>A)

LegacyVariant: p.Y112* (c.549C>A)

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA16602183 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.336C>A

gnomAD: N/A

VariantEvidence: This paper declares this variant is predicted to compromise the Elongin-binding site by truncating the protein.

MutationType: stop_gained

CivicName: Y112* (c.336C>A)

MultipleGeneVariants: N/A

GroupID/ KindredID: 147CA

DiseaseAssertion: VHL

GroupSize: N/A

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: This germline familial VHL mutation was taken from the Cambridge, Department of Pathology database, with an unknown number of members belonging to family ID Family 147CA. Table 5 lists all ID and mutations associated with individuals without detailed clinical information.

GroupPresentingHPOs: N/A

GroupHPOFreeText: Described as a VHL family without detailed clinical information. Other phenotypes are possible, however not detailed here.

GroupNotHPOs: N/A

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.D121Mfs*38 (c.361delG)

LegacyVariant: FS (c.574delG)

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA432421803 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.361delG

gnomAD: N/A

VariantEvidence: This paper declares this variant is predicted to compromise the Elongin-binding site by truncating the protein.

MutationType: minus_1_frameshift_variant

CivicName: D121fs (c.361delG)

MultipleGeneVariants: N/A

GroupID/ KindredID: 9YO, 51CE, 4327NCI, 160CA

DiseaseAssertion: VHL

GroupSize: N/A

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: This germline familial VHL mutation was taken from the Department of Uroglogy, Yokohama database, the Munich, university of Freiburg and Institute of Pathology database, the National Cancer Institute database, and the Cambridge, Department of Pathology database, with an unknown number of members belonging to Family ID 9YO, 51CE, 4327NCI, 160CA. Table 3 lists all ID and mutations associated with individuals possessing renal carcinoma, without pheochromocytoma.

GroupPresentingHPOs: HP:0005548 (renal cell carcinoma)

GroupHPOFreeText: Described as a VHL family with RCC, without pheochromocytoma. Other phenotypes are likely, however not detailed in this publication

GroupNotHPOs: HP:0002666 (pheochromocytoma)

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.N78S (c.233A>G)

LegacyVariant: p.N78S (c.446A>G)

CaseProblemVariantFreeText: N/A

ClinVarID: 93326 https://www.ncbi.nlm.nih.gov/clinvar/variation/93326/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: N78S (c.233A>G)

MultipleGeneVariants: N/A

PatientID: 16

KindredID: 16

Case: 44Y0M, sex unknown, ethnicity unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0009711 (hemangioblastoma; renal cell carcinoma; retinal capillary hemangioma)

CaseHPOFreeText: See Table 1&2 for retinal capillary hemangioma information

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.S65L (c.194C>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 182975 https://www.ncbi.nlm.nih.gov/clinvar/variation/182975/

CAID: N/A

gnomAD: https://gnomad.broadinstitute.org/variant/3-10183725-C-T

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: S65L (c.194C>T)

MultipleGeneVariants: N/A

PatientID: P6

KindredID: 3

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: pheochromocytoma

FamilyInfo: N/A

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Y98H (c.292T>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVar: 2223 https://www.ncbi.nlm.nih.gov/clinvar/variation/2223/

CAID: N/A

gnomAD: 0.00001343 https://gnomad.broadinstitute.org/variant/3-10183823-T-C

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: Y98H (c.292T>C)

MultipleGeneVariants: N/A

GroupID: None

KindredID:9

DiseaseAssertion: VHL

GroupSize: 3

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: American Admixed/Latino

GroupAgeRange: N/A

GroupInfo: Three members of a South American family expressed this c.344delA mutation.

