5,018 Matching Annotations
  1. Feb 2018
    1. On 2016 Mar 15, Tom Kindlon commented:

      Depression scores in this follow-up study are very different to scores in original study (looking solely at the Reeves et al. (2005) operationalization)

      Leonard Jason and colleagues previously raised concerns about the Reeves et al. (2005) chronic fatigue syndrome (CFS) criteria [which have also been described as an operationalisation of the Fukuda et al (1994) criteria] (1-4). In particular, Jason and colleagues were concerned that some people who did not have CFS might get diagnosed with CFS using this new set of criteria. They found some evidence to support this concern in a study of those with major depressive disorder who did not have CFS: 38% were found to satisfy these new criteria for CFS(4).

      Looking solely at the current study, it would look like there might have been little basis for these concerns. Of 71 people classified with CFS in the current study, only one (1.4%) had a Zung self-rating depression scale (SDS) (5) score of >=60. The mean SDS score for the 71 CFS participants was 44.78 (calculated from the data in Table 4) (6).

      However, it should be noted that the SDS (depression) scores in the follow-up study are very different from the scores in the original Georgia cohort(7). Of the 113 people diagnosed with CFS in the original Georgia cohort, data for 112 (99.1%) was published(7). The average SDS score was considerably higher at 56.2. Possibly more revealingly, 40.2% had a SDS score of >=60. As described in the paper, the SDS scale provides an index score and categories reflecting no (<50), mild (50-59), moderate (60-69), and severe (>=70) depression.

      I am not sure why there should be such a large difference in a cohort between the initial and follow-up studies in the rate of those with moderate or severe depression (40.2% vs 1.4%). But it does mean that caution should be used in terms of interpreting the findings reported in the current paper and their significance regarding the Reeves et al. (2005) criteria (1,6).

      References:

      [1]. Reeves WC, Wagner D, Nisenbaum R, Jones JF, Gurbaxani B, Solomon L, Papanicolaou DA, Unger ER, Vernon SD, Heim C. Chronic fatigue syndrome--a clinically empirical approach to its definition and study. BMC Med. 2005 Dec 15;3:19.

      [2]. Fukuda K, Straus SE, Hickie I, Sharpe MC, Dobbins JG, Komaroff A. The chronic fatigue syndrome; a comprehensive approach to its definition and study. Ann Int Med 1994, 121:953-959.

      [3]. Jason LA, & Richman JA. How science can stigmatize: The case of chronic fatigue syndrome. Journal of CFS 2007;14:85-103.

      [4]. Jason LA, Najar N, Porter N, Reh C. Evaluating the Centers for Disease Control's empirical chronic fatigue syndrome case definition. Journal of Disability Policy Studies 2009;20;93.

      [5]. Zung WW, Richards CB, Short MJ. Self-rating depression scale in an outpatient clinic: further validation of the SDS. Arch Gen Psychiatry.1965;13(6):508-515.

      [6]. Unger ER, Lin JM, Tian H, Gurbaxani BM, Boneva RS, Jones JF. Methods of applying the 1994 case definition of chronic fatigue syndrome - impact on classification and observed illness characteristics. Popul Health Metr. 2016 Mar 12;14:5.

      [7]. Heim C1, Nater UM, Maloney E, Boneva R, Jones JF, Reeves WC. Childhood trauma and risk for chronic fatigue syndrome: association with neuroendocrine dysfunction. Arch Gen Psychiatry. 2009 Jan;66(1):72-80.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Apr 12, Martin Hofmeister commented:

      Do not forget published reviews

      I thank Dr Mat Eil Ismail et al, for their interesting article "Preoperative physiotherapy and short-term functional outcomes of primary total knee arthroplasty", published in the March 2016 issue of the Singapore Medical Journal (SMJ). There is one aspect worth mentioning. In my opinion, systematic reviews of the past five years should be included in an original article consistent with good scientific practice. The reviews of Kwok et al, Jordan et al, Simmons et al and the Australian Agency for Clinical Innovation about the evidence of preoperative physiotherapy on outcomes following total knee arthroplasty are not mentioned in the discussion (1-4). The results of the SMJ study reconfirm the above-mentioned reviews: No statistically significant effect in patient key outcomes (1-4). I refer readers to the latest meta-analysis "Does preoperative rehabilitation for patients planning to undergo joint replacement surgery improve outcomes?" that can be found in the February 2016 issue of the BMJ Open (5).

      REFERENCES

      1) Kwok IH, Paton B, Haddad FS. Does Pre-Operative Physiotherapy Improve Outcomes in Primary Total Knee Arthroplasty? - A Systematic Review. J Arthroplasty. 2015;30:1657-63. Kwok IH, 2015

      2) Jordan RW, Smith NA, Chahal GS, Casson C, Reed MR, Sprowson AP. Enhanced education and physiotherapy before knee replacement; is it worth it? A systematic review. Physiotherapy. 2014;100:305-12. Jordan RW, 2014

      3) Simmons L, Smith T. Effectiveness of pre-operative physiotherapy-based programmes on outcomes following total knee arthroplasty: a systematic review and meta-analysis. Phys Ther Rev. 2013;18:1-10. http://www.tandfonline.com/doi/abs/10.1179/1743288X12Y.0000000035?journalCode=yptr20

      4) NSW Agency for Clinical Innovation (NSW ACI). Musculoskeletal Network: NSW Evidence Review: preoperative, perioperative and postoperative care of elective primary total hip and knee replacement. Chatswood, Australia: Agency for Clinical Innovation, 2012. Available at: http://www.aci.health.nsw.gov.au/__data/assets/pdf_file/0020/172091/EJR-Evidence-Review.PDF. Accessed 22 March 2016.

      5) Wang L, Lee M, Zhang Z, Moodie J, Cheng D, Martin J. Does preoperative rehabilitation for patients planning to undergo joint replacement surgery improve outcomes? A systematic review and meta-analysis of randomised controlled trials. BMJ Open 2016;6:e009857. Wang L, 2016


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 May 27, Hans Morreau commented:

      Massive Chromosomal Loss with Subsequent Whole Genome Doubling is seen in a Wide Variety of Rare Tumor Types:

      The authors Zheng et al. performed an impressive molecular characterization of 91 cases of adrenal cortical carcinoma (ACC). The integrated analysis is the way to understand the behaviour of this rare disease far better and hopefully will lead to better treatment options. They conclude that there is a subset of ACCs showing massive chromosomal loss with subsequent whole genome doubling (WGD). The authors state that this chromosomal loss leads to a hypodiploid karyotype. Such a phenomenon “was only matched by chromophobe renal cell carcinoma”. The latter is partly correct. In 2012 we published the occurrence near-haploidisation with or without subsequent endoreduplication (whole-genome doubling) in oncocytic follicular thyroid carcinoma (FTC-OV) and anaplastic thyroid carcinoma (ATC) derived from FTC-OV (Corver et al., 2012). In combined SNP array analysis and DNA content analysis the genomes of these lesions were seen as near-homozygous genomes (NHG) with DNA indices of 0.6-1.4 depending on the absence or presence of endoreduplication. Wagle et al. independently confirmed our observations in the New England Journal of Medicine with the description of one ATC patient who showed a spectacular treatment response upon giving the mTOR inhibitor everolimus. The patient’s ATC derived from FTC-OV and high density SNP analysis clearly identified NHG in the tumor. The phenomenon of NHG with or without endoreduplication is similar to the pattern that is seen by Zheng et al, although the terminology to describe this is slightly different. In 2014 we also showed that in a subset of ACC and parathyroid carcinoma NHG and endoreduplication can be seen, especially in tumors with oncocytic metaplasia (Corver et al., 2014). As seen by Zheng et al the “allelic states” (Corver et al., 2008) in ACC indicated the presence of more chromosomal breakpoints than seen in FTC. In fact similar observations of NHG or widespread chromosomal loss with endoreduplication of the complete genome has been described in peripheral chondrosarcomas (Bovee et al., 2000) and a subset of childhood acute lymphoblastic leukemia (Holmfeldt et al., 2013) and other uncommon cancers (Mandahl et al., 2012). It is intriguing what is eventually responsible for the widespread chromosomal loss with or without endoreduplication. In our model we proposed a stepwise process that might be related to metabolic processes, something that still needs to be proven. It might now be a step forward in understanding the underlying biology of endoreduplication/WGD with the observation of Zheng et al. that TERT expression is higher in the WGD group of ACCs. In conclusion the combined analysis of different tumor types with massive chromosomal loss with subsequent WGD might lead to further insights underlying this remarkable process.

      References:

      Zheng S, Cherniack AD, Dewal N, Moffitt RA, Danilova L, Murray BA, Lerario AM, Else T, Knijnenburg TA, Ciriello G, et al. (2016). Comprehensive Pan-Genomic Characterization of Adrenocortical Carcinoma. Cancer Cell. 29(5):723-36.

      Corver, W. E., Ruano, D., Weijers, K., den Hartog, W. C., van Nieuwenhuizen, M. P., de Miranda, N., van Eijk, R., Middeldorp, A., Jordanova, E. S., Oosting, J., et al. (2012). Genome haploidisation with chromosome 7 retention in oncocytic follicular thyroid carcinoma. PLoS ONE 7, e38287.

      Wagle N, Grabiner BC, Van Allen EM, Amin-Mansour A, Taylor-Weiner A, Rosenberg M, Gray N, Barletta JA, Guo Y, Swanson SJ, et al.(2014) Response and acquired resistance to everolimus in anaplastic thyroid cancer. N Engl J Med. 371(15):1426-33.

      Corver, W. E., van, W. T., Molenaar, K., Schrumpf, M., van den Akker, B., van, E. R., Ruano, N. D., Oosting, J., and Morreau, H. (2014). Near-haploidization significantly associates with oncocytic adrenocortical, thyroid, and parathyroid tumors but not with mitochondrial DNA mutations. Genes Chromosomes Cancer 53, 833-844.

      Corver, W. E., Middeldorp, A., Ter Haar, N. T., Jordanova, E. S., van Puijenbroek, M., van Eijk, R., Cornelisse, C. J., Fleuren, G. J., Morreau, H., Oosting, J., and van Wezel, T. (2008). Genome-wide allelic state analysis on flow-sorted tumor fractions provides an accurate measure of chromosomal aberrations. Cancer Res 68, 10333-10340.

      Bovee, J. V., van Royen, M., Bardoel, A. F., Rosenberg, C., Cornelisse, C. J., Cleton-Jansen, A. M., and Hogendoorn, P. C. (2000). Near-haploidy and subsequent polyploidization characterize the progression of peripheral chondrosarcoma. Am J Pathol 157, 1587-1595.

      Holmfeldt, L., Wei, L., Diaz-Flores, E., Walsh, M., Zhang, J., Ding, L., Payne-Turner, D., Churchman, M., Andersson, A., Chen, S. C., et al. (2013). The genomic landscape of hypodiploid acute lymphoblastic leukemia. Nat Genet 45, 242-252.

      Mandahl, N., Johansson, B., Mertens, F., and Mitelman, F. (2012). Disease-associated patterns of disomic chromosomes in hyperhaploid neoplasms. Genes Chromosomes Cancer 51, 536-544.

      Hans Morreau, also on behalf of Willem Corver and Tom van Wezel, Dept of Pathology, Leiden University Medical Center The Netherlands Email: j.morreau@lumc.nl.

      Note: This comment was also posted on the website of Cancer Cell attached to the manuscript of Zheng et al 2016. This will however not be visible in the PubMed domain. I do not have conflicts of interest to declare.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Jun 18, Raphael Stricker commented:

      Circular Reasoning in CDC Lyme Disease Test Review

      Raphael B. Stricker, MD; Lorraine Johnson, JD, MBA

      Previous studies have shown that commercial two-tier serological testing has a sensitivity of about 46% in later-stage Lyme disease in the USA [1]. Commercial two-tier Lyme testing in Europe demonstrates the same poor test sensitivity [2]. The Table in the latest Centers for Disease Control and Prevention (CDC) review by Moore et al. cites three studies allegedly showing that two-tier Lyme testing in later-stage (“non-cutaneous”) Lyme disease has a sensitivity of 87-96% [3]. These numbers will undoubtedly be used to support two-tier testing as a valid diagnostic tool for Lyme disease. Therefore it is important to understand the circular reasoning that produced these inflated and misleading numbers.

      Analysis of the three studies cited in the CDC review reveals the following:

      +1. Branda et al [4]: Two-tier Lyme test sensitivity 87% (55 patients). The Methods section of this article contains the following language: "All patients categorized as having Lyme disease met the CDC surveillance criteria for the diagnosis.” The reference for this statement [5] contains the CDC surveillance criteria for the diagnosis of Lyme disease. The portion of the CDC surveillance criteria relevant for later Lyme disease is set forth below.

      Clinical case definition:

      1. Erythema migrans, or
      2. At least one late manifestation, as defined below, and laboratory confirmation of infection (emphasis added).

      Laboratory criteria for diagnosis:

      1. Isolation of Borrelia burgdorferi from clinical specimen, or
      2. Demonstration of diagnostic levels of IgM and IgG antibodies to the spirochete in serum or CSF, or
      3. Significant change in IgM or IgG antibody response to B. burgdorferi in paired acute- and convalescent-phase serum samples.

      This surveillance case definition was developed for national reporting of Lyme disease; it is NOT appropriate for clinical diagnosis (emphasis added).

      Comment: Although the Branda et al. study does not say how many later-stage Lyme patients were culture-positive, presumably most were included based on positive serology. Patients who had positive serology as part of the study entry criteria would be expected to have positive serology on the same outcome measure. Circular reasoning.

      +2. Molins et al [6]: Two-tier Lyme test sensitivity 96% (46 patients). The Methods section of this article contains the following language: "Lyme disease serology or results from two-tiered testing did not play a role in patient enrollment except for inclusion of late-stage Lyme arthritis patients (emphasis added).”

      Comment: Once again, patients with later-stage Lyme disease had to have positive serology in order to be included in the study, and then they had positive serology. Circular reasoning.

      +3. Wormser et al [7]: Two-tier Lyme test sensitivity 94% (142 patients). This study was a cost analysis article based on another study [8] that contains the following language: "Lyme arthritis was defined as the presence of joint swelling that was clinically compatible with Lyme arthritis in conjunction with serologic evidence of borrelial infection demonstrated by at least a positive WCS ELISA (emphasis added).”

      Comment: Once again, patients with later-stage Lyme disease had to have positive serology in order to be included in the study, and then they had positive serology. Circular reasoning.

      Conclusions: Based on circular reasoning, the latest CDC analysis perpetuates the myth that two-tier testing is sensitive for later-stage Lyme disease. The comment in the CDC surveillance guidelines that this testing is NOT appropriate for clinical diagnosis is being ignored by the CDC.

      References

      [1] Stricker RB, Johnson L. Lyme disease diagnosis and treatment: Lessons from the AIDS epidemic. Minerva Med. 2010;101:419–25.

      [2] Ang CW, Notermans DW, Hommes M, Simoons-Smit AM, Herremans T. Large differences between test strategies for the detection of anti-Borrelia antibodies are revealed by comparing eight ELISAs and five immunoblots. Eur J Clin Microbiol Infect Dis. 2011;30:1027-32.

      [3] Moore A, Nelson C, Molins C, Mead P, Schriefer M. Current guidelines, common clinical pitfalls, and future directions for laboratory diagnosis of Lyme disease, United States. Emerg Infect Dis. 2016 Jul;22(7). doi: 10.3201/eid2207.151694.

      [4] Branda JA, Linskey K, Kim YA, Steere AC, Ferraro MJ. Two-tiered antibody testing for Lyme disease with use of 2 enzyme immunoassays, a whole-cell sonicate enzyme immunoassay fol¬lowed by a VlsE C6 peptide enzyme immunoassay. Clin Infect Dis. 2011;53:541–7.

      [5] Wharton M, Chorba TL, Vogt RL, Morse DL, Buehler JW. Case definitions for public health surveillance. MMWR Recomm Rep 1990; 39:1–43.

      [6] Molins CR, Sexton C, Young JW, Ashton LV, Pappert R, Beard CB, et al. Collection and characterization of samples for establishment of a serum repository for Lyme disease diagnostic test development and evaluation. J Clin Microbiol. 2014;52:3755–62.

      [7] Wormser GP, Levin A, Soman S, Adenikinju O, Longo MV, Branda JA. Comparative cost-effectiveness of two-tiered testing strategies for serodiagnosis of Lyme disease with noncutaneous manifestations. J Clin Microbiol. 2013;51:4045–9.

      [8] Wormser GP, Schriefer M, Aguero-Rosenfeld ME, Levin A, Steere AC, Nadelman RB, et al. Single-tier testing with the C6 peptide ELISA kit compared with two-tier testing for Lyme disease. Diagn Microbiol Infect Dis. 2013;75:9–15.

      Disclosure: RBS and LJ are members of the International Lyme and Associated Diseases Society (ILADS) and directors of LymeDisease.org. They have no financial or other conflicts to declare.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Dec 26, Kevin Kavanagh commented:

      We have expressed concerns in a previous letter and PubMed Common’s posting regarding the article by Kelly, et al,(1) where the efficacy of the evaluated product may have been overstated.(2, 3) In the authors reply, data was presented which presents less than a 30% reduction(4) as opposed to a 42% which is stated in the article and advertised by the company.(1,5) To our knowledge the peer-review record has not been corrected. In addition, we have concerns regarding at least the appearance of an undeclared conflict-of-interest between one of the article’s authors, Connie Steed, and the company in question, DebMed.(6)

      It has come to the authors’ attention that the editor in charge of adjudicating the above concerns may also have a conflict-of-interest with DebMed and with one of the authors of the manuscript in question. Significant concerns regarding the conflicts of interest of the Editor Elaine Larson have arisen because of the following associations:

      • Co-Author with Connie Steed (one of the authors in the manuscript in question) and Paul Alpert (Vice President of Patient Safety Strategy for DebMed) in an article published in Feb 2011.(7). Conflicts-of-Interest stated the following “Elaine Larson has received research funding from Deb Worldwide Healthcare, Inc.”

      • Co-Author with Paul Alpert (Vice-President of Patient Safety Strategy for DebMed) in an article published in Jan 2013.(8)

      • Co-Author with Paul Alpert (Vice-President of Patient Safety Strategy for DebMed) in an article published in Feb 2014.(9)

      • Connie Steed, RN is listed as the 2016 Secretary for the Association for Professionals in Infection Control and Epidemiology, Inc., which has as its official publication the American Journal of Infection Control(10) and provides this Journal as a benefit of their membership.(11)

      We feel that because of the above, the appearance of a conflict of interest exists which may have clouded the decision making and inhibited the correction of the potential research integrity problems in the article in question.

      References

      (1) Kelly, J.W., Blackhurst, D., McAtee, W., and Steed, C. Electronic hand hygiene monitoring as a tool for reducing health care-associated methicillin-resistant Staphylococcus aureus infection. Am J Infect Control. 2016; 44: 956–95 Kelly JW, 2016

      (2) Kavanagh KT, Saman DM. Comment Regarding: Electronic hand hygiene monitoring as a tool for reducing health care–associated methicillin-resistant Staphylococcus aureus infection. American Journal of infection Control. December 01 2016 http://www.ajicjournal.org/article/S0196-6553(16)30904-X/fulltext

      (3) Kavanagh KT, Saman DM. Comment on PMID: 27908437: Response to Letter Regarding Manuscript “Electronic Hand Hygiene Monitoring as a Tool for Reducing Nosocomial Methicillin-resistant Staphylococcus aureus Infection” In: PubMed Commons [Internet]. Bethesda (MD): National Library of Medicine; 2016 Dec. 16. Available from: https://www.ncbi.nlm.nih.gov/pubmed/27908437#cm27908437_34333

      (4) Kelly JW, Blackhurst D, McAtee W, Steed C. Response to Letter Regarding Manuscript "Electronic Hand Hygiene Monitoring as a Tool for Reducing Nosocomial Methicillin-resistant Staphylococcus aureus Infection". Am J Infect Control. 2016 Dec 1;44(12):1763. doi>: 10.1016/j.ajic.2016.08.009. http://www.ajicjournal.org/article/S0196-6553(16)30812-4/fulltext Kelly JW, 2016

      (5) DebMed: Discover how one facility was able to reduce MRSA HAIs by up to 42%. Last accessed on Dec. 21, 2017 from http://info.debmed.com/mrsa-study-flyer

      (6) Hospital Reduces MRSA Rates by 42% with electronic hand hygiene measurement. Infection Control Today. July 8, 2016. http://www.infectioncontroltoday.com/news/2016/07/hospital-reduces-mrsa-rates-by-42-with-electronic-hand-hygiene-measurement.aspx

      (7) Connie Steed, MSN, RN, CIC J. William Kelly, MD Dawn Blackhurst, DrPH Sue Boeker, BSN, RN, CIC Thomas Diller, MD, MMM Paul Alper, BA Elaine Larson, RN, PhD, FAAN, CIC Hospital hand hygiene opportunities: Where and when (HOW2)? The HOW2 Benchmark Study. American Journal of Infection Control. Feb 2011 39(1):19-26. Steed C, 2011

      (8) Buet A, Cohen B, Marine M, Scully F, Alper P, Simpser E, Saiman L, Larson E. Hand hygiene opportunities in pediatric extended care facilities. J Pediatr Nurs. 2013 Jan;28(1):72-6. doi: 10.1016/j.pedn.2012.04.010. Epub 2012 Jun 1. Buet A, 2013

      (9) Conway LJ, Riley L, Saiman L, Cohen B, Alper P, Larson EL. Implementation and impact of an automated group monitoring and feedback system to promote hand hygiene among health care personnel. Jt Comm J Qual Patient Saf. 2014 Sep;40(9):408-17. Conway LJ, 2014

      (10) American Journal of Infection Control Home Page. Accessed on Dec. 26, 2017 from https://www.journals.elsevier.com/ajic-american-journal-of-infection-control

      (11) Association for Professionals in Infection Control and Epidemiology, Inc. Web Posting. Accessed on Dec. 26, 2017 from http://www.ajicjournal.org/article/S0196-6553(15)01270-5/pdf

      Comment also posted on PubPeer


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Dec 22, Holger Schunemann commented:

      Error in author listing; the correct citation for this article is http://www.bmj.com/content/354/bmj.i3507: BMJ. 2016 Jul 20;354:i3507. doi: 10.1136/bmj.i3507. When and how to update systematic reviews: consensus and checklist. Garner P, Hopewell S, Chandler J, MacLehose H, Akl EA, Beyene J, Chang S, Churchill R, Dearness K, Guyatt G, Lefebvre C, Liles B, Marshall R, Martínez García L, Mavergames C, Nasser M, Qaseem A, Sampson M, Soares-Weiser K, Takwoingi Y, Thabane L, Trivella M, Tugwell P, Welsh E, Wilson EC, Schünemann HJ


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Sep 30, Paul Brookes commented:

      I submitted a response to this opinion piece to the journal (Circ. Res.), but unfortunately was informed that they do not accept or publish correspondence related to this type of article. So, here's my un-published letter, which raises a number of issues with the article...

      A recent Circ. Res. viewpointLoscalzo J, 2016 discussed the complex relationships between redox biology and metabolism in the setting of hypoxia, with an emphasis on the use of biochemically correct terminology. While there is broad agreement that the field of redox biology is often confounded by use of inappropriate methods and language Kalyanaraman B, 2012,Forman HJ, 2015, concern is raised regarding some ideas on reductive stress in the latter part of the article.

      In discussing the fate of glycolytically-derived NADH in hypoxia, the reader is urged to “Remember that while redirecting glucose metabolism to glycolysis decreases NADH production by the TCA cycle and decreases leaky electron transport chain flux, glycolysis continues to produce NADH". First, glucose undergoes glycolysis regardless of cellular oxygenation status; this simply happens at a faster rate in hypoxia. As such, glucose is not redirected but rather its product pyruvate is. Second, regardless a proposed lower rate of NADH generation by the TCA cycle (which may not actually be the case Chouchani ET, 2014,Hochachka PW, 1975) NADH still accumulates in hypoxic mitochondria because its major consumer, the O2-dependent respiratory chain, is inhibited. It is clear that both NADH consumers and producers can determine the NADH/NAD+ ratio, and in hypoxia the consumption side of the equation cannot be forgotten.

      While the field is in broad agreement that NADH accumulates in hypoxia, the piece goes on to claim that “How the cell handles this mounting pool of reducing equivalents remained enigmatic until recently.” This is misleading. The defining characteristic of hypoxia, one that has dominated the literature in the nearly 90 years since Warburg's seminal work Warburg O, 1927, is the generation of lactate by lactate dehydrogenase (LDH), a key NADH consuming reaction that permits glycolysis to continue. Lactate is “How cells handle the mounting pool of reducing equivalents.”

      Without mentioning lactate, an alternate fate for hypoxic NADH is proposed, based on the recent discovery that both LDH and malate dehydrogenase (MDH) can use NADH to drive the reduction of 2-oxoglutarate (α-ketoglutarate, α-KG) to the L(S)-enantiomer of 2-hydroxyglutarate (L-2-HG) under hypoxic conditions Oldham WM, 2015,Intlekofer AM, 2015. We also found elevated 2-HG in the ischemic preconditioned heart Nadtochiy SM, 2015, and recently reported that acidic pH – a common feature of hypoxia – can promote 2-HG generation by LDH and MDH Nadtochiy SM, 2016.

      While there can be little doubt that the discovery of hypoxic L-2-HG accumulation is an important milestone in understanding hypoxic metabolism and signaling, the claim that L-2-HG is “a reservoir for reducing equivalents and buffers NADH/NAD+” is troublesome on several counts. From a quantitative standpoint, we reported the canonical activities of LDH (pyruvate + NADH --> lactate + NAD+) and of MDH (oxaloacetate + NADH --> malate + NAD+) are at least 3-orders of magnitude greater than the rates at which these enzymes can reduce α-KG to L-2-HG Nadtochiy SM, 2016. This is in agreement with an earlier study reporting a catalytic efficiency ratio of 10<sup>7</sup> for the canonical vs. L-2-HG generating activities of MDH Rzem R, 2007. Given these constraints, we consider it unlikely that the generation of L-2-HG by these enzymes is a quantitatively important NADH sink, compared to their native reactions. It is also misleading to refer to the α-KG --> L-2-HG reaction as a "reservoir for reducing equivalents", because even though this reaction consumes NADH, it is not clear whether the reverse reaction regenerates NADH. Specifically, the metabolite rescue enzyme L-2-HG-dehydrogenase uses an FAD electron acceptor and is not known to consume NAD+ Nadtochiy SM, 2016,Rzem R, 2007,Weil-Malherbe H, 1937.

      Another potentially important sink for reducing equivalents in hypoxia that was not mentioned, is succinate. During hypoxia, NADH oxidation by mitochondrial complex I can drive the reversal of complex II (succinate dehydrogenase) to reduce fumarate to succinate Chouchani ET, 2014. This redox circuit, in which fumarate replaces oxygen as an electron acceptor for respiration, was first hinted at over 50 years ago SANADI DR, 1963. Importantly (and in contrast to L-2-HG as mentioned above), the metabolites recovered upon withdrawal from a fumarate --> succinate "electron bank" are the same as those deposited.

      Although recent attention has focused on the pathologic effects of accumulated succinate in driving ROS generation at tissue reperfusion Chouchani ET, 2014,Pell VR, 2016, the physiologic importance of hypoxic complex II reversal as a redox reservoir and as an evolutionarily-conserved survival mechanism Hochachka PW, 1975 should not be overlooked. Quantitatively, the levels of lactate and succinate accumulated during hypoxia are comparable Hochachka PW, 1975, and both are several orders of magnitude greater than reported hypoxic 2-HG levels.

      While overall the article makes a number of important points regarding reductive stress and the correct use of terminology in this field, we feel that the currently available data do not support a quantitatively significant role for L-2-HG as a hypoxic reservoir for reducing equivalents. These quantitative limitations do not diminish the potential importance of L-2-HG as a hypoxic signaling molecule Nadtochiy SM, 2016,Su X, 2016,Xu W, 2011.

      Paul S. Brookes, PhD.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 May 16, Michael Stillman commented:

      I read this article with great interest. And with significant concern.

      A sweeping review by the Department of Health and Human Services' Office for Human Research Protections of Dr. Harkema's spinal cord injury research program (https://www.hhs.gov/ohrp/compliance-and-reporting/determination-letters/2016/october-17-2016-university-louisville/index.html accessed May 16, 2017) documented numerous instances of sloppy methodologies and potential frank scientific misconduct. This report included evidence of: a) missing source documents, leading to an inability to verify whether protocols had been followed or captured data was valid; b) multiple instances of unapproved deviations from experiments protocols; c) participants having been injured while participating in translational research experiments; d) a failure to document and adjudicate adverse events and to report unanticipated problems to the IRB; and e) subjects being misled about the cost of participating in research protocols. Dr. Harkema's conduct was so concerning that the National Institute of Disability, Independent Living, and Rehabilitation Research (NIDILRR) prematurely halted and defunded one of her major research projects (http://kycir.org/2016/07/11/top-u-of-l-researcher-loses-federal-funding-for-paralysis-study/ accessed May 26, 2017).

      I approached the editors of "Journal of Neurotrauma" with reports from both Health and Human Services (above) and University of Louisville's IRB and asked them three questions: a) were they adequately concerned with this study's integrity to consider a retraction; b) were they adequately concerned to consider publishing a "concerned" letter to the editor questioning the study's integrity and reliability; and c) were they interested in reviewing adverse events associated with the experiments. Their response: "no," "no," and "no."

      I call on the editorial board of "Journal of Neurotrauma" to carefully inspect all documents and data sets related to this work. I would further expect them to review all adverse events reports, and to demand evidence that they've been reviewed and adjudicated by an independent medical monitor or study physician. Short of this, this work remains specious.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Feb 06, GARRET STUBER commented:

      *This review was completed as part of a graduate level circuits and behavior course at UNC-Chapel Hill. The critique was written by students in the class and edited by the instructor, Garret Stuber.

      Comments and critique

      Written by Li et al., this paper investigated a class of oxytocin receptor interneurons (OxtrINs) on which the same group first characterized in 2014 [1]. OxtrINs are a subset of somatostatin positive interneurons in the medial prefrontal cortex (mPFC) that seem to be important for sociosexual behaviors in females, specifically during estrus and not diestrus. To complement their previous story, here the authors concluded that OxtrINs in males regulate anxiety-related behaviors through the release of corticotropin releasing hormone binding protein (Crhbp). While we agree that these neurons could be mediating sexually dimorphic behaviors, it is unclear how robust these differences really are.

      We had some technical issues with this paper. First, it is unclear exactly how many mice were allotted to each experimental group, and it would have been useful to see individual data in each of the behavioral experiments, so that we can better understand some of the variability in the authors’ graphs. Even among different experiments, there were variable sizes of n (e.g. Fig. 5F-H, “n = 8-14 mice per group”). There was also no mention of how many cells per animal were tested for each brain slice experiment; instead, we received total numbers of cells tested per group. This paper did not include the complementary female data to Fig. 4F-G and Fig. 5A-B, the experiments pairing blue light with Crhr1 antagonist or Crhbp antagonist. We would have appreciated seeing this data adjacent to that for the males. In addition, there was no mentioned control for the optogenetic experiments. The authors only compared responses between light on and light off trials. Typically in optogenetic approaches, a set of control mice are also implanted with optic fibers and flashed with blue light in the absence of virus to test whether the light alone influences behavior. Incidentally, there is evidence that blue light influences blood flow, which may affect neuronal activity [2]. It was also unclear during the sociosexual behavioral testing whether the males were exposed to females in estrus or diestrus. In all, lack of detailed sample sizes and controls made it difficult to assess how prominent these sex differences were.

      These issues aside, knocking out endogenous Oxtr in their targeted interneuron population was a key experiment, as it demonstrated that oxytocin signaling in OxtrINs is important in anxiety-related behaviors in males, but not in females regardless of the estrus stage. They did this using a floxed Oxtr mouse and deleted OxtR using a Cre-inducible virus, allowing for temporal and cell-type-specific control of this deletion, and subsequently measured the resulting phenotype using an elevated plus maze and open field task. The authors also validated that changes in exploration were not due to hyperactivity. We think these experiments are convincing.

      TRAP profiling, which the same research group pioneered in 2014 [3], provided a set of genes enriched in OxtrINs. TRAP targets RNAs while they are translated into proteins, so we think their results here are particularly relevant. Moreover, the authors provided a list of genes enriched in sex-specific OxtrINs, a useful resource for those interested in gene expression differences in males and females. Once they identified Crhbp, an inhibitor of Crh, they hypothesized that OxtrINs were releasing Crhbp to modulate anxiogenic behaviors in males. The authors next measured Crh levels in the paraventricular nucleus of the hypothalamus and found that Crh levels are higher in females than males. They thus concluded Crh levels were driving sex differences associated with OxtrINs. We wonder whether Crh levels are also higher in the female mPFC, but we agree here too.

      To demonstrate that Crhbp expressed by OxtrINs is important in modulating anxiety-like behaviors in males, the authors targeted Crhbp mRNA using Cre-inducible viral delivery of an shRNA construct and subsequently tested anxiety-related behaviors. They found that knocking down Crhbp was anxiogenic in males and not in females. This was a critical experiment, but the shRNA constructs targeting Crhbp were validated solely in a cell line. It would have been more appropriate to perform a western blot on mPFC punches of adult mice, showing whether this lentiviral construct knocked down Crhbp expression in the mouse brain prior to behavioral testing. In fact, it also would have been useful to see a quantification of the shRNA transfection rate, as well as its specificity in vivo. As stated above, we also do not know the distribution of behavioral responses here either. Without these pieces of information, it is difficult to assess how reliable or robust their knockdown was.

      The authors concluded that sexually dimorphic hormones act through the otherwise sexually monomorphic OxtrINs to regulate anxiety-related behaviors in males and sociosexual behaviors in females. We agree that OxtrINs interact with oxytocin and Crh to bring about sex-specific phenotypes, but we also think that using additional paradigms testing anxiety and social behaviors, such as a predator odor, novelty-suppressed feeding or social grooming, could shed more light on the nuances of mPFC circuitry. In addition, the authors suggested that OxtrINs are sexually monomorphic because they are equally abundant in males and females. The authors’ TRAP data however suggested that OxtrINs of males and females have different gene expression profiles (Table S2), thus indicating that these interneurons may form different connections in each sex that mediate the electrophysiological and behavioral differences we see in this study.

      It would be interesting to overexpress Crhbp in female mice, preferably in a cell-type-specific manner, to see whether female mice would demonstrate the anxiety-like behavior seen in males. If the Crh:Crhbp balance is in fact mediating this sexually dimorphic behavior through OxtrINs, we would expect that doing these manipulations may “masculinize” the females’ behavior. Regardless, we believe that this study opens opportunities for future work into how oxytocin and Crh release from the hypothalamus may act together to coordinate behavior. It will also be interesting to see if single-cell RNA sequencing could provide insight into whether OxtrINs can be further divided into sexually dimorphic subtypes. As the authors pointed out, understanding the dynamics of Crh and oxytocin in the mPFC will be important for gender-specific therapy and treatment.

      [1] Nakajima, M. et al. Oxytocin modulates female sociosexual behavior through a specific class of prefrontal cortical interneurons. Cell. 159, 295-305 (2014).

      [2] Rungta, R. L. et al. Light controls cerebral blood flow in naïve animals. Nature Communications. 8, 14191 (2017).

      [3] Heiman, M. et al. Cell-type-specific mRNA purification by translating ribosome affinity purification (TRAP). Nature Protocols. 9, 1282-1291 (2014).


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Feb 13, David Reardon commented:

      This analysis of perinatal psychiatric episodes by Munk-Olsen T, 2016<sup>1</sup> is flawed by the failure to examine the effects of prior pregnancy losses. Numerous studies have shown that prior fetal loss, either from miscarriage, stillbirth, or induced abortion, increases the risk psychiatric disorders during and after subsequent pregnancies.<sup>2-7</sup> There is even a dose effect, with multiple losses associated with elevated rates compared to a single loss.<sup>2</sup>

      Notably, the heightened risk of mental illness following miscarriage and abortion have also been confirmed by several of Munk-Olsen’s own studies.<sup>8-10</sup> Unfortunately, while abortion was used as a control variable in two cases, the effects were not described.<sup>8,10</sup>

      In light of the literature, Munk-Olsen T, 2016's conclusion that it is not possible to “predict which women will become ill postpartum”<sup>1</sup> is an overstatement. There is strong evidence that prior fetal loss is risk factor.

      It is strongly recommended that the authors of this most recent study<sup>1</sup> should publish a reanalysis showing the effects of prior pregnancy loss relative to (a) one or more abortions and (b) one or more miscarriages or other natural losses. These results could lead to improved screening to identify women who may benefit from additional care.

      Editors and peer reviewers should be alert to the recommendation that all studies relative to the intersection between mental and reproductive health should always consider the effects of prior pregnancy loss.<sup>11-13</sup> In particular, both the Royal College of Psychiatrists<sup>14</sup> and the American Psychological Association<sup>15</sup> have lamented the lack of high quality studies examining the statistical associations between abortion and mental health. Record linkage studies from national data sets, such as that examined by Munk-Olsen, can help to fill this gap of knowledge . . . but only if they include analyses examining these effects.

      References

      1) Munk-Olsen T, Maegbaek ML, Johannsen BM, et al. Perinatal psychiatric episodes: a population-based study on treatment incidence and prevalence. Transl Psychiatry. 2016;6(10):e919. doi:10.1038/tp.2016.190.

      2) Giannandrea SAM, Cerulli C, Anson E, Chaudron LH. Increased risk for postpartum psychiatric disorders among women with past pregnancy loss. J Womens Health (Larchmt). 2013;22(9):760-768. doi:10.1089/jwh.2012.4011.

      3) Gong X, Hao J, Tao F, et al. Pregnancy loss and anxiety and depression during subsequent pregnancies: data from the C-ABC study. Eur J Obstet Gynecol Reprod Biol. 2013;166(1):30-36. doi:10.1016/j.ejogrb.2012.09.024.

      4) Blackmore ER, Côté-Arsenault D, Tang W, et al. Previous prenatal loss as a predictor of perinatal depression and anxiety. Br J Psychiatry. 2011;198(5):373-378. doi:10.1192/bjp.bp.110.083105.

      5) Räisänen S, Lehto SM, Nielsen HS, Gissler M, Kramer MR, Heinonen S. Risk factors for and perinatal outcomes of major depression during pregnancy: a population-based analysis during 2002-2010 in Finland. BMJ Open. 2014;4(11):e004883. doi:10.1136/bmjopen-2014-004883.

      6) Montmasson H, Bertrand P, Perrotin F, El-Hage W. Facteurs prédictifs de l’état de stress post-traumatique du postpartum chez la primipare. J Gynécologie Obs Biol la Reprod. 2012;41(6):553-560. doi:10.1016/j.jgyn.2012.04.010.

      7) McCarthy F, Moss-Morris R, Khashan A, et al. Previous pregnancy loss has an adverse impact on distress and behaviour in subsequent pregnancy. BJOG An Int J Obstet Gynaecol. 2015;122(13):1757-1764. doi:10.1111/1471-0528.13233.

      8) Munk-Olsen T, Bech BH, Vestergaard M, Li J, Olsen J, Laursen TM. Psychiatric disorders following fetal death: a population-based cohort study. BMJ Open. 2014:1-6. doi:10.1136/bmjopen-2014-005187.

      9) Meltzer-Brody S, Maegbaek ML, Medland SE, Miller WC, Sullivan P, Munk-Olsen T. Obstetrical, pregnancy and socio-economic predictors for new-onset severe postpartum psychiatric disorders in primiparous women. Psychol Med. 2017:1-15. doi:10.1017/S0033291716003020.

      10) Munk-Olsen T, Agerbo E. Does childbirth cause psychiatric disorders? A population-based study paralleling a natural experiment. Epidemiology. 2015;26(1):79-84. doi:10.1097/EDE.0000000000000193.

      11) Reardon DC. Lack of pregnancy loss history mars depression study. Acta Psychiatr Scand. 2012;126(2):155. doi:10.1111/j.1600-0447.2012.01880.x.

      12) Sullins DP. Abortion, substance abuse and mental health in early adulthood: Thirteen-year longitudinal evidence from the United States. SAGE Open Med. 2016;4(0):2050312116665997. doi:10.1177/2050312116665997.

      13) Coleman PK. Abortion and mental health: Quantitative synthesis and analysis of research published 1995-2009. Br J Psychiatry. 2011;199(3):180-186.

      14) National Collaborating Centre for Mental Health. Induced Abortion and Mental Health: A Systematic Review of the Mental Health Outcomes of Induced Abortion, Including Their Prevalence and Associated Factors. London, UK: Academy of Medical Royal Colleges; 2011. http://www.aomrc.org.uk/wp-content/uploads/2016/05/Induced_Abortion_Mental_Health_1211.pdf.

      15) Major B, Appelbaum M, Beckman L, Dutton MA, Russo NF, West C. Report of the APA Task Force on Mental Health and Abortion. Washington, DC: American Psychological Association; 2008. http://www.apa.org/pi/women/programs/abortion/mental-health.pdf.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 May 11, Jean-Pierre Bayley commented:

      Should we screen carriers of maternally inherited SDHD mutations?

      Jean-Pierre Bayley (1), Jeroen C Jansen (2), Eleonora P M Corssmit (3) and Frederik J Hes (4) 1. Department of Human Genetics, 2. Department of Otorhinolaryngology, 3. Department of Endocrinology and Metabolic Diseases, 4. Department of Clinical Genetics, Leiden University Medical Center, Leiden, the Netherlands

      We wish to comment on the above paper by Burnichon and colleagues: Burnichon N, et al. Risk assessment of maternally inherited SDHD paraganglioma and phaeochromocytoma. J Med Genet. 2017; 54:125-133. 3

      In this paper a prospective study is presented that identified and described development of pheochromocytoma in a carrier of an SDHD mutation. Although at first sight not an uncommon occurrence in carriers of these mutations, this case is unusual because the mutation was inherited via the maternal line. This is now only the third reported case of confirmed phaeochromocytoma development following maternal transmission of an SDHD mutation. (1-3) The patient in question was identified amongst a cohort of 20 maternal mutation carriers who underwent imaging surveillance. Based on the identification of one patient in this cohort (5%), the authors make recommendations for the clinical care of carriers of a maternally inherited SDHD mutation. They advise targeted familial genetic testing from the age of 18 in families with SDHD mutations, and that identified carriers undergo imaging and biochemical workup to detect asymptomatic tumours. If the first workup is negative, the authors suggest that patients be informed about paraganglioma-phaeochromocytoma (PPGL) symptoms and recommend an annual clinical examination and blood pressure measurement, with a new workup indicated in case of symptoms suggestive of PPGL. Although this paper is a meaningful contribution to the literature, we are concerned that the authors base their subsequent clinical recommendations on a relatively small cohort. In a recent study, we described one confirmed case of maternal transmission and concluded that “we consider the increase in risk represented by these reports to be negligible.” (2)

      Two reasons underlie this statement. Firstly, the somatic rearrangements underlying the maternal cases identified to date are far more complex (loss of the paternal wild-type SDHD allele by mitotic recombination, followed by loss of the recombined paternal chromosome containing the paternal 11q23 region and the maternal 11p15 region) than the molecular events seen in paternal cases (loss of whole chromosome 11). Secondly, our conclusions were based, implicitly, on many previous studies at our centre over the past three decades in which we described various aspects of the large SDHD cohort collected by us over that period. Genetic aspects of this cohort, and 601 patients with paternally transmitted SDHD mutations, were described by Hensen and co-workers in 2012. (4) As all previous studies suggest that mutations are equally transmissible via the paternal or maternal line, our identification of a single maternal case amongst this cohort suggests that the penetrance of maternally transmitted mutations is very low. Using the calculation employed by Burnichon and colleagues and assuming that at least 600 maternal mutation carriers are alive in the Netherlands, we arrive at an estimate of 0.17% (1/601 = 0.17%), rather than their figure of 5%. In addition to our own cohort, 1000’s of SDHD mutation carriers have been identified world-wide. Assuming that 1 in 20 maternally transmitted mutations result in tumours, many more maternally inherited cases would have come to our attention, even without surveillance.

      In our opinion the question of management of maternally inherited SDHD mutations comes down to a risk-benefit analysis. The most obvious implication of the recommendations made by Burnichon and colleagues in our patient population would be the institution of surveillance, with all the attendant practical, financial and psychological burdens for 600 carriers of maternally inherited SDHD mutations in order to identify a single case. Furthermore, SDHD-associated PPGL mortality rates and survival in a Dutch cohort of SDHD variant carriers was not substantially increased compared with the general population. (5) In practice, carriers of maternally inherited SDHD mutations at our centre are not advised to undergo surveillance. Instead, we reassure them that their risk of developing PPGL is exceptionally low (described three times worldwide), but that they should be aware, more so than the general population, of symptoms that are suggestive of paraganglioma or phaeochromocytoma. Many families have been in our care for over 25 years and in that time we have found no evidence to suggest that this policy should be revised.

      NB. A version of this comment has been posted on the Journal of Medical Genetics website and has been commented on in turn by Burnichon and colleagues.

      References

      1.Yeap PM, Tobias ES, Mavraki E, Fletcher A, Bradshaw N, Freel EM, Cooke A, Murday VA, Davidson HR, Perry CG, Lindsay RS. Molecular analysis of pheochromocytoma after maternal transmission of SDHD mutation elucidates mechanism of parent-of-origin effect. J Clin Endocrinol Metab 2011;96:E2009-E2013.

      2.Bayley JP, Oldenburg RA, Nuk J, Hoekstra AS, van der Meer CA, Korpershoek E, McGillivray B, Corssmit EP, Dinjens WN, de Krijger RR, Devilee P, Jansen JC, Hes FJ. Paraganglioma and pheochromocytoma upon maternal transmission of SDHD mutations. BMC Med Genet 2014;15:111.

      3.Burnichon N, Mazzella JM, Drui D, Amar L, Bertherat J, Coupier I, Delemer B, Guilhem I, Herman P, Kerlan V, Tabarin A, Wion N, Lahlou-Laforet K, Favier J, Gimenez-Roqueplo AP. Risk assessment of maternally inherited SDHD paraganglioma and phaeochromocytoma. J Med Genet 2017;54:125-33.

      4.Hensen EF, van DN, Jansen JC, Corssmit EP, Tops CM, Romijn JA, Vriends AH, Van Der Mey AG, Cornelisse CJ, Devilee P, Bayley JP. High prevalence of founder mutations of the succinate dehydrogenase genes in the Netherlands. Clin Genet 2012;81:284-8.

