4,329 Matching Annotations
  1. Jul 2021
    1. SciScore for 10.1101/2021.07.16.452441: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TwinStrep-tagged protein expression and purification: RBDWT, RBDQ498Y and RBDβbaculovirus were used to infect Sf9 cells in a 1:2000 dilution, for 72 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sf9</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RBDQ498Y-ACE2 complex crystallization: Sf9 insect cells were infected with RBDQ498Y and TwinStrep-tagged ACE2 (1:2000) separately for 72 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RBDQ498Y-ACE2 complex crystallization: Sf9</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequences were digested from delivery generic vectors using BamHI and NotI restriction enzymes (FastDigest) and cloned in the pAcGP67A transfer vector using Optizyme™ T4 DNA Ligase (Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pAcGP67A</div><div>suggested: RRID:Addgene_41812)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An N-terminal TwinStrep tag and 3C site containing version of ACE2 with no His tag was generated by PCR using ACE2 plasmid DNA as template.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: RRID:Addgene_164219)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structure was solved by molecular replacement using Phaser and previously deposited coordinates for RBDWT-ACE2 complex (PDB accession number 6M0J) as template, and refined using Phenix.refine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phaser</div><div>suggested: (Phaser, RRID:SCR_014219)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The final molecule was generated after several cycles of manual building in Coot followed by refinement.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. According to reports from Keefe, Bruyette & Woods (KBW), industry executives are optimistic about the prospects for the run-off reinsurance market, which they say should benefit from rising pricing trends. KBW recently hosted a series of meetings with Florida and Bermuda re/insurance executives about their outlook on various sectors of the ... Read the full article

      Industry execs optimistic about runoff, which should benefit from rising pricing trends.

    1. SciScore for 10.1101/2021.07.14.452313: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression was performed in HEK293 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike protein constructs: The SARS-CoV spike protein constructs were expressed in HEK293-6E cells and purified via a C-terminally introduced 6 X His-Tag with Ni-NTA affinity chromatography.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293-6E</div><div>suggested: RRID:CVCL_HF20)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein expression and purification: hACE2: The biotinylated hACE2-fc (residues 18-740) was purchased by Acrobiosystems and contains a C-terminal IgG1 Fc-Tag (residues 100-330), followed by a biotinylated Avitag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Acrobiosystems</div><div>suggested: (ACRObiosystems, RRID:SCR_012550)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. An idea is a fiction.

      certainly a fiction is a kind of idea but it's not a "lie"....it is just fictional...it may be a lie if some agent remove the "fiction" tag and stamp "historical" instead..

      Anyway..is mathemathics fictional? aren't they real?

    1. Reviewer #2 (Public Review):

      The paper by Huber et al. analyzes the detoxification strategy of an insect herbivore, the cockchafer, against a prominent defensive compound, taraxinic acid glucopyranosyl ester (TA-G), of dandelions, one of the beetle larvae's preferred food plants. As the authors can convincingly show a beta glucosidase, a digesting enzyme in the herbivore's gut, acts as a detoxification enzyme and simultaneously seems to induce the beetle larvae to avoid plants with this defensive compound. The data presented cover the full range from physiological and chemical analytical data exploring the fate of the plant defense compound in the larvae's digestive system to transcriptomic analyses identifying the beetle's relevant beta glucosidase with their tissue and diet specific expression level to cell culture expression of those beta glucosidases and functional verification whether they are able to deglycosylate TAG. The authors thereby home in on one specific enzyme that has the strongest TAG cleaving activity and further demonstrate its effect by silencing it via RNAi. This knock down results in significantly reduced growth of larvae exposed to the toxin, on the other hand, the presence of the enzyme was necessary to elicit the TAG avoidance behavior previously reported for cockchafer larvae.

      The manuscript flawlessly follows up on the observed detoxification ability of the beetle larvae from one organismic level to the next and provides an in depth analysis of the phenomenon. All analyses have been carefully performed, correctly analysed and fully support the conclusions drawn. The manuscript is well written and provides a well laid out case study on how digestive enzymes of an insect herbivore can be coopted to provide a specific adaptation to a preferred host plant and not only circumvent its main defense but also modulate the herbivores behavior.

    1. Every text in computer format is encoded with tags, whether this is apparent to the user or not

      I had never really wondered about the origins of tags and hashtags, even though I knew they were a somewhat recent phenomenon in terms of use by the general population. But this made me wonder if it happened as a result of the already common practice of tagging in code, or if it developed on its own. Turns out, we owe it all to programmers and wildfires!

    1. because she is the first person person she labels  her annotation with the following hashtag tag   consensus one signifying her support and that she  is the first person to weigh in

      iGracias! Frida Silva for demonstrating the scaffold (hashtag, sequence, what to write in). This is a clear example I want to share with my colleagues.

    1. SciScore for 10.1101/2021.07.05.451222: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All human donors were assessed for medical decision-making capacity using a standardized, approved assessment, and voluntarily gave informed consent prior to being enrolled in the study.<br>Field Sample Permit: Ethics Statement: The mice and rhesus macaque animal studies were approved and carried out in accordance with protocols provided to the Institutional Animal Care and Use Committee (IACUC) respectively at The Scripps Research Institute (TSRI; La Jolla, CA) under approval number 19-0020 and at Alphagenesis Institutional Animal Care and Use Committee (IACUC) under approval number AUP 19-10.<br>IACUC: Ethics Statement: The mice and rhesus macaque animal studies were approved and carried out in accordance with protocols provided to the Institutional Animal Care and Use Committee (IACUC) respectively at The Scripps Research Institute (TSRI; La Jolla, CA) under approval number 19-0020 and at Alphagenesis Institutional Animal Care and Use Committee (IACUC) under approval number AUP 19-10.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">One group of 5 mice (C57BL/6 mice (Jackson Laboratory): 3 females and 2 males), aged ∼8 weeks, were immunized with 20µg SARS-CoV-2 S protein immunogen along with 5µg of SMNP adjuvant per animal per immunization.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">For conjugation, 500 µL (500 µg/mL) of randomly biotinylated SARS-CoV-2-RBD solution was mixed with 5 mg of cleaned T1 beads.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA: 96-well half-area plates (Corning cat. #3690, Thermo Fisher Scientific) were coated overnight at 4°C with 2 μg/mL of mouse anti-His-tag antibody (Invitrogen cat. #MA1-21315-1MG, Thermo Fisher Scientific) in PBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washes, a secondary antibody conjugated with alkaline phosphatase (AffiniPure goat anti-human IgG Fc fragment specific, Jackson ImmunoResearch Laboratories cat. #109-055-008) diluted 1:1000 in 1% BSA/PBST, was added to each well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-055-008, RRID:AB_2337601)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Percentage of neutralization was calculated according to the equation:

      The 50% pseudovirus neutralizing (IC50) or binding (ID50) antibody titer was calculated by non- linear fitting the plots of luciferase signals against antibody concentrations or sera dilution ratio in Graph Pad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ID50</div><div>suggested: (bNAber Cat# bNAberID_50, RRID:AB_2491067)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For neutralization of anti-RBD antibody depleted macaque sera, the immune sera were depleted by two rounds of sequential incubation with SARS-CoV-2 RBD-conjugated with magnetic beads.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic analysis: Heavy chain sequences of neutralizing and non-neutralizing antibodies collected from animals K398 and K288 were processed using DiversityAnalyzer tool (92).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K288</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transient transfection: To express antibodies, the corresponding HC and LC plasmids were transiently transfected into the Expi293 cell (Life Technologies) at 3 x 106 cells/mL with FectoPRO PolyPlus transfection reagent (Polyplus Cat # 116-040).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To express the soluble S ectodomain proteins from SARS-CoV-1, SARS-CoV-2 and their truncations, plasmids were transfected into HEK293F cells (Life Technologies) at 1 million cells/mL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: To generate HeLa-hACE2 cells, the human ACE2 lentivirus was transduced into HeLa cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: CLS Cat# 300194/p772_HeLa, RRID:CVCL_0030)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus production: To generate the pseudoviruses, the MLV-gag/pol and MLV-CMV-Luciferase plasmids were co- transfected with full-length or variant SARS-CoV-1 or SARS-CoV-2 plasmid into HEK293T cells by using Lipofectamine 2000 (Thermo Fisher Scientific, 11668019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus entry and serum neutralization assays: To test the inhibition of pseudovirus infection by serum or mAbs, we used the stable cell line HeLa-hACE2 generated by lentivirus transduction with consistent ACE2 expression level to carry out the assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The truncated heavy chains were co-transfected with the corresponding light chains in 293Expi cells to produce the Fab.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293Expi</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One group of 5 mice (C57BL/6 mice (Jackson Laboratory): 3 females and 2 males), aged ∼8 weeks, were immunized with 20µg SARS-CoV-2 S protein immunogen along with 5µg of SMNP adjuvant per animal per immunization.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ectodomains of SARS-CoV-1 and SARS-CoV-2 were constructed by PCR amplification and Gibson assembly (NEB, E2621L) cloning into the vector phCMV3 (Genlantis, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>phCMV3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate gene fragments encoding SARS-CoV-1 RBD (residue 307-513), SARS-CoV-2 NTD (residue 1- 290), RBD (residue 320-527), RBD-SD1 (residue 320-591), and RBD-SD1-2 (residue 320-681) subdomains, PCR-amplifications were carried out from the SARS-CoV-1 and SARS-CoV-2 plasmids.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: RRID:Addgene_164583)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To produce the ACE2 lentivirus, the pBOB-hACE2 plasmid was co-transfected into HEK293T cells with lentiviral packaging plasmids pMDL, pREV, and pVSV-G (Addgene #12251, #12253, #8454) by Lipofectamine 2000 (Thermo Fisher Scientific, 11668019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBOB-hACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pMDL</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pREV</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pVSV-G</div><div>suggested: RRID:Addgene_138479)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Crystal structure determination of Fab-RBD complexes: The coding sequence for receptor binding domain (RBD; residues 333-529) of the SARS-CoV-2 spike (S) protein was synthesized and cloned into a customized pFastBac vector (84), which was designed to fuse an N-terminal gp67 signal peptide and C-terminal His6-tag to the target protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pFastBac</div><div>suggested: RRID:Addgene_1925)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protocol was approved by the UCSD Human Research Protection Program.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UCSD Human Research Protection Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation, the Protein A Sepharose was loaded into Econo-Pac columns (BioRad #7321010).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioRad</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The biotinylated proteins were evaluated by BioLayer Interferometry using the SA biosensor.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioLayer</div><div>suggested: (Harvard Medical School Center for Macromolecular Interactions Core Facility, RRID:SCR_018270)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Micrographs were collected on a ThermoFisher Tecnai Spirit microscope operating at 120kV with a FEI Eagle CCD (4k) camera at 52,000 magnification using Leginon automated image collection software (81).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Leginon</div><div>suggested: (Leginon, RRID:SCR_016731)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Particles were picked using DogPicker (82) and 3D classification was done using Relion 3.0 (83).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Relion</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Iterative model building and refinement were carried out in COOT (90, 91), respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr></table>


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 23. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. Shouldn’t Tech Developers (such as yourself) be reaching out to Schools/ Teachers/ Districts FIRST to create and design tech rather than the other way around?”

      Edit

      Reaching out again with new project MentorsOnline.NET

      Notes: 1st edit of annotation for update of info

      • 2nd use of tag: LTI-test-team
    1. Google Meet training and help

      Scenario: Team building exercise, group tag(s) sorting downstream readers/ viewers (audience).

      Note: First use of tag: LTI-test-team

    1. SciScore for 10.1101/2021.07.06.21259528: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Research phlebotomy was performed at the NIH Clinical Research Center in Bethesda, MD under protocols approved by the NIH Institutional Review Board,<br>Consent: All participants provided written informed consent.<br>Field Sample Permit: Blood sample collection and processing: Peripheral blood mononuclear cells (PBMC) were isolated by Ficoll density gradient centrifugation from whole blood collected in EDTA vacutainer tubes.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed and incubated with MSD SULFO-TAG™ anti-human IgG, IgA or IgM detection antibodies at RT for 60 minutes with shaking.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Intracellular flow cytometry: PBMC were first stained with antibodies against cell surface markers CD3, CD19, CD20 and CD27, fixed (Lysing Solution, BD Biosciences), permeabilized (Permeabilizing Solution 2; BD Biosciences) and stained with antibodies against IgG, IgA, IgD and IgM (antibody details in Extended Data Table 5).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD19</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD20</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD27</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antibodies against IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA , IgD</div><div>suggested: (MyBioSource Cat# MBS531438, RRID:AB_10577295)</div></div><div style="margin-bottom:8px"><div>IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISpot assay to enumerate SARS-CoV-2 spike-specific PB: Spike protein S1 and RBD-specific antibody-secreting PB were enumerated by modifying the antigen-specific portion of a previously described ELISpot assay31,32.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-secreting PB</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, wells of Immobilon-P polyvinylidene difluoride (PVDF) membrane 96-well plates (Millipore) were coated with 5ug/ml anti-Ig light-chain antibodies (Rockland Immunochemicals) overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Ig light-chain</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were incubated at 37°C for 5 hours, followed by overnight incubation at 4°C with biotinylated antibodies (Jackson Immunoresearch) against IgA (catalogue 109-066-011), IgG (catalogue 709-066-149), IgM (catalogue 709-066-073), or biotinylated proteins S1 (Acrobiosystems, catalogue S1N-C82E8) or RBD (Biolegend, catalogue 790904).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Modeling of association between endpoint antibody concentrations and cluster frequencies: A linear model accounting for the age and gender of the longitudinal vaccine participants was used to estimate whether cell cluster frequencies in response to vaccination were associated with SARS-COV2 spike protein (S-2P/RBD) antibody concentration at endpoint (v2D28):

      Analyses were carried out on both standardized antigen non-specific and specific frequencies, i.e., cluster cell counts as a fraction of total CD19+ cell counts and RBD+ S1+ cells within the clusters, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-COV2 spike protein (S-2P/RBD</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The DNA encoding sequence was cloned into the mammalian cell expression vector pCAGGS and confirmed by sequencing, prior to transient transfection in FreeStyle 293-F cells with 293fectin transfection reagent (ThermoFisher)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_18926)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were performed with Excel (Microsoft) and Prism 9.0 (Graphpad) software and antibody concentrations were assigned arbitrary units (AU/ml) by interpolation from the standard curve.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Densities of antibody concentrations at endpoint (v2D28) were estimated using a gaussian kernel with bandwidth automatically selected through biased cross validation using the stat_density function from ggplot2 (3.3.3) with bw = “bcv”.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The stained cells were acquired on a FACS Canto II flow cytometer (BD Biosciences) and analyzed using FlowJo software v9.9.6 (BD Biosciences)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spectral flow cytometry data processing for FlowSOM clustering and UMAP embedding: FCS files generated from spectral flow cytometry with the 17-color panel and associated manual gates were read into R using FlowWorkspace (4.2.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowWorkspace</div><div>suggested: (flowWorkspace, RRID:SCR_001155)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following markers were used to perform clustering CD20, CD138, CD38, CD10, CD11c, CD19, CD27, CD21, IgD, IgM, IgG, IgA, using FlowSOM (1.22.0)33, with the number of desired metaclusters (nClus) set to 30.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowSOM</div><div>suggested: (FlowSOM, RRID:SCR_016899)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The clusters were then grouped by hierarchical clustering of the mean trends using the Euclidean distance at each timepoint and using Ward’s method, as implemented in the hclust function (method = “ward.D2) in R (4.0.2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>hclust</div><div>suggested: (HCLUST, RRID:SCR_009154)</div></div></td></tr></table>


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT00001281</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Studies of Blood and Reproductive Fluids in HIV-Infected and…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04411147</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Longitudinal Study of COVID-19 Sequelae and Immunity</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04280705</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Adaptive COVID-19 Treatment Trial (ACTT)</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04579393</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Fostamatinib for Hospitalized Adults With COVID-19</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. Then in your daily note Template add a tag that flags it as a daily note somewhere (eg. “#journal”. Also add an embedded query that looks like this: ```query {{date}} -"#journal" ```

      Embeddable search queries for Obsidian

    1. Then she remembered that the Diamond might take to shining of itself, with its awful moony light in the dark

      Description of the Diamond. I'm going to tag this as character description assuming we're calling The Moonstone a character.

    1. The Tag can be found in the “FullScript API” section of your dashboard. Here you can define your settings and also add a blacklist or whitelist to your script. We will go into detail about these features later. 

      Lass uns hier eher eine abstraktere Grafik nutzen, statt screenshot vom Dashboard. Oder eventuell einfach so einer art "eingebetteten" code editor als grafik dafür. (Siehe Notion: /code befehl)

    1. SciScore for 10.1101/2021.07.02.450964: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Membranes were incubated with the following primary antibodies: mouse anti-Actin (Cell sig, 3700), rabbit anti-IMPDH2 (Proteintec, 12948-1-AP), mouse anti-Strep-tag (Quiagen, 34850).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Actin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IMPDH2</div><div>suggested: (Proteintech Cat# 12948-1-AP, RRID:AB_2127351)</div></div><div style="margin-bottom:8px"><div>anti-Strep-tag ( Quiagen , 34850</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies: rabbit anti mouse - HRP conjugated (Millipore), mouse anti rabbit-HRP conjugated (Millipore).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti mouse -</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti rabbit-HRP conjugated ( Millipore) .</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cell transcriptome was used as a reference to query for Enriched GO terms from up- and down-regulated DEG lists.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids pLVX-EF1alpha-SARS-CoV-2-proteins-2xStrep-IRES-Puro proteins are a gift from Nevan Krogan (Addgene)(Gordon, Jang, et al., 2020) are listed in Table 14 and purified by Midi-prep using Invitrogen kit.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX-EF1alpha-SARS-CoV-2-proteins-2xStrep-IRES-Puro</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 1500ng of total DNA (1200 ng of pLVX-EF1alpha-SARS-CoV-2-proteins-2xStrep-IRES-Pur + 300ng of pLVX-EF1alpha-eGFP-2xStrep-IRES-Puro) were incubated at RT for 20 min with PEI, with a ratio 3:1=PEI:DNA in 100ul of serum free medium, and the mixture was added to the cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX-EF1alpha-SARS-CoV-2-proteins-2xStrep-IRES-Pur</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pLVX-EF1alpha-eGFP-2xStrep-IRES-Puro</div><div>suggested: RRID:Addgene_141395)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cloning of Nsp14 ExoN mutants: pLXV-EIF1 alpha-2xStrep-SARS-CoV-2-nsp14-D90A/G92A-IRES-Puro: pLXV-EF1alpha-2xStrep-SARS-CoV-2-nsp14-IRES-Puro was opened with BsrGI-HF (NEB) and EcoRI-HF (NEB).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLXV-EIF1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>alpha-2xStrep-SARS-CoV-2-nsp14-D90A/G92A-IRES-Puro</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pLXV-EF1alpha-2xStrep-SARS-CoV-2-nsp14-IRES-Puro</div><div>suggested: RRID:Addgene_141380)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gblock: Gaattcgccgccaccatgtggtcccatccgcagtttgagaagggtggtggttcaggcggaggctccgggggcgggagctggtctcaccc gcaatttgaaaaaggcgctgcggctgctgaaaatgtaacgggcttgtttaaagactgtagtaaagtgatcacaggactccaccccacacaag cacctacccacctttccgtagatacgaagttcaaaacggaaggattgtgtgtggatataccagggataccaaaggatatgacgtaccgaagg ctgatttccatgatgggttttaagatgaattaccaagttaatggctaccccaacatgttcatcaccagggaggaggcaattagacacgtaagag cctggataggcttcGCCgttGCCggttgccatgcaacccgggaagccgtaggcacaaaccttccgttgcagcttggcttttccacgggc gtcaacctcgttgccgtaccgactggctatgttgacacgccgaacaacaccgatttctctcgcgtaagtgctaagcctcctccgggagatcaa ttcaagcatcttatacctctcatgtaca Primers: D90AG92A_F: cacacGaattcgccgccac D90AG92A _R: cacacTGTACATGAGAGGTATAAGA pLXV-EIF1 alpha-2xStrep-SARS-CoV-2-nsp14-D273A-IRES-Puro: pLXV-EF1alpha-2xStrep-SARS-CoV-2-nsp14-IRES-Puro was opened with BstBI (NEB) and AfeI (NEB).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLXV-EIF1 alpha-2xStrep-SARS-CoV-2-nsp14-D273A-IRES-Puro: pLXV-EF1alpha-2xStrep-SARS-CoV-2-nsp14-IRES-Puro</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primers: D273A_F: CCACACTTCGAACTTACTTCTATG D273A_R: cacacagcgctgcttttactacc Cloning of CXCL8-Firefly reporter: pGL_RSV_RF_BG (a modification of the pGL plasmid) was a kind gift from Dr. Marr at Brandeis University.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pGL</div><div>suggested: RRID:Addgene_119952)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were transfected with 75ng of Firefly reporter, 75ng of Renilla reporter, and 600ng of pLVX-EF1alpha-SARS-CoV-2-Nsp14-2xStrep-IRES-Puro or 600ng of empty vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX-EF1alpha-SARS-CoV-2-Nsp14-2xStrep-IRES-Puro</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Addgene plasmid # 49343; http://n2t.net/addgene:49343; RRID:Addgene_49343)(Wilson et al., 2013) 7xE-Box::Renilla was a gift from Koen Venken (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_49343)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Addgene plasmid # 124532; http://n2t.net/addgene:124532; RRID:Addgene_124532, Sarrion-Perdigones et al., 2020) At the indicated time point, cells were lysate in lysis buffer (25 mM Tris-phosphate at pH 7.8, 10% glycerol, 1% Triton X-100, 1 mg/ml of bovine serum albumin (BSA), 2 mM cyclohexylene diamin tetraacetate, and 2 mM DTT).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_124532)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, Gemini Bio/Fisher, # 100-602), and 1X Penicillin-Streptomycin (Penicillin-Streptomycin 100x, Genesee Scientific, 25-512)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gemini Bio/Fisher</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bioinformatic analyses: Raw reads were aligned to the human genome (hg38) using STAR (Dobin et al., 2013)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_004463)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FeatureCounts (Gohr and Irimia, 2019) was used to quantify mapped transcripts from total RNA-seq libraries.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FeatureCounts</div><div>suggested: (featureCounts, RRID:SCR_012919)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DEGs with |L2FC| > 1, p-adjusted value <0.05 were considered significant and used as input in downstream Gene Ontology (GO) analysis (DAVID, v 6.8).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DAVID</div><div>suggested: (DAVID, RRID:SCR_001881)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene set enrichment analysis (GSEA) was performed using the fgsea package in R (Sergushichev et al., 2016)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene set enrichment analysis</div><div>suggested: (Gene Set Enrichment Analysis, RRID:SCR_003199)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data visualization was carried out using ggplot2 in R.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differentially expressed circRNAs were found by DESeq2 (Love, Huber and Anders, 2014)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used the motif data base HOmo sapiens COmprehensive MOdel COllection (HOCOMOCO) v11 transcription factor (TF) binding models (binding profiles or binding motifs) for human transcription factors.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HOCOMOCO</div><div>suggested: (HOCOMOCO, RRID:SCR_005409)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.07.03.450938: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: Reagents: Vero E6 cells (CRL-1586, Resource Research Identifier (RRID): CVCL0574) were purchased from American Tissue Type Collection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Rabbit anti-NP SARS-CoV-2 antibody R001 (40143-R001, RRID Number: AB_2827974), R004 (40143-R004, RRID Number: AB_2827975), R019 (40143-R019, RRID Number: AB_2827973), and R040 (40143-R040, RRID Number: AB_2827976) was purchased from Sino Biological and mouse anti-NP MAb 1C7C7 was provided by Dr. Tomas Moran and purchased from Leinco (LT7000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-NP SARS-CoV-2</div><div>detected: (Sino Biological Cat# 40143-R019, RRID:AB_2827973)</div></div><div style="margin-bottom:8px"><div></div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>R040</div><div>suggested: (Sino Biological Cat# 40143-R040, RRID:AB_2827976)</div></div><div style="margin-bottom:8px"><div>anti-NP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IgG antibodies R001, R004, R019, R040 were raised against recombinant SARS-CoV nucleocapsid phosphoprotein (NP (Sino Biological, 0143-V08B) and expressed in HEK293 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>R019 , R040 were raised against recombinant SARS-CoV nucleocapsid phosphoprotein ( NP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>0143-V08B</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then antigen-antibody complexes were detected using appropriate anti species HRP-conjugates and West Femto substrate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti species HRP-conjugates</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IgG antibodies R001, R004, R019, R040 were raised against recombinant SARS-CoV nucleocapsid phosphoprotein (NP (Sino Biological, 0143-V08B) and expressed in HEK293 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Preparation of Viral Lysates and Tissue Culture Supernatant (TCS) Production: Vero-E6 cells were plated in 12-well plates at 450 000 cells/well in 1.25 mL of growth media.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PCR fragments were digested with SacI and SmaI and cloned into SacI- and SmaI-digested pCAGGS plasmid containing a C-terminal HA epitope tag (pCAGGS NP-HA) 20 uL of 15,000 Vero E6 cells per well was seeded into half-area 96-well plates and incubated O/N at 37°C, 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PCR fragments were digested with SacI and SmaI and cloned into SacI- and SmaI-digested pCAGGS plasmid containing a C-terminal HA epitope tag (pCAGGS NP-HA) 20 uL of 15,000 Vero E6 cells per well was seeded into half-area 96-well plates and incubated O/N at 37°C, 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_18926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A plasmid encoding for SARS-CoV-2 NP (pCAGGS NP-HA) was transfected into the cells using Lipofectamine 2000 according to manufacturer’s recommendations (starting concentration 100 ng of plasmid and two-fold serial dilutions).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS NP-HA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The custom labeling of MAbs was performed by Columbia Biosciences.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Columbia Biosciences</div><div>suggested: (Columbia Biosciences Corporation, RRID:SCR_004347)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nucleotide sequences were translated to amino acid sequences using ExPASY online software 31 and the codon frame that contained the full NP was copied to ClustalO (1.2.4)32 for multiple sequence alignment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ExPASY</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Graphpad Prism V9.1.0 was used to generate all graphs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. MMRRC:03425

      DOI: 10.1073/pnas.1511351113

      Resource: (MMRRC Cat# 030779-UCD,RRID:MMRRC_030779-UCD)

      Curator: @bandrow

      SciCrunch record: RRID:MMRRC_030779-UCD

      Curator comments: I reached out to the author about a subsequent manuscript and he will be seeking an erratum to both. The ID of this mouse and the name is incorrect. The corrected information is in the tag. Documented on July 6, 2021.


      What is this?

    1. “Western journalists who couldn’t reach—or didn’t bother reaching?—people on the ground in Iran simply scrolled through the English-language tweets post with tag #iranelection,” she wrote. “Through it all, no one seemed to wonder why people trying to coordinate protests in Iran would be writing in any language other than Farsi.”

      Lazy Western journalists refuse to break outside of Western sources to actually learn about what is occurring on the ground. Lends itself to be used by people who may manipulate situations for anti-social gains

    1. INSTRUCTIONS:

      1. Read over the poem for the first time to get acquainted with the poem.

      Feel free to type page notes that you choose to keep private or share with the group. Note pages are optional.

      1. Read it a second time and highlight parts you want to annotate and share your ideas and thoughts with the class.

      2. Answer these two questions.

      3. Remember to tag each annotation answer with the tag shown after the question.

      4. QUESTIONS:

      • A - What is the central theme of the poem? tag - #QuestA
      • B - What is the overall lesson we should learn from this poem? #QuestB
    1. SciScore for 10.1101/2021.07.02.450896: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Euthanasia Agents: Inhibitor treatment: At 24h post transfection, cells were incubated for 6h with two pan-PC inhibitors: the cell permeable decanoyl-RVKR-chloromethylketone (cmk; 50 mM; 4026850.001; Bachem), or with the cell surface PC-inhibitor hexa-D-arginine (D6R; 20 μM; 344931; EMD).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The proteins were revealed using a V5-monoclonal antibody (V5-mAb V2660; 1:5000; Invitrogen), ACE2 antibody (rabbit monoclonal ab108252; 1:3,000; Abcam),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>V5-mAb</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>V2660</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TMPRSS2 antibody (rabbit polyclonal; 14427-1-AP; 1:1,000; Proteintech)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Actin antibody (rabbit polyclonal A2066; 1:5,000; Sigma), HA-HRP antibody (12-013-819; 1:3,500; Roche), or SARS-CoV-2 spike antibody (rabbit polyclonal GenTex GTX135356; 1:2,000; GenTex).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HA-HRP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: (GeneTex Cat# GTX135356, RRID:AB_2887482)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Namely, 0.3 ml of media were immunoprecipitated with either 25 µl EZ view Red anti-HA affinity gel (E 6779; Sigma-Aldrich) or 1.2 µg ACE2 antibody (goat ployclonal AF 933; R&D) and 30 µl TrueBlot anti-Goat Ig IP beads (00-8844-25; Rockland Inc.), respectively, according to the manufacturers’ protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HA</div><div>suggested: (Sigma-Aldrich Cat# E6779, RRID:AB_10109562)</div></div><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Goat</div><div>suggested: (Rockland Cat# 00-8844-25, RRID:AB_2610705)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Upon SDS-PAGE separation and PVDF transfer, the immunoprecipitated proteins were detected using an HA-HRP antibody (12-013-819; 1:3,500; Roche) or ACE2 antibody (rabbit monoclonal ab108252; 1:3,000; Abcam) and TrueBlot anti-Goat IgG HRP (18-8814-31; Rockland Inc.), respectively. Microscopy: To establish the luciferase assay, cell co-cultures were plated on glass coverslips.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Goat IgG</div><div>suggested: (Rockland Cat# 18-8814-31, RRID:AB_2610843)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were incubated with primary antibodies overnight at 4°C using an antibody against V5 (mouse monoclonal R960-25; 1:1000; Invitrogen), Spike (mouse monoclonal GTX632604; 1:500; GeneTex) and ACE2 (goat polyclonal AF933; 1:500; RnDsystems).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>V5</div><div>suggested: (Thermo Fisher Scientific Cat# R960-25, RRID:AB_2556564)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Enzymatic PC-inhibition by BOS-inhibitors: Biochemical assay: The proprotein convertases Furin (108-574-Tev-Flag-6His), PC5A (PCSK5; 115-63-Tev-Flag-6His), PACE4 (PCSK6; 150-693-Tev-Flag-6His), and PC7 (PCSK7; 142-634-Tev-Flag-6His) enzymes were purified from BacMam transduced CHO cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: CLS Cat# 603479/p746_CHO, RRID:CVCL_0213)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cellular assay: Analyses were initiated by the addition of U2OS cells simultaneously transduced with a BacMam-delivered construct containing a Golgi-targeting sequence followed by a 12-amino acid Furin/PCSK cleavage site from Bone Morphogenic Protein 10 (BMP10) and then GFP at the C terminus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>U2OS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture and transfection: Monolayers of HeLa, HEK293T, HEK293T17</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, Vero E6 and Calu-3 cells were cultured in 5% CO2 at 37°C in Dulbecco’s modified Eagle’s medium (DMEM; Wisent) supplemented with 10% (v/v)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T-ACE2[98], a generous gift from Dr. Paul Bieniasz, were maintained in DMEM containing 10% FBS, 1% nonessential amino acids (NEAA) and 50 µg/ml blasticidin (Invivogen)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CHO-ldlD cells, which are defective in UDP-Gal/UDP-GalNAc 4-epimerase [50] and therefore cannot O-glycosylate proteins, and their parental CHO-K1 cells were cultured in DMEM/F12 medium (50/50) (Wisent) supplemented with 3% FBS and F12K medium (Wisent) containing 10% FBS, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO-K1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In certain experiments, 293T17 cells were treated with BOS inhibitors at 6 h post transfection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T17</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell viability assay using MTT: Cells, seeded in a 96-well plate, the day before, at 10,000 (HEK-293T and Vero E6) or 50,000 (Calu-3) cells, were treated with serial 10-fold dilutions of BOS inhibitors for up to 48h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: RRID:CVCL_A7UK)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell-to-cell fusion assay: HeLa or HeLa TZM-bl cells were plated at 200,000 cells in 12-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa TZM-bl</div><div>suggested: NIH-ARP Cat# 8129-442, RRID:CVCL_B478)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The relative light units (RLU) were measured using a Promega GLOMAX plate reader (Promega, Madison, WI, USA) and values were reported as fold increase over the RLU measured in co-culture of HeLa cells transfected EV with respective TZM-bl cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: CLS Cat# 300194/p772_HeLa, RRID:CVCL_0030)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein immunoprecipitation from co-culture media: When indicated, the secreted form of double tagged Spike glycoprotein of Sars-CoV-2 (N-terminal HA tag and C-terminal V5 tag) and the TMPRSS2-shed forms of ACE2 receptor from the FBS containing media of co-cultured HeLA and HeLa-TZM-bl cells were immunoprecipitated for WB analyses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa-TZM-bl</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plaque assay in Vero E6: Vero E6 cells (1.2 x 105 cells/well) were seeded in quadruplicate in 24-well tissue culture plates in DMEM supplemented with 10% FBS two days before infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral production in the supernatant was quantified using a plaque assay on Vero E6.1 cells as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6.1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids: Single tagged (C-terminal V5 tag) or double tagged (N-terminal HA tag and C-terminal V5 tag) Spike glycoprotein of SARS-CoV-2 (optimized sequence) and its mutants were cloned into the pIRES2-EGFP vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pIRES2-EGFP</div><div>suggested: RRID:Addgene_14998)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plasmids pCI-NEO-hACE2 received from DW Lambert (University of Leeds) and pIRES-NEO3-hTMPRSS2 from P Jolicoeur (IRCM).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCI-NEO-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Luc.R-E-) was obtained from Dr. Nathaniel Landau through the NIH AIDS Reagent Program whereas the pHIV-1NL4-3 ΔEnv-NanoLuc construct was a kind gift from Dr. P</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHIV-1NL4-3 ΔEnv-NanoLuc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids encoding VSV-G, as HIV-1 Env and tat were previously described [96, 97].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VSV-G</div><div>suggested: RRID:Addgene_138479)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate HIV particles pseudotyped with SARS-CoV-2 S, 293T17 cells (600,000 cells plated in a 6-well vessel) were transfected with 1 µg pNL4-3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL4-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Luc.R-E- (or pHIV-1NLΔEnv-NanoLuc) in the presence or absence of 0.3 µg pIR-2019-nCoV-S V5 plasmids using Lipofectamine-3000 (Life Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHIV-1NLΔEnv-NanoLuc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>V5</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were visualized using a confocal laser-scanning microscope (LSM710, Carl Zeiss) with Plan-Apochromat 63x/1.40 Oil DIC M27 objective on ZEN software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ZEN</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plaques were counted manually and in parallel, imaged plaque plates were processed and plaques enumerated using an automated algorithm based Matlab software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Matlab</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The results from experiments done with two biological replicates and two technical replicates in triplicates were used to calculate the IC50 by nonlinear regression using GraphPad Prism V5.0 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. Ben: The business started blossoming when we were in Texas. I had told my wife to give me…Within five years we'll have a house and we'll both have good vehicles, dependable vehicles, but it's going to take a while. Well within a year and a half from when I started, we bought out first house and we both had good, dependable vehicles. However, it was still tight when I took a project on in Akron, Ohio. And when I took that project on, I did not want to go up there for many reasons. One, because I had this immigration issue on me and I'm going near the Canadian border. Another, I didn't really want to be away from my family.Ben: But when these customers get persistent, "What's it going to take? What's it going to take?" And I said, "It's just out of the question. I can't go up there, I got all these jobs going on. Plus, I got bad equipment, my equipment’s old and if my equipment breaks down up there, I'm not going to be able to meet the schedules and we're all going to be in trouble.” "Is that it? Really?" The last price he had upped the price of what the contract was to pay, and the pay was fine. I had other reasons why I didn't want to go. Well when he says, "I'll throw in a brand-new texture machine on top of it, but I'll sign off on the paperwork after you complete the project.” And I go, "You'll do that?" "I'll do that and when have you known me to not keep my word?" And I go, "Done deal.”Ben: One of those texture machines, the price tag at that time was about $30,000. Right now, it's probably closer to $40,000 because we're talking about 1996. And he followed through, I came up to Akron, when I got up to Akron though, they had projects, there were projects everywhere, Kentucky, Michigan. And the pay, the pay was awesome. And that is where it really, within I think about the second month that I was up north, it just completely changed.Ben: But I hadn't seen my wife and children since I had taken off up there. So, I told her to come up there and visit and I started discuss with her. I go, "Look these other jobs,” and I had already said I was going to take them, but I didn't tell her that. I told her, she says, "What if you go to be traveling?" I go, "It's worth it to be traveling back and forth, but I'm not going to be traveling back and forth. We're going to just take the kids; we're going to move up here and we're going to be together".Ben: And so that's when I moved them to Indianapolis. We stationed in Indianapolis although I did travel quite a bit. I was on the road quite a bit because I had later ended up with jobs as far down as Orlando, Florida. And I ended up in New Orleans after Hurricane Katrina to repair a bunch of apartments which we had worked on before. But it was a pretty wild ride, but we really were doing really well, and it was really amazing.

      Time in the US, Jobs/employment/work, Small business owner, Earnings, Careers, Construction; Time in the US, States, Texas, Indiana, Louisiana, Florida, Ohio

    1. This appears to be evidence that one can (now) use emoji as tags in Hypothes.is?

      It's the first time I've seen someone other than me make an attempt in the wild.

    1. SciScore for 10.1101/2021.06.28.21259576: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the University of Pittsburgh Institutional Review Board (Study ID: 21030056/HCC 21-032).<br>Field Sample Permit: Data Collection and Outcomes: Study data were collected by the project coordinators and managed using the Research Electronic Data Capture (REDCap) hosted at the University of Pittsburgh.10 REDCap is a secure, web-based software platform designed to support data capture for research studies.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody assays: Serum underwent antibody testing using the Beckman Coulter SARS-CoV-2 platform (Spike (S) receptor-binding domain (RBD) IgG).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Spike (S) receptor-binding domain (RBD) IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 pseudovirus (PSV) was generated in 293T cells by co-transfection of pFC37K-CMV-S, an enhanced expression plasmid encoding for codon-optimized full-length SARS-CoV-2 S (Wuhan-1 sequence containing D614G substitution) with the N-term HiBit tag removed, and pNL4-3.luc.R-E-mCherry-luciferase, an envelope deficient HIV-1 dual reporter construct that was cloned by recombination of the pNL.luc.R-E-plasmid (NIH AIDS Reagent Program) and the fully infectious pNL4-3 mCherry luciferase plasmid (Addgene).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For neutralization assays, 104 293T-hACE2 cells were plated in 100 microliters (μL) media per well in 96 well white-wall white-bottom plates (Perkin Elmer) and incubated overnight at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-hACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 pseudovirus (PSV) was generated in 293T cells by co-transfection of pFC37K-CMV-S, an enhanced expression plasmid encoding for codon-optimized full-length SARS-CoV-2 S (Wuhan-1 sequence containing D614G substitution) with the N-term HiBit tag removed, and pNL4-3.luc.R-E-mCherry-luciferase, an envelope deficient HIV-1 dual reporter construct that was cloned by recombination of the pNL.luc.R-E-plasmid (NIH AIDS Reagent Program) and the fully infectious pNL4-3 mCherry luciferase plasmid (Addgene).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pFC37K-CMV-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pNL4-3.luc.R-E-mCherry-luciferase</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pNL.luc.R-E-plasmid</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pNL4-3 mCherry luciferase</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data Collection and Outcomes: Study data were collected by the project coordinators and managed using the Research Electronic Data Capture (REDCap) hosted at the University of Pittsburgh.10 REDCap is a secure, web-based software platform designed to support data capture for research studies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations of this study include lack of longitudinal sampling and assessment of cellular immunity. Nonetheless, our data call for the need for funding to better understand immune responses to COVID-19 vaccines in immunosuppressed patients. Future studies should focus on correlating immune responses with clinical efficacy of COVID-19 vaccines and measurement of other correlates of immunity such as T-cell and memory B-cell responses, particularly in seronegative patients. There is a critical need to develop studies of revaccination, and for countries providing revaccination to publish their data. There is also a critical need to design trials of passive immunity using monoclonal antibodies or direct-acting antivirals for the prevention of COVID-19 in immunocompromised patients. Finally, results such as ours should not be used to fuel vaccine hesitancy, but rather to encourage vaccination and emphasize the need for ongoing vigilance until additional interventions are available.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04885907</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Third Dose of Moderna COVID-19 Vaccine in Transplant Recipie…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.30.450614: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">E phenotype quantification was performed on 50 cells per condition, with sample identification randomised and blinded during scoring.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">E phenotype quantification was performed on 50 cells per condition, with sample identification randomised and blinded during scoring.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Cell Culture: STR-profiled, mycoplasma-free vials of 293T and VeroE6 cells were obtained from the Crick Cell Services Science Technology Platform.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies and fluorescent labels: An antibody against GAPDH (MAB374) was from Millipore; an antibody against SARS-CoV-2 Spike (GTX632604) was from GeneTex; an antibody against SARS-CoV-2 Nucleocapsid (BS-41408R) was from Bioss; an antibody against SARS-CoV Membrane (101-401-A55) was from (Rockland); an antibody against ERGIC53 (E1031) was from Sigma-Aldrich; an antibody against GM130 (610822) was from BD Biosceinces; an antibody against TGN46 (ab50595) was from Abcam; an antibody against EEA1 (610457) was from BD Biosciences; an antibody against O-GlcNAc (CTD110.6) was from Sigma; an antibody against HA.11 (16B12) was from Biolegend; an antibody against HaloTag (G9211) was from Promega; an antibody against GFP (7.1/13.1) was from Roche; an antibody against RER1 (HPA051400) was from Sigma-Aldrich; an antibody against PALS1 (17710-1-AP) was from Proteintech; an antibody against GORAPS2 (10598-1-AP) was from Proteintech; an HRP-conjugated antibody against Streptavidin (S911) was from Invitrogen; Alexa conjugated secondary antibodies were from Invitrogen and HRP-conjugated secondary antibodies were from Millipore.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GAPDH</div><div>suggested: (Millipore Cat# MAB374, RRID:AB_2107445)</div></div><div style="margin-bottom:8px"><div>GTX632604</div><div>suggested: (GeneTex Cat# GTX632604, RRID:AB_2864418)</div></div><div style="margin-bottom:8px"><div>ERGIC53</div><div>suggested: (Sigma-Aldrich Cat# E1031, RRID:AB_532237)</div></div><div style="margin-bottom:8px"><div>GM130</div><div>suggested: (BD Biosciences Cat# 610822, RRID:AB_398141)</div></div><div style="margin-bottom:8px"><div>TGN46</div><div>suggested: (Abcam Cat# ab50595, RRID:AB_2203289)</div></div><div style="margin-bottom:8px"><div>EEA1</div><div>suggested: (BD Biosciences Cat# 610457, RRID:AB_397830)</div></div><div style="margin-bottom:8px"><div>O-GlcNAc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HA.11</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antibody against HaloTag (G9211</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GFP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>RER1</div><div>suggested: (Atlas Antibodies Cat# HPA051400, RRID:AB_2681469)</div></div><div style="margin-bottom:8px"><div>HPA051400</div><div>suggested: (Atlas Antibodies Cat# HPA051400, RRID:AB_2681469)</div></div><div style="margin-bottom:8px"><div>PALS1</div><div>suggested: (Proteintech Cat# 17710-1-AP, RRID:AB_2282012)</div></div><div style="margin-bottom:8px"><div>GORAPS2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antibody against Streptavidin (S911</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then prepared for fixed cell imaging, with the presence of HA tagged Dynamin2-K44A detected by detection by an HA antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fixed cell imaging: VeroE6 cells were plated at 40,000 per well on 13mm No. 1.5 coverslips and transfected as described the following day.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TurboID Proximity Biotinylation, Pull Down, and Mass Spectrometry: HEK293T cells were grown for at least 5 days in biotin-free growth media to remove all sources of biotin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For analysis of post-translational modification on E, 600,000 293T cells in a 35 mm dish were transfected with 2 mg pCR3.1 E-HTSite3, or derivatives.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Insertion of HaloTag in the E coding sequence was performed using HiFi DNA Assembly, with HaloTag amplified by PCR from pHTN-HaloTag CMV-neo (Promega), with a Gly-Gly-Gly-Ser linker placed either side of the HaloTag at site 3 and 4, a single linker placed between E N/C-terminus and HaloTag at tag sites 1 or 5, and a Gly-Gly-Gly-Ser-HaloTag-Gly-Gly-Gly-Ser-Glu-Glu inserted at site 2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHTN-HaloTag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Hemagglutinin (HA)-TurboID tagging at sites 3 and 4 was performed by HiFi DNA Assembly, with HA-TurboID amplified by PCR from 3xHA-TurboID-NLS_pCDNA3 (Addgene #107171) and inserted with a Gly-Gly-Gly-Ser linker either side of the HA-TurboID sequence.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>3xHA-TurboID-NLS_pCDNA3</div><div>suggested: RRID:Addgene_107171)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Emerald-TurboID was used for a cytosolic control in proximity biotinylation experiments and was generated by using HiFi DNA Assembly to assemble Emerald-TurboID in a pLXIN vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLXIN</div><div>suggested: RRID:Addgene_132935)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">mEmerald was amplified from mEmerald-Sec61b-C1 (Addgene #90992) and TurboID amplified from 3xHA-TurboID-NLS_pCDNA3, with AgeI and EcoRI restriction sites for insertion into pEGFP-C1. pHLARE plasmids were a kind gift from Prof. Diana Barber (University of California, San Francisco).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>mEmerald-Sec61b-C1</div><div>suggested: RRID:Addgene_90992)</div></div><div style="margin-bottom:8px"><div>pEGFP-C1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pHLARE</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunoprecipitation Assay: 25 million 293T cells in a 150 mm dish were transfected with 40 mg pCR3.1 E-HTSite3 or pCR3.1 using Polyethyleneimine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCR3.1</div><div>suggested: RRID:Addgene_106457)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For analysis of post-translational modification on E, 600,000 293T cells in a 35 mm dish were transfected with 2 mg pCR3.1 E-HTSite3, or derivatives.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCR3.1 E-HTSite3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus Like Particle Production Assay: 7.5 million 293T cells in a 100 mm dish were transfected with a mixture comprising 5 mg pCR3.1 SARS-CoV-2 S (codon optimised), 3 mg pCR3.1 SARS-CoV-2 M, 3 mg pCR3.1 SARS-CoV-2 E (or derivatives) and 1 mg of pCR3.1 SARS-CoV-2 N (codon optimised).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCR3.1 SARS-CoV-2 N</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A sequence corresponding to the native sequence of Membrane was synthesised by GeneWIZ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GeneWIZ</div><div>suggested: (GENEWIZ, RRID:SCR_003177)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies and fluorescent labels: An antibody against GAPDH (MAB374) was from Millipore; an antibody against SARS-CoV-2 Spike (GTX632604) was from GeneTex; an antibody against SARS-CoV-2 Nucleocapsid (BS-41408R) was from Bioss; an antibody against SARS-CoV Membrane (101-401-A55) was from (Rockland); an antibody against ERGIC53 (E1031) was from Sigma-Aldrich; an antibody against GM130 (610822) was from BD Biosceinces; an antibody against TGN46 (ab50595) was from Abcam; an antibody against EEA1 (610457) was from BD Biosciences; an antibody against O-GlcNAc (CTD110.6) was from Sigma; an antibody against HA.11 (16B12) was from Biolegend; an antibody against HaloTag (G9211) was from Promega; an antibody against GFP (7.1/13.1) was from Roche; an antibody against RER1 (HPA051400) was from Sigma-Aldrich; an antibody against PALS1 (17710-1-AP) was from Proteintech; an antibody against GORAPS2 (10598-1-AP) was from Proteintech; an HRP-conjugated antibody against Streptavidin (S911) was from Invitrogen; Alexa conjugated secondary antibodies were from Invitrogen and HRP-conjugated secondary antibodies were from Millipore.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GeneTex</div><div>suggested: (GeneTex, RRID:SCR_000069)</div></div><div style="margin-bottom:8px"><div>Bioss</div><div>suggested: (Bioss Inc, RRID:SCR_013539)</div></div><div style="margin-bottom:8px"><div>BD Biosceinces</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>BD Biosciences</div><div>suggested: (BD Biosciences, RRID:SCR_013311)</div></div><div style="margin-bottom:8px"><div>Sigma</div><div>suggested: (SigmaPlot, RRID:SCR_003210)</div></div><div style="margin-bottom:8px"><div>Biolegend</div><div>suggested: (BioLegend, RRID:SCR_001134)</div></div><div style="margin-bottom:8px"><div>Promega</div><div>suggested: (Promega, RRID:SCR_006724)</div></div><div style="margin-bottom:8px"><div>Proteintech</div><div>suggested: (Proteintech Group, RRID:SCR_008986)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Acquired images were processed using Zeiss’ “Auto” 2D Airyscan processing, and image brightness levels and image crops were adjusted and performed using the FIJI distribution of ImageJ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Zeiss’</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Raw files were then exported into FLIMfit software35 for analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FLIMfit</div><div>suggested: (FLIMfit, RRID:SCR_016298)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Intensity based absolute quantification (iBAQ) in MaxQuant was performed using a built-in quantification algorithm36 enabling the ‘Match between runs’ option (time window 0.7 minutes) within replicates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MaxQuant</div><div>suggested: (MaxQuant, RRID:SCR_014485)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MaxQuant output files were processed with Perseus, v1.4.0.238.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Perseus</div><div>suggested: (Perseus, RRID:SCR_015753)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: 2-tailed Student’s T-tests, or ordinary 1-way ANOVA with the indicated post-hoc tests were used to assess significance between test samples and controls and were performed using GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 33 and 30. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. Custom tags Hypertag allows programmers to define custom tags, either directly in Hypertag code (native tags), or as Python classes (external tags). Both cases are described below.
      • section : custom tag
    1. The FBI said it has stopped using the "Black Identity Extremist" tag and acknowledged that white supremacist violence is the biggest terrorist threat this country faces. https://trib.al/OepGw2S

      Still figuring out Hypothesis, and have never used twitter... I highlighted this text and link to use one of Caulfields methods to verify the link.