GroupPresentingHPOs: HP:0010797, HP:0009711, HP:0005584 (hemangioblastoma, retinal capillary hemangioma, renal cell carcinoma)

GroupHPOFreeText: N/A

GroupNotHPOs: HP:0002894, HP:0002666 (neoplasm of the pancreas, pheochromocytoma )

GroupNotHPOFreeText: N/A

GroupPreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.H115Pfs*44 (c.344delA)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID:N/A

CAID: CA70049370 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.344delA

gnomAD: N/A

VariantEvidence: N/A

MutationType: minus_1_frameshift_variant

CivicName: H115Pfs*44(c.344delA) and P61=(c.183C>G)

MultipleGeneVariants: Germline, VHL,c.c.183C>G (p.Pro61Pro)

ArticleReferenceSequence: Assumption: variants assumed to have been documented by the author under reference sequence NM_000551.3

GenotypingMethod: The three exons of the VHL gene were amplified by PCR. PCR products were sequenced in both strands with Big Dye terminators (Applied Biosystems) and sequences were collected and analysed on an ABI Prism 377 (Applied Biosystems). The same PCR primers were used in the sequencing reactions, with the exception of exon 3, which was sequenced in the sense direction with an internal primer 3I 5‘ CGTTCCTTGTACTGAGACCCT 3‘. Germline rearrangements involving part or the entire VHL gene were detected by quantitative Southern blotting using g7 cDNA11 and a β globin probe.

SamplingMethod: peripheral blood

Germline mutations were found in 20 Brazilian, VHL probands and their families. Peripheral blood samples were taken and genomic DNA was sequenced using PCR and Southern Blotting. The three exons of the VHL gene were amplified by PCR, sequenced in both strands with Big Dye terminators (Applied Biosystems), and collected and analysed on an ABI Prism 377 (Applied Biosystems). Germline rearrangements involving part or the entire VHL gene were detected by quantitative Southern blotting using g7 cDNA11 and a β globin probe. This mutation, H115Pfs*44 (c.344delA) , was found in a VHL type 1 family of 3 affected individuals (VHL family 9). This mutation caused a frameshift to occur leading to the protein terminating at residue 157. One had hemangioblastomas of the central nervous system, one with retinal angiomas, and one with renal carcinoma. Within this family a second mutation was also discovered in the VHL gene, P61= (183C>G), which was assumed to not be deleterious. ACMG codes as follows: A frameshift mutation in a gene where loss-of-function is a known mechanism of disease (PVS1). Cosegregation with disease in multiple affected family members in a gene definitively known to cause the disease (PP1).

ArticleReferenceSequence: Assumption: variants assumed to have been documented by the author under reference sequence NM_000551.3

GenotypingMethod: DNA sequencing

SamplingMethod: blood

PatientID: 3

KindredID: 3

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs HP:0001737; HP:0005584 (Pancreatic cysts; Renal cell carcinoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Yes

Variant: p.Y175* (c.525C>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 1298905, https://www.ncbi.nlm.nih.gov/clinvar/variation/1298905/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: Y175* (c.525C>A)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 97

Case: Age, sex ethnicity unknown

DiseaseAssertion: unknown; paper focused only on pheochromocytoma

FamilyInfo: No specific family info was present; although this was recorded as a family germline mutation belonging to Family ID 97

CasePresentingHPOs: N/A

CaseHPOFreeText: Unknown

CaseNotHPOs: HP:0002666 (pheochromocytoma)

CaseNotHPOFreeText: No presence of phaeochromocytoma in family

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.W117* (c.351G>A)

CaseProblemVariantFreeText: N/A

LegacyVariant: p.W117* (c.564G>A)

ClinVarID: N/A

CAID: CA351753679 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.351G%3EA

gnomAD: 0.000003976 https://gnomad.broadinstitute.org/variant/3-10188208-G-A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: W117* (c.351G>A)

MultipleGeneVariants: N/A

In a study of 138 unrelated VHL families, 109 germline mutations were found. Missense mutations were more frequently found in families with pheochromocytoma (PC). Deletions. Nonsense, and frameshift mutations were more frequently found in families without PC. Large deletions and mutations predicted to cause truncated protein were associated with lower risk of PC. The mutation p.F76del was referred to in the paper by c.440delTCT due to a difference in transcript sequence. This inframe deletion was found in 2 VHL families: ID 134, ID 144. It was also published in other PMIDs thought to be the same members: PMID: 32179488, 17024664

PatientID: VH3

KindredID: F2

Case: F, 18Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Family history of pheo (type 2 VHL) - Her asymptomatic sibling however was tested and did not carry the mutation nor had large deletion.