      5.van Hulsteijn LT, Heesterman B, Jansen JC, Bayley JP, Hes FJ, Corssmit EP, Dekkers OM. No evidence for increased mortality in SDHD variant carriers compared with the general population. Eur J Hum Genet 2015;23:1713-6.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Feb 14, Mark Schiffman commented:

      Prophylactic HPV vaccines consist of the major coat protein L1 assembled into macromolecular structures – virus like particles (VLPs) that mimic the geometry and morphology of the wild type virus coat or capsid but do not contain full length HPV DNA genomes. VLPs, with their repeat crystalline array of L1 pentamers as in the wild type virus, are intrinsically immunogenic(1) eliciting high antibody titres with or without adjuvant(2). The safety profile of the licensed vaccines was assessed extensively in randomized clinical trials (RCTs)(3-5). In the 10 years since the first 2 commercial vaccines Gardasil and Cervarix were licensed, the safety profile has been intensively monitored in the post-licensure setting by robust pharmacovigilance using both passive and active surveillance (3, 6). These studies, which collectively have included millions of subjects, provide no evidence whatsoever to support the speculation that HPV vaccines by virtue of their protein content, adjuvants or any other element within the formulation –could induce, trigger or exacerbate auto-immune disorders, thromboembolic events, demyelinating diseases or other chronic conditions.<br> The Global Advisory Committee on Vaccine Safety of the World Health Organisation has reviewed the safety data for HPV vaccines on several occasions http://www.who.int/vaccine_safety/committee/topics/hpv/en/ GACVS stated in 2014: “In summary, the GACVS continues to closely monitor the safety of HPV vaccines and, based on a careful examination of the available evidence, continues to affirm that its benefit-risk profile remains favorable. The Committee is concerned, however, by the claims of harm that are being raised on the basis of anecdotal observations and reports in the absence of biological or epidemiological substantiation. While the reporting of adverse events following immunization by the public and health care providers should be encouraged and remains the cornerstone of safety surveillance, their interpretation requires due diligence and great care. As stated before, allegations of harm from vaccination based on weak evidence can lead to real harm when, as a result, safe and effective vaccines cease to be used. To date, there is no scientific evidence that aluminium-containing vaccines cause harm, that the presence of aluminium at the injection site (the MMF “tattoo”) is related to any autoimmune syndrome, and that HPV DNA fragments are responsible for inflammation, cerebral vasculitis or other immune-mediated phenomena.” http://www.who.int/vaccine_safety/committee/topics/hpv/GACVS_Statement_HPV_12_Mar_2014.pdf Efficacy against vaccine type high grade cervical intraepithelial neoplasia CIN3 (the well-established precursor of cervical cancer(7)) has been demonstrated for the vaccines in the relevant RCTs (8-10). Cervical cancer cannot be used for ethical reasons as an end point in clinical trials (7). With regard to screening, contrary to the misleading comments by Dr. Lee, there is a large and authoritative body of evidence (including many RCTs) showing that any of the approved HPV tests is substantially more sensitive for detection of CIN2, CIN3, or cancer than cytology (11). The figure he quotes of 58% sensitivity is the result of a controversial application of “verification bias adjustment” in detection of CIN2 or worse, in a single trial. Large systematic reviews have consistently reported much higher sensitivity of HPV testing compared to cytology (12). The sensitivity of HPV testing is not at issue; rather specificity is a concern. As we emphasized in the article, HPV testing does require a secondary triage method to identify persistent infection and cancer precursors that require treatment, because HPV is very common and most infections “clear”. There are several choice of triage strategy prior to treatment; HPV typing and cytology or its analogues are most often proposed. Automated methods will soon be available. Carcinogenic human papillomavirus infections are a global public health problem, >80 % of the annual ≥530,000 cervical cancer cases occur in resource poor countries in which the disease is often incurable (13). Whatever preventive measures are adopted, evaluating the impact of interventions to control infection and disease requires a global perspective; from this perspective the promise of HPV vaccination and HPV testing are overwhelmingly supported by highly credible data. • Mark Schiffman • , John Doorbar • , Nicolas Wentzensen • , Silvia de Sanjosé • , Carole Fakhry • , Bradley J. Monk • , Margaret A. Stanley • & Silvia Franceschi  

      1. Bachmann MF, Zinkernagel RM. The influence of virus structure on antibody responses and virus serotype formation. Immunology today. 1996;17(12):553-8.
      2. Harro CD, Pang YY, Roden RB, Hildesheim A, Wang Z, Reynolds MJ, et al. Safety and immunogenicity trial in adult volunteers of a human papillomavirus 16 L1 virus-like particle vaccine. J Natl Cancer Inst. 2001;93(Feb 21. 4): 284-492.
      3. Vichnin M, Bonanni P, Klein NP, Garland SM, Block SL, Kjaer SK, et al. An Overview of Quadrivalent Human Papillomavirus Vaccine Safety: 2006 to 2015. Pediatr Infect Dis J. 2015;34(9):983-91.
      4. Moreira ED, Jr., Block SL, Ferris D, Giuliano AR, Iversen OE, Joura EA, et al. Safety Profile of the 9-Valent HPV Vaccine: A Combined Analysis of 7 Phase III Clinical Trials. Pediatrics. 2016.
      5. Descamps D, Hardt K, Spiessens B, Izurieta P, Verstraeten T, Breuer T, et al. Safety of human papillomavirus (HPV)-16/18 AS04-adjuvanted vaccine for cervical cancer prevention: A pooled analysis of 11 clinical trials. Hum Vaccin. 2009;5(5).
      6. Angelo MG, Zima J, Tavares Da Silva F, Baril L, Arellano F. Post-licensure safety surveillance for human papillomavirus-16/18-AS04-adjuvanted vaccine: more than 4 years of experience. Pharmacoepidemiol Drug Saf. 2014;23(5):456-65.
      7. Pagliusi SR, Teresa Aguado M. Efficacy and other milestones for human papillomavirus vaccine introduction. Vaccine. 2004;23(Dec 16. 5):569-78.
      8. Future II Study Group. Quadrivalent vaccine against human papillomavirus to prevent high-grade cervical lesions. The New England journal of medicine. 2007;356(19):1915-27.
      9. Lehtinen M, Paavonen J, Wheeler CM, Jaisamrarn U, Garland SM, Castellsague X, et al. Overall efficacy of HPV-16/18 AS04-adjuvanted vaccine against grade 3 or greater cervical intraepithelial neoplasia: 4-year end-of-study analysis of the randomised, double-blind PATRICIA trial. Lancet Oncol. 2012;13(1):89-99.
      10. Joura EA, Giuliano AR, Iversen OE, Bouchard C, Mao C, Mehlsen J, et al. A 9-valent HPV vaccine against infection and intraepithelial neoplasia in women. The New England journal of medicine. 2015;372(8):711-23.
      11. Ronco G, Dillner J, Elfström KM, Tunesi S, Snijders PJ, Arbyn M, Kitchener H, Segnan N, Gilham C, Giorgi-Rossi P, Berkhof J, Peto J, Meijer CJ; International HPV screening working group.. Efficacy of HPV-based screening for prevention of invasive cervical cancer: follow-up of four European randomised controlled trials. Lancet. 2014 Feb 8;383(9916):524-32. Erratum in: Lancet. 2015 Oct 10;386(10002):1446.<br>
      12. Arbyn M, Ronco G, Anttila A, Meijer CJLM, Poljak M, Ogilvie G et al. Evidence Regarding Human Papillomavirus Testing in Secondary Prevention of Cervical Cancer. Vaccine. 2012; 30 Suppl 5:F88-99.
      13. Plummer M, de Martel C, Vignat J, Ferlay J, Bray F, Franceschi S. Global burden of cancers attributable to infections in 2012: a synthetic analysis. Lancet Glob Health. 2016 Sep;4(9):e609-16. doi: 10.1016/S2214-109X(16)30143-7.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Dec 07, Raphael Stricker commented:

      Serological Test Sensitivity in Late Lyme Disease.

      Raphael B. Stricker, MD<br> Union Square Medical Associates San Francisco, CA rstricker@usmamed.com

      Cook and Puri have written an excellent review of the sorry state of commercial two-tier testing for Lyme disease (1). Unfortunately the authors failed to address the myth of high serological test sensitivity in late Lyme disease.

      In the review, Figure 4 and Table 7 show a mean two-tier serological test sensitivity of 87.3-95.8% for late Lyme arthritis, neuroborreliosis and Lyme carditis. However, this apparently high sensitivity is based on circular reasoning: in order for patients to be diagnosed with these late conditions, they were required to have clinical symptoms AND POSITIVE SEROLOGICAL TESTING. Then guess what, they had positive serological testing! This spurious circular reasoning invalidates the high sensitivity rate and should have been pointed out by the authors of the review.

      As an example, the study by Bacon et al. (2) contains the following language: "For late disease, the case definition requires at least one late manifestation AND LABORATORY CONFIRMATION OF INFECTION, and therefore the possibility of selection bias toward reactive samples cannot be discounted" (emphasis added). Other studies of late Lyme disease using spurious circular reasoning to prove high sensitivity of two-tier serological testing have been discussed elsewhere (3-5).

      In the ongoing controversy over Lyme disease, it is important to avoid propagation of myths about the tickborne illness, and insightful analysis of flawed reasoning is the best way to accomplish this goal.

      References 1. Cook MJ, Puri BK. Commercial test kits for detection of Lyme borreliosis: a meta-analysis of test accuracy. Int J Gen Med 2016;9:427–40. 2. Bacon RM, Biggerstaff BJ, Schriefer ME, et al. Serodiagnosis of Lyme disease by kinetic enzyme-linked immunosorbent assay using recombinant VlsE1 or peptide antigens of Borrelia burgdorferi compared with 2-tiered testing using whole-cell lysates. J Infect Dis. 2003;187:1187–99. 3. Stricker RB, Johnson L. Serologic tests for Lyme disease: More smoke and mirrors. Clin Infect Dis. 2008;47:1111-2. 4. Stricker RB, Johnson L. Lyme disease: the next decade. Infect Drug Resist. 2011;4:1–9. 5. Stricker RB, Johnson L. Circular reasoning in CDC Lyme disease test review. Pubmed Commons comment on: Moore A, Nelson C, Molins C, Mead P, Schriefer M. Current guidelines, common clinical pitfalls, and future directions for laboratory diagnosis of Lyme disease, United States. Emerg Infect Dis. 2016;22:1169-77.

      Disclosure: RBS is a member of the International Lyme and Associated Diseases Society (ILADS) and a director of LymeDisease.org. He has no financial or other conflicts to declare.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Jun 12, Bastian Fromm commented:

      Summary The author describes the results of a combined smallRNA sequencing and blasting approach in Taenia ovis. Specifically RNA was retrieved from Tov metacercaria and then mapped to the genome of T. solium. Mapping reads are then blasted against miRBase and so the author describes 34 miRNAs as present in Tov.

      Major problems

      1. The author uses miRBase as reference for cestode miRNAs although it is very outdated (last update 2014). The author should rather have used available literature for comparisons (1-9).
      2. Consequently (?) the author fails to acknowledge his results in the light of standard work in the field of miRNA evolution in flatworms (10-12) and to draw conclusions about the completeness of his predictions.
      3. The approach of mapping a smallRNA sequencing library of a given species against another is problematic and I cannot understand why no the author does not at least try to use classical PCR to confirm loci.

      Minor problems 1) page 3 line 61 author should make sentence more clear. It looks like author removed all reads that had adapter sequences. Recommendation 1) Author should get all available PRE-sequences for cestodes and ma his Tov reads with liberal settings to them and report results.

      1. Jiang, S., Li, X., Wang, X., Ban, Q., Hui, W. and Jia, B. (2016) MicroRNA profiling of the intestinal tissue of Kazakh sheep after experimental Echinococcus granulosus infection, using a high-throughput approach. Parasite, 23, 23.
      2. Kamenetzky, L., Stegmayer, G., Maldonado, L., Macchiaroli, N., Yones, C. and Milone, D.H. (2016) MicroRNA discovery in the human parasite Echinococcus multilocularis from genome-wide data. Genomics, 107, 274-280.
      3. Macchiaroli, N., Cucher, M., Zarowiecki, M., Maldonado, L., Kamenetzky, L. and Rosenzvit, M.C. (2015) microRNA profiling in the zoonotic parasite Echinococcus canadensis using a high-throughput approach. Parasit Vectors, 8, 83.
      4. Jin, X., Guo, X., Zhu, D., Ayaz, M. and Zheng, Y. (2017) miRNA profiling in the mice in response to Echinococcus multilocularis infection. Acta tropica, 166, 39-44.
      5. Bai, Y., Zhang, Z., Jin, L., Kang, H., Zhu, Y., Zhang, L., Li, X., Ma, F., Zhao, L., Shi, B. et al. (2014) Genome-wide sequencing of small RNAs reveals a tissue-specific loss of conserved microRNA families in Echinococcus granulosus. BMC genomics, 15, 736.
      6. Cucher, M., Prada, L., Mourglia-Ettlin, G., Dematteis, S., Camicia, F., Asurmendi, S. and Rosenzvit, M. (2011) Identification of Echinococcus granulosus microRNAs and their expression in different life cycle stages and parasite genotypes. International journal for parasitology, 41, 439-448.
      7. Ai, L., Xu, M.J., Chen, M.X., Zhang, Y.N., Chen, S.H., Guo, J., Cai, Y.C., Zhou, X.N., Zhu, X.Q. and Chen, J.X. (2012) Characterization of microRNAs in Taenia saginata of zoonotic significance by Solexa deep sequencing and bioinformatics analysis. Parasitology research, 110, 2373-2378.
      8. Wu, X., Fu, Y., Yang, D., Xie, Y., Zhang, R., Zheng, W., Nie, H., Yan, N., Wang, N., Wang, J. et al. (2013) Identification of neglected cestode Taenia multiceps microRNAs by illumina sequencing and bioinformatic analysis. BMC veterinary research, 9, 162.
      9. Ai, L., Chen, M.-X., Zhang, Y.-N., Chen, S.-H., Zhou, X.-N. and Chen, J.-X. (2014) Comparative analysis of the miRNA profiles from Taenia solium and Taenia asiatica adult. African Journal of Microbiology Research, 8, 895-902.
      10. Fromm, B., Worren, M.M., Hahn, C., Hovig, E. and Bachmann, L. (2013) Substantial Loss of Conserved and Gain of Novel MicroRNA Families in Flatworms. Molecular biology and evolution, 30, 2619-2628.
      11. Cai, P., Gobert, G.N. and McManus, D.P. (2016) MicroRNAs in Parasitic Helminthiases: Current Status and Future Perspectives. Trends Parasitol, 32, 71-86.
      12. Fromm, B., Ovchinnikov, V., Hoye, E., Bernal, D., Hackenberg, M. and Marcilla, A. (2016) On the presence and immunoregulatory functions of extracellular microRNAs in the trematode Fasciola hepatica. Parasite immunology.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Apr 11, Yu-Chen Liu commented:

      The authors appreciate the insightful feedbacks and agree with prospect that hypothesis derived from small RNA-seq data analysis deserve examination in skeptical views and further experimental validation. Regarding the skeptical view of Prof. Witwer on this issue, whether a specific sequence were indeed originate from plant can be validated through examining the 2’-O-methylation on their 3’ end (Chin, et al., 2016; Yu, et al., 2005). The threshold of potential copy per cell for plant miRNAs to affect human gene expression was also discussed in previous researches (Chin, et al., 2016; Zhang, et al., 2012).

      Some apparent misunderstandings are needed to be clarified:

      In the commentary of Prof. Witwer:

      “A cross-check of the source files and articles shows that the plasma data evaluated by Liu et al were from 198 plasma samples, not 410 as reported. Ninomiya et al sequenced six human plasma samples, six PBMC samples, and 11 cultured cell lines 19. Yuan et al sequenced 192 human plasma libraries (prepared from polymer-precipitated plasma particles). Each library was sequenced once, and then a second time to increase total reads.”

      Authors’ response:

      First of all, the statement "410 samples" within the article was meant to the amount of runs of small RNA-seq run conducted in the referred researches. Whether multiple NGS runs conducted on same plasma sample should be count as individual experiment replicates is debatable. The analysis of each small RNA-seq run was conduct independently. The authors appreciate the kind comments for the potential confusion that can be made in this issue.

      In the commentary of Prof. Witwer:

      “Strikingly, the putative MIR2910 sequence is not only a fragment of plant rRNA; it has a 100% coverage, 100% identity match in the human 18S rRNA (see NR 003286.2 in GenBank; Table 3). These matches of putative plant RNAs with human sequences are difficult to reconcile with the statement of Liu et al that BLAST of putative plant miRNAs "resulted in zero alignment hit", suggesting that perhaps a mistake was made, and that the BLAST procedure was performed incorrectly.”

      Authors’ response:

      The precursor sequences of the plant miRNAs, including the stem loop sequences (precursor sequences) were utilized in the BLAST sequence alignment in this work. The precursor sequence of peu-MIR2910, “UAGUUGGUGGAGCGAUUUGUCUGGUUAAUUCCGUUAACGAACGAGACCUCAGCCUGCUA” was used. The alignment was not performed merely with the mature sequence, “UAGUUGGUGGAGCGAUUUGUC”. The stem loop sequences, as well as the alignment of the sequences against the plant genomes, was taken into consideration by using miRDeep2 (Friedländer, et al., 2012). As illustrated in the provided figures, sequencing reads were mapped to the precursor sequences of MIR2910 and MIR2916. As listed in the table below, a lot of sequencing reads can be aligned to other regions within the precursor sequences except the sequencing reads aligned to mature sequences. For instance, in small RNA-seq data of DRR023286, 5369 reads were mapped to peu-MIR2910, and 4010 reads were mapped to the other regions in the precursor sequences.  

      miRNA | Run |Total reads | on Mature | on precursor

      peu-MIR2910 | DRR023286 | 9370 | 5369 | 4010

      peu-MIR2910 | SRR2105454 | 3013 | 1433 | 1580

      peu-MIR2914 | DRR023286 | 1036 | 19 | 1017

      peu-MIR2916 |SRR2105342 | 556 | 227 | 329

      (Check the file MIR2910_in_DRR023286.pdf, MIR2910_in_SRR2105454.pdf, MIR2914_in_DRR023286 and MIR2916_in_SRR2105342.pdf)

      The pictures are available in the URL:

      https://www.dropbox.com/sh/9r7oiybju8g7wq2/AADw0zkuGSDsTI3Aa_4x6r8Ua?dl=0

      As described in the article, all reported reads mapped onto the plant miRNA sequences were also mapped onto the five conserve plant genomes. Within the provided link a compressed folder file “miRNA_read.tar.gz” is available. Results of the analysis through miRDeep2, were summarized in these pdf files. Each figure file was named according to the summarized reads, sequence run and the mapped plant genome. For example, reads from the run SRR2105181 aligned onto both Zea mays genome and peu-MIR2910 precursor sequences are summarized in the figure file “SRR2105181_Zea_mays_peu-MIR2910.pdf”.

      In the commentary of Prof. Witwer:

      “Curiously, several sequences did not map to the species to which they were ascribed by the PMRD. Unfortunately, the PMRD could not be accessed directly during this study; however, other databases appear to provide access to its contents.”

      Authors’ response:

      All the stem loop sequences of plant miRNAs were acquired from the 2016 updated version of PMRD (Zhang, et al., 2010), which was not properly referred. The used data were provided in the previously mentioned URL.

      In the commentary of Prof. Witwer:

      “Counts were presented as reads per million mapped reads (rpm). In contrast, Liu et al appear to have reported total mapped reads in their data table. Yuan et al also set an expression cutoff of 32 rpm (log2 rpm of 5 or above). With an average 12.5 million reads per sample (the sum of the two runs per library), and, on average, about half of the sequences mapped, the 32 rpm cutoff would translate to around 200 total reads in the average sample as mapped by Liu et al.”

      Authors’ response:

      Regarding the concern of reads per million mapped reads (rpm) threshold, the author appreciate the kind remind of the need to normalize sequence reads count into the unit in reads per million mapped reads (rpm) for proper comparison between samples of different sequence depth. However the comparison was unfortunately not conducted in this work. Given the fact that the reads were mapped onto plant genome instead of human genome, the normalization would be rather pointless, considering the overall mapped putative plant reads only consist of ~3% of the overall reads. On the other hand, the general amount of cell free RNA present in plasma samples was meant to be generally lower than within cellar samples (Schwarzenbach, et al., 2011).

      Reference

      Chin, A.R., et al. Cross-kingdom inhibition of breast cancer growth by plant miR159. Cell research 2016;26(2):217-228.

      Friedländer, M.R., et al. miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades. Nucleic acids research 2012;40(1):37-52.

      Schwarzenbach, H., Hoon, D.S. and Pantel, K. Cell-free nucleic acids as biomarkers in cancer patients. Nature Reviews Cancer 2011;11(6):426-437.

      Yu, B., et al. Methylation as a crucial step in plant microRNA biogenesis. Science 2005;307(5711):932-935.

      Zhang, L., et al. Exogenous plant MIR168a specifically targets mammalian LDLRAP1: evidence of cross-kingdom regulation by microRNA. Cell research 2012;22(1):107-126.

      Zhang, Z., et al. PMRD: plant microRNA database. Nucleic acids research 2010;38(suppl 1):D806-D813.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Aug 06, John Greenwood commented:

      (cross-posted from Pub Peer, comment numbers refer to that discussion but content is the same)

      To address your comments in reverse order -

      Spatial vision and spatial maps (Comment 19):

      We use the term “spatial vision” in the sense defined by Russell & Karen De Valois: “We consider spatial vision to encompass both the perception of the distribution of light across space and the perception of the location of visual objects within three-dimensional space. We thus include sections on depth perception, pattern vision, and more traditional topics such as acuity." De Valois, R. L., & De Valois, K. K. (1980). Spatial Vision. Annual Review of Psychology, 31(1), 309-341. doi:doi:10.1146/annurev.ps.31.020180.001521

      The idea of a "spatial map” refers to the representation of the visual field in cortical regions. There is extensive evidence that visual areas are organised retinotopically across the cortical surface, making them “maps". See e.g. Wandell, B. A., Dumoulin, S. O., & Brewer, A. A. (2007). Visual field maps in human cortex. Neuron, 56(2), 366-383.

      Measurement of lapse rates (Comments 4, 17, 18):

      There really is no issue here. In Experiment 1, we fit a psychometric function in the form of a cumulative Gaussian to responses plotted as a function of (e.g.) target-flanker separation (as in Fig. 1B), with three free parameters: midpoint, slope, and lapse rate. The lapse rate is 100-x where x is the asymptote of the curve. It accounts for lapses (keypress errors etc) when performance is otherwise high - i.e. it is independent of the chance level. In this dataset it is never about 5%. However its inclusion does improve estimate of slope (and therefore threshold) which we are interested in. Any individual differences are therefore better estimated by factoring out individual differences in lapse rate. Its removal does not qualitatively affect the pattern of results in any case. You cite Wichmann and Hill (2001) and that is indeed the basis of this three-parameter fit (though ours is custom code that doesn’t apply the bootstrapping procedures etc that they use).

      Spatial representations (comment 8):

      We were testing the proposal that crowding and saccadic preparation might depend on some degree of shared processes within the visual system. Specific predictions for shared vs distinct spatial representations are made on p E3574 and in more detail on p E3576 of our manuscript. The idea comes from several prior studies arguing for a link between the two, as we cite, e.g.: Nandy, A. S., & Tjan, B. S. (2012). Saccade-confounded image statistics explain visual crowding. Nature Neuroscience, 15(3), 463-469. Harrison, W. J., Mattingley, J. B., & Remington, R. W. (2013). Eye movement targets are released from visual crowding. The Journal of Neuroscience, 33(7), 2927-2933.

      Bisection (Comments 7, 13, 15):

      Your issue relates to biases in bisection. This is indeed an interesting area, mostly studied for foveal presentation. These biases are however small in relation to the size of thresholds for discrimination, particularly for the thresholds seen in peripheral vision where our measurements were made. An issue with bias for vertical judgements would lead to higher thresholds for vertical vs. horizontal judgements, which we don’t see. The predominant pattern in bisection thresholds (as with the other tasks) is a radial/tangential anisotropy, so vertical thresholds are worse than horizontal on the vertical meridian, but better than horizontal thresholds on the horizontal meridian. The role of biases in that anisotropy is an interesting question, but again these biases tend to be small relative to threshold.

      Vernier acuity (Comment 6):

      We don’t measure vernier acuity, for exactly the reasons you outline (stated on p E3577).

      Data analyses (comment 5):

      The measurement of crowding/interference zones follows conventions established by others, as we cite, e.g.: Pelli, D. G., Palomares, M., & Majaj, N. J. (2004). Crowding is unlike ordinary masking: Distinguishing feature integration from detection. Journal of Vision, 4(12), 1136-1169.

      Our analyses are certainly not post-hoc exercises in data mining. The logic is outlined at the end of the introduction for both studies (p E3574).

      Inclusion of the authors as subjects (Comment 3):

      In what way should this affect the results? This can certainly be an issue for studies where knowledge of the various conditions can bias outcomes. Here this is not true. We did of course check that data from the authors did not differ in any meaningful way from other subjects (aside from individual differences), and it did not. Testing (and training) experienced psychophysical observers takes time, and authors tend to be experienced psychophysical observers.

      The theoretical framework of our experiments (Comments 1 & 2):

      We make an assumption about hierarchical processing within the visual system, as we outline in the introduction. We test predictions that arise from this. We don’t deny that feedback connections exist, but I don’t think their presence would alter the predictions outlined at the end of the introduction. We also make assumptions regarding the potential processing stages/sites underlying the various tasks examined. Of course we can’t be certain about this (and psychophysics is indeed ill-poised to test these assumptions) and that is the reason that no one task is linked to any specific neural locus, e.g. crowding shows neural correlates in visual areas V1-V4, as we state (e.g. p E3574). Considerable parts of the paper are then addressed at considering whether some tasks may be lower- or higher-level than others, and we outline a range of justifications for the arguments made. These are all testable assumptions, and it will be interesting to see how future work then addresses this.

      All of these comments are really fixated on aspects of our theoretical background and minor details of the methods. None of this in any way negates our findings. Namely, there are distinct processes within the visual system, e.g. crowding and saccadic precision, that nonetheless show similarities in their pattern of variations across the visual field. We show several results that suggest these two processes to be dissociable (e.g. that the distribution of saccadic errors is identical for trials where crowded targets were correctly vs incorrectly identified). If they’re clearly dissociable tasks, how then to explain the correlation in their pattern of variation? We propose that these properties are inherited from earlier stages in the visual system. Future work can put this to the test.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Jun 12, John Sotos commented:

      West describes angiogenesis, erythropoiesis, and vasoconstriction as clinical sequelae arising from chronically hypoxic tissues at altitude. Another, similar, effect is solid-organ hyperplasia.

      In the late 1960s a Peruvian medical student observed several-fold enlargement of the carotid bodies in Andean altitude dwellers (1,2). The degree of enlargment increased with time spent at altitude and, in animal models, reversed after restoration of normoxia(3). Interestingly, this hyperplasia is mediated via endothelin signalling, not by hypoxia-inducible-factors(4).

      Tissue hyperplasia may also occur in hypoxic patients at sea level. For example, even before the Peruvian discovery, hyperplasia -- and sometimes malignancy -- of adrenal chromaffin cells, i.e. pheochromocytomas, were described in adults having uncorrected cyanotic congenital heart disease(5). Carotid body cells and adrenal chromaffin cells have similar lineage (from the neural crest) and function (oxygen sensing).

      (1) Arias-Stella J. Human carotid body at high altitudes. (Abstract). American Journal of Pathology. 1969; 55: 82a.

      (2) Heath D. The carotid bodies in chronic respiratory disease. Histopathology. 1991; 18: 281-283.

      (3) Kay JM, Laidler P. Hypoxia and the carotid body. J Clin Pathol Suppl (R Coll Pathol). 1977; 11: 30-44.

      (4) Platero-Luengo A, González-Granero S, Durán R, Díaz-Castro B, Piruat J, García-Verdugo JM, Pardal R, López-Barneo J. An O2-Sensitive Glomus Cell-Stem Cell Synapse Induces Carotid Body Growth in Chronic Hypoxia. Cell. 2014; 156, 291–303.

      (5) Folger GM, Roberts WC, Mehrizi A, Shah KD, Glancy DL, Carpenter CCJ, Esterly JR. Cyanotic Malformations of the Heart with Pheochromocytoma: A Report of Five Cases. Circulation. 1964; 29: 750-757.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Aug 29, Andreas Lundh commented:

      Comment on Association of streptococcal throat infection with mental disorders

      A recent Danish register-based cohort study(1) concludes that “individuals with a streptococcal throat infection had elevated risks of mental disorders, particularly OCD and tic disorders.” However, some methodological issues need consideration.

      Firstly, the choice of exposure has a risk of misclassification. Exposure (i.e. Group A Streptococcal (GAS) throat infection) was the combination of a rapid antigen test performed by the patient’s general practitioner and subsequent antibiotic prescription. In Denmark use of rapid antigen test and antibiotic prescription are guided by modified Centor criteria(2,3) where symptomatic patients at high risk of GAS throat infection are not tested, but instead receive empirical antibiotic treatment. This leads to patients being misclassified as unexposed since they are never tested.

      Secondly, the choice of outcome has a similar risk of misclassification. Psychiatric diagnoses are identified from national databases that only contain hospital information. Psychiatric patients that are not treated in hospitals (e.g. treated by primary care psychiatrists) are misclassified as not having had the outcome. Misclassification seems likely as only 0.1% and 0.2%, respectively, had a diagnosis of OCD or tics in the study period.

      Thirdly, the analytical strategy has a risk of bias. The authors compared patients that had received both a rapid antigen test and antibiotics with a group that was never tested. GAS throat infection will in most cases resolve spontaneously and many patients will never contact their general practitioner for testing. The group tested therefore likely differs from the group not being tested and represents a group with certain healthcare seeking behavior. This is substantiated by the findings that risk of mental disorders seems to increase with number of tests and regardless of whether the tests are negative or positive. A more reasonable analysis that avoids confounding by test indication would be to compare the group of tested patients prescribed antibiotics with the group of tested patients without prescribed antibiotics. This comparison weakens the association and it is no longer statistically significant for tics.

      Instead of describing this as a possible source of bias the authors conclude that nonstreptococcal throat infection was also associated with increased risk of mental disorders, a theory that was not part of the original study hypothesis. Another interpretation is that these associations can be explained by a certain healthcare seeking behavior of patients and parents leading to an increased probability of receiving an antigen test, being prescribed an antibiotic and being treated in hospital.

      References

      1) Orlovska S, Vestergaard CH, Bech BH, Nordentoft M, Vestergaard M, Benros ME. Association of Streptococcal Throat Infection With Mental Disorders: Testing Key Aspects of the PANDAS Hypothesis in a Nationwide Study. JAMA Psychiatry 2017;74:740-6.

      2) Bjerrum L, Gahrn-Hansen B, Hansen MP, Córdoba G, Aabenhus R, Monrad RN. [Airway infections – diagnosis and treatment. Clinical guideline for general practitioners]. Copenhagen: Danish College of General Practitioners; 2014.

      3) Choby BA. Diagnosis and treatment of streptococcal pharyngitis. Am Fam Physician 2009; 79:383-90.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Sep 12, David Keller commented:

      Pre-Existing Rheumatoid Arthritis Should Increase, Not Reduce, the Risk of Incident Parkinson Disease

      The authors of this editorial ask "Would tamping down the immune system be a good thing for PD (Parkinson disease) symptoms, or would activation of the immune system be advantageous?"[1] They cite epidemiologic studies which showed "a higher risk of PD in patients with type 1 diabetes mellitus (T1DM) and Crohn disease (CD), among others [2]", in conflict with studies that showed a decreased risk of PD in patients with rheumatoid arthritis (RA). So, does the presence of RA increase or decrease the incidence of PD?

      Genome-wide association studies (GWAS) found "enrichment" of loci associated with Parkinson disease conditional on the presence of loci associated with each of 7 autoimmune diseases, to varying degrees. The graphs in Figure 1 [3] demonstrate that for all 7 autoimmune diseases, the greater the population of SNPs associated with autoimmunity, the greater the enrichment of PD SNPs. The authors designate this as "leftward" deviation of the curves, although mathematically it is really UPWARD deviation from the straight line representing the null hypothesis. So, in genetic studies, all seven of the tested autoimmune diseases (T1DM, CD, Ulcerative Colitis, Celiac Disease, Psoriasis, Multiple Sclerosis and Rheumatoid Arthritis) were genetically associated with increased risk of incident PD.

      How can genetic risk of PD increase directly with the genetic risk of RA, yet epidemiological studies demonstrate an inverse association of established RA disease on the incidence of PD? The authors of one such epidemiological study did not believe their own results, and hypothesized that "the decreased risk [of incident PD] among patients with RA might be explained by underdiagnosis of movement disorders such as PD in this patient group, or by a protective effect of treatment with anti-inflammatory drugs over prolonged periods." [4] In other words, early signs of PD, such as bradykinesia, could be masked in RA patients, in whom slow movement might be attributed to pain or joint destruction, and ibuprofen use could have further confounded their results.

      The nonsteroidal antiinflammatory drugs (NSAID) have been studied extensively, and the only one which significantly reduces the risk of incident PD is ibuprofen.[5] A study by Sung and colleagues [6] concluded that pre-existing RA reduces the risk of incident PD, but they corrected their data for the use of any NSAID, rather than the use of ibuprofen, introducing systematic errors in their results, and potentially invalidating their conclusions. [7]

      Can a destructive autoimmune disease like RA reduce the risk of incident PD, in contrast to 6 other autoimmune diseases, which raise risk for PD? Or, do symptom masking and the protective effects of ibuprofen explain the reduction in incident PD seen in patients with RA? In an unpublished reply to these arguments, Sung's group wrote: "[Keller's] criticism focuses on the issue whether [any] non-aspirin NSAID or ibuprofen only, has the truly protective effect against the development of PD", and agreed that "ibuprofen was associated with decreased risk of PD, but not aspirin or other NSAIDs" and concluded that "ibuprofen use should be considered as an important covariable in future correlational research in PD." [8]

      References

      1: McFarland NR, McFarland KN, Golde TE. Parkinson Disease and Autoimmune Disorders-What Can We Learn From Genome-wide Pleiotropy? JAMA Neurol. 2017 Jul 1;74(7):769-770. doi: 10.1001/jamaneurol.2017.0843. PubMed PMID: 28586798.

      2: Lin JC, Lin CS, Hsu CW, Lin CL, Kao CH. Association Between Parkinson's Disease and Inflammatory Bowel Disease: a Nationwide Taiwanese Retrospective Cohort Study. Inflamm Bowel Dis. 2016 May;22(5):1049-55. doi: 10.1097/MIB.0000000000000735. PubMed PMID: 26919462.

      3: Witoelar A, Jansen IE, et al. for the International Parkinson’s Disease Genomics Consortium. Genome-wide Pleiotropy Between Parkinson Disease and Autoimmune Diseases. JAMA Neurol. 2017;74(7):780–792. doi:10.1001/jamaneurol.2017.0469

      4: Rugbjerg K, Friis S, Ritz B, Schernhammer ES, Korbo L, Olsen JH. Autoimmune disease and risk for Parkinson disease: a population-based case-control study. Neurology. 2009 Nov 3;73(18):1462-8. doi: 10.1212/WNL.0b013e3181c06635. Epub 2009 Sep 23. PubMed PMID: 19776374; PubMed Central PMCID: PMC2779008.

      5: Gao X, Chen H, Schwarzschild MA, Ascherio A. Use of ibuprofen and risk of Parkinson disease. Neurology. 2011 Mar 8;76(10):863-9. doi: 10.1212/WNL.0b013e31820f2d79. Epub 2011 Mar 2. PubMed PMID: 21368281; PubMed Central PMCID: PMC3059148.

      6: Sung YF, Liu FC, Lin CC, Lee JT, Yang FC, Chou YC, Lin CL, Kao CH, Lo HY, Yang TY. Reduced Risk of Parkinson Disease in Patients With Rheumatoid Arthritis: A Nationwide Population-Based Study. Mayo Clin Proc. 2016 Oct;91(10):1346-1353. doi: 10.1016/j.mayocp.2016.06.023. PubMed PMID: 27712633.

      7: Keller DL, Only ibuprofen is associated with reduced PD risk - controlling for use of any NSAID introduces error. PubMed Commons Comment, accessed on 9/12/2017 at the following URL: https://www.ncbi.nlm.nih.gov/pubmed/27712633#cm27712633_34408

      8: Sung YF, Lin CL, Kao CH, and Yang TY. Reply to Keller's unpublished letter to Mayo Clinic Proceedings. Received by email on November 22, 2016.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Jun 18, Raphael Stricker commented:

      Chronic Lyme Disease Treatment: Science versus Anecdotes.

      Lorraine Johnson, Raphael B. Stricker, MD.

      Lymedisease.org, PO Box 1352, Chico, CA 95927; ILADS, PO Box 341461, Bethesda, MD 20827

      lorrainejohnson@outlook.com; rstricker@usmamed.com

      The article by Marzec et al. published in MMWR purports to show the dangers of treatment in patients diagnosed with chronic Lyme disease (1). Recent reports from the Centers for Disease Control and Prevention (CDC) indicate that more than 300,000 new cases of Lyme disease are diagnosed each year in the USA (2). The MMWR article from the CDC describes five anecdotal cases of treatment complications in these patients while ignoring the significant morbidity related to denial of treatment for chronic Lyme disease (2,3). The resultant biased report raises scientific and ethical issues about the CDC's role in promoting the best care for patients with tickborne diseases.

      The MMWR piece resulted from anecdotal reports gathered by Dr. Christina Nelson of the CDC. The article notes that the information was gathered because “clinicians and state health departments periodically contact CDC concerning patients who have acquired serious bacterial infections during treatments for chronic Lyme disease.” However, an ethics complaint filed against Dr. Nelson by the Lyme disease patient advocacy group LymeDisease.org suggests that these adverse event reports were in fact specifically solicited by Dr. Nelson via emails distributed in 2014 (4). Dr. Nelson asked clinicians from the Infectious Diseases Society of America (IDSA) to provide anecdotal evidence of harm to patients from intravenous antibiotic therapy related to Lyme disease, and she apparently offered coauthorship of her article as an incentive to describe these adverse events. She did not ask for consequences of failing to treat these patients, nor did she solicit commentary from practitioners who treat chronic Lyme disease according to the guidelines of the International Lyme and Associated Diseases Society (ILADS).

      The risk of any medical treatment is extremely context-sensitive. A crucial question is whether the risks of treatment are warranted given the potential benefits, the availability of other treatment options, the severity of the patient's presentation, and the risk tolerance of the individual patient. By asking for an assessment of treatment risks only, Dr. Nelson is framing the issue in a manner that excludes the other half of the equation in a risk/benefit assessment. She is also ignoring an issue that is critical to patients who suffer a profoundly diminished quality of life due to their illness, namely the risk of not treating (5,6). Moreover, by failing to mention that these adverse event reports were rare and specifically solicited, she implies that these rare occurrences are a common concern. In reality, studies of the risks and benefits associated with intravenous antibiotic treatment for Lyme disease indicate that the risks of adverse events are no greater than the risks of intravenous therapy in other unrelated diseases (7,8).

      By asking the question only of those on one side of the controversy, Dr. Nelson is further demonstrating favoritism and a lack of impartiality on the part of the CDC. Accordingly, Dr. Nelson's solicitation of anecdotal adverse events for case studies of Lyme disease is a highly inappropriate partisan act of favoritism toward the IDSA viewpoint at the expense of critical stakeholders - Lyme disease patients and their treating physicians - and an attack on the ILADS viewpoints.

      References 1. Marzec NS, Nelson C, Waldron PR, et al. Serious bacterial infections acquired during treatment of patients given a diagnosis of chronic Lyme disease - United States. MMWR Morb Mortal Wkly Rep. 2017 Jun 16;66(23):607-609. 2. Stricker RB, Johnson L. Lyme disease: Call for a ‘‘Manhattan Project’’ to combat the epidemic. PLoS Pathog. 2014;10(1): e1003796. 3. Stricker RB, Fesler MC. Chronic Lyme disease: A working case definition. Chronic Dis Int. 2017; 4(1): 1025. 4. Leland DK. TOUCHED BY LYME: CDC ignores ethics, attacks “chronic Lyme”. Available at https://www.lymedisease.org/touchedbylyme-cdc-ignores-ethics/. Accessed June 16, 2017. 5. Johnson L, Aylward A, Stricker RB. Healthcare access and burden of care for patients with Lyme disease: a large United States survey. Health Policy. 2011;102: 64–71. 6. Johnson L, Wilcox S, Mankoff J, Stricker RB. Severity of chronic Lyme disease compared to other chronic conditions: a quality of life survey. Peer J. 2014;2:e322. 7. Stricker RB, Green CL, Savely VR, Chamallas SN, Johnson L. Safety of intravenous antibiotic therapy in patients referred for treatment of neurologic Lyme disease. Minerva Med. 2010;101:1–7. 8. Stricker RB, Delong AK, Green CL, et al. Benefit of intravenous antibiotic therapy in patients referred for treatment of neurologic Lyme disease. Int J Gen Med. 2011; 4: 639–646. Disclosure: RBS and LJ are members of the International Lyme and Associated Diseases Society (ILADS) and directors of LymeDisease.org. They have no financial or other conflicts to declare.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Jun 24, Sin Hang Lee commented:

      Jorge Cervantes proposed a new theory to argue against the existence of chronic Lyme disease with persistent infection [1]. According to this theory, “after antibiotic eradication of Bb, its DNA is able to persist in anatomical locations that coincide with sites of inflammation.” He assumed that the free, naked and water-soluble DNA molecules released from the dying Borrelia burgdorferi spirochetes remain in the extracellular matrix of the patient’s tissues. However, under section “3. Borrelia DNA persistence” of his article, the references cited did not test for free borrelial DNA at all, and therefore do not back up his theory. For examples, in the reference by Li et al. [2], the authors concluded that the DNA detected was in moribund or dead B burgdorferi cells, not in free form. In the reference by Schmidt et al. [3] and the reference by Aberer et al. [4], borrelial DNA was detected in the pellet of patients’ urine samples after centrifugation at 14,000 x g and 36,000 × g, respectively. Since soluble free DNA molecules cannot be pelleted by such a low centrifugal force, the borrelial DNA detected by these authors must be still bound to bacterial cells or cell fragments in the urine. In the reference by Kubanek et al. [5], the authors actually showed by electron microscopy that the tissues tested positive for borrelial DNA clearly contained borrelial bacteria, not free DNA.

      Free, extracellular, naked bacterial DNA is very prone to decay. Foreign DNA experimentally introduced into a mammal is degraded and eliminated from the host’s blood within 48 hours [6]. But the stability of extracellular DNA still depends on its form or even on the sequence of its nucleotide bases. Circular plasmid DNA is more stable in vitro than a segment of linear chromosomal DNA after release from the bacterial cell. Even DNase I does not cleave DNA randomly although not base nor sequence specific. Extracellular bacterial 16S rDNA is known to be degraded much more rapidly in the environment than those bound to cell fragments [7]. Borrelial 16S rDNA extracted by ammonium hydroxide stored in TE buffer is stable, but is degraded rapidly in human serum at room temperature (unpublished personal observation). DNA sequencing-confirmed detection of borrelial 16S rDNA in the pellet of serum or plasma samples derived from patients’ venous blood constitutes solid molecular evidence of spirochetemia in Lyme borreliosis [8, 9]. Whether spirochetemia in chronic Lyme disease needs to be treated with prolonged antibiotics is an important heath care issue which should be further discussed. To push an elusive DNA-binding AMP treatment of chronic Lyme disease can only direct the attention away from the real issue of how to define Lyme disease, acute or chronic, as an emerging infectious disease, like Ebola and Zika, for proper patient management. There is no evidence that free naked borrelial DNA has been demonstrated in any patient samples.

      The author should also cite a reference to back up his claim that human macrophages can remove extracellular Bb DNA. The reference by Brencicova and Diebold [10], cited by the author, clearly stated “Endosomal TLR are situated in the membrane of the endolysosomal compartment of APC and sample the content of these compartments for the presence of nucleic acid agonists. Pathogens or dead cells gain access to the compartment by endocytosis. Alternatively, infection-induced autophagy can shuttle viral nucleic acids and antigens into the endolysosomal compartment and allow for recognition of replicating virus within infected cells by endosomal TLR.” Free DNA was not mentioned.

      References [1] Cervantes J. Doctor says you are cured, but you still feel the pain. Borrelia DNA persistence in Lyme disease. Microbes Infect 2017 Jun 15. pii: S1286-4579(17)30090-4. doi: 10.1016/j.micinf.2017.06.002. [Epub ahead of print] Review. [2] Li X, McHugh GA, Damle N, Sikand VK, Glickstein L, Steere AC. Burden and viability of Borrelia burgdorferi in skin and joints of patients with erythema migrans or lyme arthritis. Arthritis Rheum 2011;63: 2238-47. [3] Schmidt B, Muellegger RR, Stockenhuber C, Soyer HP, Hoedl S, Luger A, et al. Detection of Borrelia burgdorferi-specific DNA in urine specimens from patients with erythema migrans before and after antibiotic therapy. J Clin Microbiol 1996;34:1359-63. [4] Aberer E, Bergmann AR, Derler AM, Schmidt B. Course of Borrelia burgdorferi DNA shedding in urine after treatment. Acta Derm Venereol 2007;87(1):39-42. [5] Kubanek M, Sramko M, Berenova D, Hulinska D, Hrbackova H, Maluskova J, et al. Detection of Borrelia burgdorferi sensu lato in endomyocardial biopsy specimens in individuals with recent-onset dilated cardiomyopathy. Eur J Heart Fail 2012;14:588-96. [6] Schubbert R, Renz D, Schmitz B, Doerfler W. Foreign (M13) DNA ingested by mice reaches peripheral leukocytes, spleen, and liver via the intestinal wall mucosa and can be covalently linked to mouse DNA. Proc Natl Acad Sci U S A. 1997;94:961-6. [7] Corinaldesi C, Danovaro R, Dell'Anno A. Simultaneous recovery of extracellular and intracellular DNA suitable for molecular studies from marine sediments. Appl Environ Microbiol 2005;71:46-50. [8] Lee SH, Vigliotti JS, Vigliotti VS, Jones W, Shearer DM. Detection of borreliae in archived sera from patients with clinically suspect Lyme disease. Int J Mol Sci. 2014;15:4284-98. [9] Lee SH. Lyme disease caused by Borrelia burgdorferi with two homeologous 16S rRNA genes: a case report. Int Med Case Rep J. 2016;9:101-6. [10] Brencicova E, Diebold SS. Nucleic acids and endosomal pattern recognition: how to tell friend from foe? Front Cell Infect Microbiol 2013;3:37.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Jul 11, Martine Crasnier-Mednansky commented:

      The cya crp* mutant strain CA-8404 isolated by L. Soll (Sabourin D, 1975), which has been widely used for transduction of its crp* gene (also used in the present work), was finally characterized by Karimova G, 2004 as containing three mutations in the crp gene. Karimova G, 2004 further reported this CRP* was indeed capable of responding to cAMP and therefore was still sensitive to Carbon Catabolite Repression (CCR). Of interest to the present study, and any other studies aimed at releasing CCR in Escherichia coli, Karimova G, 2004 also characterized a novel CRP* with two mutations which totally relieved CCR as compared to the three-mutation CRP*.

      Here cAMP-dependent CCR may not be the main culprit for preventing xylose utilization by the Escherichia coli wild type W strain (the Waksman’s strain). Generally, an increase in cAMP upon glucose depletion allows utilization of less-preferred sugar like xylose. Figure S7-A indicates that upon glucose exhaustion, E. coli W was still unable to use xylose after 96 hours, even though it could use xylose quite efficiently in the absence of glucose (Figure 2-D). In addition, the CRP* isolated by the authors (G141D) for specifically increasing xylose catabolism (Figure 1), and which doubled xylose utilization in the parent strain XW043, did not improve E. coli W xylose consumption at all in the presence of glucose (Figure 4-A). Thus, based on current knowledge, the inability of the Waksman’s strain to use xylose in the presence of a large excess glucose does not appear to relate to cAMP-dependent CCR. Interestingly, E. coli B, unlike W, is unable to use glucose fully when grown in excess glucose, and the typical increase in cAMP does not occur after cessation of growth (figure 2 in Peterkofsky A, 1971). Thus, if some glucose remains unused in the medium, cells may fail to use xylose.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Oct 22, George Kunos commented:

      We read with interest the above article (Varga B, 2017), comparing the pharmacological properties of a series of cannabinoid receptor 1 (CB1R) blockers, including first generation brain-penetrant compounds and more recently introduced peripherally restricted compounds in various tests, including their anti-obesity effects in a mouse diet-induced obesity (DIO) model. The complete lack of effect of the peripheral CB1R inverse agonist JD-5037 in the DIO mouse model was of particular interest to us, as we have earlier documented its high anti-obesity efficacy in DIO mice (Tam J, 2012, Cinar R, 2014) and in a mouse model of Prader-Willi syndrome (Knani I, 2016), as well as its anti-diabetic efficacy in a rat model of type 2 diabetes (Jourdan T, 2013, Jourdan T, 2014). In these as well as in more recent studies (Tam J, 2017, Hinden L, 2018, Udi S, 2017), JD-5037 was dissolved in 4% DMSO/1% Tween-80 in PBS (vehicle #1) for administration by oral gavage (see Jourdan T, 2013), whereas Varga et al. used a 5% Tween-80 solution (vehicle #2). Because in our hands the inclusion of DMSO was critical for keeping this highly lipophilic compound in solution, we compared the oral bioavailability and peripheral target engagement of JD-5037 dissolved in these 2 vehicles. Using vehicle #1, the peak plasma concentration of JD-5037 measured by LC-MS/MS 1 h after oral administration to lean, male C57Bl6/J mice was 1076 ± 208 ng/mL (1840 nM), similar to values we published earlier (Tam J, 2012). In contrast, using vehicle #2, the plasma level of JD-5037 was 0.38 ± 0.02 ng/mL (0.67 nM), more than 1,000-fold lower and barely detectable. JD-5037 is 99.6% protein-bound in plasma (Tam J, 2012), so its calculated free concentration was 7.4 nM using vehicle #1 versus 2.7 pM using vehicle #2, the latter value being 2 orders of magnitude below the binding Kd of JD-5037 for CB1R (0.4 nM), which predicts no significant CB1R occupancy. We further verified this by using the upper GI motility test as a measure of peripheral CB1R occupancy (Tam J, 2012). In vehicle-treated mice, an oral charcoal bolus traveled 54 ± 3% of the length of the small intestine in 30 minutes, whereas In mice treated with a maximally effective dose of the CB1R agonist ACEA, the charcoal bolus traveled only 25 ± 3%, indicating a 54% inhibition. The inhibitory effect of ACEA was completely blocked by pretreatment with a single dose of 3 mg/kg JD-5037 in vehicle #1 (53 ± 3%), in agreement with our published data (Tam J, 2012). In contrast, the same dose of JD-5037 administered in vehicle #2 was completely without effect, the distance traveled by the charcoal bolus (29 ± 2%) being the same as with ACEA alone. Thus, the negative findings of Varga et al. can be attributed to lack of absorption and a consequent lack of peripheral CB1R occupancy by JD-5037, due to the use of an inappropriate vehicle. Such pitfalls are avoidable by verifying bioavailability and target engagement, which is a basic requirement when testing the in vivo efficacy of novel compounds.