    1. SciScore for 10.1101/2021.06.17.448891: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ltd (Guangzhou, China) and inserted into plasmid pET-44b(+) and pET-28a(+), respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-44b(+</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pET-28a(+)</div><div>suggested: RRID:Addgene_108949)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2.2 Protein expression and purification: The plasmids pET-44b-NusA-5HB, pET-28a-5HB, and pCold-NusA containing the gene encoding NusA-5HB, 5HB and NusA (with N-terminal His-tag) were transformed into competent E. coli BL21 (DE3) cells (Invitrogen) respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-28a-5HB</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCold-NusA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The recombinant E. coli was cultivated in LB medium with antibiotic (50 mg/L Kan for pET-28a-5HB; 100 mg/L Amp for pET-44b-NusA-5HB and pCold-NusA) at 37 °C and rotary shaking at 200 rpm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-44b-NusA-5HB</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The obtained f values were plotted using GraphPad Prism 8 to calculate the IC50.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PyMOL (Version 1.5, Schrö dinger, LLC) was used to prepare figures of the complexes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.24.449680: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics statement: All animal experiments were approved by the Institutional Animal Care and Use Committee of XXXXXX.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">For Ad5-hACE2-transduced BALB/c mice 51, specific pathogen-free 6-10 weeks old male and female BALB/c mice were lightly anesthetized with isoflurane and transduced intranasally with 2.5×108 fluorescence focus units (FFU) of Ad5-ACE2 in 75 μL DMEM.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were then fixed with 4% paraformaldehyde (Sigma-Aldrich) for 30 min at room temperature and stained with anti-His-tag antibodies (Abmart, M30111S).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, the cells were stained with goat anti-mouse Alexla Fluor 488-conjugated secondary antibodies (Invitrogen, A11001), and were detected with flow cytometry.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Thermo Fisher Scientific Cat# A-11001, RRID:AB_2534069)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In some experiments, LAD2 cells were prior-treated with 0.25% trypsin (without EDTA) for 10 min at 37 °C or prior-blocked with anti-ACE2 antibody (5 μg/mL, R&D Systems, AF933) for 2 h at 37 °C before the incubation with Spike-RBD protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The anti-ACE2 antibody (Abcam, EPR4435), anti-MMP9 antibody (signal antibody, 29091), anti-GAPDH antibody (Abcam, 6C5), and the horseradish peroxidase-conjugated secondary antibody were used in Western blotting.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-MMP9</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-GAPDH</div><div>suggested: (Abcam Cat# ab92412, RRID:AB_2278693)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detecting tight junction proteins ZO-1, Occludin, Claudin-5 and JAM2 in A549 cells, cells were blocked with 5% BSA in PBS for 1 h at room temperature then incubated with primary antibodies for 2h at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ZO-1, Occludin,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Claudin-5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>JAM2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies against ZO-1 (Invitrogen, 402200), Occludin (Invitrogen, OC-3F10), Claudin-5 (Invitrogen, 4C3C2) and JAM-2 (Abcam, EPR2489), were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ZO-1</div><div>suggested: (Thermo Fisher Scientific Cat# 40-2200, RRID:AB_2533456)</div></div><div style="margin-bottom:8px"><div>Occludin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>JAM-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudotyped virus was generated by EZ Trans cell transfection reagent-mediated co-transfection of HEK293T cells with the Spike-expressing plasmid pcDNA3.1-2019-nCoV-S-IRES (strain 2019-nCoV WIV04) and pNL4-3. Luc. ΔR ΔE 81.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For immuno-staining assay, A549 cells were added leukocyte activation cocktail containing BD GolgiPlug (BD, 550583) and cultured for 6 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2-humanzied mice and rhesus macaques experiments: 3-4 months old C57BL/6N-Ace2em2(hACE2-WPRE,pgk-puro)/CCLA mice were provided by Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Science 47.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6N-Ace2em2(hACE2-WPRE,pgk-puro)/CCLA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For Ad5-hACE2-transduced BALB/c mice 51, specific pathogen-free 6-10 weeks old male and female BALB/c mice were lightly anesthetized with isoflurane and transduced intranasally with 2.5×108 fluorescence focus units (FFU) of Ad5-ACE2 in 75 μL DMEM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudotyped virus was generated by EZ Trans cell transfection reagent-mediated co-transfection of HEK293T cells with the Spike-expressing plasmid pcDNA3.1-2019-nCoV-S-IRES (strain 2019-nCoV WIV04) and pNL4-3. Luc. ΔR ΔE 81.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Spike-expressing</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA3.1-2019-nCoV-S-IRES</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pNL4-3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, cells were detected with BD Accuri C6 and analyzed with FlowJo.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Raw RNA sequencing (RNA-seq) reads were filtered using Trimmomatic v0.36 82.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Trimmomatic</div><div>suggested: (Trimmomatic, RRID:SCR_011848)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The filtered reads were mapped to the human (hg38) reference genomes using HISAT v2.1 with corresponding gene annotations (GRCh38.p13) with default settings 83.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HISAT</div><div>suggested: (HISAT2, RRID:SCR_015530)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Total counts per mapped gene were determined using featureCounts function in SubReads package v1.5.3 with default parameter 84.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>featureCounts</div><div>suggested: (featureCounts, RRID:SCR_012919)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, counts matrix obtained from featureCounts was used as input for differential expression gene analysis with the bioconductor package DESeq2 v1.26 in R v4.085.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>bioconductor</div><div>suggested: (Bioconductor, RRID:SCR_006442)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Filtered counts matrix was normalized using the DESeq2 method to remove the library-specific artifacts.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transcription-factor enrichment analysis and functional enrichment analysis was performed using Metascape server tool 86 (https://metascape.org/gp/index.html#/main/step1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Metascape</div><div>suggested: (Metascape, RRID:SCR_016620)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene set enrichment analysis (GSEA) were performed using the R package clusterProfiler v3.18.1 87.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene set enrichment analysis</div><div>suggested: (Gene Set Enrichment Analysis, RRID:SCR_003199)</div></div><div style="margin-bottom:8px"><div>clusterProfiler</div><div>suggested: (clusterProfiler, RRID:SCR_016884)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein-protein interaction (PPI) networks of DEGs were built using STRING v11 with a confidence score threshold of 0.7 and visualized with Cytoscape v3.8.1 88,89.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STRING</div><div>suggested: (STRING, RRID:SCR_005223)</div></div><div style="margin-bottom:8px"><div>Cytoscape</div><div>suggested: (Cytoscape, RRID:SCR_003032)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      The limitation of our study is that the administration of Eba or Lor significantly reduced SARS-CoV-2-induced inflammation and lung injury, but showed limitation in suppressing viral replication in lungs of ACE2 humanized mice. A combination of MC stabilizers with antiviral drugs such as the RNA polymerase inhibitors Remdesivir and Favipiravir 6,78–80, may provide more optimal treatment strategy that dampening inflammation and clearing viruses at the same time. In summary, we demonstrate that SARS-CoV-2 triggers lung MCs degranulation, which induces the remodeling of various cellular signalings in human alveolar epithelial cells, particularly, MCs degranulation induces the alveolar epithelial inflammation and leads to the consequent disruption of tight junction proteins; importantly, we find that the clinically used MC degranulation stabilizers Eba and Lor are potent agents at reducing virus-induced production of pro-inflammatory factors and preventing lung injury. Our finding uncovers a potentially novel mechanism of SARS-CoV-2 infection initiates alveolar epithelial inflammation and induces lung Injury. Significantly, our results suggest a potential off-label use of MC stabilizers as immunomodulators to treat the severe cases of COVID-19.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04324021</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Terminated</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Efficacy and Safety of Emapalumab and Anakinra in Reducing H…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04338958</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ruxolitinib in Covid-19 Patients With Defined Hyperinflammat…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.22.449355: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Euthanasia Agents: Mice were injected intramuscularly into the gastroc nemius muscle of each hind leg using a 27-gauge needle (BD, San Diego, CA) with 50 mL per injection site (100 mL total) of immunogen under isoflurane anesthesia.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">HEK293F is a female human embryonic kidney cell line transformed and adapted to grow in suspension (Life Technologies).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">De-identified clinical serum samples were randomly used for spiking in target proteins.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">No sample was excluded from data analysis, and no blinding was used.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TMPRSS2 expression was confirmed using an anti-V5 antibody (Thermo Fisher Scientific, 2F11F7) or anti-TMPRSS2 mAb (Abnova, Clone 2F4) and APC-conjugated goat anti-mouse IgG (BioLegend, 405308).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-V5</div><div>suggested: (Thermo Fisher Scientific Cat# 37-7500, RRID:AB_2533339)</div></div><div style="margin-bottom:8px"><div>anti-TMPRSS2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (BioLegend Cat# 405308, RRID:AB_315011)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One day post-transfection, cells were infected with VSV(G*ΔG-luciferase) and after 2 h were washed five times with DMEM before adding medium supplemented with anti-VSV-G antibody (I1-mouse hybridoma supernatant, CRL-2700, ATCC)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-VSV-G</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody levels were quantified by conversion of the optical density to a z-score relative to pre-pandemic serum anti-S1 IgG concentrations, as previously described23,33.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S1 IgG</div><div>suggested: (Imported from the IEDB Cat# 2E10, RRID:AB_2848047)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expi293F cells are derived from the HEK293F cell line (Life Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 (CRL-1586, American Type Culture Collection), Vero-TMPRSS2 (a gift of S. Ding, Washington University) and Vero-hACE2-TMPRSS2 (a gift of A. Creanga and B. Graham, National Institutes of Health (NIH)) cells were cultured at 37°C in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 10 mM HEPES (pH 7.3), 1 mM sodium pyruvate, 1× nonessential amino acids and 100 U mL-1of penicillin-streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero-hACE2-TMPRSS2 cell cultures were supplemented with 10 μg ml-1of puromycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-hACE2-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly for MLV, HEK293T cells were co-transfected using Lipofectamine 2000 (Life Technologies) with an S-encoding plasmid, an MLV Gag-Pol packaging construct, and the MLV transfer vector encoding a luciferase reporter according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells in DMEM supplemented with 10% FBS, 1% PenStrep seeded in 10-cm dishes were transfected with the plasmid encoding for the corresponding S glycoprotein using lipofectamine 2000 (Life Technologies) following manufacturer’s indications.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Live and pseudovirus entry and serum neutralization assays: SARS2-02 and SARS2-38 were assayed for neutralization potency by focus-reduction neutralization test (FRNT) as described previously34, and using Vero-TMPRSS2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immune complexes were then added to Vero-TMRPSS2 cell monolayers in a 96-well plate and incubated for 1 h at 37°C prior to the addition of 1% (w/v) methylcellulose in MEM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-TMRPSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the mAbs CV30, B38, and CR3022 and for the vaccinated human serum samples, HEK-hACE2 cells were cultured in DMEM with 10% FBS (Hyclone) and 1% PenStrep with 8% CO2 in a 37C incubator (ThermoFisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-hACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monoclonal antibodies: The murine mAbs SARS2-02 and SARS2-38 studied were isolated from BALB/c mice immunized with SARS-CoV-2 spike and RBD proteins and have been described previously25.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Genes encoding CR302226, B3827, and CV3018 heavy and light chains were ordered from GenScript and cloned into pCMV/R.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV/R</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">General procedures for bacterial protein production and purification: The E. coli Lemo21(DE3) strain (NEB) was transformed with a pET29b+ plasmid encoding the synthesized gene of interest.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET29b+</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmid construction for RBD: The SARS-CoV-2 RBD (BEI NR-52422) construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag (GHHHHHHHH).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1-with</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Relative luciferase units were plotted and normalized in Prism (GraphPad) using a zero value of cells alone and a 100% value of 1:2 virus alone.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Systems of ordinary differential equations describing the kinetics of the interactions between the species involved in each sensor were numerically integrated using integrate.odeint() as implemented in Scipy (version 1.6.3)35.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Scipy</div><div>suggested: (SciPy, RRID:SCR_008058)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The python code for running these simulations is provided as a Jupyter notebook: https://github.com/bwicky/covid_nAb_sensor_simulation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All data were analyzed and plotted using GraphPad Prism 8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.28.450190: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The studies were approved either by the Geneva Cantonal Ethics Commission (2020-00516) or by the ethics committee of Charité-Universitätsmedizin Berlin (EA2/066/20, EA4/244/20, EA2/092/20, and EA4/245/20).<br>IACUC: Animal experimentation ethics declarations: All ferret and hamster experiments were evaluated by the responsible ethics committee of the State Office of Agriculture, Food Safety, and Fishery in Mecklenburg–Western Pomerania (LALLF M-V) and gained governmental approval under registration number LVL MV TSD/7221.3-1-004/21.<br>Field Sample Permit: Mouse studies were conducted in compliance with the Swiss Animal Welfare legislation and approved by the commission for animal experiments of the canton of Bern under license BE-43/20.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunohistochemistry (IHC) was performed using an anti-SARS nucleocapsid antibody (Novus Biologicals #NB100-56576, dilution 1:200) according to standardized avidin-biotin-peroxidase complex-method producing a red labelling and hematoxylin counterstain.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS</div><div>suggested: (Novus Cat# NB100-56576, RRID:AB_838838)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: Vero E6 cells (kindly provided by Doreen Muth, Marcel Müller, and Christian Drosten, Charité, Berlin, Germany) or Vero-TMPRSS2 22 (kindly provided by Stefan Pöhlmann, German Primate Center - Leibniz Institute for Primate Research, Göttingen, Germany) were propagated in Dulbecco’s Modified Eagle Medium-GlutaMAX™ supplemented with 1 mM sodium pyruvate, 10% (v/v) heat-inactivated fetal bovine serum (FBS), 100 μg/ml streptomycin, 100 IU/ml penicillin, 1% (w/v) nonessential amino acids, and 15 mM HEPES (Gibco, Gaithersburg, Maryland, United States of America).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Contemporary clinical isolates from the B.1.160 (SD614G) (EPI_ISL_414019), B.1.1.7 (EPI_ISL_2131446, EPI_ISL_751799 (L4549)) and B.1.351 (EPI_ISL_803957 (L4550)) were isolated and minimal passaged upon Vero E6 cells. B.1.351 (EPI_ISL_981782) was initially isolated on A549 cells expressing hACE2 before passaging on Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Isogenic viruses were grown on Vero-TMPRSS2 cells, after one passage on human bronchial airway epithelial cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero-E6 cells were washed 1x with PBS and inoculated with the virus serum/plasma mixture for 1h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 B.1.1.7 (L4549) and B.1.351 (L4550) 18 were received from the Robert-Koch-Institut Berlin,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 B.1.1.7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein expression, purification, and biolayer interferometry assay: SARS-CoV-2 spike protein expression plasmids were constructed to encode the ectodomain of spike protein S614G or SB.1.1.7 (residues 1–1208, with a mutated furin cleavage site and K986P/V987P substitutions) followed by a T4 foldon trimerization domain and a polyhistidine purification tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SB.1.1.7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Evaluation and interpretation was performed by board-certified veterinary pathologists (DiplECVP) (AB, IBV).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AB</div><div>suggested: RRID:BDSC_203)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse studies: Homozygous hACE2 knock-in mice (B6.Cg-Ace2tm1(ACE2)Dwnt; henceforth hACE2-KI) and hemizygous transgenic mice (Tg(K18-hACE2)2Prlmn; henceforth hACE2-K18Tg) were described previously 4, 16.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6.Cg-Ace2tm1 ( ACE2)Dwnt; henceforth hACE2-KI )</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Tg(K18-hACE2)2Prlmn; henceforth hACE2-K18Tg</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One day after inoculation, infected hACE2-K18Tg mice were placed in the cage of another hACE2-K18Tg contact mouse.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>hACE2-K18Tg</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: Statistical analysis was performed using the GraphPad Prism version 8 or R (version 4.1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.29.450397: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monoclonal antibody 5-7 for cryo-EM experiments was expressed and purified as Fab: VHCH1 with a C-terminal His-tag (His8) and LC were constructed separately into the gWiz expression vector, and then co-transfected and expressed in Expi293.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>His-tag ( His8 )</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T/17 cells and Vero E6 cells were cultured in 10% Fetal Bovine Serum (FBS, GIBCO cat# 16140071) supplemented Dulbecco’s Modified Eagle Medium (DMEM, ATCC cat# 30-2002) at 37 °C, 5% CO2</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T/17</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein expression was carried out in Human Embryonic Kidney (HEK) 293 Freestyle cells (Invitrogen) in suspension culture using serum-free media (Invitrogen) by transient transfection using polyethyleneimine (Polysciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The NTD-Avi tag-expression plasmid was transiently co-transfected with the pVRC8400 plasmid encoding the biotin-Ligase BirA from E. coli (Lys2-Lys321) into HEK293 cells suspension culture in serum-free media using polyethyleneimine transfectant.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Authentic SARS-CoV-2 microplate neutralization: The SARS-CoV-2 viruses USA-WA1/2020 (WA1), USA/CA_CDC_5574/2020 (B1.1.7), hCoV-19/South Africa/KRISP-EC-K005321/2020 (B1.351), hCoV-19/Japan/TY7-503/2021 (P.1) and hCoV-19/USA/CA (B.1.429) were obtained from BEI Resources (NIAID, NIH) and propagated for one passage using Vero E6 cells. hCoV-19/USA/NY-NP-DOH1/2021 was isolated and sequence was verified (Annavajhala et al., 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293T cells were grown to 80% confluency before transfection with the spike gene using Lipofectamine 3000 (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The NTD-Avi tag-expression plasmid was transiently co-transfected with the pVRC8400 plasmid encoding the biotin-Ligase BirA from E. coli (Lys2-Lys321) into HEK293 cells suspension culture in serum-free media using polyethyleneimine transfectant.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pVRC8400</div><div>suggested: RRID:Addgene_63164)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The NTD-expression plasmid and BirA plasmid were mixed at a 10:1 ratio for transfection and 3 hrs post-transfection the media was supplemented with 50 μM Biotin (Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BirA</div><div>suggested: RRID:Addgene_113640)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Motion correction, CTF estimation, particle extraction, 2D classification, ab initio model generation, 3D refinements and local resolution estimation for all datasets were carried out in cryoSPARC 3.2(Punjani et al., 2017); particles were picked using Topaz (Bepler et al., 2019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Automated and manual model building were iteratively performed using real space refinement in Phenix (Adams et al., 2004) and Coot (Emsley and Cowtan, 2004) respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Half maps were provided to Resolve Cryo-EM tool in Phenix to support manual model building.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phenix</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Geometry validation and structure quality assessment were performed using EMRinger (Barad et al., 2015) and Molprobity (Davis et al., 2004).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Molprobity</div><div>suggested: (MolProbity, RRID:SCR_014226)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Map-fitting cross correlation (Fit-in-Map tool) and figures preparation were carried out using PyMOL, UCSF Chimera (Pettersen et al., 2004) and Chimera X (Pettersen et al., 2021).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data was processed and fit to 1:1 interaction model using the Scrubber 2.0 (BioLogic Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Scrubber</div><div>suggested: (Scrubber2, RRID:SCR_015745)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">N AND STATISTICAL ANALYSIS: The statistical analyses for the pseudovirus neutralization assessments were performed using GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cryo-EM data were processed and analyzed using cryoSPARC and RELION.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RELION</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. Einmal am Tag sollen Patienten von einer Person Besuch bekommen können – für eine Stunde.

      § 3 (1) Krankenhaus-Covid-19-Verordnung

  2. Jun 2021
    1. Besuche in Pflegeeinrichtungen sind innerhalb folgender Mindestbesuchszeiten möglich: täglich von 10 bis 17 Uhr an mindestens einem Tag am Wochenende sowie zwei weiteren Wochentagen von 09 bis 19 Uhr Darüber hinaus sind auch individuelle Terminvereinbarungen möglich.

      § 12 (3) 3. PflegeM-Cov-19-V

    2. Auch für Neugeborene und ihre Mütter gilt das einstündige Besuchsrecht am Tag durch eine einzige Person. Geschwister des Babys unter 16 Jahren dürfen die besuchende Person begleiten. Gebärende dürfen sich zur Geburt in einem Krankenhaus von einer Person ihrer Wahl begleiten lassen.

      § 4 (1) Zweite Krankenhaus-Covid-19-Verordnung i.V.m. § 4 (2) Zweite Krankenhaus-Covid-19-Verordnung

    1. Author Response:

      Reviewer #1 (Public Review):

      The physical principles underlying oligomerization of GPCRs are not well understood. Here, authors focused on oligomerization of A2AR. They found that oligomerization of A2AR is mediated by the intrinsically disordered, extramembraneous C-terminal tail. Using experiment and MD simulation, they mapped the regions that are responsible for oligomerization and dissected the driving forces in oligomerization.

      This is a nice piece of work that applies fundamental physical principles to the understanding of an important biological problem. It is a significant finding that oligomerization of A2AR is mediated by multiple weak interactions that are "tunable" by environmental factors. It is also interesting that solute-induced, solvent-mediated "depletion interactions" can be a key driving force in membrane protein-protein interactions.

      Although this work is potentially a significant contribution to the fields of GPCRs and molecular biophysics of membrane proteins in general, there are several concerns that would need to be implemented to strengthen the conclusions.

      1) How reasonably would the results obtained in the micellar environment be translated into the phenomenon in the cell membranes?

      1a) Here authors measured oligomerization of A2AR in detergent micelles, not in the bilayer or cellular context. Although the cell membranes would provide another layer of complexity, the hydrophobic properties and electrostatics of the negatively charged membrane surface may cooperate or compete with the interactions mediated by the C-terminal tail, especially if the oligomerization is mediated by multiple weak interactions.

      The translatability of properties of membrane proteins in detergent micelles to the cellular context is a valid concern. However, this shortcoming applies to all biophysical studies of membrane proteins in non-native environments. Even for membrane proteins reconstituted in liposomes, the question arises whether the artificial lipid composition that differs from that in the human plasma membrane would alter protein properties, especially as surface charges and cholesterol content can impact membrane protein dynamics, association, and stability. In that sense, this question cannot be answered satisfyingly, especially for GPCRs that are notoriously difficult to isolate. However, we can offer some perspectives. The propensity for membrane proteins to associate and oligomerize, if anything, is greater in lipid bilayers compared to that in detergent micelles, while detergent micelles can effectively solubilize membrane protein monomers (Popot and Engelman, Biochem 1990, 29 (17), 4031–4037). Hence, the findings that A2AR readily oligomerizes in detergent micelles and that the degree of oligomerization can be systematically tuned by the C-terminal length of A2AR in the same micellar system suggest that inter-A2AR interactions are modulating receptor oligomerization; we speculate that A2AR oligomers will be present or be enhanced in the lipid bilayer environment. In fact, in the cellular context, it has been shown that A2AR assembles into homodimers at the cell surface in transfected HEK293 cells (Canals et al, J Neurochem 2004, 88, 726–734) and into higher- order oligomers at the plasma membrane in Cath.A differentiated neuronal cells (Vidi et al, FEBS Lett 2008, 582, 3985–3990). Furthermore, C-terminally truncated A2AR has been demonstrated to show no protein aggregation or clustering on the cell surface, a process otherwise observed in the WT form (Burgueno et al, J Biol Chem 2003, 278 (39), 37545–37552). These results provide the research community with a valid starting point to discover factors that control oligomerization of A2AR in the cellular context.

      1b) Related to the point above (1a), I wonder if MD simulation could provide an insight into the role of the lipid bilayer in the inter- or intra-molecular interactions involving the tail. Although the neutral POPC bilayer was employed in the simulation, the tail-membrane interaction may affect oligomerization since the tail is intrinsically disordered and possess a significant portion of nonpolar residues (Fig. S4).

      The reviewer brings up a valid point about the ability for MD simulations to provide insights into the role of membrane-protein interactions. In response to the reviewer, we performed additional analysis focusing on the interactions of the C-terminus with the lipid bilayer. Overall, as the C-terminus is extended, there is a decrease in its interaction with the cytoplasmic leaflet of the membrane (left figure below). More specifically, we find that the C-terminal segment associated with helix 8 (residues 291 to 314) interacts tightly with the membrane, while the rest of the C-terminus (an intrinsically disordered segment) more weakly interacts with the membrane, regardless of truncation (right figure below). As the C-terminus is extended, the inherent conformational flexibility leads to a decrease in the interactions between the protein and the bilayer. We also observe that shorter stretches of the disordered segment do have the ability to interact more closely with the membrane. While these portions include charged residues that can participate in formation of the dimer interface, no general trends are observed. We therefore cannot draw any conclusions regarding the role of C-terminal-membrane interactions on the dimerization of A2AR. What we do know is that the MD simulations presented here should be considered a model study that reveals that the charged and disordered C-terminus of A2AR can account for oligomerization via multiple and weak inter-protomer contacts.

      MD simulations showing (Left) average distance of all C-terminal residues and (right) average per-residue distance from the cytoplasmic membrane of the lipid bilayer.

      2) Ensuring that the oligomer distributions are thermodynamic products.

      Since authors interpret the SEC results on the basis of thermodynamic concepts (driving forces, depletion interactions, etc.), it would be important to verify that the distribution of different oligomeric states is the outcome of the thermodynamic control. There is a possibility that the distribution is the outcome of the "kinetic trapping" during detergent solubilization.

      This is an important question. As we have shown in the manuscript, the A2AR dimer level was found to be reduced in the presence of TCEP (Figure 2B), suggesting that disulfide linkages have a role in facilitating A2AR oligomerization. However, disulfide cross-linking reaction cannot be the sole driving force of A2AR oligomerization because (1) a significant population of A2AR dimer remained resistant to TCEP (Figure 2B), (2) A2AR oligomer levels decreased progressively with the shortening of the C-terminus (Figure 3), and (3) A2AR oligomerization is driven by depletion interactions enhanced with increasing ionic strength (Figure 5).

      To answer whether A2AR oligomer is a thermodynamic or kinetic product, we tested the stability and reversibility of the A2AR monomer and dimer/oligomer population. We used SEC to separate these populations of both the A2AR-WT and A2AR-Q372ΔC variants, then performed a second round of SEC to observe their repopulation, if any. The results are summarized in the figure below, which we will include in the revised manuscript as Figure 5-figure supplement 1.

      We find that the SEC-separated monomers repopulate measurably into dimer/oligomer, with the total oligomer level after redistribution comparable with that of the initial samples for both A2AR WT (initial: 2.87; redistributed: 1.60) and A2AR-Q372ΔC (initial: 1.49; redistributed: 1.40) (Figure 5-figure supplement 1A). This observation indicates that A2AR oligomer is a thermodynamic product with a lower free energy compared with that of the monomer. This is consistent with the results we have shown in the manuscript that the oligomer levels of A2AR-WT are consistent (1.34–2.87; Table S1) and that A2AR oligomerization can be modulated with ionic strengths via depletion interactions (Figure 5).

      Figure S5. The dimer/oligomerization of A2AR is a thermodynamic process where the dimer and HMW oligomer once formed are kinetically trapped. (A) SEC chromatograms of the consecutive rounds of SEC performed on A2AR-WT and Q372ΔC. The first rounds of SEC are to separate the dimer/oligomer population and the monomer population, while the second rounds of SEC are performed on these SEC-separated populations to assess their stability and reversibility. The total oligomer level is expressed relative to the monomeric population in arbitrary units. (B) Energy diagram depicting A2AR oligomerization progress. The monomer needs to overcome an activation barrier (EA), driven by depletion interactions, to form the dimer/oligomer. Once formed, the dimer/oligomer populations are kinetically trapped by disulfide linkages.

      Interestingly, the SEC-separated dimer/oligomer populations do not repopulate to form monomers (Figure 5-figure supplement 1). This observation is, again, consistent with a published study of ours on A2AR dimers (Schonenbach et al, FEBS Lett 2016, 590, 3295–3306). This observation furthermore indicates that once the oligomers are formed, some are kinetically trapped and thus cannot redistribute into monomers.

      We believe that disulfide linkages are likely candidates that kinetically stabilize A2AR oligomers, as demonstrated by their redistribution into monomers only in the presence of a reducing agent (Figure 2B). Taken together, we suggest that A2AR oligomerization is a thermodynamic process (Figure 5-figure supplement 1B), with the monomer overcoming the activation energy (EA) by depletion interactions to repopulate into dimer/oligomer with a slightly lower free energy (given that we see a distribution between the two). Once formed, the redistributed dimer/oligomer populations can be kinetically stabilized by disulfide linkages.

      3) The claim that the C-terminal tail is engaged in "cooperative" interactions is too qualitative (p. 11 line 274, p.12 line 279 and p.18 line 426).

      This claim seems derived from Fig. 3b and Figs. 4b-c. However, the gradual decrease in the dimer level and the number of interactions may indicate that different parts in the C-terminal tail contribute to dimerization additively rather than cooperatively. The large decrease in the number of interactions may stem from the large decrease in the length (395 to 354). Probably, a more quantitative measure would be the number of interactions (H-bonds/salt bridges) normalized to the tail length upon successive truncation. Even in that case, the polar/charged residues would not be uniformly distributed along the primary sequence, making the quantitative argument of cooperativity challenging.

      The request to clarify our basis to refer to a cooperative interaction is well taken. Figure 4B and 4C show that the truncation of one part of the C-terminus (segment 335–394) leads to a reduction in contacts of a different part (segment 291–334) of A2AR. Therefore, we conclude that the binding interactions that occur in segment 291–334 are altered by the interactions exerted by the segment 335–394. This characteristic is consistent with allosteric interactions. We believe that characterizing these interactions as “cooperative” is possible but is not fully justified in this work. We also agree with the comment that quantifying the role and segments involved in contacts would be challenging. The manuscript has been amended to use the term “allosteric” in place of “cooperative”.

      4) On the compactness and conformation of the C-terminal tail:

      Although the C-terminal tail is known as "intrinsically disordered", the results seem to indicate that its conformation is rather compact (or collapsed) with a number of intra- and intermolecular polar interactions (Fig. 4) and buried nonpolar residues (Fig. 6), which are subject to depletion interactions (Fig. 5). This raises a question if the tail indeed "intrinsically disordered" as is known. Recent folding studies on IDPs (Riback et al. Science 2017, 358, 238-; Best, Curr Opin Struct Biol 2020, 60, 27-) suggest that IDPs are partially expanded or expanded rather than collapsed.

      We agree that our results seem to suggest that the conformation of the C-terminus could be partially compact. However, by stating that the C-terminus on average is an intrinsically disordered region (IDR), we do not exclude the possibility of partially structured regions, or greater compactness than that of an excluded volume polymer. IDR or IDP should refer to all proteins or protein regions that do not adopt a unique structure. By that standard, we know that the C-terminus of A2AR falls into that category according to our experiments and MD simulation, as well as the literature. In isolation, the majority the C-terminus is indeed an IDR, as has been demonstrated not only by simulations but also by experimental data. In fact, the C-terminus exhibits partial alpha-helical structure, and transiently populates beta-sheet conformations, depending on its state and buffer conditions (Piirainen et al, Biophys J 2015, 108 (4), 903–917). The literature studies suggest that A2AR’s C-terminus may adopt a greater level of compactness when interactions are formed between the C-terminus and the rest of the A2AR oligomer.

      Reviewer #2 (Public Review):

      The authors expressed A2A receptor as wild type and modified with truncations/mutations at the C-terminus. The receptor was solubilized in detergent solution, purified via a C-terminal deca-His tag and the fraction of ligand binding-competent receptor separated by an affinity column. Receptor oligomerization was studied by size exclusion chromatography on the purified receptor solubilized in a DDM/CHAPS/CHS detergent solution. It was observed that truncation greatly reduces the tendency of A2A to form dimers and oligomers. Mechanistic insights into interactions that facilitate oligomerization were obtained by molecular simulations and the study of aggregation behavior of peptide sequences representing the C-terminus of A2A. It is concluded that a multitude of interactions including disulfide linkages, hydrogen bonds electrostatic- and depletion interactions contribute to aggregation of the receptor.

      The general conclusions appear to be correct and the paper is well written. This is a study of protein association in detergent solution. It is conceivable that observations are relevant for A2A receptors in cell membranes as well. However, extrapolation of mechanisms observed on receptor in detergent micelles to receptor in membranes should proceed with caution. In particular, the spatial arrangement of oligomerized receptor molecules in micelles may differ from arrangement in lipid bilayers. The lipid matrix may have a profound influence on oligomerization.

      The ultimate question to answer is how oligomerization alters receptor function. This will have to be addressed in a future study.

      We could not agree more. We address the concern regarding the translatability of properties of membrane proteins in detergent micelles to the cellular context in our response to Reviewer 1. In short, we believe the general propensity for A2AR to form dimers/oligomers and the role of the C-terminus will hold in the cellular context. However, even if it does not, given that biophysical structure-function studies of GPCRs are conducted in detergent micelles and other artificial environments, it is critical to understand the role of the C-terminus in the oligomerization of reconstituted A2AR in detergent micelles. How oligomerization alters receptor function is a question that is always on our mind and should be the the focus of future studies. Indeed, it has been demonstrated that truncation of the A2AR C-terminus significantly reduces receptor association with Gαs and cAMP production in cellular assays (Koretz et al, Biophys J 2021, https://doi.org/10.1016/j.bpj.2021.02.032). The results presented in this manuscript, which have demonstrated the impact of C-terminal truncation on A2AR oligomerization, will offer critical understanding for such study of the functional consequences of A2AR oligomerization.

      Reviewer #3 (Public Review):

      The work of Nguyen et al. demonstrates the relevant role of the C-terminus of A2AR for its homo-oligomerization. A previous work (Schonenbach et al. 2016) found that a point mutation of C394 in the C-terminus (C394S) reduces homo-oligomerization. Following this direction, more mutants were generated, the C-terminus was also truncated at different levels, and, using size-exclusion chromatography (SEC), the oligomerization levels of A2AR variants were assessed. Overall, these experiments support the role of the C-terminus in the oligomerization process. MD studies were performed and the non-covalent interactions were monitored. To 'identify the types of non-covalent interaction(s)', A2AR variants were also analysed modulating the ionic strength from 0.15 to 0.95 M. The C-terminus peptides were investigated to assess their interaction in absence of the TM domain.

      The SEC results on the A2AR variants strongly support the main conclusion of the paper, but some passages and methodologies are less convincing. The different results obtained for dimerization and oligomerization are low discussed. The MD simulations are performed on models that are not accurately described - structural information currently available may compromise the quality of the model and the validity of the results (i.e., applying MD simulations to low-resolution models may not be appropriate for the goal of this analysis, moreover the formation of disulfide bonds cannot be simulated but this can affect the conformation and consequently the interactions to be monitored). Although the C-terminus is suggested as 'a driving factor for the oligomerization', the TM domain is indeed involved in the process and if and how it will be affected by modulating the solvent ionic strength should be discussed.

      We thank the reviewer for the overall positive assessment and critical input. We will respond to the comments as followed.

      The qualitative trend for dimerization is consistent with that for oligomerization, as demonstrated in Figs. 2A, 3B, and 5. For example, a reduction in both dimerization and oligomerization was observed upon C394X mutations (Figure 2A), as well as upon systematic truncations (Figure 3B), while very similar trends were seen for the change in the dimer and oligomer levels of all four constructs upon variation of ionic strength (Figure 5).

      We agree that the experimental observation and MD simulation only incompletely describe the state of the A2AR dimer/oligomer. For example, we discover the impact of ERR:AAA mutations of the C-terminus (Figure 3C) on oligomer formation, but do not know whether this segment interacts with the TM domain or C-terminus of the neighboring A2AR. MD simulations suggest that the inter-protomer interface certainly involves inter-C-termini contact. We also mention that the A2AR oligomeric interfaces could be asymmetric, suggesting that the C-terminus can interact with other parts of the receptor, including the TM domain. However, we do not have evidence that the TM domain directly interact with each other to stabilize A2AR oligomers, and thus cannot discuss the effect of the solvent ionic strength on how the TM domain contributes to A2AR oligomerization. We minimize such discussion in our manuscript because we have incomplete insights. What we can say is that multiple and weak inter-protomer interactions that contribute to the dimer and oligomer interface formation prominently involve the C-terminus. Ultimately, the structure of the A2AR dimer/oligomer needs to be solved to answer the reviewer’s question fully.

      With respect to the validity of our model, we restricted ourselves to using the best-available X-ray crystal structure for A2AR. Since this structure (PDB 5G53) does not include the entire C-terminus, we resorted to using homology modeling software (i.e., MODELLER) to predict the structures of the C-terminus. In our model, the first segment of the C-terminus consisting of residues 291 to 314 were modeled as a helical segment parallel to the cytoplasmic membrane surface while the rest of the C-terminus was modeled as intrinsically disordered. MODELLER is much more accurate in structural predictions for segments less than 20 residues. This limitation necessitated that we run an equilibrium MD simulation for 2 µs to obtain a well-equilibrated structure that possesses a more viable starting conformation. We have included this detailed description of our model in lines 641–650. To validate our models of all potential variants of A2AR, we calculated the RMSD and RMSF for each truncated variant. Our results clearly show that the transmembrane helical bundle is very stable, as expected, and that the C-terminus is more flexible (see figure below). This flexibility is somewhat consistent for lengths up to 359 residues, with a more noticeable increase in flexibility for the 394-residue variant of A2AR.

      Root mean square fluctuation (RMSF) from sample trajectories of truncated variants modeled from the crystal structure of the adenosine A2AR bound to an engineered G protein (PDB ID 5G53), and the root mean square deviation (RMSD) of the C-terminus of each variant starting from residue 291.

    2. Reviewer #2 (Public Review):

      The authors expressed A2A receptor as wild type and modified with truncations/mutations at the C-terminus. The receptor was solubilized in detergent solution, purified via a C-terminal deca-His tag and the fraction of ligand binding-competent receptor separated by an affinity column. Receptor oligomerization was studied by size exclusion chromatography on the purified receptor solubilized in a DDM/CHAPS/CHS detergent solution. It was observed that truncation greatly reduces the tendency of A2A to form dimers and oligomers. Mechanistic insights into interactions that facilitate oligomerization were obtained by molecular simulations and the study of aggregation behavior of peptide sequences representing the C-terminus of A2A. It is concluded that a multitude of interactions including disulfide linkages, hydrogen bonds electrostatic- and depletion interactions contribute to aggregation of the receptor.

      The general conclusions appear to be correct and the paper is well written. This is a study of protein association in detergent solution. It is conceivable that observations are relevant for A2A receptors in cell membranes as well. However, extrapolation of mechanisms observed on receptor in detergent micelles to receptor in membranes should proceed with caution. In particular, the spatial arrangement of oligomerized receptor molecules in micelles may differ from arrangement in lipid bilayers. The lipid matrix may have a profound influence on oligomerization.

      The ultimate question to answer is how oligomerization alters receptor function. This will have to be addressed in a future study.

  3. dash.eloquent.works dash.eloquent.works
    1. An interesting tool for taking notes from Jeremy Ho. Designed with Roam Research in mind.

      The Eloquent tool is available to install! Capture ideas in-context with:<br>• On-page highlighting<br>• Nested bullets<br>• /snippets<br>• [[braces]] and #tag syntax<br>Quick capture is a hotkey away. Bonus hotkey sends your highlights/links to @RoamResearch pic.twitter.com/vLLbPX4zwW

      — Jeremy Ho (@jeremyqho) July 21, 2020
      <script async src="https://platform.twitter.com/widgets.js" charset="utf-8"></script>

      I wish it could save data as a local text or markdown file so it would also be easier to use with Obsidian or other note taking tools. It's similar in nature to the Roam Highlighter extension.

      Details at https://www.notion.so/Eloquent-Resource-Center-72f95c2a71d34c5181e4907edf7a96e1

    1. Birds and mammals have only one pigment cell type, the melanocyte, producing the pigment melanin (although in different shades) that is secreted into the skin or feathers and hairs.

      Tag:vertebrados,aves,mamiferos

    2. In contrast, basal vertebrates such as fish, amphibia and reptiles develop several chromatophore types producing different colours. In these animals, colour patterns arise as mosaics of chromatophores distributed in the hypodermis of the body, and the epidermis of scales and fins (Box 1).