CasePresentingHPOs: HP:0002666; HP:0030405 (pheochromocytoma; pancreatic endocrine tumor)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 24735130

SupplementalData: N/A

Variant: c.463+3A>G

LegacyVariant: IVS2+3A>G

CaseProblemVariantFreeText: N/A

ClinVarID: 428796 https://www.ncbi.nlm.nih.gov/clinvar/variation/428796/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: splice_site_variant

CivicName: Splice Region (c.463+3A>G)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 3

Case: Unknown, 36Y0M, Chinese

DiseaseAssertion:VHL

FamilyInfo: None.

CasePresentingHPOs: HP:0010797, HP:0005584, HP:0001732 (hemangioblastoma, renal cell carcinoma, abnormality of the pancreas)

CaseHPOFreeText:The patient presented with hemangioblastoma at age 35. One year later he was found to have renal cell carcinoma and pancreatic cysts or tumors.

CaseNotHPOs: HP:0009711, HP:0002666 (retinal capillary hemangioma, pheochromocytoma)

CaseNotHPOFreeText: No epididymal/ovarian cystadenomas.

CasePreviousTesting: N/A

PreviouslyPublished: 29330336

Variant: p.V62Efs*68 (c.185_193delTGCTGCGCTinsAGCA)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID:N/A

CAID: CA2499306941 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2499306941

gnomAD:N/A

VariantEvidence: N/A

MutationType: delins

CivicName:V62Efs*68 (c.185_193delTGCTGCGCTinsAGCA)

MultipleGeneVariants: N/A

PatientID: None

KindredID: 8

Case: Unknown, 24Y0M, Chinese

DiseaseAssertion:VHL

FamilyInfo: None.

CasePresentingHPOs: HP:0010797, HP:0005584, HP:0001732 (hemangioblastoma, renal cell carcinoma, abnormality of the pancreas)

CaseHPOFreeText:The patient presented with hemangioblastoma at age 18. At age 24 the patient had renal cell carcinoma and cysts/tumours of the pancreas.

CaseNotHPOs: HP:0009711, HP:0002666(retinal capillary hemangioma, pheochromocytoma)

CaseNotHPOFreeText: No epididymal/ovarian cystadenomas.

CasePreviousTesting: N/A

PreviouslyPublished: 29330336

Variant: p.W117S(c.350G>C)

LegacyVariant:N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA351753671 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.350G%3EC

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName:W117S(c.350G>C)

MultipleGeneVariants: N/A

Using polymerase chain reaction (PCR)-direct sequencing and universal primer quantitative fluorescent multiplex–PCR, mutations in VHL gene in 19 VHL disease families recruited from the Department of Urology, Peking University First Hospital in the period from 2009 to 2012 were examined. One proband (family 9) was found to carry the mutation c.343delC in exon 2 of the VHL gene. The proband presented with hemangioblastoma at age 26 and renal cell carcinoma and abnormality of the pancreas at age 36. The patient had negative VHL family history. This patient was previously published in 29330336.

PMID: 24132471

Gene: VHL

StandardizedReferenceSequence: NM_000551.3

PatientID: 6

KindredID: 6

Case: F, 49Y0M, Ethnicity unknown

DiseaseAssertion: VHL

FamilyInfo: None

CasePresentingHPOs: HP:0030405 (pancreatic endocrine tumor)

CaseHPOFreeText: See Table 1 for more information

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.L89P (c.266T>C)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 182979 https://www.ncbi.nlm.nih.gov/clinvar/variation/182979/

CAID: CA020207 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.266T%3EC

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: L89P (c.266T>C)

MultipleGeneVariants: N/A

PatientID: N/A

KindredID: 3

Case: F, 53Y0M, Italian

DiseaseAssertion: VHL

FamilyInfo: Sister was thought to be sporadic (non familial) in 2001 with a spinal T7 tumor - genetic testing in this paper describes her (the sister, case 3) without any mutations.

CasePresentingHPOs: HP:0006880 (cerebellar hemangioblastoma)

CaseHPOFreeText: The patient had a single cerebellar hemangioblastoma that was diagnosed at age 53. She had a germline point and 2 somatic point mutations found in the DNA of her CHB. These mutations are discussed further in PMID: 24335534

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 24335534 (pt. HGB-25)

SupplementalData: Supplemental Digital Content 1. Primer Sequences for VHL gene amplification, LOH and methylation analysis.