      George Kunos, Joseph Tam<sup>1,</sup> Resat Cinar, Tony Jourdan; National Institute on Alcohol Abuse and Alcoholism, National Institutes of Health, Bethesda, MD, USA

      <sup>1</sup> Current address: School of Pharmacy, The Hebrew University, Jerusalem, Israel


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Dec 05, Joseph M Barnby commented:

      This letter to the editor was originally submitted to JMIR uHealth and mHealth. The letter was later withdrawn as we became aware it was eligible to have an APC applied to it; in spite of what we understood the JMIR APC policy to be regarding letters to the editor. Neither of our institutions at the time of publication were able to cover the relevant fees. We have posted our reviewed letter here and invited Clare Killikelly to post her submitted response.

      Authors:

      Mr J M Barnby - Department of Neuroimaging, Institute of Psychiatry, Psychology and Neuroscience, King's College London, SE5 8AF. (Corresponding Author; joe.barnby@kcl.ac.uk)

      Dr S A J Fonseca - Division of Psychiatry, University College London, WC1E 6BT.

      The Editor JMIR mHealth and uHealth

      On 20th July 2017, your journal published a useful and wide-ranging systematic review of mobile and web-based technologies for people with psychosis [1] – a field of mental health which has huge potential to shape the way service users are able to take control of their treatment. Authors found service user aid in design, length of intervention, and social support were all important factors in whether a participant would stop using a digital intervention.

      Part of the authors’ summary was that, a) symptom severity may not have a significant effect on drop-out, and b) continuing to develop these interventions alongside users is vital. However, we believe that point a) is not clearly supported by the evidence presented in the article, and point b) misses out (or doesn’t plainly state) a crucial aspect of the technology.

      We believe concluding that symptom severity doesn’t have a significant effect on drop-out is premature. The authors reviewed 20 studies that used web-based or mobile technologies and found 6 that measured the impact of symptom severity, chronicity, and duration on drop-out [2, 3, 4, 5, 6, 7]. However, the review only presents the results of those who stayed in the trials, and we believe it’s safe to assume that participants did not drop out randomly. As there were several individuals who declined to take part or dropped out of the study, and since we have no data for this group, we cannot assume that symptom severity does not affect drop-out. In fact, we would argue that it is likely this group were more symptomatic than those who took part. We believe the authors should have stated this more clearly and commented on it in their conclusions about drop-out, including suggesting ways to test this.

      The authors only mention that intensity, frequency, and duration of interventions are all vital to adherence, but don’t specifically discuss the role of User Experience/User Interface (UXUI) – a role in software design which tries to make interaction with content as smooth and intuitive as possible. This is a separate but related concept to ‘co-production’ – the involvement of service users in intervention design. Commercial mobile-phone and web-based software is continuously developing more sophisticated and visually pleasing versions. It’s reasonable to hypothesise that better UXUI may result in less drop-out of interventions. Testing this hypothesis may give insight into how a more pleasing user experience may affect drop-out, and how extra investment into UXUI with user input may improve symptom control through better engagement. Indeed, research has suggested this approach might be useful in other areas of healthcare [9] and proposed it might be an important aspect to health intervention design [10]. UXUI focus is increasingly more relevant as mainstream software designers find more ways to keep users engaged, and we believe this highlights that digital interventions may have to compete for attention to meet the expectations of the users they wish to benefit.

      In future research aimed at improving user adherence we suggest testing, a) whether simple, text-based designs are as effective as visually pleasing well-designed interfaces when the content is constant (for example, computerised cognitive behavioural therapy), and b) if gamification of therapeutic content improves engagement.

      We would like to thank the authors for their current review in this important and emerging area of mental health research, and hope that these comments serve to constructively build upon the discussion.

      Yours sincerely, Joseph M Barnby & Dr J Andres S Fonseca

      References:

      [1] Killikelly C, He Z, Reeder C, Wykes T. Improving Adherence to Web-Based and Mobile Technologies for People With Psychosis: Systematic Review of New Potential Predictors of Adherence. JMIR Mhealth Uhealth 2017; 5(7):e94

      [2] van der Krieke L, Emerencia A, Boonstra N, Wunderink L, de JP, Sytema S. A web-based tool to support shared decision making for people with a psychotic disorder: randomized controlled trial and process evaluation. J Med Internet Res 2013 Oct 07;15(10):e216

      [3] Ben-Zeev D, Brenner C, Begale M, Duffecy J, Mohr D, Mueser K. Feasibility, acceptability, and preliminary efficacy of a smartphone intervention for schizophrenia. Schizophr Bull 2014 Nov;40(6):1244-1253

      [4] Palmier-Claus J, Ainsworth J, Machin M, Dunn G, Barkus E, Barrowclough C, et al. Affective instability prior to and after thoughts about self-injury in individuals with and at-risk of psychosis: a mobile phone based study. Arch Suicide Res 2013;17(3):275-287.

      [5] Schlosser D, Campellone T, Kim D, Truong B, Vergani S, Ward C, et al. Feasibility of PRIME: a cognitive neuroscience-informed mobile app intervention to enhance motivated behavior and improve quality of life in recent onset schizophrenia. JMIR Res Protoc 2016 Apr 28;5(2):e77

      [6] Kimhy D, Vakhrusheva J, Khan S, Chang RW, Hansen MC, Ballon JS, et al. Emotional granularity and social functioning in individuals with schizophrenia: an experience sampling study. J Psychiatr Res 2014 Jun; 53: 141-148

      [7] Hartley S, Haddock G, Vasconcelos ES, Emsley R, Barrowclough C. An experience sampling study of worry and rumination in psychosis. Psychol Med 2014 Jun;44(8):1605-1614.

      [8] Gleeson J, Lederman R, Wadley G, Bendall S, McGorry P, Alvarez-Jimenez M. Safety and privacy outcomes from a moderated online social therapy for young people with first-episode psychosis. Psychiatr Serv 2014 Apr 01;65(4):546-550

      [9] Boulos MN, Gammon S, Dixon MC, MacRury SM, Fergusson MJ, Rodrigues FM, Baptista TM, Yang SP. Digital games for type 1 and type 2 diabetes: underpinning theory with three illustrative examples. JMIR Serious Games. 2015 Jan;3(1).

      [10] Wilhide III CC, Peeples MM, Kouyaté RC. Evidence-based mHealth chronic disease mobile app intervention design: development of a framework. JMIR research protocols. 2016 Jan;5(1).


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Aug 29, Marcus de Jong commented:

      With great interest, but also with significant apprehension, we read the article by Yamanaka et al. recently published on-line ahead of print in Neurosurgical Review, entitled "Trilateral retinoblastoma: A systematic review of 211 cases."

      We have had a long-time interest in retinoblastoma, including trilateral retinoblastoma, and we became worried about the fact that the authors allegedly have included 211 patients with trilateral retinoblastoma in their statistical analysis. We have reason to believe that this number, and consequently, the presented results may not be correct. In 2014, we published a systematic review and meta-analysis on trilateral retinoblastoma in Lancet Oncology, based on strict adherence to the PRISMA Statement (de Jong et al. [1]). We also contacted authors to resolve any equivocal issues. In particular, we meticulously matched patients between reports to prevent including any patients twice in our analysis. Many patients with trilateral retinoblastoma appear in the literature two or more times over the years; in the extreme case, one patient features in five different reports over 12 years. Resolving duplications and consolidating the sequential reports by each patient, we ended up with 174 unique individuals with trilateral retinoblastoma (see the attached table from the online supplement of our article).

      Naturally, a number of trilateral retinoblastoma cases included in Yamanaka et al.'s paper have been published after acceptance of our paper. These are Andrade et al. [2] with 1 case, De Ioris et al. [3] with 2 new cases, and Pham et al. [4] with 3 cases, amounting to a total difference of 6 unique patients.

      However, we included several articles that Yamanaka et al. have not ascertained during their research: De Jong et al. [5], Duncan et al. [6], Dunst et al. [7], Gururangan et al. [8], Jin et al. [9], Lim et al. [10], Mauger et al. [11], Onadim et al. [12], Popovic et al. [13], White et al. [14], and Zimmerman et al. [15]. These amount to a total of 18 unique cases.

      We became very concerned after noting that, correcting for new cases and articles not included by Yamanaka et al., the difference in the number of patients between the two articles is no less than 49 (our 174 - 18 not included by Yamanaka et al. = 156 in De Jong et al. [1] versus their 211 - 6 newly reported = 205 in Yamanaka et al. [16]). Because Yamanaka et al. have not provided a patient-by-patient table of their cases unlike we did, we are limited to this numerical comparison and cannot verify case by case their unique cases.

      In summary, we have reason to believe that Yamanaka et al. have not accounted for the fact that trilateral retinoblastoma patients have often been published in more than one paper. Although the results of the meta-analysis by Yamanaka et al., in general, show results that appear largely similar to those that what we published, the unexplained and large difference in the number of patients suggests to us that most, if not all, percentages and p-values from the meta-analysis by Yamanaka et al. do not reflect reality. There is also no way of knowing whether a particular statistic is correct or not.

      To solve this issue, we ask Yamanaka et al. to clarify this crucial aspect of their meta-analysis, ideally by providing a patient-by-patient list of the 211 cases to verify their uniqueness to be attached to their paper. Hopefully the authors can provide a valid explanation that completely resolves our concerns. Otherwise, we are afraid that the statistical results of this paper will be misleading and cannot be trusted, and then perhaps the paper in the present form should be retracted in order to correct the literature and to avoid wrong interpretations in clinical practice of managing children with trilateral retinoblastoma.

      Marcus de Jong,

      on behalf of the authors of de Jong et al. [1]

      References

      1.de Jong MC, Kors WA, de Graaf P, et al (2014) Trilateral retinoblastoma: A systematic review and meta-analysis. Lancet Oncol 15:1157–1167. doi: 10.1016/S1470-2045(14)70336-5

      2.Andrade GC de, Pinto NP de C, Motono M, et al (2015) Trilateral retinoblastoma with unilateral eye involvement. Rev Assoc Med Bras 61:308–10. doi: 10.1590/1806-9282.61.04.308

      3.De Ioris MA, Valente P, Randisi F, et al (2014) Baseline central nervous system magnetic resonance imaging in early detection of trilateral retinoblastoma: pitfalls in the diagnosis of pineal gland lesions. Anticancer Res 34:7449–54.

      4.Pham TTH, Siebert E, Asbach P, et al (2015) Magnetic resonance imaging based morphologic evaluation of the pineal gland for suspected pineoblastoma in retinoblastoma patients and age-matched controls. J Neurol Sci 359:185–192. doi: 10.1016/j.jns.2015.10.046

      5.de Jong MC, Moll AC, Göricke S, et al (2016) From a Suspicious Cystic Pineal Gland to Pineoblastoma in a Patient with Familial Unilateral Retinoblastoma. Ophthalmic Genet 37:116–8. doi: 10.3109/13816810.2014.929717

      6.Duncan JL, Scott IU, Murray TG, et al (2001) Routine neuroimaging in retinoblastoma for the detection of intracranial tumors. Arch Ophthalmol 119:450–2. 7.Dunst J, Fellner E, Erhardt J (1990) Trilaterales Retinoblastom mit spinalen Metastasen. Rofo 153:343–4. doi: 10.1055/s-2008-1033391

      8.Gururangan S, McLaughlin C, Quinn J, et al (2003) High-dose chemotherapy with autologous stem-cell rescue in children and adults with newly diagnosed pineoblastomas. J Clin Oncol 21:2187–91. doi: 10.1200/JCO.2003.10.096

      9.Jin J, Tang H-F, Zhou Y-B (2006) Trilateral retinoblastoma: a case report. World J Pediatr 2:151–153.

      10.Lim FPM, Soh SY, Iyer JV, et al (2013) Clinical profile, management, and outcome of retinoblastoma in Singapore. J Pediatr Ophthalmol Strabismus 50:106–12.

      11.Mauger TF, Makley TA, Davidorf FH, Rogers GL (1992) Retinoblastoma, microphthalmia, coloboma, and neuroepithelioma of the pineal body. Ann Ophthalmol 24:290–4.

      12.Onadim Z, Woolford AJ, Kingston JE, Hungerford JL (1997) The RB1 gene mutation in a child with ectopic intracranial retinoblastoma. Br J Cancer 76:1405–9.

      13.Popovic MB, Balmer A, Maeder P, et al (2006) Benign pineal cysts in children with bilateral retinoblastoma: a new variant of trilateral retinoblastoma? Pediatr Blood Cancer 46:755–61.

      14.White L, Johnston H, Jones R, et al (1993) Postoperative chemotherapy without radiation in young children with malignant non-astrocytic brain tumours. A report from the Australia and New Zealand Childhood Cancer Study Group (ANZCCSG). Cancer Chemother Pharmacol 32:403–6.

      15.Zimmerman L (1985) Trilateral retinoblastoma. In: Blodi F (ed) Retinoblastoma. Churchill Livingstone, New York, pp 185–210

      16.Yamanaka R, Hayano A, Takashima Y (2017) Trilateral retinoblastoma: A systematic review of 211 cases. Neurosurg Rev. doi: 10.1007/s10143-017-0890-4

      Also posted here: https://pubpeer.com/publications/50D5D3EFEA81DCD2421841D84FDA8D#


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2017 Nov 23, Franck Ramus commented:

      This study seems severely underpowered, which is surprising for such a frequent disorder as dyslexia, and given that we are in the midst of a replication crisis (e.g., Button et al. 2013; Ramus et al. 2017).

      With 12 participants per group, this study had 29% chance to observe a moderate group difference (d=0.6). Here, the significant result is due to a huge group difference (d=1.28) in the left V5/MT-LGN connectivity. Even larger than the corresponding behavioural difference in RAN letters (d=1.27) and numbers (d=0.95) (from Table S1). How plausible is it that there should be such a large brain difference between two groups of dyslexic and control individuals, even larger than the cognitive symptoms that this brain difference is presumed to underlie?

      Similarly, with 12 dyslexic individuals, only huge correlations greater than 0.576 could be significant. Luckily this study observed a correlation of 0.588 between left V5/MT-LGN connectivity and RAN (using a one-tailed test and correcting for two tests), but not with reading comprehension. But what about the other behavioural variables, spelling and reading speed? Are they not core symptoms of dyslexia, even more so than RAN? Do they not rely on visual abilities? Were the a priori predictions so specific to RAN and reading comprehension, that correlations with spelling and reading speed were not even tested? If those predictions had been preregistered, this might be credible. Alternatively, were those correlations tested, but not taken into account in the correction for multiple tests? (not even mentioning correlations within the control group, or across the two groups)

      Button, K. S., Ioannidis, J. P. A., Mokrysz, C., Nosek, B. A., Flint, J., Robinson, E. S. J., & Munafò, M. R. (2013). Power failure: why small sample size undermines the reliability of neuroscience. Nature Reviews Neuroscience, 14(5), 365‑376. https://doi.org/10.1038/nrn3475 Ramus, F., Altarelli, I., Jednoróg, K., Zhao, J., & Scotto di Covella, L. (2017). Neuroanatomy of developmental dyslexia : pitfalls and promise. Neuroscience & Biobehavioral Reviews. https://doi.org/10.1016/j.neubiorev.2017.08.001


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2018 Jan 19, Andrea Messori commented:

      Eight gene therapies are already supported by a published clinical trial

      by Andrea Messori

      HTA Unit, ESTAR

      50135 Firenze, Italy

      The study by Rangarajan and co-workers shows that gene therapies can be successful for a disease condition where the deficient factor is coded for by a very large gene. As of December 31, 2017, a published clinical trial is already available for the following 8 gene therapies:

      -Voretigene neparvovec (LUXTURNA, Spark Therapeutics): trial by Russell et al 2017; approved by FDA [2].

      -Tisagenlecleucel (KYMRIAH, Novartis): trial by Oncologic Drugs Advisory Committee[3]; approved by FDA [4].

      -Axicabtagene ciloleucel (YESCARTA, Gilead): trial by Neelapu et al [5]; approved by FDA [6].

      -STRIMVELIS (GSK): trial by Cicalese et al 2016; approved by EMA [7].

      -Gene therapy with a high-specific-activity factor IX variant: trial by George et al. 2017 [9].

      -Valoctocogene roxaparvovec: trial by Rangarajan et al 2017 [10].

      -Single-dose gene-replacement therapy Spinal Muscular Atrophy: trial by Mendell et al 2017 [11].

      -Hematopoietic stem-cell gene therapy for cerebral adrenoleukodystrophy: trial by Eichler et al 2017 [12].

      References

      1) Russell S, Bennett and co-workers for Cerebral Adrenoleukodystrophy J, Wellman JA, Chung DC, Yu ZF, Tillman A, Wittes J, Pappas J, Elci O, McCague S, Cross D, Marshall KA, Walshire J, Kehoe TL, Reichert H, Davis M, Raffini L, Georg Spinal Muscular Atrophy e LA, Hudson FP, Dingfield L, Zhu X, Haller JA, Sohn EH, Mahajan VB, Pfeifer W, Weckmann M, Johnson C, Gewaily D, Drack A, Stone E, Wachtel K, Simonelli F, Leroy BP, Wright JF, High KA, Maguire AM. Efficacy and safety of voretigene neparvovec (AAV2-hRPE65v2) in patients with RPE65-mediated inherited retinal dystrophy: a randomised, controlled, open-label, phase 3 trial. Lancet. 2017 Aug 26;390(10097):849-860. doi: 10.1016/S0140-6736(17)31868-8.

      2) FDA. FDA approves hereditary blindness gene therapy. Nat Biotechnol. 2018 Jan 10;36(1):6. doi: 10.1038/nbt0118-6a.

      3) Novartis. Oncologic Drugs Advisory Committee Briefing Document. Tisagenlecleucel (CTL019) for the Treatment of Pediatric and Young Adult Patients with Relapsed/Refractory B-Cell Acute Lymphoblastic Leukemia. https://www.fda.gov/downloads/advisorycommittees /committeesmeetingmaterials/drugs /oncologicdrugsadvisorycommittee/ucm566168.pdf , July 12, 2017. Accessed September 11, 2017.

      4) Bach PB, Giralt SA, Saltz LB. FDA Approval of Tisagenlecleucel: Promise and Complexities of a $475 000 Cancer Drug. JAMA. 2017 Nov 21;318(19):1861-1862. doi:10.1001/jama.2017.15218.

      5) Neelapu SS, Locke FL, Bartlett NL, Lekakis LJ, Miklos DB, Ja for a totalcobson CA, Braunschweig I, Oluwole OO, Siddiqi T, Lin Y, Timmerman JM, Stiff PJ, Friedberg JW, Flinn IW, Goy A, Hill BT, Smith MR, Deol A, Farooq U, McSweeney P, Munoz J, Avivi I, Castro JE, Westin JR, Chavez JC, Ghobadi A, Komanduri KV, Levy R, Jacobsen ED, Witzig TE, Reagan P, Bot A, Rossi J, Navale L, Jiang Y, Aycock J, Elias M, Chang D, Wiezorek J, Go WY. Axicabtagene Ciloleucel CAR T-Cell Therapy in Refractory Large B-Cell Lymphoma. N Engl J Med. 2017 Dec 28;377(26):2531-2544. doi: 10.1056/NEJMoa1707447.

      6) FDA. U.S. Food & Drug Administration. YESCARTA (axicabtagene ciloleucel), Axicabtagene Ciloleucel (YESCARTA, Gilead). https://www.fda.gov/BiologicsBloodVaccines/CellularGeneTherapyProducts/ApprovedProducts/ucm581222.htm

      7) Cicalese MP, Ferrua F, Castagnaro L, Pajno R, Barzaghi F, Giannelli S, Dionisio F, Brigida I, Bonopane M, Casiraghi M et al. Update on the safety and efficacy of retroviral gene therapy for immunodeficiency due to adenosine deaminase deficiency. Blood 2016;128: 45 – 54.

      8) Aiuti A, Roncarolo MG, Naldini L. Gene therapy for ADA-SCID, the first marketing approval of an ex vivo gene therapy in Europe: paving the road for the next generation of advanced therapy medicinal products. EMBO Mol Med. 2017 Jun;9(6):737-740. doi: 10.15252/emmm.201707573. PubMed PMID: 28396566; URL https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5452047/pdf/EMMM-9-737.pdf

      9) George LA, Sullivan SK, Giermasz A, Rasko JEJ, Samelson-Jones BJ, Ducore J, Cuker A, Sullivan LM, Majumdar S, Teitel J, McGuinn CE, Ragni MV, Luk AY, Hui D, Wright JF, Chen Y, Liu Y, Wachtel K, Winters A, Tiefenbacher S, Arruda VR, van der Loo JCM, Zelenaia O, Takefman D, Carr ME, Couto LB, Anguela XM, High KA. Hemophilia B Gene Therapy with a High-Specific-Activity Factor IX Variant. N Engl J Med. 2017 Dec 7;377(23):2215-2227. doi: 10.1056/NEJMoa1708538.

      10) Rangarajan S, Walsh L, Lester W, Perry D, Madan B, Laffan M, Yu H, Vettermann C, Pierce GF, Wong WY, Pasi KJ. AAV5-Factor VIII Gene Transfer in Severe Hemophilia A. N Engl J Med. 2017 Dec 28;377(26):2519-2530. doi:10.1056/NEJMoa1708483.

      11) Mendell JR, Al-Zaidy S, Shell R, Arnold WD, Rodino-Klapac LR, Prior TW, Lowes L, Alfano L, Berry K, Church K, Kissel JT, Nagendran S, L'Italien J, Sproule DM, Wells C, Cardenas JA, Heitzer MD, Kaspar A, Corcoran S, Braun L, Likhite S, Miranda C, Meyer K, Foust KD, Burghes AHM, Kaspar BK. Single-Dose Gene-Replacement Therapy for Spinal Muscular Atrophy. N Engl J Med. 2017 Nov 2;377(18):1713-1722. doi: 10.1056/NEJMoa1706198.

      12) Eichler F, Duncan C, Musolino PL, Orchard PJ, De Oliveira S, Thrasher AJ, Armant M, Dansereau C, Lund TC, Miller WP, Raymond GV, Sankar R, Shah AJ, Sevin C, Gaspar HB, Gissen P, Amartino H, Bratkovic D, Smith NJC, Paker AM, Shamir E, O'Meara T, Davidson D, Aubourg P, Williams DA. Hematopoietic Stem-Cell Gene Therapy for Cerebral Adrenoleukodystrophy. N Engl J Med. 2017 Oct 26;377(17):1630-1638. doi: 10.1056/NEJMoa1700554.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. On 2016 Feb 05, James Murray commented:

      The superoxide dependent nitrogenase described in this (Ribbe M, 1997) paper is extremely unlikely to exist.

      The paper describes the purification of the components of an oxygen-tolerant nitrogenase, not homologous to the known nif,vnf, or anf-type, from Streptomyces thermoautotrophicus UBT1, a thermophilic carboxydotroph.

      Results published in February 2016 (MacKellar D, 2016) show that three independent isolates of S. thermoautotrophicus, including the original UBT1 strain, do not grow in the absence of combined nitrogen and are incapable of incorporating isotopically labelled dinitrogen into biomass, nor do they contain the claimed superoxide dependent nitrogenase genes. The N-terminal sequences assigned to nitrogenase components in Ribbe M, 1997, and the full DNA gene sequences in the PhD thesis of Carla Hofmann-Findeklee (2000, KF951061.1, KF951060.1, KF951059.1, KF956113.1) are found at near-identity in Bacillus schlegelii DSM9132 (recently renamed to Hydrogenibacillus schlegelii, "SdnMSL-like" sequences in KT861421.1), a non-diazotrophic thermophilic carboxydotrophic organism isolated in the Meyer lab (Krüger & Meyer, 1984) and known to be cultured in the Meyer laboratory in 1994 (Hänzelmann, 1994). The independently isolated B. schlegelii DSM2000 strain also has these sequences at near-identity. The closest relatives to these sequences are to Firmicutes and not Actinomycetes like S. thermoautotrophiucs. The four "nitrogenase" sequences are easily identified as encoding a superoxide dismutase ("st2", sdnO), and a three-subunit aerobic carbon monoxide dehydrogenase ("st1", sdnMSL).

      Ribbe M, 1997 relies on an ammonia production assay to determine the nitrogenase activity. This assay is known to have a high background due to environmental ammonia and protein deamination. Incorporation of isotopically labelled dinitrogen is usually considered the gold standard for the identification of a nitrogenase enzyme. No incorporation of isotopically labelled nitrogen into ammonia is shown using the claimed biochemical nitrogenase preparation. The cells were grown in media with 1.5 g/l ammonium chloride, so there was no selection for diazotrophy. No published demonstration of the superoxide dependent nitrogenase has occurred outside the Meyer laboratory.

      The nitrogenase scheme described in Ribbe M, 1997 is chemically and biologically implausible. There is no known ATPase domain, as required by the proposed reaction scheme, in any of the described proteins. The known nitrogenase types require the highly reducing ferredoxin or flavodoxin as reductants. Superoxide is an unlikely electron donor for a nitrogenase, as it is not as reducing as even NADPH or NADH, and is reactive and toxic. No other biologically productive use of superoxide as an electron donor is known. An aerobic reduction of nitrogen to ammonia is unknown, and unlikely, as under the highly reducing conditions, oxygen would most probably be reduced in preference to nitrogen. The rate of activity described is too low to be that of a biological enzyme supporting diazotrophic growth, as it would take the proposed nitrogenase over 100 hours just to replace the nitrogen in the enzyme itself, which is also incompatible with the claimed rate of diazotrophic growth of S. thermoautotrophicus (Gadkari D, 1992).

      To summarize:

      • Recent evidence suggests that three independently isolated strains of S. thermoautotrophicus are not diazotrophic.

      • If the Meyer laboratory did contaminate their S. thermoautotrophicus culture with a strain of B. schlegelii (such as the DSM9132 strain), we would observe the N-terminal sequences presented here and the DNA gene sequences also produced in the Meyer laboratory.

      • The extremely low activity "nitrogenase" was described based on a problematic ammonia production assay.

      • A superoxide-dependent aerobic nitrogenase is chemically and biologically implausible.

      Declaration: I am an author on the MacKellar D, 2016 paper, but this comment is entirely my own.

      References:

      Bernd Krüger and Ortwin Meyer. Thermophilic bacilli growing with carbon monoxide. Archives of Microbiology, 139(4):402–408, 1984.

      Petra Hänzelmann. Isolierung und Charakterisierung von Kohlenmonoxid-Dehydrogenase aus dem obligat thermophilen Bakterium Bacillus schlegelii. Diplomarbeit thesis, University of Bayreuth, 1994.

      Carla Hofmann-Findeklee. Molekularbiologische Untersuchung der Strukturgene des aeroben N2-fixierenden Systems von Streptomyces thermoautotrophicus sowie funktionelle Charakterisierung von rekombinantem SdnO. PhD thesis, University of Bayreuth, 2000.


      This comment, imported by Hypothesis from PubMed Commons, is licensed under CC BY.

    1. Clarkson, L. A. 1981. “Marriage and Fertility in Nineteenth-Century Ireland”. Marriage and Society: Studies in the Social History of Marriage. Ed. R. B. Outhwaite. New York: St. Martin’s Press, 237-55.

      READ THIS

    1. Rokas, A., B. L. Williams, N. King, and S. B. Carroll. 2003. Genome-scale approaches to resolving incongruence in molecular phylogenies. Nature 425:798–804.

      In his study, Rokas came to the conclusion that there are no genes that provide more phylogenetic information than others. This led him to believe that in order to create an accurate phylogenetic tree, one would have to study the whole genome of an organism. He believed that an infinite amount of genes will result in an infinite amount of accuracy, which is why he claimed that most phylogenetic trees at the moment were probably inaccurate.

      In this paper, the conclusions Rokas came to were disproven by the experiments carried out. Stationary genes were discovered to be better contributors to a phylogenetic tree and are needed only in a relatively small amount to create an accurate tree.

  2. Jan 2018
  3. doc-0c-5g-docs.googleusercontent.com doc-0c-5g-docs.googleusercontent.com
    1. Ğ2yRǠ§ ǠǠǠ Ǡ3ǠǠǠǠ ǠǠ  ǠǠW ]ǠO_uǠ~(Ǡ ǠgǠÜī kǠǠǠNǠW Ǡ  Ǡ~ǗǠ ǠǠݬ> ?kǠǠ ǠǠ Ǡ%^ %ëǠ Ǡ1 bǠǠ} ǠǠ ǠǠǠÁǠǠǠ%ǠPǠūǘǠ&ǠǠǠǠ$ǠǠ Ǡ ǠǠ0Ǡ  ǠǠ zƎ›# ßǠìǠqś íǠŽƜǠ&ŋ6 Í ǠǠǠƌ  ¤Ǡ¬1Ǡ 5-ǠǠFǠ ̈D" ǠUĻǠǠűǠ  ǠřǠ ƀǠǠ£ďǠ&Ǡ ̄( ǠǠP fǠ <ǠYǠ=Ǡ  ǠǠ ĶǠ cØ?ǠǠ ǠijǠÉĂǠCfǠ  Ǡμl·Ǡ Ǡ ǠǠ ǠNJEšǠWǠ%ǠǠd 7'ǠǠǠ ±Ł ǠǠǠƧǠ$ ǠǠ  ǠǠ ”Ǡ  ǠǠ " ǠǠǠǠƨǠǠ$ňǠǠ ǠǠǠd"†^ǠǠǠǠ1Ǡğ  ĴǠ %ǠǠŠǠ ÔDžăǠ9ǠǠ Ǡ-ưłƆǠ Ǡ,

      Amazing that one group of people can place such restrictions on another, and hold that much power over them. How would Western society feel if such important traditions and practices were prevented in their societies?

    2. WDZòżDZ DZ)DZ$DZDZL #DZQ7ƫ(<DZ Œ- DZ DZw% VfDZDZyDZDZ¶.DZ ,DZœDNDZDZǒėDZDDZ†DZDZDZÛ2DZDZœ! DZ% DZS DZ˜B;DZsDZ DZÀDZ DZ1DZ DZ=&ĘóĴDZDZ  DZ .»DZDZDZ“W DZ Ʃ ęDZ '5DZ&DZ  30H#DZH  ĚDZ Þ DZDZƭ Åį!.DZů  DZ  DZEÂDZĪDZ_…DZDZ[ DZ DZ #DZDZŽÎÑDZDZDZ /'DZpDZ DZ&' DZ DZDZyDZ DZDZâ ī

      Reminds me of our conversation last week in class, about how it is sometimes better for movements to have a singular, unified voice that is delivering the message, as it can provide coherence and validity to the message. But, this could also have the danger of stifling particular voices and needs in the community. So which do you think is the more ideal system to carry a movement forward?

    3. v Ƭ ŃlƬū ½ƬƬųÉ95¾ƬƬ†ƬZ(ƬƬƄƬƬ ƒ ƬƬƬƬƬ Ƭ+ƬD ƬƬ z =xƬD Ƭ(z¿ƬƬ5+Ƭ  Ƭ ƬƬ ƍƬNçƬ  ƬƈƬƬ ŨƬƬ  ƬƬe  ơƬƬĤØƬU ƬƬƬO}ƬƬƬȏlƬ&yĎa; ƬP  ƬÀƬƢ ƜƬ/  ƇƬƬƬĩ‘ƬƬOʼnŠƨ ƬƬ.ŕƬ4 ƬƬ Ĺ ƬƬ    ƣƬ=ƬK6 'Ƭï” ƬƬƬƬ Œ.3MPƬ Ƭ Ƭ Ƭ> ƬƛƬ Ƭ( SƬƬ ƬFƬƬeƬƬD ƬƬƬƬ0=Ɵ Ê ƬƬĢb Ƭ!ƬƬš ş)Ƭ   ƬÁƬ1 ƬWƬ &J€)"ƬƬžt Ƭ1 +ŸƬoƅƬƬ ńƬƬV ƒƬ# ƬŅ dƬƬûKoƬ Ƭ ƬƬƬƬ(ƬƬY   ƬƬƬ ƬƬ—3ƬƬ c Ɲ‚ ÙƬ&ƬNc€)ƬgƬ&Ƭ¥Ƭ ÂƬ ƬƬƬ ÃƬGĝp ƬƬIśn jƬƬ-Ƭ6 ũƬƔbƬ ƬƬƃ ƬEƬ Ƭ ƬƬ¦Ƭ;5|èƬ5+ƬƬĘ“ ÚƬVƬÄƬƬƬŷĸ^ Ƭ‘Ļ/Ƭ1„§ƬĽ $Ƭ0"Ƭ GƬƬ ę,ƬƬ Ƭģ ƬƬ $Ƭ Ƭ Ƭ<ƬƬƬ( Ƭe x'ƬvƬĞűdƬqƬ ƬƙƬfƬƬčƐ >ƬƬƩ  ƬƬN Ƭ@“EƬM*Ƭ6ƎƬ Ƭ-Ƭ ƬŸƬ` _ƬƬ-ƬƬƬƬ Û¡Ƭ

      Interesting that she appeared to have little reservations about abandoning the expectations of her family and society and doing what she wanted to do, especially in that era. I wonder if she faced any repercussions or social scorn for her actions, other than just having her reputation 'tainted' a bit. Would be interesting to compare the result of such actions then, to if a woman did a similar thing today.