      Tag:vertebrados,peces,anfibios,reptiles,

    3. Vertebrate colour patterns are composed of specialised pigment-producing cells, the chromatophores. These originate from the neural crest, a transient primordium of multipotent cells located at the dorsal neuroectodermal ridge from which progenitor cells emigrate to develop a variety of structures and tissues [2]. Neural crest is a developmental innovation that allowed vertebrates to get both large and colourful. Other neural crest-derived structures include elements of the skull and jaw, the neurons of the peripheral nervous system and glia.

      Tag:vertebrados

    1. 这一工作流的优点是?最大的优点是简单明确。如果将 Todo List 维护成「我所要做的所有事情」的一个 canonical representation,那么维护这一系统就几乎完全等同于维护一个文本格式的列表,没有任何额外的认知负担,任何人拿起纸笔就可以从零开始尝试。

      内核是一套文本 如果没有特别复杂,确实文本就够,最多加一些inline tag 反而在应用场景上,要注重的点是随机可达和一些基础设计

      所以让职场新人用flomo加上一些规则,其实就够了。

    1. to state them “explicitly,” teach them “directly, and [require them] in students’ work” (Horning 2007: 3).

      Yes! I often talk to instructors about using Hypothesis's tag feature to explicitly call out these micro-processes that are part of reading "well."

    1. In den Häusern des Krankenhauskonzerns Vivantes gilt bereits seit Montag ein Besuchsverbot
    2. Für Geburten gilt künftig, dass sich die Frauen einen Menschen aussuchen dürfen, der sie begleitet.

      § 4 (1) S. 1 Krankenhaus-Covid-19-Verordnung

    3. Auch Seelsorge ist laut dem Papier weiter möglich.

      § 3 (3) S. 1 Krankenhaus-Covid-19-Verordnung

    4. Wegen des Wiederanstiegs der Corona-Neuinfektionen in Berlin sollen ab Samstag Besuchsregeln für die Krankenhäuser in der Stadt gelten.
    5. Menschen mit Symptomen, die auf Covid-19 hinweisen, dürfen laut der Verordnung allerdings nicht zu Besuch in Kliniken kommen.

      § 2 Krankenhaus-Covid-19-Verordnung

    6. Für den Besuch bei Schwerstkranken und Sterbenden sind keine Einschränkungen vorgesehen.

      § 3 (2) Krankenhaus-Covid-19-Verordnung

    7. Einmal am Tag sollen Patienten demnach von einer Person Besuch bekommen können – für eine Stunde.

      § 3 (1) Krankenhaus-Covid-19-Verordnung

    1. Author Response:

      Reviewer #1:

      Zappia et al investigate the function of E2F transcriptional activity in the development of Drosophila, with the aim of understanding which targets the E2F/Dp transcription factors control to facilitate development. They follow up two of their previous papers (PMID 29233476, 26823289) that showed that the critical functions of Dp for viability during development reside in the muscle and the fat body. They use Dp mutants, and tissue-targetted RNAi against Dp to deplete both activating and repressive E2F functions, focussing primarily on functions in larval muscle and fat body. They characterize changes in gene expression by proteomic profiling, bypassing the typical RNAseq experiments, and characterize Dp loss phenotypes in muscle, fat body, and the whole body. Their analysis revealed a consistent, striking effect on carbohydrate metabolism gene products. Using metabolite profiling, they found that these effects extended to carbohydrate metabolism itself. Considering that most of the literature on E2F/Dp targets is focused on the cell cycle, this paper conveys a new discovery of considerable interest. The analysis is very good, and the data provided supports the authors' conclusions quite definitively. One interesting phenotype they show is low levels of glycolytic intermediates and circulating trehalose, which is traced to loss of Dp in the fat body. Strikingly, this phenotype and the resulting lethality during the pupal stage (metamorphosis) could be rescued by increasing dietary sugar. Overall the paper is quite interesting. It's main limitation in my opinion is a lack of mechanistic insight at the gene regulation level. This is due to the authors' choice to profile protein, rather than mRNA effects, and their omission of any DNA binding (chromatin profiling) experiments that could define direct E2F1/ or E2F2/Dp targets.

      We appreciate the reviewer’s comment. Based on previously published chromatin profiling data for E2F/Dp and Rbf in thoracic muscles (Zappia et al 2019, Cell Reports 26, 702–719) we discovered that both Dp and Rbf are enriched upstream the transcription start site of both cell cycle genes and metabolic genes (Figure 5 in Zappia et al 2019, Cell Reports 26, 702–719). Thus, our data is consistent with the idea that the E2F/Rbf is binding to the canonical target genes in addition to a new set of target genes encoding proteins involved in carbohydrate metabolism. We think that E2F takes on a new role, and rather than being re-targeted away from cell cycle genes. We agree that the mechanistic insight would be relevant to further explore.

      Reviewer #2:

      The study sets out to answer what are the tissue specific mechanisms in fat and muscle regulated by the transcription factor E2F are central to organismal function. The study also tries to address which of these roles of E2F are cell intrinsic and which of these mechanisms are systemic. The authors look into the mechanisms of E2F/Dp through knockdown experiments in both the fat body* (see weakness) and muscle of drosophila. They identify that muscle E2F contributes to fat body development but fat body KD of E2F does not affect muscle function. To then dissect the cause of adult lethality in flies, the authors proteomic and metabolomic profiling of fat and muscle to gain insights. While in the muscle, the cause seems to be an as of yet undetermined systemic change , the authors do conclude that adult lethality in fat body specific Dp knockdown is the result of decrease trehalose in the hemolymph and defects in lipid production in these flies. The authors then test this model by presenting fat body specific Dp knockdown flies with high sugar diet and showing adult survival is rescued. This study concurs with and adds to the emerging idea from human studies that E2F/Dp is critical for more than just its role in the cell-cycle and functions as a metabolic regulator in a tissue-specific manner. This study will be of interest to scientists studying inter-organ communication between muscle and fat.

      The conclusions of this paper are partially supported by data. The weaknesses can be mitigated by specific experiments and will likely bolster conclusions.

      1) This study relies heavily on the tissue specificity of the Gal4 drivers to study fat-muscle communication by E2F. The authors have convincingly confirmed that the cg-Gal4 driver is never turned on in the muscle and vice versa for Dmef2-Gal4. However, the cg-Gal4 driver itself is capable of turning on expression in the fat body cells and is also highly expressed in hemocytes (macrophage-like cells in flies). In fact, cg-Gal4 is used in numerous studies e.g.:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4125153/ to study the hemocytes and fat in combination. Hence, it is difficult to assess what contribution hemocytes provide to the conclusions for fat-muscle communication. To mitigate this, the authors could test whether Lpp-Gal4>Dp-RNAi (Lpp-Gal4 drives expression exclusively in fat body in all stages) or use ppl-Gal4 (which is expressed in the fat, gut, and brain) but is a weaker driver than cg. It would be good if they could replicate their findings in a subset of experiments performed in Figure 1-4.

      This is indeed an important point. We apologize for previously not including this information. Reference is now on page 7.

      Another fat body driver, specifically expressed in fat body and not in hemocytes, as cg-GAL4, was tested in previous work (Guarner et al Dev Cell 2017). The driver FB-GAL4 (FBti0013267), and more specifically the stock yw; P{w[+mW.hs]=GawB}FB P{w[+m*] UAS-GFP 1010T2}#2; P{w[+mC]=tubP-GAL80[ts]}2, was used to induce the loss of Dp in fat body in a time-controlled manner using tubGAL80ts. The phenotype induced in larval fat body of FB>DpRNAi,gal80TS recapitulates findings related to DNA damage response characterized in both Dp -/- and CG>Dp- RNAi (see Figure 5A-B, Guarner et al Dev Cell 2017). The activation of DNA damage response upon the loss of Dp was thoroughly studied in Guarner et al Dev Cell 2017. The appearance of binucleates in cg>DpRNAi is presumably the result of the abnormal transcription of multiple G2/M regulators in cells that have been able to repair DNA damage and to resume S-phase (see discussion in Guarner et al Dev Cell 2017). More details regarding the fully characterized DNA damage response phenotype were added on page 6 & 7 of manuscript.

      Additionally, r4-GAL4 was also used to drive Dp-RNAi specifically to fat body. But since this driver is weaker than cg-GAL4, the occurrence of binucleated cells in r4>DpRNAi fat body was mild (see Figure R1 below).

      As suggested by the reviewer, Lpp-GAL4 was used to knock down the expression of Dp specifically in fat body. All animals Lpp>DpRNAi died at pupa stage. New viability data were included in Figure 1-figure supplement 1. Also, larval fat body were dissected and stained with phalloidin and DAPI to visualize overall tissue structure. Binucleated cells were present in Lpp>DpRNAi fat body but not in the control Lpp>mCherry-RNAi (Figure 2-figure supplement 1B). These results were added to manuscript on page 7.

      Furthermore, Dp expression was knockdowned using a hemocyte-specific driver, hml-GAL4. No defects were detected in animal viability (data not shown).

      Thus, overall, we conclude that hemocytes do not seem to contribute to the formation of binucleated-cells in cg>Dp-RNAi fat body.

      Finally, since no major phenotype was found in muscles when E2F was inactivated in fat body (please see point 3 for more details), we consider that the inactivation E2F in both fat body and hemocytes did not alter the overall muscle morphology. Thus, exploring the contribution of cg>Dp-RNAi hemocytes in muscles would not be very informative.

      2) The authors perform a proteomics analysis on both fat body and muscle of control or the respective tissue specific knockdown of Dp. However, the authors denote technical limitations to procuring enough third instar larval muscle to perform proteomics and instead use thoracic muscles of the pharate pupa. While the technical limitations are understandable, this does raise a concern of comparing fat body and muscle proteomics at two distinct stages of fly development and likely contributes to differences seen in the proteomics data. This may impact the conclusions of this paper. It would be important to note this caveat of not being able to compare across these different developmental stage datasets.

      We appreciate the suggestion of the reviewer. This caveat was noted and included in the manuscript. Please see page 11.

      3) The authors show that the E2F signaling in the muscle controls whether binucleate fat body nuclei appear. In other words, is the endocycling process in fat body affected if muscle E2F function is impaired. However, they conclude that imparing E2F function in fat does not affect muscle. While muscle organization seems fine, it does appear that nuclear levels of Dp are higher in muscles during fat specific knock-down of Dp (Figure 1A, column 2 row 3, for cg>Dp-RNAi). Also there is an increase in muscle area when fat body E2F function is impaired. This change is also reflected in the quantification of DLM area in Figure 1B. But the authors don't say much about elevated Dp levels in muscle or increased DLM area of Fat specific Dp KD. Would the authors not expect Dp staining in muscle to be normal and similar to mCherry-RNAi control in Cg>dpRNAi? The authors could consider discussing and contextualizing this as opposed to making a broad statement regarding muscle function all being normal. Perhaps muscle function may be different, perhaps better when E2F function in fat is impaired.

      The overall muscle structure was examined in animals staged at third instar larva (Figure 1A-B). No defects were detected in muscle size between cg>Dp-RNAi animals and controls. In addition, the expression of Dp was not altered in cg>Dp-RNAi muscles compared to control muscles. The best developmental stage to compare the muscle structure between Mef2>Dp-RNAi and cg>Dp-RNAi animals is actually third instar larva, prior to their lethality at pupa stage (Figure 1- figure supplement 1).

      Based on the reviewer’s comment, we set up a new experiment to further analyze the phenotype at pharate stage. However, when we repeated this experiment, we did not recover cg>Dp-RNAi pharate, even though 2/3 of Mef2>Dp-RNAi animals survived up to late pupal stage. We think that this is likely due to the change in fly food provider. Since most cg>DpRNAi animals die at early pupal stage (>75% animals, Figure 1-figure supplement 1), pharate is not a good representative developmental stage to examine phenotypes. Therefore, panels were removed.

      Text was revised accordingly (page 6).

      4) In lines 376-380, the authors make the argument that muscle-specific knockdown can impair the ability of the fat body to regulate storage, but evidence for this is not robust. While the authors refer to a decrease in lipid droplet size in figure S4E this is not a statistically significant decrease. In order to make this case, the authors would want to consider performing a triglyceride (TAG) assay, which is routinely performed in flies.

      Our conclusions were revised and adjusted to match our data. The paragraph was reworded to highlight the outcome of the triglyceride assay, which was previously done. We realized the reference to Figure 6H that shows the triglyceride (TAG) assay was missing on page 17. Please see page 17 and page 21 of discussion.

    2. Reviewer #2 (Public Review): 

      The study sets out to answer what are the tissue specific mechanisms in fat and muscle regulated by the transcription factor E2F are central to organismal function. The study also tries to address which of these roles of E2F are cell intrinsic and which of these mechanisms are systemic. The authors look into the mechanisms of E2F/Dp through knockdown experiments in both the fat body* (see weakness) and muscle of drosophila. They identify that muscle E2F contributes to fat body development but fat body KD of E2F does not affect muscle function. To then dissect the cause of adult lethality in flies, the authors proteomic and metabolomic profiling of fat and muscle to gain insights. While in the muscle, the cause seems to be an as of yet undetermined systemic change , the authors do conclude that adult lethality in fat body specific Dp knockdown is the result of decrease trehalose in the hemolymph and defects in lipid production in these flies. The authors then test this model by presenting fat body specific Dp knockdown flies with high sugar diet and showing adult survival is rescued. This study concurs with and adds to the emerging idea from human studies that E2F/Dp is critical for more than just its role in the cell-cycle and functions as a metabolic regulator in a tissue-specific manner. This study will be of interest to scientists studying inter-organ communication between muscle and fat. 

      The conclusions of this paper are partially supported by data. The weaknesses can be mitigated by specific experiments and will likely bolster conclusions. 

      1) This study relies heavily on the tissue specificity of the Gal4 drivers to study fat-muscle communication by E2F. The authors have convincingly confirmed that the cg-Gal4 driver is never turned on in the muscle and vice versa for Dmef2-Gal4. However, the cg-Gal4 driver itself is capable of turning on expression in the fat body cells and is also highly expressed in hemocytes (macrophage-like cells in flies). In fact, cg-Gal4 is used in numerous studies e.g.:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4125153/ to study the hemocytes and fat in combination. Hence, it is difficult to assess what contribution hemocytes provide to the conclusions for fat-muscle communication. To mitigate this, the authors could test whether Lpp-Gal4>Dp-RNAi (Lpp-Gal4 drives expression exclusively in fat body in all stages) or use ppl-Gal4 (which is expressed in the fat, gut, and brain) but is a weaker driver than cg. It would be good if they could replicate their findings in a subset of experiments performed in Figure 1-4. 

      2) The authors perform a proteomics analysis on both fat body and muscle of control or the respective tissue specific knockdown of Dp. However, the authors denote technical limitations to procuring enough third instar larval muscle to perform proteomics and instead use thoracic muscles of the pharate pupa. While the technical limitations are understandable, this does raise a concern of comparing fat body and muscle proteomics at two distinct stages of fly development and likely contributes to differences seen in the proteomics data. This may impact the conclusions of this paper. It would be important to note this caveat of not being able to compare across these different developmental stage datasets. 

      3) The authors show that the E2F signaling in the muscle controls whether binucleate fat body nuclei appear. In other words, is the endocycling process in fat body affected if muscle E2F function is impaired. However, they conclude that imparing E2F function in fat does not affect muscle. While muscle organization seems fine, it does appear that nuclear levels of Dp are higher in muscles during fat specific knock-down of Dp (Figure 1A, column 2 row 3, for cg>Dp-RNAi). Also there is an increase in muscle area when fat body E2F function is impaired. This change is also reflected in the quantification of DLM area in Figure 1B. But the authors don't say much about elevated Dp levels in muscle or increased DLM area of Fat specific Dp KD. Would the authors not expect Dp staining in muscle to be normal and similar to mCherry-RNAi control in Cg>dpRNAi? The authors could consider discussing and contextualizing this as opposed to making a broad statement regarding muscle function all being normal. Perhaps muscle function may be different, perhaps better when E2F function in fat is impaired. 

      4) In lines 376-380, the authors make the argument that muscle-specific knockdown can impair the ability of the fat body to regulate storage, but evidence for this is not robust. While the authors refer to a decrease in lipid droplet size in figure S4E this is not a statistically significant decrease. In order to make this case, the authors would want to consider performing a triglyceride (TAG) assay, which is routinely performed in flies.

    1. Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Reply to the reviewers

      We are grateful to the reviewers for their thoughtful comments and propose the following experiments or clarifications listed below (blue) in a revised manuscript.


      Reviewer #1 (Evidence, reproducibility and clarity (Required)):

      The authors use a combination of Dsn1-Flag kinetochore purification from yeast extracts and laser trapping experiments (as in a number of previous studies), to study the effect of Mps1-dependent phosphorylation on reconstituted kinetochore-microtubule attachments in vitro. They complement this analysis with genetic experiments characterizing the effects of non-Mps1 phosphorylatable mutants on checkpoint activity and chromosome segregation in yeast.

      The authors had previously shown that Mps1 is the major kinase activity that copurifies with Dsn1-Flag in their purification scheme. They now investigate the effect of adding ATP and thereby allowing Mps1 phosphorylation in the reconstituted system. They show that addition of ATP decreases the rupture force of kinetochore-microtubule attachments, meaning it weakens the strength of the attachment. This effect can be negated either by inhibiting Mps1 with reversine, or by providing kinetochores in which the Mps1 phosphorylation sites on Ndc80 (most of them in the N-terminal tail) have been mutated to alanine. Thus, like the activity of Ipl1, Mps1 phosphorylation of the Ndc80 N-tail (which is known to be important for full MT affinity) weakens kinetochore-microtubule attachments.

      Cellular experiments demonstrate that non-Mps1 phosphorylatable Ndc80 14-A mutants have a functional mitotic checkpoint (contrary to previous claims by Kemmler et al., 2009), but show synthetic sickness with stu2 alleles that are involved in error correction.

      **Major points:**

      Within the framework of this experimental setting, the study as presented is logical and clear. The conclusions regarding the effect of Mps1 in this reconstituted system are overall well supported by the data. I have a couple of major and some minor points that can further improve data interpretation and should therefore be considered:

      1. In previous publications (e.g. Gutierrez et al., Current Biology 2020), the authors have reported that the Dam1 complex, an established Mps1 substrate, is required for full attachment strength in this system. Are the effects of Mps1-dependent Ndc80 phosphorylation and Dam1 independent from one another? For example would dad1-1 or non Cdk1 phosphorylatable Dam1 complex further reduce the rupture force in ATP? Or does Mps1 phosphorylation affect, for example, Dam1 binding to Ndc80?

      Response: To better understand the effects of ATP treatment, we analyzed the levels of Dam1 on the kinetochores after ATP treatment and did not see any change. We will add this data to a supplemental figure. Dam1 clearly makes a major contribution to the strength of the kinetochores because their strength even after ATP-treatment is higher than the rupture force of kinetochores purified from a dad1-1 mutant strain. However, as we report in the paper, blocking the eight Mps1 target sites in the tail of Ndc80 was sufficient to block the effect of ATP, so it is unlikely that phosphorylation of the Dam1 complex by Mps1 makes a major contribution to the ATP-dependent kinetochore weakening in vitro. We think Dam1 phosphorylation by Aurora B probably contributes independently to error correction, because the dam1-3D mutant, carrying phospho-mimetic substitutions in three Aurora B sites, is synthetically lethal when combined with the ndc80-8D phospho-mimetic mutant in eight Mps1 sites. We will add this genetic interaction data to the revised manuscript to provide additional information about the pathways.

      What is the effect of ATP on initial binding events? Are there differences in the fraction of beads that spontaneously attach laterally at the start of the experiment? This may allow to draw conclusions whether any kind of binding or specifically force-generating end-on attachments are affected by ATP.

      Response: We did measure a reduction in the fraction of free kinetochore-decorated beads capable of binding microtubules upon exposure to ATP (from 20% binding in the absence of adenosine to 11% in the presence of ATP). This observation suggests that the microtubule-binding activity of the kinetochores, like their rupture strength, is reduced upon exposure to ATP, as reported in the methods, in the "rupture force measurements" section. However, because we worked with a low density of kinetochores on the beads, the initial numbers of beads that spontaneously attached was quite low and free beads capable of binding to microtubules were relatively rare. In addition, when we find a bead already attached to the lattice, we cannot distinguish whether it bound initially to the lattice or instead bound to a tip that then grew beyond the bead. For these reasons, we feel it would be very difficult using our current approach to draw statistically significant conclusions about whether there were ATP-dependent changes in the relative affinities of the kinetochores for lateral versus tip attachments.

      Ndc80-8D has low attachment strength, consistent with lowered MT affinity of the phospho-mimetic Ndc80 tail. Interestingly, Supplementary Figure S4B shows that the amount of Cse4 in the pull-down western appears substantially reduced in 8D vs 8A or wt. Is the amount of co-purified inner kinetochore affected in this mutant? This may be an alternative explanation for decreased attachment strength, for example if the fraction of "full" or "complete" kinetochores may be reduced. Could this also happen upon inclusion of ATP?

      Response: The reviewer is correct that the level of Cse4 and other inner kinetochore components is slightly reduced in the Ndc80-8D kinetochores, for reasons that are not clear to us. However, the incubation of wild type kinetochores with ATP does not affect the levels of these proteins, suggesting that the weakened rupture strength is not due to reduced levels of these inner kinetochore proteins. We will add the data showing that ATP does not affect levels of inner kinetochore proteins into a supplemental figure to clarify this point.

      **Minor points:**

      page 13 (heading): "Weakening occurs via phosphorylation...". Probably good to mention what is weakened ("Weakening of kinetochore-microtubule attachments occurs via phosphorylation...".

      Response: We will alter the heading as suggested.

      page 14/Figure5C: Median Rupture Force for Ndc80-8D is 4.8 pN according to the text. In the graph it looks like >5 pN.

      Response: We thank the reviewer for noticing this mistake and will correct the median rupture force to 5.6 pN.

      page 23: comma missing between T21 S37 and T47 (should be T21, S37 and T47)

      Response: We thank the reviewer for noticing this omission and will correct it.

      page 24/25: different spelling of G1 (sometimes with subscript)

      Response: We thank the reviewer for noticing this inconsistency and will correct all to be G1.

      page 24/25: ug instead of µg

      Response: Thanks. We will fix this mistake.

      page 28: Figure 5B instead of Figure 5A

      Response: Thanks for noticing this mistake. We will correct this.

      Figure 6A: Lambda-Phosphatase treatment for 20 minutes according to figure legend and 30 minutes according to Material and Methods section.

      Response: The material and methods section specified a 20-minute incubation with phosphatase, in agreement with the figure legend. We believe the reviewer might have accidentally confused the time value with the temperature, which was 30 degrees.

      Figure 6E: One should not draw any conclusions from the anti-phospho T47 blot here, the quality is simply too poor to allow a statement regarding an mps1-1 effect

      Response: While the immunoblots with the T74 phospho-specific antibody are not as clean as many standard antibodies, we have reproduced the results multiple times and therefore feel comfortable concluding that there is a decrease in signal that is Mps1-dependent.

      Figure 6: Labelling T47P misleading (Proline substitution?, use pT47 instead)

      Response: We will change the labeling on this figure, as suggested, from T74P to pT74. To be consistent, we will also change this nomenclature in the text.

      Figure 6F: Make clear in the labelling that a stu2-AID background is used here, makes it easier to understand why Auxin is used here.

      Response: We will change the labeling, as suggested, to include the genotype of stu2-AID in the figure.

      how specific is reversine for yeast Mps1? I have not seen any data on this in previous publications.

      Response: Reversine is not necessarily specific for Mps1. However, the only kinase activity that co-purifies with the isolated kinetochores is from Mps1, so reversine should inhibit only Mps1 in our in vitro experiments. Nevertheless, to further address this concern, we will include optical trapping results using mps1-1 mutant kinetochores in the revised manuscript. We have already performed these additional experiments and found that mps1-1 kinetochores do not undergo ATP-dependent weakening, strongly reinforcing our conclusion that Mps1 is the major kinase involved.

      additional genetic interactions might be informative, if Ndc80-8D has weakened attachments, it may have synthetic effects with other mutants (dam1?), conversely, ndc80-8A may show genetic interactions with ipl1 alleles, for example.

      Response: We agree that the ndc80 phospho-mutant alleles might have genetic interactions with other mutants. Consistent with this prediction, we have found that ndc80-8D is synthetically lethal when combined with the dam1-3D mutant in three Ipl1 sites. As mentioned above, we will add this data into the revised text. We will also perform additional genetic interaction experiments with ipl1 and mps1 alleles and add any additional interactions we discover into the revised text.

      Reviewer #1 (Significance (Required)):

      The study adds to the characterization of the effects of Mps1 kinase on kinetochore-microtubule attachments and characterizes the cellular phenotypes of non-Mps1 phosphorylatable Ndc80 mutants. The major conceptual point that Mps1 phosphorylation can weaken kinetochore-microtubule interactions and thereby contributes to error correction in a manner similar to Ipl1 has previously been made in the literature. Maure et al., (Tanaka lab, 2007, Current Biology) have characterized the effects of mps1 mutant alleles on biorientation of authentic chromosomes and on replicated/unreplicated mini-chromosomes. In particular the experiments with unreplicated mini-chromosomes have revealed less frequent detachment in mps1 mutants, demonstrating that Mps1 activity is required to release attachments that are not under tension.

      Another benefit of this study is that it puts the Kemmler 2009 EMBO J. paper into perspective and corrects some of it claims. In particular the notion of sustained checkpoint activation in the Mps1 phospho-mimetic Ndc80-14D mutant, whose lethality was claimed to be rescued by checkpoint deletion. It is confirmed here that the allele is lethal but cannot be alleviated by simultaneous checkpoint deletion. Conversely, the Ndc80-14A mutant is shown to have a functional checkpoint. One could argue that since the publication of the Kemmler paper, the idea of requirement of Mps1 phosphorylation on Ndc80 for checkpoint activity has not gained any traction in the field, but it's still useful for the field to put some of these earlier claims into perspective. The paper will therefore be interesting to researchers working on mechanisms of chromosome segregation and error correction.

      From my background I cannot comment on technical details of the biophysical force spectroscopy experiments (laser trapping), but I have no reason to doubt that the authors accurately report their findings.

      Response: We sincerely thank the reviewer for their careful reading, helpful comments, and enthusiasm for our manuscript.

      Reviewer #2 (Evidence, reproducibility and clarity (Required)):

      This paper focusses on the mechanisms underlying chromosome biorientation in mitosis, an essential process that warrants equal chromosome segregation to the dividing cells. Correction of improper kinetochore-microtubule attachments relies on two conserved protein kinases, Aurora B and Mps1, that detach kinetochores that are not under tension in order to provide them with a second opportunity to establish bipolar connections. In vivo, Aurora B and Mps1 have intertwined functions and share some common targets. For this reason, despite the large body of literature on the subject, their precise roles in chromosome biorientation have been difficult to tease apart.

      The authors take advantage of an in vitro reconstitution assay that they previously published (Akyioshi et al., 2010) to identify the critical target(s) of Mps1 in weakening kinetochore-microtubule connections. The assay uses kinetochore particles purified from budding yeast cells that bear Mps1 but are notably deprived of Aurora B. Upon addition of ATP to activate the co-purified kinases (e.g. Mps1), kinetochores are added to coverslip-anchored microtubules to which they attach laterally. Through a laser trap, kinetochores are brought to the microtubule plus-end and pulled with increasing force until the kinetochore detaches, which allows measurements of the average rupture forces that reflect the strength of the attachments. The approach is straightforward and potentially very powerful, first because it provides a simplified experimental set-up in comparison to the cellular context, and second because it directly measures the impact of protein phosphorylation on the strength of attachments.

      The authors convincingly show that Mps1-dependent phosphorylation of the N-terminal part of Ndc80 significantly weakens the strength of kinetochore-microtubule attachments in vitro, while phosphorylation of other known Mps1 targets, such as Spc105, does not seem to have an effect. Eight phosphorylation sites in Ndc80, which were previously identified as Mps1-dependent phosphorylation sites (Kemmler et al., 2009), are shown to be critical to destabilise kinetochore-microtubule attachments in the in vitro reconstitution assays. The authors also present evidence for a moderate involvement of Ndc80 phosphorylation by Mps1 in correcting improper attachments in vivo, suggesting that additional mechanisms are physiologically relevant for error correction.

      The experiments are mostly well designed, the data are solid and support the main conclusions. However, to my opinion additional experiments could be performed, as outlined below, to strengthen the physiological relevance of the main findings and corroborate some of the conclusions.

      **Major points:**

      1. Given the partially overlapping function of Mps1 and Ipl1 (Aurora B) in error correction, the ndc80-8A mutant should display synthetic growth and chromosome mis-segregation defects with ipl1 temperature-sensitive alleles. Conversely, the ndc80-8D mutant should suppress the lethality at high temperatures of mps1-3 mutant cells, which were recently shown to be defective in chromosome biorientation (Benzi et al., 2020). Finally, chromosome mono-orientation could become apparent in ndc80-8A cells upon a transient treatment with microtubule-depolymerising drugs, which should amplify the cellular need for error correction.

      Response: We agree that further exploration of the possible genetic interactions might help to reinforce the physiological relevance of our main findings. Toward this goal, we will obtain the mps1-3 mutant to determine whether ndc80-8D can suppress its lethality and will add this to the revised manuscript if there is a positive result. As mentioned in response to Reviewer 1, we will add a synthetic lethal interaction between ndc80-8D and a dam1-3D mutant where the Aurora B sites are altered to the revised text. We will also perform additional genetic interactions with ipl1 and mps1 mutants and add any we find into the revision. As requested, we will perform a nocodazole wash out experiment, to determine if ndc80-8A cells show a defect in error correction and add this data to the revision if there is a defect.

      The authors show that Mps1-dependent phosphorylation of Ndc80 is not involved in the spindle assembly checkpoint, a conclusion that contradicts a previous report (Kemmler et al., 2009). They also find, in contrast with the same report, that the lethal phenotype of the ndc80-14D phospho-mimetic mutant cannot be rescued by disabling the spindle checkpoint. In my opinion, Kemmler et al. convincingly showed, through a number of different experimental approaches, that ndc80-14D cells die because of spindle checkpoint hyperactivation. Not only deletion of checkpoint genes was shown to rescue the lethality, but re-introduction of a wild type copy of the deleted checkpoint gene reinstated lethality. Thus, the explanation invoked here that spontaneous suppressing mutations could underlie the viability of ndc80-14D SAC-deficient mutants is not consistent with the published observations. A thorough examination by the authors of the phenotype of ndc80-14D cells in their hands should be carried out to support these conflicting conclusions. If authors find that ndc80-14D cells actually die because of chromosome mono-orientation, then this would highlight an important function for some or all the six additional phosphorylation sites, relative to the ndc80-8D mutant, for chromosome biorientation in vivo.

      Response: We were unable to reproduce the data that deletion of the spindle checkpoint suppresses lethality of the ndc80-14Dmutant, so it remains unclear why our results differ from those of the Kemmler paper. However, we note that re-introducing a wild-type checkpoint gene via transformation and restoring lethality to the ndc80-14D cells does not necessarily mean there were no suppressors. While that is one possible interpretation, another possibility is that there was a suppressor mutation in the viable ndc80-14D cells that also required the lack of the checkpoint to live. Kemmler and co-workers selected for viability on FOA media and never backcrossed those viable strains to show that they could regenerate the double mutant through a cross with the expected segregation pattern of two mutations, which would have been a more rigorous demonstration that the viability was specifically due to ndc80-14D and the checkpoint mutation. Instead, they transformed a wild-type copy of the checkpoint gene back into the strain that was selected for growth on FOA and showed that it reverted the phenotype. This approach cannot rule out a suppressor mutation that fails to suppress in the presence of an active checkpoint. Therefore, in our opinion, the Kemmler paper does not make an entirely convincing case that the ndc80-14D cells die because of spindle checkpoint hyperactivation.

      To further analyze the phenotype of ndc80-14D cells, we have constructed an Ndc80-AID ndc80-14D strain and added auxin, to deplete the wild-type copy of Ndc80. In agreement with the findings of Kemmler et al., this did trigger the spindle assembly checkpoint. However, when we made an Ndc80-AID ndc80-14D mad2 strain and analyzed segregation, we found that chromosome 8 missegregated in 28% of the cells compared to 2% of control cells. This observation suggests that there is a kinetochore defect in these cells that may have triggered the checkpoint and is inconsistent with the mutant solely activating the checkpoint in the absence of any other kinetochore defect. In addition, the levels of Ndc80-14D as well as Mps1 were altered on the mutant kinetochores. The combination of these defects strongly suggests that the ndc80-14D mutant alters kinetochore function in addition to leading to constitutive checkpoint signaling. Because our manuscript is mainly focused on phosphorylation of the Mps1 target sites within the N-terminal tail, we do not plan to add this data involving many additional sites, including Ipl1 target sites and sites on the CH domains of Ndc80, into the current manuscript. We will further pursue the other phosphorylation sites in the future.

      The conclusion that Spc105 phosphorylation by Mps1 is not required for the Mps1-mediated weakening of kinetochore attachments in vitro is based on the comparison between kinetochore particles bearing wild type, untagged Spc105 and particles bearing non-phosphorylatable Spc105-6A tagged at the C-terminus with twelve myc epitopes. Thus, the presence of the tag could obliterate the effects of the mutations in the phosphorylation sites by destabilising kinetochore-microtubule attachments in the presence of ATP. Consistent with this conclusion, Spc105-6A-12myc-bearing kinetochores withstand lower rupture forces than Spc105-bearing kinetochores upon ATP addition. Furthermore, Spc105-6A-12myc kinetochore particles show an interacting protein at MW above 150 KD that is not present in wild type particles (Fig. S2A), suggesting that either the tag or the mutations might affect kinetochore composition. Thus, this set of experiments should be repeated using Spc105-6A kinetochore particles lacking the tag.

      Response: If we understand correctly, the reviewer is suggesting that the myc tag on Spc105-6A could cause an ATP-dependent effect on kinetochore strength. While this is formally possible, it seems highly unlikely to us, for two reasons: First, a myc tag is not expected to bind nucleotides, and while it can sometimes have a general effect on protein stability or interfere with protein-protein interactions, we are not aware of any evidence for a myc tag directly causing an ATP-dependent effect in vitro. Second, when we measured Spc105-6A kinetochores in control experiments, without adenosine or with ADP, their rupture strengths were high like wild-type kinetochores. The strength of ADP-treated Spc105-6A kinetochores (8.7 pN), for example, was statistically indistinguishable from that of ADP-treated wild-type kinetochores (8.7 pN, p = 0.27 based on a log-rank test). The wild-type-like behavior of untreated and mock-treated Spc105-6A kinetochores indicates that their composition is not affected in a manner that significantly impacts kinetochore-microtubule strength.

      In general, it would have been informative to complement the data presented here with a mass spec analysis of the composition of kinetochore particles, at least for the experiments that are most relevant to the conclusions. For instance, the composition of the Ndc80-8A kinetochore particles is assumed to be similar to that of wild type kinetochores based on gel silver staining (Fig. S4A; note also that ndc80-8A particles are compared to ndc80-8D particles and not to wild type particles). However, the authors previously showed that kinetochore particles purified from dad1-1 mutant cells (affecting the Dam1 complex) have an apparently identical composition to particles purified from wild type cells by silver staining, yet they display significantly lower resistance to the rupture strength in vitro (Akyioshi et al., 2010). What is the status of the Dam1 complex (or other kinetochore subunits) in kinetochores purified from ndc80-8A/-8D or spc105-6A cells relative to wild type kinetochore particles?

      Response: We agree that further characterization of the kinetochore particle composition would be valuable and propose to further analyze the composition by purifying wild-type, Ndc80-8A, Ndc80-8D and Spc105-6A kinetochores and performing immunoblotting against the Dam1 complex. In addition, we will analyze the Ndc80-8A and Ndc80-8D kinetochores by mass spectrometry and report a qualitative analysis of the relative amounts of each kinetochore subcomplex in the revised manuscript supplementary data.

      **Minor comment:**

      I believe that the right reference for the sentence in the Discussion "If Aurora B is defective, for example, the opposing phosphatase PP1 prematurely localizes to kinetochores" is Liu et al. 2010.

      Response: We had cited the reference showing this effect in yeast, since our work was performed in yeast. We will also add the Liu et al paper, which showed the same result in human cells.

      Reviewer #2 (Significance (Required)):

      Although the experiments are well designed and the conclusions are mainly supported by the data, the question arises as to what extent the in vitro assays recapitulate, at least partly, what happens in vivo. An emblematic example is the involvement of Spc105 in the error correction pathway. The Biggins lab previously showed that Spc105 phosphorylation by Mps1 and subsequent Bub1 recruitment is not only essential for the spindle assembly checkpoint, but is also crucial for chromosome segregation in vivo, as shown by slow-growth phenotype and aneuploidy of the spc105-6A non-phosphorylatable mutant (London et al., 2012). Additionally, a recent paper showed that Spc105 is a crucial Mps1 target in chromosome biorientation (Benzi et al., 2020).

      In sharp contrast, the ndc80-8A mutant, which in vitro completely erases the ability of Mps1 to destabilise kinetochore-microtubule attachments, displays no growth defects in otherwise wild type cells and only modestly enhances chromosome mis-segregation in a mutant affecting an intrinsic correction pathway (stu2ccΔ). The N-terminal part of Ndc80 (aa 1-116) containing the aforementioned eight phosphorylation sites can even be deleted altogether without any consequence on cell viability (Kemmler et al., 2009). Thus, although the in vitro assays presented here produced clear-cut and reproducible results, their physiological relevance in vivo remains unclear.

      Left apart this criticism, the manuscript has several merits outlined above and will be of interest for people working in the fields of chromosome segregation, kinetochore assembly, spindle assembly checkpoint, etc.

      Expertise of this reviewer: mitosis and related checkpoints

      Response: We are grateful to the reviewer for carefully reading our manuscript and detailing their concerns. We agree that it can be challenging to establish the physiological relevance of experiments performed in vitro. However, our in vitro approach allowed the effects of Mps1 specifically on kinetochore-microtubule attachment strength to be disentangled from its numerous other effects in vivo. In our view, the relatively mild phenotypes associated with mutants in the Mps1 phosphorylation sites on the Ndc80 tail are consistent with similarly mild phenotypes of mutants in the Aurora B phosphorylation sites on the Ndc80 tail. In both cases, this appears to be due to additional error correction pathways that compensate in vivo.

      Reviewer #3 (Evidence, reproducibility and clarity (Required)):

      Sarangapani, Koch, Nelson et al. applied a combination of in vitro biophysical assays with purified kinetochore particles and in vivo analyses to investigate the contribution of Mps1 kinase to kinetochore-microtubule (KT-MT) attachment stability and error correction.

      The manuscript is well written and the authors nicely highlight the facts that 1) the focus of the field has long been on the contribution of Aurora kinases (Ipl1 in budding yeast) to attachment stability and error correction, and 2) it has been difficult to assess the relative contributions of Aurora versus Mps1 kinases in cell-based experiments. The authors note that their KT particle assay is uniquely positioned to address this gap in our understanding and to specifically isolate the contribution of Mps1 to attachment stability in vitro. The findings are well-presented and quite convincing although I have several comments that should be addressed to strengthen the central conclusion that this work has isolated the contribution of Mps1 in their assays.

      **Major points:**

      1) I think it is important to note that reversine is not specific for Mps1 kinase - although it is typically presented as such in the field. It was initially identified as an Aurora kinase inhibitor (IC50: ~25nM (Aurora B) - 900nM (Aurora A)) that turned out be an even more potent Mps1 inhibitor (IC50 ~6nM). I have concerns that the in vitro assays were done with 5 uM reversine - a concentration so high that it could certainly inhibit any Ipl1 that is present (see comment 3 below) and possibly even inhibit Bub1 activity as Santaguida et al. (JCB, 2010) measured an IC50 >1uM for Bub1 inhibition. It is important to complement/confirm the chemical inhibitor experiment by repeating the rupture assays +/- ATP in KT particles purified from the mps1-1 strain (shown in Figure 6).

      Response: We agree that reversine is not necessarily specific for Mps1 and this concern was also brought up by Reviewer 1. Because Mps1 is the only kinase activity that co-purifies with the isolated kinetochore particles, we expect reversine to inhibit only Mps1 in our in vitro assays. However, to further address this point, we will add rupture force assays using kinetochores purified from mps1-1 mutant cells to the revised manuscript. We have already performed these experiments and they confirm that kinetochores lacking Mps1 do not undergo ATP-dependent weakening. We did not put this data into the original submission because the experiment needs to be performed differently due to altered Dam1 levels. But we will clarify the changes in the materials and methods and add the data to a supplementary figure.

      2) If the ATP-mediated reduction on rupture force is lost in the mps1-1 KT particles, which will also lack Bub1 kinase, then preserving the ATP-dependent reduction in rupture force from KT particles purified from the Bub1delta mutant strain would be strong evidence that the contribution of Mps1 kinase has been disentangled from other kinases in this assay.

      Response: Although Mps1 recruits Bub1, we think it is unlikely that we are assaying Bub1 kinase activity in our in vitroexperiments. We cannot detect Bub1 activity on the purified kinetochores using a sensitive radioactive kinase assay (London et al, Curr Bio 2011), and the levels of Bub1 in our kinetochore purifications are very low (for example, see Akiyoshi et al, Nature, 2010). However, we agree with the reviewer that this caveat should be mentioned and will add this point to the revised text for clarity.

      3) Recent work has shown that Sli15-Ipl1 interacts with and is recruited to KTs by the COMA complex (Rodriguez et al., Curr Biol, 2019 and Fischbock-Halwachs et al., eLife 2019) and that this population of Ipl1 is important for accurate chromosome segregation as also shown 10 years prior by Knockleby and Vogel (Cell Cycle, 2009). I realize that this group previously showed (London et al., Curr Biol, 2012) that phosphorylation of KT particles was not affected when purified from the ipl1-321 mutants, but in light of the recent findings how sure are the authors that there is not any Sli15-Ipl1 in the preparations? I think commenting on this would be worthwhile.

      Response: We have not detected Ipl1 or Sli15 in the numerous mass spectrometry experiments we have performed on the kinetochore purifications. In addition, we have been separately assaying the effects of Ipl1 phosphorylation on kinetochores for another project (de Regt, https://doi.org/10.1101/415992), which independently confirmed that the only detectable kinase activity in our kinetochore purifications is Mps1. We will add this additional reference to the manuscript.

      4) Since the interplay between Mps1 and Aurora B are central to this story, the authors should expand upon the sentence on page 5 reading "While there is some evidence that Mps1 regulates Aurora B activity (Jelluma et al., 2010; Saurin et al., 2011; Tighe et al., 2008), significant data suggests it has an independent role in error correction and acts downstream of Aurora B (Hewitt et al., 2010; Maciejowski et al., 2010; Maure et al., 2007; Meyer et al., 2013; Santaguida et al., 2010)." I am not entirely convinced that the in vivo experiments presented here differentiate as to whether Mps1 is upstream from Ipl1 or whether they are acting independently? For example, phosphorylation of T74 looks to be completely lost in figure 6E (although it's difficult to tell since the blot for T74P is very smeary). If they are acting independently in error correction then Ipl1 should still be able to phosphorylate T74 in this condition. However, if the P-T74 really is lost completely in the mcd1-1 cells then this suggests to me that Ipl1 is downstream of Mps1 in this live cell error correction assay.

      Response: We thank the reviewer for bringing this to our attention. We did not mean to imply that Mps1 is downstream from Aurora B in budding yeast and were intending only to summarize findings from the literature regarding other organisms. We will revise this section of the text to make that point clearer, and we agree that the order of events remains unresolved. In addition, we will note that Mps1 does not eliminate the phosphorylation detected by the T74 antibody in the revision, to avoid misconceptions about the order of events.

      **Other points:**

      1) On p.8 "a median strength of 7.5 pN, similar to untreated and ADP-treated kinetochores". Similar is vague so I'm curious as to whether there a statistically significant difference between this and the 9.8 pN and 8.7 pN measured in the other conditions. If so this could be explained by partial dephosphorylation with the phosphatase.

      Response: The quoted phrase refers to the 7.5-pN strength measured when λ-phosphatase was included together with ATP (data from Fig. 1D and Supp. Fig. S1B). P-values computed from comparisons of survival plots using the log-rank test show that this strength was not significantly different from the ADP-treated wild-type (8.7 pN, p = 0.06), nor was it significantly different from the ADP- and MnCl2-treated wild-type (8.1 pN, p = 0.35). However, it was barely significantly different from MnCl2-treated wild-type (8.6 pN, p = 0.03), and it was more significantly different from untreated wild-type (9.8 pN, p = 0.0007). With the revised manuscript, we will include a supplemental table with p-values computed from log-rank tests for all the key statistical comparisons, including those mentioned here.

      2) On p.19 the authors note that Aurora A phosphorylates Ndc80 tail during mitosis. Ye et al. (Curr Biol, 2015) also showed that Aurora A can phosphorylate Aurora B sites and that this activity "converges" at the tail to weaken attachments during error correction.

      Response: We will add the reference and thank the reviewer for pointing out this omission.

      3) Optional: I am curious as to whether the addition of ATP to the Ndc80-8D particles further reduces the rupture force. If so then other sites may also be in play.