Variant: p.D126Rfs*6 (c.375_376insA)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA2573320316 https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573320316

gnomAD: N/A

VariantEvidence: N/A

MutationType: plus_1_frameshift_variant

CivicName: P25L(c.74C>T) and D126Rfs*6(c.375_376insA) and E55Rfs(c.163delG)

MultipleGeneVariants: Somatic, VHL, c.163delG (p.Glu55Argfs), Germline, VHL, c.74C>T (p.Pro25Leu)

PCR amplification was performed searching for point mutation in the entire VHL coding sequence and promoter region, including exon-intron boundaries. Amplification was performed in a Gene Amp PCR System 9700 (Perkin Elmer). When mutations were detected in DNA from tumor samples, it was searched for in the corresponding peripheral blood DNA in order to identify germline mutations. For case 3, table 2 described no mutations found through analysis of HB and peripheral blood. Case 3 was thus said to have sporadic, non-familial disease - however, her sister at 53Y had a single cerebellar hemangioblastoma, with 1 germline and 2 somatic point mutations. These are described further in PMID: 24335534 as P25L(c.74C>T) [germline], D126Rfs*6(c.375_376insA) [somatic], and E55Rfs(c.163delG) [somatic]. It is unclear as to whether the germline mutation was confirmed in case 3.

PatientID: None

KindredID: 1

Case: F, 6Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Family history revealed VHL in the father and grandfather. Molecular genetic analysis confirmed familial VHL by detecting a mutation of the VHL gene in the patient, her father, and her sister. Magnetic resonance imaging revealed spinal hemangioblastomas and kidney cysts in the father, but not in the patient.

CasePresentingHPOs: HP:0009711 (retinal capillary hemangioma)

CaseHPOFreeText: The patient had symptomatic juxtapapillary capillary retinal angioma with associated epiretinal membrane (ERM). Pars Plana Vitrectomy and removal of ERM resulted in substantial improvement of vision.

CaseNotHPOs: HP:0009713, HP:0000107( Spinal Hemangioblastoma, Renal Cyst)

CaseNotHPOFreeText: Magnetic resonance imaging revealed spinal hemangioblastomas and kidney cysts in the father, but not in the patient.

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.S65W (c.194C>G)

LegacyVariant: (407C>G)

CaseProblemVariantFreeText: N/A

ClinVar: 43597 https://www.ncbi.nlm.nih.gov/clinvar/variation/43597/

CAID: CA020099 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA020099

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: S65W (c.194C>G)

MultipleGeneVariants: N/A

PatientID: III-3

KindredID: 1

Case: M, 25Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Family in India but Ethnicity not explicitly confirmed. Father and sister with the same mutation. Sister presented at age 17 with palpitation, blurred vision, blurring vision, bilateral papilledema and bilateral pheochromocytoma. Father presented at age 14 with hypertension and a right adrenal pheochromocytoma. He had severe headache, recurrent seizures, abnormal heart sounds and recurring pheochromocytoma in the left hypochondrium at age 22. Mother and uncle were negative for the mutation.

CasePresentingHPOs: HP:0002666; HP:0002315 (Pheochromocytoma, Hypertension)

CaseHPOFreeText: Presented at 10 years of age with severe hypertension. He was found to have bilateral pheochromocytoma. Asymptomatic at age 25.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Figure 1

Variant: p.R82L (c.245G>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 526675, https://www.ncbi.nlm.nih.gov/clinvar/variation/526675/

CAID: N/A

gnomAD: N/A

VariantEvidence: Authors carried out analysis of VHL variant p.Arg82Leu with six different in silico tools namely SIFT, I-Mutant3, PhD-SNP, MutPred, PolyPhen2 and SNPs&GO in order to determine the pathogenic potential of the variant.

MutationType: missense_variant;transversion

CivicName: R82L (c.245G>T)

MultipleGeneVariants: N/A

GroupID: 8A

Case: Sex, Age, Ethnicity unknown

DiseaseAssertion: VHL

FamilyInfo: None. The patient with the given mutation in this study was a VHL patient with pancreatic ICTs.