    1. Civil-rights leader Andrew Young (left) and others stand on the balcony of the Lorraine Motel pointing in the direction of an assailant after the assassination of civil-rights leader Dr. Martin Luther King Jr., who is lying at their feet, in Memphis, Tennessee, on April 4, 1968. # Joseph Louw / The LIFE Images Collection / Getty Read more This aerial view shows clouds of smoke rising from burning buildings in northeast Washington, D.C., on April 5, 1968. The fires resulted from rioting and demonstrations after the assassination of Dr. Martin Luther King Jr. # AP Read more Firemen battle a blaze on 125th Street in Harlem, New York, on April 4, 1968, after a furniture store and other buildings were set on fire after it was learned that civil-rights leader Dr. Martin Luther King Jr. had been assassinated. # AP Read more President Johnson called federal troops into the nation's capital to restore peace after a day of arson, looting, and violence on April 5, 1968. Here, a trooper stands guard in the street as another (left) patrols a completely demolished building. # Bettmann / Getty Read more Coretta Scott King, the widow of Martin Luther King Jr., walks on the arm of Dr. Ralph Abernathy, her husband's successor as head of the Southern Christian Leadership conference, leading about 10,000 people in a memorial march to the slain Dr. King. The King children, Yolanda, Martin III, and Dexter are at left with Harry Belafonte. Reverend Andrew Young marches next to Dr. Abernathy. # Bettmann / Getty Read more Original caption: Dr. Timothy Leary holds a conference in New York City on February 21, 1968. The LSD advocate said he is tuning in with peaceniks and “Yippies” and hopes to have a million young people in Chicago during the Democratic Party’s convention in August. He said he hopes they will disrupt the convention through “Flower Guerrilla” warfare. At left is Abbie Hoffman, who said he is an organizer and at right is Jerry Rubin, peace movement worker. # AP Read more 1968 was truly a year of protest around the world. Here in Rio de Janeiro, Brazil, state police cavalry charge students attending a memorial mass for Edson Luis de Lima Souto, a student killed by police, at Candelaria Church on April 4, 1968. Edson had been part of an earlier protest over high prices in a restaurant in downtown Rio, and was shot by police who were trying to remove students from premises. # Agencia JB / AP Read more Violent clashes between policeman and students take place during the May 1968 protests in Paris, France. [Editor's note: This photo replaces a previous image in this position that had been mislabeled by the source.] # Jacques Haillot / Apis / Sygma via Getty Read more A massive anti-Vietnam war demonstration in London on March 18, 1968. Hundreds were arrested as they demonstrated outside the United States embassy. # Corbis via Getty Read more Demonstrators march on Washington, D.C., during the Poor Peoples' Campaign Solidarity Day on June 19, 1968. # Charles Tasnadi / AP Read more The Beatles pose together on February 28, 1968. From left are Paul McCartney, John Lennon, Ringo Starr, and George Harrison. This was the year they released the White Album. # AP Read more American actor Gary Lockwood on the set of 2001: A Space Odyssey, written and directed by Stanley Kubrick. The groundbreaking film premiered in April of 1968, and earned the Academy Award for Best Visual Effects. # Sunset Boulevard / Corbis via Getty Read more A propaganda image from China's Cultural Revolution. In 1968, China was in a phase of their Cultural Revolution where Chairman Mao Zedong's cult of personality was still being elevated, and intellectuals and disloyal citizens were being forced into labor camps or exiled to remote farming regions. Original caption: Members of the Sichuan Province Revolving Committee unite with civilians and soldiers to work in the fields on August 26, 1968. # API / Gamma-Rapho via Getty Read more Federal Nigerian troops walk along a road near Ikot Expene, Nigeria, to the frontier with Biafra, a few miles away, on October 13, 1968. On the roadside, two emaciated Nigerian boys slowly die from starvation and malnutrition. Biafra was a breakaway state within Nigeria that fought a war for independence from 1967 to 1970, ending after years of fighting and a crippling blockade by Nigeria resulted in the deaths of between 500,000 and two million Biafran civilians by starvation. # Dennis Lee Royle / AP Read more A street scene from Pittsburgh, Pennsylvania, Grant St. at 5th Ave. on August 24, 1968. See the same scene today in Google Street View. # CC BY David Wilson Read more Original caption: A Feminine First. Mexico City: Mexico's Norma Enriqueta Basilio, the first woman in the history of the modern Olympic Games to light the Olympic Fire, runs up the 90 steps with the Olympic Torch during the opening ceremonies here on October 12, 1968. # Bettmann / Getty Read more Tommie Smith and John Carlos, gold and bronze medalists in the 200-meter run at the 1968 Olympic Games, engage in a victory stand protest against unfair treatment of blacks in the United States. With heads lowered and black-gloved fists raised in the black power salute, they refused to recognize the American flag and national anthem. Australian Peter Norman is the silver medalist. # Bettmann / Getty Read more Senator Robert F. Kennedy is surrounded by hundreds of people as he leans down to shake hands during a presidential campaign appearance at a street corner in central Philadelphia on April 2, 1968. Kennedy had declared his candidacy for the presidency of the United States only weeks earlier, on March 16. # AP Read more Senator Robert Kennedy lies sprawled, semi-conscious in his own blood after being shot in the head and neck while busboy Juan Romero tries to comfort him in kitchen in the Ambassador Hotel in Los Angeles, California, on June 5, 1968. A Palestinian immigrant named Sirhan Sirhan, who was angry with Kennedy over his support for Israel, shot Kennedy three times. Sirhan remains in prison to this day, last denied parole in 2016. # Bill Eppridge / The LIFE Picture Collection / Getty Read more Coretta Scott King, widow of Martin Luther King Jr., walks past the casket containing the body of the assassinated Senator Robert F. Kennedy in St. Patrick's Cathedral in New York City on June 7, 1968. # Bettmann / Getty Read more A large crowd lines railroad tracks as the funeral train of Robert F. Kennedy passes on its way to Arlington National Cemetery in Washington, D.C. # Bettmann / Getty Read more Youths prepare to board buses for Chicago in August of 1968. Peace activists and anti-war groups organized to travel to Chicago to demonstrate outside the 1968 Democratic National Convention. # AP Read more Police and demonstrators clash near the Conrad Hilton Hotel on Chicago's Michigan Avenue August 28, 1968, during the Democratic National Convention. # Bettmann / Getty Read more Mike Wallace, a CBS newsman, is hustled off the Democratic National Convention floor in the aftermath of a row between delegates and security officers during the nominating session on August 28, 1968 in Chicago. He was taken up a ramp to a second-floor room. # AP Read more Vice President Hubert Humphrey and his running mate, Sen. Edmund S. Muskie, with their wives shown at the final session Democratic Convention in Chicago following their nominations for president and vice president, on August 29, 1968. # AP Read more Members of the Black Panthers gather in front of entrance to the Alameda County Courthouse in Oakland, California, on July 15, 1968, to protest the trial of Huey Newton, 26, the founder of the Black Panthers. Newton went on trial for the slaying of an Oakland policeman and for wounding another officer on October 28. # Ernest K. Bennett / AP Read more Original caption: Miami policemen, one holding the man's arm and the other with an arm lock on his neck, drag away a Negro youth during a clash between police and rioters in that city's predominantly Negro Liberty City district on August 8, 1968. # Bettmann / Getty Read more Helicopters fly low during Operation Pegasus in Vietnam on April 5, 1968. They were taking part in the operation to relieve the Khe Sanh marine base, which had been under siege for the previous three months. # Dang Van Phuoc / AP Read more Evidence of the My Lai Massacre. A photograph of Vietnamese women and children in My Lai before they were killed by U.S. soldiers in the massacre on March 16, 1968. According to court testimony, they were killed seconds after the photo was taken. The woman on the right is adjusting her blouse buttons because of a sexual assault that happened before the massacre. Image taken from Volume III, Book 6, of the Report of the Department of the Army Review of the Preliminary Investigations into the My Lai Incident, photographed by United States Army photographer Ronald L. Haeberle. # Ronald L. Haeberle / U.S. Army Read more A U.S. Marine keeps his head low as he drags a wounded buddy from the ruins of the Citadel's outer wall during the Battle of Hue in Vietnam on February 16, 1968. # Bettmann / Getty Read more United States President Lyndon B. Johnson listens to a tape recording from his son-in-law Captain Charles Robb at the White House on July 31, 1968. Robb was a U.S. Marine Corps company commander in Vietnam at the time. Robb was later awarded the Bronze Star and, after returning home, became governor of Virginia in 1982, and later a senator for the same state. # Jack Kightlinger / AP Read more Original caption: Several hundred hippies gathered at "Hippie Hill" in San Francisco's Golden Gate Park for a happening at which several bands played rock 'n' roll music. Most of the hippies sat and listened, but some just couldn't keep from dancing to the rhythms. # Bettmann / Getty Read more Mexican army soldiers crouch with weapons ready in Mexico City's Tlatelolco district, in this October 2, 1968 photo. The truth behind the stunning assault on a peaceful democracy protest known as the Tlatelolco Massacre, in which some 300 people are believed to have been killed, remains largely hidden by government and military secrecy. # AP Read more Soldiers cut a student's hair after he was arrested during the first hour and a half of shooting in the Tlatelolco area in Mexico City on October 3, 1968. Another student stands against the wall. # AP Read more SRI’s Bill English, the engineer who built the first computer mouse prototype, prepares for the December 9, 1968 "mother of all demos." The demonstration is hailed as one of the most significant technological presentations in history, showcasing technologies that have become what we now know as modern computing. He gave the first public demonstration of a computer mouse, a graphical user interface, windowed computing, hypertext, word processing, video conferencing, and much more. # SRI International Read more Richard M. Nixon is mobbed by wildly cheering supporters as he arrives at the Hilton Plaza Hotel, his Miami Beach headquarters. # Bettmann / CORBIS / Getty Read more French Foreign Minister Michel Debre and U.S. President Lyndon Johnson watch television coverage of the flight of the Saturn 1 B Rocket launching from Cape Kennedy, Florida, on on October 11, 1968, in the White House Office in Washington, D.C. # Charles Gorry / AP Read more A heavy beard covers the face of astronaut Walter M. Schirra Jr., Apollo 7 commander, as he looks out the rendezvous window in front of the commander's station on the ninth day of the Apollo 7 mission on October 20, 1968. Apollo 7 was the first Apollo mission to carry a crew, and it made 163 orbits around the Earth in 10 days, setting the stage for Apollo 8, which was heading to the moon. # JSC / NASA Read more Apollo 8, the first manned mission to the moon, entered lunar orbit on Christmas Eve, December 24, 1968. That evening, the astronauts—Commander Frank Borman, Command Module Pilot Jim Lovell, and Lunar Module Pilot William Anders—held a live broadcast from lunar orbit, in which they showed pictures of the earth and moon as seen from their spacecraft. Said Lovell, "The vast loneliness is awe-inspiring and it makes you realize just what you have back there on Earth." They ended the broadcast with the crew taking turns reading from the book of Genesis. # NASA Read more $('.transition-img').click(function () { $(this).toggleClass('active'); }); Jump to Comments Ads by Revcontent From The Web 5 Years From Now, You'll Probably Wish You Grabbed These Stocks The Motley Fool x You Already Have Amazon Prime - Here's How to Make It Even Better Honey x 19 Discounts Seniors Didn't Know They Could Get (#10 Has Cable Companies Angry) Life'd x Robin Williams Final Net Worth Brought Us to Tears Interesticle x .rc-w-12488.rc-p-pt, .rc-w-12488.rc-p-pt > div { padding: 0; margin: 0; position: relative; cursor: pointer; } .rc-w-12488.rc-p-pt > div { list-style-type: none; } .rc-w-12488.rc-p-pt .rc-item { position: relative; overflow: hidden; } .rc-w-12488.rc-p-pt .rc-item { display: block; } .rc-w-12488.rc-p-pt .rc-item-wrapper { position: relative; margin: 3px; } .rc-w-12488.rc-p-pt .rc-row > div { vertical-align: top; } .rc-w-12488.rc-p-pt .rc-cta { text-decoration: none; display: block; } .rc-w-12488.rc-p-pt .rc-cta:hover { text-decoration: none; display: block; } .rc-w-12488.rc-p-pt .rc-cta:hover .rc-headline { text-decoration: underline; } .rc-w-12488.rc-p-pt .rc-photo { width: 100%; height: 150px; background-position: center center; background-repeat: no-repeat; background-size: cover; position: relative; } .rc-w-12488.rc-p-pt .rc-photo-container{ position: relative; } .rc-w-12488.rc-p-pt .rc-fc-video { display: block !important; position: absolute; line-height: 0; border-width: 0px; } .rc-w-12488.rc-p-pt .rc-fc-video img { border-width: 0px; } .rc-w-12488.rc-p-pt .rc-fc-video .rc-fc-icon-video { fill: rgba(96, 96, 96, .85); stroke: #fff; stroke-width: 0; } .rc-w-12488.rc-p-pt .rc-item-wrapper:hover .rc-fc-video .rc-fc-icon-video { fill: rgba(96, 96, 96, .95); } .rc-w-12488.rc-p-pt .rc-fc-video .rc-fc-icon-video .rc-fc-icon-video-arrow { fill: #fff; } .rc-w-12488.rc-p-pt .rc-fc-video .rc-fc-icon-video #circle2 { fill: rgba(0,0,0,0); stroke: #fff; stroke-width: 40; } .rc-w-12488.rc-p-pt .rc-fc-video #tri-video-icon .rc-fc-icon-video-arrow { filter: url(#shadow); } .rc-w-12488.rc-p-pt .rc-fc-video .rc-fc-icon-video #square1 { rx: 10; ry: 10; } .rc-w-12488.rc-p-pt .rc-fc-video.center { top: 50%; left: 50%; width: 30%; transform: translate(-50%, -50%); -ms-transform: translate(-50%, -50%); -webkit-transform: translate(-50%, -50%); } .rc-w-12488.rc-p-pt .rc-fc-video.top_left, .rc-w-12488.rc-p-pt .rc-fc-video.top_right, .rc-w-12488.rc-p-pt .rc-fc-video.bottom_right, .rc-w-12488.rc-p-pt .rc-fc-video.bottom_left { width: 12.5%; min-width: 40px; } .rc-w-12488.rc-p-pt .rc-fc-video.top_left.ie-fix, .rc-w-12488.rc-p-pt .rc-fc-video.top_right.ie-fix, .rc-w-12488.rc-p-pt .rc-fc-video.bottom_right.ie-fix, .rc-w-12488.rc-p-pt .rc-fc-video.bottom_left.ie-fix { height: 20%; } .rc-w-12488.rc-p-pt .rc-fc-video:after { display: block; content: ""; } .rc-w-12488.rc-p-pt .rc-fc-video.top_left, .rc-w-12488.rc-p-pt .rc-fc-video.top_right { top: 10px; } .rc-w-12488.rc-p-pt .rc-fc-video.top_left { left: 10px; } .rc-w-12488.rc-p-pt .rc-fc-video.top_right { right: 10px; } .rc-w-12488.rc-p-pt .rc-fc-video.bottom_right, .rc-w-12488.rc-p-pt .rc-fc-video.bottom_left { bottom: 10px; } .rc-w-12488.rc-p-pt .rc-fc-video.bottom_right { right: 10px; } .rc-w-12488.rc-p-pt .rc-fc-video.bottom_left { left: 10px; } .rc-w-12488.rc-p-pt .rc-photo-left .rc-photo { width: 45%; float: left; } .rc-w-12488.rc-p-pt .rc-photo-left .rc-content { margin-left: 50%; } .rc-w-12488.rc-p-pt .rc-photo-right .rc-photo { width: 45%; float: right; } .rc-w-12488.rc-p-pt .rc-photo-right .rc-content { margin-right: 50%; } .rc-w-12488.rc-p-pt .rc-display-url, .rc-w-12488.rc-p-pt .rc-provider { color: #c6c6c6; font-weight: normal; text-decoration: none; } .rc-w-12488.rc-p-pt .rc-content { margin: 4px 1% 0; } .rc-w-12488.rc-p-pt .rc-content div { padding: 5px 0; } .rc-w-12488.rc-p-pt .rc-item:hover .rc-content { bottom: 0; } .rc-w-12488.rc-p-pt .rc-bp-cta { top: 5px; right: 5px; } .rc-w-12488.rc-p-pt .rc-ct-oo { top: 5px; right: 5px; } .rc-uid-12488 * h3 { font-family: -apple-system,BlinkMacSystemFont,"Helvetica Neue",Arial,sans-serif!important; font-weight: 700!important; font-size: 17px!important; color: #000000!important; } .rc-uid-12488 .rc-headline { font-family: -apple-system,BlinkMacSystemFont,"Helvetica Neue",Arial,sans-serif!important; font-size: 16px!important; line-height: 1.25!important; font-weight: 600!important; color: #000000!important; } .rc-uid-12488 .rc-item .rc-headline { font-family:-apple-system,BlinkMacSystemFont,"Helvetica Neue",Arial,sans-serif!important; font-size:16px!important; line-height:1.25!important; font-weight:600!important; color:#000000!important; } .rc-uid-12488.rc-g-t .rc-item:hover .rc-headline {text-decoration:none!important} .rc-uid-12488.rc-g-p .rc-item:hover .rc-headline {text-decoration:none!important} rc-g-dl .rc-g-dl-1>div{width:100%}.rc-g-dl .rc-g-dl-2>div{width:50%}.rc-g-dl .rc-g-dl-3>div{width:33.33333333333333%}.rc-g-dl .rc-g-dl-4>div{width:25%}.rc-g-dl .rc-g-dl-5>div{width:20%}.rc-g-dl .rc-g-dl-6>div{width:16.66666666666666%}.rc-g-dl .rc-g-dl-7>div{width:14.28%}.rc-g-dl .rc-g-dl-8>div{width:12.5%}.rc-g-dl .rc-g-dl-9>div{width:11.11111111111111%}.rc-g-dl .rc-g-dl-10>div{width:10%}.rc-g-dl.rc-bp .rc-item:hover .rc-bp-cta .rc-ct.oo{display:inline-block;cursor:pointer!important}.rc-g-d .rc-g-d-1>div{width:100%}.rc-g-d .rc-g-d-2>div{width:50%}.rc-g-d .rc-g-d-3>div{width:33.33333333333333%}.rc-g-d .rc-g-d-4>div{width:25%}.rc-g-d .rc-g-d-5>div{width:20%}.rc-g-d .rc-g-d-6>div{width:16.66666666666666%}.rc-g-d .rc-g-d-7>div{width:14.28%}.rc-g-d .rc-g-d-8>div{width:12.5%}.rc-g-d .rc-g-d-9>div{width:11.11111111111111%}.rc-g-d .rc-g-d-10>div{width:10%}.rc-g-d.rc-bp .rc-item:hover .rc-bp-cta .rc-ct.oo{display:inline-block;cursor:pointer!important}.rc-g-t .rc-g-t-1>div{width:100%}.rc-g-t .rc-g-t-2>div{width:50%}.rc-g-t .rc-g-t-3>div{width:33.33333333333333%}.rc-g-t .rc-g-t-4>div{width:25%}.rc-g-t .rc-g-t-5>div{width:20%}.rc-g-t .rc-g-t-6>div{width:16.66666666666666%}.rc-g-t .rc-g-t-7>div{width:14.28%}.rc-g-t .rc-g-t-8>div{width:12.5%}.rc-g-t .rc-g-t-9>div{width:11.11111111111111%}.rc-g-t .rc-g-t-10>div{width:10%}.rc-g-p .rc-g-p-1>div{width:100%}.rc-g-p .rc-g-p-2>div{width:50%}.rc-g-p .rc-g-p-3>div{width:33.33333333333333%}.rc-g-p .rc-g-p-4>div{width:25%}.rc-g-p .rc-g-p-5>div{width:20%}.rc-g-p .rc-g-p-6>div{width:16.66666666666666%}.rc-g-p .rc-g-p-7>div{width:14.28%}.rc-g-p .rc-g-p-8>div{width:12.5%}.rc-g-p .rc-g-p-9>div{width:11.11111111111111%}.rc-g-p .rc-g-p-10>div{width:10%}.rc-wc{position:relative;margin:0 auto;padding:0;visibility:visible;display:block}.rc-row{margin:0}.rc-row:before,.rc-row:after{display:table;content:\" \"}.rc-row:after{clear:both}.rc-row:before,.rc-row:after{display:table;content:\" \"}.rc-row:after{clear:both}.rc-item,.rc-row>div{float:left;width:100%}.rc-item .rc-headline{font-family:'Roboto', sans-serif;font-size:17px;line-height:normal;font-weight:500;color:#000000;padding:0!important;margin:4px 1% 3px;overflow:hidden;width:98%;height: auto}.rc-wc .row-item h3{min-height:12px;cursor:default;font-family:'Roboto', sans-serif;font-size:19px;font-weight:600;color:#000000;text-align:left}.rc-p-pt .rc-photo{margin:0 1%}.rc-text-left{text-align:left}.rc-text-right{text-align:right}.rc-text-center{text-align:center}.rc-text-top{width:100%}.rc-text-top.rc-branding{top:24px}.rc-text-right.rc-branding{float:right;right:10px}.rc-branding{font-family:'Roboto', sans-serif !important;visibility:visible!important;display:inline-block!important;text-decoration:none;z-index:99;width:100%;color:#999;line-height:13px;position:relative}.rc-branding div{font-size:10px;cursor:pointer;display:inline-block}.rc-iab .rc-branding{height:0;overflow:visible;margin:0 auto}.rc-iab .rc-branding div{background-color:#bbb;color:#fff;padding:4px 5px;width:0;overflow:hidden;white-space:nowrap}.rc-bp-cta .rc-ct-oo{display:none!important} Most Recent #recent1 .lead-image { background-image: url(https://cdn.theatlantic.com/assets/media/img/photo/2018/01/photos-from-the-2018-dakar-rally/d01_903490020-1/river_thumb.jpg?1516306944); } Franck Fife / AFP / Getty In Focus 2:46 PM ET 33 Photos Photos From the 2018 Dakar Rally Leaving Lima, Peru, on January 6, 335 competitors started the 40th annual Dakar Rally, which arrives in Córdoba, Argentina, on January 20. #recent2 .lead-image { background-image: url(https://cdn.theatlantic.com/assets/media/img/photo/2018/01/nozawaonsen-dosojin-and-luminarias/f01_0001-1/river_thumb.jpg?1516229316); } Carl Court / Getty, Francisco Seco / AP In Focus Jan 17, 2018 31 Photos A Pair of Fiery Festivals In the past couple of days, festivals were held in two villages separated by language, culture, religion, and great distance, but both centered on the use of fire as a method of purification and blessing. #recent3 .lead-image { background-image: url(https://cdn.theatlantic.com/assets/media/img/photo/2018/01/gorgeous-images-of-the-planet-jupit/j01_25783327168-1/river_thumb.jpg?1516135669); } NASA / SwRI / MSSS / Gerald Eichstädt / Seán Doran In Focus Jan 16, 2018 24 Photos Gorgeous Images of the Planet Jupiter In its 10th orbit around Jupiter, NASA’s Juno spacecraft is returning amazing images of the gas giant that are being made even more incredible by citizen scientists here on Earth. #recent4 .lead-image { background-image: url(https://cdn.theatlantic.com/assets/media/img/photo/2018/01/photos-of-the-week-1/w01_903110512-1/river_thumb.jpg?1515788721); } Geoff Robins / AFP / Getty In Focus Jan 12, 2018 35 Photos Photos of the Week: Snowy Sahara, Dancing Devils, Cryptocurrency J-Pop The Singapore Zoo shows off its babies, ice blankets in the U.S., fog drifts in the U.K., Saudi Arabia opens its first automotive showroom solely for women, and much more. Most Popular on The Atlantic The New Age of Astrology An Exit From Trumpocracy What if H.R. McMaster Is Right About North Korea? The Hollywood Tide Turns on Woody Allen The Humiliation of Aziz Ansari This Is Not a Sex Panic Trump's Quietly Growing List of Victories The House Voted to Avert a Shutdown—But It Might Not Be Enough The 'Underground Railroad' To Save Atheists The Problem With Courting Amazon Newsletter Signup I want to receive updates from partners and sponsors. Back to Top Join the Discussion Home Share Tweet Subscribe Support 160 years of independent journalism. Name Address 1 Address 2 City State State Alabama Alaska Alberta American Samoa APO/FPO-Africa APO/FPO-Canada APO/FPO-Europe APO/FPO-Middle East APO/FPO-Americas APO/FPO-Pacific Arizona Arkansas British Columbia California Colorado Connecticut Delaware District of Columbia Florida Georgia Guam Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Manitoba Marshall Islands Maryland Massachusetts Michigan Micronesia Minnesota Mississippi Missouri Montana Nebraska Nevada New Brunswick New Hampshire New Jersey New Mexico New York Newfoundland Newfoundland-Labrador North Carolina North Dakota Northern Mariana Isles Northwest Territories Nova Scotia Nunavut Ohio Oklahoma Ontario Oregon Palau Pennsylvania Prince Edward Island Puerto Rico Quebec Quebec Rhode Island Saskatchewan South Carolina South Dakota Tennessee Texas Utah Vermont Virgin Islands Virginia Washington West Virginia Wisconsin Wyoming Yukon Territories Zip Code Country Email Address Fraud Alert regarding The Atlantic Newsletters+ The Atlantic The Atlantic Daily This Week This Month New Photo Galleries Top Videos This Week Politics & Policy Daily CityLab Today’s Top Stories This Week's Most Popular Stories I want to receive updates from partners and sponsors. Email Address Follow+ Facebook Twitter LinkedIn Instagram Tumblr Pinterest RSS App Store About+ Masthead FAQ Press Jobs Shop Books Emporium Manage Subscription Contact Us Send a News Tip Privacy Policy Advertise Advertising Guidelines Terms and Conditions Responsible Disclosure Site Map TheAtlantic.com Copyright (c) 2018 by The Atlantic Monthly Group. All Rights Reserved. { "detective": { "url": "/assets/static/theatlantic/img/sherlock.gif" }, "peer39": true, "lazy_load": 3, "adomik": true, "amazon": "3239", "globals": { "report": "1968", "src": "article", "type": "photo", "id": 550208, "title": "50-years-ago-in-photos-a-look-back-at-1968" }, "perfUrl": "https://cdn.atlanticinsights.com/perf.gif", "zone": "/4624/TheAtlanticOnline/channel_international", "adtest_domain": "dctestsite", "patchEventHandlers": true, "headerbidding": true, "criteo": true, "outofpage": true } Close SystemJS.config({ baseURL: "https://cdn.theatlantic.com/assets/static/b/frontend/" }); SystemJS.set('pageInfo', SystemJS.newModule(window.Atlantic.page_info)); SystemJS.set('profilesConfig', SystemJS.newModule({ profiles_url: window.Atlantic.PROFILES_URL, janrain: window.Atlantic.SESSION_URLS })); (function (s) { // Set all mandatory properties that don't change. s.account = "atlanticprod"; s.charSet="UTF-8"; s.currencyCode="USD"; s.trackDownloadLinks=true; s.trackExternalLinks=true; s.trackInlineStats=true; s.linkDownloadFileTypes="exe,zip,wav,mp3,mov,mpg,avi,wmv,doc,pdf,xls"; s.linkInternalFilters="javascript:,thewire.com,citylab.com,theatlantic.com,localhost"; s.linkLeaveQueryString=false; s.linkTrackVars="None"; s.linkTrackEvents="None"; s.visitorNamespace="atlanticmedia"; s.trackingServer="atlanticmedia.122.2o7.net"; // Optimizely Adobe Analytics SiteCatalyst Integration window.optimizely = window.optimizely || []; window.optimizely.push("activateSiteCatalyst"); // We don't want to track page views for iframes loaded on TheAtlantic.com // to prevent pages from being double counted var track_page_views = true; try { if (window.parent !== window && window.parent.location.hostname === "www.theatlantic.com") { track_page_views = false; } } catch(e) {} if (track_page_views && s.t) { /************* DO NOT ALTER ANYTHING BELOW THIS LINE ! **************/ var s_code = s.t(); if (s_code) document.write(s_code) if (navigator.appVersion.indexOf('MSIE') >= 0) document.write(unescape('%3C') + '\!-' + '-'); } })(window.s); <img src="http://atlanticmedia.122.2o7.net/b/ss/atlanticprod/1/H.23.6--NS/0" height="1" width="1" border="0" alt="" /> (function() { // Duplicate a few existing s.props to be passed with linkTrackVars. If // we just reused the existing s.props, data would be recorded twice. s.prop66 = location.pathname; s.prop67 = Atlantic.page_info.view; s.prop68 = s.prop23; // Viewport s.prop69 = ""; // Referring domain. // You can coerce a URL into a URL object by creating a fake <a> // element and setting the href. Newer browsers have a real URL // constructor but this works in IE<10. if (document.referrer !== "") { var tmp = document.createElement("a"); tmp.href = document.referrer; s.prop69 = tmp.hostname; } s.linkTrackVars = "prop37,prop61,prop66,prop67,prop68,prop69,prop43,prop44,eVar21,eVar22,eVar25,eVar26,eVar27,eVar32,eVar33,eVar35,eVar36,eVar37,eVar38,eVar39,eVar40,eVar20,evar41,evar43"; })(); <div><a href="http://www.omniture.com" title="Web Analytics" ><img src="//atlanticmedia.122.2o7.net/b/ss/atlanticprod/1/H.22--NS/0" height="1" width="1" alt="" /></a></div> (function(a,c,d,e){if(!a[c]){var b=a[c]={};b[d]=[];b[e]=function(a){b[d].push(a)}}})(window,'Scroll','_q','do'); Scroll.config = { orientation: 'bottom', detected: document.cookie.indexOf("scroll0=") > -1 }; window.fbAsyncInit = function() { FB.init({ appId: '100770816677686', xfbml : false, version : 'v2.7' }); }; (function(d, s, id){ var js, fjs = d.getElementsByTagName(s)[0]; if (d.getElementById(id)) {return;} js = d.createElement(s); js.id = id; js.src = "//connect.facebook.net/en_US/sdk.js"; fjs.parentNode.insertBefore(js, fjs); }(document, 'script', 'facebook-jssdk')); /** * Route blockers */ (function(){ function redirect() { // Chrome 54-57 has a bug with its extensions that breaks // whitelisting on the first pageview when sent through // a shortened url. We can't detect shorturls reliable, // so let it slide. var chromeFreePV = (function(){ var host = window.location.protocol + "//" + window.location.host; var isFirstPV = (document.referrer.indexOf(host) !== 0); var isChrome = (window.navigator.userAgent.match(/Chrome\//) !== null); return isFirstPV && isChrome; })(); var isCrawler = (function(){ var botsRe = "(Googlebot|Bingbot|Yahoo! Slurp|DuckDuckBot|facebookexternalhit)"; return (window.navigator.userAgent.match(botsRe) !== null); }()); if ((navigator.onLine === false) || isCrawler || chromeFreePV || Atlantic.User.isMember() || Atlantic.User.isAdFree({strict: false})) { return; } var next = encodeURIComponent(window.location.href); var url = window.location.protocol + "//" + window.location.host + "/please-support-us/?next="; window.location.href = url + next; }; // Prevent race condition if (Modernizr["blocker-enabled"]) { redirect(); } else { $(window).one("blocker-detected", redirect); } })(); document.addEventListener("onBoomerangLoaded", function(e) { e.detail.BOOMR.init({ beacon_url: "https://cdn.atlanticinsights.com/rum.gif", log: null }); }); (function(){ var dom,doc,where,iframe = document.createElement('iframe'); iframe.src = "javascript:void(0)"; (iframe.frameElement || iframe).style.cssText = "width: 0; height: 0; border: 0"; var where = document.getElementsByTagName('script')[0]; where.parentNode.insertBefore(iframe, where); try { doc = iframe.contentWindow.document; } catch(e) { dom = document.domain; iframe.src="javascript:var d=document.open();d.domain='"+dom+"';void(0);"; doc = iframe.contentWindow.document; } doc.open()._l = function() { var js = this.createElement("script"); if(dom) this.domain = dom; js.id = "boomr-if-as"; js.src = 'https://cdn.theatlantic.com/assets/static/b/theatlantic/js/boomerang-1.0.1509573276.min.js'; this.body.appendChild(js); }; doc.write('<body onload="document._l();">'); doc.close(); })(); (function(){if(window.Atlantic&&(Atlantic.page_info&&dataLayer.push({page_info:Atlantic.page_info}),window.addEventListener("system:ready",function(a){Atlantic.User&&dataLayer.push({user_entitlements:Atlantic.User.entitlements})},!1),Atlantic.User&&dataLayer.push({user_entitlements:Atlantic.User.entitlements}),Atlantic.GTM)){var a=Atlantic.GTM.simplereach.conf,b=Atlantic.GTM.quantcastLabels.join(", ");a.pid="516eed0e4240cfbf3000002a";Atlantic.page_info&&Atlantic.page_info.is_sponsored&&(a.tags.push(Atlantic.page_info.sponsor), a.tags.push(Atlantic.page_info.campaign_slug),a.tags=a.tags.concat(Atlantic.page_info.tags));dataLayer.push({simplereach_config:a,quantcast_labels:b})}})();(function(){if("subscribe.theatlantic.com"===document.location.hostname){var a="The Atlantic.Subscription Pages";google_tag_manager["GTM-56LJR35"].macro('gtm1')&&(a+=", The Atlantic.Subscription Pages."+google_tag_manager["GTM-56LJR35"].macro('gtm2'));var b={pid:"588a7859736b79b6670006cb",reach_tracking:!1};dataLayer.push({simplereach_config:b,quantcast_labels:a})}})(); (function(){var a=google_tag_manager["GTM-56LJR35"].macro('gtm3');a&&0<a.length&&void 0!==window.atob&&(a=atob(a),dataLayer.push({silverpop_recipient_id:a.substring(0,a.length-1)}))})(); (function(){function a(a){a="kxatlantic_"+a;try{var b=window.localStorage}catch(e){b=null}return b?b[a]||"":navigator.cookieEnabled?(b=document.cookie.match(a+"\x3d([^;]*)"))&&unescape(b[1])||"":""}window.Krux||((Krux=function(){Krux.q.push(arguments)}).q=[]);var b=a("segs");window.Krux.user=a("user");window.Krux.segments=b?b.split(","):[];dataLayer.push({krux_user:window.Krux.user,krux_segments:window.Krux.segments})})(); (function(){window.Blueconic||(Blueconic={segments:[]});try{if(window.localStorage){var a=localStorage.getItem("bcDFPTargetingParams");if(a){var b=JSON.parse(a);a={};for(var c=0;c<b.length;c++)a["blueconic_"+b[c].key]=b[c].value,"audiences"===b[c].key&&(window.Blueconic.segments=b[c].value);0<b.length&&dataLayer.push(a)}}}catch(d){console.warn("Could not parse Blueconic segments:",d)}})();window.Krux||((Krux=function(){Krux.q.push(arguments)}).q=[]);Krux("ns:atlantic","admEvent","LddoOahE",{});dataLayer.push({gtm_loaded:"yes"});window.Krux||((Krux=function(){Krux.q.push(arguments)}).q=[]);window.Atlantic=window.Atlantic||{}; (function(){function f(a,b){if(document.querySelectorAll&&document.addEventListener)for(var e=document.querySelectorAll(a),c=function(a){this.getAttribute&&b(this.getAttribute("data-share"))},d=0;d<e.length;d++)e[d].addEventListener("click",c),e[d].addEventListener("tap",c)}if(window.Atlantic.page_info){var a=window.Atlantic.page_info;window.Atlantic.KruxDataLayer={path:window.location.pathname,domain:window.location.hostname,authors:a.authors,canonical_url:a.canonical_url,channels:a.channels,date:a.date, description:a.description,image:a.image,kicker:a.kicker,original_url:a.original_url,primary_channel:a.primary_channel,report:a.report,tags:a.tags,title:a.title,seo_title:a.seo_title,view:a.view,article_id:a.article_id,article_type:a.article_type,is_sponsored:a.is_sponsored,is_freelance:a.is_freelance}}else window.Atlantic.KruxDataLayer={path:window.location.pathname,domain:window.location.hostname};window.Blueconic&&Blueconic.segments&&(window.Atlantic.KruxDataLayer.blueconic_segments=Blueconic.segments); if(window.Atlantic.User&&(a=window.Atlantic.User,window.Atlantic.KruxDataLayer.user={print:a.isPrintSubscriber()?"yes":"no",ehub:a.isAdFree()?"yes":"no",newsletters:a.isNewsletterSubscriber()?"yes":"no"},!1===a.isLoggedIn()))for(var b in window.Atlantic.KruxDataLayer.user)window.Atlantic.KruxDataLayer.user[b]="signed-out";b=document.createElement("script");b.type="text/javascript";b.async=!0;b.src=("https:"===location.protocol?"https:":"http:")+"//cdn.krxd.net/controltag/qrixx06d0.js";a=document.getElementsByTagName("script")[0]; a.parentNode.insertBefore(b,a);var c={facebook:"KprCnYga",twitter:"KprDGKs_",linkedin:"KprE2Sd6",email:"KprFEE7b",print:"Lcl38W0M"};f("[data-share]",function(a){c[a]&&window.Krux("ns:atlantic","admEvent",c[a],{})});f("a[href^\x3d'mailto:?']",function(a){window.Krux("ns:atlantic","admEvent",c.email,{})})})();Atlantic&&Atlantic.page_info&&Atlantic.page_info.article_id&&""!==Atlantic.page_info.article_id&&(Atlantic.set_metadata=function(a){Atlantic.article_metadata=a;dataLayer.push({article_metadata:a});window.fbq&&a.categories&&fbq("trackCustom","WatsonContentViewed",{article_categories:a.categories})},function(a){var b=document.createElement("script");b.type="text/javascript";b.async=!0;b.src="https://metadata.atlanticinsights.com/"+a+"/metadata.js";a=document.getElementsByTagName("script")[0];a.parentNode.insertBefore(b, a)}(Atlantic.page_info.article_id)); if(window.Atlantic&&Atlantic.page_info){var _sf_async_config=_sf_async_config||{};_sf_async_config.uid=google_tag_manager["GTM-56LJR35"].macro('gtm5');_sf_async_config.domain=function(){var a=window.location.host,b=location.search.match(/utm_(?:campaign|source)=fb\d{4}_\d+/i);null!==b&&(a=a.replace("www.","paid."));return a}();_sf_async_config.flickerControl=!1;var _sf_startpt=(new Date).getTime();if("homepage"===Atlantic.page_info.view){var script=document.createElement("script");script.type="text/javascript";script.async= !0;script.src="https://static.chartbeat.com/js/chartbeat_mab.js";var s=document.getElementsByTagName("script")[0];s.parentNode.insertBefore(script,s)}_sf_async_config.title=Atlantic.page_info.title;_sf_async_config.path=Atlantic.page_info.path||window.location.pathname;Atlantic.opts&&Atlantic.opts.chartbeatOverrides&&(Atlantic.opts.chartbeatOverrides.path&&(_sf_async_config.path=Atlantic.opts.chartbeatOverrides.path),Atlantic.opts.chartbeatOverrides.title&&(_sf_async_config.title=Atlantic.opts.chartbeatOverrides.title)); _sf_async_config.playerdomain="www.theatlantic.com";_sf_async_config.sections=function(a){var b=[];switch(a.article_type){case "note":case "thread":b.push("notes");break;case "blog":case "citylab":case "wire":break;case "":b.push(a.primary_channel);default:b.push(a.article_type)}b=b.concat(a.channels);return b.join(",")}(Atlantic.page_info);_sf_async_config.authors=Atlantic.page_info.authors.join(",");Atlantic.page_info.is_sponsored&&(_sf_async_config.zone="sponsored");Atlantic.page_info.sponsor&& (_sf_async_config.sponsorName=Atlantic.page_info.sponsor);window._sf_endpt=(new Date).getTime();_sf_async_config.ytApikey="AIzaSyDP5dqEZLyedSSUKle2MCEtXyN6ppCmx8Y";var _cbv=window._cbv||(window._cbv=[]);_cbv.push(["autoDetectYouTubeIframes"])}; (function(){"/membership/join/"===google_tag_manager["GTM-56LJR35"].macro('gtm6')?dataLayer.push({masthead_funnel:"landing"}):0<google_tag_manager["GTM-56LJR35"].macro('gtm7').indexOf("flow\x3dmembership")&&"/"===google_tag_manager["GTM-56LJR35"].macro('gtm8')&&"accounts.theatlantic.com"===google_tag_manager["GTM-56LJR35"].macro('gtm9')?dataLayer.push({masthead_funnel:"login"}):"/pubs/A5/ATL/Membership_New.jsp"===google_tag_manager["GTM-56LJR35"].macro('gtm10')||"/pubs/A5/ATL/Membership_Existing.jsp"===google_tag_manager["GTM-56LJR35"].macro('gtm11')?dataLayer.push({masthead_funnel:"order form"}):"/pubs/A5/ATL/Membership_Conf.jsp"===google_tag_manager["GTM-56LJR35"].macro('gtm12')&& dataLayer.push({masthead_funnel:"confirmation"})})();!function(b,e,f,g,a,c,d){b.fbq||(a=b.fbq=function(){a.callMethod?a.callMethod.apply(a,arguments):a.queue.push(arguments)},b._fbq||(b._fbq=a),a.push=a,a.loaded=!0,a.version="2.0",a.queue=[],c=e.createElement(f),c.async=!0,c.src=g,d=e.getElementsByTagName(f)[0],d.parentNode.insertBefore(c,d))}(window,document,"script","https://connect.facebook.net/en_US/fbevents.js");fbq("init","1407501962855831");fbq("track","PageView"); fbq("track","ViewContent",{blueconic_segments:google_tag_manager["GTM-56LJR35"].macro('gtm14'),purchase_confirmation_viewed:google_tag_manager["GTM-56LJR35"].macro('gtm15'),utm_campaign:google_tag_manager["GTM-56LJR35"].macro('gtm16')}); <img height="1" width="1" style="display:none" src="https://www.facebook.com/tr?id=1407501962855831&amp;ev=PageView&amp;noscript=1">__reach_config=google_tag_manager["GTM-56LJR35"].macro('gtm17');google_tag_manager["GTM-56LJR35"].macro('gtm18')&&(__reach_config.ref_url="https://www.facebook.com/",__reach_config.page_url=null,__reach_config.tags&&__reach_config.tags.push("FB_Instant"));

      The sad day where Dr. King himself died and wondering of the whereabouts of the killer, and a possibility that civil rights itself may have lost because of its head figure dying.

      s18practice#Ky'MetriP

    1. Coasting along shore the)' touched at Cephallcnia3·l and made a descent on the Cranian-'h territory, and losing some men in a surprise attack b)' the Cranians, put to sea somewhat hurriedly and returned borne.

      felt like the event was important

  4. Dec 2017
  5. docs.wixstatic.com docs.wixstatic.com
    1. l comer una bolsa de galletas con chispas de chocolate, usted observa que cadauna es un disco circular con diámetro de 8.50 0.02 cm y espesor de 0.050 0.005 cm.a) Calcule el volumen promedio de una galleta y la incertidumbre del volumen. b)Obtenga la razón diámetro/espesor y la incertidumbre de dicha razón

      Eliminar este punto.

    1. J. E. K. Byrnes, L. Gamfeldt, F. Isbell, J. S. Lefcheck, J. N. Griffin, A. Hector, B. J. Cardinale, D. U. Hooper, L. E. Dee, J. E. Duffy, Investigating the relationship between biodiversity and ecosystem multifunctionality: Challenges and solutions. Methods Ecol. Evol. 5, 111–124 (2014).

      Byrne's review focuses on the impacts of assemblage diversity on ecosystem functions.

      This study acknowledges the impact of diversity on resource utilization and thus productivity, however the focus is on the characterization of multi-functionality.

    2. A. D. Barnosky, N. Matzke, S. Tomiya, G. O. U. Wogan, B. Swartz, T. B. Quental, C. Marshall, J. L. McGuire, E. L. Lindsey, K. C. Maguire, B. Mersey, E. A. Ferrer, Has the Earth's sixth mass extinction already arrived? Nature 471, 51–57 (2011).

      Barnosky discusses the events known as mass extinctions and compares the rates of extinction for these events to modern rates of extinction. PB

    3. (3)

      Has the Earth's sixth mass extinction already arrived? A. D. Barnosky, N. Matzke, S. Tomiya, G. O. U. Wogan, B. Swartz, T. B. Quental, C. Marshall, J. L. McGuire, E. L. Lindsey, K. C. Maguire, B. Mersey, E. A. Ferrer

      This article suggests that the current rate of species extinction is higher than what has been expected in the past (compared against fossil records). The authors propose that this elevated rate of extinction may possibly be the beginning of the 6th known mass extinction event on earth.

      This extinction would drastically lower biodiversity by killing off many species that would otherwise function as carbon sinks. The release of such massive amounts of carbon might have dramatic effects upon the environment.

      SC

    4. B. J. Cardinale, K. L. Matulich, D. U. Hooper, J. E. Byrnes, E. Duffy, L. Gamfeldt, P. Balvanera, M. I. O'Connor, A. Gonzalez, The functional role of producer diversity in ecosystems. Am. J. Bot. 98, 572–592 (2011).

      Cardinale reviews the roles of primary producer biodiversity with respect to ecological processes critical to the functionality and health of terrestrial and marine ecosystems. PB

    1. P r o v i d e n c e P u b l i c S c h o ol D i s t r i c t I A U PPage 8THE STUDENT

      I like that the policy has the consent form of the parents, employee and the student attached with this technology policy.

    1. L. M. Ittner, Y. D. Ke, F. Delerue, M. Bi, A. Gladbach, J. van Eersel, H. Wölfing, B. C. Chieng, M. J.Christie, I. A. Napier, A. Eckert, M. Staufenbiel, E. Hardeman, J. Götz, Dendritic function of tau mediates amyloid-β toxicity in Alzheimer’s disease mouse models. Cell 142, 387–397 (2010).

      In this article, Ittner and others show that the absence of tau in amyloid beta-forming mice lessens the severity of amyloid beta toxicity. These results suggest that tau and amyloid beta together increase the symptoms and progression of Alzheimer’s disease.

  6. Nov 2017
    1. https://ecpe.sph.harvard.edu/newsstory.cfm?story=healthcare-quality-improvement-efforts-in-united-statesCasalino, L. P. (1999). The unintended consequences of measuring quality on the quality of medical care. New England Journal of Medicine, 341 (15), 1147–1150.Centers for Medicare & Medicaid Services, Center for Clinical Standards and Quality. (2015, August). Inpatient rehabilitation facility quality reporting program: Specifications for the quality measures adopted through fiscal year 2016 final rule (CMS Contract No. HHSM-500-2013-130151 (HHSM-500-T0001). Retrieved from https://www.cms.gov/Medicare/Quality-Initiatives-Patient-Assessment-Instruments/IRF-Quality-Reporting/Downloads/IRF_Final_Rule_Quality_Measure_Specifications_7-29-2015.pdfCenters for Medicare & Medicaid Services. (2015, January13). CARE item set and B-CARE. Retrieved from https://www.cms.gov/Medicare/Quality-Initiatives-Patient-Assessment-Instruments/Post-Acute-Care-Quality-Initiatives/CARE-Item-Set-and-B-CARE.htmlCenters for Medicare & Medicaid Services. (2016). CMS quality strategy 2016. Retrieved from https://www.cms.gov/Medicare/Quality-Initiatives-Patient-Assessment-Instruments/QualityInitiativesGenInfo/Downloads/CMS-Quality-Strategy.pdf

      These links are broken.

    1. Adams, E., Krahn, G. L., Horner-Johnson, W., & Leman, R. (2009). Fundamentals of disability epidemiology. InDisability and public health(p. 7). Washington, DC: American Public Health Association.The Affordable Care Act Helps Persons with Disabilities. (n.d.). Retrieved from https://www.whitehouse.gov/sites/default/files/docs/the_aca_helps_americans_with_disabilities.pdfAlaszewski, H., Alaszewski, A., Potter, J., Penhale, B., & Billins, J. (2003). Life after stroke: Reconstructing everyday life. Report–Nunnery fields trust fund. Project report. Retrieved from http://kar.kent.ac.uk/id/eprint/7745Alper, E., O’Malley, T. A., & Greenwald, J. (2016). Hospital discharge and readmission. UpToDate. Retrieved from https://www.uptodate.com/contents/hospital-discharge-and-readmissionAltman, B. M. (2014). Definitions, concepts, and measures of disability. Annals of Epidemiology, 24, 2–7. doi: 10.1016/j.annepidem.2013.05.018American Hospital Associate. (2012). Bringing behavioral health into the care continuum: Opportunities to improve qualities, costs and outcomes. InTrendwatch. Washington, DC: Author.Americans with Disabilities Act National Network. (2015). An overview of the Americans with Disabilities Act. Retrieved from https://adata.org/sites/adata.org/files/files/ADA_Overview_2015%20bitly.pdfAnderson, W. L., Armour, B. S., Finklestein, E. A., & Wiener, J. M. (2010). Estimates of state-level health-care expenditures associated with disability. Public Health Reports, 125, 44–51.Andrews, G., Henderson, S., & Hall, W. (2001). Prevalence, comorbidity, disability and service utilization: Overview of the Australian National Mental Health Survey. British Journal of Psychiatry, 178, 145–153.Au, M., Simon, S., Chen, A., Lipson, D., Gimm, D., & Rich, E. (2011). Comparative effectiveness of care coordination for adults with disabilities. Bethesda, MD: Mathematica Policy Research. Retrieved from http://www.mathematica-mpr.com/~/media/publications/PDFs/health/comparative_care_rschbrief.pdfBaker, A., Lee, N. K., Claire, M., Lewin, T. J., Grant, T., & Pohlman, S. (2005). Brief cognitive behavioral interventions for regular amphetamine users: A step in the right direction. Addiction, 100, 367–378.Barber, R., Kogan, A. C., Riffenburgh, A., & Enguidanos, S. (2015). A role for social workers in improving care setting transitions: A case study. Social Work in Health Care, 54 (3), 177–192. doi: 10.1080/00981389.2015.1005273Beich, A., Thorsen, T., & Rollnick, S. (2003). Screening in brief intervention trials targeting excessive drinkers in general practice: Systematic review and meta-analysis. BMJ: British Medical Journal, 327, 536–542.Bernstein, E., Bernstein, J., Feldman, J., Fernandez, W., Hagan, M., Mitchell, P., … Woolard, R. (2007). An evidence-based alcohol screening, brief intervention, and referral to treatment (SBIRT) curriculum for emergency department (ED) providers improves skills and utilization. Substance Abuse, 28 (4), 79–92.Bronfenbrenner, U. (1986). Ecology of the family as a context for human development: Research perspectives. Developmental Psychology, 22 (6), 723–742.Bull, M. J., Hansen, H. E., & Gross, C. R. (2000). A professional-patient partnership model of discharge planning with elders hospitalized with heart failure. Applied Nursing Research, 13 (1), 19–28.Bush, G. H. W. (1990). Remarks at the signing of the Americans with Disabilities Act of 1990. Retrieved from https://www.eeoc.gov/eeoc/history/35th/videos/ada_signing_text.htmlButler, A. C., Chapman, J. E., Forman, E. M., & Beck, A. T. (2006). The empirical status of cognitive behavioral therapy: A review of meta-analyses. Clinical Psychology Review, 26, 17–31.Carlson, A. (2014). Social worker interventions for patients post-stroke. Master of social work clinical research papers, paper 300. Retrieved from http://sophia.stkate.edu/msw_papers/300Claiborne, N. (2006). Efficiency of a care coordination model: A randomized study with stroke patients. Research on Social Work Practice, 16 (1), 57–66.Cully, J. A., & Teten, A. L. (2006). A therapist’s guide to brief cognitive behavioral therapy. Houston, TX: Department of Veterans Affairs South Central MIRECC. Retrieved from http://www.mirecc.va.gov/visn16/docs/therapists_guide_to_brief_cbtmanual.pdfDepartment of Health and Human Services. (2014, October). Discharge planning. Retrieved from https://www.cms.gov/Outreach-and-Education/Medicare-Learning-Network-MLN/MLNProducts/Downloads/Discharge-Planning-Booklet-ICN908184.pdfDisability.gov. What the Affordable Care Act means for you and your family. Retrieved from https://www.disability.gov/resource/the-affordable-care-act-you-family

      Italic

    1. https://www.nih.gov/about-nih/what-we-do/nih-almanac/national-center-complementary-integrative-health-nccihNewberg, A. B., Lariccia, P. J., Lee, B. Y., Farrar, J. T., Lee, L., & Alavi, A. (2005, January). Cerebral blood flow effects of pain and acupuncture: A preliminary single-photon emission computed tomography imaging study. Journal of Neuroimaging, 15 (1), 43–49.Novella, S. (2015). Alternative whole medical systems. Merck Manual Professional Version. Retrieved from https://www.merckmanuals.com/professional/special-subjects/complementary-and-alternative-medicine/alternative-whole-medical-systems

      These two links are broken.

    1. shrill

      I love what the OED brings to this poem.

      shrill, v.

      (ʃrɪl)

      Also 4 schrille, 4–6 shrille, 5 shrelle, [skrille], 6–7 shril.

      [f. shrill a. Cf. G. schrillen.]

      1.1 intr. Of a voice, cry: To sound shrilly. Hence of noises, the wind, or the like, or a place echoing with sound.

         13‥ K. Alis. 777 Bulsifal neied so loude, That hit schrillith into the cloude!    1582 Stanyhurst Æneis ii. 35 The inner lodgins dyd shrille with clamorus howting.    1591 Spenser Virg. Gnat 518 Their mightie strokes so shrild, As the great clap of thunder.    1647 H. More Song of Soul ii. App. iii, Its tearing noise so terribly did shrill, That it the heavens did shake.    1782 Mickle Proph. Q. Emma iv, When the female scream ascended, Shrilling o'er the crowded lawn.    1811 Scott Don Roderick ii. xix, First shrill'd an unrepeated female shriek!    1842 Tennyson Morte d'Arthur 201 A wind, that shrills All night in a waste land.    1884 L. Wallace Ben-Hur iv. iv. 166 His voice shrilled with passion.

      2.2 To speak, cry, or sing with a shrill voice; to make a shrill noise. a.2.a Of persons or animals.

         [c 1400 Anturs of Arth. xlviii, Þene his lemmane one loft skrilles and skrikes.]    c 1440 Floriz & Bl. (MS. T) 756 Þe mayde, al for drede, Bygan to shrelle [earlier MSS. crie, schrichen] and to grede.    1595 Spenser Epithal. 82 The Ouzell shrills, the Ruddock warbles soft.    1598 Florio, Querulare‥to shril, to‥chirp.    1639 H. Ainsworth Annot. Ps. v. 12 To showt, shrill, or cry aloud for sorrow.    1837 Carlyle Fr. Rev. III. ii. vi. (1872) 81 The Tribune drones,‥the whole Hall shrilling up round it into pretty frequent wrath and provocation.    1896 A. Austin England's Darling i. ii, The misselthrush That shrilled so gleefully.

      b.2.b Of an instrument of music, whistle, etc.

         1579 Spenser Sheph. Cal. Nov. 71 Breake we our pypes, that shrild as lowde as Larke.    1590 ― F.Q. ii. iii. 20 A horne, that shrilled cleare Throughout the wood.    1710 Philips Pastorals iv. 56 Thro' all the Wood his Pipe is heard to shrill.    1842 Tennyson Sir Galahad 5 The shattering trumpet shrilleth high.    1879 E. Gosse New Poems 100 The first sharp snow is shrilling through the trees.    1903 Kipling Five Nations 114 The whistle shrills to the picket.

      3.3 trans. To utter, give forth (a sound, cry, words) in shrill tones; to exclaim or proclaim with a shrill voice. Also with out.

         1595 Spenser Epithal. 129 Harke, how the Minstrels gin to shrill aloud Their merry Musick.    1606 Shakes. Tr. & Cr. v. iii. 84 Harke‥How poore Andromache shrils her dolour forth.    1613 Heywood Silver Age iii. i, Through all th' Abysse, I haue shril'd thy daughters losse.    1613 ― Brazen Age ii. ii, What better can describe his shape and terror Then all the pittious clamours shrild through Greece?

         1801 Lusignan I. 173 The terror of the feathered tribe, shrilled in the omens of an approaching tempest.    1817 Coleridge Biog. Lit. xxi. (1882) 205 Gnats, beetles, wasps,‥may shrill their tiny pipes‥unchastised and unnoticed.    1837 Carlyle Fr. Rev. I. v. ii, ‘Messieurs’, shrills de Brézé.    1904 M. Hewlett Queen's Quair i. vii, Lethington likened her to Diana on Taygetus shrilling havoc.    1947 A. Ransome Great Northern? i. 16 Roger's voice shrilled out, ‘Sail HO!’    1975 New Yorker 16 June 97/3 It was a lapse on Miss Sills' part to shrill out a high E flat at the end of the first finale, but otherwise she was tender, touching, and sensitive.

      4.4 To render shrill. rare—1.

         1772 Foote Nabob Prol. Wks. 1799 II. 285 If age contracts my muscles, shrills my tone.

      5.5 To summon with a shrill sound. rare—1.

         1859 Masson Brit. Novelists iii. 204 The pibroch shrills them to the work they do.

    1. Figure 24.4 Growth curves of L. plantarum grown at 18.2 (a) and 35oC (b). Figures 2 and 3. From Zweitering et al. 1990 Figures 2 and 3. Modeling of the bacterial growth curve. Applied and Environmental Microbiology 56(6):1875–1881. Reprinted with permission from American Society for Microbiolo

      even though the both the graphs looks the same, the x axis have a different scale in graph B proving that there is a optimal temp for this species.

    1. promotes

      Promotes language and communication

      • Learning Language and Loving It™ Certification Workshop for Speech-Language Pathologists and Early Childhood Education Consultants/Trainers. (2016). Retrieved October 24, 2017, from http://www.hanen.org/Professional-Development/Workshops-For-SLPs/Learning-Language-Loving-It.aspx The Hanen Centre offers a professional workshop for teachers and directors to work on their language teaching skills. The Learning language and loving it workshop teaches responsive interaction strategies to promote language development. This workshop is only offered twice in the U.S. and had limited spots open. This is a paid workshop that has requirements to meet before being able to take it. This is offered around the world in many countries as a learning tool for teachers.

      • Mendelsohn, A. L., Brockmeyer, C. A., Dreyer, B. P., Fierman, A. H., Berkule-Silberman, S. B., & Tomopoulos, S. (2010). Do verbal interactions with infants during electronic media exposure mitigate adverse impacts on their language development as toddlers? Infant and Child Development, 19(6), 577-593. doi:10.1002/icd.711 This article is about how language can be affected by media. Just how much the young child's language can be affected; as well as later affects this has on a child. They studied 253 families to see what affects media plays in their young child. They started at 6 months old and then checked back in around 14 months to see the impacts media had on the child. The findings were that media verbal interactions may have a positive impact on the language development of a young child.

    2. promotes

      Promotes language and communication

      • Learning Language and Loving It™ Certification Workshop for Speech-Language Pathologists and Early Childhood Education Consultants/Trainers. (2016). Retrieved October 24, 2017, from http://www.hanen.org/Professional-Development/Workshops-For-SLPs/Learning-Language-Loving-It.aspx The Hanen Centre offers a professional workshop for teachers and directors to work on their language teaching skills. The Learning language and loving it workshop teaches responsive interaction strategies to promote language development. This workshop is only offered twice in the U.S. and had limited spots open. This is a paid workshop that has requirements to meet before being able to take it. This is offered around the world in many countries as a learning tool for teachers.

      • Mendelsohn, A. L., Brockmeyer, C. A., Dreyer, B. P., Fierman, A. H., Berkule-Silberman, S. B., & Tomopoulos, S. (2010). Do verbal interactions with infants during electronic media exposure mitigate adverse impacts on their language development as toddlers? Infant and Child Development, 19(6), 577-593. doi:10.1002/icd.711 This article is about how language can be affected by media. Just how much the young child's language can be affected; as well as later affects this has on a child. They studied 253 families to see what affects media plays in their young child. They started at 6 months old and then checked back in around 14 months to see the impacts media had on the child. The findings were that media verbal interactions may have a positive impact on the language development of a young child.

  7. Oct 2017
    1. p.104 There are axial modes

      • (involve only two opposite and parallel surfaces)
             Tangential modes - involves four surfaces.
             Oblique modes - involve all surfaces in the room.
        

      Waves vs Rays Waves For low frequencies, in which the wavelength is comparable to the dimension of the room, the ray approach doesn't work. So these are studied as waves.

      Rays

      For higher frequencies, the model in which a sound bounces off with the angle equal to the angle of incidence works.

      Wave Acoustics: WE GO INTO MATH B*** > simplified down from 'wave equation'

      What are the permissable frequencies based on the modes of the space? See eq. p 106 - folder 'saved images' in 'pictures'. Can tell the frequency of any axial/tangential/oblique mode of rectangular room.

      Speed of sound 'c' 1130 ft / sec p q and r are variable LWH are set (dimensions)

      If only L participates then we have an axial mode, (or if only W or only H participates) Only one pair of surfaces is involved

      If only one zero = tangential mode If no zeros = oblique mode

    Annotators

    1. al=σ(wlal−1+bl)

      Makes perfect sense to work with the compact form of the matrix. However, in my preferred notation, this would look like:

      $$A^l = \sigma(W^la^{l-1} + b^l)$$

    1. The goal of this study was to determine whether verbal interactions between mothers and their 6-month-old infants during media exposure (‘media verbal interactions’) might have direct positive impacts, or mitigate any potential adverse impacts of media exposure, on language development at 14 months. For 253 low-income mother–infant dyads participating in a longitudinal study, media exposure and media verbal interactions were assessed using 24-hour recall diaries. Additionally, general level of cognitive stimulation in the home [StimQ] was assessed at 6 months and language development [Preschool Language Scale-4] was assessed at 14 months. Results suggest that media verbal interactions play a role in the language development of infants from low-income, immigrant families. Evidence showed that media verbal interactions moderated adverse impacts of media exposure found on 14-month language development, with adverse associations found only in the absence the these interactions. Findings also suggest that media verbal interactions may have some direct positive impacts on language development, in that media verbal interactions during the co-viewing of media with educational content (but not other content) were predictive of 14-month language independently of overall level of cognitive stimulation in the home.