      Response: We agree this is an interesting question but we have not yet performed those assays and agree it might be worthwhile for a future study.

      4) Please comment on why MnCl2 is used in the rupture assays in Figure S1. I saw no mention of this in the main text.

      Response: We include MnCl2 in the assay because it is required for phosphatase activity and will add this point to the legend of supplementary Figure S1.

      5) Consider moving S2 A and B to Figure 3 C and D. This is an interesting result and would go well in the main figure next to the significantly reduced rupture force measurements for the 6A mutant so the reader doesn't have to dig into the supplemental for the data providing this reasonable explanation for the rupture force result.

      Response: We thank the reviewer for this suggestion and will move S2A and S2B into Figure 3.

      Reviewer #3 (Significance (Required)):

      The significance of this relates to focusing on an important phenomenon - error correction - and in looking beyond the traditional focus of the field on Aurora kinases to Mps1 kinase, which is largely implicated in checkpoint signaling. Disentangling the contributions of these two players is an important advance.

      The work will be of interest to audiences interested in: kinases, cell division, checkpoints, kinetochore biology, biophysics

      The above areas of interest overlap with my expertise.

      Response: We thank the reviewer for their enthusiasm for our experiments that help distinguish kinase activities and thus contribute to understanding the process of error correction.

    2. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #2

      Evidence, reproducibility and clarity

      This paper focusses on the mechanisms underlying chromosome biorientation in mitosis, an essential process that warrants equal chromosome segregation to the dividing cells. Correction of improper kinetochore-microtubule attachments relies on two conserved protein kinases, Aurora B and Mps1, that detach kinetochores that are not under tension in order to provide them with a second opportunity to establish bipolar connections. In vivo, Aurora B and Mps1 have intertwined functions and share some common targets. For this reason, despite the large body of literature on the subject, their precise roles in chromosome biorientation have been difficult to tease apart.

      The authors take advantage of an in vitro reconstitution assay that they previously published (Akyioshi et al., 2010) to identify the critical target(s) of Mps1 in weakening kinetochore-microtubule connections. The assay uses kinetochore particles purified from budding yeast cells that bear Mps1 but are notably deprived of Aurora B. Upon addition of ATP to activate the co-purified kinases (e.g. Mps1), kinetochores are added to coverslip-anchored microtubules to which they attach laterally. Through a laser trap, kinetochores are brought to the microtubule plus-end and pulled with increasing force until the kinetochore detaches, which allows measurements of the average rupture forces that reflect the strength of the attachments. The approach is straightforward and potentially very powerful, first because it provides a simplified experimental set-up in comparison to the cellular context, and second because it directly measures the impact of protein phosphorylation on the strength of attachments.

      The authors convincingly show that Mps1-dependent phosphorylation of the N-terminal part of Ndc80 significantly weakens the strength of kinetochore-microtubule attachments in vitro, while phosphorylation of other known Mps1 targets, such as Spc105, does not seem to have an effect. Eight phosphorylation sites in Ndc80, which were previously identified as Mps1-dependent phosphorylation sites (Kemmler et al., 2009), are shown to be critical to destabilise kinetochore-microtubule attachments in the in vitro reconstitution assays. The authors also present evidence for a moderate involvement of Ndc80 phosphorylation by Mps1 in correcting improper attachments in vivo, suggesting that additional mechanisms are physiologically relevant for error correction.

      The experiments are mostly well designed, the data are solid and support the main conclusions. However, to my opinion additional experiments could be performed, as outlined below, to strengthen the physiological relevance of the main findings and corroborate some of the conclusions.

      Major points:

      1. Given the partially overlapping function of Mps1 and Ipl1 (Aurora B) in error correction, the ndc80-8A mutant should display synthetic growth and chromosome mis-segregation defects with ipl1 temperature-sensitive alleles. Conversely, the ndc80-8D mutant should suppress the lethality at high temperatures of mps1-3 mutant cells, which were recently shown to be defective in chromosome biorientation (Benzi et al., 2020). Finally, chromosome mono-orientation could become apparent in ndc80-8A cells upon a transient treatment with microtubule-depolymerising drugs, which should amplify the cellular need for error correction.
      2. The authors show that Mps1-dependent phosphorylation of Ndc80 is not involved in the spindle assembly checkpoint, a conclusion that contradicts a previous report (Kemmler et al., 2009). They also find, in contrast with the same report, that the lethal phenotype of the ndc80-14D phospho-mimetic mutant cannot be rescued by disabling the spindle checkpoint. In my opinion, Kemmler et al. convincingly showed, through a number of different experimental approaches, that ndc80-14D cells die because of spindle checkpoint hyperactivation. Not only deletion of checkpoint genes was shown to rescue the lethality, but re-introduction of a wild type copy of the deleted checkpoint gene reinstated lethality. Thus, the explanation invoked here that spontaneous suppressing mutations could underlie the viability of ndc80-14D SAC-deficient mutants is not consistent with the published observations. A thorough examination by the authors of the phenotype of ndc80-14D cells in their hands should be carried out to support these conflicting conclusions. If authors find that ndc80-14D cells actually die because of chromosome mono-orientation, then this would highlight an important function for some or all the six additional phosphorylation sites, relative to the ndc80-8D mutant, for chromosome biorientation in vivo.
      3. The conclusion that Spc105 phosphorylation by Mps1 is not required for the Mps1-mediated weakening of kinetochore attachments in vitro is based on the comparison between kinetochore particles bearing wild type, untagged Spc105 and particles bearing non-phosphorylatable Spc105-6A tagged at the C-terminus with twelve myc epitopes. Thus, the presence of the tag could obliterate the effects of the mutations in the phosphorylation sites by destabilising kinetochore-microtubule attachments in the presence of ATP. Consistent with this conclusion, Spc105-6A-12myc-bearing kinetochores withstand lower rupture forces than Spc105-bearing kinetochores upon ATP addition. Furthermore, Spc105-6A-12myc kinetochore particles show an interacting protein at MW above 150 KD that is not present in wild type particles (Fig. S2A), suggesting that either the tag or the mutations might affect kinetochore composition. Thus, this set of experiments should be repeated using Spc105-6A kinetochore particles lacking the tag.
      4. In general, it would have been informative to complement the data presented here with a mass spec analysis of the composition of kinetochore particles, at least for the experiments that are most relevant to the conclusions. For instance, the composition of the Ndc80-8A kinetochore particles is assumed to be similar to that of wild type kinetochores based on gel silver staining (Fig. S4A; note also that ndc80-8A particles are compared to ndc80-8D particles and not to wild type particles). However, the authors previously showed that kinetochore particles purified from dad1-1 mutant cells (affecting the Dam1 complex) have an apparently identical composition to particles purified from wild type cells by silver staining, yet they display significantly lower resistance to the rupture strength in vitro (Akyioshi et al., 2010). What is the status of the Dam1 complex (or other kinetochore subunits) in kinetochores purified from ndc80-8A/-8D or spc105-6A cells relative to wild type kinetochore particles?

      Minor comment:

      I believe that the right reference for the sentence in the Discussion "If Aurora B is defective, for example, the opposing phosphatase PP1 prematurely localizes to kinetochores" is Liu et al. 2010.

      Significance

      Although the experiments are well designed and the conclusions are mainly supported by the data, the question arises as to what extent the in vitro assays recapitulate, at least partly, what happens in vivo. An emblematic example is the involvement of Spc105 in the error correction pathway. The Biggins lab previously showed that Spc105 phosphorylation by Mps1 and subsequent Bub1 recruitment is not only essential for the spindle assembly checkpoint, but is also crucial for chromosome segregation in vivo, as shown by slow-growth phenotype and aneuploidy of the spc105-6A non-phosphorylatable mutant (London et al., 2012). Additionally, a recent paper showed that Spc105 is a crucial Mps1 target in chromosome biorientation (Benzi et al., 2020).

      In sharp contrast, the ndc80-8A mutant, which in vitro completely erases the ability of Mps1 to destabilise kinetochore-microtubule attachments, displays no growth defects in otherwise wild type cells and only modestly enhances chromosome mis-segregation in a mutant affecting an intrinsic correction pathway (stu2ccΔ). The N-terminal part of Ndc80 (aa 1-116) containing the aforementioned eight phosphorylation sites can even be deleted altogether without any consequence on cell viability (Kemmler et al., 2009). Thus, although the in vitro assays presented here produced clear-cut and reproducible results, their physiological relevance in vivo remains unclear.

      Left apart this criticism, the manuscript has several merits outlined above and will be of interest for people working in the fields of chromosome segregation, kinetochore assembly, spindle assembly checkpoint, etc.

      Expertise of this reviewer: mitosis and related checkpoints

    1. All Bee v1.0 versions are incompatible with the v0.6 Swarm. Node operators who currently run nodes on the Swarm test network should not update to this version. This version is currently only rolled-out to the Swarm mainnet, to which node operators can operate fully-functional nodes when the BZZ token is circulating (after June 21st).

      该版本同测试网的不兼容,到6月21日上主网了才能用。需要BZZ代币。

    1. Reviewer #3 (Public Review):

      The authors modified a previously reported hybrid cytochrome bcc-aa3 supercomplex, consisting of bcc from M. tuberculosis and aa3 from M. smegmatis, (Kim et al 2015) by appending an affinity tag facilitating purification. The cryo-EM experiments are based on the authors' earlier work (Gong et al. 2018) on the structure of the bcc-aa3 supercomplex from M. smegmatis. The authors then determine the structure of the bcc part alone and in complex with Q203 and TB47.

      The manuscript is well written and the obtained results are presented in a concise, clear-cut manner. In general, the data support the conclusions drawn.

      To this reviewer, the following points are unclear:

      1. The purified enzyme elutes from the gel filtration column as one peak, but there seems to be no information given on the subunit composition and the enzymatic activity of the purified hybrid cytochrome bcc-aa3 supercomplex.

      2. It is unclear what is the conclusion of the structure comparison (Fig 6) is regarding the affinity of Q203 for M. smegmatis.

    1. SciScore for 10.1101/2021.06.16.448640: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Patch-clamp experiments: On the day of the experiment, transfected HEK293 or A549 were separated by trypsinization, seeded at low density on 10*10 mm coverslips, and then incubated for 2 to 4 hours to allow adhering of cells on the glass surface.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transformation of yeast cells: The K+ uptake deficient S. cerevisiae strains PLY240 (MATa his3Δ200 leu2-3,112 trp1Δ901 ura3-52 suc2Δ9 trk1Δ51 trk2Δ50::lox-kanMX-lox) [55] was transformed with the constructed pYES2sh plasmids using Frozen-EZ Yeast Transformation II kit (Zymo Research Europe GmbH, Freiburg, Germany) according to manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>trp1Δ901 ura3-52 suc2Δ9 trk1Δ51 trk2Δ50::lox-kanMX-lox </div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For in vitro protein expression the Ep-CoV2 DNA fragment was amplified via PCR using primer pair 1 (table 1) and subsequently cloned into a modified pET24 vector (pET24Δlac) in which the lac-operator and the ribosome binding site (RBS) were replaced by the 5’-UTR of the in vitro expression vector pEXP-5-CT/TOPO (Invitrogen, Karlsbad, CA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET24</div><div>suggested: RRID:Addgene_73142)</div></div><div style="margin-bottom:8px"><div>pEXP-5-CT/TOPO</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For cloning, pET24Δlac was first linearized with the restriction enzymes NdeI and SalI.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET24Δlac</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The DNA fragment encoding the desired FLAG-TEV tag was generated via PCR using primer pair 2 (table 1) and subsequently cloned into the NdeI restriction site of pET24Δlac/Ep-CoV2 using NEBuilder® HiFi DNA Assembly (NEB, Ipswich, MA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET24Δlac/Ep-CoV2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These fragments were subsequently inserted into a modified pYES2 shuttle vector (pYES2sh) in which the original PGAL1 promoter of pYES2 (Invitrogen, Karlsbad, CA, USA) was replaced by the methionine repressible PMET3 promoter.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pYES2</div><div>suggested: RRID:Addgene_86470)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For this purpose, the coding sequence of KcvPBCV-1 was amplified with appropriate overhangs using primer pair 5 (table1) and subsequently cloned into pYES2sh as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pYES2sh</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For expression in mammalian cells, Ep-CoV2 and Ep-CoV2™ were cloned into pEGFP-N2 which contains the eGFP sequence for generating C-terminal eGFP-tags.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pEGFP-N2</div><div>suggested: RRID:Addgene_78822)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After reaching approximately 80% confluence mammalian cells were (co-)transfected in a 35 mm petri dish with 1 µg of the plasmid carrying the gene of interest and (if necessary) 1 µg of empty pEGFP-N2 or empty pIRES2-mRuby3 to enable identification of transfected cells via eGFP or mRuby3 fluorescence, respectively. pIRES2-mRuby3 was generated by replacing the sequence encoding for the green fluorescent protein eGFP in pIRES2-eGFP by a DNA sequence encoding for the red fluorescent protein mRuby3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pIRES2-mRuby3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pIRES2-eGFP</div><div>suggested: RRID:Addgene_14998)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The capillaries were coated at tapper with Sigmacote® (Merck KgaA, Darmstadt, Germany) and baked after pulling at 65°C for 45 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sigmacote®</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was collected with PatchMaster (HEKA Elektronik, Lambrecht, Germany) and analyzed with FitMaster (HEKA Elektronik, Lambrecht, Germany)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PatchMaster</div><div>suggested: (Patchmaster, RRID:SCR_000034)</div></div><div style="margin-bottom:8px"><div>FitMaster</div><div>suggested: (FITMASTER, RRID:SCR_016233)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. We can also use the capitalized JSX tag to call JavaScript functions with capitalized function names. The functions are also known as the Pure Function Component.

      pure function components

    1. Author Response:

      Reviewer #1 (Public Review):

      The manuscript by Chakraborty focuses on methods to direct dsDNA to specific cell types within an intact multicellular organism, with the ultimate goal of targeting DNA-based nanodevices, often as biosensors within endosomes and lysosomes. Taking advantage of the endogenous SID-2 dsRNA receptor expressed in C. elegans intestinal cells, the authors show that dsDNA conjugated to dsRNA can be taken into the intestinal endosomal system via feeding and apical endocytosis, while dsDNA alone is not an efficient endocytic cargo from the gut lumen. Since most cells do not express a dsRNA receptor, the authors sought to develop a more generalizable approach. Via phage display screening they identified a novel camelid antibody 9E that recognizes a short specific DNA sequence that can be included at the 3' end of synthesized dsDNAs. The authors then showed that this antibody can direct binding, and in some cases endocytosis, of such DNAs when 9E was expressed as a fusion with transmembrane protein SNB-1. This approach was successful in targeting microinjected dsDNA pan-neuronally when expressed via the snb-1 promoter, and to specific neuronal subsets when expressed via other promoters. Endocytosed dsDNA appeared in puncta moving in neuronal processes, suggesting entry into endosomes. Plasma membrane targeting appeared feasible using 9E fusion to ODR-2.

      The major strength of the paper is in the identification and testing of the 9E camelid antibody as part of a generalizable dsDNA targeting system. This aspect of the paper will likely be of wide interest and potentially high impact, since it could be applied in any intact animal system subject to transgene expression. A weakness of the paper is the choice of "nanodevice". It was not clear what utility was present in the DNAs used, such as D38, that made them "devices", aside from their fluorescent tag that allowed tracking their localization.

      We used a DNA nanodevice, denoted pHlava-9E, that uses pHrodo as a pH-sensitive dye. pHlava-9E is designed to provide a digital output of compartmentalization i.e., its pH profile is such that even if it is internalized into a mildly acidic vesicle, the pH readout is as high as one would observe with a lysosome. This gives an unambiguous readout of surface-immobilized probe to endocytosed probe.

      Another potential weakness is that the delivered DNA is limited to the cell surface or the lumen of endomembrane compartments without access to the cytoplasm or nucleus. In general the data appeared to be of high quality and was well controlled, supporting the authors conclusions.

      We completely agree that we cannot target DNA nanodevices to sub-cellular locations such as the cytoplasm or the nucleus with this strategy. However, we do not see this as a “weakness”, but rather, as a limitation of the current capabilities of DNA nanotechnology. It must be mentioned that though fluorescent proteins were first described in 1962, it was 30 years before others targeted them to the endoplasmic reticulum (1992) or the nucleus (1993)(Brini et al., 1993; Kendall et al., 1992). Probe technologies undergo stage-wise improvements/expansions. We have therefore added a small section in the conclusions section outlining the future challenges in sub-cellular targeting of DNA-nanodevices.

      Reviewer #2 (Public Review):

      The authors demonstrate the tissue-specific and cell-specific targeting of double-stranded DNA (dsDNA) using C. elegans as a model host animal. The authors focused on two distinct tissues and delivery routes: feeding dsDNA to target a class of organelles within intestinal cells, and injecting dsDNA to target presynaptic endocytic structures in neurons. To achieve efficient intestinal targeting, the authors leveraged dsRNA uptake via endogenous intestinal SID-2 receptors by fusing dsRNA to a fluorophore-labeled dsDNA probe. In contrast, neuronal endosome/synaptic vesicle (SV) targeting was achieved by designing a nanobody that specifically binds a short dsDNA motif fused to the fluorophore-labeled dsDNA probe. Combining dsDNA probe injection with nanobody neuronal expression (fused to a neuronal vSNARE to achieve synaptic targeting), the authors demonstrated that the injected dsDNA could be taken up by a variety of distinct neuronal subtypes.

      Strengths:

      While nanodevices built on dsDNA platforms have been shown to be taken up by scavenger receptors in C. elegans (including previous work from several of these authors), this strategy will not work in many tissue types lacking these receptors. The authors successfully circumvented this limitation using distinct strategies for two cell types in the worm, thereby providing a more general approach for future efforts. The approaches are creative, and the nanobody development in particular allows for endocytic delivery in any cell type. The authors exploited quantitative imaging approaches to examine the subcellular targeting of dsDNA probes in living animals and manipulated endogenous receptors to demonstrate the mechanism of dsRNA-based dsDNA uptake in intestinal cells.

      Weaknesses:

      To validate successful delivery of a functional nanodevice, one would ideally demonstrate the function of a particular nanodevice in at least one of the examples provided in this work. The authors have successfully used a variety of custom-designed dsDNA probes in living worms in numerous past studies, so this would not be a technical hurdle. In the current study, the reader has no means of assessing whether the dsDNA is intact and functional within its intracellular compartment.

      We now demonstrate the use of a functional nanodevice to detect pH profiles of a given microenvironment. This functional nanodevice contains two fluorescent reporter dyes, each attached to one of the strands of a DNA duplex. In order to obtain pH readouts, the device integrity is essential for ratiometric sensing.

      Coelomocytes are cells known for their scavenging and degradative lysosomal machinery. Previous studies of the stability of variously structured DNA nanodevices in coelomocytes, have shown that DNA devices based on 38 bp DNA duplexes have a half life of >8 hours in actively scavenging cells such as coelomocytes (Chakraborty et al., 2017; Surana et al., 2013) Given that our sensing in the gut as well as in the neuron are performed in <1 hour post feeding or injection, pHlava-9E is >97% intact.

      Another minor weakness is the lack of a quantitative assessment of colocalization in intestinal cells or neurons in an otherwise nicely quantitative study. Since characterization of the targeting described here is an essential part of evaluating the method, a stronger demonstration of colocalization would significantly buttress the authors' claims.

      We have now quantified colocalization in each cellular system. Please see Figure R1 below (Figure 1 Supplementary figure 1 and Figure 4 Supplementary figure 2 of the revised manuscript).

      Figure R1: a) Pearson’s correlation coefficient (PCC) calculated for the colocalization between R50D38 (red) and lysosomal markers LMP-1 or GLO-1 (green) in the indicated transgenic worms. b) & d) Representative images of nanodevice nD647 uptake (red) in transgenics expressing both prab-3::gfp::rab-3 (green) and psnb-1:snb-1::9E c - e) Normalized line intensity profiles across the indicated lines in b and d; f) Percentage colocalization of nD647 (red) with RAB3:GFP (green). Error bar represents the standard deviation between two data sets.

      While somewhat incomplete, this study represents a step forward in the development of a general targeting approach amenable to nanodevice delivery in animal models.

    2. Reviewer #1 (Public Review):

      The manuscript by Chakraborty focuses on methods to direct dsDNA to specific cell types within an intact multicellular organism, with the ultimate goal of targeting DNA-based nanodevices, often as biosensors within endosomes and lysosomes. Taking advantage of the endogenous SID-2 dsRNA receptor expressed in C. elegans intestinal cells, the authors show that dsDNA conjugated to dsRNA can be taken into the intestinal endosomal system via feeding and apical endocytosis, while dsDNA alone is not an efficient endocytic cargo from the gut lumen. Since most cells do not express a dsRNA receptor, the authors sought to develop a more generalizable approach. Via phage display screening they identified a novel camelid antibody 9E that recognizes a short specific DNA sequence that can be included at the 3' end of synthesized dsDNAs. The authors then showed that this antibody can direct binding, and in some cases endocytosis, of such DNAs when 9E was expressed as a fusion with transmembrane protein SNB-1. This approach was successful in targeting microinjected dsDNA pan-neuronally when expressed via the snb-1 promoter, and to specific neuronal subsets when expressed via other promoters. Endocytosed dsDNA appeared in puncta moving in neuronal processes, suggesting entry into endosomes. Plasma membrane targeting appeared feasible using 9E fusion to ODR-2.

      The major strength of the paper is in the identification and testing of the 9E camelid antibody as part of a generalizable dsDNA targeting system. This aspect of the paper will likely be of wide interest and potentially high impact, since it could be applied in any intact animal system subject to transgene expression. A weakness of the paper is the choice of "nanodevice". It was not clear what utility was present in the DNAs used, such as D38, that made them "devices", aside from their fluorescent tag that allowed tracking their localization. Another potential weakness is that the delivered DNA is limited to the cell surface or the lumen of endomembrane compartments without access to the cytoplasm or nucleus. In general the data appeared to be of high quality and was well controlled, supporting the authors conclusions.

    1. We should think about the number of simultaneous connections (peak and average) and the message rate/payload size. I think, the threshold to start thinking about AnyCable (instead of just Action Cable) is somewhere between 500 and 1000 connections on average or 5k-10k during peak hours.
      • number of simultaneous connections (peak and average)

      • the message rate/payload size.

    1. SciScore for 10.1101/2021.06.09.447527: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Preparation of hybridoma cell lines producing monoclonal antibodies specific to SARS-CoV-2 spike protein and RBD: Six-week-old Balb/cN mice were primed subcutaneously either with 30 μg of recombinant SARS-Cov-2 Spike protein (S) or Spike-RBD (RBD) in the complete Freund’s adjuvant (SIGMA-ALDRICH) and boosted three times at three-week intervals with 20 μg of the same antigen in the incomplete Freund`s adjuvant.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 spike protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound monoclonal antibodies were detected with goat anti-mouse immunoglobulin (Ig) conjugated with horse radish peroxidase (HRP, Dako, Denmark).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse immunoglobulin ( Ig )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Typically, 10 000 RU (response units) of polyclonal anti-mouse antibody (No. Z 0420; Dako, Denmark) or polyclonal anti-human antibody (I2136, Merck, Germany) was coupled simultaneously in four flow cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The equilibrium dissociation constants KD of antibody-RBD complexes were calculated from the averaged association and dissociation rate constants.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RBD-ACE2 binding inhibition assay: With the aim to select the antibodies blocking the interaction of receptor binding domain (RBD) with angiotensin-converting enzyme 2 (ACE2) receptor, ELISA-based inhibition test was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were fixed with 4% paraformaldehyde and labelled with anti-human ACE2 antibody at 10 μg/ml (cat. # 600-401-X59; Rockland Immunochemicals), followed by goat anti-rabbit IgG secondary antibody at 1/500 dilution (green; cat. # A-11008; Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human ACE2</div><div>suggested: (LSBio (LifeSpan Cat# LS-C347-500, RRID:AB_1271966)</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: (Thermo Fisher Scientific Cat# A-11008, RRID:AB_143165)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Stable cell line HEK293T/17-hACE2 were maintained in selection medium: Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum (FBS), 2 mM L-glutamine (GIBCO), 5μg/ml gentamicin (SIGMA) and 100μg/ml hygromycin B (Invitrogen) at 37°C in 5%CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T/17-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In PRNT, Vero E6 cells (Vero C1008, ATCC CRL 1586) were cultured in Eagle’s minimal essential medium (EMEM, Lonza) supplemented with 5% FBS (GIBCO), Penicillin-Streptomycin-Amphotericin B Solution (10ml/l, Lonza, Switzerland).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: ATCC Cat# CRL-1586, RRID:CVCL_0574)</div></div><div style="margin-bottom:8px"><div>C1008</div><div>suggested: ATCC Cat# CRL-1586, RRID:CVCL_0574)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids that drive protein expression from the CMV promoter were either transfected with polyethyleneimine (PEI) or by electroporation into Expi293 cells that were in exponential growth phase.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S-ACE2 binding inhibition assay: HEK 293T/17 cells stably expressing human ACE2 protein (HEK 293T/17-hACE2) were seeded at 60-70% plating density in 48-well plates and cultivated O/N at 37°C, 5% CO2 in a humidified incubator in DMEM supplemented with 10% (v/v) fetal calf serum, 2 mM L-glutamine, 100 units/mL penicillin/streptomycin (all from Life Technologies Invitrogen, Carlsbad, CA, USA) and 100 μg/ml</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T/17</div><div>suggested: ATCC Cat# CRL-11268G-1, RRID:CVCL_UE07)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the recipient cells HEK293/17-hACE2 were seeded in 96-well plate and cultured overnight in a humidified CO2 incubator (at 5% CO2 and 37°C) in 100 μL of normal growth medium (DMEM) with 10% of FCS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293/17-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MAb–virus mixtures were then added to Vero E6 cell monolayer in 24-well plates and incubated at 37°C for additional 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Preparation of hybridoma cell lines producing monoclonal antibodies specific to SARS-CoV-2 spike protein and RBD: Six-week-old Balb/cN mice were primed subcutaneously either with 30 μg of recombinant SARS-Cov-2 Spike protein (S) or Spike-RBD (RBD) in the complete Freund’s adjuvant (SIGMA-ALDRICH) and boosted three times at three-week intervals with 20 μg of the same antigen in the incomplete Freund`s adjuvant.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Balb/cN</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: Human embryonic kidney HEK293T/17-hACE2 cells with stable expression of human angiotensin-converting enzyme ACE2 (AXON Neuroscience SE) were prepared by stable transfection of pDUO2-hACE2-TMPRSS2a (InvivoGen) with transfection reagent Lipofectamine 3000 (Thermo Fisher Scientific), according the to the manufacturer’s recommendations.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pDUO2-hACE2-TMPRSS2a</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proteins: The prefusion-stabilized SARS-CoV-2 S protein ectodomain (residues 1−1208 from GenBank: MN908947, with proline substitutions at residues 986 and 987, a “GSAS” substitution at the furin cleavage site residues 682–685, a C-terminal T4 fibritin trimerization motif, an HRV3C protease cleavage site, a TwinStrepTag and an 8XHisTag), the receptor binding domain (RBD) fragment of the S protein (amino acids 319-591), containing the His-tag and Twin-Strep-tag and modified ACE2 (angiotensin-converting enzyme 2), containing tags for purification were synthesized at BioCat Co. (BioCat GmbH, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioCat</div><div>suggested: (BioCAT, RRID:SCR_001440)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plasmid DNA was isolated using PureLink®</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PureLink®</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primers for mutagenesis were designed using The QuickChange® Primer Design Program provided by manufacturer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Primer Design Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IC50 values for particular experiments were calculated by nonlinear regression analysis using GraphPad Prism (GraphPad Software Inc.)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were fitted to logistic 4-parameter sigmoidal dose response curve using GraphPad Prism (GraphPad Software Inc.), the goodness of fit was R2>0.9, except for AX266 on B1.1.7 (R2=0.7888), AX96 on B.1.1.7 (R2=0.8766), AX290ch on B1.1.7 (R2=0.8730) and AX677ch on B.1.351 (R2=0.8598).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Variants were called using the ARTIC pipeline (https://artic.network/ncov-2019/ncov2019-bioinformatics-sop.html), which internally filters reads based on quality and length, aligns them to the reference (Wuhan-Hu-1 isolate, NC_045512) using minimap2 (https://github.com/lh3/minimap2), trims primers, and calls variants using Nanopolish (https://github.com/jts/nanopolish).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Nanopolish</div><div>suggested: (Nanopolish, RRID:SCR_016157)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      To avoid this therapeutic limitation, we screened and selected the antibodies showing neutralization activity against several variants of SARS-CoV-2. We took advantage of the mouse immunoglobulin repertoire 18 through the hybridoma technology to isolate monoclonal antibodies neutralizing live authentic SARS-CoV-2 virus. The in vitro and live virus screening assays allowed us to identify two neutralizing antibodies, AX290 and AX677, each of them neutralizing live authentic SARS-CoV-2 virus circulating in Europe in the spring of 2020 and two fast-spreading authentic variants of concern B.1.1.7 and B.1.351. It is important to emphasize that the antibodies were resistant to the E484K mutation, which has been recently shown to endow the S-typed VSV pseudovirus with resistance to several human convalescent sera 33. The authors have suggested that the repertoire of antigenic sites on RBD is limited in some individuals and that this amino acid is a part of a dominant neutralizing epitope. The use of a live authentic SARS-CoV-2 virus to identify the escape mutations, as opposed to other studies that employed an S-typed pseudovirus 10,33,35–38, allowed to eliminate a potential bias from an inadequate infection and replication machinery of a model virus. It has been noted that only some of the spike escape mutations identified in SARS-CoV-2 S-typed infectious vesicular stomatitis virus were found so far in the context of authentic SARS-CoV-2 virus isolates, it is possible that those not...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.07.447437: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The protocols for human specimen collection were approved by the institutional review board of City of Hope.<br>Euthanasia Agents: Mice were euthanized using ketamine (100 mg/kg)/xylazine (10 mg/kg) when body weights dropped below 20% of their original body weights.<br>IACUC: Experiments and handling of mice were conducted under federal, state, and local guidelines and with approvals from the Northern Arizona University (20-005) and City of Hope Animal Care and Use Committees.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cell lines were routinely tested to confirm absence of mycoplasma using the MycoAlert Plus Mycoplasma Detection Kit from Lonza (Walkersville, MD).</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 viral nucleocapsid protein (NP) was detected using the anti-NP protein antibody (PA5-81794, Thermo Fisher) diluted 1:10000 in 0.1% tween-20/1%BSA/PBS solution as a primary antibody, followed by detecting with an anti-rabbit secondary antibody (ab6721, Abcam) at a 1:20,000 dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 viral nucleocapsid protein ( NP )</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2 viral nucleocapsid protein ( NP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>PA5-81794</div><div>suggested: (Thermo Fisher Scientific Cat# PA5-81794, RRID:AB_2788968)</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (Abcam Cat# ab6721, RRID:AB_955447)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FXa-HRP conjugated anti-human Fc antibody (05-4220, Invitrogen) was used as a detecting antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human Fc</div><div>suggested: (Thermo Fisher Scientific Cat# 05-4220, RRID:AB_2532922)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were then washed and incubated with an anti-S protein antibody for 20 minutes at room temperature, followed by staining with a FITC-labeled secondary antibody (111-605-045, Jackson ImmunoResearch).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An HRP-conjugated anti-His tag antibody (ab1187, Abcam) was used as a detecting antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>An HRP-conjugated anti-His tag antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-His tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IHC staining with an anti-FXa protein antibody (PIPA529118, Invitrogen), an anti-furin antibody (ab183495, Abcam), an anti-trypsin antibody (ab200997, Abcam), or an anti-plasmin antibody (LS-C150813-1, LSBio) as a primary antibody was performed by the Pathology Shared Resource Core at City of Hope Beckman Research Institute.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-FXa protein</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-furin</div><div>suggested: (Abcam Cat# ab183495, RRID:AB_2801581)</div></div><div style="margin-bottom:8px"><div>anti-trypsin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-plasmin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">H&E staining and IHC with anti-NP protein antibody (NB100-56576, Novus) as the primary antibody were performed by the Pathology Shared Resource Core at City of Hope Beckman Research Institute.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-NP protein antibody</div><div>suggested: (Creative Diagnostics Cat# DPAB-DC4728, RRID:AB_2501850)</div></div><div style="margin-bottom:8px"><div>anti-NP protein</div><div>suggested: (Creative Diagnostics Cat# DPAB-DC4728, RRID:AB_2501850)</div></div><div style="margin-bottom:8px"><div>NB100-56576</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monkey kidney epithelium-derived Vero cells, Vero E6 cells, human embryonic kidney-derived HEK293T cells, and Chinese hamster ovary (CHO) cells were cultured in DMEM with 10% FBS, penicillin (100 U/ml), and streptomycin (100 μg/ml).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Chinese hamster ovary (CHO)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To determine viral production, Vero cells were pre-seeded for 24 hours and infected with the supernatants collected from MA104 cells infected by VSV-SARS-CoV at 24 or 48 hpi.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation and purification of FXa: CHO cells were transduced with a pCDH lentiviral vector expressing FXa to produce the FXa-Fc fusion protein for functionality assays.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: CLS Cat# 603479/p746_CHO, RRID:CVCL_0213)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus isolates were passaged in Vero E6 cells (ATCC CRL-1586) as previously described3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Assessment of binding between S protein and FXa using flow cytometry: HEK293T cells were transduced with lentiviral vector expressing FXa for 48 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In vivo infection model: 6-8-week-old K18-hACE2 mice were anesthetized with ketamine (80 mg/kg)/xylazine (8 mg/kg) and intranasally infected with 5×103 PFU wild type SARS-CoV-2 or B.1.1.7 variant in 25 μl DMEM, followed by intranasal treatment with PBS, FXa-Fc (200 μg), or Fc (200 μg) in 25 μl DMEM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pull-down assay: HEK293T cells were transduced with a pCDH lentiviral vector expressing the full-length spike (S) protein for 48 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDH</div><div>suggested: RRID:Addgene_102325)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Prism software v.8 (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. The more compelling your title tag, combined with high rankings in search results, the more visitors you’ll attract to your website. This underscores that SEO is not only about search engines, but rather the entire user experience.

      In Moz's example of their Title Tag, they have their name and what their role is as well as what service they provide. Aside from a company name and possibly a role or action, what other key words would be suggested?

    1. SciScore for 10.1101/2021.06.05.447221: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All procedures were performed according to the animal study protocols approved by the FDA White Oak Animal Program Animal Care and Use Committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mice: Hemizygous B6.Cg-Tg(K18-ACE2)2Prlmn/J (K18-hACE) female mice (JAX Stock No. 034860) and noncarrier c57BL/6J male mice (JAX Stock No. 000664) were mated to maintain live colonies at the ABSL2 facility of FDA White Oak Vivarium</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">At the age of 8-10 weeks, K18-hACE mice of both sexes were randomly assigned to experimental groups at approximately 1:1 ratio and were transferred to the ABSL3 facility for infection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Only hACE2 (+) offspring as confirmed by genotyping (Transnetyx) were retained and were used for experiments.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation at 37 °C, 5% CO2 for two days, virus-infected cells were detected using an in-house rabbit polyclonal antibody specific for SARS-CoV-2 N/M/E followed by horseradish peroxidase-conjugated goat anti-mouse IgG (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound antibodies were detected using peroxidase-conjugated goat anti-mouse IgM heavy chain (Southern Biotech) or IgG (H+L) antibodies (Invitrogen) followed by One-step TMB substrate (ThermoFisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>peroxidase-conjugated goat anti-mouse IgM heavy chain ( Southern Biotech )</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG ( H+L ) antibodies ( Invitrogen ) followed by One-step TMB substrate ( ThermoFisher)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus-infected cells were detected using in-house raised rabbit anti-S polyclonal antibody along with peroxidase-conjugated goat anti-rabbit IgG (H+L) secondary antibody (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus-serum mixtures were then added to Vero E6 cells (2X104 cells/well) pre-seeded in 96-well tissue culture plates and were incubated at 37°C, 5% CO2 for 2 days.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice: Hemizygous B6.Cg-Tg(K18-ACE2)2Prlmn/J (K18-hACE) female mice (JAX Stock No. 034860) and noncarrier c57BL/6J male mice (JAX Stock No. 000664) were mated to maintain live colonies at the ABSL2 facility of FDA White Oak Vivarium</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6.Cg-Tg(K18-ACE2)2Prlmn/J</div><div>suggested: RRID:IMSR_JAX:034860)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">At the age of 8-10 weeks, K18-hACE mice of both sexes were randomly assigned to experimental groups at approximately 1:1 ratio and were transferred to the ABSL3 facility for infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In separated experiments, K18-hACE2 mice of both sexes were primed and boosted at 3 weeks intervals with S (10 µg/dose) or RBD (20 µg/dose) emulsified with AddaS03™ (InvivoGen) via intramuscular route.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant proteins: The DNA sequences encoding the full-length S (residues 1-1213) and RBD (residues 319-541) of WA (GenBank: MN985325.1) with a T4 trimerization domain and a 6xHis tag at the C-terminus were codon-optimized and were subcloned into pcDNA5/FRT mammalian expression vector (ThermoFisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA5/FRT</div><div>suggested: RRID:Addgene_31983)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Threshold cycle (Ct) values were calculated using MxPro qPCR software (Agilent) and the N gene copies in individual tissues were interpolated from a standard curve constructed by serial dilutions of a pCC1-CoV2-F7 plasmid expressing SARS-CoV-2 N57.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCC1-CoV2-F7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The copies of expressed hACE2 were interpolated from a standard curve created by serial dilutions of a pSBbi-bla ACE2 plasmid expressing hACE2 (kindly provided by J Yewdell, NIAID/NIH).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSBbi-bla ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>hACE2</div><div>suggested: RRID:Addgene_1786)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Heatmap was generated using Prism 8.4.3 (GraphPad, San Diego, CA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tissue sections were visualized using a Leica Aperio AT2 slide scanner with Aperio ImageScope DX clinical viewing software (Histoserv).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageScope</div><div>suggested: (ImageScope, RRID:SCR_014311)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">R version 4.0.3 (https://www.r-project.org/) was used to perform all the above analyses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.r-project.org/</div><div>suggested: (R Project for Statistical Computing, RRID:SCR_001905)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.06.446826: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Membranes were probed with rabbit-anti-SARS spike (Invitrogen, PA1-411-1165, 0.5ug/ml), rabbit-anti-Orf6 (Abnova, PAB31757, 4ug/ml), Cr3009 SARS-CoV-2 cross-reactive human-anti-N antibody (1ug/ml) (a kind gift from Dr. Laura McCoy, UCL), mouse-anti-alpha-tubulin (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>rabbit-anti-Orf6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>PAB31757</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>mouse-anti-alpha-tubulin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SIGMA, clone DM1A) followed by IRDye 800CW or 680RD secondary antibodies (Abcam, goat anti-rabbit, goat anti-mouse or goat anti-human).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human) .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then incubated with 1μg/ml CR3009 SARS-CoV-2 cross-reactive antibody (a kind gift from Dr. Laura McCoy, UCL) in permeabilization buffer for 30 min at room temperature, washed once and incubated with secondary Alexa Fluor 488-Donkey-anti-Human IgG (Jackson Labs).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>488-Donkey-anti-Human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A blocking step was carried out for 1h at room temperature with 10% goat serum/1%BSA in PBS. Nucleocapsid (N) protein detection was performed by primary incubation with human anti-N antibody (Cr3009, 1ug/ml) for 18h, and washed thoroughly in PBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-N</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Cr3009</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies were detected by labelling with secondary anti-human AlexaFluor-568 and anti-mouse AlexaFluor 488 conjugates (Jackson Immuno Research) for 1h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies: Rabbit anti–Strep-tag II (Abcam #ab232586); Rabbit anti-beta-actin (Cell Signaling Technology #4967); Monoclonal mouse anti-FLAG M2 antibody (Sigma Aldrich, F1804)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti–Strep-tag II</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-beta-actin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-FLAG</div><div>suggested: (Sigma-Aldrich Cat# F1804, RRID:AB_262044)</div></div><div style="margin-bottom:8px"><div>F1804</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Hela-ACE2 cells were a kind gift from Dr. James E Voss (TSRI, USA)51</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Hela-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 cells were grown to 60-80% confluence prior to infection as described previously23. Viruses: SARS-CoV-2 isolate VIC was provided by NISBC, and IC19, B.1.1.7, B.1.1.7 (B) and B.1.1.7 (C) are reported in 11, full isolate names and GISAID references are listed below.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viruses were propagated by infecting Caco-2 cells at MOI 0.01 TCID50/cell, in culture medium at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Innate immune sensing assay: HEK293T cells were seeded in 48-well plates (5×104 cells/well) the day before transfection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For viral protein expression, cells were transfected with 100ng of empty vector or vector encoding either ORF9b, ORF9bS50/53E, VIC N or B.1.1.7 N (pLVX-EF1alpha-IRES-Puro backbone), alongside 10ng of ISG56-firefly luciferase reporter plasmid (kindly provided by Andrew Bowie, Trinity College Dublin), and 2.5ng of a Renilla luciferase under control of thymidine kinase promoter (Promega), as a control for transfection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX-EF1alpha-IRES-Puro</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Amplicon libraries were sequenced using MinION flow cells v9.4.1 (Oxford Nanopore Technologies, Oxford, UK).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MinION</div><div>suggested: (MinION, RRID:SCR_017985)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All samples were acquired on a BD Fortessa X20 using BD FACSDiva software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD FACSDiva</div><div>suggested: (BD FACSDiva Software, RRID:SCR_001456)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was analysed using FlowJo v10 (Tree Star).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image analysis of immunofluorescence experiments: IRF3 raw image channels were pre-processed using a batch rolling ball background correction in FIJI imagej software package56 prior to 514 quantification.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>imagej</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plotted are 1000 randomly sampled cells selected for each condition using the ‘Pandas’ data processing package in Python 3 with a filter of 0.1>=<5. Coimmunoprecipitation of Tom70 with Orf9b: HEK293T were transfected with the indicated mammalian expression plasmids using Lipofectamine 2000 (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For all analyses, samples were injected on a C18 reverse phase column (25 cm × 75 μm packed with ReprosilPur 1.9 μm particles).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ReprosilPur</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Total RNA samples were run on the Agilent Bioanalyzer, using the Agilent RNA 6000 Nano Kit.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Agilent Bioanalyzer</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reads containing possible junctions were extracted by filtering for exact matches to the 3’ end of the leader sequence “CTTTCGATCTCTTGTAGATCTGTTCTC” using the bbduk program in the BBTools package (BBTools -Bushnell B. - sourceforge.net/projects/bbmap/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BBTools</div><div>suggested: (Bestus Bioinformaticus Tools, RRID:SCR_016968)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The filtered and trimmed reads were matched against SARS2 genomic sequence with the bbmap program from BBtools with settings (maxindel=100, strictmaxindel=t, local=t).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>bbmap</div><div>suggested: (BBmap, RRID:SCR_016965)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Host RNA analysis: All reads were mapped to the human host genome (ensembl 101) using HISAT2 aligner58</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HISAT2</div><div>suggested: (HISAT2, RRID:SCR_015530)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differential gene expression were done on read counts extracted for each protein coding gene using featureCount and significance was determined by the DESeq2 R package60.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resource comprises of a comprehensive collection of phosphosite annotations of direct substrates of kinases obtained from six databases, PhosphoSitePlus, SIGNOR, HPRD, NCI-PID</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HPRD</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. One of the consequences (although arguably not the primary motivation) of DRY is that you tend to end up with chunks of complex code expressed once, with simpler code referencing it throughout the codebase. I can't speak for anyone else, but I consider it a win if I can reduce repetition and tuck it away in some framework or initialisation code. Having a single accessor definition for a commonly used accessor makes me happy - and the new Object class code can be tested to hell and back. The upshot is more beautiful, readable code.

      new tag?:

      • extract reusable functions to reduce duplication / allow elegant patterns elsewhere
    1. SciScore for 10.1101/2021.06.04.447160: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The amplified gene was inserted into pBAD-sfGFP vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBAD-sfGFP</div><div>suggested: RRID:Addgene_85482)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In the final construct (pBAD-sfGFP-PLpro), a hexahistidine tag is located at the N-terminus of sfGFP.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBAD-sfGFP-PLpro</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The normalized PLPro activity against drug concentration was analyzed with the inhibition curve (three parameters) analysis option in GraphPad 8.0 to determine the IC50 values.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.02.21258073: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) Human B cell ImmunoSpot® assays: For enumeration of antibody-secreting cells (ASC), irrespective of their antigen specificity, cell suspensions were serially diluted 2-fold in duplicates, starting at 3 x 104 live cells/well, in round-bottom 96-well tissue culture plates (Corning, Sigma-Aldrich) and subsequently transferred into assay plates precoated with anti-Igκ/λ capture antibody contained in the human IgA/IgG/IgM Three-Color ImmunoSpot® kit (from CTL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Igκ/λ</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alternatively, 6XHis-tagged protein solutions at 10µg/mL in PBS (unless otherwise specified) were applied to EtOH pre-conditioned wells precoated overnight at 4°C with 10µg/mL (unless otherwise specified) anti-His tag antibody (Biolegend, San Diego, CA) and incubated overnight at 4°C to improve antigen absorption.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Murine B cell hybridomas: Murine B cell hybridoma lines secreting (IgG1, κ) monoclonal antibody (mAb) with reactivity against the hemagglutinin (HA) protein of the pandemic H1N1 (pH1N1) A/California/04/2009 (CA/09) influenza vaccine strain have been reported previously [70].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>hemagglutinin ( HA</div><div>suggested: (GeneTex Cat# GTX127357, RRID:AB_2728683)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For enumeration of total ASC, irrespective of their antigen-specificity, ∼100 B cell hybridomas were input into wells precoated with anti-Igκ capture antibody contained in mouse B cell ImmunoSpot® kits (from CTL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specificity</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Igκ</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Murine B cell hybridoma lines secreting mAb with reactivity against the Spike protein of SARS-CoV-2 were generated from DBA/2J mice (Jackson Laboratory, Bar Harbor, Maine, USA) that were immunized intraperitoneally with heat-inactivated SARS-CoV-2 virus antigen [71] (∼100µL of virus antigen/mouse) adjuvanted with alum hydroxide on day 0, day 21 and day 42.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DBA/2J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(GraphPad Prism 9, San Diego, CA, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. Munch Tales

      Same feedback as the Atelier. In addition,

      • The job title and "self-employed" sound inconsistent. Consider a more powerful title. I'd get rid of the self-employed tag. It's got a bit of a bad reputation on LI
      • The company description needs to add some points of differentiation. Currently it doesn't impress.
    1. SciScore for 10.1101/2021.06.02.446468: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: All studies were approved by the Emory Institutional Review Board (IRB) under protocol numbers IRB00058507, IRB00057983 and IRB00058271.<br>Consent: Informed consent was obtained from the patients when they had decision making ability or from a legal authorized representative (LAR) if the patient was unable to provide consent.<br>Field Sample Permit: All work with infectious virus and respiratory samples from COVID-19 patients was conducted inside a biosafety cabinet within the Emory Health and Safety Office (EHSO)- and United States Department of Agriculture (USDA)-approved BSL3 containment facility in the Health Sciences Research Building at Emory University following protocols approved by the Institutional Biosafety Committee (IBC) and Biosafety Officer.<br>IACUC: All work with infectious virus and respiratory samples from COVID-19 patients was conducted inside a biosafety cabinet within the Emory Health and Safety Office (EHSO)- and United States Department of Agriculture (USDA)-approved BSL3 containment facility in the Health Sciences Research Building at Emory University following protocols approved by the Institutional Biosafety Committee (IBC) and Biosafety Officer.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single-cell surface antibody-derived tag (ADT), encapsulation, and library generation: Leukocytes from whole blood and ETA samples were incubated with oligo-conjugated Ig-A/D/G/M for 10 mins at 4°C followed by the addition of Human TruStain FcX™ (BioLegend) and 10 min incubation at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Single-cell surface antibody-derived tag ( ADT) , encapsulation</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>library generation: Leukocytes from whole blood and ETA samples</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ADT reads were aligned to a feature reference file containing the antibody-specific barcode sequences.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-specific barcode sequences .</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plaque assays: Vero E6 cells were seeded in a 6-well plates (Falcon) with 5 x 105 cells/well in 5% DMEM 24 h prior to infection and checked to verify ≥80% confluency. 10-fold dilutions of virus, respiratory secretions, and/or scRNA-seq emulsion in serum-free DMEM (200 μL) were incubated on Vero E6 monolayers for 1 h absorption at 37°C with rocking at 15 min intervals.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed in ~4 mL FACS buffer, then resuspended in 200-1000 μL for acquisition using BD FACSDiva™ Software on the Emory Pediatric/Winship Flow Cytometry Core BD FACSymphony™ A5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD FACSDiva™</div><div>suggested: (BD FACSDiva Software, RRID:SCR_001456)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed with FlowJo™ v10.7 (FlowJo LLC)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo™</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To recover neutrophils, scRNA-seq UMI count matrices were imported to R 4.0.2, and data analyses were performed using Seurat v4.042.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Seurat</div><div>suggested: (SEURAT, RRID:SCR_007322)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The R package Slingshot was used to infer the trajectories of neutrophils recruited to the lungs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Slingshot</div><div>suggested: (Slingshot, RRID:SCR_017012)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses: Statistical analyses were performed using GraphPad Prism9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.26.21256092: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Centre, location AMC, the Netherlands and approved by the local ethical committee (NL 73281.018.20).<br>Consent: All individuals provided written informed consent before participating.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All other proteins were produced in HEK293F cells (Invitrogen) maintained in Freestyle medium (Life Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293T cells expressing the SARS-CoV-2 receptor ACE2 were seeded in poly-L-lysine coated 96-wells plates and the next day triplicate serial dilutions of heat-inactivated serum samples were prepared, mixed 1:1 with SARS-CoV-2 pseudovirus, incubated for 1 h at 37°C and then added in a 1:1 ratio to the cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Specifically, a gene encoding amino acids 1-1276, in which the furin cleavage site (amino acids 752-756) was replaced with a GGSGS sequence and amino acids at position 1067 and 1068 were mutated to prolines, was ordered and cloned into a pPPI4 plasmid containing a T4 trimerization domain followed by a hexahistidine tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pPPI4</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mann-Whitney U-tests for unpaired comparisons, Wilcoxon matched-pairs signed rank test for paired comparisons and Spearman correlations were performed in GraphPad Prism 8.3.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Principal component analysis was performed in Matlab 9.6 (R2019a).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Matlab</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. { "id": "https://preview.iiif.io/cookbook/0021-tagging/recipe/0021-tagging/annotation/p0001-tag", "type": "Annotation", "motivation": "tagging", "body": { "type": "TextualBody", "value": "Germany" }, "target": "https://preview.iiif.io/cookbook/0021-tagging/recipe/0021-tagging/canvas/p1" }

      Should this be in an annotations property of the Canvas, Manifest, or AnnotationPage?