CasePresentingHPOs: HP:0030405 (pancreatic endocrine tumor)

CaseHPOFreeText: Patient has islet cell tumors (ICTs), or listed as pancreatic endocrine tumor.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.G114S (c.340G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 583094 https://www.ncbi.nlm.nih.gov/clinvar/variation/583094/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: G114S (c.340G>A)

MultipleGeneVariants: N/A

GroupID: 29A

DiseaseAssertion: VHL

GroupSize: 2

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: 2 VHL patients with the given VHL mutation and manifestation were grouped in this study.

GroupPresentingHPOs: HP:0030405 (pancreatic endocrine tumor)

GroupHPOFreeText: Patients have islet cell tumors (ICTs), or listed as pancreatic endocrine tumor. Other clinical manifestations outside of a pancreatic neuroendocrine tumor are possible, but were not discussed.

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.L198Q (c.593T>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 1066145 https://www.ncbi.nlm.nih.gov/clinvar/variation/1066145/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: L198Q (c.593T>A)

MultipleGeneVariants: N/A

A retrospective series of case reports were analyzed to detect and compare changes in VHL disease-associated tumors before and after sunitinib treatment. Sanger sequencing of blood identified the mutations discussed. Two members of a family tested positive for a c.239G>T VHL mutation leading to a p.Ser80Ile protein change. The first family member (patient 1) described is a 44 year old female, whose presentations included bilateral adrenal pheochromocytoma at 29, pancreatic neuroendocrine tumor at 38, renal cysts and renal cell carcinoma at 42, and cerebellar hemangioblastoma at 43. Her daughter underwent cortex-sparing adrenalectomies for bilateral pheochromocytomas as well as hemangioblastoma resection in her left cerebellum at age of 19 years, although testing for VHL is not stated. Patient 2, the brother of the first patient, presented with bilateral adrenal pheochromocytoma at 38, cerebellar hemangioblastoma at 46, and clear cell renal cell carcinoma at 54.

PMID: 31034483

Gene: VHL

StandardizedReferenceSequence: NM_000551.3

Out of 48 Danish families presenting with renal cell carcinoma, one patient was found to harbor the germline mutations c.3G>A (p.Met1Ile) and c.631A>C (p.Met211Leu) in the VHL gene. This patient was diagnosed with clear cell renal cell carcinoma (age of onset: 28). He had a family history of testicular cancer in his maternal uncle. The patient has been through the national screening program for putative VHL, which includes MRI of the cerebrum, spinal medulla and abdomen, neurological examination, auditory tests, ocular examination and blood work for chromogranin A and metanephrines, with normal results. The proband also presented with the germline variant c.1729+8T>C in BAP1. Unclear if/which other family members were genetically tested.

PatientID: 28

KindredID: 28

Case: M, 34Y0M, Korean

DiseaseAssertion: Paraganglioma

FamilyInfo: No information provided.

CasePresentingHPOs: HP:0002668 (paraganglioma)

CaseHPOFreeText: The patient presented with paraganglioma (see table 3).

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET, NF1, MAX, SDHA/SDHAF2/SDHB/SDHC/SDHD

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.P103L (c.308C>T))

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 1488386, https://www.ncbi.nlm.nih.gov/clinvar/variation/1488386/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transition

CivicName: P103L (c.308C>T)

MultipleGeneVariants: N/A

ArticleReferenceSequence: Not specified – Assumption: variants assumed to have been documented by the author under reference sequence NM_000551.3

GenotypingMethod: All exon of the VHL gene were examined by direct sequencing. Polymerase chain reaction (PCR) were performed using primers designed to flank the splice junctions of target exons. Also, multiplex ligation-dependent probe amplification (MLPA) was carried out using the SALSA P016-C2 VHL Kit (MRC Holland, Amsterdam, Holland) for VHL

SamplingMethod: peripheral blood

PatientID: 3

KindredID: 3

Case: F, 16Y0M, Korean

DiseaseAssertion: pheochromocytoma

FamilyInfo: No family history of PPGLs

CasePresentingHPOs: HP:0002666 (pheochromocytoma)