      This article is about how language can be affected by media. Just how much the young child's language can be affected; as well as later affects this has on a child.

      They studied 253 families to see what affects media plays in their young child. They started at 6 months old and then checked back in around 14 months to see the impacts media had on the child. The findings were that media verbal interactions may have a positive impact on the language development of a young child. Mendelsohn, A. L., Brockmeyer, C. A., Dreyer, B. P., Fierman, A. H., Berkule-Silberman, S. B., & Tomopoulos, S. (2010). Do verbal interactions with infants during electronic media exposure mitigate adverse impacts on their language development as toddlers? Infant and Child Development, 19(6), 577-593. doi:10.1002/icd.711

    1. The intuition behind the backpropagation algorithm is as follows. Given a training example (x,y)(x,y)(x,y), we will first run a “forward pass” to compute all the activations throughout the network, including the output value of the hypothesis hW,b(x)hW,b(x)h_{W,b}(x). Then, for each node iii in layer lll, we would like to compute an “error term” δ(l)iδi(l)\delta^{(l)}_i that measures how much that node was “responsible” for any errors in our output. For an output node, we can directly measure the difference between the network’s activation and the true target value, and use that to define δ(nl)iδi(nl)\delta^{(n_l)}_i (where layer nlnln_l is the output layer). How about hidden units? For those, we will compute δ(l)iδi(l)\delta^{(l)}_i based on a weighted average of the error terms of the nodes that uses a(l)iai(l)a^{(l)}_i as an input. In detail, here is the backpropagation algorithm

      Backpropagation algorithm是为了计算所有参数$Wij$的相对于cost的偏导,output layer的偏导是好计算的,因为该layer的参数只参与了最后的hypothesis function计算(只在一条link里出现),但是internal参数的偏导则不好计算,因为由于forward propagation作用,从她定义的connection到最后的output中间有多条links。既然output layer的偏导容易计算,那么有没有一种方法,从后往前计算,用l layer的已知结果去计算l-1 layer呢?有点像背锅,预期的任务没完成,则根据下面每人负责的比例,将黑锅(error)一层层平摊下去,最终平摊到每人头上的锅换算成应加班的小时数就得到了我们的偏导。

    1. I can't do a thing about m~ hrr~:~ps:e ~thers feeling or what thinks or wants or wishes. I eehw_ hat the doctors call an "or-h r l Hyperempat y 1s w I believe t ey iee · ,, Bi shit. It hurts, thats all I know. ganic delusional syndrome. g_ll the Einstein powder, the par-Thanks to Paracetco, the small p1 b, b fore my birth killed her, th chose to a use e . ticular drug my mo er . f that doesn't belong to me, and that I'm crazy. I get a lot of gne isn't real. But it hurts.

      what even? highlighting can be very furstrating but tried to highlight and annotate when lauren talks about her hyperempathy. It sounds like it would take a toll on anyone. must suck.

    1.       UNITED STATES DISTRICT COURT
                                 DISTRICT OF MASSACHUSETTS
      

      UNITED STATES OF AMERICA ) ) v. ) Cr. No. 09-10304-MLW ) DIEGO MASMARQUES, ) Defendant. )

                                   MEMORANDUM AND ORDER
      

      WOLF, D.J. September 22, 2015

       Defendant         Diego    MasMarques         has    filed    a    Motion    to    Seal,
      

      asking the court to seal the record of this case on the PACER

      system and to remove the record from the Federal Bureau of

      Investigation's ("FBI") National Criminal Information Center

      ("NCIC") database (the "Motion"). The Motion is being denied

      for the reasons explained below.

      I. BACKGROUND

       On July 17, 2000, MasMarques, who is an American citizen,
      

      was convicted of two counts of burglary and one count of willful

      homicide in Spain. The Spanish court sentenced him to one year

      in prison on the first burglary count, two years in prison on

      the second burglary count, and twelve years in prison on the

      homicide count. In 2005, pursuant to a Transfer Treaty, he was

      transferred to the United States to serve the remainder of his

      sentence.

       Prior      to     his    transfer    to       the    United   States,       MasMarques
      

      signed a form consenting to serve the remainder of his sentence Case 1:09-cr-10304-MLW Document 7 Filed 09/22/15 Page 2 of 7

      according to the laws of the United States. By signing the

      form, he agreed that his "conviction or sentence can only be

      modified or set aside through appropriate proceedings brought by

      me or on my behalf in Spain." See Feb. 13, 2006 Verification of

      Consent to Transfer (Docket No. 1-4).

       MasMarques's         case    was    initially      assigned       to       the    Eastern
      

      District of Wisconsin for performance of the verification

      proceedings required by 18 U.S.C. §4108. On August 20, 2008,

      MasMarques was released to a three-year term of supervised

      release in the Southern District of New York. On June 2, 2009,

      with the permission of the Probation Office, MasMarques moved to

      Woburn, Massachusetts. As a result, his case was transferred to

      this court for supervision during the remainder of his period of

      supervised release. See 18 U.S.C. §4106A(b)(3).

       On January 18, 2013, MasMarques, acting pro se, filed a
      

      motion requesting that the court seal the record of his

      conviction in Spain. In addition, he requests that the court

      remove a negative "alert" that appears in the FBI's NCIC

      database. He claims that the availability of his criminal

      record has harmed his ability to find a job. He maintains that

      allowing this criminal record to be publicly accessible violates

      his rights under the Double Jeopardy Clause.

                                                2
      

      Case 1:09-cr-10304-MLW Document 7 Filed 09/22/15 Page 3 of 7

      II. DISCUSSION

        MasMarques's       Motion     to    Seal    presents      four    issues:    (1)
      

      whether public availability of his criminal record constitutes a

      second punishment in violation of the Double Jeopardy Clause of

      the Fifth Amendment; (2) whether the court should seal the

      record of his conviction; (3) whether the court has authority to

      order the removal of the negative "alert" based on his case that

      appears in the FBI's NCIC database; and (4) whether the court

      has authority to expunge MasMarques's criminal record.

        MasMarques is proceeding pro se.                   Therefore, his motion
      

      will be construed liberally. See Erickson v. Pardus, 551 U.S.

      89, 94 (2007). Nevertheless, there is no legal basis to grant

      the relief that he requests. Therefore, his Motion is being

      denied.

        A.    Double Jeopardy
      
        The     Double     Jeopardy        Clause   "safeguards      an     individual
      

      against (1) a second prosecution for the same offense, following

      an acquittal; (2) a second prosecution for the same offense,

      following a conviction; and (3) multiple punishments for the

      same offense." United States v. Stoller, 78 F.3d 710, 714 (1st

      Cir. 1996) (quoting United States v. Rivera-Martinez, 931 F.3d

      148, 152 (1st Cir.), cert. denied, 502 U.S. 862 (1991)). "The

      Clause protects only against the imposition of multiple criminal

      punishments for the same offense . . . and then only when such

                                              3
      

      Case 1:09-cr-10304-MLW Document 7 Filed 09/22/15 Page 4 of 7

      occurs in successive proceedings." Hudson v. United States, 522

      U.S. 93, 99 (1997) (emphasis in original). In determining

      whether a government action is "punishment" for purposes of the

      Double Jeopardy Clause, courts examine the totality of the

      circumstances to determine whether its objectives or effects are

      "punitive" in nature. See Stoller, 78 F.3d at 721.

         The    public     availability       of    the    records       of    MasMarques's
      

      conviction under the PACER, CORI, and NCIS system is not a

      "punishment" in violation of the Double Jeopardy Clause. Many

      courts have recognized that "[t]he dissemination of accurate

      public record information concerning an individual's past

      criminal activities holds "the potential for substantial

      negative consequences." E.B. v. Verniero, 119 F.3d 1077, 1099

      (3d Cir. 1997). "Nevertheless, our laws' insistence that

      information regarding criminal proceedings be publicly

      disseminated is not intended as punishment and has never been

      regarded as such." Id. at 1100. The purpose of these systems

      is "regulatory," and they, therefore, are "not punishment even

      though it may bear harshly on one affected." Doe v. Pataki, 120

      F.3d 1263, 1279 (2d Cir. 1997) (quoting Flemming v. Nestor, 363

      U.S. 603, 613 (1960). Furthermore, the negative effects of

      publicly disseminating criminal records do not "implicate any

      interest of fundamental constitutional magnitude." See

      Verniero, 119 F.3d at 1103. Therefore, the availability of the

                                              4
      

      Case 1:09-cr-10304-MLW Document 7 Filed 09/22/15 Page 5 of 7

      PACER records, the NCIC alerts, and the resulting negative

      effects do not constitute a second punishment in violation of

      the Double Jeopardy Clause.

        B.    Sealing MasMarques's Court Records
      
        In the United States, there is a common law presumption of
      

      public access to judicial records. See Nixon v. Warner

      Commc'ns, Inc., 435 U.S. 589, 597 (1978); United States v.

      Kravetz, 706 F.3d 47, 62 (1st Cir. 2013). This presumption

      "stems from the premise that public monitoring of the judicial

      system fosters the important values of 'quality, honesty and

      respect for our legal system.'" Siedle v. Putnam Investments,

      Inc., 147 F.3d 7, 9-10 (1st Cir. 1998). Furthermore, Congress

      has recognized a "compelling public need" to keep criminal

      records publicly available. United States v. Schnitzer, 567

      F.2d 536, 539 (2d Cir. 1977). When evaluating a motion to seal

      a court record, the court "carefully balances the competing

      interests that are at stake in the particular case." Siedle,

      147 F.3d at 10.

        MasMarques contends that it is unfair to allow the record
      

      of his case to be publicly accessible through the court's PACER

      system because public availability of the record has made it

      difficult for him to find a job. If courts were to allow the

      stigma resulting from the public record of a case to outweigh

      the public right of access, then virtually all criminal records

                                               5
      

      Case 1:09-cr-10304-MLW Document 7 Filed 09/22/15 Page 6 of 7

      would be sealed. The balance might lean more in MasMarques's

      favor if he had been acquitted or exonerated of the charges in

      Spain. See Diamond v. United States, 649 F.2d 496, 499 (7th

      Cir. 1981). However, the presumptive public right of access to

      court records is not outweighed solely because the record has an

      adverse effect on the defendant's livelihood, as such rule would

      vitiate the presumptive public right of access. Indeed, "courts

      must be reluctant to substitute their judgment for that of

      employers, legislators, and others in whom the discretion to

      give second chances is more properly vested." United States v.

      Barrow, 06-Cr-1086(JFK), 2014 WL 2011689, at *2. Consequently,

      the court is denying MasMarques's request to seal the record of

      this case.

         C.    Removing the "Alert" from the NCIC Database
      
         28 U.S.C. §534 directs the Attorney General to maintain a
      

      criminal records database. MasMarques complains that his

      criminal record is accessible in this database. However, courts

      are without authority to order removal of a criminal record from

      the NCIC database. See Carter v. United States, 431 Fed. Appx.

      104, 105-06 (3d Cir. 2011); United States v. Lucido, 612 F.3d

      871, 875 (6th Cir. 2010). Therefore, the court must deny

      MasMarques's request.

                                        6
      

      Case 1:09-cr-10304-MLW Document 7 Filed 09/22/15 Page 7 of 7

         D.   Expunging MasMarques's Criminal Record
      
         MasMarques also appears to request that the court expunge
      

      the American court records of his convictions in Spain.

      However, federal courts lack subject matter jurisdiction to

      expunge criminal records based solely on "equitable reasons,"

      meaning "grounds that rely only on notions of fairness and are

      entirely divorced from legal considerations." United States v.

      Coloian, 480 F.3d 47, 52 (1st Cir. 2009). MasMarques provides

      no legal basis to expunge his record. The court does not have

      jurisdiction to expunge his record on these grounds. See id.

      III. ORDER

         In   view   of   the    foregoing,    it     is   hereby   ORDERED    that
      

      Defendant's Motion to Seal (Docket No. 4) is DENIED.

                                                       /s/ Mark L. Wolf
                                               UNITED STATES DISTRICT JUDGE
      
    1. L. M. Day, B. C. Jayne, J. Exp. Biol. 210, 642 (2007).

      The authors studied the position of the limb in the squeletton during locomotion in various felidae. Despites the very distinct size and weight, the position seems very similar and conclude that bigger species of felidae do not have more upright limbs than smaller one. (106)