    1. Reviewer #1 (Public Review): 

      The paper by Sim et al describes phospho-proteomic analysis of ATR kinase-dependent pathway in mouse spermatocytes. By administrating an ATR inhibitor, AZ20, to mice and using Rad1 (a component of 911 DNA damage clamp) conditional knockout mouse (cKO), the authors isolated testis from these mice, isolated phospho-peptides and analyzed with Tandem Mass Tag (TMT). The analyses identified 37,180 phosphorylation sites and created the data base for them. Importantly, in-depth analysis of the phosphorylation sites revealed an unique consensus site of the ATR-dependent phosphorylation; S/TPXK, whose kinase has not been identified yet. In addition, the authors showed new ATR-dependent phosphorylation sites in proteins in RNA metabolisms including piRNA biogenesis for transposon silencing and showed ATR-dependent localization of two RNA processing enzymes, SETX helicase, and RANBP3 in meiosis sex chromosome inactivation (MSCI). This is an important body of work as a good resource for phosphorylation in mouse germ cells. The study had been done in a great care with proper controls. The data set in the paper is very much useful and of great interest to researchers in meiosis and DNA damage response (DDR) field.

    1. SciScore for 10.1101/2021.05.26.21257441: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Both studies were conducted at the Amsterdam University Medical Centers in the Netherlands and approved by the local ethical committee.<br>Consent: All individuals included in this study gave written informed consent before participating.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All S constructs were verified by Sanger sequencing and subsequently produced in HEK293F cells (ThermoFisher) and purified as previously described (25).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus was produced by co-transfecting the pCR3 SARS-CoV-2-SΔ19 expression plasmid with the pHIV-1NL43 ΔEnv-NanoLuc reporter virus plasmid in HEK293T cells (ATCC, CRL-11268) (44, 45)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus neutralization assay: HEK293T/ACE2 cells kindly provided by Dr. Paul Bieniasz (44) were seeded at a density of 20,000 cells/well in a 96-well plate coated with 50 μg/mL poly-L-lysine 1 day prior to the start of the neutralization assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T/ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero-E6 cells were added in a concentration of 20,000 cells/well and incubated for 72 h at 35°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">They were ordered as gBlock gene fragments (Integrated DNA Technologies) and cloned PstI/NotI in a pPPI4 expression vector containing a hexahistidine (his) tag with Gibson Assembly (ThermoFisher).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pPPI4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus was produced by co-transfecting the pCR3 SARS-CoV-2-SΔ19 expression plasmid with the pHIV-1NL43 ΔEnv-NanoLuc reporter virus plasmid in HEK293T cells (ATCC, CRL-11268) (44, 45)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCR3 SARS-CoV-2-SΔ19</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pHIV-1NL43 ΔEnv-NanoLuc</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The inhibitory concentration (IC50) and neutralization titers (ID50) were determined as the NAb concentration and serum dilution at which infectivity was inhibited by 50%, respectively using a non-linear regression curve fit (GraphPad Prism software version 8.3) (45)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      While our study aims to provide an overview of many different aspects of pre-existing immunity against VOC, there are some limitations. In this study, we present a vaccinee population that consists of primary health care workers that are generally of middle age, with only four (8%) participants being older than 60 (Table 1). However, we found no correlation between age and titers in convalescent patients against any of the VOC tested. Moreover, we have focused on the neutralization potential of immune sera and did not examine antibody effector functions which have been implicated previously in the control of SARS-CoV-2 infection (41). Similar to other studies, our convalescent and vaccinee sera samples were collected four to six weeks after infection and four weeks after vaccination (i.e. at the peak of immunity), respectively. While we present findings that may have implications for additional booster vaccines and the monitoring of VOC, we did not examine the aspect of waning antibody titers and how those might influence VOC binding and neutralization. Finally, we have merely examined an early line of defense against infection with SARS-CoV-2 (i.e. serum antibody levels), while we expect memory B cells to play an important part in re-infections with SARS-CoV-2 VOC. Indeed, swift re-activation of memory compartments may lead to reduced transmissibility, a milder course of disease and a more potent immune response. In conclusion, we observed a substantial reduction in binding ...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a protocol registration statement.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.06.01.446555: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To detect expression pattern or biotinylation pattern, the primary antibody, such as anti-V5 (Invitrogen, cat. No. R960-25, 1:5,000 dilution), was incubated for 1 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-V5</div><div>suggested: (Thermo Fisher Scientific Cat# R960-25, RRID:AB_2556564)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing three times with TBST for 5 min at room temperature, secondary antibodies, namely mouse-HRP (Bio-rad, cat. No. 1706516, 1:3,000 dilution) and rabbit-HRP (Cell signaling, cat. No. 7074S, 1:3,000 dilution), or SA-HRP (Thermofisher, cat. No. 21126, 1:10,000 dilution) were incubated for 1 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>mouse-HRP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>rabbit-HRP</div><div>suggested: (Carl Roth Cat# 4750, RRID:AB_2890006)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HeLa cells and A549 cells were from Laboratory of Dr.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Obtaining Secreted Proteins in Cell Culture Media: After biotin labeling of HEK293 cells expressing SEC61B-TurboID, cells were incubated with no FBS DMEM for 16 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proteome Digestion & Enrichment of Biotinylated Peptides: For mass sampling, HEK293T cells were split in three T75 flasks for triplicate samples per each condition.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression Plasmids: Genes with epitope tag (i.e. V5, FLAG, HA, twin strep) were cloned into pCDNA3, pCDNA3.1, and pCDNA5 using digestion with enzymatic restriction sites and ligation with T4 DNA ligase.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA3</div><div>suggested: RRID:Addgene_15475)</div></div><div style="margin-bottom:8px"><div>pCDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div><div style="margin-bottom:8px"><div>pCDNA5</div><div>suggested: RRID:Addgene_49428)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For transiently co-expressed two constructs, vPOI-GFP and TurboID-GBP, cells were grown at 70–80% confluence and transfected with wanted constructs using PEI.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>vPOI-GFP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pearson correlation was conducted using image J software program (NIH).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>image J</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing three times with TBST for 5 min at room temperature, results of immunoblotting assay were obtained using ECL solution using GENESYS program.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GENESYS</div><div>suggested: (GeneSys, RRID:SCR_015770)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Enlarged fluorescence images were fitted to the electron micrographs using the Image J BigWarp program.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Image J BigWarp</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Processing MS data and Identification of Proteins: All MS/MS data were searched using MaxQuant (version 1.5.3.30) with Andromeda search engine at 10 ppm precursor ion mass tolerance against the SwissProt Homo sapiens proteome database (20,199 entries, UniProt (http://www.uniprot.org/)).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MaxQuant</div><div>suggested: (MaxQuant, RRID:SCR_014485)</div></div><div style="margin-bottom:8px"><div>UniProt</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The imputation of protein intensity were conducted using Perseus software program.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Perseus</div><div>suggested: (Perseus, RRID:SCR_015753)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. Critical to the acceptance of the position of the script subtag was the inclusion of information in the registry to make clear the need to avoid script subtags except where they add useful distinguishing information. Thus, the registry entry for the language subtag "en" (English) has a field called "Suppress-Script" indicating that the script subtag "Latn" should be avoided with that language, since virtually all English documents use the Latin script.
      • not worth saying
      • not necessary to say/write
      • useless information

      Suppress-Script

    2. Another problem was the ambiguity of RFC 3066 regarding the generative syntax. The idea of "language-dash-region" language tags was easy enough to grasp; most users didn't read RFC 3066 directly or consider the unstated-but-realized implication that other subtags might sometimes occur in the second position.

      unstated-but-realized

    3. Because ISO code lists were not always free and because they change over time, a key idea was to create a permanent, stable registry for all of the subtags valid in a language tag.

      Why was it not free???

    1. SciScore for 10.1101/2021.05.29.446300: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the biotinylated bait preparations, bait constructs were mixed with a pHLsec-BirA-ER vector (Chang et al., 2015) into a 3 to 1 ratio and co-transfected in HEK293T cells in the presence of 0.1 mM Biotin (MilliporeSigma B4639).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following five backbone constructs used for the Fc fusion or biotinylated baits and AP fusion probes were derived from the pHLsec vector (Aricescu et al., 2006). (1) The pHLsec-3C-Fc (C103A)-8H vector contains a C-terminal Human Rhinovirus (HRV)-3C protease cleavage site followed by the human immunoglobulin heavy constant gamma 1 (resi 102-330; having a C103A mutation to remove an unpaired cysteine; UniProtKB code P01857) and an 8xHis tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHLsec</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>C103A)-8H</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(2) The pHLsec-Fc-Avi-6H vector contains the human immunoglobulin heavy constant gamma 1 (resi 101-330; UniProtKB code P01857) followed by an Avi tag that can be biotinylated by BirA ligases and a 6xHis tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHLsec-Fc-Avi-6H</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(3) The pHLsec-3C-mVenus-Avi-8H vector derived from pHLsec-mVenus-12H (Chang et al., 2015) was tagged with a C-terminally HRV-3C protease cleavage site followed by a mVenus fusion protein, an Avi tag and finally an 8xHis tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHLsec-mVenus-12H</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(4) The pHL-N-AP-Myc-8H vector was constructed N-terminally with the human alkaline phosphatase (AP; resi 1-506; NCBI code NP_001623) followed by a Myc tag and finally a C-terminal 8xHis tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHL-N-AP-Myc-8H</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(5) The pHLsec-C-Myc-AP-8H vector contains a C-terminal Myc tag followed by the human AP (resi 18-506; NCBI code NP_001623) and finally an 8xHis tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHLsec-C-Myc-AP-8H</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Lgr4LRR was constructed into the pHLsec-3C-mVenus-Avi-8H vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHLsec-3C-mVenus-Avi-8H</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 RBD insert was grafted into the pHLsec-mMGD21-3C-mVenus-Avi-8H vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHLsec-mMGD21-3C-mVenus-Avi-8H</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2ECD (resi 19-615), NBVHH-72, and NBH11-D4 were cloned into the pHLsec-AP-8H vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHLsec-AP-8H</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the biotinylated bait preparations, bait constructs were mixed with a pHLsec-BirA-ER vector (Chang et al., 2015) into a 3 to 1 ratio and co-transfected in HEK293T cells in the presence of 0.1 mM Biotin (MilliporeSigma B4639).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pHLsec-BirA-ER</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following five backbone constructs used for the Fc fusion or biotinylated baits and AP fusion probes were derived from the pHLsec vector (Aricescu et al., 2006). (1) The pHLsec-3C-Fc (C103A)-8H vector contains a C-terminal Human Rhinovirus (HRV)-3C protease cleavage site followed by the human immunoglobulin heavy constant gamma 1 (resi 102-330; having a C103A mutation to remove an unpaired cysteine; UniProtKB code P01857) and an 8xHis tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UniProtKB</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The structures of Tspan28 (CD81; PDB codes 1G8Q and 5TCX) were selected to generate an initial computational model of Tspan12EC2 with Modeller (Eswar et al., 2006).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Modeller</div><div>suggested: (MODELLER, RRID:SCR_008395)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Notably, the structures of Tspan25 (CD53; PDB code 6WVG), and Tspan29 (CD9, PDB codes 6RLR and 6K4J) were not available during the HHpred search.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HHpred</div><div>suggested: (HHpred, RRID:SCR_010276)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the protein design of Antibody Display Tspan12EC2, LAIR1 insert was removed from the model of MGD21 Fab fragment (PDB code 5NST) and the Tspan12EC2 model was docked into the MGD21 VH manually by using COOT (Emsley et al., 2010) and PyMOL Molecular Graphic System (Schrödinger, LLC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      At present, the limitations for selecting POI for Antibody Display such as protein shape and size remain unclear; further studies will be required to address these questions. Comparing with conventional Fc fusion proteins in which the POI is fused to the N terminus of Fc usually including the flexible hinge region, we reasoned that the Antibody Display, which grafts the POI onto the β-strands G and F of the heavy chain, provides several potential advantages: (1) design and production of a more conformationally constrained chimeric protein, (2) reduction of proteolysis with the POI inserted into a stable antibody Ig fold, and (3) extension of the current antibody engineering toolkit for generating bispecific and chimeric antibodies. Further studies will be needed to explore these potential advantages. An intriguing feature of using the Antibody Display for Tspan12EC2 is with a better yield of protein production than Tspan12EC2. Our functional assays demonstrated that Tspan12EC2 bound to Norrin directly, in agreement with previous genetic studies (Lai et al., 2017). As Tspan12 playing critical roles in CNS vascular development (Junge et al., 2009; Zhang et al., 2018) and tumorigenesis (Knoblich et al., 2014; Otomo et al., 2014), Tspan12EC2-AD may be a useful reagent for these studies. Moreover, Tspan proteins are well known for their important roles in regulating tumor migration, invasion and metastasis (Charrin et al., 2014; Hemler, 2014; Vences-Catalan and Levy, 2018). Antibo...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.31.445667: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1 mg of cell lysate was cleared with protein A magnetic beads to remove non-specific interactions (S1425S, NEB) and incubated overnight with anti-ZAP antibody (Proteintech 16820-1-AP) or anti-IgG from rabbit as a control (Cell Signaling, a gift from Dr. Mathias Munschauer, HIRI-HZI).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ZAP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After transfer using Trans-Blot (Bio-Rad), nitrocellulose membranes were developed using the following primary antibodies: anti-His-tag (ab18184), anti-DDDDK (ab49763), anti-ALFA (FluoTag®-X2 anti-ALFA AlexaFluor 647), anti-ZC3HAV1 (Proteintech 16820-1-AP).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His-tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-ALFA</div><div>suggested: (Antibodies-Online Cat# ABIN125862, RRID:AB_11186338)</div></div><div style="margin-bottom:8px"><div>anti-ZC3HAV1</div><div>suggested: (Proteintech Cat# 16820-1-AP, RRID:AB_2728733)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following secondary antibodies were used: IRDye® 800CW Goat anti-rabbit and IRDye® 680RD Donkey anti-Mouse (both LI-COR).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (LI-COR Biosciences Cat# 926-68073, RRID:AB_10954442)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The nitrocellulose membranes were developed using anti-DDDDK primary (Abcam ab49763) and IRDye® 680RD donkey anti-mouse secondary antibody (LI-COR).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-DDDDK</div><div>suggested: (Abcam Cat# ab49763, RRID:AB_869428)</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the experiments, optical tweezers (OT) constructs were mixed with 4 μl of polystyrene beads coated with antibodies against digoxigenin (AD beads, 0.1% v/v suspension, Ø 1.76 μm, Spherotech), 10 μl of assay buffer (20 mM HEPES, pH 7.6, 300 mM KCl, 5 mM MgCl2, 5 mM DTT and 0.05% Tween) and 1 μl of RNase inhibitor.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>digoxigenin</div><div>suggested: (Millipore Cat# AQ300D, RRID:AB_11212694)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 cells (ATCC HTB-55) were cultured in MEM (Sigma) supplemented with 10% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: ATCC Cat# HTB-55, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The supernatant was used to transduce naïve Huh7 cells in the presence of 10 μg/ml polybrene (Merck Millipore).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus was raised for two passages on Caco-2 cells (HZI Braunschweig).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: CLS Cat# 300137/p1665_CaCo-2, RRID:CVCL_0025)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To study the effect of ZAP-S on SARS-CoV-2 infection, Huh-7 cells were employed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: CLS Cat# 300156/p7178_HuH7, RRID:CVCL_0336)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were infected with 200000 pfu/ml, corresponding to an MOI of 0.03 at 24h post-infection, cell culture supernatants were collected and titrated by plaque assay on Vero E6 cells (ATCC CRL-1586).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Polysome profiling analysis: A plasmid expressing ZAP-S N-terminally tagged with a His-tag was transfected into HEK293 cells using PEI, as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To check endogenous ZAP-S expression, HEK cells were transfected with a plasmid containing the same backbone and His-tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TFRC (NM_003234.4), ZAP (NM_024625.4) and ZNF346 (NM_012279.4) were placed in frame with the coding sequence for ECFP in pFlp-Bac-to-Mam (gift from Dr.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pFlp-Bac-to-Mam</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein-coding sequences were introduced by Golden Gate Assembly using AarI cut sites 69. pET-SUMO-GFP (gift from Prof. Utz Fischer, Julius-Maximilians-University, Würzburg, Germany) was used as the parental vectors for protein overexpression in E. coli.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-SUMO-GFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Optical tweezers constructs were based on the wild type SARS-CoV-2 frameshifting site (nucleotides 13475-13541) cloned into the plasmid pMZ_lambda_OT, which encodes for the optical tweezer handle sequences (2Kb each) flanking the RNA structure (130 nt).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMZ_lambda_OT</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VSV-G envelope pseudo-typed lentivirus for the generation of stable cell lines was produced by co-transfection of each transfer plasmid with pCMVdR 8.91 71 and pCMV-VSV-G (gift from Prof. Weinberg, Addgene plasmid # 8454 72).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV-VSV-G</div><div>suggested: RRID:Addgene_8454)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RNAs were labeled at the 3’ end using pCp-Cy5 (Cytidine-5’-phosphate-3’-(</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCp-Cy5</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry data were analyzed with FlowJo software (BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bands corresponding to the –1 or 0-frame products, 58 kDa and 33 kDa respectively, on western blots of in vitro translations were quantified densitometrically using ImageJ software 74.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Graphs were plotted using GraphPad Prism 8.4.3 software. Microscopy: HEK293 cells were cultured on glass slides and transfected as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The results were plotted using Prism 8.0.2 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All data are available in the main text, the supplementary materials as well as in Mendeley Data: DOI: 10.17632/c7rbxb86k2.1</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Mendeley</div><div>suggested: (Mendeley Data, RRID:SCR_002750)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr style="background-color:#FF0000"><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT811</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Trial number did not resolve on clinicaltrials.gov. Is the number correct?</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr></table>


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.31.446386: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the transfer, the membrane was blocked in 1% Casein in PBS (Thermo Scientific) and stained using primary antibodies directed against SARS-CoV-2 S (1:1,000, Biozol, 1A9, #GTX632604), ACE2 (1:1,000</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, VSV-M (1:2,000, Absolute Antibody, 23H12, #Ab01404-2.0), V5-tag (1:1,000</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>V5-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, Cell Signaling, #13202), GAPDH (1:1,000, BioLegend, #631401) and Infrared Dye labelled secondary antibodies (1:20,000, LI-CORIRDye).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GAPDH</div><div>suggested: (BioLegend Cat# 631401, RRID:AB_2247301)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human embryonic kidney 293T cells purchased from American type culture collection (ATCC: #CRL3216) were cultivated in Dulbecco’s Modified Eagle Medium (DMEM, Gibco) supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS, Gibco), 2 mM L-glutamine (PANBiotech), 100 μg/ml streptomycin (PANBiotech) and 100 U/ml penicillin (PANBiotech).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: ATCC Cat# CRL-3216, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudoparticle production: To produce pseudotyped VSVΔG-GFP particles, 6*106 HEK 293 T cells were seeded 18 hours before transfection in 10 cm dishes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Stem Cell Culture and Intestinal Differentiation: Human embryonic stem cell line HUES8 (Harvard University, Cambridge, MA) was used with permission from the Robert Koch Institute according to the “79.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HUES8</div><div>suggested: RRID:CVCL_B207)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">α5β5 integrin blocking: Caco-2 cells were preincubated with the indicated amounts of α5β5 integrin Inhibitor ATN-161 (Sigma) for two hours and infected with 100 μl freshly produced VSVΔG-GFP pseudo particles.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 cells were preincubated with the indicated amounts of ATN-161 (Sigma) for two hours and infected with SARS-CoV-2 Viral isolate BetaCoV/France/IDF0372/2020 (MOI 0.05, six hours).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression constructs: pCG_SARS-CoV-2-Spike-IRES_eGFP, coding the spike protein of SARS-CoV-2 isolate Wuhan-Hu-1, NCBI reference Sequence YP_009724390.1, was kindly provided by Stefan Pöhlmann (German Primate Center, 473 Göttingen, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCG_SARS-CoV-2-Spike-IRES_eGFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pCG_SARS-CoV-2-Spike C-V5-IRES_eGFP and RaTG13-S (synthesized by Baseclear) was PCR amplified and subcloned into a pCG-IRES_eGFP expression construct using the restriction enzymes XbaI and MluI (New England Biolabs).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCG_SARS-CoV-2-Spike C-V5-IRES_eGFP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCG-IRES_eGFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting amplicons were assembled with a modified pBeloBAC11 backbone, containing CMV and T7 promotors as well as the HDV ribozyme and bGH polyA signal, using the NEBuilder HiFi DNA Assembly Cloning Kit.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBeloBAC11</div><div>suggested: RRID:Addgene_60342)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Assembled DNA was electroporated into E. coli GS1783 strain and resulting clones of pBelo-SARSARS-CoV-2 were confirmed by restriction digestion and next generation sequencing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBelo-SARSARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 ΔS replicon system: HEK293 T cells were seeded in six well format and transfected with 3 μg pBelo-SARSCoV-2-dSpike-GLuc-K2 or pBelo-SARSCoV-2-dSpike-EGFP and 0.25 μg of each expression construct pLVX-EF1alpha-SARS-CoV2-N-2xStrep-IRES-Puro, pCG-ACE2, pCAG-T7-RNA-polymerase and one pCG-vector encoding the spike protein of SARS-CoV-2, RaTG13 or the indicated mutant S respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pBelo-SARSCoV-2-dSpike-GLuc-K2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pBelo-SARSCoV-2-dSpike-EGFP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pLVX-EF1alpha-SARS-CoV2-N-2xStrep-IRES-Puro</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCG-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCAG-T7-RNA-polymerase</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCG-vector</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Organoids were imaged using the Cytation 3 cell imaging system and processed with Gen 5 and ImageJ software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence logos were generated using R packages ggplot2 and ggseqlogo34.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: Statistical analyses were performed using GraphPad PRISM 8 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad PRISM</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 28. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.28.446179: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The gene was later modified for expression in HEK293 cells by adding a fluorescent EGFP tag, in frame, to the C-terminus of the E-protein sequence via overlap extension PCR and subsequently subcloning the product into a pcDNA3.1 vector; generating the EcGFP construct.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Microscopy: HEK293T cells were seeded on an 18 mm diameter coverslip and transiently transfected with the constructs mentioned above (Results and Fig. 2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The gene was later modified for expression in HEK293 cells by adding a fluorescent EGFP tag, in frame, to the C-terminus of the E-protein sequence via overlap extension PCR and subsequently subcloning the product into a pcDNA3.1 vector; generating the EcGFP construct.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The gene was subcloned in the pFastBac1 (for Sf9 expression) and pEG-BM (for HEK293 expression) vectors and baculovirus was generated according to the bac-to-bac baculovirus expression system.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pEG-BM</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Colors were added to signals post-acquisition using default look-up tables in Fiji software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Electrophysiology: Whole-cell patch clamp recordings were performed using an EPC-10 amplifier and Patchmaster software (HEKA Elektronik; Lambrecht/Pfalz, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Patchmaster</div><div>suggested: (Patchmaster, RRID:SCR_000034)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Although several articles and preprints in the past year74,79–84 have reported simulations of this structure, a review of their results shows similar limitations, with abbreviated timescales,80–82 reliance on secondary-structure restraints,74 elevated RMSDs,74,80 and/or dewetting in the absence of electric fields.74 Instability of the open structure may reflect underdetermination of the starting protein or membrane models, unresolved interactions with the C-terminal or other domains, or other factors yet to be identified. Taken together, we have shown that recombinantly expressed full-length E protein from SARS-CoV-2 is capable of independent multimerization, possibly as a tetrameric or smaller species. We also confirmed that the protein localizes intracellularly, similar to its predecessor from SARS-CoV, with no evidence of ion channel properties at the cell surface. Our coarse-grained simulations further support a role for the E protein in viral budding, as the presence of the protein bends the surrounding membrane. Reduction of intracellular Ca2+ in E-protein-transfected cells may further promote viral replication. However, our atomistic simulations and permeation calculations based on previously reported NMR structures resulted in unstable proteins incapable of Ca2+ conduction. We emphasize the importance of using high-resolution structural data obtained from a full-length protein to gain detailed molecular insight of the E protein, and enable future drug-screening effort...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

  4. May 2021
    1. tweet at them. This has multiple effects: If they don't respond, it's bad PR
    2. The best advice I can give you is: Seek a smaller provider which often are less formal and more approachable. When you found one where you have a good support, request your friends and family to move to this. You are doing something for them, then it can only happen on your terms.
      • supporting those you like by sending business to them
      • less formal and more approachable
    3. So, +1 for play ball. Level 1 is supposed to filter out all simple issues (and once upon a time, you'll have forgotten something, happens to all of us), and they are not supposed to be creative. They get a script that has been refined over and over. Learn the scripts, prepare the answers, and you'll get to Level 2 more quickly than with any other method.
  5. www.reclam.de www.reclam.de
    1. 5»Du willst wirklichnichtmehr weiterspielen, Else?«–»Nein, Paul, ich kann nicht mehr. Adieu. – Auf Wiederse-hen, gnädige Frau.« –»Aber, Else, sagen Sie mir doch: FrauCissy. – Oder lieber noch: Cissy, ganz einfach.«–»AufWiedersehen, Frau Cissy.« –»Aber warum gehen Sie denn5schon, Else? Es sind noch volle zwei Stunden bis zum Din-ner.«– »Spielen Sie nur Ihr Single mit Paul, Frau Cissy, mitmir ist’s doch heut wahrhaftig kein Vergnügen.« –»LassenSie sie, gnädige Frau, sie hat heut ihren ungnädigen Tag. –

      .

    1. SciScore for 10.1101/2021.05.26.445185: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Movies were acquired for 10 minutes at 10 frames per second, under illumination with a 532 nm laser at a power of 0.70 µW/µm2, to excite Cy3 fluorophores.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: 5 Traces containing robust smFRET signals for eIF4E–RNA interaction were selected by visual inspection.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Luciferase assays: 100 nM CoV firefly luciferase fusion RNA was added to 12 µL of HeLa lysate reaction mix from an in vitro protein expression kit (Thermo Scientific, 88882), along with 0.5 µL of rocaglamide/RocA solution (Med Chem Express, Product No. HY-19356) or 4E2RCat solution (Med Chem Express, Product No. HY-100733) in varying concentrations as indicated in the Results and Discussion.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For preparation of the luciferase fusion construct, DNA fragments containing the class II T7 promoter Φ2.5, followed by the SARS-CoV-2 5’ untranslated region sequence, the coding sequence for firefly luciferase, and the SARS-CoV-2 5’ untranslated region sequence were assembled in a pUC57 vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pUC57</div><div>suggested: RRID:Addgene_40306)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The sequence was inserted into pUC119 via SalI and EcoRI restriction sites incorportated during gBlock synthesis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pUC119</div><div>suggested: RRID:Addgene_50010)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Preparation of fluorescently labeled eIF4E and eIF4E(S209D): The pET-28a(+) vectors containing the sequences of eIF4E or eIF4E(S209D), each fused with an N-terminal Protein G tag, were designed similarly to Feokistova et. al., (2013).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-28a(+ )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pULTRA expression vector, containing inserts encoding tRNACUA and pAzF-tRNACUA-synthetase – a generous gift from Abhishek Chatterjee, Boston College – was co-transformed into an E. coli BL95ΔAΔfabR strain with the pET28a(+)-eIF4E plasmid, and transformants were selected on LB agar containing Kanamycin (50 µg/mL) and Spectinomycin (100 µg/mL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pULTRA</div><div>suggested: RRID:Addgene_24129)</div></div><div style="margin-bottom:8px"><div>pET28a(+)-eIF4E</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The full-length human GAPDH transcript sequence, obtained from UCSC Genome Browser, was purchased as a gBlock from IDT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UCSC Genome Browser</div><div>suggested: (UCSC Genome Browser, RRID:SCR_005780)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">48 Event timings identified from ebFRET analysis were converted to empirical cumulative probability distributions for the times between events, and the event durations, then fit with single- or double-exponential models to determine kon or koff, according to the equations:

      Fitting was carried out in MATLAB by non-linear least-squares regression using the Trust-Region algorithm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MATLAB</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr></table>


      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. Gwern.net was one of the earliest and most consistent gardeners to offer meta-reflections on their work. Each entry comes with:topic tagsstart and end datea stage tag: draft, in progress, or finisheda certainty tag: impossible, unlikely, certain, etc.1-10 importance tagThese are all explained in their website guide, which is worth reading if you're designing your own epistemological system.
    2. Rory Sutherland (oddly, the vice president of Ogilvy Group)

      His Twitter tag line is: "The Spectator's Wiki Man."

    3. They're not following the conventions of the "personal blog," as we've come to know it.

      There are a number of bloggers who have to some extent, specifically used their blogs for this purpose though. I've documented several at https://boffosocko.com/tag/thought-spaces/

    1. I think so...I actually can't remember. I've used this script quite a bit.

      where did it come from? don't remember

      after a while, something that came from another starts to feel like your own

      you make it your own

    1. Are you also tired and fed up with the bulkiness of jQuery, but also don't want to have to type document.querySelector("div").appendChild(document.createTextNode("hello")); just to add some text to an element?

      happy middle/medium?

    1. --tag-rename '':'my-module-' (the single quotes are unnecessary, but make it clearer to a human that we are replacing the empty string as a prefix with my-module-)
    1. mf-Lon does not recognize or degrade ec-ssrA, providing a protease and cognate degradation tag with orthogonal functionality in E. coli

      I wonder if this insulation will be applicable to other gram negatives? (or other gram positives too?)

    1. This link may be placed in such a way that it is not even necessary for the victim to click the link. For example, it may be embedded within an html image tag on an email sent to the victim which will automatically be loaded when the victim opens their email.
    1. SciScore for 10.1101/2021.05.21.445201: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">αEp9 Abs binding to the potential epitopes was detected using horse radish peroxidase (HRP) conjugated αHuman Fc IgG (Thermo Fisher Scientific, Waltham MA) or αIgM µ-chain specific (Millipore Sigma, Temecula, CA) Abs diluted 1:5000 in ChonBlock Sample Antibody Dilution buffer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HRP) conjugated αHuman Fc IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cloning: Predicted OAS epitopes were subcloned for phage display using the pM1165a phagemid vector (Levin, 2006) with an N-terminal FLAG-tag and a C-terminal P8 M13-bacteriophage coat protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pM1165a</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression and Purification of eGFP fusion peptides: pET28c plasmids encoding eGFP fusions to C-terminal Ep9-FLAG, EpNeu-FLAG, EpPred-FLAG and FLAG (negative control) and N-terminal His6 peptide epitopes, were transformed into BL21DE3 Star E. coli chemically competent cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET28c</div><div>suggested: RRID:Addgene_161936)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alignment of Ep9 sequence with the orthologs from other human coronaviruses (hCoVs) such as SARS-CoV, MERS, HKU-1, NL63, 229E and OC43 was conducted using the Benchling sequence alignment tool (Benchling, 2017) (https://benchling.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://benchling.com</div><div>suggested: (Benchling, RRID:SCR_013955)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To explore a wider range of human host pathogens pBLAST (Altschul et al., 1997) (https://blast.ncbi.nlm.nih.gov/Blast.cgi) was used to search for Ep9 homology in a database of non-redundant protein sequences; common human-host viruses were specified in the organism category.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://blast.ncbi.nlm.nih.gov/Blast.cgi</div><div>suggested: (TBLASTX, RRID:SCR_011823)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The queries were conducted with the blastp (protein-protein BLAST) program (Altschul et al., 1997) with search parameters automatically adjusted for short input sequences.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Using the ProMod3 3.2.0 tool (Studer et al., 2021), a structural model was generated based on the crystal structure (2.35Å, PDB 4GZS 1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ProMod3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: The ELISA data were analyzed in GraphPad Prism 9 (https://www.graphpad.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.23.445348: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The synthesized and mutated genes were cloned into pcDNA 3.4 Topo vector, modified by including a signal sequence of human immunoglobulin heavy chain, His-Tag and SUMOstar protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA 3.4</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. timeless decision theory

      This as since been renamed to updateless decision theory%20is,which%20it%20makes%20its%20decisions.&text=It%20acts%20as%20though%20its,some%20dualist%20free%2Dwill%20theories.)

    1. Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.

      Learn more at Review Commons


      Referee #1

      Evidence, reproducibility and clarity

      Summary:

      In the manuscript „Intra-helical salt bridge contribution to membrane protein insertion" the authors investigate the effect of salt bridge formation between positively and negatively charged amino acids on the insertion behavior of α-helical protein segments into the membrane. Generally it is believed that polar or even charged residues prevent stable membrane insertion of α-helical protein segments, but some of these authors had already shown in a previous paper that such residues are more frequent than expected in transmembrane helices. In the current study, the authors investigate in detail the role of intra-helical salt bridge formation on stable membrane insertion. Using an in vitro membrane insertion assay based on the E. coli leader peptidase (Lep) protein, they found better membrane insertion for helical segments with opposite charge pairs placed at positions compatible with intra-helical salt bridge formation (positions i→i+1; i→i+3 and i→i+4). Furthermore, the authors performed a database screen which revealed that oppositely charged residues are overrepresented at these positions. Finally they picked two candidate membrane proteins from the database (Halorhodopsin and calcium ATPase 1) and proved the presence of an intra-helical salt bridge and determined the contribution of the salt bridge to the apparent free energy of membrane insertion (ΔGapp), which was in the range of 0,5-0,7 kcal/mol.

      Major comments

      1. It seems that the data in Fig. 3b has been mixed up, making it difficult to judge the conclusions. The bars with forward slash seem to represent the "same charge" data and the bars with backward slash seem to represent the "opposite charge" data (exactly contrary to the figure legend). In general the forward and backward slash representation is not easily distinguishable, and for the position i+4 both bars contain a forward slash (making it impossible to discriminate same and opposite charge). Please use filled and unfilled bars instead. Furthermore the bar diagram in Fig. 3a is stacked for opposite and same charge, whereas in Fig. 3b the respective bars are placed next to each other. Additionally the label of the y-axis in Fig. 3c is misleading, as it is not the "Frac. of opp. charged pairs" but the fraction of oppositely charged pairs that form salt bridges.
      2. The authors don´t give details no how the log odds ratios and the respective p-values have been determined. Please include this in the Materials and Methods section. What does a p-value of 0.00e+00 mean (see Table 2, Spacing: +3, "All Log odds")?
      3. What is the proof that for the isolated helix A from the calcium ATPase 1 the membrane embedded part is identical to the full-length protein? The authors investigated two different helix A peptides, the full-length helix ranging from L49-F78, and one short fragment ranging from L49-A69 containing the more hydrophilic N-terminal region, which is the membrane-embedded region in the full-length protein. The authors state: "In contrast, when only the membrane-embedded sequence was included, the Lep chimera was mainly doubly-glycosylated (Fig. 5c, lane 3), suggesting that helix A is properly inserted when the full helical sequence is present." In my opinion this conclusion cannot be drawn from the data presented. The authors used an isolated helical segment, so in my opinion it is much more likely that the isolated full-length helix inserted via its hydrophobic C-terminal part (L60-F78) into the membrane. The authors themselves state in their manuscript: "It has been previously shown that the position in the membrane of TM helices in protein folded structures does not always correspond to the thermodynamically favored positions in the membrane of the isolated helices." Also the i→i+5 mutant points into that direction, because the effect of disturbing the intra-helical salt bridge for the helix A is much less pronounced compared to the similar data in Fig. 4f for the Halorhodopsin protein. In my opinion this shows that most probably only one charged residue (R63) is embedded inside the membrane (with a membrane embedded part of L60-F78).

      Minor comments:

      1. line 151: ",see Figure 2)" Typo: Bracket missing.
      2. line 172: "Other known structural features can also be hinted at, including aromatic ring stacking by His-Trp pair [20] at i→i+6." Please give some more examples of important structural features of membrane proteins, which can be seen in your analysis (e.g. I think that also the glycine zipper can be seen in the i→i+4 data set).
      3. line 255: "The salt bridge contributes approximately ~0,5 kcal/mol to the apparent experimental free energy of membrane insertion." Please explain that this value was derived from the comparison of the ΔGexp between the wt and the i→i+5 mutant. Please comment also on the large difference between the predicted (ΔGpred) and the experimental values (ΔGexp), even if no salt-bridge is involved (e.g. for the DD mutant).
      4. line 348: "Asp-Lys pairs at position i, i+4 and Glu-Lys pairs at position i→ i+3 are the most prevalent as seen previously in Figure 2. They are both among the most prevalent oppositely charged pairs and the charged pairs that form the highest number of salt bridges in membrane protein structures. This is in stark contrast to Glu-Arg pair at position i→ i+1 that although as frequent in pairs as Asp-Lys and Glu-Lys at positions i→i+4 and i→i+3 respectively, only form salt bridges in one-fourth of the cases." Fig. 2 shows that each charge pair has a different prevalence depending on the order (e.g. Asp-Lys and Lys-Asp pairs). I think for this statement the sum of both prevalences should be taken into account, and as the sum is not easy discernible from Fig. 2, it would help to include a table containing the sums. Furthermore, it would be good to refer also to Fig. 3, which also contains a part of the discussed data.
      5. line 402: "c-myc tag (Glu-Gln-Lys-Leu-Ile-Ser-Glu-Glu-Asp-Leu, EQKLISEEDL) was added in Ct in hanging with de PCR primer before cloning." Please revise the sentence and I think the one letter code for the c-myc tag is sufficient (please correct this also in line 428).
      6. line 420: "A region's total ΔG is the sum of these individual scores weighted on where in the region the residue, a residue in the middle of the helix has a higher weight than residues at the ends." Please revise the sentence, the meaning is unclear.
      7. line 436: "Total protein was quantified and equal amounts of protein submitted to Endo H treatment or mock-treated, followed by SDS-PAGE analysis and transferred into a PVDF transfer membrane (ThermoFisher Scientific)." Please revise the sentence.
      8. line 498: "Topological files with sequence and membrane topology are created with the help of the RCSB secondary structure file and only membranes annotated as pure α-helices were retained." I assume that the description contains a typo (membranes annotated as pure α-helices?)
      9. line 507: typo "..., but we did not clustered the proteins" 14: line 560: "The individual value of each experiment in represented by a solid dot being represented as a green square the experimental ΔG value for the L4/A15 sequence from [2]." Please revise the sentence. 15: line 562: "The wt and simple mutants are shown in white bars." Typo: single mutants 16: line 563: "Charges at compatible distances with salt bridge formation (i→i+1; i→i+3; and i→i+4) are shown in yellow. Not compatible distances with salt bridge formation (i→i+2; and i→i+5) are shown in dark gray. Compatible distances but not compatible amino acid pair (i, i+4 DD pair) is shown in clear gray." The given colors don´t match with the figure (i→i+1 = brown; i→i+3 = orange; i→i+4 = yellow and i→i+4 DD pair = white) 17: line 597: "The different monomers are shown in transparent blue, purple and indigo." The different colors are hardly distinguishable in the figure. 18: Figure 4a: The table could be simplified. I think the column "charges" can be removed, as it contains not really charges and the names of the peptides already contain the same information. The column "Å" contains only a value for the wt (and not for the DK i,i+5 mutant) and as the distance for the wt is also given in Fig. 4g, this column can be also removed.
      10. Fig. 4f: The marker lane is hardly visible (completely dark lane)
      11. Fig. 5b: The column "Å" contains only values for the wt sequences (long and short). See also comment 18.
      12. Fig 5d: Why is in the SDS gel a mass shift between the wt and the i→i+5 mutant visible, even though the peptide mass is equal.
      13. There are several changes of font type or format changes (e.g. line 210-214). Please correct this.