CaseHPOFreeText: recurrent PPGL - initially removed at 2.5cm; no metastases; increased NE/NM hormone levels

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.P81L (c.242C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 36899 https://www.ncbi.nlm.nih.gov/clinvar/variation/36899/

CAID: N/A

gnomAD: 0.000004349 https://gnomad.broadinstitute.org/variant/3-10183773-C-T

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: P81L (c.242C>T)

MultipleGeneVariants: N/A

PatientID: 27

KindredID: 9

Case: F, 40Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0001737; HP:0001732; HP:0005584; HP:0010797 (Pancreatic cysts, Abnormality of the pancreas, Renal cell carcinoma, Hemangioblastoma)

CaseHPOFreeText: The proband, patient 27, presented at age 36 with a CNS hemangioblastoma, and renal cell carcinoma and multiple pancreatic cysts and tumors at 40.

CaseNotHPOs: HP:0002666, HP:0009711 (Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336). This mutation was also published in PMID 32179488 in reference to one patient with VHL disease type 1 in this paper with the c.227_229del variant. However, it is unclear whether patient #27, #28, or #30 is specifically published in PMID 32179488.

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.F76del (c.227_229del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA357012; https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.224_226del

gnomAD: N/A

VariantEvidence: N/A

MutationType: inframe_deletion

CivicName: F76del (c.224_226delTCT)

MultipleGeneVariants: N/A

PatientID: 6

KindredID: 3

Case: F, 37Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: No family information was provided for this patient. A total of 291 patients from 115 different families were included for analysis. VHL mutation confirmation was verified in at least one patient of each family.

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001737; HP:0001732 (Hemangioblastoma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas)

CaseHPOFreeText: The proband presented with a CNS hemangioblastoma at age 34. At age 37, they presented with renal cell carcinoma and multiple pancreatic cysts/tumors.

CaseNotHPOs: HP:0009711; HP:0002666; (Retinal Capillary Hemangioma, Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.S65W (c.194C>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 43597, https://www.ncbi.nlm.nih.gov/clinvar/variation/43597/

CAID:

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: S65W (c.194C>G)

MultipleGeneVariants: N/A

PatientID: 98

KindredID: 33

Case: M, 43Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 97) presented with a CNS hemangioblastoma at 37, retinal angioma at 20, and renal cell carcinoma and multiple pancreatic cysts/tumors at age 29. Their brother, patient 98, presented with a retinal angioma at age 32, and at age 43 presented with renal cell carcinoma and multiple pancreatic cysts/tumors.

CasePresentingHPOs: HP:0009711; HP:0005584; HP:0001737; HP:0001732 (Retinal capillary hemangioma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas)

CaseHPOFreeText: The proband's brother, patient 98, presented with a retinal angioma at age 32, and at age 43 presented with renal cell carcinoma and multiple pancreatic cysts/tumors.

CaseNotHPOs: HP:0002666; HP:0010797 (Pheochromocytoma, Hemangioblastoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.P97Afs*35 (c.287_288insA)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA432420510, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.287_288insA

gnomAD: N/A

VariantEvidence: N/A

MutationType: plus_1_frameshift_variant

CivicName: P97Afs*35 (c.287_288insA)

MultipleGeneVariants: N/A

A retrospective cohort study included all the VHL patients diagnosed at Peking University First Hospital (Beijing, China) prior to June 1 2016. A total of 291 patients from 115 different families were included for analysis. A male patient (family #16, patient #45) was confirmed with this missense mutation (p.R82P(c.245G>C)) in the VHL gene. He was diagnosed with CNS hemangioblastoma at 40Y and multiple pancreatic cysts or tumours at 26Y. This patient was also published in a paper by Wang et al., 2018 (PMID: 29330336).

PatientID: 187

KindredID: 72

Case: M, 67Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband, patient 72, has multiple family members with the same mutation. Her father (patient 73) had a CNS hemangioblastoma at 65, renal cell carcinioma at 54, and multiple pancreatic cysts/tumors at 67. Her sister 2 (second sister) had multiple pancreatic cysts/tumors at 36, and a CNS hemangioblastoma at 39. Her sister 3 had multiple pancreatic cysts/tumors at 32, and a retinal angioma at 34. The proband's sister 1 had a CNS hemangioblastoma at 22, but passed away before they could be diagnosed/ confirmed with the mutation.