  8. Sep 2017
    1. CD4 1551-04 Class is archived. Restore it to add or edit anything.Class has been archived by your teacher. You can't add or edit anything.RestoreStream was updatedShowClass is archived. Restore it to add or edit anything.Class has been archived by your teacher. You can't add or edit anything.RestoreYou're invited to teach this classAcceptYou're invited to teach this classAccept CD41551-04 ClassroomStreamClassmatesAboutMy AccountSearchMailCalendarDriveDocsSheetsSlidesSitesGroupsContactsClassroomMeetMoreMapsNewsPhotosVaultFormsKeepCloud SearchMore from Apps Marketplace0This account is managed by medford.k12.ma.us.Learn moreChangeEvan Liaoeliao20@medford.k12.ma.usPrivacyMy AccountEvan Liaoeliao20@medford.k12.ma.us (default)All your Brand Accounts »Add accountSign out/* _GlobalPrefix_ */ this.gbar_=this.gbar_||{};(function(_){var window=this; /* _Module_:syh */ try{ _.Oc=function(a,c,d){if(!a.f)if(d instanceof Array)for(var e in d)_.Oc(a,c,d[e]);else{e=(0,_.p)(a.B,a,c);var f=a.w+d;a.w++;c.setAttribute("data-eqid",f);a.o[f]=e;c&&c.addEventListener?c.addEventListener(d,e,!1):c&&c.attachEvent?c.attachEvent("on"+d,e):a.A.log(Error("d`"+c))}}; }catch(e){_._DumpException(e)} /* _Module_:qaaw */ try{ var Pc=window.document.querySelector(".gb_da .gb_b");Pc&&_.Oc(_.wc,Pc,"click"); }catch(e){_._DumpException(e)} /* _Module_:syk */ try{ _.Qc=function(a,c){var d=Array.prototype.slice.call(arguments,1);return function(){var c=d.slice();c.push.apply(c,arguments);return a.apply(this,c)}};_.Rc=function(a,c){return 0==a.lastIndexOf(c,0)}; }catch(e){_._DumpException(e)} /* _Module_:syj */ try{ _.Sc=function(a){var c=_.ka(a);return"array"==c||"object"==c&&"number"==typeof a.length};_.Tc=function(a){var c=a.length;if(0<c){for(var d=Array(c),e=0;e<c;e++)d[e]=a[e];return d}return[]};_.Uc=function(a){return _.ac(_.Xb.ra(),a)};_.Vc=!_.x||_.pb(9);_.Wc=!_.Ya&&!_.x||_.x&&_.pb(9)||_.Ya&&_.nb("1.9.1");_.Xc=_.x&&!_.nb("9");_.Yc=_.x||_.Va||_.Za; _.$c=function(){this.b="";this.f=_.Zc};_.$c.prototype.Ob=!0;_.$c.prototype.Ab=function(){return this.b};_.$c.prototype.toString=function(){return"Const{"+this.b+"}"};_.Zc={};_.ad=function(a){var c=new _.$c;c.b=a;return c};_.ad("");var bd;_.cd=function(){this.b="";this.f=bd};_.cd.prototype.Ob=!0;_.cd.prototype.Ab=function(){return this.b};_.cd.prototype.le=!0;_.cd.prototype.Bc=function(){return 1};_.dd=function(a){if(a instanceof _.cd&&a.constructor===_.cd&&a.f===bd)return a.b;_.ka(a);return"type_error:TrustedResourceUrl"};bd={};_.ed=function(a){var c=new _.cd;c.b=a;return c}; _.gd=function(){this.b="";this.f=_.fd};_.gd.prototype.Ob=!0;_.gd.prototype.Ab=function(){return this.b};_.gd.prototype.le=!0;_.gd.prototype.Bc=function(){return 1};_.hd=/^(?:(?:https?|mailto|ftp):|[^:/?#]*(?:[/?#]|$))/i;_.fd={};_.id=function(a){var c=new _.gd;c.b=a;return c};_.id("about:blank"); _.kd=function(){this.b="";this.f=_.jd};_.kd.prototype.Ob=!0;_.jd={};_.kd.prototype.Ab=function(){return this.b};_.ld=function(a){var c=new _.kd;c.b=a;return c};_.md=_.ld("");_.od=function(){this.b="";this.j=_.nd;this.f=null};_.od.prototype.le=!0;_.od.prototype.Bc=function(){return this.f};_.od.prototype.Ob=!0;_.od.prototype.Ab=function(){return this.b};_.nd={};_.pd=function(a,c){var d=new _.od;d.b=a;d.f=c;return d};_.pd("<!DOCTYPE html>",0);_.qd=_.pd("",0);_.rd=_.pd("<br>",0); _.sd=function(a,c){return _.n(c)?a.getElementById(c):c};_.td=function(a,c){return(c||window.document).getElementsByTagName(String(a))};_.I=function(a,c){var d=c||window.document;if(d.getElementsByClassName)a=d.getElementsByClassName(a)[0];else{d=window.document;var e=c||d;a=e.querySelectorAll&&e.querySelector&&a?e.querySelector(""+(a?"."+a:"")):_.ud(d,a,c)[0]||null}return a||null}; _.ud=function(a,c,d){var e;a=d||a;if(a.querySelectorAll&&a.querySelector&&c)return a.querySelectorAll(""+(c?"."+c:""));if(c&&a.getElementsByClassName){var f=a.getElementsByClassName(c);return f}f=a.getElementsByTagName("*");if(c){var g={};for(d=e=0;a=f[d];d++){var h=a.className;"function"==typeof h.split&&_.Ga(h.split(/\s+/),c)&&(g[e++]=a)}g.length=e;return g}return f};_.vd=function(a,c){return a.createElement(String(c))}; }catch(e){_._DumpException(e)} /* _Module_:syi */ try{ var wd,yd;wd=function(a){var c=arguments.length;if(1==c&&_.la(arguments[0]))return wd.apply(null,arguments[0]);for(var d={},e=0;e<c;e++)d[arguments[e]]=!0;return d};_.xd=function(a){return _.na(a)&&1==a.nodeType};wd("A AREA BUTTON HEAD INPUT LINK MENU META OPTGROUP OPTION PROGRESS STYLE SELECT SOURCE TEXTAREA TITLE TRACK".split(" "));_.zd=function(a,c){c?a.setAttribute("role",c):a.removeAttribute("role")}; _.J=function(a,c,d){_.la(d)&&(d=d.join(" "));var e="aria-"+c;""===d||void 0==d?(yd||(yd={atomic:!1,autocomplete:"none",dropeffect:"none",haspopup:!1,live:"off",multiline:!1,multiselectable:!1,orientation:"vertical",readonly:!1,relevant:"additions text",required:!1,sort:"none",busy:!1,disabled:!1,hidden:!1,invalid:"false"}),d=yd,c in d?a.setAttribute(e,d[c]):a.removeAttribute(e)):a.setAttribute(e,d)}; }catch(e){_._DumpException(e)} /* _Module_:syl */ try{ var Bd;_.Ad=function(a,c){c=(0,_.Ba)(a,c);var d;(d=0<=c)&&Array.prototype.splice.call(a,c,1);return d};Bd=function(a,c){for(var d in a)if(c.call(void 0,a[d],d,a))return!0;return!1};_.Cd=function(a,c){try{return _.Sa(a[c]),!0}catch(d){}return!1};_.Dd=function(a,c){this.type=a;this.b=this.target=c;this.j=!1;this.Kf=!0};_.Dd.prototype.stopPropagation=function(){this.j=!0};_.Dd.prototype.preventDefault=function(){this.Kf=!1};_.Ed=function(a,c){_.Dd.call(this,a?a.type:"");this.relatedTarget=this.b=this.target=null;this.button=this.screenY=this.screenX=this.clientY=this.clientX=0;this.key="";this.f=this.keyCode=0;this.metaKey=this.shiftKey=this.altKey=this.ctrlKey=!1;this.state=null;this.pointerId=0;this.pointerType="";this.lb=null;a&&this.init(a,c)};_.u(_.Ed,_.Dd);var Fd={2:"touch",3:"pen",4:"mouse"}; _.Ed.prototype.init=function(a,c){var d=this.type=a.type,e=a.changedTouches?a.changedTouches[0]:null;this.target=a.target||a.srcElement;this.b=c;(c=a.relatedTarget)?_.Ya&&(_.Cd(c,"nodeName")||(c=null)):"mouseover"==d?c=a.fromElement:"mouseout"==d&&(c=a.toElement);this.relatedTarget=c;null===e?(this.clientX=void 0!==a.clientX?a.clientX:a.pageX,this.clientY=void 0!==a.clientY?a.clientY:a.pageY,this.screenX=a.screenX||0,this.screenY=a.screenY||0):(this.clientX=void 0!==e.clientX?e.clientX:e.pageX,this.clientY= void 0!==e.clientY?e.clientY:e.pageY,this.screenX=e.screenX||0,this.screenY=e.screenY||0);this.button=a.button;this.keyCode=a.keyCode||0;this.key=a.key||"";this.f=a.charCode||("keypress"==d?a.keyCode:0);this.ctrlKey=a.ctrlKey;this.altKey=a.altKey;this.shiftKey=a.shiftKey;this.metaKey=a.metaKey;this.pointerId=a.pointerId||0;this.pointerType=_.n(a.pointerType)?a.pointerType:Fd[a.pointerType]||"";this.state=a.state;this.lb=a;a.defaultPrevented&&this.preventDefault()}; _.Ed.prototype.stopPropagation=function(){_.Ed.H.stopPropagation.call(this);this.lb.stopPropagation?this.lb.stopPropagation():this.lb.cancelBubble=!0};_.Ed.prototype.preventDefault=function(){_.Ed.H.preventDefault.call(this);var a=this.lb;if(a.preventDefault)a.preventDefault();else if(a.returnValue=!1,_.Cc)try{if(a.ctrlKey||112<=a.keyCode&&123>=a.keyCode)a.keyCode=-1}catch(c){}}; var Id;_.Gd="closure_listenable_"+(1E6*Math.random()|0);_.Hd=function(a){return!(!a||!a[_.Gd])};Id=0;var Jd;Jd=function(a,c,d,e,f){this.listener=a;this.b=null;this.src=c;this.type=d;this.capture=!!e;this.xd=f;this.key=++Id;this.Ic=this.kd=!1};_.Kd=function(a){a.Ic=!0;a.listener=null;a.b=null;a.src=null;a.xd=null};_.Ld=function(a){this.src=a;this.b={};this.f=0};_.Nd=function(a,c,d,e,f,g){var h=c.toString();c=a.b[h];c||(c=a.b[h]=[],a.f++);var l=Md(c,d,f,g);-1<l?(a=c[l],e||(a.kd=!1)):(a=new Jd(d,a.src,h,!!f,g),a.kd=e,c.push(a));return a};_.Ld.prototype.remove=function(a,c,d,e){a=a.toString();if(!(a in this.b))return!1;var f=this.b[a];c=Md(f,c,d,e);return-1<c?(_.Kd(f[c]),Array.prototype.splice.call(f,c,1),0==f.length&&(delete this.b[a],this.f--),!0):!1}; _.Od=function(a,c){var d=c.type;if(!(d in a.b))return!1;var e=_.Ad(a.b[d],c);e&&(_.Kd(c),0==a.b[d].length&&(delete a.b[d],a.f--));return e};_.Ld.prototype.Cc=function(a,c){a=this.b[a.toString()];var d=[];if(a)for(var e=0;e<a.length;++e){var f=a[e];f.capture==c&&d.push(f)}return d};_.Ld.prototype.bc=function(a,c,d,e){a=this.b[a.toString()];var f=-1;a&&(f=Md(a,c,d,e));return-1<f?a[f]:null}; _.Ld.prototype.hasListener=function(a,c){var d=_.ea(a),e=d?a.toString():"",f=_.ea(c);return Bd(this.b,function(a){for(var g=0;g<a.length;++g)if(!(d&&a[g].type!=e||f&&a[g].capture!=c))return!0;return!1})};var Md=function(a,c,d,e){for(var f=0;f<a.length;++f){var g=a[f];if(!g.Ic&&g.listener==c&&g.capture==!!d&&g.xd==e)return f}return-1}; var Pd,Qd,Rd,Ud,Wd,Xd,ae,Yd,ce;Pd="closure_lm_"+(1E6*Math.random()|0);Qd={};Rd=0;_.K=function(a,c,d,e,f){if(e&&e.once)return _.Sd(a,c,d,e,f);if(_.la(c)){for(var g=0;g<c.length;g++)_.K(a,c[g],d,e,f);return null}d=_.Td(d);return _.Hd(a)?a.K(c,d,_.na(e)?!!e.capture:!!e,f):Ud(a,c,d,!1,e,f)}; Ud=function(a,c,d,e,f,g){if(!c)throw Error("n");var h=_.na(f)?!!f.capture:!!f,l=_.Vd(a);l||(a[Pd]=l=new _.Ld(a));d=_.Nd(l,c,d,e,h,g);if(d.b)return d;e=Wd();d.b=e;e.src=a;e.listener=d;if(a.addEventListener)_.Dc||(f=h),void 0===f&&(f=!1),a.addEventListener(c.toString(),e,f);else if(a.attachEvent)a.attachEvent(Xd(c.toString()),e);else throw Error("o");Rd++;return d};Wd=function(){var a=Yd,c=_.Bc?function(d){return a.call(c.src,c.listener,d)}:function(d){d=a.call(c.src,c.listener,d);if(!d)return d};return c}; _.Sd=function(a,c,d,e,f){if(_.la(c)){for(var g=0;g<c.length;g++)_.Sd(a,c[g],d,e,f);return null}d=_.Td(d);return _.Hd(a)?a.tb(c,d,_.na(e)?!!e.capture:!!e,f):Ud(a,c,d,!0,e,f)};_.Zd=function(a,c,d,e,f){if(_.la(c))for(var g=0;g<c.length;g++)_.Zd(a,c[g],d,e,f);else e=_.na(e)?!!e.capture:!!e,d=_.Td(d),_.Hd(a)?a.Ga(c,d,e,f):a&&(a=_.Vd(a))&&(c=a.bc(c,d,e,f))&&_.$d(c)}; _.$d=function(a){if(_.fa(a)||!a||a.Ic)return!1;var c=a.src;if(_.Hd(c))return c.Kd(a);var d=a.type,e=a.b;c.removeEventListener?c.removeEventListener(d,e,a.capture):c.detachEvent&&c.detachEvent(Xd(d),e);Rd--;(d=_.Vd(c))?(_.Od(d,a),0==d.f&&(d.src=null,c[Pd]=null)):_.Kd(a);return!0};Xd=function(a){return a in Qd?Qd[a]:Qd[a]="on"+a};_.be=function(a,c,d,e){var f=!0;if(a=_.Vd(a))if(c=a.b[c.toString()])for(c=c.concat(),a=0;a<c.length;a++){var g=c[a];g&&g.capture==d&&!g.Ic&&(g=ae(g,e),f=f&&!1!==g)}return f}; ae=function(a,c){var d=a.listener,e=a.xd||a.src;a.kd&&_.$d(a);return d.call(e,c)}; Yd=function(a,c){if(a.Ic)return!0;if(!_.Bc){var d=c||_.ha("window.event");c=new _.Ed(d,this);var e=!0;if(!(0>d.keyCode||void 0!=d.returnValue)){a:{var f=!1;if(0==d.keyCode)try{d.keyCode=-1;break a}catch(h){f=!0}if(f||void 0==d.returnValue)d.returnValue=!0}d=[];for(f=c.b;f;f=f.parentNode)d.push(f);a=a.type;for(f=d.length-1;!c.j&&0<=f;f--){c.b=d[f];var g=_.be(d[f],a,!0,c);e=e&&g}for(f=0;!c.j&&f<d.length;f++)c.b=d[f],g=_.be(d[f],a,!1,c),e=e&&g}return e}return ae(a,new _.Ed(c,this))}; _.Vd=function(a){a=a[Pd];return a instanceof _.Ld?a:null};ce="__closure_events_fn_"+(1E9*Math.random()>>>0);_.Td=function(a){if(_.ma(a))return a;a[ce]||(a[ce]=function(c){return a.handleEvent(c)});return a[ce]}; }catch(e){_._DumpException(e)} /* _Module_:syo */ try{ _.de=function(a,c,d){return 2>=arguments.length?Array.prototype.slice.call(a,c):Array.prototype.slice.call(a,c,d)};_.L=function(){_.D.call(this);this.Eb=new _.Ld(this);this.Zf=this;this.Ae=null};_.u(_.L,_.D);_.L.prototype[_.Gd]=!0;_.k=_.L.prototype;_.k.Nc=function(){return this.Ae};_.k.vc=function(a){this.Ae=a};_.k.addEventListener=function(a,c,d,e){_.K(this,a,c,d,e)};_.k.removeEventListener=function(a,c,d,e){_.Zd(this,a,c,d,e)}; _.k.dispatchEvent=function(a){var c,d=this.Nc();if(d)for(c=[];d;d=d.Nc())c.push(d);d=this.Zf;var e=a.type||a;if(_.n(a))a=new _.Dd(a,d);else if(a instanceof _.Dd)a.target=a.target||d;else{var f=a;a=new _.Dd(e,d);_.Ma(a,f)}f=!0;if(c)for(var g=c.length-1;!a.j&&0<=g;g--){var h=a.b=c[g];f=h.$b(e,!0,a)&&f}a.j||(h=a.b=d,f=h.$b(e,!0,a)&&f,a.j||(f=h.$b(e,!1,a)&&f));if(c)for(g=0;!a.j&&g<c.length;g++)h=a.b=c[g],f=h.$b(e,!1,a)&&f;return f};_.k.N=function(){_.L.H.N.call(this);this.Ed();this.Ae=null}; _.k.K=function(a,c,d,e){return _.Nd(this.Eb,String(a),c,!1,d,e)};_.k.tb=function(a,c,d,e){return _.Nd(this.Eb,String(a),c,!0,d,e)};_.k.Ga=function(a,c,d,e){return this.Eb.remove(String(a),c,d,e)};_.k.Kd=function(a){return _.Od(this.Eb,a)};_.k.Ed=function(a){if(this.Eb){var c=this.Eb;a=a&&a.toString();var d=0,e;for(e in c.b)if(!a||e==a){for(var f=c.b[e],g=0;g<f.length;g++)++d,_.Kd(f[g]);delete c.b[e];c.f--}c=d}else c=0;return c}; _.k.$b=function(a,c,d){a=this.Eb.b[String(a)];if(!a)return!0;a=a.concat();for(var e=!0,f=0;f<a.length;++f){var g=a[f];if(g&&!g.Ic&&g.capture==c){var h=g.listener,l=g.xd||g.src;g.kd&&this.Kd(g);e=!1!==h.call(l,d)&&e}}return e&&0!=d.Kf};_.k.Cc=function(a,c){return this.Eb.Cc(String(a),c)};_.k.bc=function(a,c,d,e){return this.Eb.bc(String(a),c,d,e)};_.k.hasListener=function(a,c){return this.Eb.hasListener(_.ea(a)?String(a):void 0,c)}; }catch(e){_._DumpException(e)} /* _Module_:syp */ try{ var he;_.ee=function(a,c){if(void 0!==a.b||void 0!==a.f)throw Error("f");a.b=c;_.kc(a)};_.fe=function(a){return/^[\s\xa0]*$/.test(a)};_.ge=function(a){var c=[],d=0,e;for(e in a)c[d++]=a[e];return c};he=function(a,c,d){this.o=d;this.j=a;this.A=c;this.f=0;this.b=null};he.prototype.get=function(){if(0<this.f){this.f--;var a=this.b;this.b=a.next;a.next=null}else a=this.j();return a};var ie=function(a,c){a.A(c);a.f<a.o&&(a.f++,c.next=a.b,a.b=c)}; var je;je=function(a){return function(){return a}};_.ke=je(!0);_.le=je(null);_.me=function(a){return a};var ne=function(a){_.m.setTimeout(function(){throw a;},0)},oe,pe=function(){var a=_.m.MessageChannel;"undefined"===typeof a&&"undefined"!==typeof window&&window.postMessage&&window.addEventListener&&!_.v("Presto")&&(a=function(){var a=window.document.createElement("IFRAME");a.style.display="none";a.src="";window.document.documentElement.appendChild(a);var c=a.contentWindow;a=c.document;a.open();a.write("");a.close();var d="callImmediate"+Math.random(),e="file:"==c.location.protocol?"*":c.location.protocol+ "//"+c.location.host;a=(0,_.p)(function(a){if(("*"==e||a.origin==e)&&a.data==d)this.port1.onmessage()},this);c.addEventListener("message",a,!1);this.port1={};this.port2={postMessage:function(){c.postMessage(d,e)}}});if("undefined"!==typeof a&&!_.v("Trident")&&!_.v("MSIE")){var c=new a,d={},e=d;c.port1.onmessage=function(){if(_.ea(d.next)){d=d.next;var a=d.Me;d.Me=null;a()}};return function(a){e.next={Me:a};e=e.next;c.port2.postMessage(0)}}return"undefined"!==typeof window.document&&"onreadystatechange"in window.document.createElement("SCRIPT")?function(a){var c=window.document.createElement("SCRIPT");c.onreadystatechange=function(){c.onreadystatechange=null;c.parentNode.removeChild(c);c=null;a();a=null};window.document.documentElement.appendChild(c)}:function(a){_.m.setTimeout(a,0)}}; var qe=function(){this.f=this.b=null},se=new he(function(){return new re},function(a){a.reset()},100);qe.prototype.remove=function(){var a=null;this.b&&(a=this.b,this.b=this.b.next,this.b||(this.f=null),a.next=null);return a};var re=function(){this.next=this.scope=this.b=null};re.prototype.set=function(a,c){this.b=a;this.scope=c;this.next=null};re.prototype.reset=function(){this.next=this.scope=this.b=null}; var xe=function(a,c){te||ue();ve||(te(),ve=!0);var d=we,e=se.get();e.set(a,c);d.f?d.f.next=e:d.b=e;d.f=e},te,ue=function(){if(-1!=String(_.m.Promise).indexOf("[native code]")){var a=_.m.Promise.resolve(void 0);te=function(){a.then(ye)}}else te=function(){var a=ye;!_.ma(_.m.setImmediate)||_.m.Window&&_.m.Window.prototype&&!_.v("Edge")&&_.m.Window.prototype.setImmediate==_.m.setImmediate?(oe||(oe=pe()),oe(a)):_.m.setImmediate(a)}},ve=!1,we=new qe,ye=function(){for(var a;a=we.remove();){try{a.b.call(a.scope)}catch(c){ne(c)}ie(se, a)}ve=!1}; _.ze=function(a){a.prototype.then=a.prototype.then;a.prototype.$goog_Thenable=!0};_.Ae=function(a){if(!a)return!1;try{return!!a.$goog_Thenable}catch(c){return!1}};var De,Ie,Me,Ke,Pe,Oe,Qe;_.Ce=function(a,c){this.b=0;this.B=void 0;this.o=this.f=this.j=null;this.A=this.w=!1;if(a!=_.ia)try{var d=this;a.call(c,function(a){Be(d,2,a)},function(a){Be(d,3,a)})}catch(e){Be(this,3,e)}};De=function(){this.next=this.context=this.f=this.j=this.b=null;this.o=!1};De.prototype.reset=function(){this.context=this.f=this.j=this.b=null;this.o=!1};var Ee=new he(function(){return new De},function(a){a.reset()},100),Fe=function(a,c,d){var e=Ee.get();e.j=a;e.f=c;e.context=d;return e}; _.Ce.prototype.then=function(a,c,d){return _.Ge(this,_.ma(a)?a:null,_.ma(c)?c:null,d)};_.ze(_.Ce);_.Ce.prototype.cancel=function(a){0==this.b&&xe(function(){var c=new _.He(a);Ie(this,c)},this)};Ie=function(a,c){if(0==a.b)if(a.j){var d=a.j;if(d.f){for(var e=0,f=null,g=null,h=d.f;h&&(h.o||(e++,h.b==a&&(f=h),!(f&&1<e)));h=h.next)f||(g=h);f&&(0==d.b&&1==e?Ie(d,c):(g?(e=g,e.next==d.o&&(d.o=e),e.next=e.next.next):Je(d),Ke(d,f,3,c)))}a.j=null}else Be(a,3,c)}; Me=function(a,c){a.f||2!=a.b&&3!=a.b||Le(a);a.o?a.o.next=c:a.f=c;a.o=c};_.Ge=function(a,c,d,e){var f=Fe(null,null,null);f.b=new _.Ce(function(a,h){f.j=c?function(d){try{var f=c.call(e,d);a(f)}catch(r){h(r)}}:a;f.f=d?function(c){try{var f=d.call(e,c);!_.ea(f)&&c instanceof _.He?h(c):a(f)}catch(r){h(r)}}:h});f.b.j=a;Me(a,f);return f.b};_.Ce.prototype.D=function(a){this.b=0;Be(this,2,a)};_.Ce.prototype.G=function(a){this.b=0;Be(this,3,a)}; var Be=function(a,c,d){if(0==a.b){a===d&&(c=3,d=new TypeError("Promise cannot resolve to itself"));a.b=1;a:{var e=d,f=a.D,g=a.G;if(e instanceof _.Ce){Me(e,Fe(f||_.ia,g||null,a));var h=!0}else if(_.Ae(e))e.then(f,g,a),h=!0;else{if(_.na(e))try{var l=e.then;if(_.ma(l)){Ne(e,l,f,g,a);h=!0;break a}}catch(q){g.call(a,q);h=!0;break a}h=!1}}h||(a.B=d,a.b=c,a.j=null,Le(a),3!=c||d instanceof _.He||Oe(a,d))}},Ne=function(a,c,d,e,f){var g=!1,h=function(a){g||(g=!0,d.call(f,a))},l=function(a){g||(g=!0,e.call(f, a))};try{c.call(a,h,l)}catch(q){l(q)}},Le=function(a){a.w||(a.w=!0,xe(a.C,a))},Je=function(a){var c=null;a.f&&(c=a.f,a.f=c.next,c.next=null);a.f||(a.o=null);return c};_.Ce.prototype.C=function(){for(var a;a=Je(this);)Ke(this,a,this.b,this.B);this.w=!1};Ke=function(a,c,d,e){if(3==d&&c.f&&!c.o)for(;a&&a.A;a=a.j)a.A=!1;if(c.b)c.b.j=null,Pe(c,d,e);else try{c.o?c.j.call(c.context):Pe(c,d,e)}catch(f){Qe.call(null,f)}ie(Ee,c)};Pe=function(a,c,d){2==c?a.j.call(a.context,d):a.f&&a.f.call(a.context,d)}; Oe=function(a,c){a.A=!0;xe(function(){a.A&&Qe.call(null,c)})};Qe=ne;_.He=function(a){_.va.call(this,a)};_.u(_.He,_.va);_.He.prototype.name="cancel"; }catch(e){_._DumpException(e)} /* _Module_:syq */ try{ var Te;_.Re=function(a){a&&"function"==typeof a.ka&&a.ka()};_.Se=function(a,c){c=_.Qc(_.Re,c);a.La?_.ea(void 0)?c.call(void 0):c():(a.Lb||(a.Lb=[]),a.Lb.push(_.ea(void 0)?(0,_.p)(c,void 0):c))};Te=0;_.Ue=function(a){return a[_.oa]||(a[_.oa]=++Te)};_.Ve=function(a,c){_.L.call(this);this.f=a||1;this.b=c||_.m;this.j=(0,_.p)(this.Ti,this);this.o=(0,_.ta)()};_.u(_.Ve,_.L);_.k=_.Ve.prototype;_.k.enabled=!1;_.k.nb=null; _.k.Ti=function(){if(this.enabled){var a=(0,_.ta)()-this.o;0<a&&a<.8*this.f?this.nb=this.b.setTimeout(this.j,this.f-a):(this.nb&&(this.b.clearTimeout(this.nb),this.nb=null),this.dispatchEvent("tick"),this.enabled&&(this.nb=this.b.setTimeout(this.j,this.f),this.o=(0,_.ta)()))}};_.k.start=function(){this.enabled=!0;this.nb||(this.nb=this.b.setTimeout(this.j,this.f),this.o=(0,_.ta)())};_.k.stop=function(){this.enabled=!1;this.nb&&(this.b.clearTimeout(this.nb),this.nb=null)}; _.k.N=function(){_.Ve.H.N.call(this);this.stop();delete this.b};_.We=function(a,c,d){if(_.ma(a))d&&(a=(0,_.p)(a,d));else if(a&&"function"==typeof a.handleEvent)a=(0,_.p)(a.handleEvent,a);else throw Error("p");return 2147483647<Number(c)?-1:_.m.setTimeout(a,c||0)}; }catch(e){_._DumpException(e)} /* _Module_:syu */ try{ var Xe;Xe=function(a){if(a.classList)return a.classList;a=a.className;return _.n(a)&&a.match(/\S+/g)||[]};_.M=function(a,c){return a.classList?a.classList.contains(c):_.Ga(Xe(a),c)};_.O=function(a,c){a.classList?a.classList.add(c):_.M(a,c)||(a.className+=0<a.className.length?" "+c:c)}; _.Ye=function(a,c){if(a.classList)(0,_.Ca)(c,function(c){_.O(a,c)});else{var d={};(0,_.Ca)(Xe(a),function(a){d[a]=!0});(0,_.Ca)(c,function(a){d[a]=!0});a.className="";for(var e in d)a.className+=0<a.className.length?" "+e:e}};_.P=function(a,c){a.classList?a.classList.remove(c):_.M(a,c)&&(a.className=(0,_.Da)(Xe(a),function(a){return a!=c}).join(" "))};_.Ze=function(a,c){a.classList?(0,_.Ca)(c,function(c){_.P(a,c)}):a.className=(0,_.Da)(Xe(a),function(a){return!_.Ga(c,a)}).join(" ")}; _.$e=function(a){_.D.call(this);this.W=a;this.O={}};_.u(_.$e,_.D);var af=[];_.$e.prototype.K=function(a,c,d,e){return bf(this,a,c,d,e)};_.$e.prototype.j=function(a,c,d,e,f){return bf(this,a,c,d,e,f)};var bf=function(a,c,d,e,f,g){_.la(d)||(d&&(af[0]=d.toString()),d=af);for(var h=0;h<d.length;h++){var l=_.K(c,d[h],e||a.handleEvent,f||!1,g||a.W||a);if(!l)break;a.O[l.key]=l}return a};_.$e.prototype.tb=function(a,c,d,e){return cf(this,a,c,d,e)}; var cf=function(a,c,d,e,f,g){if(_.la(d))for(var h=0;h<d.length;h++)cf(a,c,d[h],e,f,g);else{c=_.Sd(c,d,e||a.handleEvent,f,g||a.W||a);if(!c)return a;a.O[c.key]=c}return a};_.$e.prototype.Ga=function(a,c,d,e,f){if(_.la(c))for(var g=0;g<c.length;g++)this.Ga(a,c[g],d,e,f);else d=d||this.handleEvent,e=_.na(e)?!!e.capture:!!e,f=f||this.W||this,d=_.Td(d),e=!!e,c=_.Hd(a)?a.bc(c,d,e,f):a?(a=_.Vd(a))?a.bc(c,d,e,f):null:null,c&&(_.$d(c),delete this.O[c.key]);return this}; _.df=function(a){_.Ka(a.O,function(a,d){this.O.hasOwnProperty(d)&&_.$d(a)},a);a.O={}};_.$e.prototype.N=function(){_.$e.H.N.call(this);_.df(this)};_.$e.prototype.handleEvent=function(){throw Error("q");}; var hf;_.gf=function(a,c,d,e,f,g){if(!(_.x||_.Wa||_.Za&&_.nb("525")))return!0;if(_.$a&&f)return _.ef(a);if(f&&!e)return!1;_.fa(c)&&(c=_.ff(c));f=17==c||18==c||_.$a&&91==c;if((!d||_.$a)&&f||_.$a&&16==c&&(e||g))return!1;if((_.Za||_.Wa)&&e&&d)switch(a){case 220:case 219:case 221:case 192:case 186:case 189:case 187:case 188:case 190:case 191:case 192:case 222:return!1}if(_.x&&e&&c==a)return!1;switch(a){case 13:return!0;case 27:return!(_.Za||_.Wa)}return _.ef(a)}; _.ef=function(a){if(48<=a&&57>=a||96<=a&&106>=a||65<=a&&90>=a||(_.Za||_.Wa)&&0==a)return!0;switch(a){case 32:case 43:case 63:case 64:case 107:case 109:case 110:case 111:case 186:case 59:case 189:case 187:case 61:case 188:case 190:case 191:case 192:case 222:case 219:case 220:case 221:return!0;default:return!1}};_.ff=function(a){if(_.Ya)a=hf(a);else if(_.$a&&_.Za)switch(a){case 93:a=91}return a}; hf=function(a){switch(a){case 61:return 187;case 59:return 186;case 173:return 189;case 224:return 91;case 0:return 224;default:return a}}; }catch(e){_._DumpException(e)} /* _Module_:syw */ try{ var jf,kf,lf,mf,nf,of,pf,qf,uf,zf,Df,Ff;kf=/&/g;lf=/</g;mf=/>/g;nf=/"/g;of=/'/g;pf=/\x00/g;qf=/[\x00&<>"']/;_.rf=function(a){if(!qf.test(a))return a;-1!=a.indexOf("&")&&(a=a.replace(kf,"&amp;"));-1!=a.indexOf("<")&&(a=a.replace(lf,"&lt;"));-1!=a.indexOf(">")&&(a=a.replace(mf,"&gt;"));-1!=a.indexOf('"')&&(a=a.replace(nf,"&quot;"));-1!=a.indexOf("'")&&(a=a.replace(of,"&#39;"));-1!=a.indexOf("\x00")&&(a=a.replace(pf,"&#0;"));return a}; _.sf=function(a){return String(a).replace(/([-()\[\]{}+?*.$\^|,:#<!\\])/g,"\\$1").replace(/\x08/g,"\\x08")};_.tf=function(a){return String(a).replace(/\-([a-z])/g,function(a,d){return d.toUpperCase()})};uf=function(a){var c=_.n(void 0)?_.sf(void 0):"\\s";return a.replace(new RegExp("(^"+(c?"|["+c+"]+":"")+")([a-z])","g"),function(a,c,f){return c+f.toUpperCase()})};_.vf=function(a,c){this.width=a;this.height=c};_.wf=function(a){return new _.vf(a.width,a.height)};_.k=_.vf.prototype; _.k.ag=function(){return this.width*this.height};_.k.aspectRatio=function(){return this.width/this.height};_.k.nc=function(){return!this.ag()};_.k.ceil=function(){this.width=Math.ceil(this.width);this.height=Math.ceil(this.height);return this};_.k.floor=function(){this.width=Math.floor(this.width);this.height=Math.floor(this.height);return this};_.k.round=function(){this.width=Math.round(this.width);this.height=Math.round(this.height);return this}; _.xf=function(a,c){return a==c?!0:a&&c?a.width==c.width&&a.height==c.height:!1};_.yf=function(a){return 9==a.nodeType?a:a.ownerDocument||a.document};zf={cellpadding:"cellPadding",cellspacing:"cellSpacing",colspan:"colSpan",frameborder:"frameBorder",height:"height",maxlength:"maxLength",nonce:"nonce",role:"role",rowspan:"rowSpan",type:"type",usemap:"useMap",valign:"vAlign",width:"width"}; _.Af=function(a,c){_.Ka(c,function(c,e){c&&c.Ob&&(c=c.Ab());"style"==e?a.style.cssText=c:"class"==e?a.className=c:"for"==e?a.htmlFor=c:zf.hasOwnProperty(e)?a.setAttribute(zf[e],c):_.Rc(e,"aria-")||_.Rc(e,"data-")?a.setAttribute(e,c):a[e]=c})};_.Bf=function(a){return"CSS1Compat"==a.compatMode};_.Cf=function(a){a=(a||window).document;a=_.Bf(a)?a.documentElement:a.body;return new _.vf(a.clientWidth,a.clientHeight)}; Df=function(a){if(a&&"number"==typeof a.length){if(_.na(a))return"function"==typeof a.item||"string"==typeof a.item;if(_.ma(a))return"function"==typeof a.item}return!1};_.Ef=function(a,c,d,e){function f(d){d&&c.appendChild(_.n(d)?a.createTextNode(d):d)}for(;e<d.length;e++){var g=d[e];!_.Sc(g)||_.na(g)&&0<g.nodeType?f(g):(0,_.Ca)(Df(g)?_.Tc(g):g,f)}}; Ff=function(a,c){var d=String(c[0]),e=c[1];if(!_.Vc&&e&&(e.name||e.type)){d=["<",d];e.name&&d.push(' name="',_.rf(e.name),'"');if(e.type){d.push(' type="',_.rf(e.type),'"');var f={};_.Ma(f,e);delete f.type;e=f}d.push(">");d=d.join("")}d=a.createElement(d);e&&(_.n(e)?d.className=e:_.la(e)?d.className=e.join(" "):_.Af(d,e));2<c.length&&_.Ef(a,d,c,2);return d};_.Q=function(a,c,d){return Ff(window.document,arguments)};_.Gf=function(a){for(var c;c=a.firstChild;)a.removeChild(c)}; _.Hf=function(a){return a&&a.parentNode?a.parentNode.removeChild(a):null};_.If=function(a,c){if(!a||!c)return!1;if(a.contains&&1==c.nodeType)return a==c||a.contains(c);if("undefined"!=typeof a.compareDocumentPosition)return a==c||!!(a.compareDocumentPosition(c)&16);for(;c&&a!=c;)c=c.parentNode;return c==a}; _.Jf=function(a,c){if("textContent"in a)a.textContent=c;else if(3==a.nodeType)a.data=String(c);else if(a.firstChild&&3==a.firstChild.nodeType){for(;a.lastChild!=a.firstChild;)a.removeChild(a.lastChild);a.firstChild.data=String(c)}else _.Gf(a),a.appendChild(_.yf(a).createTextNode(String(c)))};_.Kf=function(a){try{return a&&a.activeElement}catch(c){}return null};_.Lf=function(a){this.b=a||_.m.document||window.document};_.k=_.Lf.prototype;_.k.F=function(a){return _.sd(this.b,a)}; _.k.Ua=function(a,c,d){return Ff(this.b,arguments)};_.k.createElement=function(a){return _.vd(this.b,a)};_.k.ud=function(a,c){a.appendChild(c)};_.k.$e=_.Gf;_.k.af=_.Hf;_.k.contains=_.If;_.Mf=function(a){return a?new _.Lf(_.yf(a)):jf||(jf=new _.Lf)}; var Pf;_.Of=function(a,c,d){if(_.n(c))(c=_.Nf(a,c))&&(a.style[c]=d);else for(var e in c){d=a;var f=c[e],g=_.Nf(d,e);g&&(d.style[g]=f)}};Pf={};_.Nf=function(a,c){var d=Pf[c];if(!d){var e=_.tf(c);d=e;void 0===a.style[e]&&(e=(_.Za?"Webkit":_.Ya?"Moz":_.x?"ms":_.Va?"O":null)+uf(e),void 0!==a.style[e]&&(d=e));Pf[c]=d}return d};_.Qf=function(a,c){var d=_.yf(a);return d.defaultView&&d.defaultView.getComputedStyle&&(a=d.defaultView.getComputedStyle(a,null))?a[c]||a.getPropertyValue(c)||"":""}; _.Rf=function(a,c){return _.Qf(a,c)||(a.currentStyle?a.currentStyle[c]:null)||a.style&&a.style[c]};_.Sf=function(a){try{var c=a.getBoundingClientRect()}catch(d){return{left:0,top:0,right:0,bottom:0}}_.x&&a.ownerDocument.body&&(a=a.ownerDocument,c.left-=a.documentElement.clientLeft+a.body.clientLeft,c.top-=a.documentElement.clientTop+a.body.clientTop);return c}; _.Uf=function(a,c,d){if(c instanceof _.vf)d=c.height,c=c.width;else if(void 0==d)throw Error("r");a.style.width=_.Tf(c,!0);a.style.height=_.Tf(d,!0)};_.Tf=function(a,c){"number"==typeof a&&(a=(c?Math.round(a):a)+"px");return a};_.Wf=function(a){var c=_.Vf;if("none"!=_.Rf(a,"display"))return c(a);var d=a.style,e=d.display,f=d.visibility,g=d.position;d.visibility="hidden";d.position="absolute";d.display="inline";a=c(a);d.display=e;d.position=g;d.visibility=f;return a}; _.Vf=function(a){var c=a.offsetWidth,d=a.offsetHeight,e=_.Za&&!c&&!d;return _.ea(c)&&!e||!a.getBoundingClientRect?new _.vf(c,d):(a=_.Sf(a),new _.vf(a.right-a.left,a.bottom-a.top))};_.Xf=_.Ya?"MozUserSelect":_.Za||_.Wa?"WebkitUserSelect":null; }catch(e){_._DumpException(e)} /* _Module_:syr */ try{ var cg,dg;_.Yf=function(a){if(a instanceof _.gd&&a.constructor===_.gd&&a.f===_.fd)return a.b;_.ka(a);return"type_error:SafeUrl"};_.Zf=function(a){if(a instanceof _.gd)return a;a=a.Ob?a.Ab():String(a);_.hd.test(a)||(a="about:invalid#zClosurez");return _.id(a)};_.$f=function(a){if(a instanceof _.od&&a.constructor===_.od&&a.j===_.nd)return a.b;_.ka(a);return"type_error:SafeHtml"};_.ag=function(a,c){a.innerHTML=_.$f(c)};_.bg=function(a){return null==a?"":String(a)}; cg=function(a,c,d,e){Array.prototype.splice.apply(a,_.de(arguments,1))};dg=function(a,c){return null!==a&&c in a?a[c]:void 0};_.eg=function(a,c){c=c instanceof _.gd?c:_.Zf(c);a.href=_.Yf(c)}; _.fg=function(){};_.ja(_.fg);_.fg.prototype.b=0;_.gg=function(a){return":"+(a.b++).toString(36)};var jg,kg;_.S=function(a){_.L.call(this);this.j=a||_.Mf();this.ha=hg;this.X=null;this.Ea=!1;this.b=null;this.J=void 0;this.D=this.w=this.f=this.A=null;this.Ca=!1};_.u(_.S,_.L);_.S.prototype.wa=_.fg.ra();var hg=null;_.S.prototype.getId=function(){return this.X||(this.X=_.gg(this.wa))};_.S.prototype.F=function(){return this.b};_.ig=function(a){a.J||(a.J=new _.$e(a));return a.J}; jg=function(a,c){if(a==c)throw Error("s");var d;if(d=c&&a.f&&a.X){d=a.f;var e=a.X;d=d.D&&e?dg(d.D,e)||null:null}if(d&&a.f!=c)throw Error("s");a.f=c;_.S.H.vc.call(a,c)};_.S.prototype.vc=function(a){if(this.f&&this.f!=a)throw Error("t");_.S.H.vc.call(this,a)};_.S.prototype.jc=function(){this.b=this.j.createElement("DIV")};_.S.prototype.tc=function(a){kg(this,a)};kg=function(a,c,d){if(a.Ea)throw Error("u");a.b||a.jc();c?c.insertBefore(a.b,d||null):a.j.b.body.appendChild(a.b);a.f&&!a.f.Ea||a.ya()}; _.lg=function(a,c){if(a.Ea)throw Error("u");if(c){a.Ca=!0;var d=_.yf(c);a.j&&a.j.b==d||(a.j=_.Mf(c));a.xc(c);a.ya()}else throw Error("v");};_.k=_.S.prototype;_.k.xc=function(a){this.b=a};_.k.ya=function(){this.Ea=!0;_.mg(this,function(a){!a.Ea&&a.F()&&a.ya()})};_.k.Qa=function(){_.mg(this,function(a){a.Ea&&a.Qa()});this.J&&_.df(this.J);this.Ea=!1}; _.k.N=function(){this.Ea&&this.Qa();this.J&&(this.J.ka(),delete this.J);_.mg(this,function(a){a.ka()});!this.Ca&&this.b&&_.Hf(this.b);this.f=this.A=this.b=this.D=this.w=null;_.S.H.N.call(this)}; _.k.Yb=function(a,c,d){if(a.Ea&&(d||!this.Ea))throw Error("u");if(0>c||c>_.ng(this))throw Error("w");this.D&&this.w||(this.D={},this.w=[]);if(a.f==this){var e=a.getId();this.D[e]=a;_.Ad(this.w,a)}else{e=this.D;var f=a.getId();if(null!==e&&f in e)throw Error("a`"+f);e[f]=a}jg(a,this);cg(this.w,c,0,a);a.Ea&&this.Ea&&a.f==this?(d=this.b,c=d.childNodes[c]||null,c!=a.F()&&d.insertBefore(a.F(),c)):d?(this.b||this.jc(),c=_.og(this,c+1),kg(a,this.b,c?c.b:null)):this.Ea&&!a.Ea&&a.b&&a.b.parentNode&&1==a.b.parentNode.nodeType&& a.ya()};_.ng=function(a){return a.w?a.w.length:0};_.og=function(a,c){return a.w?a.w[c]||null:null};_.mg=function(a,c,d){a.w&&(0,_.Ca)(a.w,c,d)};_.S.prototype.removeChild=function(a,c){if(a){var d=_.n(a)?a:a.getId();a=this.D&&d?dg(this.D,d)||null:null;if(d&&a){var e=this.D;d in e&&delete e[d];_.Ad(this.w,a);c&&(a.Qa(),a.b&&_.Hf(a.b));jg(a,null)}}if(!a)throw Error("x");return a}; }catch(e){_._DumpException(e)} /* _Module_:syx */ try{ var pg,qg;pg=function(a,c,d){if(a.f)return null;if(d instanceof Array){var e=null,f;for(f in d){var g=pg(a,c,d[f]);g&&(e=g)}return e}e=null;a.b&&a.b.type==d&&a.j==c&&(e=a.b,a.b=null);if(f=c.getAttribute("data-eqid"))c.removeAttribute("data-eqid"),(f=a.o[f])?c.removeEventListener?c.removeEventListener(d,f,!1):c.detachEvent&&c.detachEvent("on"+d,f):a.A.log(Error("e`"+c));return e};qg=[1,4,2];_.rg=function(a){return(_.Ac?0==a.lb.button:"click"==a.type?!0:!!(a.lb.button&qg[0]))&&!(_.Za&&_.$a&&a.ctrlKey)}; _.sg=function(a,c,d,e){d.K(c,e,void 0,a.W||a,a)};_.T=function(a,c,d){d?