      Significance

      As a structural biologist with a focus on membrane-proteins, I understand that the study is concerned on intra-helical salt bridges, but the implications of inter-helical salt bridges should also be discussed, at least in the introduction or outlook. The authors propose that their results are important for the improvement of membrane protein topology prediction methods, so for this aim it is also necessary to take any potential inter-helical salt bridges into account. In this context, it would be relevant to point point out that there even exist extended rows of salt bridges between transmembrane segments (charge-zippers), which serve an important structural element in several membrane proteins.

      The article is well written and most of the conclusions drawn from the experimental results are convincing. I agree with the authors that their results are relevant for future improvement of membrane protein topology prediction software, which so far does not take the possibility of salt bridge formation into account. Therefore, I recommend publication after clarification/revision of the abovementioned points.

    1. SciScore for 10.1101/2021.05.19.444889: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Euthanasia Agents: After 2 weeks, mice were anesthetized with sodium pentobarbital (40 mg/kg, i.p.) with no avoidance response to foot pinch.<br>IACUC: Following imaging was performed using confocal microscope (Nikon) Mouse vaccination: The mouse study was performed under the guidance of Institutional Animal Care and Use Committee (IACUC) of Shanghaitech University, China. Male BALB/c mice aging 6 – 8 weeks were used in this study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Following imaging was performed using confocal microscope (Nikon) Mouse vaccination: The mouse study was performed under the guidance of Institutional Animal Care and Use Committee (IACUC) of Shanghaitech University, China. Male BALB/c mice aging 6 – 8 weeks were used in this study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, the NC membrane was incubated for 1 hour in 5% milk PBST with a 1:1,000 dilution of mouse anti-His tag antibody (Proteintech, Cat# 66005-1-lg).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The slices were then stained using rabbit anti-GFP antibody (Proteintech, Cat# 50430-2-AP) in 0.1% Triton X-100 and 1% serum in PBS overnight at 4 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-GFP</div><div>suggested: (Proteintech Cat# 50430-2-AP, RRID:AB_11042881)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing with PBS, sections were incubated with the Alexa-488 conjugated donkey anti-rabbit antibody (Thermo Fisher Scientific, Cat# A21206) (1:1000 dilution) for 2 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (Thermo Fisher Scientific Cat# A-21206, RRID:AB_2535792)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washes with PBS, HRP-conjugated secondary antibodies (HRP conjugated goat anti-mouse IgG: Proteintech, Cat# SA00001-1; HRP conjugated goat anti-mouse IgG2a: Proteintech, Cat# SA00012-2; HRP conjugated goat anti-mouse IgG1: Proteintech, Cat# SA00012-1; HRP-conjugated goat anti-monkey IgG: Southern Biotech, Cat# 4700-05) were added and incubated for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (Proteintech Cat# SA00012-2, RRID:AB_2890965)</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG2a</div><div>suggested: (Gen-Probe Cat# 855.470.005, RRID:AB_10698621)</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG1</div><div>suggested: (Gen-Probe Cat# 855.470.005, RRID:AB_10698621)</div></div><div style="margin-bottom:8px"><div>anti-monkey IgG</div><div>suggested: (SouthernBiotech Cat# 4700-05, RRID:AB_2796069)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plasmids were transfected into HEK Expi293F cells (Thermo Fisher Scientific, Cat# A14527) using polyethylenimine (PEI) method.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK Expi293F</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudo-virus neutralization assay: To prepare SARS-CoV-2 and related mutated pseudo-viruses, HEK-293T cells were co-transfected with pcDNA3.1-SARS-CoV-2-S or related mutants and pNL4-3.luc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To test the neutralizing activity of immune sera against pseudo-virus, HEK293T cells stably transfected with hACE2 were seeded in 96-well culture plates at a density of 5,000 cells per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following imaging was performed using confocal microscope (Nikon) Mouse vaccination: The mouse study was performed under the guidance of Institutional Animal Care and Use Committee (IACUC) of Shanghaitech University, China. Male BALB/c mice aging 6 – 8 weeks were used in this study.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The coding sequences of S-trimer ECD (residues 1-1208) or RBD were cloned into pTT5 vector with a N-terminal IL-2 signal peptide and a C-terminal 6 × His tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTT5</div><div>suggested: RRID:Addgene_52326)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudo-virus neutralization assay: To prepare SARS-CoV-2 and related mutated pseudo-viruses, HEK-293T cells were co-transfected with pcDNA3.1-SARS-CoV-2-S or related mutants and pNL4-3.luc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1-SARS-CoV-2-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pNL4-3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: Antibody titers of ELISA assay, EC50 value of pseudo-virus neutralization assay were determined using non-linear regression analysis using Graphpad PRISM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad PRISM</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 10 and 21. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.16.444369: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All mouse experiments were approved by the institutional animal care and use committee (IACUC) in Clover Biopharmaceuticals and were conducted according to international guidelines for animal studies.<br>IRB: Human COVID-19 convalescent serum samples: Human convalescent sera samples from recovered COVID-19 patients (table S1) infected with the original SARS-CoV-2 strain were obtained from Public Health Clinical Center of Chengdu in Chengdu, China, under approved guidelines by the Institutional Review Board (IRB), and all patients had provided written informed consent before sera sample were collected.<br>Consent: Human COVID-19 convalescent serum samples: Human convalescent sera samples from recovered COVID-19 patients (table S1) infected with the original SARS-CoV-2 strain were obtained from Public Health Clinical Center of Chengdu in Chengdu, China, under approved guidelines by the Institutional Review Board (IRB), and all patients had provided written informed consent before sera sample were collected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animal studies, facilities and ethics statements: Specific pathogen-free (SPF) BALB/c female mice (6-8 weeks old) for immunogenicity studies were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. and kept under standard pathogen-free conditions in the animal care center at Chengdu Hi-tech Incubation Park.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">2C) of the study, animals in group 1 were randomized to receive a booster (Dose 3 on Day 35) with either 3 µg Prototype or 3 µg B.1.351 S -Trimer (half adjuvanted and half non-adjuvanted).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing 3 times with PBST, the plates were incubated with 1:5000 dilution of rabbit anti-Trimer-Tag antibody (Clover Biopharmaceuticals) at 37°C for 1 h, followed by washing 3 times with PBST and then a 1:20000 dilution of goat anti-rabbit IgG-HRP (Southern Biotech).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Trimer-Tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After transient transfection in 293F cells, the variant S-Trimer antigens were expressed and secreted at sufficient levels to enable further characterization and mouse immunogenicity studies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293F</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animal studies, facilities and ethics statements: Specific pathogen-free (SPF) BALB/c female mice (6-8 weeks old) for immunogenicity studies were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. and kept under standard pathogen-free conditions in the animal care center at Chengdu Hi-tech Incubation Park.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Data arrangement was performed by Excel and statistical analyses were performed using the Prism 8.0 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.15.444222: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animal procedures were performed under the approvals of the Institutional Animal Care and Use Committee of University of Washington, Seattle, WA.<br>Euthanasia Agents: Mice were injected intramuscularly into the gastrocnemius muscle of each hind leg using a 27-gauge needle (BD, San Diego, CA) with 50 μL per injection site (100 μL total) of immunogen under isoflurane anesthesia.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Cell lines: Expi293F cells are derived from the HEK293F cell line, a female human embryonic kidney cell line transformed and adapted to grow in suspension (Life Technologies).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Cell lines other than Expi293F were not tested for mycoplasma contamination nor authenticated.<br>Authentication: Cell lines other than Expi293F were not tested for mycoplasma contamination nor authenticated.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serial dilutions of sera were added to the plates and, after washing, antibody binding was revealed using a hydrogen peroxidase coupled horse anti-mouse IgG antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: Expi293F cells are derived from the HEK293F cell line, a female human embryonic kidney cell line transformed and adapted to grow in suspension (Life Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293F</div><div>suggested: RRID:CVCL_D615)</div></div><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The HEK-ACE2 adherent cell line was obtained through BEI Resources, NIAID, NIH: Human Embryonic Kidney Cells (HEK293T) Expressing Human Angiotensin-Converting Enzyme 2, HEK293T-hACE2 Cell Line, NR-52511.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T-ACE2 cells (BEI NR-52511) were seeded at 1.25×104 cells per well in 50 uL D10 growth media (DMEM with 10% heat-inactivated FBS, 2 mM L-glutamine, 100 U/mL penicillin, and 100 μg/mL streptomycin) in poly-L-lysine coated black-walled clear-bottom 96-well plates (Greiner 655930).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Poly-lysine was removed, plates were dried for 5 min then washed 1× with water prior to plating cells HEK-hACE2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-hACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice: Female BALB/c mice four weeks old were obtained from Jackson Laboratory, Bar Harbor, Maine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The HexaPro-foldon construct used for immunization studies was produced as previously described (24) and placed into pCMV/R with an octa-histidine tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV/R</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Melting temperatures were defined as the maximum point of the first derivative of the melting curve, with first derivatives calculated using GraphPad Prism software after smoothing with four neighboring points using 2nd order polynomial settings.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Midpoint titers calculations (EC50) were generated based on fitted four point logistic equations using the SciPy library in Python, in which the EC50 was the serum dilution at which the curve reached 50% of its maximum.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SciPy</div><div>suggested: (SciPy, RRID:SCR_008058)</div></div><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.13.444010: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Enrolled adults were healthy and provided informed consent prior to any study procedures.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">8 subjects each were randomly chosen from participants from age cohorts 18-55, 56-70, and 71+ years of age who received two doses of 100 mcg mRNA-1273.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were incubated with an anti-SARS-CoV spike primary antibody directly conjugated to biotin (CR3022-biotin) for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV spike</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CR3022-biotin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates are washed and Sulfo-tag labeled anti IgG antibody is applied to the wells and allowed to associate with complexed coated antigen – sample antibody within the assay wells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and Viruses: VeroE6 cells were obtained from ATCC (clone E6, ATCC, #CRL-1586) and cultured in complete DMEM medium consisting of 1x DMEM (VWR, #45000-304), 10% FBS, 25mM HEPES Buffer (Corning Cellgro), 2mM L-glutamine, 1mM sodium pyruvate, 1x Non-essential Amino Acids, and 1x antibiotics.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VeroE6-TMPRSS2 cells were kindly provided by Drs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viruses were propagated in Vero-TMPRSS2 cells to generate viral stocks.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudoviruses were mixed with serial dilutions of sera or antibodies and then added to monolayers of ACE2-overexpressing 293T cells (gift of Michael Farzan and Huihui Mu), in triplicate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Saponin [Sigma, 47036-250G-F] in PBS), was added to the fixed Vero cells for 20 minutes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell-surface spike binding: HEK293T cells were transiently transfected with plasmids encoding full length SARS-CoV-2 spike variants using lipofectamine 3000 (L3000-001, ThermoFisher) following manufacturer’s protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To produce SARS-CoV-2 pseudoviruses, an expression plasmid bearing codon-optimized SARS-CoV-2 full-length S plasmid was co-transfected into HEK293T/17 cells (ATCC#CRL-11268) cells with packaging plasmid pCMVDR8.2, luciferase reporter plasmid pHR′CMV-Luc (40) and a TMPRSS2 plasmid (41).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMVDR8.2 , luciferase reporter</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pHR′CMV-Luc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>TMPRSS2</div><div>suggested: RRID:Addgene_53887)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All calculations are performed within Excel and the GraphPad Prism software, version 7.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The samples were then acquired on a BD LSR Fortessa X-50 flow cytometer (BD biosciences) and analyzed using Flowjo (BD biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flowjo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. tag format e.g. #go #push

      IMHO #go == [[go]]. In that sense we should probably support all conventions that clearly demonstrate an [[intent]] to trigger an action, I'm fine adding support for these.

    1. RRID:AB_1097802126183

      DOI: 10.1016/j.celrep.2021.109151

      Resource: (Thermo Fisher Scientific Cat# 26183, RRID:AB_10978021)

      Curator: @Naa003

      SciCrunch record: RRID:AB_10978021

      Curator comments: HA Tag Monoclonal Antibody (2-2.2.14) Thermo Fisher Scientific Cat# 26183


      What is this?

    1. There’s this thing I simply call “365”. With each new year (or sometimes at the end of a notebook, when I feel like it), I make a 2-page spread mind map of things that kept me busy. It’s more or less an analog tag cloud and it’s extremely rewarding to make. You get to browse through previous journals, look at things you’ve written down and actually managed to pull of, and take note of that in one or two words. That creates a thick cloud full of the things that defined you for the last year. It’s actually quite incredible to look at. When I’m done doing that, I try to underline the words that meant more to me than others. Applying the retrospective principles from software development on your own personal life and writing down what made you glad, mad or sad actually helps you do something about that.

      This is an example of spaced repetition being done as retrospective and hiding some of the value of making the important things stand out and reviewing them for better long term retention.

    1. SciScore for 10.1101/2021.05.06.21256766: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants received oral and written information about the study and written consent was obtained.<br>IRB: All protocols performed in the study were in accordance with the ethical standards approved by the Ethical Committee of the Hospital Clínico Universitario of Valencia (Ref. 2020/133) and by the rest of the Ethical and Research’s Committees.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Participants were pregnant with intended breastfeeding and nursing women with positive PCR for SARS-CoV-2 in nasopharynge or presence of SARS-CoV-2 antibodies in serum determined in hospitals.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Those women were randomly selected from the MAMI birth cohort in Spain [15] (ClinicalTrials.gov Identifier: NCT03552939).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Women were excluded when COVID-19 symptomatology required specific treatment and/or hospitalization in intensive care units.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Breast milk SARS-CoV-2-specific antibody detection: Levels of antibodies directed to structural proteins as RBD of the SARS-CoV-2 spike protein and to non-structural viral proteins as cysteine-like protease, also known as the main protease (Mpro) or 3CLpro, were analyzed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 spike protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detection of the different antibody isotypes, anti-human IgA (α-chain-specific) HRP antibody (Thermo-Fisher Scientific; A18781; 1:6.000), anti-human IgM (μ-chain-specific) HRP antibody (Sigma-Aldrich; A0420; 1:4.000), and anti-human IgG (Fc specific) HRP antibody (Sigma-Aldrich; A0170; 1:4.000) were used and incubated for 1 h in 1 % (w/v) milk powder in PBS-T.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HRP</div><div>suggested: (Sigma-Aldrich Cat# A0420, RRID:AB_257886)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, an anti-human IgA antibody pre-adsorbed to the plate allowed to capture the IgA, which was later detected by the addition of a biotinylated detection antibody and streptavidin-conjugated horseradish peroxidase that catalyzed the colorimetric reaction with the chromogenic substrate TMB.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RBD protein was produced under HHSN272201400008C and obtained through BEI Resources, NIAID, NIH: Spike Glycoprotein RBD from SARS-CoV-2, Wuhan-Hu-1 with C-Terminal Histidine Tag, Recombinant from HEK293T Cells, NR-52946.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detection of the different antibody isotypes, anti-human IgA (α-chain-specific) HRP antibody (Thermo-Fisher Scientific; A18781; 1:6.000), anti-human IgM (μ-chain-specific) HRP antibody (Sigma-Aldrich; A0420; 1:4.000), and anti-human IgG (Fc specific) HRP antibody (Sigma-Aldrich; A0170; 1:4.000) were used and incubated for 1 h in 1 % (w/v) milk powder in PBS-T.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo-Fisher Scientific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detection of MPro-reactive antibodies, a commercial ELISA Kit (ImmunoStep, Salamanca, Spain) was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImmunoStep</div><div>suggested: (IMMUNOSTEP, S.L., RRID:SCR_013411)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Endpoint titers were calculated from log-transformed titration curves using 4-parameter non-linear regression function in GraphPad Prism 8.0 and the positive cut-off values obtained from the prepandemic control group for each antigen and isotype.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Regarding the potential limitations, we did not collect skin swabs to control for the potential presence of SARS-CoV-2 in the skin [7,33]. However, all milk samples as well as the infants were negative for SARS-CoV-2 presence. Thus, although there are still limited data, it is accepted that breastfeeding does not represent a vehicle for vertical transmission of SARS-CoV-2 [9]. There are still many open questions: when are SARS-CoV-2 antibodies produced after maternal infection, when can they be detected in breast milk, and how long do they persist. To cover some of these questions, we aimed to determine the presence of antibodies in breast milk samples from COVID-19 women and to compare these with milk samples collected prior to the pandemic as reference controls. While different studies have reported presence of specific IgA antibodies against SARS-CoV-2 [7,12,13,36], limited information is available on IgG and IgM. Our results showed presence of anti-SARS-CoV-2 antibodies in milk, primarily IgA but also IgG and IgM targeting RBD. Furthermore, IgA- and IgG against non-structural MPro were analyzed for the first time in human milk samples. High intra- and inter-individual variability was observed in antibody presence and significant differences were observed for all three antibody classes when compared to prepandemic samples in agreement with previous data [26]. In our dataset we found that 82·9 % of the milk samples tested positive for the RBD antigen at least in one of the ...

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04768244</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Impact of Maternal COVID-19 Disease on Breast Milk and Infan…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT03552939</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">The Impact of Maternal Microbes on Infant Health Programming</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. The Go visibility rules for struct fields are amended for JSON when deciding which field to marshal or unmarshal. If there are multiple fields at the same level, and that level is the least nested (and would therefore be the nesting level selected by the usual Go rules), the following extra rules apply: 1) Of those fields, if any are JSON-tagged, only tagged fields are considered, even if there are multiple untagged fields that would otherwise conflict. 2) If there is exactly one field (tagged or not according to the first rule), that is selected. 3) Otherwise there are multiple fields, and all are ignored; no error occurs.

      这段主要解释嵌套匿名结构在 marshal or unmarshal 时,field key 的冲突情况。我把 untagged 域 json 化的 key 称为 field key,tagged 域 json 化的 key 称为 tag key。

      注意:这里讲的 tagged 域是指设置了 key name 的 tag,没有设置 key name 的 tagged 域在 json 化中使用的还是 filed key。

      本段涉及的域处在同一层级,且该层级至少是一层嵌套层。

      # 至少是这样的嵌套
      type A struct {
          Name string
      }
      
      type B struct {
          Name string
      }
      
      type C struct {
          Name string
      }
      
      type D struct {
          A
          B
          C
      }
      
      func TestFeature(t *testing.T) {
          d := D{A{"A"}, B{"B"}, C{"C"}}
          r, _ := json.Marshal(d)
          fmt.Println(string(r))
      }
      

      以上 D struct 的 instance 有多个相同名称的域 Name。在对其做 marshal or unmarshal 时应用以下规则:

      1、json tagged 的域优先于 untagged 的域考虑。

      # 如果 A 的域被 `json:"Name"`,则 B C 里的 Name 域都被忽略。
      {"Name":"A"}
      

      2、如果 tagged 域的 tag key 唯一,则被正常 marshal or unmarshal,否则冲突的 tagged 域都被忽略。如果 untagged 域的 field key 唯一,则被正常 marshal or unmarshal,否则冲突的 untagged 域都被忽略。

      # 如果 A 和 B 的 Name 域都被 `json:"Name"`,则视为  tag key 冲突,所以两者都被忽略。并且 C 的 Name 域为 untagged,所以 C instance 在这场“Name 域 json 化争夺战”中完全处于下风。最终这场战斗没有人胜出。
      # {}
      
      # 如果 A 的 Name 域被 `json:"Nickname"`,则剩下 B C 两个 untagged 域争夺,根据规则,最终没有在 json string 中见到 Name key。
      # {"Nickname":"A"}
      
    2. Anonymous struct fields

      首先要明白什么是 anonymous struct field,看这里。

      看过上面文章,应该对 anonymous struct field 及其规则有大致的了解。

      在对 anonymous struct field 做 json encoding 时,anonymous struct field 中的 exported field 默认会被当做 outer struct 的 field 来 encoding。

      如果对匿名结构域使用 json tag 功能给予 key name,则在 encoding 时不会被当作匿名结构域应用上述规则。

      如果匿名结构域是 interface{} 类型,则也不会被当作匿名结构域应用上述规则,interface{} 的名称会被当作 key name。

      举例:

      type Kitchen struct {
          NumOfPlates uint
      }
      
      type Door interface {
          echo()
      }
      
      type FrontDoor struct {
          Name string
      }
      
      func (frontDoor *FrontDoor) echo() {
          fmt.Println("I'm " + frontDoor.Name)
      }
      
      type House struct {
          Kitchen    `json:"kitchen"`
          NumOfRooms uint
          Door
      }
      
      func main() {
      
          h := House{Kitchen{10}, 3, &FrontDoor{"Gold Door"}}
      
          sp, _ := json.Marshal(h)
          fmt.Println(string(sp))
      }
      # {"kitchen":{"NumOfPlates":10},"NumOfRooms":3,"Door":{"Name":"Gold Door"}}
      # 正常被当作匿名结构域 encoding json 时:
      # {"NumOfPlates":10,"NumOfRooms":3}
      
    3. The encoding of each struct field can be customized by the format string stored under the "json" key in the struct field's tag.

      struct field 的 json encoding 行为可以通过 json tag 自定义,格式为:json:"keyName,option1,..."

      以下是一些使用情况介绍:

      1、即想使用 json tag 定义行为又要使用 struct field name 来作为 json key:json:",option1,..."

      2、使用 omitempty 选项可以忽略该 field 的 json encoding,如果该 field 的值是空值的话。

      3、使用 json:"-" 的 field 在 encoding 时被忽略。如果想要使用 "-" 做为 json key,那么在 "-" 后加上一个 comma 即可:json:"-,"

      4、如果你想要一些非 string 的类型被 encoding 为 json string,使用 json:",string" 标签选项即可。

      type Person struct {
          Age uint `json:",string"`
      }
      
      func main() {
          p := Person{
              23,
          }
          sp, _ := json.Marshal(p)
          fmt.Println(string(sp))
      }
      # {"Age":"23"}
      
    4. key name

      这里的 key name 不知道指什么,如果指的是 json tag 里给的 key name,那么在上面已经介绍过了,这里难道只再提一下作为 key name 的规则吗?

    1. SciScore for 10.1101/2021.05.12.443228: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Ethics statement: All mice involved in the experiments were approved by the Biomedical Research Ethics Committee of the Institute of Biophysics of the Chinese Academy of Sciences and were performed in compliance with the Guidelines for the Care and Use of Laboratory Animals of the Institute of Biophysics.<br>IACUC: Non-human primates, Rhesus macaques immunogenicity studies were performed in the animal facility of Guangxi Fangchenggang Biotechnology Development Co., Ltd. (GFBDCL), according to the guidelines of the Committee on Animals of GFBDCL (approval No.: SYXK2018-0004/200005).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animals: Female (6-8-week-old) BALB/c mice and C57BL/6J mice were obtained from Vital River (Beijing) and bred under specific pathogen-free (SPF) conditions in the animal facility of the Institute of Biophysics and the Institute of Microbiology, Chinese Academy of Science.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Immunogenicity of I-P-R-F in rhesus macaques: To evaluate the immunogenicity of I-P-R-F in non-human primates, a total of 10 rhesus macaques (5 male and 5 female, weighing 3∼5 kg) purchased from Guangxi Fangchenggang Biotechnology Development Co., Ltd. were randomly assigned into four groups with one male and one female in each group and intramuscularly immunized with high does(50 μg) or low dose(10 μg) of I-P-R-F with or without alum as adjuvant two times at a 14-day interval.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ploy-histidine tagged hACE2, rabbit anti-SARS-CoV-2 nucleocapsid, and HRP-conjugated goat anti-rabbit IgG (H+L) antibody antibodies were purchased from Sino Biological lnc. (Beijing, China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 nucleocapsid,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were then washed with PBST (PBS containing 0.05% Tween 20) and incubated with goat anti-mouse IgG-HRP (1:5000, Cwbiotech) or goat anti-monkey IgG-HRP (1:10000, Invitrogen) at 37°C for 30 minutes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2×106 cells were blocked with anti-CD16/32 (anti-FcγIII/II receptor, clone 2.4G2) and stained with specific fluorescence-labeled antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD16/32 (anti-FcγIII/II receptor,</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blood was collected at indicated time points, and the SARS-CoV-2 specific IgG and neutralization antibody titers in serum were determined.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 specific IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, human immunodeficiency virus backbones expressing firefly luciferase (pNL43R-E-luciferase) and pcDNA3.1 (Invitrogen) expression vectors encoding the SARS-VoV-2 S protein were co-transfected into 293T cells (ATCC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus was stock and amplified in Vero-E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 RBD protein (rRBD) was also expressed in 293F cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293F</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The anti-viral activity of IFNα: The IFNα bioactivity was determined by the anti-viral infection assay using the L929 fibroblast cell line sensitive to VSV infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>L929</div><div>suggested: ECACC Cat# 86032004, RRID:CVCL_4238)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To evaluate the neutralization of vaccinated mice serum, 293-hACE2 cells were seeded into 96-well plates (2×104 per well) and 3-fold serially diluted heat-inactivated serum samples were incubated with 100 TCID50 of pseudovirus for 1 hour at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mixture was incubated for 1 hour at 37°C and then transferred to the 96-well plates seeded with Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animals: Female (6-8-week-old) BALB/c mice and C57BL/6J mice were obtained from Vital River (Beijing) and bred under specific pathogen-free (SPF) conditions in the animal facility of the Institute of Biophysics and the Institute of Microbiology, Chinese Academy of Science.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: RRID:IMSR_JAX:000664)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Female (6-8-week-old) BALB/c or C57BL/6 mice were immunized intramuscularly or subcutaneously with different immunogens in 100μL using insulin syringes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, human immunodeficiency virus backbones expressing firefly luciferase (pNL43R-E-luciferase) and pcDNA3.1 (Invitrogen) expression vectors encoding the SARS-VoV-2 S protein were co-transfected into 293T cells (ATCC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL43R-E-luciferase</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, the coding sequence for RBD with a 6 x his tag on C terminus was cloned into the pEE12.4 vector without a human IgG1 Fc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pEE12.4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, the pseudovirus was produced by co-transfection of the plasmid expressing firefly luciferase (pNL43R-E-luciferase) and pcDNA3.1 expressing the SARS-CoV-2 spike protein into 293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The coding sequence for SARS-CoV-2 RBD spanning S protein 319-541 (GenBank: YP_009724390) was codon-optimized for mammalian cells and synthesized by GENEWIZ, China.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GENEWIZ</div><div>suggested: (GENEWIZ, RRID:SCR_003177)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The fluorescence imaging data were analyzed by Living Image software (PerkinElmer).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Living Image</div><div>suggested: (Living Image software, RRID:SCR_014247)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All the samples were acquired by BD LSRFortessa flow cytometer (BD Bioscience), and the data were analyzed with Flowjo software (TreeStar).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Bioscience</div><div>suggested: (BD Biosciences, RRID:SCR_013311)</div></div><div style="margin-bottom:8px"><div>Flowjo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantification and statistical analysis: All statistical analyses were performed using Graphpad Prism 8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 33, 37 and 38. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.08.21256891: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression and purification of M-MLV and BstLF: The M-MLV gene was synthesized as a Gblock from IDT and cloned into at pET-19b vector with N-terminal 10x His-tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-19b</div><div>suggested: RRID:Addgene_153312)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BstLF DNA sequence from the OpenEnzyme collection was cloned into pET15b with a 6x His-tag at its N-terminus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET15b</div><div>suggested: RRID:Addgene_129689)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Both DNAs can be obtained from the Open Bioeconomy Lab and/or FreeGenes collection32.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FreeGenes</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      A potential limitation of our proof of concept method is that the use of intercalating dyes can make target-specific real-time detection challenging44, and could pose as a barrier for use in resource limited areas. Future lower resource implementations of our method could substitute EvaGreen for 100-200 µM halochromic dyes, like Cresol Red, in pH 8.8 buffered reaction mix to cause detectable colorimetric change when amplification products have been produced47. Alternatively more advanced detection methods utilizing sequence specific methods based on the use of probes (e.g. LAMP-BEAC23, OSD48, DARQ49 and QUASR50) could also be utilized as end-point detection methods, and remain to be tested in future work. Such methods would be advantageous as they could be multiplexed for different targets in the same reaction. QUASR, for instance, has been shown to allow single step and close-tube multiplexing50. The versions of both M-MLV and BstLF enzymes used in this paper are in the public domain in Chile but some of the M-MLV mutations are still subject to protection in other jurisdictions e.g. in the US (patent no. US7056716B251) with anticipated expiration date of 15 March 2021. Future work will, therefore, explore the use of off-patent enzymes Open-MMLV or HIV RT15 from the E. coli expression toolkit from ReClone initiative52 in order to have freedom-to-operate in any country. The use of public domain enzymes would also permit commercial partnerships seeking to scale-up production lo...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.11.443686: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant sfGFP-ACE2 was transiently expressed in Expi293 cell and secreted into the culture medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus neutralization assay: The pseudovirus neutralization assays were performed using 293T cells overexpressing ACE2 and pseudoviruses expressing full-length S protein provided by RNAi Core of Academic Sinica</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The DNA sequence corresponding the residues 1-1208 of S-UK was subcloned into the mammalian expression vector pcDNA3.4-TOPO (Invitrogen), which contains a foldon trimerization domain based on phage T4 fibritin followed by a c-myc epitope and a hexa-repeat histidine tag as described previously28.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.4-TOPO</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression and purification of sfGFP-ACE2: The sfGFP-ACE2 construct was obtained from Addgene (Plasmid #145171), which was deposited by Erik Proco (University of Illinois,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>sfGFP-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After motion correction, all corrected micrographs then were transferred to cryoSPARC v2.1432.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cumulated epitope counts were mapped onto the crystal structure of RBD in complex with ACE2 (PDB accession code 6M0J) and rendered by using Pymol (Schrodinger Inc. U. S. A.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pymol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IC50 was determined by a four-parameter logistic regression using GraphPad Prism (GraphPad Software Inc.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.10.443532: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">After 24 h incubation, five fields were randomly selected in each well to count the number of nuclei in fused and unfused cells.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells, antibodies and reagents: HEK 293T cells (ATCC CRL-3216 from American Type Culture Collection, Rockville, MD) and HEK 293T Lenti-X (Clontech/Takara Bio) were cultured at 37°C in 5% CO2 in Dulbecco’s modified Eagle’s medium (DMEM; Life Technologies) supplemented with 10% fetal bovine serum (FBS; Gibco), 2 mM L-glutamine (Life Technologies), and antibiotics (100 U/ml penicillin and 100 μg/ml streptomycin; Life Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibiotics</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike protein S2 monoclonal antibody (1A9), PDI mouse antibody (Clone: RL90), Alexa 594- and Alexa 488-conjugated antibodies against mouse and rabbit IgG, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PDI</div><div>suggested: (Thermo Fisher Scientific Cat# MA3019A488, RRID:AB_2633336)</div></div><div style="margin-bottom:8px"><div>rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">rabbit monoclonal antibody, the Calnexin (C5C9) rabbit monoclonal antibody and the FLAG-tag (D6W5B)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FLAG-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The eluted samples were separated by SDS-PAGE and analyzed by Western blotting using anti-FLAG M2 monoclonal antibody or SARS-CoV/SARS-CoV-2 Spike protein S2 monoclonal antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-FLAG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV/SARS-CoV-2 Spike protein S2</div><div>suggested: (Thermo Fisher Scientific Cat# MA5-35946, RRID:AB_2866558)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Input lysates and pulldown proteins were analyzed by western blotting with the anti-FLAG M2 monoclonal antibody (Sigma) and anti-GAPDH monoclonal antibody (Cell Signaling) as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-GAPDH</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Digested proteins were analyzed by Western blotting with anti-M2 FLAG monoclonal antibody (Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-M2 FLAG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells, antibodies and reagents: HEK 293T cells (ATCC CRL-3216 from American Type Culture Collection, Rockville, MD) and HEK 293T Lenti-X (Clontech/Takara Bio) were cultured at 37°C in 5% CO2 in Dulbecco’s modified Eagle’s medium (DMEM; Life Technologies) supplemented with 10% fetal bovine serum (FBS; Gibco), 2 mM L-glutamine (Life Technologies), and antibiotics (100 U/ml penicillin and 100 μg/ml streptomycin; Life Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: ATCC Cat# CRL-3216, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In order to transduce cells with pseudovirions, virus was added either to mock transfected 293T or ACE2-transfected 293T cell lines at 24 hr post-transfection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Treatment with N-glycosylation processing inhibitors and glycosidases: Tunicamycin (TM) and Kifunensine (KIF) at a concentration of 1 μg/ml and 5 μg/ml, respectively, were used to inhibit N-glycosylation in transfected HEK-293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids: The plasmids, pCDNA3.1-hACE2-FLAG and pCDNA3.1-pACE2-FLAG, which express human ACE2 (GenBank accession number NM_021804.3) and pig ACE2 (GenBank accession number NM_001123070.1) fused to a FLAG epitope, respectively, were purchased from GenScript, as well as the pCDNA3.1-TMPRSS2-FLAG expressing TMPRSS2 ( GenBank accession number NM_005656.4) fused to a FLAG epitope.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA3.1-hACE2-FLAG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCDNA3.1-pACE2-FLAG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCDNA3.1-TMPRSS2-FLAG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pCDNA3.1-SARS2-Spike expressing full-lengh Spike (S) protein from SARS-CoV-2 (GenBank accession number QHD43416.1) was purchased from Addgene.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA3.1-SARS2-Spike</div><div>suggested: RRID:Addgene_145032)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell surface biotinylation assay: Human 293T cells were transiently transfected with plasmids encoding FLAG-tagged hACE2 variants or FLAG-tagged pACE2 protein for 24h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate these viruses, Lenti-X 293 T cells (Takara Bio) grown in 10 cm dish were transiently transfected with the following plasmids: 5 µg of pLenti-GFP (Cell Biolabs), 6 µg of psPAX2 and 0.9 µg of pCMV-VSVG (Cell Biolabs), or 0.9 µg of pCDNA3.1-SARS2-SpikeΔ19, or 0.9 µg of pCDNA3.1-SARS-Spike using the TransIT®-LT1 Transfection Reagent (Mirus) according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLenti-GFP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>psPAX2</div><div>suggested: RRID:Addgene_12260)</div></div><div style="margin-bottom:8px"><div>pCMV-VSVG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCDNA3.1-SARS2-SpikeΔ19</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCDNA3.1-SARS-Spike</div><div>suggested: RRID:Addgene_145031)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following antibodies were purchased from Thermo Fischer: SARS-CoV/SARS-CoV-2</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Fischer</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The images were processed with NIS-elements software (Nikon).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NIS-elements</div><div>suggested: (NIS-Elements, RRID:SCR_014329)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 56 and 54. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.10.443524: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nsp2 Expression: SARS-CoV-2 Nsp2, codon optimized for Escherichia coli expression, was cloned in a pET-29b(+) vector backbone with N-terminus 10XHis-tag and SUMO-tag (Ep156).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET-29b(+)</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Each collection was performed with semi-automated scripts in SerialEM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cys/His residues were manually identified for Zn coordination sites and Zn was placed in COOT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Local resolution was determined by running ResMap program45.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ResMap</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">First three were individually aligned with matchmaker in ChimeraX to the experimental model to assess the similarity and report RMSDs in the main text.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ChimeraX</div><div>suggested: (UCSF ChimeraX, RRID:SCR_015872)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence alignment and sequence conservation analysis: Nsp2 sequences were manually downloaded from UniProt and aligned in Jalview using MAFFT49,50.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UniProt</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div><div style="margin-bottom:8px"><div>Jalview</div><div>suggested: (Jalview, RRID:SCR_006459)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Conservation was mapped on the Nsp2 structure using a combination of Chimera and ChimeraX and the supplementary alignment figure was prepared with MView server47,51,52.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Conservation</div><div>suggested: (Conservation, RRID:SCR_016064)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. A w2g <cite> tag identifies/distinguishes itself in css by have a w2gid propert

      If you look at the incomplete graph.js implementation, you can see that it's actually using a class instead. This is good! However, I advocate for class names that happen to also be a hostname + resource (i.e., like URL, but omitting the http:// part).

      (I suppose that, alternatively, if someone wanted to use a shorter class name, such as "w2g-tag", then graph.js could be configured to allow for that, but it would need to be explicit configuration on the author/publisher's part.)

    1. SciScore for 10.1101/2021.05.09.442808: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">AMBRA (antigen-specific memory B cell repertoire analysis) of IgG antibodies: Replicate cultures of total unfractionated PBMC from SARS-CoV-2 infected or vaccinated individuals were seeded in 96 U-bottom plates (Corning) in RPMI1640 supplemented with 10% Hyclone, sodium pyruvate, MEM non-essential amino acid, stable glutamine and PenicillinStreptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific memory B cell repertoire analysis) of IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody discovery and expression: Antigen specific IgG+ memory B cells were isolated and cloned from total PBMCs of convalescent individuals.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antigen specific IgG+</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry of antibody on S Protein expressing ExpiCHO-S cells: For Expi-CHO cell transient transfection, S plasmids (21, 58) were diluted in cold OptiPRO SFM, mixed with ExpiFectamine CHO Reagent (Life Technologies, A29130) and added to the cells seeded at 6×106 cells/ml in a volume of 5 ml in a 50 ml bioreactor.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A29130</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Twelve-point 3-fold serial dilutions of S2P6 were prepared in DMEM and OC43 S VSV pseudoviruses were added 1:1 (v/v) to each dilution in the presence of anti-VSV-G antibody from I1-mouse hybridoma supernatant diluted 50 times (final volume: 50 μl).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-VSV-G</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: Cell lines used in this study were obtained from ATCC (HEK293T and Vero-E6) or ThermoFisher Scientific (ExpiCHO cells, FreeStyle™ 293-F cells and Expi293F™ cells).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>293-F</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In a BSL3 facility, serial dilutions of mAbs (1:4) were incubated with 200 PFU (plaque forming units, corresponding to a multiplicity of infection of 0.01) of authentic SARS-CoV-2 (isolate USA-WA1/2020, passage 3, passaged in Vero-E6 cells) for 30 minutes at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To perform pseudotype neutralization assays, VeroE6-TMPRSS2 cells were used for VSV-SARS-CoV-2, VSV-SARS-CoV-1, and VSV-GD19 and Huh7 cells were used for VSV-MERS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: CLS Cat# 300156/p7178_HuH7, RRID:CVCL_0336)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK-293T cells at 70~80% confluency were transfected with the pCDNA3.1 expression vectors encoding full-length OC43 S harboring a truncation of the 17 C-terminal residues along with a fusion to Ha-tag and the bovine coronavirus hemagglutinin esterase protein Fc-tagged at molar ratios of 7:1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 S D614G, used for production of SARS-CoV-2 postfusion, contains a mu-phosphatase signal peptide beginning at 14Q, a mutated S1/S2 cleavage site (SGAR), and ends at residue K1211 followed by a TEV cleavage, foldon trimerization motif, and an 8X his tag in a pCMV vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV</div><div>suggested: RRID:Addgene_20783)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VSV pseudotype virus production and neutralization: Sarbecovirus spike cassettes with a C-terminal deletion of 19 amino acids (D19) were synthesized and cloned into mammalian expression constructs (pcDNA3.1(+) or pTwist-CMV) for the following Sarbecoviruses: SARS-CoV-2 (Accession QOU99296.1), SARS-CoV-1 (Accession AAP13441.1), hCoV-19/pangolin/Guangdong/1/2019 (GD19, Accession QLR06867.1), and Middle East respiratory syndrome-related coronavirus (MERS, Accession YP_009047204).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTwist-CMV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK-293T cells at 70~80% confluency were transfected with the pCDNA3.1 expression vectors encoding full-length OC43 S harboring a truncation of the 17 C-terminal residues along with a fusion to Ha-tag and the bovine coronavirus hemagglutinin esterase protein Fc-tagged at molar ratios of 7:1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">UCA sequences of the VH and VL were constructed using IMGT/V-QUEST.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IMGT/V-QUEST</div><div>suggested: (IMGT/V-QUEST, RRID:SCR_010749)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Conservation analysis: Conservation analysis was performed as described previously (Pinto et al 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Conservation</div><div>suggested: (Conservation, RRID:SCR_016064)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The multiple sequences alignment was performed using MAFFT (https://mafft.cbrc.jp/alignment/software/) with the spike amino acid sequences as input.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were imaged with an automated microscope (Cytation5, Biotek), and nuclei and cells positive for the SARS-CoV-2 Nucleoprotein were quantified using the supplied Gen5 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gen5</div><div>suggested: (Gen5, RRID:SCR_017317)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Percent neutralization data were analyzed using GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Several subsequent rounds of model building and refinement were performed using Coot (71), ISOLDE (72), Refmac5 (73), and MOE, to arrive at a final model for the complex.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Two rounds of reference-free 2D classification were performed using cryoSPARC (76) to select well-defined particle images.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 34 and 31. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.10.443404: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK-293T cells adapted to grow in suspension in Freestyle F-17 medium were transfected with the resulting genetic constructs, using linear polyethyleneimine as the transfection agent.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentiviral particles containing the gene of interest were produced and used for stable transduction of CHO-K1 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO-K1</div><div>suggested: CLS Cat# 603480/p693_CHO-K1, RRID:CVCL_0214)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The optimized nucleotide sequence was assembled and amplified by PCR using gene fragments synthesized by Eurofins and oligonucleotides synthesized at CIGB (Cuba), and cloned into pCMX/His vector through BssHII and NotI restriction sites.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMX/His</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(RBD(319-541)-CHO)2 from transduced CHO-K1 cells: The whole expression cassette including the gene coding for RBD319-541 (from CMV promoter to His6 tag and stop codon) was amplified by PCR from pCMX/His (see the previous section) and re-cloned into the lentiviral vector pL6WBlast (CIGB, Cuba) with the restriction enzymes XhoI and EcoRV.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pL6WBlast</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting amplicon, after digestion with these enzymes, was cloned in-frame into Nhe I/Sal I-digested pET28a+ (Novagen, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pET28a+</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After digestion with these enzymes, the fragment was cloned in-frame with the S. cerevisiae alpha factor pre-pro peptide into EcoR I/Xba I-digested pPICK-αA (a pPICZ-αA derivative bearing a G418 resistant selection marker).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pPICK-αA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pPICZ-αA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Argon was used as a collision gas and the mass spectra were processed by using MassLynx v4.1 (Micromass, UK).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MassLynx</div><div>suggested: (MassLynx , RRID:SCR_014271)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.08.443267: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The protocols were approved by the Institutional Animal Care and Use Committee at the Washington University School of Medicine (Assurance number A3381-01).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Female BALB/c (catalog 000651) and K18-hACE2 C57BL/6 (catalog 034860) mice were purchased from The Jackson Laboratory.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed then sequentially incubated with an oligoclonal pool of SARS2-2, SARS2-11, SARS2-16, SARS2-31, SARS2-38, SARS2-57, and SARS2-71 62 anti-S antibodies and HRP-conjugated goat anti-mouse IgG (Sigma, 12-349) in PBS supplemented with 0.1% saponin and 0.1% bovine serum albumin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS2-57</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS2-71</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>62</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Isotype analysis was perfomed by incubating the immune complexes with secondary goat anti-mouse-PE antibody (IgG1 1070-09, IgG2a 1080-09S, IgG2b 1090-09S, IgG3 1100-09, IgM 1020-09, IgA 1040-09 Southern Biotech) for each isotype.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse-PE</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody-dependent neutrophil or cellular phagocytosis: Antibody-dependent neutrophil phagocytosis (ADNP) and cellular phagocytosis (ADCP) assays were conducted as described previously 66, 67, 68.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antibody-dependent neutrophil phagocytosis ( ADNP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viruses and cells: Vero E6 (CRL-1586, American Type Culture Collection (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero-TMPRSS2 cells also were supplemented with 5 μg/mL of blasticidin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-TMPRSS2</div><div>suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus was passaged once in Vero CCL-81 cells and titrated by focus-forming assay (FFA) on Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero CCL-81</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The rescued replication-incompetent ChAd-SARS-CoV-2-S and ChAd-Control vectors were scaled up in HEK293 cells and purified by CsCl density-gradient ultracentrifugation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus-serum mixtures were added to Vero cell monolayers in 96-well plates and incubated for 1 h at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Female BALB/c (catalog 000651) and K18-hACE2 C57BL/6 (catalog 034860) mice were purchased from The Jackson Laboratory.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_JAX:000651)</div></div><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">K18-hACE2 mice were challenged on indicated days after immunization with 104 FFU of SARS-CoV-2 (WA1/2020, Wash-B.1.351, or Wash-B.1.1.28) via IN route.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, prefusion-stabilized S 64 and RBD were cloned into a pCAGGS mammalian expression vector with a hexahistidine tag and transiently transfected into Expi293F cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_18926)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were incubated at room temperature for 1 h, washed thrice in PBST, and then 100 µL of 1-Step Ultra TMB-ELISA was added (ThermoFisher Cat. #34028).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher Cat.</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical significance was assigned when P values were < 0.05 using Prism Version 8 (GraphPad) or Jupyter Notebook 6.1.4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      Limitations of study: Although a single intranasal administration of ChAd-SARS-CoV-2-S durably protected against SARS-CoV-2 variant replication in the upper and lower respiratory tract even ∼9 months after immunization, we note several limitations in our study. (1) We performed challenge studies in BALB/c mice transduced with hACE2 or C57BL/6 mice expressing an hACE2 transgene. Durability and protection studies will need to be corroborated in hamsters, non-human primates, and ultimately in humans. (2) Although our studies suggest that the mucosal immunity induced by intranasal vaccination could limit SARS-CoV-2 transmission, the use of mice precluded formal respiratory transmission analysis, which is better studied in hamsters and ferrets 46. (3) We observed robust protection in vivo against viruses displaying B.1.351 and B.1.1.28 spike proteins likely due to the high serum neutralizing antibody titers. Even though neutralizing antibody levels were lower with the variant strains due to mutations at sites in the receptor binding motif, the high starting level against the historical SARS-CoV-2 likely provided a sufficient cushion to overcome this loss in potency. Studies in other animals or with even lower doses of vaccine where neutralizing titers might be lower are needed to determine if the protective phenotype against variants of concern is maintained. (4) Finally, we did not establish the correlate of protection in these studies, as passive antibody transfer or T cell depl...