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001732; HP:0001737 (Hemangioblastoma, Renal cell carcinoma, Abnormality of the pancreas, Pancreatic cysts)

CaseHPOFreeText: The patient presented with a CNS hemangioblastoma at 65, renal cell carcinoma at 54, and multiple pancreatic cysts/tumors at 67.

CaseNotHPOs: HP:0009711; HP:0002666 (Retinal capillary hemangioma, Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.R167W (c.499C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2218; https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007954; https://gnomad.broadinstitute.org/variant/3-10191506-C-T?dataset=gnomad_r2_1

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

PatientID: 272

KindredID: 106

Case: F, 51Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband, patient 272, has a daughter and a father who both passed away before diagnosis/ before they could undergo genetic testing. The proband's daughter (patient 273) had a CNS hemangioblastoma at age 13, and the proband's father (patient 274) had a CNS hemangioblastoma at age 30.

CasePresentingHPOs: HP:0001737; HP:0001732; HP:0010797 HP:0009711; HP:0005584 (Pancreatic cysts, Abnormality of the pancreas, Hemangioblastoma, Retinal capillary hemangioma, Renal cell carcinoma)

CaseHPOFreeText: The proband presented with a retinal angioma at 49, and at 51 presented with a CNS hemangioblastoma, renal cell carcinoma, and multiple pancreatic cysts/tumors.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This cohort was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: Exon 2 Deletion (c.341-?_463+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 2 Deletion

MultipleGeneVariants: N/A

PatientID: 157

KindredID: 58

Case: M, Age Unknown, Chinese

DiseaseAssertion: Asymptomatic

FamilyInfo: The proband (patient 155) has a sister (patient 156) and a nephew (son of sister, patient 157) that were both genetically confirmed with the mutation. The sister presented with a CNS hemangioblastoma at 21 and multiple pancreatic cysts/tumors at 27, and the nephew was asymptomatic at the time of analysis.

CasePresentingHPOs: N/A

CaseHPOFreeText: The proband's nephew (son of sister) was asymptomatic at the time of analysis.

CaseNotHPOs: HP:0002666; HP:0005584; HP:0009711; HP:0001737; HP:0001732; HP:0010797 (Pheochromocytoma, Renal cell carcinoma, Retinal capillary hemangioma, Pancreatic cysts, Abnormality of the pancreas, Hemangioblastoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.E160Dfs*10 (c.480del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA432423139; https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA432423139

gnomAD: N/A

VariantEvidence: N/A

MutationType: minus_1_frameshift_variant

CivicName: E160fs (c.480delG)

MultipleGeneVariants: N/A

PatientID: 14

KindredID: N/A

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CohortInfo: The authors evaluated 64 VHL patients (32 women and 32 men) with renal involvement of whom 54/64 had undergone renal surgery or a radiofrequency thermal ablation procedure for RCC. In 10/64 VHL patients, at least one or more RCC were diagnosed, however at the time of diagnosis an indication for treatment was not yet present. For all patients several CT/MRI scans existed for retrospective description of tumour growth kinetics.

CasePresentingHPOs: HP:0005584 (Renal cell carcinoma)

CaseHPOFreeText: This is a tumor resolution study (VHL patients were investigated based on the presence of renal tumors.) No other phenotypic information is available.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table S1 describes 19 patients with missense mutations, including this patient.

Variant: p.P154L (c.461C>T)

LegacyVariant: c.674C>T

CaseProblemVariantFreeText: N/A

ClinVarID: 649525, https://www.ncbi.nlm.nih.gov/clinvar/variation/649525/?new_evidence=true

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: P154L (c.461C>T)

MultipleGeneVariants: N/A

PatientID: III-5

KindredID: Family A

Case: F, 32Y0M, Ethnicity unknown

DiseaseAssertion: VHL

FamilyInfo: Patient’s grandfather (I-1), now deceased, and aunt (II-1) had CNS/spinal hemangioblastoma and the confirmed VHL gene mutation. Her mom II-2 had confirmed VHL and CNS hemangioblastoma; and her cousin (III-6) has renal cell carcinoma and CNS/spinal hemangioblastoma and also the confirmed VHL gene mutation. Her uncle (II-3) has confirmed VHL gene and pancreatic and renal cysts. Her brother and sister (III-3; III-4) both were found with the confirmed VHL gene mutation; III-3 with retinal hemangioblastoma and CNS/spinal hemangioblastomas and III-4 with pancreatic and ovarian cysts. IV-1 and IV-3, were confirmed with the VHL gene mutation although no other manifestations.