_.O(a,c):_.P(a,c)};_.tg=function(a,c){var d=!_.M(a,c);_.T(a,c,d)}; var ug,vg;ug=function(){};_.U=new ug;vg=["click",_.Ya?"keypress":"keydown","keyup"];ug.prototype.K=function(a,c,d,e,f){var g=function(a){var d=_.Td(c),f=_.xd(a.target)?a.target.getAttribute("role")||null:null;"click"==a.type&&_.rg(a)?d.call(e,a):13!=a.keyCode&&3!=a.keyCode||"keyup"==a.type?32!=a.keyCode||"keyup"!=a.type||"button"!=f&&"tab"!=f||(d.call(e,a),a.preventDefault()):(a.type="keypress",d.call(e,a))};g.qc=c;g.Ki=e;f?f.K(a,vg,g,d):_.K(a,vg,g,d)}; ug.prototype.Ga=function(a,c,d,e,f){for(var g,h=0;g=vg[h];h++){var l=a;var q=g;var r=!!d;q=_.Hd(l)?l.Cc(q,r):l?(l=_.Vd(l))?l.Cc(q,r):[]:[];for(l=0;r=q[l];l++){var w=r.listener;if(w.qc==c&&w.Ki==e){f?f.Ga(a,g,r.listener,d,e):_.Zd(a,g,r.listener,d,e);break}}}}; _.wg=function(a,c,d){return function(){try{return c.apply(d,arguments)}catch(e){a.log(e)}}};_.xg=function(a,c){if(a instanceof window.Element&&(c=pg(_.Uc("eq"),a,c||[])))if(_.x&&c instanceof window.MouseEvent&&a.dispatchEvent){var d=window.document.createEvent("MouseEvent");d.initMouseEvent(c.type,!0,!0,c.view,c.detail,c.screenX,c.screenY,c.clientX,c.clientY,c.ctrlKey,c.altKey,c.shiftKey,c.metaKey,c.button,c.relatedTarget);a.dispatchEvent(d)}else a.dispatchEvent&&a.dispatchEvent(c)}; _.yg=function(a,c){_.$e.call(this,c);this.A=a;this.va=c||this};_.u(_.yg,_.$e);_.yg.prototype.K=function(a,c,d,e){if(d){if("function"!=typeof d)throw new TypeError("Function expected");d=_.wg(this.A,d,this.va);d=_.yg.H.K.call(this,a,c,d,e);_.xg(a,zg(c));return d}return _.yg.H.K.call(this,a,c,d,e)}; _.yg.prototype.j=function(a,c,d,e,f){if(d){if("function"!=typeof d)throw new TypeError("Function expected");d=_.wg(this.A,d,f||this.va);d=_.yg.H.j.call(this,a,c,d,e,f);_.xg(a,zg(c));return d}return _.yg.H.j.call(this,a,c,d,e,f)};_.yg.prototype.tb=function(a,c,d,e){if(d){if("function"!=typeof d)throw new TypeError("Function expected");d=_.wg(this.A,d,this.va);d=_.yg.H.tb.call(this,a,c,d,e);_.xg(a,zg(c));return d}return _.yg.H.tb.call(this,a,c,d,e)}; var zg=function(a){return _.la(a)?(0,_.Ea)(a,zg):_.n(a)?a:a?a.toString():a}; _.Ag=function(a,c){_.yg.call(this,c);this.f=a};_.u(_.Ag,_.yg);_.Ag.prototype.F=function(){return this.f};_.Ag.prototype.N=function(){this.f=null;_.Ag.H.N.call(this)}; }catch(e){_._DumpException(e)} /* _Module_:syv */ try{ _.Bg=!_.x&&!_.Oa(); }catch(e){_._DumpException(e)} /* _Module_:syy */ try{ var Dg,Eg,Fg,Jg;_.Cg=function(a,c,d,e){if(null!=a)for(a=a.firstChild;a;){if(c(a)&&(d.push(a),e)||_.Cg(a,c,d,e))return!0;a=a.nextSibling}return!1};Dg=function(a,c){var d=[];_.Cg(a,c,d,!1);return d};Eg=function(a){return _.x&&!_.nb("9")?(a=a.getAttributeNode("tabindex"),null!=a&&a.specified):a.hasAttribute("tabindex")};Fg=function(a){a=a.tabIndex;return _.fa(a)&&0<=a&&32768>a}; _.Gg=function(a){var c;if((c="A"==a.tagName||"INPUT"==a.tagName||"TEXTAREA"==a.tagName||"SELECT"==a.tagName||"BUTTON"==a.tagName?!a.disabled&&(!Eg(a)||Fg(a)):Eg(a)&&Fg(a))&&_.x){var d;!_.ma(a.getBoundingClientRect)||_.x&&null==a.parentElement?d={height:a.offsetHeight,width:a.offsetWidth}:d=a.getBoundingClientRect();a=null!=d&&0<d.height&&0<d.width}else a=c;return a};_.Hg=function(a,c,d){for(var e=0;a&&(null==d||e<=d);){if(c(a))return a;a=a.parentNode;e++}return null}; _.Ig=function(a,c){a=a.getAttribute("aria-"+c);return null==a||void 0==a?"":String(a)};Jg=function(a){return null!=_.Hg(a,function(a){return 1==a.nodeType&&"true"==_.Ig(a,"hidden")})};_.Kg=function(a){return a?Dg(a,function(a){return 1==a.nodeType&&_.Gg(a)&&!Jg(a)}):[]}; }catch(e){_._DumpException(e)} /* _Module_:sy10 */ try{ _.Lg=function(a,c,d){_.Ag.call(this,a,c);this.w=d;this.o=_.M(this.f,"gb_3b");(a=_.I("gb_4b",this.f))&&_.sg(this,a,_.U,this.b)};_.u(_.Lg,_.Ag);_.Lg.prototype.b=function(a){var c;(a=a.b)&&(a=a.getAttributeNode("data-ved"))&&a.value&&(c={ved:a.value});this.w.log(this.o?41:39,c)}; }catch(e){_._DumpException(e)} /* _Module_:syz */ try{ var Mg=function(a){_.D.call(this);this.A=a;this.o=this.b=null;this.f={};this.w={};this.j={}};_.u(Mg,_.D);var Ng=new Mg(_.H);_.Zb("dd",Ng); }catch(e){_._DumpException(e)} /* _Module_:syt */ try{ var Rg,Sg,Vg,Wg,$g,ah,bh,ch,gh,kh;_.Pg=function(a,c){c&&_.Og(a,a.href.replace(/([?&](continue|followup)=)[^&]*/g,"$1"+(0,window.encodeURIComponent)(c)))};Rg=function(a,c){if(void 0!==a.b||void 0!==a.f)throw Error("f");a.f=c;_.kc(a)};Sg=function(a){_.z(this,a,0,-1,null)};_.u(Sg,_.y);_.Tg=function(a){return _.Wc&&void 0!=a.children?a.children:(0,_.Da)(a.childNodes,function(a){return 1==a.nodeType})};_.Ug=function(a,c,d){_.D.call(this);this.qc=a;this.j=c||0;this.f=d;this.b=(0,_.p)(this.Ug,this)}; _.u(_.Ug,_.D);_.k=_.Ug.prototype;_.k.Dc=0;_.k.N=function(){_.Ug.H.N.call(this);this.stop();delete this.qc;delete this.f};_.k.start=function(a){this.stop();this.Dc=_.We(this.b,_.ea(a)?a:this.j)};_.k.stop=function(){0!=this.Dc&&_.m.clearTimeout(this.Dc);this.Dc=0};_.k.Ug=function(){this.Dc=0;this.qc&&this.qc.call(this.f)};Vg=function(a,c){a=_.I("gb_Xa",a.F());_.T(a,"gb_5a",!c)};Wg=function(a){return String(a).replace(/([A-Z])/g,"-$1").toLowerCase()}; _.Og=function(a,c){c=c instanceof _.gd?c:_.Zf(c);a.href=_.Yf(c)};_.Xg=function(a,c){var d=c||window.document;return d.querySelectorAll&&d.querySelector?d.querySelectorAll("."+a):_.ud(window.document,a,c)};_.Yg=function(a,c){return _.I(a,c)};_.Zg=function(a,c,d){a.insertBefore(c,a.childNodes[d]||null)};$g=function(a,c){var d=c.parentNode;d&&d.replaceChild(a,c)};ah=function(a,c){var d=[];return _.Cg(a,c,d,!0)?d[0]:void 0};bh={SCRIPT:1,STYLE:1,HEAD:1,IFRAME:1,OBJECT:1};ch={IMG:" ",BR:"\n"}; _.dh=function(a,c){c?a.tabIndex=0:(a.tabIndex=-1,a.removeAttribute("tabIndex"))};_.eh=function(a,c,d){if(!(a.nodeName in bh))if(3==a.nodeType)d?c.push(String(a.nodeValue).replace(/(\r\n|\r|\n)/g,"")):c.push(a.nodeValue);else if(a.nodeName in ch)c.push(ch[a.nodeName]);else for(a=a.firstChild;a;)_.eh(a,c,d),a=a.nextSibling}; _.fh=function(a){if(_.Xc&&null!==a&&"innerText"in a)a=a.innerText.replace(/(\r\n|\r|\n)/g,"\n");else{var c=[];_.eh(a,c,!0);a=c.join("")}a=a.replace(/ \xAD /g," ").replace(/\xAD/g,"");a=a.replace(/\u200B/g,"");_.Xc||(a=a.replace(/ +/g," "));" "!=a&&(a=a.replace(/^\s*/,""));return a};gh=function(a,c){return c?_.Hg(a,function(a){return!c||_.n(a.className)&&_.Ga(a.className.split(/\s+/),c)},void 0):null};_.hh=function(a,c){a=a.getAttribute("aria-"+c);return null==a?a:"boolean"==typeof a?a:"true"==a}; _.ih=function(a,c,d,e){e=_.wg(a,e,void 0);_.K(c,d,e,void 0,void 0);_.xg(c,d)};_.jh=function(a,c,d){if(_.Bg&&a.dataset)a.dataset[c]=d;else{if(/-[a-z]/.test(c))throw Error("y");a.setAttribute("data-"+Wg(c),d)}};kh=function(a){if(/-[a-z]/.test("item"))return null;if(_.Bg&&a.dataset){if(_.Pa()&&!("item"in a.dataset))return null;a=a.dataset.item;return void 0===a?null:a}return a.getAttribute("data-"+Wg("item"))}; _.mh=function(a,c){_.L.call(this);this.b=a;this.j=lh(this.b);this.B=c||100;this.o=_.K(a,"resize",this.A,!1,this)};_.u(_.mh,_.L);_.mh.prototype.N=function(){_.$d(this.o);_.mh.H.N.call(this)};_.mh.prototype.A=function(){this.f||(this.f=new _.Ug(this.w,this.B,this),_.Se(this,this.f));this.f.start()}; _.mh.prototype.w=function(){if(!this.b.La){var a=this.j,c=lh(this.b);this.j=c;if(a){var d=!1;a.width!=c.width&&(this.dispatchEvent("b"),d=!0);a.height!=c.height&&(this.dispatchEvent("a"),d=!0);d&&this.dispatchEvent("resize")}else this.dispatchEvent("a"),this.dispatchEvent("b"),this.dispatchEvent("resize")}}; var nh=function(a){_.L.call(this);this.f=a||window;this.j=_.K(this.f,"resize",this.o,!1,this);this.b=_.Cf(this.f)},oh,lh;_.u(nh,_.L);_.ph=function(){var a=window,c=_.Ue(a);return oh[c]=oh[c]||new nh(a)};oh={};lh=function(a){return a.b?_.wf(a.b):null};nh.prototype.N=function(){nh.H.N.call(this);this.j&&(_.$d(this.j),this.j=null);this.b=this.f=null};nh.prototype.o=function(){var a=_.Cf(this.f);_.xf(a,this.b)||(this.b=a,this.dispatchEvent("resize"))}; _.qh=function(a){this.f=a;this.b=null};_.rh=function(a){a.b||(a.b=_.K(a.f,"keydown",a.j,!1,a))};_.qh.prototype.j=function(a){9!=a.keyCode||_.M(this.f,"gb_5")||(_.sh(this,!0),_.th(this))};_.th=function(a){a.b&&(_.$d(a.b),a.b=null)};_.sh=function(a,c){_.T(a.f,"gb_5",c)}; _.uh=function(a,c){_.L.call(this);this.B=a;c&&(this.B.id=c)};_.u(_.uh,_.L);_.uh.prototype.F=function(){return this.B};_.uh.prototype.getId=function(){return this.B.id};_.uh.prototype.X=function(){var a=this.B.id;a||(a="gb$"+_.gg(_.fg.ra()),this.B.id=a);return a};_.uh.prototype.N=function(){_.Hf(this.B);_.uh.H.N.call(this)}; _.vh=function(a){_.uh.call(this,a);_.U.K(a,this.b,!1,this)};_.u(_.vh,_.uh);_.vh.prototype.b=function(a){this.dispatchEvent("click")||a.preventDefault()};_.wh=function(a){return ah(a,function(a){return _.xd(a)&&_.Gg(a)})};_.xh=function(a){(a=_.wh(a))&&a.focus()};var yh=function(){};var zh=function(a,c,d){this.f=a;this.j=c;this.b=d||_.m};var Ah=function(){this.b=[]};Ah.prototype.f=function(a,c,d){this.A(a,c,d);this.b.push(new zh(a,c,d))};Ah.prototype.A=function(a,c,d){d=d||_.m;for(var e=0,f=this.b.length;e<f;e++){var g=this.b[e];if(g.f==a&&g.j==c&&g.b==d){this.b.splice(e,1);break}}};Ah.prototype.j=function(a){for(var c=0,d=this.b.length;c<d;c++){var e=this.b[c];"catc"==e.f&&e.j.call(e.b,a)}}; var Ch=function(a,c,d){this.o=new Ah;this.C=a;this.w=c;this.b=Bh(a.offsetWidth,this.w);this.D=d||new _.mh(_.ph(),10);_.K(this.D,"b",function(){window.requestAnimationFrame?window.requestAnimationFrame((0,_.p)(this.B,this)):this.B()},!1,this)},Bh=function(a,c){for(var d=0,e=c.length-1,f=c[0];d<e;){if(a<=f.max)return f.id;f=c[++d]}return c[e].id};Ch.prototype.B=function(){var a=Bh(this.C.offsetWidth,this.w);a!=this.b&&(this.b=a,this.j(new yh))};Ch.prototype.f=function(a,c,d){this.o.f(a,c,d)}; Ch.prototype.A=function(a,c){this.o.A(a,c)};Ch.prototype.j=function(a){this.o.j(a)}; var Dh={mj:"gb_9b",Ij:"gb_yd",aj:"gb_fc"};var Eh={id:"unlimitedProductControl",Bd:Number.MAX_SAFE_INTEGER};var Fh=function(a,c){c||(c=this.createElement(),a.Xc().appendChild(c));_.uh.call(this,c);this.o=new _.$e(this);_.sg(this.o,this.F(),_.U,this.fh)};_.u(Fh,_.uh);_.k=Fh.prototype;_.k.createElement=function(){var a=_.vd(window.document,"LI");_.O(a,"gb_kc");_.zd(a,"menuitem");return a}; _.k.si=function(a){a?_.jh(this.F(),"item",a):(a=this.F(),/-[a-z]/.test("item")||(_.Bg&&a.dataset?!/-[a-z]/.test("item")&&(_.Bg&&a.dataset?"item"in a.dataset:a.hasAttribute?a.hasAttribute("data-"+Wg("item")):a.getAttribute("data-"+Wg("item")))&&delete a.dataset.item:a.removeAttribute("data-"+Wg("item"))));return this};_.k.Wc=function(){return kh(this.F())};_.k.Jc=function(a){_.T(this.F(),"gb_mc",a);return this};_.k.focus=function(){_.xh(this.F())};_.k.fh=function(){this.dispatchEvent("click")}; var Gh=function(a,c){Fh.call(this,a,c);this.j=_.Yg("gb_nc",this.F());this.w=_.I("gb_pc",this.j);this.b=null;this.f=_.I("gb_oc",this.j)};_.u(Gh,Fh);_.k=Gh.prototype;_.k.createElement=function(){var a=Gh.H.createElement.call(this);_.O(a,"gb_qc");var c=_.Q("A","gb_nc");_.dh(c,!0);a.appendChild(c);var d=_.Q("SPAN","gb_oc");c.appendChild(d);return a};_.k.Wc=function(){return Gh.H.Wc.call(this)||this.xf()};_.k.xf=function(){return _.fh(this.f)};_.k.ti=function(a){_.Jf(this.f,a);return this}; _.k.Ni=function(a){if(!this.w)if(this.w=_.Q("IMG","gb_pc"),this.b)$g(this.w,this.b),this.b=null;else{var c=this.f;c.parentNode&&c.parentNode.insertBefore(this.w,c)}this.w.setAttribute("src",a);return this}; _.k.Mi=function(a){if(!(a instanceof window.Element&&"svg"==a.tagName.toLowerCase()))return this;if(this.w)$g(a,this.w),this.w=null;else if(this.b)$g(a,this.b);else{var c=this.f;c.parentNode&&c.parentNode.insertBefore(a,c)}(c=a.getAttribute("class"))?a.setAttribute("class",c+" gb_pc"):a.setAttribute("class","gb_pc");this.b=a;return this};_.k.focus=function(){this.j.focus()}; _.Hh=function(a){_.uh.call(this,a);this.f=[];this.G={}};_.u(_.Hh,_.uh);_.uh.prototype.Xc=function(){return this.F()};_.Hh.prototype.$=function(a){var c=this.G[a];if(c)return c;var d=window.document.getElementById(a);if(d)for(var e=0,f=this.f.length;e<f;++e)if(c=this.f[e],c.F()==d)return this.G[a]=c;return null};_.Hh.prototype.ub=function(a){a.vc(this);this.f.push(a);var c=a.getId();c&&(this.G[c]=a)};_.Hh.prototype.W=function(){for(var a=0,c=this.f.length;a<c;a++)this.f[a].ka();this.G={};this.f=[]}; var Ih=function(a,c){_.Hh.call(this,c||this.createElement());this.j=a;a=this.F().getElementsByClassName("gb_kc");for(c=0;c<a.length;c++){var d=a[c];_.M(d,"gb_qc")?this.ub(new Gh(this,d)):this.ub(new Fh(this,d))}this.b=_.I("gb_lc",this.F())};_.u(Ih,_.Hh);_.k=Ih.prototype;_.k.createElement=function(){var a=_.vd(window.document,"UL");_.O(a,"gb_jc");var c=_.Q("SPAN","gb_lc");a.appendChild(c);return a}; _.k.ub=function(a){Ih.H.ub.call(this,a);var c=this.j,d=a.F();d=d.id||(d.id="gbm"+_.gg(_.fg.ra()));c.M[d]=a};_.k.oi=function(){return null!=this.b?_.fh(this.b):null};_.k.ri=function(a){return null!=this.b?(_.Jf(this.b,a),this):null};_.k.eg=function(){var a=new Fh(this);this.ub(a);return a};_.k.fg=function(){var a=new Gh(this);this.ub(a);return a}; var V=function(a,c,d,e,f){_.Hh.call(this,a);this.b=c;this.w=a;this.A=d;this.J=e;this.j=_.I("gb_gc",this.b);this.L=new _.qh(this.j);this.C=_.I("gb_hc",this.j);this.D=_.I("gb_ic",this.j);this.M={};this.O=[];this.R=f||!1;this.o=new _.$e(this);Jh(this);a=this.j.getElementsByClassName("gb_jc");for(c=0;c<a.length;c++)this.ub(new Ih(this,a[c]))};_.u(V,_.Hh);var Kh="click mousedown scroll touchstart wheel keydown".split(" ");V.prototype.N=function(){V.H.N.call(this);Lh(this)};V.prototype.Xc=function(){return this.j}; V.prototype.T=function(){Mh(this);return Nh(this,this.C)};V.prototype.U=function(){Mh(this);return Nh(this,this.D)};var Nh=function(a,c){var d=new Ih(a),e=d.F();c.appendChild(e);a.ub(d);return d},Mh=function(a){a.C||(a.C=_.vd(window.document,"DIV"),_.O(a.C,"gb_hc"),a.j.appendChild(a.C),a.D=_.vd(window.document,"DIV"),_.O(a.D,"gb_ic"),a.j.appendChild(a.D))};V.prototype.ha=function(a){_.T(this.b,"gb_ec",1==a);this.dispatchEvent("msc")};V.prototype.V=function(){return Oh(this)?0:1}; var Ph=function(a,c){switch(c){case "menu":_.P(a.F(),"gb_5a");break;case "back":_.P(a.A,"gb_5a")}},Qh=function(a){_.O(a.F(),"gb_5a");_.O(a.A,"gb_5a")};_.k=V.prototype;_.k.Ba=function(a){switch(a){case "menu":return!_.M(this.F(),"gb_5a");case "back":return!_.M(this.A,"gb_5a")}return!1}; _.k.we=function(){this.J||(this.dispatchEvent("beforeshow"),_.O(this.b,"gb_g"),_.J(this.F(),"expanded",!0),_.xh(this.j),_.rh(this.L),this.dispatchEvent("open"),this.o.j(window.document.body,Kh,this.mf,!0,this),this.o.K(window.document.body,_.Fc,this.yf))};_.k.close=function(){if(!this.J){_.P(this.b,"gb_g");_.J(this.F(),"expanded",!1);window.document.activeElement==this.F()&&this.F().blur();var a=this.L;_.th(a);_.sh(a,!1);this.dispatchEvent("close");Lh(this)}}; _.k.Si=function(a){!_.M(this.w,"gb_5a")&&_.O(this.w,"gb_cc");_.P(this.A,"gb_5a");a&&_.Sd(this.A,"click",a)};_.k.Wh=function(){_.O(this.A,"gb_5a");_.M(this.w,"gb_cc")&&_.P(this.w,"gb_cc")};_.k.Fb=function(){return _.M(this.b,"gb_g")};var Jh=function(a){_.sg(a.o,a.F(),_.U,a.Z);a.F().addEventListener("keydown",function(a){32==a.keyCode&&a.preventDefault()});_.sg(a.o,a.j,_.U,a.Dh);a.o.K(a.b,"keydown",a.ui);a.o.K(a.b,"keyup",a.Ah);_.sg(a.o,a.A,_.U,function(){this.dispatchEvent("bbc")})}; V.prototype.Z=function(){this.dispatchEvent("mbc");this.J||(this.Fb()?this.close():this.we())};var Oh=function(a){return!_.M(a.b,"gb_ec")||_.M(a.b,"gb_9b")||_.M(a.b,"gb_yd")};_.k=V.prototype;_.k.Ah=function(a){9===a.keyCode&&this.Fb()&&(a=this.L,_.sh(a,!0),_.th(a))}; _.k.ui=function(a){a:{if(36==a.keyCode||35==a.keyCode){var c=_.Kg(this.b);if(0<c.length){var d=c[c.length-1];36==a.keyCode&&(d=!Oh(this)&&1<c.length?c[1]:c[0]);d.focus();a.preventDefault();break a}}27!=a.keyCode||this.R&&!Oh(this)||(this.close(),null!=this.w&&this.w.focus())}9===a.keyCode&&this.Fb()&&Oh(this)&&(c=a.target,d=_.Kg(this.b),0<d.length&&(c==d[0]&&a.shiftKey?(d[d.length-1].focus(),a.preventDefault()):c!=d[d.length-1]||a.shiftKey||(d[0].focus(),a.preventDefault())))}; _.k.Dh=function(a){if(a.target instanceof window.Node){a:{a=a.target;for(var c=this.j;a&&a!==c;){var d=a.id;if(d in this.M){a=this.M[d];break a}a=a.parentNode}a=null}if(a){a=a.Wc();c=0;for(d=this.O.length;c<d;++c){var e=this.O[c];e.b.call(e.f,a)}this.R&&!Oh(this)||this.close()}}}; _.k.mf=function(a){this.Fb()&&a.target instanceof window.Node&&Oh(this)&&("keydown"==a.type?27==a.keyCode&&(a.preventDefault(),a.stopPropagation(),this.close(),this.F().focus()):gh(a.target,"gb_fa")||gh(a.target,"gb_8b")||_.If(this.b,a.target)||("touchstart"==a.type&&(a.preventDefault(),a.stopPropagation()),this.close()))};_.k.yf=function(){this.Fb()&&(!Oh(this)||gh(window.document.activeElement,"gb_dc")||gh(window.document.activeElement,"gb_fa")||_.xh(this.j))}; var Lh=function(a){a.o.Ga(window.document.body,Kh,a.mf,!1,a);a.o.Ga(window.document.body,_.Fc,a.yf)};V.prototype.S=function(a,c){this.O.push(new Rh(a,c))};var Rh=function(a,c){this.b=a;this.f=c}; _.Sh=function(a){_.uh.call(this,a);_.K(a,"click",this.b,!1,this)};_.u(_.Sh,_.uh);_.Sh.prototype.f=function(){return _.hh(this.F(),"pressed")||!1};_.Sh.prototype.b=function(a){a=a.b;var c=_.Ig(a,"pressed");_.fe(_.bg(c))||"true"==c||"false"==c?_.J(a,"pressed","true"==c?"false":"true"):a.removeAttribute("aria-pressed");this.dispatchEvent("click")}; var Th,Vh;_.Uh=function(){_.L.prototype.za=_.Qc(Th,_.L.prototype.K);_.L.prototype.zb=_.L.prototype.Nc;_.t("gbar.I",_.uh);_.uh.prototype.ia=_.uh.prototype.getId;_.uh.prototype.ib=_.uh.prototype.F;_.uh.prototype.ic=_.uh.prototype.X;_.t("gbar.J",_.Hh);_.Hh.prototype.ja=_.Hh.prototype.$;_.Hh.prototype.jb=_.Hh.prototype.W;_.t("gbar.K",_.vh);_.t("gbar.L",_.Sh);_.Sh.prototype.la=_.Sh.prototype.f};Th=function(a,c,d,e,f){return a.call(this,c,_.Qc(Vh,d),e,f)}; Vh=function(a,c){c.xa=c.type;c.xb=c.target;return a.call(this,c)}; var W=function(a,c,d,e){_.L.call(this);this.f=a;_.P(this.f,"gb_td");this.j=c;this.Ca=d;this.yb="";this.kb=e;this.O=this.b=null;this.Va=this.Z=this.Y=!1;this.Xa=_.E(_.A(this.j,16),!1);this.$=new _.$e(this);this.S=_.I("gb_Lc",this.f);this.M=_.E(_.A(c,6),!1);this.Wb=_.I("gb_Mc",this.S);this.A=_.I("gb_ud",this.f);this.L=_.I("gb_zd",this.f);(this.ta=_.E(_.A(this.j,21),!1))&&this.A&&(this.Fa=_.I("gb_de",this.f),this.W=_.I("gb_he",this.f),this.R=_.I("gb_ee",this.f));this.B=_.I("gb_tc",this.f);this.T=_.I("gb_Ud", this.f);this.Wf=_.I("gb_Wd",this.f);this.D=_.I("gb_Kd",this.f);this.o=_.I("gb_Hd",this.f);this.J=Array.prototype.slice.call(_.Xg("gb_0d",this.f));this.U=!1;this.Kb=_.E(_.A(this.j,19),!1);this.Jb=_.E(_.A(this.j,20),!1);this.G=_.E(_.A(this.j,18),!1);c=Wh(this,!0);d=Wh(this,!1);this.Ub=Math.max(c,d);this.X=_.A(this.j,15);this.V=_.E(_.A(this.j,17),!1);a=Xh(this,c,d);this.C=new Ch(this.f,Yh);this.ta&&this.A&&(this.ab=new Ch(this.f,Zh),this.ab.f("catc",this.ua,this),this.ua(),_.sg(this.$,this.Fa,_.U,function(){_.tg(this.W, "gb_5a")}));this.Tb=_.E(_.A(this.j,1),!1);$h(this);ai(this,this.C.b);this.C.f("catc",this.Cb,this);_.A(this.j,8)&&window.document.addEventListener("scroll",(0,_.p)(function(){_.T(this.f,"gb_wd",0<window.scrollY)},this));c+=d;null!=this.o&&(_.A(this.j,7)&&(this.va=new Ch(this.o,a),this.va.f("catc",this.ke,this),this.ke(),c+=48),this.V&&_.Of(this.o,"min-width",c+"px"))};_.u(W,_.L); var bi="click mousedown scroll touchstart wheel keydown".split(" "),Yh=[{id:"gb_9b",max:599},{id:"gb_yd",max:1023},{id:"gb_fc"}],Zh=[{id:{id:"oneProductControl",Bd:1},max:320},{id:{id:"twoProductControl",Bd:2},max:360},{id:{id:"threeProductControl",Bd:3},max:410},{id:Eh}];_.k=W.prototype;_.k.F=function(){return this.f};_.k.Oi=function(a){this.O=a;this.G&&"gb_9b"==this.C.b?(ci(this,!0),this.wa(!1)):Vg(this.O,this.Y)}; _.k.Pi=function(a){this.S&&(_.Jf(this.Wb,a||""),_.T(this.S,"gb_5a",!a||this.G&&"gb_9b"==this.C.b),this.M=!!a,ai(this,this.C.b))};_.k.Mg=function(){return _.I("gb_8d",this.A)};_.k.ke=function(){if(null!=this.va){var a=this.va.b;3==a?di(this,!1):1==a?di(this,!this.G):di(this,!this.G&&"gb_fc"==this.C.b)}}; var di=function(a,c){if(_.A(a.j,7)&&(a.G||!a.U||c)){if(a.X){var d=_.I("gb_pe",a.f);if(d){var e=_.I("gb_qe",a.f),f="gb_fc"!=a.C.b||c?"":a.Ub+"px";_.Of(d,"min-width",f);_.Of(e,"min-width",f)}}_.M(a.o,"gb_Cd")!=c&&(_.T(a.o,"gb_Cd",c),c?a.dispatchEvent("sfi"):a.dispatchEvent("sfu"),_.T(_.I("gb_xe",a.o),"gb_Cd",c),c&&a.ua())}},$h=function(a){var c=_.G.ra();a.A||Rg(c.f,Error("C"));_.E(_.A(a.j,11))||Rg(c.B,Error("D"));_.E(_.A(a.j,7))||Rg(c.w,Error("E"));_.E(_.A(a.j,12))||Rg(c.o,Error("F"));_.E(_.A(a.j,13))|| Rg(c.A,Error("G"))},ai=function(a,c){var d;if(!a.b&&a.A){if(d=_.I("gb_8b",a.f)){var e=_.I("gb_dc");if(e){var f=_.I("gb_bc");f?(a.b=new V(d,e,f,_.E(_.A(a.j,16),!1),_.E(_.A(a.j,9),!1)),a.b.K("open",a.Hb,!1,a),a.b.K("close",a.Gb,!1,a),a.b.K("msc",a.Ib,!1,a),_.Uh(),_.t("gbar.C",V),V.prototype.ca=V.prototype.Xc,V.prototype.cb=V.prototype.T,V.prototype.cc=V.prototype.S,V.prototype.cd=V.prototype.ha,V.prototype.ce=V.prototype.U,V.prototype.cf=V.prototype.we,V.prototype.cg=V.prototype.close,V.prototype.ch= V.prototype.V,V.prototype.ci=V.prototype.Si,V.prototype.cj=V.prototype.Wh,V.prototype.ck=V.prototype.Fb,_.t("gbar.D",Ih),Ih.prototype.da=Ih.prototype.eg,Ih.prototype.db=Ih.prototype.fg,Ih.prototype.dc=Ih.prototype.oi,Ih.prototype.dd=Ih.prototype.ri,_.t("gbar.E",Fh),Fh.prototype.ea=Fh.prototype.F,Fh.prototype.eb=Fh.prototype.Jc,Fh.prototype.ec=Fh.prototype.si,Fh.prototype.ed=Fh.prototype.Wc,_.t("gbar.F",Gh),Gh.prototype.fa=Gh.prototype.ti,Gh.prototype.fb=Gh.prototype.Ni,Gh.prototype.fc=Gh.prototype.Mi, Gh.prototype.fd=Gh.prototype.xf,Gh.prototype.ed=Gh.prototype.Wc,_.ee(_.G.ra().f,a.b)):a.Ca.log(Error("z"))}else a.Ca.log(Error("A"))}else a.Ca.log(Error("B"));d=_.E(_.A(a.j,14),!1)}d&&a.ha("back");a.b&&!a.Z&&a.ha("default");a.b&&a.Jb&&a.ha("none");ei(a);a.Kb?a.Y=!0:(d="gb_9b"==c,e=_.E(_.A(a.j,5),!1),f=_.E(_.A(a.j,7),!1),a.Y=!(a.M||d&&(e||f)));d=fi(a,c);if(a.b&&d)a:{if(!_.gi(a)){if(a.V){if(null==a.T)break a;d=_.I("gb_6d");a.T.parentNode!=d&&_.Zg(d,a.T,0);_.O(a.B,"gb_Vd")}else d=_.I("gb_6d"),a.B.parentNode!= d&&_.Zg(d,a.B,0),_.P(a.B,"gb_Td");a.ma();a.dispatchEvent("upi")}}else a:if(_.gi(a)&&a.A){if(a.V){if(null==a.T)break a;_.Zg(a.Wf,a.T,0);_.P(a.B,"gb_Vd")}else a.A.appendChild(a.B),_.O(a.B,"gb_Td");a.ma();a.dispatchEvent("upo")}d="gb_9b"==c;a.O&&!a.Xa&&(e=a.O.F(),f=!a.M,_.T(e,"gb_5a",!f),f&&(a.G&&d?(a.wa(!1),ci(a,!0)):Vg(a.O,a.Y&&(!a.G||!d))));a.b&&(a.b.Ba("menu")||a.b.Ba("back"))&&!Oh(a.b)&&(a.Va=a.b.Fb());e=_.ge(Dh);_.Ze(a.f,e);_.O(a.f,c);_.A(a.j,7);if(a.X&&null!=a.D)if("gb_fc"!=c)_.Of(a.D,"min-width", ""),_.Of(a.B,"min-width","");else{f=_.Wf(a.D).width;var g=_.Wf(a.B).width;f=Math.max(f,g);_.Of(a.D,"min-width",f+"px");_.Of(a.B,"min-width",f+"px")}d?a.U||(a.U=!a.G,di(a,a.U),ci(a,!0)):(ci(a,!1),a.U=!1,a.ke());hi(a,a.o);hi(a,a.D);null!=a.o&&(f="gb_yd"==c,_.T(a.o,"gb_Od",!d&&!f),_.T(a.o,"gb_Nd",d||f));a.b&&(d=a.b.b,_.Ze(d,e),_.O(d,c),Oh(a.b)?_.I("gb_7d",void 0).appendChild(d):a.f.appendChild(d),a.b.Ba("menu")||a.b.Ba("back"))&&(c=!Oh(a.b),d=a.b.Fb(),c&&!d&&a.Va?a.b.we():!c&&d&&a.b.close());_.ii(a)}, hi=function(a,c){var d="gb_9b"==a.C.b;null!=c&&_.T(c,"gb_Md",d&&a.G)},Xh=function(a,c,d){var e=320+2*Math.max(c,d);c=320+c+d;return e!=c&&a.X?[{id:1,max:c},{id:2,max:e},{id:3}]:[{id:1,max:c},{id:3}]},Wh=function(a,c){if(a=_.I(c?"gb_pe":"gb_qe",a.f)){var d=a.offsetWidth;(0,_.Ca)(a.children,function(a){_.M(a,"gb_5a")&&(d-=a.offsetWidth)});return d}return 0},ji=function(a){var c=Wh(a,!0),d=Wh(a,!1);c+=d;d=a.o;var e=d.style[_.tf("min-width")];""!=("undefined"!==typeof e?e:d.style[_.Nf(d,"min-width")]|| "")&&_.Of(a.o,"min-width",c+"px")},ki=function(a){return function(){a.click()}},li=function(a){var c=_.I("gb_qe",a.f),d=[];(0,_.Ca)(_.I("gb_pe",a.f).children,function(a){d.push(a)});_.E(_.A(a.j,7),!1)&&(a=_.I("gb_Cd",a.o))&&(a=a.children[0],a.b=!0,d.push(a));(0,_.Ca)(c.children,function(a){d.push(a)});return d}; W.prototype.ua=function(){if(this.ta&&this.A){var a=li(this);a=(0,_.Da)(a,function(a){return _.M(a,"gb_yb")||_.M(a,"gb_hf")||_.M(a,"gb_Re")});var c=this.ab.b.Bd,d=!1;a.length>c&&(d=!0,c--);var e=a.length-c;if(d!=!_.M(this.Fa,"gb_5a")||e!=this.R.children){_.T(this.Fa,"gb_5a",!d);if(d)for(;this.R.firstChild;)this.R.removeChild(this.R.firstChild);mi(this,a,c);ji(this);d?this.$.j(window.document.body,bi,this.Oa,!0,this):this.$.Ga(window.document.body,bi,this.Oa,!1,this)}}}; var mi=function(a,c,d){for(var e=0;e<c.length;e++){var f=c[e];if(e>=d){_.O(f,"gb_5a");var g=void 0,h=a,l=_.vd(window.document,"LI");_.Ye(l,["gb_fe","gb_kc","gb_qc"]);_.dh(l,!0);_.sg(h.$,l,_.U,ki(f));var q=_.Q("A","gb_nc");l.appendChild(q);var r=_.Q("SPAN","gb_oc");q.appendChild(r);q=f.b?f.getAttribute("aria-label"):f.title;_.Jf(r,q);q=!1;_.M(f,"gb_hf")&&(q=!0);var w=f.children[0];q?g=w.children[0].children[0].src:f.b?g="https://www.gstatic.com/images/icons/material/system/1x/search_black_24dp.png": g=w.src;h.w=_.Q("IMG");_.Ye(h.w,["gb_pc","gb_ge"]);h.w.setAttribute("src",g);r.parentNode&&r.parentNode.insertBefore(h.w,r);a.R.appendChild(l)}else _.P(f,"gb_5a")}};W.prototype.Oa=function(a){!_.M(this.W,"gb_5a")&&a.target instanceof window.Node&&("keydown"==a.type?27==a.keyCode&&(a.preventDefault(),a.stopPropagation(),_.O(this.W,"gb_5a"),this.F().focus()):_.If(this.W,a.target)||("touchstart"==a.type&&(a.preventDefault(),a.stopPropagation()),_.O(this.W,"gb_5a")))}; W.prototype.Cb=function(){ai(this,this.C.b);this.b&&_.ni(this,this.b.Fb(),!1);this.dispatchEvent("ffc")};_.ni=function(a,c,d){a.b&&(Oh(a.b)&&(c=!1),a=window.document.body,_.T(a,"gb_be",c),_.T(a,"gb_ae",d))};W.prototype.Hb=function(){_.ni(this,!0,!0)};W.prototype.Gb=function(){_.ni(this,!1,!0)};W.prototype.Ib=function(){var a=Oh(this.b),c=this.b.b;a?_.I("gb_7d",void 0).appendChild(c):this.f.appendChild(c)};_.gi=function(a){return!!a.b&&(a.V?_.M(a.B,"gb_Vd"):a.B.parentNode!=a.A)}; W.prototype.ha=function(a){switch(a){case "back":this.Z=!0;Qh(this.b);Ph(this.b,"back");break;case "default":this.Z=!1;fi(this,this.C.b)||this.Tb?this.b&&!this.b.Ba("menu")&&(Qh(this.b),Ph(this.b,"menu")):(this.b&&this.b.Ba("back")&&Qh(this.b),this.b&&this.b.Ba("menu")?(a=this.b,a.close(),_.O(a.F(),"gb_5a"),!_.M(a.A,"gb_5a")&&_.P(a.F(),"gb_cc")):(a=_.I("gb_8b",this.f))&&_.O(a,"gb_5a"));break;case "none":this.Z=!0,Qh(this.b)}}; var fi=function(a,c){var d="gb_9b"==c;c="gb_yd"==c;var e=_.E(_.A(a.j,5),!1),f=_.E(_.A(a.j,2),!1);return!(_.E(_.A(a.j,10),!1)||a.Xa)&&f&&(d||c&&(e||a.M))};W.prototype.getHeight=function(){return this.f.offsetHeight};_.ii=function(a){var c=a.getHeight()+"px";a.yb!=c&&(a.yb=c,a.kb&&(a.kb.style.height=c),a.dispatchEvent("resize"))};W.prototype.Vb=function(){this.L&&_.ii(this)}; W.prototype.Ka=function(){if(!this.L){var a=_.vd(window.document,"DIV");_.Ye(a,["gb_zd","gb_0d"]);var c=this.J[0];c=c.classList.contains("gb_2d")?1:c.classList.contains("gb_1d")?2:0;oi(a,c);a.style.backgroundColor=this.J[0].style.backgroundColor;this.J.push(a);c=this.A;c.parentNode&&c.parentNode.insertBefore(a,c.nextSibling);this.L=a}return this.L};W.prototype.Xb=function(){_.Hf(this.L);this.L=null;_.ii(this)};_.pi=function(a,c){a.A&&a.A.appendChild(c)}; W.prototype.Nd=function(a){for(var c=0;c<this.J.length;c++)oi(this.J[c],a)};var oi=function(a,c){_.Ze(a,["gb_1d","gb_2d"]);1==c?_.O(a,"gb_2d"):2==c&&_.O(a,"gb_1d")};W.prototype.Ld=function(a){for(var c=0;c<this.J.length;c++)this.J[c].style.backgroundColor=a};W.prototype.ma=function(){var a=_.Uc("dd");a.b&&a.b.close();a.b=null};W.prototype.Md=function(a){if(null==this.o)throw Error("H");if(this.X)throw Error("I");if(8>a)throw Error("J");this.hb=a;ei(this)}; var ei=function(a){null!=a.D&&("gb_9b"==a.C.b?_.Of(a.D,"min-width",""):null!=a.hb&&_.Of(a.D,"min-width",a.hb-8+"px"))};W.prototype.wa=function(a){_.T(_.I("gb_1b",this.A),"gb_5a",!a)};var ci=function(a,c){a.G&&(null!=a.D&&_.T(a.D,"gb_Ld",c),null!=a.S&&_.T(a.S,"gb_5a",c||!a.M))};W.prototype.Lc=function(a){if(a){var c=_.I("gb_Fa");null!=c&&_.Pg(c,a);_.G.ra().j.then(function(c){c.If(a)})}}; var qi;var ri=_.I("gb_rc"); if(null==ri)qi=null;else{var si=_.C(_.mc,Sg,6)||new Sg,ti=new W(ri,si,_.H,_.I("gb_xd"));_.t("gbar.P",W);W.prototype.pa=W.prototype.getHeight;W.prototype.pb=W.prototype.Pi;W.prototype.pc=W.prototype.Nd;W.prototype.pd=W.prototype.Ld;W.prototype.pe=W.prototype.Ka;W.prototype.pf=W.prototype.Vb;W.prototype.pg=W.prototype.Xb;W.prototype.ph=W.prototype.Mg;W.prototype.pi=W.prototype.ma;W.prototype.pj=W.prototype.Md;W.prototype.pk=W.prototype.wa;W.prototype.pl=W.prototype.Lc;W.prototype.pm=W.prototype.ha; _.ee(_.G.ra().b,ti);qi=ti}_.X=qi; }catch(e){_._DumpException(e)} /* _Module_:qaid */ try{ var ui=window.document.querySelector(".gb_eb .gb_b");ui&&_.Oc(_.wc,ui,"click"); }catch(e){_._DumpException(e)} /* _Module_:qalo */ try{ (function(){for(var a=window.document.querySelectorAll(".gb_4b"),c=0;c<a.length;c++)_.Oc(_.wc,a[c],"click");_.G.ra().b.then(function(a){if(a){var c=_.I("gb_1b",a.A);c&&(c=new _.Lg(c,_.H,_.vc),a.Oi(c))}})})(); }catch(e){_._DumpException(e)} /* _Module_:qano */ try{ var vi=window.document.querySelector(".gb_Cc");if(vi){var wi=vi.querySelector(".gb_b");wi&&_.Oc(_.wc,wi,"click")}; }catch(e){_._DumpException(e)} /* _GlobalSuffix_ */ })(this.gbar_); // Google Inc.   if (window.parent !== window) document.querySelector('.dxu4Dd').style.display = 'none';CD4 1551-04Lisa DunphySelect themeUpload photoDue ThursdayEssay OutlineView allTopicsGeneral InfoRenameDeleteAdd topicStreamShow deleted itemsTopics (1)Topics (1)General InfoRenameDeleteAdd topicAssignment: "Essay Outline"Lisa DunphyCreated 11:25 AM11:25 AM – DeletedNot done This assignment is visible to all teachers in this class. It will be permanently deleted in 30 days.Due Oct 5Essay OutlineOpenGrease Essay OutlineGoogle DocsAdd class comment…Add class comment…CancelPostAnnouncement: "Class Policies- please print out, sign…"Lisa DunphyCreated Sep 6Sep 6 (Edited Sep 6) – Deleted This post is visible to all teachers in this class. It will be permanently deleted in 7 days.General InfoClass Policies- please print out, sign and return by 9/15.Media Literacy ~ Class PoliciesGoogle DocsAdd class comment…Assignment: "Movie Permission Form"Lisa DunphyCreated Sep 6Sep 6 – DeletedDone late This assignment is visible to all teachers in this class. It will be permanently deleted in 7 days.General InfoDue Sep 15Movie Permission FormPlease print out, have parent/guardian sign and returnOpenMovie Permission 2017-18Google DocsAdd class comment…Announcement: "Syllabus- subject to change"Lisa DunphyCreated Sep 6Sep 6 – Deleted This post is visible to all teachers in this class. It will be permanently deleted in 7 days.General InfoSyllabus- subject to changeSyllabus 2017-2018Google DocsAdd class comment…Due Oct 5Essay Outline Lisa Dunphy 11:25 AM Add class comment  Grease Essay OutlineGoogle DocsYour workNot doneFiles you add or create can be viewed and edited by your teacherMark as done or attach work to turn inNo work attachedAddGoogle DriveLinkFileCreateMark as donePrivate commentsAdd private comment…Main menu/* _GlobalPrefix_ */ this.gbar_=this.gbar_||{};(function(_){var window=this; /* _Module_:qebr */ try{ if(_.X){var xi;if(xi=_.A(_.X.j,3))for(var yi=_.Xg(xi),zi=0;zi<yi.length;zi++)_.jh(yi[zi],"ogpc","");_.ni(_.X,!!_.X.b&&_.X.b.Fb(),!1)}; }catch(e){_._DumpException(e)} /* _Module_:qein */ try{ var Ai=function(a){_.z(this,a,0,-1,null)};_.u(Ai,_.y);var Bi=function(a){_.z(this,a,0,-1,null)};_.u(Bi,_.y);var Ci=function(a){_.ad("From proto message. b/12014412");a=_.A(a,4)||"";return _.ed(a)};var Di=_.C(_.mc,Bi,17)||new Bi,Ei=_.C(Di,Ai,1),Fi=Ei?Ci(Ei):null,Gi=_.C(Di,Ai,2),Hi=Gi?Ci(Gi):null,Ii=function(a,c,d){_.vc.log(46,{att:a,max:c,url:d})},Ki=function(a,c,d){_.vc.log(47,{att:a,max:c,url:d});a<c?Ji(a+1,c):_.H.log(Error("K`"+a+"`"+c),{url:d})},Ji=function(a,c){if(Fi){var d=_.vd(window.document,"SCRIPT");d.async=!0;d.type="text/javascript";d.charset="UTF-8";d.src=_.dd(Fi);d.onload=_.Qc(Ii,a,c,d.src);d.onerror=_.Qc(Ki,a,c,d.src);_.vc.log(45,{att:a,max:c,url:d.src});_.td("HEAD")[0].appendChild(d)}}; Ji(1,2);if(Hi){var Li=_.vd(window.document,"LINK");Li.setAttribute("type","text/css");Li.rel="stylesheet";Li.href=_.dd(Hi);_.td("HEAD")[0].appendChild(Li)}; }catch(e){_._DumpException(e)} /* _GlobalSuffix_ */ })(this.gbar_); // Google Inc. Google appsNotificationsGoogle AccountEvan Liaoeliao20@medford.k12.ma.us