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04751682</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety and Immunogenicity of an Intranasal SARS-CoV-2 Vaccin…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.04.441029: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All animal experiments were performed with the approval of the Academia Sinica Institutional Animal Care and Utilization Committee (IACUC Protocol No. 12-08-391) and in strict accordance with its guidelines and those of the Council of Agriculture Guidebook for the Care and Use of Laboratory Animals.<br>Euthanasia Agents: Surviving mice after viral challenge were euthanized using carbon dioxide.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Plasmid constructions: Generation of hACE2 transgenic mice: For mice production, we super-ovulated 3-4 week-old C57BL/6J female mice with 3.75-5 i.u. of pregnant mare serum gonadotropin (PMSG, Sigma-Aldrich G4877), followed 46-h later by 3.75-5 i.u. of human chorionic gonadotropin (hCG, Sigma-Aldrich CG1063).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">All recordings and analyses were conducted blind to the experiential conditions (i.e., HA tag or Spike protein expression).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies and respective dilutions are as follows: hACE2 (Abcam ab108209, 1:2500); HA (Cell Signaling #3725, 1:1000); and HSP90 (provided by Dr. Chung Wang, 1:5000) [16].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HSP90</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following commercial antibodies were used as primary antibodies for immunostaining: rabbit anti-ACE2 (Abcam, ab108209); mouse anti-HA (Abcam, ab130275); and rabbit anti-HA (Cell Signaling, 3742).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neuronal cultures were then fixed for immunofluorescence staining as described previously [18, 19] using the following primary antibodies: rabbit anti-ACE2 (Abcam, ab108209); mouse anti-HA (Abcam, ab130275); rabbit anti-HA (Cell Signaling, 3742); mouse anti-MAP2 (Sigma,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-MAP2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">M4403); mouse anti-GFAP (Millipore, MAB3402); and rabbit anti-GFP (Invitrogen, A6455).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-GFP</div><div>suggested: (Molecular Probes Cat# A-6455, RRID:AB_221570)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of pseudotyped SARS-CoV-2 lentivirus: The pseudotyped SARS-CoV-2 lentivirus, which carries SARS-CoV-2 Spike protein as viral envelope protein, was generated by transiently transfecting HEK-293T cells with pCMV-ΔR8.91, pLAS2w.EGFP.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmid constructions: Generation of hACE2 transgenic mice: For mice production, we super-ovulated 3-4 week-old C57BL/6J female mice with 3.75-5 i.u. of pregnant mare serum gonadotropin (PMSG, Sigma-Aldrich G4877), followed 46-h later by 3.75-5 i.u. of human chorionic gonadotropin (hCG, Sigma-Aldrich CG1063).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 infection: CAG-hACE2 transgenic or wild-type (WT) mice were anesthetized and intranasally challenged with SARS-CoV-2 TCDC#4 (hCoV-19/Taiwan/4/2020 obtained from Taiwan Centers of Disease Control; lot: IBMS20200819) in a volume of 100 μL of sterile PBS at the indicated plaque-forming units (PFU).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 infection: CAG-hACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of pseudotyped SARS-CoV-2 lentivirus: The pseudotyped SARS-CoV-2 lentivirus, which carries SARS-CoV-2 Spike protein as viral envelope protein, was generated by transiently transfecting HEK-293T cells with pCMV-ΔR8.91, pLAS2w.EGFP.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV-ΔR8.91</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pLAS2w.EGFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Puro and pcDNA3.1-nCoV-SΔ18.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1-nCoV-SΔ18</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting products were scanned on a QX200 Droplet Reader (Bio-Rad Laboratories), and the data was analyzed using QuantaSoft™ software (Bio-Rad Laboratories).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bio-Rad Laboratories</div><div>suggested: (Bio-Rad Laboratories, RRID:SCR_008426)</div></div><div style="margin-bottom:8px"><div>QuantaSoft™</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The images were processed using Photoshop (Adobe) with minimal adjustment of brightness or contrast applied to the entire images.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Photoshop</div><div>suggested: (Adobe Photoshop, RRID:SCR_014199)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analyses were carried out in Excel or GraphPad Prism 8.0 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 20, 21 and 22. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.10.443438: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Immunization of mice and serum samples: Female CB6F1 mice (Charles River Laboratories, Montreal, QC, Canada) (</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Rabbit anti-SARS-CoV-2 Spike (RBD) antibody was commercially sourced (SinoBiological, Cat# 40592-T62).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RBD-specific antibodies from mouse antisera were detected by a horseradish peroxidase-conjugated goat anti-mouse secondary antibody (1:10,000; Cedarlane Laboratories, Burlington, ON, Canada) and peroxidase substrate (KPL, Gaithersburg, Md, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed (3X) with PBS +0.05% Tween20 and bound FLAG-ACE-2 was detected with HRP-conjugated anti-FLAG antibody (1:20,000, Sigma cat# A8592) and peroxidase substrate (KPL, Gaithersburg, Md, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-FLAG</div><div>suggested: (Sigma-Aldrich Cat# A8592, RRID:AB_439702)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T cells and Vero E6 cells (ATCC CRL-1586) were propagated in Dulbecco’s modified Eagle’s medium (Thermo Fisher Scientific) containing 10% heat-inactivated fetal bovine serum (Omega Scientific, Tarzana, CA), and Pen/Strep (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T cells overexpressing ACE-2 (293T ACE-2) were generously provided by Dr. Paul Bieniasz (The Rockefeller University) 31 and cultured in 293T cells media supplemented with 5ug/ml blasticidin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For neutralization assays, 293T ACE-2 cells were plated on poly-lysine-coated 96-well plates one day prior to infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunization of mice and serum samples: Female CB6F1 mice (Charles River Laboratories, Montreal, QC, Canada) (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CB6F1</div><div>suggested: RRID:MGI:5649749)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">protease cleavable C-terminal human monomeric IgG1 Fc tag (mFc) was inserted into the SpeI/ XhoI site of the pTRIP lentiviral vector bearing an IRES-AcGFP reporter 32.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pTRIP</div><div>suggested: RRID:Addgene_127663)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE-2 Expression and Purification: Full length human ACE-2-MycDDK in pCMV-6 entry vector (Origene, cat #RC208442) was expressed in Expi293™ cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV-6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The synthetic DNA fragment (Integrated DNA technologies Inc., Coralville, Iowa) containing corresponding mutations were used to replace the BamHI and AgeI fragment of pSARS-CoV-2Δ19 and confirmed by DNA sequencing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSARS-CoV-2Δ19</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.09.443331: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The research protocol was approved by the Institutional Animal Care and Use Committee of WRAIR.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Each study group was composed of 10 hACE2 K18 Tg mice (5 males and 5 females).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mice were randomly assigned to experimental groups and were not pre-screened or selected based on size or other gross physical characteristics.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the antibodies, plasmids encoding heavy and light chains of antibodies (CR3022, and SR1-SR5) were co-transfected into Expi293F cells (ThermoFisher) according to the manufacturer’s instructions for expression of antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-COV-2 antibodies were immobilized onto AHC biosensors (FortéBio) for 100 seconds, followed by a brief baseline in assay buffer for 15 s.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-COV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody positive (anti-RBD mouse mAb; BEI resources) and negative controls were included on each plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The secondary antibodies were HRP-conjugated AffiniPure Goat Anti-Mouse antibodies from Jackson ImmunoResearch specific for either Fcγ subclass 1, Fcγ subclass 2a, or Fcγ subclass 2c.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Mouse</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Fcγ subclass 1 , Fcγ subclass 2a , or Fcγ subclass 2c .</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infectivity and neutralization titers were determined using ACE2-expressing HEK293 target cells (Integral Molecular) in a semi-automated assay format using robotic liquid handling (Biomek NXp Beckman Coulter).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus was passaged once in Vero CCL81 cells (ATCC) and titrated by focus-forming assay on Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero CCL81</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum-virus mixtures were then added to Vero E6 cells in 96-well plates and incubated for 1 h at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BALB/c and C57BL/6 mice were obtained from Jackson Laboratories (Bar Harbor, ME).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the passive immunization study, on day −1, K18-hACE2 mice were injected intravenously with purified IgG from C57BL/6 vaccinated mice.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The His-tagged SARS-CoV-2 RBD molecule was generated by amplifying the RBD domain from the RBD-Ferritin plasmid while encoding the 3’ purification tag and subcloned into the CMVR vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RBD-Ferritin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 pseudovirions (PSV) were produced by co-transfection of HEK293T/17 cells with a SARS-CoV-2 S plasmid (pcDNA3.4) and an HIV-1 NL4-3 luciferase reporter plasmid (The reagent was obtained through the NIH HIV Reagent Program, Division of AIDS, NIAID,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.4</div><div>suggested: RRID:Addgene_131198)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human Immunodeficiency Virus 1 (HIV-1) NL4-3 ΔEnv Vpr Luciferase Reporter Vector (pNL4-3.Luc.R-E-), ARP-3418, contributed by Dr. Nathaniel Landau and Aaron Diamond).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL4-3.Luc.R-E-</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S-domain ferritin nanoparticle fusions were modelled using Pymol and Coot (Emsley et al., 2010) and expanded using “phenix.apply_ncs” (Liebschner et al., 2019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Visual analysis and figure generation was conducted using ChimeraX and PyMOL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ChimeraX</div><div>suggested: (UCSF ChimeraX, RRID:SCR_015872)</div></div><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Grids were imaged using a FEI T20 operating at 200 kV with an Eagle 4K CCD using SerialEM or using a Thermo Scientific Talos L120C operating at 120 kV with Thermo Scientific Ceta using EPU.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RELION 3.1.1, and/or cisTEM-1.0.0-beta.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RELION</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CTF estimation was done with CTFFIND 4.1.13 and used for 2D classification.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CTFFIND</div><div>suggested: (CTFFIND, RRID:SCR_016732)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Purified research grade nanoparticle immunogens were formulated in PBS with 5% glycerol at 1 mg/ml and subsequently diluted with dPBS (Quality Biological) to provide 10 μg or lower amount per 50 μl dose upon mixing with adjuvant.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Quality Biological</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike-Ferritin nanoparticle immunogens were formulated with ALFQ to contain 20 μg 3D-PHAD and 10 μg QS21 per 50 μl dose.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ALFQ</div><div>suggested: (aLFQ, RRID:SCR_005925)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 pseudovirions (PSV) were produced by co-transfection of HEK293T/17 cells with a SARS-CoV-2 S plasmid (pcDNA3.4) and an HIV-1 NL4-3 luciferase reporter plasmid (The reagent was obtained through the NIH HIV Reagent Program, Division of AIDS, NIAID,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HIV Reagent Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Assay equivalency for SARS-CoV-2 was established by participation in the SARS-CoV-2 Neutralizing Assay Concordance Survey (SNACS) run by the Virology Quality Assurance Program and External Quality Assurance Program Oversite Laboratory (EQAPOL) at the Duke Human Vaccine Institute, sponsored through programs supported by the National Institute of Allergy and Infectious Diseases, Division of AIDS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Quality Assurance Program</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Quality Assurance Program Oversite Laboratory</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization curves were generated using Prism software (GraphPad Prism 8.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT03186781</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Influenza HA Ferritin Vaccine, Alone or in Prime-Boost Regim…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT03814720</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Dose, Safety, Tolerability and Immunogenicity of an Influenz…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04579250</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Dose, Safety, Tolerability and Immunogenicity of an Influenz…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04645147</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Safety and Immunogenicity of an Epstein-Barr Virus (EBV) gp3…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04296279</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Trial For The Study of Falciparum Malaria Protein 014 Admi…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04784767</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">SARS-COV-2-Spike-Ferritin-Nanoparticle (SpFN) Vaccine With A…</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.06.442911: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: (24) Animal Studies: All animal work was performed in accordance with protocols approved by the Lawrence Livermore National Laboratory Institutional Animal Care and Use Committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Groups of male and female K18-hACE2 C57BL/6J transgenic mice (Jackson Laboratory) ranging in age from 12-16 weeks were inoculated intranasally with 2.5×104 PFU SARS-2 (USA-WA 01/2020) while under anesthesia (4-5% isoflurane in 100% oxygen).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2-huFc, ACE2-rbFc, and VHH-huFc antibodies were produced by transient expression in CHO-S cells using the ExpiCHO expression system.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VHH-huFc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A high diversity library was designed by incorporating the natural prevalence of amino acids at positions in CDR1 and CDR2 based off 670 functional VHH antibodies deposited on sdAb-DB (www.sdab-db.ca).(15) Amino acids cysteine and methionine were omitted from all CDR loops and full diversity was used for CDR3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CDR2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CDR3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibody, goat anti-human H+L IgG HRP (Thermo) was added for an additional hour before washing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human H+L IgG HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-2-NG, VSV-SARS-2-GFP, or VSV-SARS-1-GFP was added to the serially diluted VHH-huFc antibodies for a final multiplicity of infection (MOI) of 0.2 (RG 2) or 0.1 (RG 3) and allowed to incubate at 37°C for 30 minutes to 1 hour with shaking prior to transfer of virus-VHH-huFc mixture to cells seeded in 96 (RG 3) or 384 well plates (RG 2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VSV-SARS-2-GFP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Expi293 cells were subsequently infected with VSV-DG-GFP, itself pseudotyped with VSV-G, at 72 h post-transfection using a multiplicity of infection (MOI) of 3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VHH-huFc-virus complexes were incubated with Vero cells at 37°C with 5% CO2 for 12-16 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After a 30-minute incubation of VHH-huFc-virus complexes with Vero E6 cells at 37°C with 5% CO2, overlays of 2 mL per well of 0.6% microcrystalline cellulose (MCC, Sigma 435244), in 8% FBS, 1% P/S complemented 2X MEM were added.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Groups of male and female K18-hACE2 C57BL/6J transgenic mice (Jackson Laboratory) ranging in age from 12-16 weeks were inoculated intranasally with 2.5×104 PFU SARS-2 (USA-WA 01/2020) while under anesthesia (4-5% isoflurane in 100% oxygen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DNA Manipulation and Production of Proteins: pSF-CMV-SARS-2-S was constructed as follows.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSF-CMV-SARS-2-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pSF-SARS-2-RBD was produced by commercial production of double stranded DNA encoding a N-terminal Kozak, a signal peptide (MDWTWRFLFVVAAATGVQS), 319-577 of the SARS-2 S gene (GenBank:MN908947.3), a TEV site, and a C-terminal, decahistadine tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSF-SARS-2-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All DNA fragments and pSF-CMV vector restriction digested with EcoRI and BamHI were assembled using NEBuilder HiFi DNA master.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSF-CMV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pAce2-huFc was produced by subcloning the ectodomain on human ACE2 (Sino Biological) into pCR-Fc using the NotI and BamHI restriction sites.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCR-Fc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To produce Ace2-rbFc (rabbit Fc domain), a gBlock (IDT) of this same region of Ace2 was subcloned into pFUSE rIgG-Fc2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pFUSE</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The minimum region containing all 3 CDR domains, approximately 300 bps, was excised from the pADL20c backbone by two-step restriction digests, BglI followed by DdeI/BstEII double digests on the gel-purified small fragment from the BglI restriction reaction.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pADL20c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Diversity of the nanobody library was determined by both NGS and colony PCR.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NGS</div><div>suggested: (PM4NGS, RRID:SCR_019164)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BCL files were converted to FASTQ and demutiplexed using the bcl2fastq script from MyIllumina (https://my.illumina.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>bcl2fastq</div><div>suggested: (bcl2fastq , RRID:SCR_015058)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The quality filtering and adaptor trimming were performed using fastp (https://github.com/OpenGene/fastp) with following parameters, -q 30 -l 100 -x 7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://github.com/OpenGene/fastp</div><div>suggested: (fastp, RRID:SCR_016962)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">R2read was reformatted to be reverse complemented and merged with R1 read using BBTools (BBMap, https://sourceforge.net/projects/bbmap/).(17) Three CDR domains with correct sequence lengths were extracted, concatenated and translated and counted unique amino acid sequences using a custom python script.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BBMap</div><div>suggested: (BBmap, RRID:SCR_016965)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The dose response curves and 50% effective inhibitory concentrations (EC50) were generated using Graphpad Prism 9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The filtered reads were mapped to Spike protein coding region of the SARS-2 Wuhan Hu-1 isolate (GenBank:MN908947.3) using Bowtie 2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bowtie</div><div>suggested: (Bowtie, RRID:SCR_005476)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Kaplan-Meier survival curves were generated based on two independent experiments and log rank tests were performed with Bonferroni multiple comparison correction applied (GraphPad Prism).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
      While vaccines have been great successes, therapeutic biologics are emerging as a critical tool in preventing progression to severe disease in those who do become infected.(31) Several therapeutic antibody candidates with efficacy against SARS-2 have been recently identified, including three with emergency use authorization, but there are a number of caveats associated with conventional antibodies as therapeutics such as time-consuming discovery, relying on immunized or patient sera, expensive and labor-intensive production, and the large doses required to achieve clinical efficacy. (9, 22, 32-34) High stability, solubility, and the ability to be multimerized, are just some of the many reasons why single-domain heavy chain-based antibody therapeutics (VHH-Fc) represent a highly promising method for treatment.(12) One VHH-based therapeutic is already approved by the FDA for treatment of a rare blood clotting disorder and many more are in late stage clinical trials.(12, 35) The small size of VHH antibodies and the wider distribution of CDR3 loop lengths compared to human IgGs expands the type of epitope which can be effectively targeted.(12) Finally, preliminary evidence suggests that VHH-Fc antibodies are transported more efficiently into the blood and lung parenchyma following intraperitoneal administration compared to conventional IgG1 antibodies.(36, 37) Several groups have recently used in vitro screening techniques to identify VHH domains with high affinity for the SARS-2...

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. Printed in black on neckband and tail. The shape,

      The brand name on the tag, ignoring the people who made these by hand

    2. Printed in black on neckband and tail. The shape,

      Is he talking about the name on the tag of the shirt?

    1. However, the novelty wears off quickly and the whole thing soon becomes a slog — the career mode could be cut in half and the experience would be better for it.

      less is more/better

    1. SciScore for 10.1101/2021.05.04.21256571: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: SNBTS blood donors gave fully informed consent to virological testing, donation was made under the SNBTS Blood Establishment Authorisation and the study was approved by the SNBTS Research and Sample Governance Committee IRAS project number 18005.<br>IRB: Ethical approval was given by the South Central - Oxford C Research Ethics Committee in England (Ref: 13/SC/0149) and by the Scotland A Research Ethics Committee (Ref: 20/SS/0028).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">Researchers working with the samples in the laboratory were blinded to the clinical outcomes of the ICU patients during testing.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Enzyme-linked immunosorbent assay: SARS-CoV-2 spike, RBD as well as HCoV-229E, HCoV-NL63, HCoV-HKU1 and HCoV-OC43 spike IgG antibody responses were measured using ELISAs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-OC43 spike IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibody rabbit anti-human whole IgG conjugated to alkaline phosphatase (Sigma, USA) was added at a dilution of 1:1000 in casein–PBS solution and incubated for 1 hour at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Secondary antibody rabbit anti-human whole IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human whole IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein sequences used in ELISAs: MSD V-PLEX assay: IgG antibody responses to SARS-CoV-2 spike, RBD, NTD and nucleocapsid and the spike proteins of SARS-CoV-1, HCoV-229E, HCoV-NL63, HCoV-HKU1 and HCoV-OC43 were assessed using the Meso Scale Diagnostics (MSD) Multi-Spot Assay System (MSD, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-NL63</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HCoV-HKU1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A 1x working concentration of the SULFO-TAG anti-human IgG Detection Antibody was prepared in Diluent 100.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (RevMAb Biosciences Cat# 31-1019-MK, RRID:AB_2783627)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MSD ACE2 competition assay: The ability of antibodies present in serum/plasma to inhibit the binding of angiotensin-converting enzyme 2 (ACE2) to the SARS-CoV full-length spike proteins and RBD domains was assessed using the COVID-19 ACE2 competition assay (MSD, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Enzyme-linked immunosorbent assay: SARS-CoV-2 spike, RBD as well as HCoV-229E, HCoV-NL63, HCoV-HKU1 and HCoV-OC43 spike IgG antibody responses were measured using ELISAs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-NL63</div><div>suggested: RRID:CVCL_RW88)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HCoV-229E, HCoV-NL63, HCoV-HKU1 and HCoV-OC43 spike antigens were bought from Sino Biological, China.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-229E</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">ISRCTN51287266</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr></table>


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.05.04.21256472: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This includes the immunoreceptor used in the assay which is SARS-CoV-2 Spike Glycoprotein (S1) terminally tagged with a predominantly monomeric Sheep Fc-Tag (produced in HEK293 cells) and subsequently conjugated with electrochemically active Horseradish Peroxidase (HRP); Antibodies for spiking experiments, namely the Human recombinant monoclonal IgM Anti-SARS-CoV-2 Spike (S1) Antibody and Human recombinant monoclonal IgG1 Anti-SARS-CoV-2 Spike (S1) Antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This includes the immunoreceptor used in the assay which is SARS-CoV-2 Spike Glycoprotein (S1) terminally tagged with a predominantly monomeric Sheep Fc-Tag (produced in HEK293 cells) and subsequently conjugated with electrochemically active Horseradish Peroxidase (HRP); Antibodies for spiking experiments, namely the Human recombinant monoclonal IgM Anti-SARS-CoV-2 Spike (S1) Antibody and Human recombinant monoclonal IgG1 Anti-SARS-CoV-2 Spike (S1) Antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The standard bare carbon screen printed electrodes were contract manufactured by GSI Technologies, USA as per the designs provided by PathShodh Healthcare Pvt. Ltd.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PathShodh Healthcare</div><div>suggested: None</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • No funding statement was detected.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. Author Response:

      Reviewer #1:

      In this manuscript the authors show that a designer exon containing a Fluorescent Protein insert can be used to edit vertebrate genes using an NHEJ based repair mechanism. The approach utilizes CRISPR to generate DSBs in intronic sequences of a target gene along with excision of a donor fragment from a co-transfected plasmid to initiate insertion of the exon cassette by ligation into the chromosome DSB.

      I like the idea here of inserting FP sequences (and other tags) into introns in this way. Focusing on the N- and C-termini for insertions has always seemed arbitrary to me. In practice these internal sites may even tolerate tag insertions better than the termini. However, this remains to be seen.

      My major reservation with this study is that the concepts here are not particularly novel. The approach is very similar to a concept already well established in gene-therapy circles of using introns as targets for inserting a super-exon preceded by a splice acceptor to correct inborn genetic lesions. The methodology employed is essentially HITI (https://www.nature.com/articles/nature20565).

      What is new is the finding that FP insertions are frequently expressed and at least partly functional as evidenced by their ability to localize to the expected intracellular structures. However, no actual functional data is provided in this study so it remains to be seen how frequently the insertion of FP exons is tolerated. It would help the study substantilly to have functional information for a few insertions.

      The value and utility of this study hinges on whether insertions of this type frequently retain function. The authors speculate that "labeling at an internal site of a gene is feasible as long as the insertion does not disrupt the function of the encoded protein. Many introns reside at the junctions of functional domains because introns have evolved in part to facilitate functional domain exchanges (Kaessmann et al., 2002; Patthy, 1999)." Thus an analysis of how often intron tags are tolerated as homozygotes would be helpful for users who will worry that a potentially "quick and dirty" CRISPIE insertion might not accurately report on the function and localization of their protein of interest.

      We thank the reviewer for appreciating our idea. CRISPIE is indeed improved HITI, with the notable difference that the insertion takes place at the intronic region and that a designer intron/exon module is used. This design has a significant benefit in that INDELs in both labeled and unlabeled alleles will be unlikely to cause mutations at the levels of mRNA and proteins. CRISPIE is also different from the super-exon, which is now cited (Bednarski et al, 2016). CRISPIE does not involve the 3’ UTR and the poly A signal. This makes the donor template more standardized and smaller. Transcriptional controls embedded in endogenous introns after the editing sites can be retained in CRISPIE, but not when super-exons are used. We also achieve much higher efficiency in vivo than previous editing methods, which we feel is an important advance.

      We now provide three different experiments to address the function of CRISPIEd β-actin and, in one experiment, the function of CRISPIEd α-tubulin 1B. One of the key functions of the cytoskeleton is to support growth. We now show that neither CRISPIE labeling of β-actin (hACTB), at two different intronic loci, and nor CRISPIE labeling of α-tubulin 1B (TUBA1B) affect the growth of U2OS cells (New Experiment #1; Figure 1H, and Figure 1-figure supplement 4), suggesting that labeled β-actin and α-tubulin are functional. In addition, as suggested, we now demonstrate that cells homozygous for CRISPIE insertions are viable and able to divide (New Experiment #2; Figure 4-figure supplement 1). We also show that two important neuronal functional parameters – the mEPSC frequency and amplitude – are not altered by CRISPIE labeling of hACTB in neurons in cultured hippocampal slices. (New Experiment #3; Figure 5– figure supplement 2).

      Having shown the above results, we also hope to emphasize that, although CRISPIE provides a way to perform FP tagging of endogenous protein with high efficiency and low error rates, it cannot ensure that FP-tagging itself is benign for all proteins. Numerous studies have overexpressed FP-tagged proteins, which is well documented to have side effects. The CRISPIE method empowers researchers by allowing them to tag endogenous proteins without overexpression. However, if the FP-tagging itself affects protein function, CRISPIE will not be helpful. Each FP-tagging project, whether it is based on CRISPIE or other methods, will requires its own systematic characterization. We have now made this clear in the discussion (pg. 17): “… although CRISPIE enables the tagging of endogenous proteins with low error rates, it does not ensure that the tagged protein functions the same as the wild-type protein. Not all tagging is benign, and rigorous characterizations will be needed for each tagging experiment.”

      Other comments:

      1) Were homozygotes identified and were they viable in each instance?

      We now provide data showing that cells homozygous for CRISPIE insertions are viable and able to divide (New Experiment #2; Figure 4-figure supplement 1).

      2) You say: "The CRISPIE method should be broadly applicable for use with different FPs or with other functional domains, different protein targets, and different animal species." I don't know if you optimized your FP to avoid potential reverse strand splice acceptors, but some discussion of this important point should be made so that those trying to apply the approach will make sure that strong acceptors are not included accidentally in reverse oriented inserts.

      Our RT-PCR does not detect reversed inserts at the mRNA level. We now add in the Discussion that donor design needs to eliminate unintended splicing sites in the reverse orientation. We write (pg. 17): “It should also be noted that, when designing the donor template, care should be given to not create unintended splicing acceptor sites in the inverted orientation. Otherwise, inverted insertion events can cause mutations at the mRNA and protein levels.”

      3) Would your mRNA sequencing methodologies detect defective transcripts where the splice acceptor and a portion of the upstream FP exon was inserted causing a frame shifted and mispliced mRNA? Such mRNAs would be unstable due to NMD and thus not detected readily in a PCR based approach. Thus disruption of the mRNA by partial insertion of your donor (or fragments of the other co-injected DNA) might be much more widespread than is measured here. This could be tested by recovering clones that partially inserted the donor in the forward orientation and carefully monitoring for defects in mRNA splicing of the inserted allele. Were such clones detected and how frequently?

      Our method should detect defective mRNAs, if they are not degraded. However, if defective mRNAs are quickly degraded, they are not measured in our current RT-PCR and NGS experiments, as described in Figure 2. While we cannot address this question directly, we now provide evidence that the cell growth and neuronal function after CRISPIE labeling of β-actin remain normal.

      We also thank the reviewer for suggesting the cloning approach. This proposed experiment, however, may potentially be affected if potential defective mRNAs can result in decreased cell survival/growth. Although this experiment will require time beyond the three-month revision period expected by eLife due to the length of time required to clone cells, we will keep this in mind in our future efforts.

      4) You note that in the case of vinculin the coding sequence of the last exon of hVCL was included in the insertion donor sequence, and a stop codon was introduced at the end of the mEGFP coding sequence. This is essentially the strategy for super-exon insertion into targets for gene therapy, instead of a splice donor on the C-terminus you include a stop codon. You should site these previous studies. Inclusion of a stop codon in frame would be expected to cause NMD, did you also include transcription termination signals?

      NMD will happen if the stop codon is further than about approximately 50 nucleotides upstream of any exon-junction complexes (Lewis et al, PNAS 2009). However, NMD won’t occur if it is within 50 nucleotides. For example, synaptophysin – a highly expressed neuronal protein – has its stop codon at its second to last exon within 50 nucleotides of the exon junction. The stop codon we used for labeling hVCL is also within 50 nucleotides (~20 nt) of the exon junction.

      We now cite Bernarski et al, 2016, which describes the use of super-exons in gene therapy. At the same time, we think that our approach is still different from the super-exon concept. After the stop codon, the 3’ UTR is not included. Instead, a splicing donor is included, allowing the exon to be spliced to the subsequent endogenous exon. This allows the insert to remain small for high insertion efficiency and makes it easy to produce the template (some 3’ UTRs can be several kilobase pairs in length), while utilizing the endogenous translational controls built into the native 3’ UTR.

      Reviewer #2:

      In-frame insertion of fluorescent protein tags into endogenous genes allows observation of protein localization at native expression levels, and is therefore an essential approach for quantitative cell biology. Once limited to unicellular model organisms such as yeast, endogenous gene tagging has become well-established in invertebrate model systems such as C. elegans and Drosophila since the advent of CRISPR technology in the last decade. However, a robust and widely accepted endogenous gene tagging strategy for mammalian cells has remained elusive. This is largely due to the fact that homologous recombination, the method used to create knock-ins in invertebrates, is inefficient (or sometimes doesn't work at all) in mammalian cells, especially those that do not divide rapidly.

      Several studies have attempted to bypass the need for homologous recombination by using a different method, non-homologous end joining (NHEJ) to insert GFP tags into vertebrate genomes (e.g. Auer et al. Genome Res 2014; Suzuki et al. Nature 2016; Artegiani et al. Nature Cell Biol. 2020). Such approaches can be orders of magnitude more efficient than homologous recombination, but the generated alleles require careful validation because of the error-prone nature of NHEJ.

      Here, Zhong and colleagues improve upon the existing NHEJ-based gene tagging approaches by designing synthetic exons (comprising a FP coding sequence with 5' and 3' splice sites) that can be inserted into native introns using NHEJ. The beauty of this approach is that any mutations (indels) created by the error-prone NHEJ repair mechanism are spliced out, and therefore do not affect the sequence of the encoded protein. A limitation is that tags must be inserted internally within a protein of interest and cannot be targeted to the extreme N- or C-terminus, but this limitation is clearly stated and discussed by the authors. Overall, this is a novel (to my knowledge) and powerful strategy that is likely to advance the field.

      We thank the reviewer for the very positive comments regarding our CRISPIE method.

    2. Reviewer #1 (Public Review):

      In this manuscript the authors show that a designer exon containing a Fluorescent Protein insert can be used to edit vertebrate genes using an NHEJ based repair mechanism. The approach utilizes CRISPR to generate DSBs in intronic sequences of a target gene along with excision of a donor fragment from a co-transfected plasmid to initiate insertion of the exon cassette by ligation into the chromosome DSB.

      I like the idea here of inserting FP sequences (and other tags) into introns in this way. Focusing on the N- and C-termini for insertions has always seemed arbitrary to me. In practice these internal sites may even tolerate tag insertions better than the termini. However, this remains to be seen.

      My major reservation with this study is that the concepts here are not particularly novel. The approach is very similar to a concept already well established in gene-therapy circles of using introns as targets for inserting a super-exon preceded by a splice acceptor to correct inborn genetic lesions. The methodology employed is essentially HITI (https://www.nature.com/articles/nature20565).

      What is new is the finding that FP insertions are frequently expressed and at least partly functional as evidenced by their ability to localize to the expected intracellular structures. However, no actual functional data is provided in this study so it remains to be seen how frequently the insertion of FP exons is tolerated. It would help the study substantilly to have functional information for a few insertions.

      The value and utility of this study hinges on whether insertions of this type frequently retain function. The authors speculate that "labeling at an internal site of a gene is feasible as long as the insertion does not disrupt the function of the encoded protein. Many introns reside at the junctions of functional domains because introns have evolved in part to facilitate functional domain exchanges (Kaessmann et al., 2002; Patthy, 1999)." Thus an analysis of how often intron tags are tolerated as homozygotes would be helpful for users who will worry that a potentially "quick and dirty" CRISPIE insertion might not accurately report on the function and localization of their protein of interest.

      Other comments:

      1) Were homozygotes identified and were they viable in each instance?

      2) You say: "The CRISPIE method should be broadly applicable for use with different FPs or with other functional domains, different protein targets, and different animal species." I don't know if you optimized your FP to avoid potential reverse strand splice acceptors, but some discussion of this important point should be made so that those trying to apply the approach will make sure that strong acceptors are not included accidentally in reverse oriented inserts.

      3) Would your mRNA sequencing methodologies detect defective transcripts where the splice acceptor and a portion of the upstream FP exon was inserted causing a frame shifted and mispliced mRNA? Such mRNAs would be unstable due to NMD and thus not detected readily in a PCR based approach. Thus disruption of the mRNA by partial insertion of your donor (or fragments of the other co-injected DNA) might be much more widespread than is measured here. This could be tested by recovering clones that partially inserted the donor in the forward orientation and carefully monitoring for defects in mRNA splicing of the inserted allele. Were such clones detected and how frequently?

      4) You note that in the case of vinculin the coding sequence of the last exon of hVCL was included in the insertion donor sequence, and a stop codon was introduced at the end of the mEGFP coding sequence. This is essentially the strategy for super-exon insertion into targets for gene therapy, instead of a splice donor on the C-terminus you include a stop codon. You should site these previous studies. Inclusion of a stop codon in frame would be expected to cause NMD, did you also include transcription termination signals?

    1. SciScore for 10.1101/2021.05.02.442326: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The studies were approved by the Institutional Review Board of Vanderbilt University Medical Center.<br>IACUC: The protocols were approved by the Institutional Animal Care and Use Committee at the Washington University School of Medicine (assurance number A3381–01).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">We studied one patient (a 59-year-old male) who received Pfizer-BioNTech vaccine.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Mycoplasma testing of cell lines was performed on monthly basis using a PCR-based mycoplasma detection kit (ATCC, 30-1012K), with negative results at each testing.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound antibodies were detected using goat anti-human IgG conjugated with horseradish peroxidase and TMB substrate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody binding was detected with anti-IgG Alexa-Fluor-647-labelled secondary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IgG Alexa-Fluor-647-labelled secondary antibodies.</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2 binding was detected using HRP-conjugated anti-FLAG antibodies and developed with TMB substrate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-FLAG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary J2 anti-dsRNA (Scicons #10010500) antibody solution at a 1:1,000 dilution was placed on the cells overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-dsRNA</div><div>suggested: (SCICONS Cat# 10010200, RRID:AB_2651015)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed with 0.1% Tween-20/PBS (PBST) three times and plates were incubated with secondary goat anti-mouse Alexa-Fluor-546-labeled antibody at 1:1,000 dilution (Thermo Fisher Scientific) for 2 h at room temperature in the dark.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Enriched cells were stained 30 min on ice in a RoboSep buffer (StemCell Technologies) containing following phenotyping antibodies; anti-CD19-FITC (1:20 dilution, eBioscience), anti-CD27-APC (1:20 dilution), and anti-CD38-PE (1:25 dilution, BD Biosciences), and then analyzed by flow cytometry using an SH800 cell sorter (Sony).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD19-FITC</div><div>suggested: (Millipore Cat# FCMAB218F, RRID:AB_10919255)</div></div><div style="margin-bottom:8px"><div>anti-CD27-APC</div><div>suggested: (Sigma-Aldrich Cat# SAB4700132, RRID:AB_10896618)</div></div><div style="margin-bottom:8px"><div>anti-CD38-PE</div><div>suggested: (Sigma-Aldrich Cat# P6722, RRID:AB_261136)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISpot assay: Direct enzyme-linked immunosorbent spot (ELISpot) assay was performed to enumerate plasmablasts present in the PBMC samples secreting IgG, IgM, or IgA antibodies reacting with either SARS-CoV-2-S6Pecto protein or influenza A/Darwin/42/2020 H1N1 hemagglutinin protein (as a negative control).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>H1N1 hemagglutinin protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed with PBS and then PBS containing 0.05% Tween, and then incubated with either goat anti-human IgG-HRP conjugated antibodies (Southern Biotech), goat anti-human IgA-HRP conjugated antibodies (Southern Biotech), or goat anti-human IgM-HRP conjugated antibodies (Southern Biotech) for 2 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG-HRP</div><div>suggested: (SouthernBiotech Cat# 2040-05, RRID:AB_2795644)</div></div><div style="margin-bottom:8px"><div>anti-human IgM-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed with PBS and then PBS containing 0.05% Tween, and then incubated with either goat anti-human IgG-HRP conjugated antibodies (Southern Biotech, catalog no. 2040-05), goat anti-human IgA-HRP conjugated antibodies (Southern Biotech, catalog no. 2050-05), or goat anti-human IgM-HRP conjugated antibodies (Southern Biotech, catalog no. 2020-05) for 2 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgA-HRP</div><div>suggested: (SouthernBiotech Cat# 2050-05, RRID:AB_2687526)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: Vero E6 (ATCC, CRL-1586) cells were maintained at 37°C in 5% CO2 in Dulbecco’s minimal essential medium (DMEM) containing 10% heat inactivated fetal bovine serum (FBS), 10 mM HEPES pH 73, 1 mM sodium pyruvate, 1× non-essential amino acids, and 100 U/mL of penicillin-streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Calu-3 (ATCC, HTB-55) cells were maintained at 37°C in 5% CO2 in DMEM with high glucose and L-glutamine (Gibco 11965092), containing 10% heat inactivated fetal bovine serum (FBS), and 100 U/mL of penicillin-streptomycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: ATCC Cat# HTB-55, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infectious stocks were propagated by inoculating Vero CCL81 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero CCL81</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell-surface antigen-display assay: Vero cell monolayers were monitored until 80% confluent and then inoculated with VSV-SARS-CoV-2 V (WA1/2020 strain) at an MOI of 0.5 in culture medium (DMEM with 2% FBS).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A plasmid encoding cDNA for each S protein mutant was transfected into HEK-293T cells and allowed to express for 22 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Heterozygous K18-hACE c57BL/6J mice (strain: 2B6.Cg-Tg(K18-ACE2)2Prlmn/J) were obtained from The Jackson Laboratory.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE c57BL/6J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Heat map generation: All sequences that were identified to be public clonotypes were analyzed with PyIR66 to identify the V and J genes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyIR66</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These frequency counts then were plotted onto the heatmap using Python Seaborn Library.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expressed protein was incubated with BioLock (IBA Lifesciences) and then isolated by Strep-tag affinity chromatography on StrepTrap HP columns (GE Healthcare), followed by size-exclusion chromatography on TSKgel G4000SWXL (TOSOH) if needed.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioLock</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, a TaqMan assay was designed to target a highly conserved region of the N gene (forward primer: ATGCTGCAATCGTGCTACAA; Reverse primer:m GACTGCCGCCTCTGCTC; Probe: /56-FAM/TCAAGGAAC/ZEN/AACATTGCCAA/3IABkFQ/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GACTGCCGCCTCTGCTC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Probe</div><div>suggested: (UniPROBE, RRID:SCR_005803)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image processing was performed using the cryoSPARC software package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Enriched cells were stained 30 min on ice in a RoboSep buffer (StemCell Technologies) containing following phenotyping antibodies; anti-CD19-FITC (1:20 dilution, eBioscience), anti-CD27-APC (1:20 dilution), and anti-CD38-PE (1:25 dilution, BD Biosciences), and then analyzed by flow cytometry using an SH800 cell sorter (Sony).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Biosciences</div><div>suggested: (BD Biosciences, RRID:SCR_013311)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Amplicons were sequenced on an Illumina Novaseq 6000, and data were processed using the CellRanger software v3.1.0 (10X Genomics).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CellRanger</div><div>suggested: (SCIGA, RRID:SCR_021002)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using Prism v8.4.3 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.30.21256060: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Field Sample Permit: The number of replicates carried out for each experiment is described in the figure/table legends.<br>IRB: Sample acquisition from COVID-19 patients: The Ethics Committee of Huoshenshan Hospital approved the study (HSSLL036).<br>Consent: Given the urgency of the COVID-19 pandemic, the need for informed consent forms was waived by the ethics boards of the hospitals.<br>IACUC: All animal experiments were performed at the AMMS Animal Center (Beijing, China) and were approved by the Institutional Animal Care and Use Committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">decompensated chronic renal insufficiency, or severe congestive heart failure), were pregnant or had malignancy (Table 1).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Fasting blood glucose and random blood glucose levels were measured weekly.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cell lines tested for mycoplasma contamination were incubated in DMEM at 37°C in a humidified atmosphere with 5% CO2.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies: Anti-α-tubulin (T6074, 1:5,000 dilution) and anti-Flag (A8592, 1:5,000 dilution) antibodies were purchased from Sigma-Aldrich (Missouri, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-α-tubulin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>T6074</div><div>suggested: (Sigma-Aldrich Cat# T6074, RRID:AB_477582)</div></div><div style="margin-bottom:8px"><div>anti-Flag</div><div>suggested: (Sigma-Aldrich Cat# A8592, RRID:AB_439702)</div></div><div style="margin-bottom:8px"><div>A8592</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">dilution), anti-insulin (ab6995, 1:200 dilution), anti-CREB-phospho S133 (ab32096, 1:1000 dilution), and anti-CREB (ab32515, 1:1000 dilution) antibodies were purchased from Abcam (Illinois, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-insulin</div><div>suggested: (Abcam Cat# ab6995, RRID:AB_305690)</div></div><div style="margin-bottom:8px"><div>anti-CREB-phospho</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CREB</div><div>suggested: (Abcam Cat# ab32515, RRID:AB_2292301)</div></div><div style="margin-bottom:8px"><div>ab32515</div><div>suggested: (Abcam Cat# ab32515, RRID:AB_2292301)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An anti-GP73 antibody (F-12, sc-393372, 1:200 dilution) was purchased from Santa Cruz (Texas, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>sc-393372</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">An anti-His antibody (KM8001, 1:1000 dilution) was purchased from Taihua Lekang Biotechnology (Beijing, China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: (LSBio (LifeSpan Cat# LS-C129774-1000, RRID:AB_10832018)</div></div><div style="margin-bottom:8px"><div>KM8001</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">dilution), anti-Akt (9272, 1:1000 dilution), anti-phospho-PKA-C-α (Thr197, 5661, 1:1000 dilution), anti-phospho-PKA substrate (RRXpS/T, 9624, 1:1000 dilution), and anti-PKA-C-α (5842, 1:1000 dilution) antibodies were purchased from Cell Signaling Technology (Danvers, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-phospho-PKA substrate ( RRXpS/T , 9624</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-PKA-C-α ( 5842</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-rabbit HRP-IgG (ZB-2301, 1:5000 dilution) and anti-mouse HRP-IgG (ZB-2305, 1:5000 dilution) secondary antibodies were purchased from ZSGB-BIO (Beijing, China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-rabbit HRP-IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ZB-2301</div><div>suggested: (ZSGB-Bio Cat# ZB-2301, RRID:AB_2747412)</div></div><div style="margin-bottom:8px"><div>anti-mouse HRP-IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sandwich ELISA and Western blot analysis: For endogenous GP73 sandwich ELISA, two custom-made rat monoclonal anti-GP73 antibodies were used as the capture antibody and the detection antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-GP73</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The HepG2 (CRL-10741), Vero E6 (CRL-1568), HK-2 (CRL-2190), 293T (CRL-3216) and L6 (CRL-1658) cell lines were obtained from the American Type Culture Collection (ATCC, Rockville, MD, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HepG2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To knock out human GP73 in Huh-7 cells, two small guide RNAs (sgRNAs) targeting GP73 were designed and inserted into the LentiCrispr v2 vector to construct transfer plasmids.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T cells were transfected with pMD2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GP73 KO mice (T20200316-18[D25]) were generated by Southern Model Biotechnology (Shanghai, China)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GP73 KO</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Male C57 BLKS/J db/db and BKS control mice (8 weeks, 36-40 g) were purchased from GemPharma Tech Co. Ltd. (Jiangsu, China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57 BLKS/J</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">STZ (40 mg/kg) in citric acid buffer (0.1 mol/L, pH 4.2) was administered to male C57BL/6N mice via intraperitoneal injection, and the same dose of STZ was injected 24 h later.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6N</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids and cell culture: Mammalian expression vectors encoding Flag-tagged human, mouse and rat GP73 were constructed by inserting the corresponding PCR-amplified fragments into pcDNA3 (Invitrogen, Massachusetts, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3</div><div>suggested: RRID:Addgene_15475)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T cells were transfected with pMD2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMD2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">G, psPAX2 and the corresponding transfer plasmid to produce lentivirus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>psPAX2</div><div>suggested: RRID:Addgene_12260)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant GP73 protein purification: Human, mouse, and rat GP73 cDNAs, each with a six-amino-acid His tag on the N-terminus, were cloned into the pCDNA3.1 vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">triglyceride (TG, 200224) and cholesterol (CHO, 200224) biochemical test kits were purchased from Ruierda Biological Technology (Beijing, China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ruierda Biological</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The network was represented using Cytoscape ver 3.6.2 (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Cytoscape</div><div>suggested: (Cytoscape, RRID:SCR_003032)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">https://cytoscape.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://cytoscape.org/</div><div>suggested: (CluePedia Cytoscape plugin, RRID:SCR_015784)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein-protein interactions were retrieved from STRING App (v1.51) (https://string-db.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STRING</div><div>suggested: (STRING, RRID:SCR_005223)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For KEGG and GO enrichment analysis, DAVID Bioinformatics Resources 6.8 (https://david.ncifcrf.gov/home.jsp) was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: The present study used GraphPad Prism 8.0 for statistical calculations and data plotting.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. RRID:AB_256335

      DOI: 10.1016/j.devcel.2020.08.012

      Resource: (BioLegend Cat# 901513, RRID:AB_2565335)

      Curator: @Naa003

      SciCrunch record: RRID:AB_2565335

      Curator comments: Anti-HA.11 Epitope Tag antibody BioLegend Cat# 901513


      What is this?