CasePresentingHPOs: HP:0010797; HP:0009711 (CNS hemangioblastoma, retinal capillary hemangioblastoma)

CaseHPOFreeText: developed hemangioblastoma at the optic nerve in her left eye at the age of 16. At the age of 30, patient A III-5 underwent surgery for a CNS hemangioblastoma.

CaseNotHPOs: HP:0005584; HP:0002666 (renal cell carcinoma, pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: Deletion of exon 3 (c.464-?_642+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 3 Deletion

MultipleGeneVariants: N/A

Between 1994 and 2001, the Dutch VHL working group conducted DNA analysis on 146 probands with VHL-associated manifestations. DNA of probands was extracted from peripheral blood samples. Exons 1, 2 and 3 of the VHL gene and their flanking untranslated and intronic coding sequences were amplified by PCR and subjected to semi-automated sequence analysis. Screening for structural rearrangements, including deletions, involving the VHL gene was performed by Southern blot analysis and the multiplex ligation-dependent probe amplification (MLPA) assay. Deletions encompassing the entire VHL gene were confirmed by FISH analysis on lymphocytes from affected individuals. VHL mutations were identified in 43 families. This mutation (c.509T>A) was detected in 14 VHL patients (family no. 18). Six had retinal hemangioblastoma, 9 had CNS hemangioblastoma, 7 had renal cell carcinoma, 8 had renal cysts, 4 had pheochromocytoma, 5 had pancreatic cysts, 2 had endolymphatic sac tumors, 1 with adnexal papillary tumor of probably mesonephric origin, and 5 had hepatic cysts.

PatientID: None

KindredID: 3

Case: Age, Sex, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Familial VHL

CasePresentingHPOs: HP:0009711; HP:0010797; HP:0001737; HP:0005584; HP:0000107 (retinal capillary hemangioma, hemangioblastoma, pancreatic cysts, renal cell carcinoma, renal cyst)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0002666 (pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: Previously reported, HGMD (Human Gene Mutation Database: http://uwcmml1s.uwcm.ac.uk/uwcm/mg/search/120488.html)

SupplementalData: N/A

Variant: p.S65W (c.194C>G)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 43597 https://www.ncbi.nlm.nih.gov/clinvar/variation/43597/

CAID: CA020099 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.194C%3EG

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: S65W (c.194C>G)

MultipleGeneVariants: N/A

GroupID/ KindredID: 23

DiseaseAssertion: VHL

GroupSize: 2

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: N/A

GroupAgeRange: N/A

GroupInfo: Described are 2 patients with this familial VHL mutation. They belong to family 23 and have the germline VHL mutation of c.583C>T

GroupPresentingHPOs: HP:0009711; HP:0010797; HP:0002666 (retinal capillary hemangioma, hemangioblastoma, pheochromocytoma)

GroupHPOFreeText: 2 familial patients affected; 2 rHAB (retinal hemangioblastoma), 1 cHAB (central nervous system hemangioblastoma), 1 pheochromocytoma.

GroupNotHPOs: HP:0005584; HP:0001737 (renal cell carcinoma, pancreatic cysts)

GroupNotHPOFreeText: None have the above manifestations

GroupPreviousTesting: N/A

PreviouslyPublished: Previously reported, HGMD (Human Gene Mutation Database: http://uwcmml1s.uwcm.ac.uk/uwcm/mg/search/120488.html)

SupplementalData: N/A

Variant: p.Q195* (c.583C>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVar: 428794 https://www.ncbi.nlm.nih.gov/clinvar/variation/428794/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: Q195* (c.583C>T)

MultipleGeneVariants: N/A