    1. My name is Floyd Lu, I have been designing and publishing games since 2015 under B&B Games studio. In 2020 B&B Games studio dissolved. I took over a part of the business including this account. I am unable to change the name and URL of my Kickstarter account. I delivered and personally worked on each project that I did and I can't transfer all the followers, therefore, I am still launching new projects under this account.
    1. when HTML5 started, the feedback from the HTML5 guys was pretty clear: HTML5 is there to improve web apps (standards-based flash! yay!), and not to improve HTML as a hypermedia format. http://dret.typepad.com/dretblog/2008/05/xhtml-fragment.html was a very early attempt to raise the issue and was shot down promptly. with HTML5 now branching into so many micro-specs (https://github.com/dret/HTML5-overview), maybe there’s a good chance to simply create a “FragIDs in HTML5” spec and see if there’s any community uptake. it would be great to see this getting started, and maybe IETF with its more open process would be a better place than W3C.
    2. The simple problem that I see with fragment identifiers is that their existence and functionality relies completely on the developer rather than the browser. Yes, the browser needs to read and interpret the identifier and identify the matching fragment. But if the developer doesn’t include any id attributes in the HTML of the page, then there will be no identifiable fragments. Do you see why this is a problem? Whether the developer has coded identifiers into the HTML has nothing to do with whether or not the page actually has fragments. Virtually every web page has fragments. In fact, sectioning content as defined in the HTML5 spec implies as much. Every element on the page that can contain content can theoretically be categorized as a “fragment”.

      at the mercy of author

    1. Making effective use of this mechanism requires either control of the targeted document or generous creators of targeted documents who have liberally applied id attributes throughout a document.

      unlikely for anyone/most people to actually do that

    1. But more so, external style cannot be applied to a subsection of a web page unless they force it into an iframe, which has all sorts of issues of it's own which is why external CSS is usually ignored. Inline CSS is often stripped by the tag strippers who don't want you turning things on or off... and media queries shouldn't even play into it since the layout should be controlled by the page it's being shown inside (for webmail) or the client itself, NOT your mail.
    2. That's something that has been bugging me too. I mean, it's fine if not everything is supported, but if everyone could agree on what is or should be supported then that would make a huge difference. But until then, it's going to be a struggle.
    1. Honestly, even without flexbox support, most of the layout problems would be solved with simple-basic CSS3 support that is standard in all clients.

      layout problems don't need ; all we need is simple-basic CSS3 support that is standard in all clients.

    1. Approaching email development this way transitions more of the quality assurance (QA) process to the browser instead of the email client. It gives email designers more power, control, and confidence in developing an email that will render gracefully across all email clients.

      can mostly test with browser and have less need (but still not no need) to test with email client

    1. They don't look like advertisements. The second the recipient interprets your email as an ad, promotion, or sales pitch—and it does take just a second—its chances of being read or acted upon plummet towards zero. A plain email leads people to start reading it before jumping to conclusions.

      forces you to read before deciding

    1. hidden price tag:

      so this means that the product may not be the best for our planet and yet we don't know about it and are continuing to buy these products.

    2. hidden price tag:

      a toll on the planet, everything we buy has some effect on the planet

    3. price tag

      that's a good song by jessie j

    1. SciScore for 10.1101/2021.04.30.442182: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      NIH rigor criteria are not applicable to paper type.

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single cells secreting target-specific antibodies were identified and isolated using three assay types (55): a multiplexed bead assay using multiple optically-encoded beads, each conjugated to the soluble pre-fusion stabilized S protein of either SARS-CoV-2 or WIV1 S with T4-foldon domain, 3C protease cleavage site, 6x His-tags, and twin-strep tags (34), the SARS-CoV-2 S1 subunit or negative controls (bovine serum albumin [BSA] His-tag and T4 FoldOn trimerization domain), and a live cell assay using passively dyed suspension-adapted Chinese hamster ovary (CHO) cells transiently transfected to surface-express full-length SARS-CoV-2 S protein (GenBank ID MN908947.3) with a green fluorescent protein (GFP) reporter, and non-transfected cells as a negative control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies were recombinantly produced by transient transfection in either human-embryonic kidney (HEK293) or CHO cells as described in Supplemental Methods.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were prepared by mixing each antibody in 10-fold molar excess with antigen (1:1 freshly prepared mix of 400 nM antibody and 40 nM antigen, both diluted in 1X HBSTE + 0.05% BSA running buffer).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen</div><div>suggested: (W. Sieghart, Center for Brain Research, Medical University of Vienna; Vienna; Austria Cat# Beta1 (375-400, RRID:AB_2827800)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To test the antibodies’ ability to block ACE2, antibodies coupled to the HC-30M chip as described above were exposed to SARS-CoV-2 S protein:ACE2 complex.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Multi-cycle kinetics on Biacore: The capture molecule, an anti-human IgG (Fc) antibody, was immobilized on a Biacore CM5 chip by direct coupling.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CHO cells were washed, and binding was detected by using a fluorescently labeled anti-human secondary antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human secondary antibody .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Median fluorescence intensity of each antibody was normalized over the median fluorescence intensity of the human isotype control for respective antigens.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human isotype control for respective antigens .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infectious titers were determined for a subset of virus preparations by infection of VeroE6 cells (ATCC CRL-1586) with serially diluted virus followed by staining with an anti-luciferase antibody (Novus Cat # NB600-307PEATT594) and analysis by fluorescence-activated cell sorting using a Becton Dickinson LSRFortessaTM X-20</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-luciferase</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>NB600-307PEATT594</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infected cells were detected using a primary detection antibody recognizing SARS-CoV-2 nucleocapsid protein (Sino Biological) following staining with secondary detection antibody (goat α-rabbit) conjugated to AlexaFluor 488.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 nucleocapsid protein</div><div>suggested: (Bioss Cat# bsm-41414M, RRID:AB_2848129)</div></div><div style="margin-bottom:8px"><div>α-rabbit</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The extracellular domain (ECD, residues 18 to 618) of ACE2 was expressed in CHO cells as an Fc-fusion protein containing a TEV-protease recognition site.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: CLS Cat# 603479/p746_CHO, RRID:CVCL_0213)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single cells secreting target-specific antibodies were identified and isolated using three assay types (55): a multiplexed bead assay using multiple optically-encoded beads, each conjugated to the soluble pre-fusion stabilized S protein of either SARS-CoV-2 or WIV1 S with T4-foldon domain, 3C protease cleavage site, 6x His-tags, and twin-strep tags (34), the SARS-CoV-2 S1 subunit or negative controls (bovine serum albumin [BSA] His-tag and T4 FoldOn trimerization domain), and a live cell assay using passively dyed suspension-adapted Chinese hamster ovary (CHO) cells transiently transfected to surface-express full-length SARS-CoV-2 S protein (GenBank ID MN908947.3) with a green fluorescent protein (GFP) reporter, and non-transfected cells as a negative control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Chinese hamster ovary ( CHO )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells were transfected with individual mutant spike expression plasmids, and 16 to 20 hours later, transfected cells were infected with VSV-G-pseudotyped ΔGluciferase rVSV.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infectious titers were determined for a subset of virus preparations by infection of VeroE6 cells (ATCC CRL-1586) with serially diluted virus followed by staining with an anti-luciferase antibody (Novus Cat # NB600-307PEATT594) and analysis by fluorescence-activated cell sorting using a Becton Dickinson LSRFortessaTM X-20</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For neutralization assay serial dilutions (2 dilutions at 10 and 1 μg/ml for the initial screen assay or 8 dilutions for the full curve at 10-0.0006 μg/ml) of monoclonal antibodies were mixed with titrated pseudovirus, incubated for 45 minutes at 37 °C and added to pre-seeded 293T-ACE2 cells (provided by Dr. Michael Farzan) in triplicate in 96-well white/black Isoplates (Perkin Elmer).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero-76 cells were inoculated with SARS-CoV-2 (GenBank MT020880.1) at a MOI = 0.01 and incubated at 37°C with 5% CO2 and 80% humidity.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-76</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibody-virus mixture was applied to monolayers of Vero-E6 cells in a 96-well plate and incubated for 1 hour at 37°C in a humidified incubator.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single-cell sequencing, bioinformatic analysis, and cloning: Single cell polymerase chain reaction (PCR) and custom molecular biology protocols generated NGS sequencing libraries (MiSeq, Illumina) using automated workstations (Bravo, Agilent).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MiSeq</div><div>suggested: (A5-miseq, RRID:SCR_012148)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids were verified by Sanger sequencing to confirm the original sequence previously identified by NGS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NGS</div><div>suggested: (PM4NGS, RRID:SCR_019164)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization IC50, IC80 and IC90 titers were calculated using GraphPad Prism 8.0.2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Model building was performed with Coot (CCP4) and final structure validation with MolProbity (Chen et al., 2010) and CCP4 validation tools.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div><div style="margin-bottom:8px"><div>MolProbity</div><div>suggested: (MolProbity, RRID:SCR_014226)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, 2019.0101; Chemical Computing Group ULC), and detailed contact analysis with CCP4 CONTACT(Winn et al., 2011) and custom shell/Perl scripts.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CCP4</div><div>suggested: (CCP4, RRID:SCR_007255)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We aligned the genomes to the SARS-CoV-2 reference genome (Genbank file MN908947.3) using BWA-MEM (Danecek et al., 2021), and performed variant calling and annotation using SAMTools.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BWA-MEM</div><div>suggested: (Sniffles, RRID:SCR_017619)</div></div><div style="margin-bottom:8px"><div>SAMTools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All further analysis (i.e. slicing by time or geographic region) was performed using custom-written Python scripts.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.29.21256002: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Experimental Model and Subject Details Study Cohort: Blood samples were collected from COVID-19 patients (n = 25) in acute phase of infection (COVT1) hospitalized at the Hospital del Mar (Barcelona, Spain), with patient informed consent.<br>IRB: All procedures followed were approved by the Ethical Committee for Clinical Investigation of the Institut Hospital del Mar d’Investigacions Mèdiques (Number 2020/9189/I).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">52 % were males.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, plates were incubated with horseradish peroxidase (HRP)-conjugated anti-human Ig secondary antibodies diluted in PBS containing 0.05% Tween 20 1% BSA for 45 minutes at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human Ig secondary</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To assess the distribution of the different IgG antibody subclasses, HRP-conjugated anti-human IgG1, IgG2, IgG3 and IgG4 (Southern Biotech) were used at a 1:3000 dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG2, IgG3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To quantitate the level of each viral antigen-specific antibody class or subclasses optical density (OD) values were calculated after subtraction of background (OD450 of serum dilutions on PBS-coated plates) and the area under the curve (AUC) derived from optical density measurements of six serial dilutions was determined using Prism 8 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then resuspended in 2 mL of LIVE/DEAD Fixable Yellow Dead Cell Stain Kit (Thermo Fisher Scientific) 1:20000 in PBS, incubated for 30 min at RT and stained with two different fluorophore-conjugated antibody cocktails (Table S2 and S4).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-CCR7 antibody was added first and incubated for 10 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-CCR7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, all other anti-chemokine receptor antibodies (CXCR3, CXCR4, CXCR5, CCR4 and CCR6 for MIX3, and CXCR3 and CXCR4 for MIX 1) were added to the corresponding tubes and incubated for 10 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-chemokine receptor</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CXCR3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CXCR4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CXCR5</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CCR4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CCR6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>MIX3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then washed and stained with the MIX 2 antibody cocktail for 10 min using anti-human IgA AmCyan instead of anti-human IgA FITC (Table S3) and DAPI fluorescent dye (Sigma Aldrich).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Principal component analysis (PCA) was used to identify the most important features from 41 variables (including antibody titers and immune parameters; Data File S1) using COVT1 (n = 25), COVT2 (n = 20) and healthy controls (n = 16).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COVT1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>COVT2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The pLVX-EF1alpha-nCoV2019-N-2xStrep-IRES-Puro construct, encoding for the full-length SARS-CoV-2 nucleocapsid protein (NP) fused to a double Strep-tag at the C-terminus was a gift from Dr Krogan (University of California, San Francisco USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLVX-EF1alpha-nCoV2019-N-2xStrep-IRES-Puro</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To quantitate the level of each viral antigen-specific antibody class or subclasses optical density (OD) values were calculated after subtraction of background (OD450 of serum dilutions on PBS-coated plates) and the area under the curve (AUC) derived from optical density measurements of six serial dilutions was determined using Prism 8 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">High-dimensional data analysis of flow cytometry data: t-Distributed Stochastic Neighbor Embedding (tSNE) analyses were performed with Flowjo V10.6.2 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flowjo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis and visualization: GraphPad Prism (version 8.0) and R (version 3.6.3, R Core Team (2019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 36. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. aber jetzt noch nicht. Wann würde sie die Höchstgrenzung ihres Unglück erreichen? Sie wusste nicht, weil jeder Tag fast unerträglich war. Aber die Königreich sah weg von Olga undignorierte ihre ernstes und unfreundliches Betragen, wie ein beschämter Vater der sein Kind vor den Dorf Betrunkenen versteckt

      Dieses Zitat zeigt eine spezifische Reflexion der Ursprünge, aus denen die spezifischen Elemente der Geschichte bestehen. Es sind jedoch stilistische Elemente, die diese zum Tragen bringen. Hier sehen wir den Einfluss, den Elternschaft und Kindheit auf die Geschichte haben, insbesondere in Bezug auf die Erziehung von Kindern vom Vater. Eine Metapher wird verwendet, um Olga's Situation, eine der wichtigsten weiblichen Figuren, mit einer Situation zu vergleichen, die einem beschämten Vater ähnelt. Dies zeigt, wie die Autoren versuchen, sich den Geschlechterrollen zu widersetzen, insbesondere denen der patriarchalischen Herrschaft, was sich in ihrer anfänglichen Motivation widerspiegelte, eine Geschichte mit einer jungen Protagonistin zu schreiben und eine "Heldin" anstatt ein "Held".

    Tags

    Annotators

    1. What Is Half-Duplex And Full-Duplex Operation, And How Does It Affect Your Router? By Phoon YS Published Sep 22, 2014 Share Share Tweet Email WiFi connections are running at half-duplex while the wired part of the LAN are on full-duplex. So it seems that by connecting through WiFi, something had to give. Were we shortchanged?

  6. Apr 2021
    1. SciScore for 10.1101/2021.04.28.441474: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All studies were performed in accordance with Wistar Institutional Animal Care and Use Committees under approved animal protocols.<br>Euthanasia Agents: For cellular responses, mice were euthanized under CO2 overdose.<br>Field Sample Permit: Serum samples were collected at indicated timepoints via saphenous vein blood collection throughout the experiment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Female Hartley guinea pigs (8 weeks old, Elm Hill Labs, Chelmsford MA) were housed at Acculab (San Diego CA).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">For the lethal challenge study, Texas Biomed were blinded to identity of vaccination groups and weight loss cutoff for euthanasia was 20%.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blocking Buffer (LI-COR) for >1 hour at ambient temperature then incubated with *** μg / protein gel of MonoRab anti-his tag C-term (Genscript) in Intercept T20 (PBS) Antibody Diluent (LI-COR) overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-his tag C-term</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The membrane was then incubated in a 1:10000 IRDye 800CW goat anti-rabbit IgG (LI-COR Biosciences) in Intercept T20 (PBS) Antibody Diluent (LI-COR) at room temperature for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Goat anti-Human IgG-Fc fragment cross-adsorbed antibody HRP conjugated (Bethyl Laboratories) secondary at a 1:10,000 dilution for 1 hour at ambient temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Goat anti-Human IgG-Fc fragment cross-adsorbed antibody HRP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Human IgG-Fc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For BL6, BALB/c, and K18 ACE2 mouse studies, goat anti-mouse IgG h+l HRP-tagged antibody (Bethyl Laboratories) diluted 1:20000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fragment Goat Anti-Rat IgM, μ chain specific (Jackson ImmunoResearch) at 1:10000, Goat anti-Human Kappa Light Chain Antibody HRP Conjugated (Bethyl Laboratories) at 1:10000,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Rat IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Human Kappa Light Chain</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Goat anti-Human Lambda Light Chain Antibody HRP Conjugated (Bethyl Laboratories) at 1:10000, and Goat anti-Mouse IgG-heavy and light chain Antibody HRP Conjugated (Bethyl Laboratories) at 1:20000, and Goat anti-guinea pig IgG whole molecule (Sigma) at 1:10,000 were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human Lambda Light Chain</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Mouse IgG-heavy</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-guinea pig IgG whole molecule ( Sigma )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-Hamster HRP antibody (Sigma) was diluted in diluent buffer 1:10,000 and were incubated for 1 hr at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Hamster HRP antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-Hamster HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Intracellular cytokine staining and Flow cytometry: Splenocytes were processed as described in the previous section and stimulated with RBD peptides for 5 hours at 37°C with protein transport inhibitor (Invitrogen) and anti-mouse CD107a-FITC antibody (BioLegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse CD107a-FITC</div><div>suggested: (SouthernBiotech Cat# 1920-02, RRID:AB_2795531)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-mouse CD4-BV510, CD8-APC-Cy7, CD44-A700, and CD62L-BV711 antibodies were used for surface staining and CD3e-PE-Cy5, IFN-γ-APC, and TNF-α-BV605 (all from BioLegend) were used for intracellular staining.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-mouse CD4-BV510</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD8-APC-Cy7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD44-A700</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD62L-BV711</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD3e-PE-Cy5 , IFN-γ-APC ,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>TNF-α-BV605</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ExpiF293 cells were transfected with the pVAX plasmid vector either carrying the nanoparticles or the His-Tagged monomer transgene with PEI/Opti-MEM and harvested 6-7 days post transfection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ExpiF293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus Neutralization Assay: HEK293T (CRL-3216) and CHO cells (CRL-12023: double check) were obtained from ATCC (Manassas, VA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CHO</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CHO-ACE2 cells were seeded at 10,000 cells/well in 96-well plates and incubated for 24 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To grow a stock of virus, 3 million Vero cells were seeded in a T-75 flask for overnight incubation (37⍰C, 5% CO2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For BL6, BALB/c, and K18 ACE2 mouse studies, goat anti-mouse IgG h+l HRP-tagged antibody (Bethyl Laboratories) diluted 1:20000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animal Studies: C57BL/6, BALBc, and K18-hACE2 mice were obtained from Charles River Laboratories (Malvern, PA) and The Jackson Laboratory (Bar Harbor, ME).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>K18-hACE2</div><div>suggested: RRID:IMSR_GPT:T037657)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All animals were housed in the Wistar animal facility in ventilated cages and given free access to food and water.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Wistar</div><div>suggested: RRID:MGI:5657554)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DNA encoding the variants were codon optimized for homo sapiens and cloned with a IgE secretion sequence into the pVAX vector.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pVAX</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For antibody production, heavy and light chains were encoded in pFUSEss-CHIg-hG1, and pFUSE2ss-CLIg-hk or pFUSEss-CLIg-hL2 respectively and were co-transfected in equal parts using ExpiFectamine™ 293 Transfection Kit(Gibco) according to manufacturer’s protocol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pFUSEss-CHIg-hG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pFUSE2ss-CLIg-hk</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pFUSEss-CLIg-hL2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">6μg S_IgE_deltaCterm19_plasmid (Genscript), and 6μg pNL4-3.luc.R-E- backbone (Aldevron) and incubated for 48 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pNL4-3.luc.R-E-</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Curves were analyzed in GraphPad Prism 8 with Sigmoidal, 4PL, X is concentration and AUC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For variant pseudoviruses, cells were similarly treated with GeneJammer and backbone with 6μg of S_SA_IgE_deltaCterm19, S_UK_IgE_deltaCterm19, or S_Brazil_IgE_deltaCterm19 plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GeneJammer</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus titer (TCID50/ml) was calculated using the Reed-Munch method and the Microsoft Excel based calculator published by Lei et al[73] For neutralization assays, Vero cells were seeded in DMEM with 1% FBS at 20,000 cells/well in 96 well flat bottom plates for overnight incubation (37C, 5% CO2)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data processing was performed in Relion v3.1.2[74]</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Relion</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The samples were run on an 18-color LSRII flow cytometer (BD Biosciences) and analyzed by FlowJo software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After being washed, the plates were further incubated at room temperature for 1 hour with goat-anti human IgG-Fc fragment cross-adsorbed Ab (A80-340P; Bethyl Laboratories) at a 1: 10,000 dilution, followed by addition of TMB substrates (ThermoFisher), and then quenched with 1M H2SO4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher</div><div>suggested: (ThermoFisher; SL 8; Centrifuge, RRID:SCR_020809)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.26.441517: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A correction nomogram for this ELISA is reproduced in Figure 1A. ELISA for Human IgG Antibodies Specific for the SARS-CoV-2 Spike Protein Receptor-Binding Domain (RBD): This is a sandwich ELISA in which a capture antibody, rabbit anti-mouse IgG, is adsorbed onto microtititer wells, followed by antigen capture.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA Inhibition by RBD Variants: Human anti-SP IgG or ACE-2 Fc was mixed with recombinant SARS-CoV-2 spike RBD His tag (R&D Systems) or recombinant SARS-CoV-2 spike RBD (N501Y)-His tag (Sino Biological, Wayne, PA), both comprising R319-F541 (MW 26 kDa), to produce serial dilutions of 0-500 ng/ml of RBD in the presence of 25 ng/ml of antibody standard for primary incubation following the blocking step of the rSP ELISA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SP IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>N501Y)-His tag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IC50 values of inhibition curves were determined by exponential decay regression analysis using SigmaPlot 10 software, as (−0.693)/(-k), where k is the decay constant, expressed as molar concentration.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SigmaPlot</div><div>suggested: (SigmaPlot, RRID:SCR_003210)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.19.21255739: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study Populations: Two longitudinal COVID-19 cohort studies at Fred Hutchinson Cancer Research Center (Seattle, Washington) and Emory University (Atlanta, Georgia) began after receiving institutional review board approvals (IRB 10440, IRB 00001080 and IRB00022371).<br>Consent: Adults ≥18 years were enrolled who met eligibility criteria for SARS-CoV-2 infection and provided informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Participants undiagnosed with COVID-19 had a nasopharyngeal (NP) swab collected and tested for SARS-CoV-2 via an FDA-approved PCR test and blood was collected for SARS-CoV-2 antibody (Abbott) and study assays.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following a wash, plates were incubated with 50ul/well of Sulfo-Tag anti-human IgG, IgA, or IgM detection antibody and shaken at 700RPM at room temperature for 1 hr.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibody-virus mixture was added to VeroE6 cell (C1008, ATCC,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C1008</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibody-virus mixture was added to VeroE6 cell (C1008, ATCC,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Study Populations: Two longitudinal COVID-19 cohort studies at Fred Hutchinson Cancer Research Center (Seattle, Washington) and Emory University (Atlanta, Georgia) began after receiving institutional review board approvals (IRB 10440, IRB 00001080 and IRB00022371).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IRB 00001080</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Participants undiagnosed with COVID-19 had a nasopharyngeal (NP) swab collected and tested for SARS-CoV-2 via an FDA-approved PCR test and blood was collected for SARS-CoV-2 antibody (Abbott) and study assays.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The FRNT-mNG50 titers were interpolated using a 4-parameter nonlinear regression in GraphPad Prism 8.4.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was analyzed in Flow Jo version 9.9.4</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flow Jo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      Results from scite Reference Check: We found no unreliable references.


      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. There's nothing to stop you from doing initializer code in a file that lives in app/models. for example class MyClass def self.run_me_when_the_class_is_loaded end end MyClass.run_me_when_the_class_is_loaded MyClass.run_me... will run when the class is loaded .... which is what we want, right? Not sure if its the Rails way.... but its extremely straightforward, and does not depend on the shifting winds of Rails.

      does not depend on the shifting winds of Rails.

    1. # This will register formatters only on specific tag names logger.tag_formatter.add(:thread) { |thread| "Thread(#{thread.name})" } logger.tag_formatter.add(:current_user, Lumberjack::Formatter::IdFormatter.new)
    2. Lumberjack 1.0 had a concept of a unit of work id that could be used to tie log messages together. This has been replaced by tags. There is still an implementation of Lumberjack.unit_of_work, but it is just a wrapper on the tag implementation.
    1. does not have limited user permissions for accessing the medical record system TakeCare to what is needed only for the user to be able to carry out their duties

      lack of limited user permission; lack of restricted access to what is only needed for the carer's duty

      ADD TAG

    1. SciScore for 10.1101/2021.04.20.440678: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: All cells were maintained at 37°C with 5% CO2 Source of Primary Human T cells: Blood was obtained from Blood Centers of the Pacific (San Francisco, CA) as approved by the University Institutional Review Board.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies: Surface expressed proteins were assayed for using Alexa Fluor 647 Anti-Myc tag antibody (Cell Signaling Technologies #2233S)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Myc tag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells expressing ACE2 and TMPRSS2, a generous gift of Hannah S Sperber and Dr. Satish Pillai, were cultured in DMEM High Glucose (Gibco #10569-010) supplemented with 10% FBS, 1% of Antibiotic-Antimycotic,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of Stable Cell Lines: Lenti-X 293T cells (Takara Bio #632180) were seeded at approximately 7e5 cells/well in a 6-well plate to yield ~80% confluency the following day.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Media was changed after 24 hours, and at 48 hours the viral supernatant was filtered through a 0.45μm PVDF filter and added to Jurkat or K562 cells seeded at approximately 1e5 cells/well in a 12-well plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Jurkat</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>K562</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Prior to the flow cytometry, cells were seeded at densities described below in a 96 well plates, using flat-bottom plates (Falcon #353072) for experiments involving BHK-21 cells and U bottom plates for all other experiments (Falcon #877217) and incubated for 24-72 hours as specified by the experiment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following day cells were transfected with 1.5μg of transfer vector containing the desired expression cassette, and the lentiviral packaging plasmids pMD2</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMD2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">G (170ng) and pCMV-dR8.91 (1.33μg) using 10μl of Lipofectamine 2000 (Invitrogen #11668-027) according to manufacturer protocols.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV-dR8.91</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells were transfected with plasmid DNA (340 ng of Spike vector, 1μg CMV-Gag-Pol (pCMV-dΔR8.91), 125 ng pAdvantage (Promega), 1 μg Luciferase reporter (per 6-well plate)) for 48 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCMV-dΔR8.91</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For positive control, Spike vector was replaced with pMD2.G and for negative control this vector was omitted.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pMD2.G</div><div>suggested: RRID:Addgene_12259)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For LCB1 and LCB3, protein sequences were translated to human optimized coding sequences using Benchling.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Benchling</div><div>suggested: (Benchling, RRID:SCR_013955)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All data were collected using FACSDiva (BD Biosciences) Flow Cytometry: Flow cytometry was performed using a LSR-Fortessa (BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FACSDiva</div><div>suggested: (BD FACSDiva Software, RRID:SCR_001456)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The protein concentration was estimated based on the protein absorbance at 280nm with a spectrophotometer (Nanodrop One, Thermo), flash frozen, and stored in −80 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo</div><div>suggested: (Thermo Xcalibur, RRID:SCR_014593)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All data analysis was conducted using custom Python scripts, available on github (https://github.com/weinberz/sarsnotch).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis was conducted in Jupyter59 and relied on numpy60, matplotlib, seaborn, pandas, SciPy61, scikit-learn62 and fcsparser.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>matplotlib</div><div>suggested: (MatPlotLib, RRID:SCR_008624)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your code and data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.19.440481: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: The original studies to obtain blood samples after written informed consent were previously described and had been approved by the Ethics Board of ChongQing Medical University24.<br>IRB: The original studies to obtain blood samples after written informed consent were previously described and had been approved by the Ethics Board of ChongQing Medical University24.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Six-to eight-week-old female hACE2 mice were treated with 58G6 or 510A5 monoclonal antibody at a concentration of 10 mg/kg by intraperitoneal route, respectively.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence analysis of antigen-specific mAbs: IMGT/V-QUEST (http://www.imgt.org/IMGT_vquest/vquest) and IgBLAST (https://www.ncbi.nlm.nih.gov/igblast/), MIXCR (https://mixcr.readthedocs.io/en/master/) and VDJtools (https://vdjtools-doc.readthedocs.io/en/master/overlap.html) tools were used to do the variable region analysis and annotation for each antibody clone.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific mAbs: IMGT/V-QUEST ( http://www.imgt.org/IMGT_vquest/vquest )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A CM5 chip (GE Healthcare) was linked with anti-human IgG-Fc antibody to capture about 9000 response units of the neutralizing Abs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG-Fc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The next days, the membranes were washed with TBST and incubated with HRP-conjugated Goat-anti-human Fc antibody (Abcam, ab99759, 1:10000) for 1 h at RT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ab99759</div><div>suggested: (Abcam Cat# ab99759, RRID:AB_10673762)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ELISA plates were washed 4 times by blocking buffer and 50 μL Goat F(ab’)2 Anti-Human IgG (Fab’)2 secondary antibody conjugated with ALP (Abcam, ab98532, 1:2000) was incubated with the plate at RT for 30 mins.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the incubation, the mixtures were then transferred into 96-well plates, which were seeded with Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells were grown to 80% confluency before transfection with VSV-G pseudotyped ΔG-luciferase, pWPXL and pSPAX2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 72 hrs, the luciferase activities of infected HEK293T/ACE2 cells were detected by the Bright-Luciferase Reporter Assay System (Promega, E2650)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T/ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expi293 cells (Thermo Fisher Scientific, USA) cultured in Freestyle 293 Expression Medium (Thermo Fisher Scientific, USA) were maintained at 37 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Authentic SARS-CoV-2 and B.1.351 viruses and animal study: Authentic SARS-CoV-2 (WIV04) and B.1.351 (NPRC 2.062100001) viruses were propagated on the Vero-E6 cells and titrated by single layer plaque assay with standard procedure.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of pseudovirus bearing S protein: pVSVG expressing SARS-CoV-2 S protein was constructed as previously described29.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pVSVG</div><div>suggested: RRID:Addgene_85140)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells were grown to 80% confluency before transfection with VSV-G pseudotyped ΔG-luciferase, pWPXL and pSPAX2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pSPAX2</div><div>suggested: RRID:Addgene_12260)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein expression and purification: To express the prefusion S ectodomain, the gene encoding residues 1-1208 of SARS-CoV-2 S (GenBank: MN908947.3) with a C-terminal T4 fibritin trimerization motif, an HRV-3C protease cleavage site, a Twin-Strep-tag and an 8 × His-tag was synthesized, and cloned into the mammalian expression vector pcDNA3.1, which was a kind gift from L.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pcDNA3.1</div><div>suggested: RRID:Addgene_79663)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The IC50 and IC80 of the evaluated mAbs was and calculated by a four-parameter logistic regression using GraphPad Prism 8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence analysis of antigen-specific mAbs: IMGT/V-QUEST (http://www.imgt.org/IMGT_vquest/vquest) and IgBLAST (https://www.ncbi.nlm.nih.gov/igblast/), MIXCR (https://mixcr.readthedocs.io/en/master/) and VDJtools (https://vdjtools-doc.readthedocs.io/en/master/overlap.html) tools were used to do the variable region analysis and annotation for each antibody clone.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgBLAST</div><div>suggested: (IgBLAST, RRID:SCR_002873)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">2605 micrographs were collected in a single session with a defocus range comprised between 1.0 and 2.8 μm using SerialEM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cryo-EM data processing: All dose-fractioned images were motion-corrected and dose-weighted by MotionCorr2 software32 and their contrast transfer functions were estimated by cryoSPARC patch CTF estimation33.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MotionCorr2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following 2D, 3D classifications, and refinements were all performed in cryoSPARC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Both of the 58G6 and 13G9 Fab models were first predicted using Phyre226 and then manually built in Coot 0.936 with the guidance of the cryo-EM electron density maps, and overall real-space refinements were performed using Phenix 1.1837.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div><div style="margin-bottom:8px"><div>Phenix</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr></table>

      Results from OddPub: Thank you for sharing your data.


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>

    1. SciScore for 10.1101/2021.04.20.440588: (What is this?)

      Please note, not all rigor criteria are appropriate for all manuscripts.

      Table 1: Rigor

      <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Ethics</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Cells were originally obtained from ATCC and routinely tested negative for mycoplasma contamination (PCR Mycoplasma Detection Set, Takara)</td></tr></table>

      Table 2: Resources

      <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fixed cells were incubated with anti-T7e epitope mouse monoclonal antibodies (Novagen, 69522-4) and anti-HA rabbit polyclonal antibodies (Sigma Aldrich, H6908).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-T7e</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The secondary antibodies Alexa 488 donkey anti-mouse IgG (Molecular Probes, A-21202) and Alexa 568 donkey anti-rabbit IgG (Molecular Probes, A-10042) were used for double staining.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (Molecular Probes Cat# A-21202, RRID:AB_141607)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To detect intracellular RABV-P protein, cells were permeabilized with 0.2% Triton X-100 in PBS for 5 min at room temperature and incubated with anti-RABV-P rabbit polyclonal antibody (Tobiume et al., 2009).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RABV-P</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The secondary antibodies Alexa 488 donkey anti-mouse IgG and Alexa 568 donkey anti-rabbit IgG were used for staining.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To evaluate ubiquitination states, proteins immunoprecipitated with anti-ubiquitin mouse antibodies were subjected to Western blotting with anti-T7e rabbit antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ubiquitin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Total cell lysate was also subjected to immunoblotting with anti-T7e rabbit antibodies and anti-HA rabbit polyclonal antibodies (Sigma Aldrich, H6908) to evaluate the expression levels of Env-T7es and HA-MARCH8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HA</div><div>suggested: (Sigma-Aldrich Cat# H6908, RRID:AB_260070)</div></div><div style="margin-bottom:8px"><div>HA-MARCH8</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell maintenance: 293T, HeLa, NIH3T3, HOS, and M8166+MARCH8 (Tada et al., 2015) cells were maintained under standard conditions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To determine viral infectivity, 1 × 104 NIH3T3 cells or HeLa cells were incubated with 1 ng of p24 antigen of either arenavirus virus envelope (LCMV-GP)- or alphavirus E3-E2-6K-E1 envelope (derived from CHIKV or RRV)-pseudotyped HIV-1 luciferase reporter viruses, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NIH3T3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DNA constructs: The envelope glycoprotein (Env)-deficient HiBiT-tagged HIV-1 proviral indicator construct pNL-Luc2-IN/HiBiT-E(-)Fin, the HIV-1 Gag-Pol expression plasmid pC-GagPol-RRE, the VSV-G expression plasmid pC-VSVg, the severe acute respiratory syndrome coronavirus (SARS-CoV) spike (S) protein expression plasmid pC-SARS-S, the SARS-CoV-2-S protein expression plasmid pC-SARS2-S, the HIV-1 Rev expression plasmid pCa-Rev, the MARCH8 expression plasmid pC-MARCH8, pC-HA-MARCH8, and the tyrosine motif-mutant pC-MARCH8-AxxL, the ACE2 expression plasmid pC-ACE2 and the TMPRSS2 expression plasmid pC-TMPRSS2, have previously been described elsewhere (Iwabu et al., 2009; Ozono et al., 2021; Ozono et al., 2020; Tada et al., 2015).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pC-GagPol-RRE</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>VSV-G</div><div>suggested: RRID:Addgene_138479)</div></div><div style="margin-bottom:8px"><div>pCa-Rev</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-MARCH8</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-MARCH8-AxxL</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plasmid pC-LCMVgp expressing the viral envelope derived from lymphocytic choriomeningitis virus (LCMV) glycoprotein (gp) was created by inserting PCR-amplified and BsiWI/XhoI-digested LCMV-GP fragments (PCR-amplified from pCI-LCMV-GP (Reignier et al., 2006)) into the Acc65I/XhoI-digested pCAGGS mammalian expression plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pCI-LCMV-GP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pCAGGS</div><div>suggested: RRID:Addgene_18926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plasmid pC-CHIKVe expressing alphavirus E3-E2-6K-E1 polyprotein derived from Chikungunya virus (CHIKV) was created by inserting the PCR-amplified and Acc65I/XhoI-digested E3-E2-6K-E1 fragments (PCR-amplified from codon-optimized CHIKV’s C-E3-E2-6K-E1 plasmid (Kishishita et al., 2013)) into the corresponding site of pCAGGS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pC-CHIKVe</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>C-E3-E2-6K-E1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Another E3-E2-6K-E1 expression plasmid, pC-RRVe, derived from the Ross River virus (RRV) T48 strain, was created by inserting the PCR-amplified and EcoRV/NotI-digested E3-E2-6K-E1 fragments (PCR-amplified from pRRV-E2E1 (Sharkey et al., 2001)) into the corresponding site of pCAGGS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pRRV-E2E1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The RABV-G or LCMV-GP mutant (pC-RABVg-CT3K/R, or pC-LCMVgp-CT6K/R), in which cytoplasmic lysine residues at positions 489/508/517 or 465/471/478/487/492/496 were mutated to arginine residues, was created by inserting overlapping PCR fragments into correspondingly digested pC-RABVg or pC-LCMVgp, respectively</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pC-RABVg-CT3K/R</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-LCMVgp-CT6K/R</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mutants of SARS-CoV-S and SARS-CoV-2-S (pC-SARS-S-CT4K/R, or pC-SARS2-S-CT4K/R), in which cytoplasmic lysine residues at positions 1227/1237/1248/1251 and 1245/1255/1266/1269 were mutated to arginine residues, were created by inserting overlapping PCR fragments into correspondingly digested pC-SARS-S and pC-SARS2-S, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pC-SARS-S-CT4K/R</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-SARS2-S-CT4K/R</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-SARS-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The CHIKV and RRV 6K mutants (pC-CHIKV-6K-2K/R and pC-RRV-6K-2K/R), in which the 6K region’s cytoplasmic lysine residues at positions 37/44 were mutated to arginine residues, were created by inserting overlapping PCR fragments into correspondingly digested pC-CHIKVe and pC-RRVe, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pC-CHIKV-6K-2K/R</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-RRV-6K-2K/R</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-RRVe</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Similarly, the E2 mutants of CHIKV and RRV (pC-CHIKVe-E2-K/R or pC-RRVe-E2-K/R), in which E2’s C-terminal lysine residues at positions 422 and 394 were mutated to arginine residues, were created by inserting overlapping PCR fragments into correspondingly digested pCAGGS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pC-CHIKVe-E2-K/R</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-RRVe-E2-K/R</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The C-terminally T7-epitope–tagged wild-type and its mutant expression plasmids of RABV-G (pC-RABVg-T7e and pC-RABVg-CT3K/R-T7e), LCMV-GP (pC-LCMVgp-T7e and pC-LCMVgp-CT6K/R-T7e), SARS-CoV-S (pC-SARS-S-T7e and pC-SARS-S-CT4K/R-T7e), SARS-CoV-2-S (pC-SARS2-S-T7e and pC-SARS2-S-CT4K/R-T7e), CHIKVe3-E2-6K-E1 (pC-CHIKVe-T7e, pC-CHIKVe-6K-2K/R-T7e, and pC-CHIKVe-E2-K/R-T7e), and RRVe3-E2-6K-E1 (pC-RRVe-T7e, pC-RRVe-6K-2K/R-T7e, and pC-RRVe-E2-K/R-T7e) were created by replacing the VSV-G gene of pC-VSVg-T7e (Zhang et al., 2020) with the corresponding PCR-amplified fragments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pC-RABVg-T7e</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-LCMVgp-T7e</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-LCMVgp-CT6K/R-T7e</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-SARS-S-T7e</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-SARS-S-CT4K/R-T7e</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-SARS2-S-T7e</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-SARS2-S-CT4K/R-T7e</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-CHIKVe-T7e</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-CHIKVe-6K-2K/R-T7e</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-CHIKVe-E2-K/R-T7e</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-RRVe-T7e</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-RRVe-6K-2K/R-T7e</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-RRVe-E2-K/R-T7e</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-VSVg-T7e</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To detect ubiquitinated CHIKV-E2 proteins by immunoprecipitation assays, WT or E2-K/R mutant plasmids expressing CHIKV E3-E2-6K-E1, in which the T7 epitope-tag is inserted immediately downstream of a furin-cleavage site between E3 and E2, were created by inserting overlapping PCR fragments that harbor a T7e sequence into correspondingly digested pCAGGS and were designated pC-CHIKVe-T7eE2, pC-CHIKVe-T7eE2-K/R, pC-RRVe-T7eE2, and pC-RRVe-T7eE2-K/R, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pC-RRVe-T7eE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-RRVe-T7eE2-K/R</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virion infectivity assays: To prepare various viral envelope-pseudotyped HIV-1 luciferase reporter viruses, 1.1 × 105 293T cells were cotransfected with increasing amounts of the MARCH8 expression plasmid, 20 ng of viral envelope expression plasmid (pC-VSVg, pC-RABVg, pC-LCMVgp, pC-SARS-S, pC-SARS2-S, pC-CHIKVe, pC-RRVe, and their mutants), 500 ng of pNL-Luc2-IN/HiBiT-E(-)Fin, and an empty vector up to 1 μg of total DNA using FuGENE 6 (Promega).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pC-VSVg</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-RABVg</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-LCMVgp</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-SARS2-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pNL-Luc2-IN/HiBiT-E(-)Fin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alternatively, 2.2 × 104 293T cells transiently coexpressing ACE2 and TMPRSS2 (using pC-ACE2 and pC-TMPRSS2) were incubated with 1 ng of p24 antigen of either SARS-CoV-S- or SARS-CoV-2-S-pseudotyped luciferase reporter lentiviruses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pC-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunofluorescence microscopy: HOS cells were plated on 13-mm coverslips, cotransfected with 0.5 μg of pC-xx-T7e (xx: RABV-G, RABV-G-CT3K/R, LCMVgp, LCMVgp-CT6K/R, SARS-S, SARS-S-CT4K/R, SARS2-S, SARS2-S-CT4K/R, CHIKVe, CHIKVe-6K-2K/R, CHIKVe-E2-K/R, RRVe, RRVe-6K-2K/R, or RRVe-E2-K/R), 0.1 μg of pC-GagPol-RRE, 0.05 μg of pCa-Rev, and 0.3 μg of either the HA-MARCH8 expression plasmid or an empty control using FuGENE6, and cultured for 24 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pC-xx-T7e</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HA-MARCH8</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ubiquitination assays: 293T cells (5 × 105) were cotransfected with 0.8 μg of pC-RABVg-T7e, pC-RABVg-CT3K/R-T7e, pC-CHIKVe-T7eE2, or pC-CHIKVe-T7eE2-K/R; and 0.2 μg of pC-HA-MARCH8 or an empty control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pC-RABVg-CT3K/R-T7e</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-CHIKVe-T7eE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-CHIKVe-T7eE2-K/R</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pC-HA-MARCH8</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses: Column graphs that combine bars and individual data points were created with GraphPad Prism version 9.10.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>

      Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).


      Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.

      Results from TrialIdentifier: No clinical trial numbers were referenced.


      Results from Barzooka: We did not find any issues relating to the usage of bar graphs.


      Results from JetFighter: We did not find any issues relating to colormaps.


      Results from rtransparent:
      • Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
      • Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
      • No protocol registration statement was detected.

      <footer>

      About SciScore

      SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.

      </footer>