      this class is very special

    2. CD4 1551-04 Class is archived. Restore it to add or edit anything.Class has been archived by your teacher. You can't add or edit anything.RestoreStream was updatedShowClass is archived. Restore it to add or edit anything.Class has been archived by your teacher. You can't add or edit anything.RestoreYou're invited to teach this classAcceptYou're invited to teach this classAccept CD41551-04 ClassroomStreamClassmatesAboutMy AccountSearchMailCalendarDriveDocsSheetsSlidesSitesGroupsContactsClassroomMeetMoreMapsNewsPhotosVaultFormsKeepCloud SearchMore from Apps Marketplace0This account is managed by medford.k12.ma.us.Learn moreChangeEvan Liaoeliao20@medford.k12.ma.usPrivacyMy AccountEvan Liaoeliao20@medford.k12.ma.us (default)All your Brand Accounts »Add accountSign out/* _GlobalPrefix_ */ this.gbar_=this.gbar_||{};(function(_){var window=this; /* _Module_:syh */ try{ _.Oc=function(a,c,d){if(!a.f)if(d instanceof Array)for(var e in d)_.Oc(a,c,d[e]);else{e=(0,_.p)(a.B,a,c);var f=a.w+d;a.w++;c.setAttribute("data-eqid",f);a.o[f]=e;c&&c.addEventListener?c.addEventListener(d,e,!1):c&&c.attachEvent?c.attachEvent("on"+d,e):a.A.log(Error("d`"+c))}}; }catch(e){_._DumpException(e)} /* _Module_:qaaw */ try{ var Pc=window.document.querySelector(".gb_da .gb_b");Pc&&_.Oc(_.wc,Pc,"click"); }catch(e){_._DumpException(e)} /* _Module_:syk */ try{ _.Qc=function(a,c){var d=Array.prototype.slice.call(arguments,1);return function(){var c=d.slice();c.push.apply(c,arguments);return a.apply(this,c)}};_.Rc=function(a,c){return 0==a.lastIndexOf(c,0)}; }catch(e){_._DumpException(e)} /* _Module_:syj */ try{ _.Sc=function(a){var c=_.ka(a);return"array"==c||"object"==c&&"number"==typeof a.length};_.Tc=function(a){var c=a.length;if(0<c){for(var d=Array(c),e=0;e<c;e++)d[e]=a[e];return d}return[]};_.Uc=function(a){return _.ac(_.Xb.ra(),a)};_.Vc=!_.x||_.pb(9);_.Wc=!_.Ya&&!_.x||_.x&&_.pb(9)||_.Ya&&_.nb("1.9.1");_.Xc=_.x&&!_.nb("9");_.Yc=_.x||_.Va||_.Za; _.$c=function(){this.b="";this.f=_.Zc};_.$c.prototype.Ob=!0;_.$c.prototype.Ab=function(){return this.b};_.$c.prototype.toString=function(){return"Const{"+this.b+"}"};_.Zc={};_.ad=function(a){var c=new _.$c;c.b=a;return c};_.ad("");var bd;_.cd=function(){this.b="";this.f=bd};_.cd.prototype.Ob=!0;_.cd.prototype.Ab=function(){return this.b};_.cd.prototype.le=!0;_.cd.prototype.Bc=function(){return 1};_.dd=function(a){if(a instanceof _.cd&&a.constructor===_.cd&&a.f===bd)return a.b;_.ka(a);return"type_error:TrustedResourceUrl"};bd={};_.ed=function(a){var c=new _.cd;c.b=a;return c}; _.gd=function(){this.b="";this.f=_.fd};_.gd.prototype.Ob=!0;_.gd.prototype.Ab=function(){return this.b};_.gd.prototype.le=!0;_.gd.prototype.Bc=function(){return 1};_.hd=/^(?:(?:https?|mailto|ftp):|[^:/?#]*(?:[/?#]|$))/i;_.fd={};_.id=function(a){var c=new _.gd;c.b=a;return c};_.id("about:blank"); _.kd=function(){this.b="";this.f=_.jd};_.kd.prototype.Ob=!0;_.jd={};_.kd.prototype.Ab=function(){return this.b};_.ld=function(a){var c=new _.kd;c.b=a;return c};_.md=_.ld("");_.od=function(){this.b="";this.j=_.nd;this.f=null};_.od.prototype.le=!0;_.od.prototype.Bc=function(){return this.f};_.od.prototype.Ob=!0;_.od.prototype.Ab=function(){return this.b};_.nd={};_.pd=function(a,c){var d=new _.od;d.b=a;d.f=c;return d};_.pd("<!DOCTYPE html>",0);_.qd=_.pd("",0);_.rd=_.pd("<br>",0); _.sd=function(a,c){return _.n(c)?a.getElementById(c):c};_.td=function(a,c){return(c||window.document).getElementsByTagName(String(a))};_.I=function(a,c){var d=c||window.document;if(d.getElementsByClassName)a=d.getElementsByClassName(a)[0];else{d=window.document;var e=c||d;a=e.querySelectorAll&&e.querySelector&&a?e.querySelector(""+(a?"."+a:"")):_.ud(d,a,c)[0]||null}return a||null}; _.ud=function(a,c,d){var e;a=d||a;if(a.querySelectorAll&&a.querySelector&&c)return a.querySelectorAll(""+(c?"."+c:""));if(c&&a.getElementsByClassName){var f=a.getElementsByClassName(c);return f}f=a.getElementsByTagName("*");if(c){var g={};for(d=e=0;a=f[d];d++){var h=a.className;"function"==typeof h.split&&_.Ga(h.split(/\s+/),c)&&(g[e++]=a)}g.length=e;return g}return f};_.vd=function(a,c){return a.createElement(String(c))}; }catch(e){_._DumpException(e)} /* _Module_:syi */ try{ var wd,yd;wd=function(a){var c=arguments.length;if(1==c&&_.la(arguments[0]))return wd.apply(null,arguments[0]);for(var d={},e=0;e<c;e++)d[arguments[e]]=!0;return d};_.xd=function(a){return _.na(a)&&1==a.nodeType};wd("A AREA BUTTON HEAD INPUT LINK MENU META OPTGROUP OPTION PROGRESS STYLE SELECT SOURCE TEXTAREA TITLE TRACK".split(" "));_.zd=function(a,c){c?a.setAttribute("role",c):a.removeAttribute("role")}; _.J=function(a,c,d){_.la(d)&&(d=d.join(" "));var e="aria-"+c;""===d||void 0==d?(yd||(yd={atomic:!1,autocomplete:"none",dropeffect:"none",haspopup:!1,live:"off",multiline:!1,multiselectable:!1,orientation:"vertical",readonly:!1,relevant:"additions text",required:!1,sort:"none",busy:!1,disabled:!1,hidden:!1,invalid:"false"}),d=yd,c in d?a.setAttribute(e,d[c]):a.removeAttribute(e)):a.setAttribute(e,d)}; }catch(e){_._DumpException(e)} /* _Module_:syl */ try{ var Bd;_.Ad=function(a,c){c=(0,_.Ba)(a,c);var d;(d=0<=c)&&Array.prototype.splice.call(a,c,1);return d};Bd=function(a,c){for(var d in a)if(c.call(void 0,a[d],d,a))return!0;return!1};_.Cd=function(a,c){try{return _.Sa(a[c]),!0}catch(d){}return!1};_.Dd=function(a,c){this.type=a;this.b=this.target=c;this.j=!1;this.Kf=!0};_.Dd.prototype.stopPropagation=function(){this.j=!0};_.Dd.prototype.preventDefault=function(){this.Kf=!1};_.Ed=function(a,c){_.Dd.call(this,a?a.type:"");this.relatedTarget=this.b=this.target=null;this.button=this.screenY=this.screenX=this.clientY=this.clientX=0;this.key="";this.f=this.keyCode=0;this.metaKey=this.shiftKey=this.altKey=this.ctrlKey=!1;this.state=null;this.pointerId=0;this.pointerType="";this.lb=null;a&&this.init(a,c)};_.u(_.Ed,_.Dd);var Fd={2:"touch",3:"pen",4:"mouse"}; _.Ed.prototype.init=function(a,c){var d=this.type=a.type,e=a.changedTouches?a.changedTouches[0]:null;this.target=a.target||a.srcElement;this.b=c;(c=a.relatedTarget)?_.Ya&&(_.Cd(c,"nodeName")||(c=null)):"mouseover"==d?c=a.fromElement:"mouseout"==d&&(c=a.toElement);this.relatedTarget=c;null===e?(this.clientX=void 0!==a.clientX?a.clientX:a.pageX,this.clientY=void 0!==a.clientY?a.clientY:a.pageY,this.screenX=a.screenX||0,this.screenY=a.screenY||0):(this.clientX=void 0!==e.clientX?e.clientX:e.pageX,this.clientY= void 0!==e.clientY?e.clientY:e.pageY,this.screenX=e.screenX||0,this.screenY=e.screenY||0);this.button=a.button;this.keyCode=a.keyCode||0;this.key=a.key||"";this.f=a.charCode||("keypress"==d?a.keyCode:0);this.ctrlKey=a.ctrlKey;this.altKey=a.altKey;this.shiftKey=a.shiftKey;this.metaKey=a.metaKey;this.pointerId=a.pointerId||0;this.pointerType=_.n(a.pointerType)?a.pointerType:Fd[a.pointerType]||"";this.state=a.state;this.lb=a;a.defaultPrevented&&this.preventDefault()}; _.Ed.prototype.stopPropagation=function(){_.Ed.H.stopPropagation.call(this);this.lb.stopPropagation?this.lb.stopPropagation():this.lb.cancelBubble=!0};_.Ed.prototype.preventDefault=function(){_.Ed.H.preventDefault.call(this);var a=this.lb;if(a.preventDefault)a.preventDefault();else if(a.returnValue=!1,_.Cc)try{if(a.ctrlKey||112<=a.keyCode&&123>=a.keyCode)a.keyCode=-1}catch(c){}}; var Id;_.Gd="closure_listenable_"+(1E6*Math.random()|0);_.Hd=function(a){return!(!a||!a[_.Gd])};Id=0;var Jd;Jd=function(a,c,d,e,f){this.listener=a;this.b=null;this.src=c;this.type=d;this.capture=!!e;this.xd=f;this.key=++Id;this.Ic=this.kd=!1};_.Kd=function(a){a.Ic=!0;a.listener=null;a.b=null;a.src=null;a.xd=null};_.Ld=function(a){this.src=a;this.b={};this.f=0};_.Nd=function(a,c,d,e,f,g){var h=c.toString();c=a.b[h];c||(c=a.b[h]=[],a.f++);var l=Md(c,d,f,g);-1<l?(a=c[l],e||(a.kd=!1)):(a=new Jd(d,a.src,h,!!f,g),a.kd=e,c.push(a));return a};_.Ld.prototype.remove=function(a,c,d,e){a=a.toString();if(!(a in this.b))return!1;var f=this.b[a];c=Md(f,c,d,e);return-1<c?(_.Kd(f[c]),Array.prototype.splice.call(f,c,1),0==f.length&&(delete this.b[a],this.f--),!0):!1}; _.Od=function(a,c){var d=c.type;if(!(d in a.b))return!1;var e=_.Ad(a.b[d],c);e&&(_.Kd(c),0==a.b[d].length&&(delete a.b[d],a.f--));return e};_.Ld.prototype.Cc=function(a,c){a=this.b[a.toString()];var d=[];if(a)for(var e=0;e<a.length;++e){var f=a[e];f.capture==c&&d.push(f)}return d};_.Ld.prototype.bc=function(a,c,d,e){a=this.b[a.toString()];var f=-1;a&&(f=Md(a,c,d,e));return-1<f?a[f]:null}; _.Ld.prototype.hasListener=function(a,c){var d=_.ea(a),e=d?a.toString():"",f=_.ea(c);return Bd(this.b,function(a){for(var g=0;g<a.length;++g)if(!(d&&a[g].type!=e||f&&a[g].capture!=c))return!0;return!1})};var Md=function(a,c,d,e){for(var f=0;f<a.length;++f){var g=a[f];if(!g.Ic&&g.listener==c&&g.capture==!!d&&g.xd==e)return f}return-1}; var Pd,Qd,Rd,Ud,Wd,Xd,ae,Yd,ce;Pd="closure_lm_"+(1E6*Math.random()|0);Qd={};Rd=0;_.K=function(a,c,d,e,f){if(e&&e.once)return _.Sd(a,c,d,e,f);if(_.la(c)){for(var g=0;g<c.length;g++)_.K(a,c[g],d,e,f);return null}d=_.Td(d);return _.Hd(a)?a.K(c,d,_.na(e)?!!e.capture:!!e,f):Ud(a,c,d,!1,e,f)}; Ud=function(a,c,d,e,f,g){if(!c)throw Error("n");var h=_.na(f)?!!f.capture:!!f,l=_.Vd(a);l||(a[Pd]=l=new _.Ld(a));d=_.Nd(l,c,d,e,h,g);if(d.b)return d;e=Wd();d.b=e;e.src=a;e.listener=d;if(a.addEventListener)_.Dc||(f=h),void 0===f&&(f=!1),a.addEventListener(c.toString(),e,f);else if(a.attachEvent)a.attachEvent(Xd(c.toString()),e);else throw Error("o");Rd++;return d};Wd=function(){var a=Yd,c=_.Bc?function(d){return a.call(c.src,c.listener,d)}:function(d){d=a.call(c.src,c.listener,d);if(!d)return d};return c}; _.Sd=function(a,c,d,e,f){if(_.la(c)){for(var g=0;g<c.length;g++)_.Sd(a,c[g],d,e,f);return null}d=_.Td(d);return _.Hd(a)?a.tb(c,d,_.na(e)?!!e.capture:!!e,f):Ud(a,c,d,!0,e,f)};_.Zd=function(a,c,d,e,f){if(_.la(c))for(var g=0;g<c.length;g++)_.Zd(a,c[g],d,e,f);else e=_.na(e)?!!e.capture:!!e,d=_.Td(d),_.Hd(a)?a.Ga(c,d,e,f):a&&(a=_.Vd(a))&&(c=a.bc(c,d,e,f))&&_.$d(c)}; _.$d=function(a){if(_.fa(a)||!a||a.Ic)return!1;var c=a.src;if(_.Hd(c))return c.Kd(a);var d=a.type,e=a.b;c.removeEventListener?c.removeEventListener(d,e,a.capture):c.detachEvent&&c.detachEvent(Xd(d),e);Rd--;(d=_.Vd(c))?(_.Od(d,a),0==d.f&&(d.src=null,c[Pd]=null)):_.Kd(a);return!0};Xd=function(a){return a in Qd?Qd[a]:Qd[a]="on"+a};_.be=function(a,c,d,e){var f=!0;if(a=_.Vd(a))if(c=a.b[c.toString()])for(c=c.concat(),a=0;a<c.length;a++){var g=c[a];g&&g.capture==d&&!g.Ic&&(g=ae(g,e),f=f&&!1!==g)}return f}; ae=function(a,c){var d=a.listener,e=a.xd||a.src;a.kd&&_.$d(a);return d.call(e,c)}; Yd=function(a,c){if(a.Ic)return!0;if(!_.Bc){var d=c||_.ha("window.event");c=new _.Ed(d,this);var e=!0;if(!(0>d.keyCode||void 0!=d.returnValue)){a:{var f=!1;if(0==d.keyCode)try{d.keyCode=-1;break a}catch(h){f=!0}if(f||void 0==d.returnValue)d.returnValue=!0}d=[];for(f=c.b;f;f=f.parentNode)d.push(f);a=a.type;for(f=d.length-1;!c.j&&0<=f;f--){c.b=d[f];var g=_.be(d[f],a,!0,c);e=e&&g}for(f=0;!c.j&&f<d.length;f++)c.b=d[f],g=_.be(d[f],a,!1,c),e=e&&g}return e}return ae(a,new _.Ed(c,this))}; _.Vd=function(a){a=a[Pd];return a instanceof _.Ld?a:null};ce="__closure_events_fn_"+(1E9*Math.random()>>>0);_.Td=function(a){if(_.ma(a))return a;a[ce]||(a[ce]=function(c){return a.handleEvent(c)});return a[ce]}; }catch(e){_._DumpException(e)} /* _Module_:syo */ try{ _.de=function(a,c,d){return 2>=arguments.length?Array.prototype.slice.call(a,c):Array.prototype.slice.call(a,c,d)};_.L=function(){_.D.call(this);this.Eb=new _.Ld(this);this.Zf=this;this.Ae=null};_.u(_.L,_.D);_.L.prototype[_.Gd]=!0;_.k=_.L.prototype;_.k.Nc=function(){return this.Ae};_.k.vc=function(a){this.Ae=a};_.k.addEventListener=function(a,c,d,e){_.K(this,a,c,d,e)};_.k.removeEventListener=function(a,c,d,e){_.Zd(this,a,c,d,e)}; _.k.dispatchEvent=function(a){var c,d=this.Nc();if(d)for(c=[];d;d=d.Nc())c.push(d);d=this.Zf;var e=a.type||a;if(_.n(a))a=new _.Dd(a,d);else if(a instanceof _.Dd)a.target=a.target||d;else{var f=a;a=new _.Dd(e,d);_.Ma(a,f)}f=!0;if(c)for(var g=c.length-1;!a.j&&0<=g;g--){var h=a.b=c[g];f=h.$b(e,!0,a)&&f}a.j||(h=a.b=d,f=h.$b(e,!0,a)&&f,a.j||(f=h.$b(e,!1,a)&&f));if(c)for(g=0;!a.j&&g<c.length;g++)h=a.b=c[g],f=h.$b(e,!1,a)&&f;return f};_.k.N=function(){_.L.H.N.call(this);this.Ed();this.Ae=null}; _.k.K=function(a,c,d,e){return _.Nd(this.Eb,String(a),c,!1,d,e)};_.k.tb=function(a,c,d,e){return _.Nd(this.Eb,String(a),c,!0,d,e)};_.k.Ga=function(a,c,d,e){return this.Eb.remove(String(a),c,d,e)};_.k.Kd=function(a){return _.Od(this.Eb,a)};_.k.Ed=function(a){if(this.Eb){var c=this.Eb;a=a&&a.toString();var d=0,e;for(e in c.b)if(!a||e==a){for(var f=c.b[e],g=0;g<f.length;g++)++d,_.Kd(f[g]);delete c.b[e];c.f--}c=d}else c=0;return c}; _.k.$b=function(a,c,d){a=this.Eb.b[String(a)];if(!a)return!0;a=a.concat();for(var e=!0,f=0;f<a.length;++f){var g=a[f];if(g&&!g.Ic&&g.capture==c){var h=g.listener,l=g.xd||g.src;g.kd&&this.Kd(g);e=!1!==h.call(l,d)&&e}}return e&&0!=d.Kf};_.k.Cc=function(a,c){return this.Eb.Cc(String(a),c)};_.k.bc=function(a,c,d,e){return this.Eb.bc(String(a),c,d,e)};_.k.hasListener=function(a,c){return this.Eb.hasListener(_.ea(a)?String(a):void 0,c)}; }catch(e){_._DumpException(e)} /* _Module_:syp */ try{ var he;_.ee=function(a,c){if(void 0!==a.b||void 0!==a.f)throw Error("f");a.b=c;_.kc(a)};_.fe=function(a){return/^[\s\xa0]*$/.test(a)};_.ge=function(a){var c=[],d=0,e;for(e in a)c[d++]=a[e];return c};he=function(a,c,d){this.o=d;this.j=a;this.A=c;this.f=0;this.b=null};he.prototype.get=function(){if(0<this.f){this.f--;var a=this.b;this.b=a.next;a.next=null}else a=this.j();return a};var ie=function(a,c){a.A(c);a.f<a.o&&(a.f++,c.next=a.b,a.b=c)}; var je;je=function(a){return function(){return a}};_.ke=je(!0);_.le=je(null);_.me=function(a){return a};var ne=function(a){_.m.setTimeout(function(){throw a;},0)},oe,pe=function(){var a=_.m.MessageChannel;"undefined"===typeof a&&"undefined"!==typeof window&&window.postMessage&&window.addEventListener&&!_.v("Presto")&&(a=function(){var a=window.document.createElement("IFRAME");a.style.display="none";a.src="";window.document.documentElement.appendChild(a);var c=a.contentWindow;a=c.document;a.open();a.write("");a.close();var d="callImmediate"+Math.random(),e="file:"==c.location.protocol?"*":c.location.protocol+ "//"+c.location.host;a=(0,_.p)(function(a){if(("*"==e||a.origin==e)&&a.data==d)this.port1.onmessage()},this);c.addEventListener("message",a,!1);this.port1={};this.port2={postMessage:function(){c.postMessage(d,e)}}});if("undefined"!==typeof a&&!_.v("Trident")&&!_.v("MSIE")){var c=new a,d={},e=d;c.port1.onmessage=function(){if(_.ea(d.next)){d=d.next;var a=d.Me;d.Me=null;a()}};return function(a){e.next={Me:a};e=e.next;c.port2.postMessage(0)}}return"undefined"!==typeof window.document&&"onreadystatechange"in window.document.createElement("SCRIPT")?function(a){var c=window.document.createElement("SCRIPT");c.onreadystatechange=function(){c.onreadystatechange=null;c.parentNode.removeChild(c);c=null;a();a=null};window.document.documentElement.appendChild(c)}:function(a){_.m.setTimeout(a,0)}}; var qe=function(){this.f=this.b=null},se=new he(function(){return new re},function(a){a.reset()},100);qe.prototype.remove=function(){var a=null;this.b&&(a=this.b,this.b=this.b.next,this.b||(this.f=null),a.next=null);return a};var re=function(){this.next=this.scope=this.b=null};re.prototype.set=function(a,c){this.b=a;this.scope=c;this.next=null};re.prototype.reset=function(){this.next=this.scope=this.b=null}; var xe=function(a,c){te||ue();ve||(te(),ve=!0);var d=we,e=se.get();e.set(a,c);d.f?d.f.next=e:d.b=e;d.f=e},te,ue=function(){if(-1!=String(_.m.Promise).indexOf("[native code]")){var a=_.m.Promise.resolve(void 0);te=function(){a.then(ye)}}else te=function(){var a=ye;!_.ma(_.m.setImmediate)||_.m.Window&&_.m.Window.prototype&&!_.v("Edge")&&_.m.Window.prototype.setImmediate==_.m.setImmediate?(oe||(oe=pe()),oe(a)):_.m.setImmediate(a)}},ve=!1,we=new qe,ye=function(){for(var a;a=we.remove();){try{a.b.call(a.scope)}catch(c){ne(c)}ie(se, a)}ve=!1}; _.ze=function(a){a.prototype.then=a.prototype.then;a.prototype.$goog_Thenable=!0};_.Ae=function(a){if(!a)return!1;try{return!!a.$goog_Thenable}catch(c){return!1}};var De,Ie,Me,Ke,Pe,Oe,Qe;_.Ce=function(a,c){this.b=0;this.B=void 0;this.o=this.f=this.j=null;this.A=this.w=!1;if(a!=_.ia)try{var d=this;a.call(c,function(a){Be(d,2,a)},function(a){Be(d,3,a)})}catch(e){Be(this,3,e)}};De=function(){this.next=this.context=this.f=this.j=this.b=null;this.o=!1};De.prototype.reset=function(){this.context=this.f=this.j=this.b=null;this.o=!1};var Ee=new he(function(){return new De},function(a){a.reset()},100),Fe=function(a,c,d){var e=Ee.get();e.j=a;e.f=c;e.context=d;return e}; _.Ce.prototype.then=function(a,c,d){return _.Ge(this,_.ma(a)?a:null,_.ma(c)?c:null,d)};_.ze(_.Ce);_.Ce.prototype.cancel=function(a){0==this.b&&xe(function(){var c=new _.He(a);Ie(this,c)},this)};Ie=function(a,c){if(0==a.b)if(a.j){var d=a.j;if(d.f){for(var e=0,f=null,g=null,h=d.f;h&&(h.o||(e++,h.b==a&&(f=h),!(f&&1<e)));h=h.next)f||(g=h);f&&(0==d.b&&1==e?Ie(d,c):(g?(e=g,e.next==d.o&&(d.o=e),e.next=e.next.next):Je(d),Ke(d,f,3,c)))}a.j=null}else Be(a,3,c)}; Me=function(a,c){a.f||2!=a.b&&3!=a.b||Le(a);a.o?a.o.next=c:a.f=c;a.o=c};_.Ge=function(a,c,d,e){var f=Fe(null,null,null);f.b=new _.Ce(function(a,h){f.j=c?function(d){try{var f=c.call(e,d);a(f)}catch(r){h(r)}}:a;f.f=d?function(c){try{var f=d.call(e,c);!_.ea(f)&&c instanceof _.He?h(c):a(f)}catch(r){h(r)}}:h});f.b.j=a;Me(a,f);return f.b};_.Ce.prototype.D=function(a){this.b=0;Be(this,2,a)};_.Ce.prototype.G=function(a){this.b=0;Be(this,3,a)}; var Be=function(a,c,d){if(0==a.b){a===d&&(c=3,d=new TypeError("Promise cannot resolve to itself"));a.b=1;a:{var e=d,f=a.D,g=a.G;if(e instanceof _.Ce){Me(e,Fe(f||_.ia,g||null,a));var h=!0}else if(_.Ae(e))e.then(f,g,a),h=!0;else{if(_.na(e))try{var l=e.then;if(_.ma(l)){Ne(e,l,f,g,a);h=!0;break a}}catch(q){g.call(a,q);h=!0;break a}h=!1}}h||(a.B=d,a.b=c,a.j=null,Le(a),3!=c||d instanceof _.He||Oe(a,d))}},Ne=function(a,c,d,e,f){var g=!1,h=function(a){g||(g=!0,d.call(f,a))},l=function(a){g||(g=!0,e.call(f, a))};try{c.call(a,h,l)}catch(q){l(q)}},Le=function(a){a.w||(a.w=!0,xe(a.C,a))},Je=function(a){var c=null;a.f&&(c=a.f,a.f=c.next,c.next=null);a.f||(a.o=null);return c};_.Ce.prototype.C=function(){for(var a;a=Je(this);)Ke(this,a,this.b,this.B);this.w=!1};Ke=function(a,c,d,e){if(3==d&&c.f&&!c.o)for(;a&&a.A;a=a.j)a.A=!1;if(c.b)c.b.j=null,Pe(c,d,e);else try{c.o?c.j.call(c.context):Pe(c,d,e)}catch(f){Qe.call(null,f)}ie(Ee,c)};Pe=function(a,c,d){2==c?a.j.call(a.context,d):a.f&&a.f.call(a.context,d)}; Oe=function(a,c){a.A=!0;xe(function(){a.A&&Qe.call(null,c)})};Qe=ne;_.He=function(a){_.va.call(this,a)};_.u(_.He,_.va);_.He.prototype.name="cancel"; }catch(e){_._DumpException(e)} /* _Module_:syq */ try{ var Te;_.Re=function(a){a&&"function"==typeof a.ka&&a.ka()};_.Se=function(a,c){c=_.Qc(_.Re,c);a.La?_.ea(void 0)?c.call(void 0):c():(a.Lb||(a.Lb=[]),a.Lb.push(_.ea(void 0)?(0,_.p)(c,void 0):c))};Te=0;_.Ue=function(a){return a[_.oa]||(a[_.oa]=++Te)};_.Ve=function(a,c){_.L.call(this);this.f=a||1;this.b=c||_.m;this.j=(0,_.p)(this.Ti,this);this.o=(0,_.ta)()};_.u(_.Ve,_.L);_.k=_.Ve.prototype;_.k.enabled=!1;_.k.nb=null; _.k.Ti=function(){if(this.enabled){var a=(0,_.ta)()-this.o;0<a&&a<.8*this.f?this.nb=this.b.setTimeout(this.j,this.f-a):(this.nb&&(this.b.clearTimeout(this.nb),this.nb=null),this.dispatchEvent("tick"),this.enabled&&(this.nb=this.b.setTimeout(this.j,this.f),this.o=(0,_.ta)()))}};_.k.start=function(){this.enabled=!0;this.nb||(this.nb=this.b.setTimeout(this.j,this.f),this.o=(0,_.ta)())};_.k.stop=function(){this.enabled=!1;this.nb&&(this.b.clearTimeout(this.nb),this.nb=null)}; _.k.N=function(){_.Ve.H.N.call(this);this.stop();delete this.b};_.We=function(a,c,d){if(_.ma(a))d&&(a=(0,_.p)(a,d));else if(a&&"function"==typeof a.handleEvent)a=(0,_.p)(a.handleEvent,a);else throw Error("p");return 2147483647<Number(c)?-1:_.m.setTimeout(a,c||0)}; }catch(e){_._DumpException(e)} /* _Module_:syu */ try{ var Xe;Xe=function(a){if(a.classList)return a.classList;a=a.className;return _.n(a)&&a.match(/\S+/g)||[]};_.M=function(a,c){return a.classList?a.classList.contains(c):_.Ga(Xe(a),c)};_.O=function(a,c){a.classList?a.classList.add(c):_.M(a,c)||(a.className+=0<a.className.length?" "+c:c)}; _.Ye=function(a,c){if(a.classList)(0,_.Ca)(c,function(c){_.O(a,c)});else{var d={};(0,_.Ca)(Xe(a),function(a){d[a]=!0});(0,_.Ca)(c,function(a){d[a]=!0});a.className="";for(var e in d)a.className+=0<a.className.length?" "+e:e}};_.P=function(a,c){a.classList?a.classList.remove(c):_.M(a,c)&&(a.className=(0,_.Da)(Xe(a),function(a){return a!=c}).join(" "))};_.Ze=function(a,c){a.classList?(0,_.Ca)(c,function(c){_.P(a,c)}):a.className=(0,_.Da)(Xe(a),function(a){return!_.Ga(c,a)}).join(" ")}; _.$e=function(a){_.D.call(this);this.W=a;this.O={}};_.u(_.$e,_.D);var af=[];_.$e.prototype.K=function(a,c,d,e){return bf(this,a,c,d,e)};_.$e.prototype.j=function(a,c,d,e,f){return bf(this,a,c,d,e,f)};var bf=function(a,c,d,e,f,g){_.la(d)||(d&&(af[0]=d.toString()),d=af);for(var h=0;h<d.length;h++){var l=_.K(c,d[h],e||a.handleEvent,f||!1,g||a.W||a);if(!l)break;a.O[l.key]=l}return a};_.$e.prototype.tb=function(a,c,d,e){return cf(this,a,c,d,e)}; var cf=function(a,c,d,e,f,g){if(_.la(d))for(var h=0;h<d.length;h++)cf(a,c,d[h],e,f,g);else{c=_.Sd(c,d,e||a.handleEvent,f,g||a.W||a);if(!c)return a;a.O[c.key]=c}return a};_.$e.prototype.Ga=function(a,c,d,e,f){if(_.la(c))for(var g=0;g<c.length;g++)this.Ga(a,c[g],d,e,f);else d=d||this.handleEvent,e=_.na(e)?!!e.capture:!!e,f=f||this.W||this,d=_.Td(d),e=!!e,c=_.Hd(a)?a.bc(c,d,e,f):a?(a=_.Vd(a))?a.bc(c,d,e,f):null:null,c&&(_.$d(c),delete this.O[c.key]);return this}; _.df=function(a){_.Ka(a.O,function(a,d){this.O.hasOwnProperty(d)&&_.$d(a)},a);a.O={}};_.$e.prototype.N=function(){_.$e.H.N.call(this);_.df(this)};_.$e.prototype.handleEvent=function(){throw Error("q");}; var hf;_.gf=function(a,c,d,e,f,g){if(!(_.x||_.Wa||_.Za&&_.nb("525")))return!0;if(_.$a&&f)return _.ef(a);if(f&&!e)return!1;_.fa(c)&&(c=_.ff(c));f=17==c||18==c||_.$a&&91==c;if((!d||_.$a)&&f||_.$a&&16==c&&(e||g))return!1;if((_.Za||_.Wa)&&e&&d)switch(a){case 220:case 219:case 221:case 192:case 186:case 189:case 187:case 188:case 190:case 191:case 192:case 222:return!1}if(_.x&&e&&c==a)return!1;switch(a){case 13:return!0;case 27:return!(_.Za||_.Wa)}return _.ef(a)}; _.ef=function(a){if(48<=a&&57>=a||96<=a&&106>=a||65<=a&&90>=a||(_.Za||_.Wa)&&0==a)return!0;switch(a){case 32:case 43:case 63:case 64:case 107:case 109:case 110:case 111:case 186:case 59:case 189:case 187:case 61:case 188:case 190:case 191:case 192:case 222:case 219:case 220:case 221:return!0;default:return!1}};_.ff=function(a){if(_.Ya)a=hf(a);else if(_.$a&&_.Za)switch(a){case 93:a=91}return a}; hf=function(a){switch(a){case 61:return 187;case 59:return 186;case 173:return 189;case 224:return 91;case 0:return 224;default:return a}}; }catch(e){_._DumpException(e)} /* _Module_:syw */ try{ var jf,kf,lf,mf,nf,of,pf,qf,uf,zf,Df,Ff;kf=/&/g;lf=/</g;mf=/>/g;nf=/"/g;of=/'/g;pf=/\x00/g;qf=/[\x00&<>"']/;_.rf=function(a){if(!qf.test(a))return a;-1!=a.indexOf("&")&&(a=a.replace(kf,"&amp;"));-1!=a.indexOf("<")&&(a=a.replace(lf,"&lt;"));-1!=a.indexOf(">")&&(a=a.replace(mf,"&gt;"));-1!=a.indexOf('"')&&(a=a.replace(nf,"&quot;"));-1!=a.indexOf("'")&&(a=a.replace(of,"&#39;"));-1!=a.indexOf("\x00")&&(a=a.replace(pf,"&#0;"));return a}; _.sf=function(a){return String(a).replace(/([-()\[\]{}+?*.$\^|,:#<!\\])/g,"\\$1").replace(/\x08/g,"\\x08")};_.tf=function(a){return String(a).replace(/\-([a-z])/g,function(a,d){return d.toUpperCase()})};uf=function(a){var c=_.n(void 0)?_.sf(void 0):"\\s";return a.replace(new RegExp("(^"+(c?"|["+c+"]+":"")+")([a-z])","g"),function(a,c,f){return c+f.toUpperCase()})};_.vf=function(a,c){this.width=a;this.height=c};_.wf=function(a){return new _.vf(a.width,a.height)};_.k=_.vf.prototype; _.k.ag=function(){return this.width*this.height};_.k.aspectRatio=function(){return this.width/this.height};_.k.nc=function(){return!this.ag()};_.k.ceil=function(){this.width=Math.ceil(this.width);this.height=Math.ceil(this.height);return this};_.k.floor=function(){this.width=Math.floor(this.width);this.height=Math.floor(this.height);return this};_.k.round=function(){this.width=Math.round(this.width);this.height=Math.round(this.height);return this}; _.xf=function(a,c){return a==c?!0:a&&c?a.width==c.width&&a.height==c.height:!1};_.yf=function(a){return 9==a.nodeType?a:a.ownerDocument||a.document};zf={cellpadding:"cellPadding",cellspacing:"cellSpacing",colspan:"colSpan",frameborder:"frameBorder",height:"height",maxlength:"maxLength",nonce:"nonce",role:"role",rowspan:"rowSpan",type:"type",usemap:"useMap",valign:"vAlign",width:"width"}; _.Af=function(a,c){_.Ka(c,function(c,e){c&&c.Ob&&(c=c.Ab());"style"==e?a.style.cssText=c:"class"==e?a.className=c:"for"==e?a.htmlFor=c:zf.hasOwnProperty(e)?a.setAttribute(zf[e],c):_.Rc(e,"aria-")||_.Rc(e,"data-")?a.setAttribute(e,c):a[e]=c})};_.Bf=function(a){return"CSS1Compat"==a.compatMode};_.Cf=function(a){a=(a||window).document;a=_.Bf(a)?a.documentElement:a.body;return new _.vf(a.clientWidth,a.clientHeight)}; Df=function(a){if(a&&"number"==typeof a.length){if(_.na(a))return"function"==typeof a.item||"string"==typeof a.item;if(_.ma(a))return"function"==typeof a.item}return!1};_.Ef=function(a,c,d,e){function f(d){d&&c.appendChild(_.n(d)?a.createTextNode(d):d)}for(;e<d.length;e++){var g=d[e];!_.Sc(g)||_.na(g)&&0<g.nodeType?f(g):(0,_.Ca)(Df(g)?_.Tc(g):g,f)}}; Ff=function(a,c){var d=String(c[0]),e=c[1];if(!_.Vc&&e&&(e.name||e.type)){d=["<",d];e.name&&d.push(' name="',_.rf(e.name),'"');if(e.type){d.push(' type="',_.rf(e.type),'"');var f={};_.Ma(f,e);delete f.type;e=f}d.push(">");d=d.join("")}d=a.createElement(d);e&&(_.n(e)?d.className=e:_.la(e)?d.className=e.join(" "):_.Af(d,e));2<c.length&&_.Ef(a,d,c,2);return d};_.Q=function(a,c,d){return Ff(window.document,arguments)};_.Gf=function(a){for(var c;c=a.firstChild;)a.removeChild(c)}; _.Hf=function(a){return a&&a.parentNode?a.parentNode.removeChild(a):null};_.If=function(a,c){if(!a||!c)return!1;if(a.contains&&1==c.nodeType)return a==c||a.contains(c);if("undefined"!=typeof a.compareDocumentPosition)return a==c||!!(a.compareDocumentPosition(c)&16);for(;c&&a!=c;)c=c.parentNode;return c==a}; _.Jf=function(a,c){if("textContent"in a)a.textContent=c;else if(3==a.nodeType)a.data=String(c);else if(a.firstChild&&3==a.firstChild.nodeType){for(;a.lastChild!=a.firstChild;)a.removeChild(a.lastChild);a.firstChild.data=String(c)}else _.Gf(a),a.appendChild(_.yf(a).createTextNode(String(c)))};_.Kf=function(a){try{return a&&a.activeElement}catch(c){}return null};_.Lf=function(a){this.b=a||_.m.document||window.document};_.k=_.Lf.prototype;_.k.F=function(a){return _.sd(this.b,a)}; _.k.Ua=function(a,c,d){return Ff(this.b,arguments)};_.k.createElement=function(a){return _.vd(this.b,a)};_.k.ud=function(a,c){a.appendChild(c)};_.k.$e=_.Gf;_.k.af=_.Hf;_.k.contains=_.If;_.Mf=function(a){return a?new _.Lf(_.yf(a)):jf||(jf=new _.Lf)}; var Pf;_.Of=function(a,c,d){if(_.n(c))(c=_.Nf(a,c))&&(a.style[c]=d);else for(var e in c){d=a;var f=c[e],g=_.Nf(d,e);g&&(d.style[g]=f)}};Pf={};_.Nf=function(a,c){var d=Pf[c];if(!d){var e=_.tf(c);d=e;void 0===a.style[e]&&(e=(_.Za?"Webkit":_.Ya?"Moz":_.x?"ms":_.Va?"O":null)+uf(e),void 0!==a.style[e]&&(d=e));Pf[c]=d}return d};_.Qf=function(a,c){var d=_.yf(a);return d.defaultView&&d.defaultView.getComputedStyle&&(a=d.defaultView.getComputedStyle(a,null))?a[c]||a.getPropertyValue(c)||"":""}; _.Rf=function(a,c){return _.Qf(a,c)||(a.currentStyle?a.currentStyle[c]:null)||a.style&&a.style[c]};_.Sf=function(a){try{var c=a.getBoundingClientRect()}catch(d){return{left:0,top:0,right:0,bottom:0}}_.x&&a.ownerDocument.body&&(a=a.ownerDocument,c.left-=a.documentElement.clientLeft+a.body.clientLeft,c.top-=a.documentElement.clientTop+a.body.clientTop);return c}; _.Uf=function(a,c,d){if(c instanceof _.vf)d=c.height,c=c.width;else if(void 0==d)throw Error("r");a.style.width=_.Tf(c,!0);a.style.height=_.Tf(d,!0)};_.Tf=function(a,c){"number"==typeof a&&(a=(c?Math.round(a):a)+"px");return a};_.Wf=function(a){var c=_.Vf;if("none"!=_.Rf(a,"display"))return c(a);var d=a.style,e=d.display,f=d.visibility,g=d.position;d.visibility="hidden";d.position="absolute";d.display="inline";a=c(a);d.display=e;d.position=g;d.visibility=f;return a}; _.Vf=function(a){var c=a.offsetWidth,d=a.offsetHeight,e=_.Za&&!c&&!d;return _.ea(c)&&!e||!a.getBoundingClientRect?new _.vf(c,d):(a=_.Sf(a),new _.vf(a.right-a.left,a.bottom-a.top))};_.Xf=_.Ya?"MozUserSelect":_.Za||_.Wa?"WebkitUserSelect":null; }catch(e){_._DumpException(e)} /* _Module_:syr */ try{ var cg,dg;_.Yf=function(a){if(a instanceof _.gd&&a.constructor===_.gd&&a.f===_.fd)return a.b;_.ka(a);return"type_error:SafeUrl"};_.Zf=function(a){if(a instanceof _.gd)return a;a=a.Ob?a.Ab():String(a);_.hd.test(a)||(a="about:invalid#zClosurez");return _.id(a)};_.$f=function(a){if(a instanceof _.od&&a.constructor===_.od&&a.j===_.nd)return a.b;_.ka(a);return"type_error:SafeHtml"};_.ag=function(a,c){a.innerHTML=_.$f(c)};_.bg=function(a){return null==a?"":String(a)}; cg=function(a,c,d,e){Array.prototype.splice.apply(a,_.de(arguments,1))};dg=function(a,c){return null!==a&&c in a?a[c]:void 0};_.eg=function(a,c){c=c instanceof _.gd?c:_.Zf(c);a.href=_.Yf(c)}; _.fg=function(){};_.ja(_.fg);_.fg.prototype.b=0;_.gg=function(a){return":"+(a.b++).toString(36)};var jg,kg;_.S=function(a){_.L.call(this);this.j=a||_.Mf();this.ha=hg;this.X=null;this.Ea=!1;this.b=null;this.J=void 0;this.D=this.w=this.f=this.A=null;this.Ca=!1};_.u(_.S,_.L);_.S.prototype.wa=_.fg.ra();var hg=null;_.S.prototype.getId=function(){return this.X||(this.X=_.gg(this.wa))};_.S.prototype.F=function(){return this.b};_.ig=function(a){a.J||(a.J=new _.$e(a));return a.J}; jg=function(a,c){if(a==c)throw Error("s");var d;if(d=c&&a.f&&a.X){d=a.f;var e=a.X;d=d.D&&e?dg(d.D,e)||null:null}if(d&&a.f!=c)throw Error("s");a.f=c;_.S.H.vc.call(a,c)};_.S.prototype.vc=function(a){if(this.f&&this.f!=a)throw Error("t");_.S.H.vc.call(this,a)};_.S.prototype.jc=function(){this.b=this.j.createElement("DIV")};_.S.prototype.tc=function(a){kg(this,a)};kg=function(a,c,d){if(a.Ea)throw Error("u");a.b||a.jc();c?c.insertBefore(a.b,d||null):a.j.b.body.appendChild(a.b);a.f&&!a.f.Ea||a.ya()}; _.lg=function(a,c){if(a.Ea)throw Error("u");if(c){a.Ca=!0;var d=_.yf(c);a.j&&a.j.b==d||(a.j=_.Mf(c));a.xc(c);a.ya()}else throw Error("v");};_.k=_.S.prototype;_.k.xc=function(a){this.b=a};_.k.ya=function(){this.Ea=!0;_.mg(this,function(a){!a.Ea&&a.F()&&a.ya()})};_.k.Qa=function(){_.mg(this,function(a){a.Ea&&a.Qa()});this.J&&_.df(this.J);this.Ea=!1}; _.k.N=function(){this.Ea&&this.Qa();this.J&&(this.J.ka(),delete this.J);_.mg(this,function(a){a.ka()});!this.Ca&&this.b&&_.Hf(this.b);this.f=this.A=this.b=this.D=this.w=null;_.S.H.N.call(this)}; _.k.Yb=function(a,c,d){if(a.Ea&&(d||!this.Ea))throw Error("u");if(0>c||c>_.ng(this))throw Error("w");this.D&&this.w||(this.D={},this.w=[]);if(a.f==this){var e=a.getId();this.D[e]=a;_.Ad(this.w,a)}else{e=this.D;var f=a.getId();if(null!==e&&f in e)throw Error("a`"+f);e[f]=a}jg(a,this);cg(this.w,c,0,a);a.Ea&&this.Ea&&a.f==this?(d=this.b,c=d.childNodes[c]||null,c!=a.F()&&d.insertBefore(a.F(),c)):d?(this.b||this.jc(),c=_.og(this,c+1),kg(a,this.b,c?c.b:null)):this.Ea&&!a.Ea&&a.b&&a.b.parentNode&&1==a.b.parentNode.nodeType&& a.ya()};_.ng=function(a){return a.w?a.w.length:0};_.og=function(a,c){return a.w?a.w[c]||null:null};_.mg=function(a,c,d){a.w&&(0,_.Ca)(a.w,c,d)};_.S.prototype.removeChild=function(a,c){if(a){var d=_.n(a)?a:a.getId();a=this.D&&d?dg(this.D,d)||null:null;if(d&&a){var e=this.D;d in e&&delete e[d];_.Ad(this.w,a);c&&(a.Qa(),a.b&&_.Hf(a.b));jg(a,null)}}if(!a)throw Error("x");return a}; }catch(e){_._DumpException(e)} /* _Module_:syx */ try{ var pg,qg;pg=function(a,c,d){if(a.f)return null;if(d instanceof Array){var e=null,f;for(f in d){var g=pg(a,c,d[f]);g&&(e=g)}return e}e=null;a.b&&a.b.type==d&&a.j==c&&(e=a.b,a.b=null);if(f=c.getAttribute("data-eqid"))c.removeAttribute("data-eqid"),(f=a.o[f])?c.removeEventListener?c.removeEventListener(d,f,!1):c.detachEvent&&c.detachEvent("on"+d,f):a.A.log(Error("e`"+c));return e};qg=[1,4,2];_.rg=function(a){return(_.Ac?0==a.lb.button:"click"==a.type?!0:!!(a.lb.button&qg[0]))&&!(_.Za&&_.$a&&a.ctrlKey)}; _.sg=function(a,c,d,e){d.K(c,e,void 0,a.W||a,a)};_.T=function(a,c,d){d?_.O(a,c):_.P(a,c)};_.tg=function(a,c){var d=!_.M(a,c);_.T(a,c,d)}; var ug,vg;ug=function(){};_.U=new ug;vg=["click",_.Ya?"keypress":"keydown","keyup"];ug.prototype.K=function(a,c,d,e,f){var g=function(a){var d=_.Td(c),f=_.xd(a.target)?a.target.getAttribute("role")||null:null;"click"==a.type&&_.rg(a)?d.call(e,a):13!=a.keyCode&&3!=a.keyCode||"keyup"==a.type?32!=a.keyCode||"keyup"!=a.type||"button"!=f&&"tab"!=f||(d.call(e,a),a.preventDefault()):(a.type="keypress",d.call(e,a))};g.qc=c;g.Ki=e;f?f.K(a,vg,g,d):_.K(a,vg,g,d)}; ug.prototype.Ga=function(a,c,d,e,f){for(var g,h=0;g=vg[h];h++){var l=a;var q=g;var r=!!d;q=_.Hd(l)?l.Cc(q,r):l?(l=_.Vd(l))?l.Cc(q,r):[]:[];for(l=0;r=q[l];l++){var w=r.listener;if(w.qc==c&&w.Ki==e){f?f.Ga(a,g,r.listener,d,e):_.Zd(a,g,r.listener,d,e);break}}}}; _.wg=function(a,c,d){return function(){try{return c.apply(d,arguments)}catch(e){a.log(e)}}};_.xg=function(a,c){if(a instanceof window.Element&&(c=pg(_.Uc("eq"),a,c||[])))if(_.x&&c instanceof window.MouseEvent&&a.dispatchEvent){var d=window.document.createEvent("MouseEvent");d.initMouseEvent(c.type,!0,!0,c.view,c.detail,c.screenX,c.screenY,c.clientX,c.clientY,c.ctrlKey,c.altKey,c.shiftKey,c.metaKey,c.button,c.relatedTarget);a.dispatchEvent(d)}else a.dispatchEvent&&a.dispatchEvent(c)}; _.yg=function(a,c){_.$e.call(this,c);this.A=a;this.va=c||this};_.u(_.yg,_.$e);_.yg.prototype.K=function(a,c,d,e){if(d){if("function"!=typeof d)throw new TypeError("Function expected");d=_.wg(this.A,d,this.va);d=_.yg.H.K.call(this,a,c,d,e);_.xg(a,zg(c));return d}return _.yg.H.K.call(this,a,c,d,e)}; _.yg.prototype.j=function(a,c,d,e,f){if(d){if("function"!=typeof d)throw new TypeError("Function expected");d=_.wg(this.A,d,f||this.va);d=_.yg.H.j.call(this,a,c,d,e,f);_.xg(a,zg(c));return d}return _.yg.H.j.call(this,a,c,d,e,f)};_.yg.prototype.tb=function(a,c,d,e){if(d){if("function"!=typeof d)throw new TypeError("Function expected");d=_.wg(this.A,d,this.va);d=_.yg.H.tb.call(this,a,c,d,e);_.xg(a,zg(c));return d}return _.yg.H.tb.call(this,a,c,d,e)}; var zg=function(a){return _.la(a)?(0,_.Ea)(a,zg):_.n(a)?a:a?a.toString():a}; _.Ag=function(a,c){_.yg.call(this,c);this.f=a};_.u(_.Ag,_.yg);_.Ag.prototype.F=function(){return this.f};_.Ag.prototype.N=function(){this.f=null;_.Ag.H.N.call(this)}; }catch(e){_._DumpException(e)} /* _Module_:syv */ try{ _.Bg=!_.x&&!_.Oa(); }catch(e){_._DumpException(e)} /* _Module_:syy */ try{ var Dg,Eg,Fg,Jg;_.Cg=function(a,c,d,e){if(null!=a)for(a=a.firstChild;a;){if(c(a)&&(d.push(a),e)||_.Cg(a,c,d,e))return!0;a=a.nextSibling}return!1};Dg=function(a,c){var d=[];_.Cg(a,c,d,!1);return d};Eg=function(a){return _.x&&!_.nb("9")?(a=a.getAttributeNode("tabindex"),null!=a&&a.specified):a.hasAttribute("tabindex")};Fg=function(a){a=a.tabIndex;return _.fa(a)&&0<=a&&32768>a}; _.Gg=function(a){var c;if((c="A"==a.tagName||"INPUT"==a.tagName||"TEXTAREA"==a.tagName||"SELECT"==a.tagName||"BUTTON"==a.tagName?!a.disabled&&(!Eg(a)||Fg(a)):Eg(a)&&Fg(a))&&_.x){var d;!_.ma(a.getBoundingClientRect)||_.x&&null==a.parentElement?d={height:a.offsetHeight,width:a.offsetWidth}:d=a.getBoundingClientRect();a=null!=d&&0<d.height&&0<d.width}else a=c;return a};_.Hg=function(a,c,d){for(var e=0;a&&(null==d||e<=d);){if(c(a))return a;a=a.parentNode;e++}return null}; _.Ig=function(a,c){a=a.getAttribute("aria-"+c);return null==a||void 0==a?"":String(a)};Jg=function(a){return null!=_.Hg(a,function(a){return 1==a.nodeType&&"true"==_.Ig(a,"hidden")})};_.Kg=function(a){return a?Dg(a,function(a){return 1==a.nodeType&&_.Gg(a)&&!Jg(a)}):[]}; }catch(e){_._DumpException(e)} /* _Module_:sy10 */ try{ _.Lg=function(a,c,d){_.Ag.call(this,a,c);this.w=d;this.o=_.M(this.f,"gb_3b");(a=_.I("gb_4b",this.f))&&_.sg(this,a,_.U,this.b)};_.u(_.Lg,_.Ag);_.Lg.prototype.b=function(a){var c;(a=a.b)&&(a=a.getAttributeNode("data-ved"))&&a.value&&(c={ved:a.value});this.w.log(this.o?41:39,c)}; }catch(e){_._DumpException(e)} /* _Module_:syz */ try{ var Mg=function(a){_.D.call(this);this.A=a;this.o=this.b=null;this.f={};this.w={};this.j={}};_.u(Mg,_.D);var Ng=new Mg(_.H);_.Zb("dd",Ng); }catch(e){_._DumpException(e)} /* _Module_:syt */ try{ var Rg,Sg,Vg,Wg,$g,ah,bh,ch,gh,kh;_.Pg=function(a,c){c&&_.Og(a,a.href.replace(/([?&](continue|followup)=)[^&]*/g,"$1"+(0,window.encodeURIComponent)(c)))};Rg=function(a,c){if(void 0!==a.b||void 0!==a.f)throw Error("f");a.f=c;_.kc(a)};Sg=function(a){_.z(this,a,0,-1,null)};_.u(Sg,_.y);_.Tg=function(a){return _.Wc&&void 0!=a.children?a.children:(0,_.Da)(a.childNodes,function(a){return 1==a.nodeType})};_.Ug=function(a,c,d){_.D.call(this);this.qc=a;this.j=c||0;this.f=d;this.b=(0,_.p)(this.Ug,this)}; _.u(_.Ug,_.D);_.k=_.Ug.prototype;_.k.Dc=0;_.k.N=function(){_.Ug.H.N.call(this);this.stop();delete this.qc;delete this.f};_.k.start=function(a){this.stop();this.Dc=_.We(this.b,_.ea(a)?a:this.j)};_.k.stop=function(){0!=this.Dc&&_.m.clearTimeout(this.Dc);this.Dc=0};_.k.Ug=function(){this.Dc=0;this.qc&&this.qc.call(this.f)};Vg=function(a,c){a=_.I("gb_Xa",a.F());_.T(a,"gb_5a",!c)};Wg=function(a){return String(a).replace(/([A-Z])/g,"-$1").toLowerCase()}; _.Og=function(a,c){c=c instanceof _.gd?c:_.Zf(c);a.href=_.Yf(c)};_.Xg=function(a,c){var d=c||window.document;return d.querySelectorAll&&d.querySelector?d.querySelectorAll("."+a):_.ud(window.document,a,c)};_.Yg=function(a,c){return _.I(a,c)};_.Zg=function(a,c,d){a.insertBefore(c,a.childNodes[d]||null)};$g=function(a,c){var d=c.parentNode;d&&d.replaceChild(a,c)};ah=function(a,c){var d=[];return _.Cg(a,c,d,!0)?d[0]:void 0};bh={SCRIPT:1,STYLE:1,HEAD:1,IFRAME:1,OBJECT:1};ch={IMG:" ",BR:"\n"}; _.dh=function(a,c){c?a.tabIndex=0:(a.tabIndex=-1,a.removeAttribute("tabIndex"))};_.eh=function(a,c,d){if(!(a.nodeName in bh))if(3==a.nodeType)d?c.push(String(a.nodeValue).replace(/(\r\n|\r|\n)/g,"")):c.push(a.nodeValue);else if(a.nodeName in ch)c.push(ch[a.nodeName]);else for(a=a.firstChild;a;)_.eh(a,c,d),a=a.nextSibling}; _.fh=function(a){if(_.Xc&&null!==a&&"innerText"in a)a=a.innerText.replace(/(\r\n|\r|\n)/g,"\n");else{var c=[];_.eh(a,c,!0);a=c.join("")}a=a.replace(/ \xAD /g," ").replace(/\xAD/g,"");a=a.replace(/\u200B/g,"");_.Xc||(a=a.replace(/ +/g," "));" "!=a&&(a=a.replace(/^\s*/,""));return a};gh=function(a,c){return c?_.Hg(a,function(a){return!c||_.n(a.className)&&_.Ga(a.className.split(/\s+/),c)},void 0):null};_.hh=function(a,c){a=a.getAttribute("aria-"+c);return null==a?a:"boolean"==typeof a?a:"true"==a}; _.ih=function(a,c,d,e){e=_.wg(a,e,void 0);_.K(c,d,e,void 0,void 0);_.xg(c,d)};_.jh=function(a,c,d){if(_.Bg&&a.dataset)a.dataset[c]=d;else{if(/-[a-z]/.test(c))throw Error("y");a.setAttribute("data-"+Wg(c),d)}};kh=function(a){if(/-[a-z]/.test("item"))return null;if(_.Bg&&a.dataset){if(_.Pa()&&!("item"in a.dataset))return null;a=a.dataset.item;return void 0===a?null:a}return a.getAttribute("data-"+Wg("item"))}; _.mh=function(a,c){_.L.call(this);this.b=a;this.j=lh(this.b);this.B=c||100;this.o=_.K(a,"resize",this.A,!1,this)};_.u(_.mh,_.L);_.mh.prototype.N=function(){_.$d(this.o);_.mh.H.N.call(this)};_.mh.prototype.A=function(){this.f||(this.f=new _.Ug(this.w,this.B,this),_.Se(this,this.f));this.f.start()}; _.mh.prototype.w=function(){if(!this.b.La){var a=this.j,c=lh(this.b);this.j=c;if(a){var d=!1;a.width!=c.width&&(this.dispatchEvent("b"),d=!0);a.height!=c.height&&(this.dispatchEvent("a"),d=!0);d&&this.dispatchEvent("resize")}else this.dispatchEvent("a"),this.dispatchEvent("b"),this.dispatchEvent("resize")}}; var nh=function(a){_.L.call(this);this.f=a||window;this.j=_.K(this.f,"resize",this.o,!1,this);this.b=_.Cf(this.f)},oh,lh;_.u(nh,_.L);_.ph=function(){var a=window,c=_.Ue(a);return oh[c]=oh[c]||new nh(a)};oh={};lh=function(a){return a.b?_.wf(a.b):null};nh.prototype.N=function(){nh.H.N.call(this);this.j&&(_.$d(this.j),this.j=null);this.b=this.f=null};nh.prototype.o=function(){var a=_.Cf(this.f);_.xf(a,this.b)||(this.b=a,this.dispatchEvent("resize"))}; _.qh=function(a){this.f=a;this.b=null};_.rh=function(a){a.b||(a.b=_.K(a.f,"keydown",a.j,!1,a))};_.qh.prototype.j=function(a){9!=a.keyCode||_.M(this.f,"gb_5")||(_.sh(this,!0),_.th(this))};_.th=function(a){a.b&&(_.$d(a.b),a.b=null)};_.sh=function(a,c){_.T(a.f,"gb_5",c)}; _.uh=function(a,c){_.L.call(this);this.B=a;c&&(this.B.id=c)};_.u(_.uh,_.L);_.uh.prototype.F=function(){return this.B};_.uh.prototype.getId=function(){return this.B.id};_.uh.prototype.X=function(){var a=this.B.id;a||(a="gb$"+_.gg(_.fg.ra()),this.B.id=a);return a};_.uh.prototype.N=function(){_.Hf(this.B);_.uh.H.N.call(this)}; _.vh=function(a){_.uh.call(this,a);_.U.K(a,this.b,!1,this)};_.u(_.vh,_.uh);_.vh.prototype.b=function(a){this.dispatchEvent("click")||a.preventDefault()};_.wh=function(a){return ah(a,function(a){return _.xd(a)&&_.Gg(a)})};_.xh=function(a){(a=_.wh(a))&&a.focus()};var yh=function(){};var zh=function(a,c,d){this.f=a;this.j=c;this.b=d||_.m};var Ah=function(){this.b=[]};Ah.prototype.f=function(a,c,d){this.A(a,c,d);this.b.push(new zh(a,c,d))};Ah.prototype.A=function(a,c,d){d=d||_.m;for(var e=0,f=this.b.length;e<f;e++){var g=this.b[e];if(g.f==a&&g.j==c&&g.b==d){this.b.splice(e,1);break}}};Ah.prototype.j=function(a){for(var c=0,d=this.b.length;c<d;c++){var e=this.b[c];"catc"==e.f&&e.j.call(e.b,a)}}; var Ch=function(a,c,d){this.o=new Ah;this.C=a;this.w=c;this.b=Bh(a.offsetWidth,this.w);this.D=d||new _.mh(_.ph(),10);_.K(this.D,"b",function(){window.requestAnimationFrame?window.requestAnimationFrame((0,_.p)(this.B,this)):this.B()},!1,this)},Bh=function(a,c){for(var d=0,e=c.length-1,f=c[0];d<e;){if(a<=f.max)return f.id;f=c[++d]}return c[e].id};Ch.prototype.B=function(){var a=Bh(this.C.offsetWidth,this.w);a!=this.b&&(this.b=a,this.j(new yh))};Ch.prototype.f=function(a,c,d){this.o.f(a,c,d)}; Ch.prototype.A=function(a,c){this.o.A(a,c)};Ch.prototype.j=function(a){this.o.j(a)}; var Dh={mj:"gb_9b",Ij:"gb_yd",aj:"gb_fc"};var Eh={id:"unlimitedProductControl",Bd:Number.MAX_SAFE_INTEGER};var Fh=function(a,c){c||(c=this.createElement(),a.Xc().appendChild(c));_.uh.call(this,c);this.o=new _.$e(this);_.sg(this.o,this.F(),_.U,this.fh)};_.u(Fh,_.uh);_.k=Fh.prototype;_.k.createElement=function(){var a=_.vd(window.document,"LI");_.O(a,"gb_kc");_.zd(a,"menuitem");return a}; _.k.si=function(a){a?_.jh(this.F(),"item",a):(a=this.F(),/-[a-z]/.test("item")||(_.Bg&&a.dataset?!/-[a-z]/.test("item")&&(_.Bg&&a.dataset?"item"in a.dataset:a.hasAttribute?a.hasAttribute("data-"+Wg("item")):a.getAttribute("data-"+Wg("item")))&&delete a.dataset.item:a.removeAttribute("data-"+Wg("item"))));return this};_.k.Wc=function(){return kh(this.F())};_.k.Jc=function(a){_.T(this.F(),"gb_mc",a);return this};_.k.focus=function(){_.xh(this.F())};_.k.fh=function(){this.dispatchEvent("click")}; var Gh=function(a,c){Fh.call(this,a,c);this.j=_.Yg("gb_nc",this.F());this.w=_.I("gb_pc",this.j);this.b=null;this.f=_.I("gb_oc",this.j)};_.u(Gh,Fh);_.k=Gh.prototype;_.k.createElement=function(){var a=Gh.H.createElement.call(this);_.O(a,"gb_qc");var c=_.Q("A","gb_nc");_.dh(c,!0);a.appendChild(c);var d=_.Q("SPAN","gb_oc");c.appendChild(d);return a};_.k.Wc=function(){return Gh.H.Wc.call(this)||this.xf()};_.k.xf=function(){return _.fh(this.f)};_.k.ti=function(a){_.Jf(this.f,a);return this}; _.k.Ni=function(a){if(!this.w)if(this.w=_.Q("IMG","gb_pc"),this.b)$g(this.w,this.b),this.b=null;else{var c=this.f;c.parentNode&&c.parentNode.insertBefore(this.w,c)}this.w.setAttribute("src",a);return this}; _.k.Mi=function(a){if(!(a instanceof window.Element&&"svg"==a.tagName.toLowerCase()))return this;if(this.w)$g(a,this.w),this.w=null;else if(this.b)$g(a,this.b);else{var c=this.f;c.parentNode&&c.parentNode.insertBefore(a,c)}(c=a.getAttribute("class"))?a.setAttribute("class",c+" gb_pc"):a.setAttribute("class","gb_pc");this.b=a;return this};_.k.focus=function(){this.j.focus()}; _.Hh=function(a){_.uh.call(this,a);this.f=[];this.G={}};_.u(_.Hh,_.uh);_.uh.prototype.Xc=function(){return this.F()};_.Hh.prototype.$=function(a){var c=this.G[a];if(c)return c;var d=window.document.getElementById(a);if(d)for(var e=0,f=this.f.length;e<f;++e)if(c=this.f[e],c.F()==d)return this.G[a]=c;return null};_.Hh.prototype.ub=function(a){a.vc(this);this.f.push(a);var c=a.getId();c&&(this.G[c]=a)};_.Hh.prototype.W=function(){for(var a=0,c=this.f.length;a<c;a++)this.f[a].ka();this.G={};this.f=[]}; var Ih=function(a,c){_.Hh.call(this,c||this.createElement());this.j=a;a=this.F().getElementsByClassName("gb_kc");for(c=0;c<a.length;c++){var d=a[c];_.M(d,"gb_qc")?this.ub(new Gh(this,d)):this.ub(new Fh(this,d))}this.b=_.I("gb_lc",this.F())};_.u(Ih,_.Hh);_.k=Ih.prototype;_.k.createElement=function(){var a=_.vd(window.document,"UL");_.O(a,"gb_jc");var c=_.Q("SPAN","gb_lc");a.appendChild(c);return a}; _.k.ub=function(a){Ih.H.ub.call(this,a);var c=this.j,d=a.F();d=d.id||(d.id="gbm"+_.gg(_.fg.ra()));c.M[d]=a};_.k.oi=function(){return null!=this.b?_.fh(this.b):null};_.k.ri=function(a){return null!=this.b?(_.Jf(this.b,a),this):null};_.k.eg=function(){var a=new Fh(this);this.ub(a);return a};_.k.fg=function(){var a=new Gh(this);this.ub(a);return a}; var V=function(a,c,d,e,f){_.Hh.call(this,a);this.b=c;this.w=a;this.A=d;this.J=e;this.j=_.I("gb_gc",this.b);this.L=new _.qh(this.j);this.C=_.I("gb_hc",this.j);this.D=_.I("gb_ic",this.j);this.M={};this.O=[];this.R=f||!1;this.o=new _.$e(this);Jh(this);a=this.j.getElementsByClassName("gb_jc");for(c=0;c<a.length;c++)this.ub(new Ih(this,a[c]))};_.u(V,_.Hh);var Kh="click mousedown scroll touchstart wheel keydown".split(" ");V.prototype.N=function(){V.H.N.call(this);Lh(this)};V.prototype.Xc=function(){return this.j}; V.prototype.T=function(){Mh(this);return Nh(this,this.C)};V.prototype.U=function(){Mh(this);return Nh(this,this.D)};var Nh=function(a,c){var d=new Ih(a),e=d.F();c.appendChild(e);a.ub(d);return d},Mh=function(a){a.C||(a.C=_.vd(window.document,"DIV"),_.O(a.C,"gb_hc"),a.j.appendChild(a.C),a.D=_.vd(window.document,"DIV"),_.O(a.D,"gb_ic"),a.j.appendChild(a.D))};V.prototype.ha=function(a){_.T(this.b,"gb_ec",1==a);this.dispatchEvent("msc")};V.prototype.V=function(){return Oh(this)?0:1}; var Ph=function(a,c){switch(c){case "menu":_.P(a.F(),"gb_5a");break;case "back":_.P(a.A,"gb_5a")}},Qh=function(a){_.O(a.F(),"gb_5a");_.O(a.A,"gb_5a")};_.k=V.prototype;_.k.Ba=function(a){switch(a){case "menu":return!_.M(this.F(),"gb_5a");case "back":return!_.M(this.A,"gb_5a")}return!1}; _.k.we=function(){this.J||(this.dispatchEvent("beforeshow"),_.O(this.b,"gb_g"),_.J(this.F(),"expanded",!0),_.xh(this.j),_.rh(this.L),this.dispatchEvent("open"),this.o.j(window.document.body,Kh,this.mf,!0,this),this.o.K(window.document.body,_.Fc,this.yf))};_.k.close=function(){if(!this.J){_.P(this.b,"gb_g");_.J(this.F(),"expanded",!1);window.document.activeElement==this.F()&&this.F().blur();var a=this.L;_.th(a);_.sh(a,!1);this.dispatchEvent("close");Lh(this)}}; _.k.Si=function(a){!_.M(this.w,"gb_5a")&&_.O(this.w,"gb_cc");_.P(this.A,"gb_5a");a&&_.Sd(this.A,"click",a)};_.k.Wh=function(){_.O(this.A,"gb_5a");_.M(this.w,"gb_cc")&&_.P(this.w,"gb_cc")};_.k.Fb=function(){return _.M(this.b,"gb_g")};var Jh=function(a){_.sg(a.o,a.F(),_.U,a.Z);a.F().addEventListener("keydown",function(a){32==a.keyCode&&a.preventDefault()});_.sg(a.o,a.j,_.U,a.Dh);a.o.K(a.b,"keydown",a.ui);a.o.K(a.b,"keyup",a.Ah);_.sg(a.o,a.A,_.U,function(){this.dispatchEvent("bbc")})}; V.prototype.Z=function(){this.dispatchEvent("mbc");this.J||(this.Fb()?this.close():this.we())};var Oh=function(a){return!_.M(a.b,"gb_ec")||_.M(a.b,"gb_9b")||_.M(a.b,"gb_yd")};_.k=V.prototype;_.k.Ah=function(a){9===a.keyCode&&this.Fb()&&(a=this.L,_.sh(a,!0),_.th(a))}; _.k.ui=function(a){a:{if(36==a.keyCode||35==a.keyCode){var c=_.Kg(this.b);if(0<c.length){var d=c[c.length-1];36==a.keyCode&&(d=!Oh(this)&&1<c.length?c[1]:c[0]);d.focus();a.preventDefault();break a}}27!=a.keyCode||this.R&&!Oh(this)||(this.close(),null!=this.w&&this.w.focus())}9===a.keyCode&&this.Fb()&&Oh(this)&&(c=a.target,d=_.Kg(this.b),0<d.length&&(c==d[0]&&a.shiftKey?(d[d.length-1].focus(),a.preventDefault()):c!=d[d.length-1]||a.shiftKey||(d[0].focus(),a.preventDefault())))}; _.k.Dh=function(a){if(a.target instanceof window.Node){a:{a=a.target;for(var c=this.j;a&&a!==c;){var d=a.id;if(d in this.M){a=this.M[d];break a}a=a.parentNode}a=null}if(a){a=a.Wc();c=0;for(d=this.O.length;c<d;++c){var e=this.O[c];e.b.call(e.f,a)}this.R&&!Oh(this)||this.close()}}}; _.k.mf=function(a){this.Fb()&&a.target instanceof window.Node&&Oh(this)&&("keydown"==a.type?27==a.keyCode&&(a.preventDefault(),a.stopPropagation(),this.close(),this.F().focus()):gh(a.target,"gb_fa")||gh(a.target,"gb_8b")||_.If(this.b,a.target)||("touchstart"==a.type&&(a.preventDefault(),a.stopPropagation()),this.close()))};_.k.yf=function(){this.Fb()&&(!Oh(this)||gh(window.document.activeElement,"gb_dc")||gh(window.document.activeElement,"gb_fa")||_.xh(this.j))}; var Lh=function(a){a.o.Ga(window.document.body,Kh,a.mf,!1,a);a.o.Ga(window.document.body,_.Fc,a.yf)};V.prototype.S=function(a,c){this.O.push(new Rh(a,c))};var Rh=function(a,c){this.b=a;this.f=c}; _.Sh=function(a){_.uh.call(this,a);_.K(a,"click",this.b,!1,this)};_.u(_.Sh,_.uh);_.Sh.prototype.f=function(){return _.hh(this.F(),"pressed")||!1};_.Sh.prototype.b=function(a){a=a.b;var c=_.Ig(a,"pressed");_.fe(_.bg(c))||"true"==c||"false"==c?_.J(a,"pressed","true"==c?"false":"true"):a.removeAttribute("aria-pressed");this.dispatchEvent("click")}; var Th,Vh;_.Uh=function(){_.L.prototype.za=_.Qc(Th,_.L.prototype.K);_.L.prototype.zb=_.L.prototype.Nc;_.t("gbar.I",_.uh);_.uh.prototype.ia=_.uh.prototype.getId;_.uh.prototype.ib=_.uh.prototype.F;_.uh.prototype.ic=_.uh.prototype.X;_.t("gbar.J",_.Hh);_.Hh.prototype.ja=_.Hh.prototype.$;_.Hh.prototype.jb=_.Hh.prototype.W;_.t("gbar.K",_.vh);_.t("gbar.L",_.Sh);_.Sh.prototype.la=_.Sh.prototype.f};Th=function(a,c,d,e,f){return a.call(this,c,_.Qc(Vh,d),e,f)}; Vh=function(a,c){c.xa=c.type;c.xb=c.target;return a.call(this,c)}; var W=function(a,c,d,e){_.L.call(this);this.f=a;_.P(this.f,"gb_td");this.j=c;this.Ca=d;this.yb="";this.kb=e;this.O=this.b=null;this.Va=this.Z=this.Y=!1;this.Xa=_.E(_.A(this.j,16),!1);this.$=new _.$e(this);this.S=_.I("gb_Lc",this.f);this.M=_.E(_.A(c,6),!1);this.Wb=_.I("gb_Mc",this.S);this.A=_.I("gb_ud",this.f);this.L=_.I("gb_zd",this.f);(this.ta=_.E(_.A(this.j,21),!1))&&this.A&&(this.Fa=_.I("gb_de",this.f),this.W=_.I("gb_he",this.f),this.R=_.I("gb_ee",this.f));this.B=_.I("gb_tc",this.f);this.T=_.I("gb_Ud", this.f);this.Wf=_.I("gb_Wd",this.f);this.D=_.I("gb_Kd",this.f);this.o=_.I("gb_Hd",this.f);this.J=Array.prototype.slice.call(_.Xg("gb_0d",this.f));this.U=!1;this.Kb=_.E(_.A(this.j,19),!1);this.Jb=_.E(_.A(this.j,20),!1);this.G=_.E(_.A(this.j,18),!1);c=Wh(this,!0);d=Wh(this,!1);this.Ub=Math.max(c,d);this.X=_.A(this.j,15);this.V=_.E(_.A(this.j,17),!1);a=Xh(this,c,d);this.C=new Ch(this.f,Yh);this.ta&&this.A&&(this.ab=new Ch(this.f,Zh),this.ab.f("catc",this.ua,this),this.ua(),_.sg(this.$,this.Fa,_.U,function(){_.tg(this.W, "gb_5a")}));this.Tb=_.E(_.A(this.j,1),!1);$h(this);ai(this,this.C.b);this.C.f("catc",this.Cb,this);_.A(this.j,8)&&window.document.addEventListener("scroll",(0,_.p)(function(){_.T(this.f,"gb_wd",0<window.scrollY)},this));c+=d;null!=this.o&&(_.A(this.j,7)&&(this.va=new Ch(this.o,a),this.va.f("catc",this.ke,this),this.ke(),c+=48),this.V&&_.Of(this.o,"min-width",c+"px"))};_.u(W,_.L); var bi="click mousedown scroll touchstart wheel keydown".split(" "),Yh=[{id:"gb_9b",max:599},{id:"gb_yd",max:1023},{id:"gb_fc"}],Zh=[{id:{id:"oneProductControl",Bd:1},max:320},{id:{id:"twoProductControl",Bd:2},max:360},{id:{id:"threeProductControl",Bd:3},max:410},{id:Eh}];_.k=W.prototype;_.k.F=function(){return this.f};_.k.Oi=function(a){this.O=a;this.G&&"gb_9b"==this.C.b?(ci(this,!0),this.wa(!1)):Vg(this.O,this.Y)}; _.k.Pi=function(a){this.S&&(_.Jf(this.Wb,a||""),_.T(this.S,"gb_5a",!a||this.G&&"gb_9b"==this.C.b),this.M=!!a,ai(this,this.C.b))};_.k.Mg=function(){return _.I("gb_8d",this.A)};_.k.ke=function(){if(null!=this.va){var a=this.va.b;3==a?di(this,!1):1==a?di(this,!this.G):di(this,!this.G&&"gb_fc"==this.C.b)}}; var di=function(a,c){if(_.A(a.j,7)&&(a.G||!a.U||c)){if(a.X){var d=_.I("gb_pe",a.f);if(d){var e=_.I("gb_qe",a.f),f="gb_fc"!=a.C.b||c?"":a.Ub+"px";_.Of(d,"min-width",f);_.Of(e,"min-width",f)}}_.M(a.o,"gb_Cd")!=c&&(_.T(a.o,"gb_Cd",c),c?a.dispatchEvent("sfi"):a.dispatchEvent("sfu"),_.T(_.I("gb_xe",a.o),"gb_Cd",c),c&&a.ua())}},$h=function(a){var c=_.G.ra();a.A||Rg(c.f,Error("C"));_.E(_.A(a.j,11))||Rg(c.B,Error("D"));_.E(_.A(a.j,7))||Rg(c.w,Error("E"));_.E(_.A(a.j,12))||Rg(c.o,Error("F"));_.E(_.A(a.j,13))|| Rg(c.A,Error("G"))},ai=function(a,c){var d;if(!a.b&&a.A){if(d=_.I("gb_8b",a.f)){var e=_.I("gb_dc");if(e){var f=_.I("gb_bc");f?(a.b=new V(d,e,f,_.E(_.A(a.j,16),!1),_.E(_.A(a.j,9),!1)),a.b.K("open",a.Hb,!1,a),a.b.K("close",a.Gb,!1,a),a.b.K("msc",a.Ib,!1,a),_.Uh(),_.t("gbar.C",V),V.prototype.ca=V.prototype.Xc,V.prototype.cb=V.prototype.T,V.prototype.cc=V.prototype.S,V.prototype.cd=V.prototype.ha,V.prototype.ce=V.prototype.U,V.prototype.cf=V.prototype.we,V.prototype.cg=V.prototype.close,V.prototype.ch= V.prototype.V,V.prototype.ci=V.prototype.Si,V.prototype.cj=V.prototype.Wh,V.prototype.ck=V.prototype.Fb,_.t("gbar.D",Ih),Ih.prototype.da=Ih.prototype.eg,Ih.prototype.db=Ih.prototype.fg,Ih.prototype.dc=Ih.prototype.oi,Ih.prototype.dd=Ih.prototype.ri,_.t("gbar.E",Fh),Fh.prototype.ea=Fh.prototype.F,Fh.prototype.eb=Fh.prototype.Jc,Fh.prototype.ec=Fh.prototype.si,Fh.prototype.ed=Fh.prototype.Wc,_.t("gbar.F",Gh),Gh.prototype.fa=Gh.prototype.ti,Gh.prototype.fb=Gh.prototype.Ni,Gh.prototype.fc=Gh.prototype.Mi, Gh.prototype.fd=Gh.prototype.xf,Gh.prototype.ed=Gh.prototype.Wc,_.ee(_.G.ra().f,a.b)):a.Ca.log(Error("z"))}else a.Ca.log(Error("A"))}else a.Ca.log(Error("B"));d=_.E(_.A(a.j,14),!1)}d&&a.ha("back");a.b&&!a.Z&&a.ha("default");a.b&&a.Jb&&a.ha("none");ei(a);a.Kb?a.Y=!0:(d="gb_9b"==c,e=_.E(_.A(a.j,5),!1),f=_.E(_.A(a.j,7),!1),a.Y=!(a.M||d&&(e||f)));d=fi(a,c);if(a.b&&d)a:{if(!_.gi(a)){if(a.V){if(null==a.T)break a;d=_.I("gb_6d");a.T.parentNode!=d&&_.Zg(d,a.T,0);_.O(a.B,"gb_Vd")}else d=_.I("gb_6d"),a.B.parentNode!= d&&_.Zg(d,a.B,0),_.P(a.B,"gb_Td");a.ma();a.dispatchEvent("upi")}}else a:if(_.gi(a)&&a.A){if(a.V){if(null==a.T)break a;_.Zg(a.Wf,a.T,0);_.P(a.B,"gb_Vd")}else a.A.appendChild(a.B),_.O(a.B,"gb_Td");a.ma();a.dispatchEvent("upo")}d="gb_9b"==c;a.O&&!a.Xa&&(e=a.O.F(),f=!a.M,_.T(e,"gb_5a",!f),f&&(a.G&&d?(a.wa(!1),ci(a,!0)):Vg(a.O,a.Y&&(!a.G||!d))));a.b&&(a.b.Ba("menu")||a.b.Ba("back"))&&!Oh(a.b)&&(a.Va=a.b.Fb());e=_.ge(Dh);_.Ze(a.f,e);_.O(a.f,c);_.A(a.j,7);if(a.X&&null!=a.D)if("gb_fc"!=c)_.Of(a.D,"min-width", ""),_.Of(a.B,"min-width","");else{f=_.Wf(a.D).width;var g=_.Wf(a.B).width;f=Math.max(f,g);_.Of(a.D,"min-width",f+"px");_.Of(a.B,"min-width",f+"px")}d?a.U||(a.U=!a.G,di(a,a.U),ci(a,!0)):(ci(a,!1),a.U=!1,a.ke());hi(a,a.o);hi(a,a.D);null!=a.o&&(f="gb_yd"==c,_.T(a.o,"gb_Od",!d&&!f),_.T(a.o,"gb_Nd",d||f));a.b&&(d=a.b.b,_.Ze(d,e),_.O(d,c),Oh(a.b)?_.I("gb_7d",void 0).appendChild(d):a.f.appendChild(d),a.b.Ba("menu")||a.b.Ba("back"))&&(c=!Oh(a.b),d=a.b.Fb(),c&&!d&&a.Va?a.b.we():!c&&d&&a.b.close());_.ii(a)}, hi=function(a,c){var d="gb_9b"==a.C.b;null!=c&&_.T(c,"gb_Md",d&&a.G)},Xh=function(a,c,d){var e=320+2*Math.max(c,d);c=320+c+d;return e!=c&&a.X?[{id:1,max:c},{id:2,max:e},{id:3}]:[{id:1,max:c},{id:3}]},Wh=function(a,c){if(a=_.I(c?"gb_pe":"gb_qe",a.f)){var d=a.offsetWidth;(0,_.Ca)(a.children,function(a){_.M(a,"gb_5a")&&(d-=a.offsetWidth)});return d}return 0},ji=function(a){var c=Wh(a,!0),d=Wh(a,!1);c+=d;d=a.o;var e=d.style[_.tf("min-width")];""!=("undefined"!==typeof e?e:d.style[_.Nf(d,"min-width")]|| "")&&_.Of(a.o,"min-width",c+"px")},ki=function(a){return function(){a.click()}},li=function(a){var c=_.I("gb_qe",a.f),d=[];(0,_.Ca)(_.I("gb_pe",a.f).children,function(a){d.push(a)});_.E(_.A(a.j,7),!1)&&(a=_.I("gb_Cd",a.o))&&(a=a.children[0],a.b=!0,d.push(a));(0,_.Ca)(c.children,function(a){d.push(a)});return d}; W.prototype.ua=function(){if(this.ta&&this.A){var a=li(this);a=(0,_.Da)(a,function(a){return _.M(a,"gb_yb")||_.M(a,"gb_hf")||_.M(a,"gb_Re")});var c=this.ab.b.Bd,d=!1;a.length>c&&(d=!0,c--);var e=a.length-c;if(d!=!_.M(this.Fa,"gb_5a")||e!=this.R.children){_.T(this.Fa,"gb_5a",!d);if(d)for(;this.R.firstChild;)this.R.removeChild(this.R.firstChild);mi(this,a,c);ji(this);d?this.$.j(window.document.body,bi,this.Oa,!0,this):this.$.Ga(window.document.body,bi,this.Oa,!1,this)}}}; var mi=function(a,c,d){for(var e=0;e<c.length;e++){var f=c[e];if(e>=d){_.O(f,"gb_5a");var g=void 0,h=a,l=_.vd(window.document,"LI");_.Ye(l,["gb_fe","gb_kc","gb_qc"]);_.dh(l,!0);_.sg(h.$,l,_.U,ki(f));var q=_.Q("A","gb_nc");l.appendChild(q);var r=_.Q("SPAN","gb_oc");q.appendChild(r);q=f.b?f.getAttribute("aria-label"):f.title;_.Jf(r,q);q=!1;_.M(f,"gb_hf")&&(q=!0);var w=f.children[0];q?g=w.children[0].children[0].src:f.b?g="https://www.gstatic.com/images/icons/material/system/1x/search_black_24dp.png": g=w.src;h.w=_.Q("IMG");_.Ye(h.w,["gb_pc","gb_ge"]);h.w.setAttribute("src",g);r.parentNode&&r.parentNode.insertBefore(h.w,r);a.R.appendChild(l)}else _.P(f,"gb_5a")}};W.prototype.Oa=function(a){!_.M(this.W,"gb_5a")&&a.target instanceof window.Node&&("keydown"==a.type?27==a.keyCode&&(a.preventDefault(),a.stopPropagation(),_.O(this.W,"gb_5a"),this.F().focus()):_.If(this.W,a.target)||("touchstart"==a.type&&(a.preventDefault(),a.stopPropagation()),_.O(this.W,"gb_5a")))}; W.prototype.Cb=function(){ai(this,this.C.b);this.b&&_.ni(this,this.b.Fb(),!1);this.dispatchEvent("ffc")};_.ni=function(a,c,d){a.b&&(Oh(a.b)&&(c=!1),a=window.document.body,_.T(a,"gb_be",c),_.T(a,"gb_ae",d))};W.prototype.Hb=function(){_.ni(this,!0,!0)};W.prototype.Gb=function(){_.ni(this,!1,!0)};W.prototype.Ib=function(){var a=Oh(this.b),c=this.b.b;a?_.I("gb_7d",void 0).appendChild(c):this.f.appendChild(c)};_.gi=function(a){return!!a.b&&(a.V?_.M(a.B,"gb_Vd"):a.B.parentNode!=a.A)}; W.prototype.ha=function(a){switch(a){case "back":this.Z=!0;Qh(this.b);Ph(this.b,"back");break;case "default":this.Z=!1;fi(this,this.C.b)||this.Tb?this.b&&!this.b.Ba("menu")&&(Qh(this.b),Ph(this.b,"menu")):(this.b&&this.b.Ba("back")&&Qh(this.b),this.b&&this.b.Ba("menu")?(a=this.b,a.close(),_.O(a.F(),"gb_5a"),!_.M(a.A,"gb_5a")&&_.P(a.F(),"gb_cc")):(a=_.I("gb_8b",this.f))&&_.O(a,"gb_5a"));break;case "none":this.Z=!0,Qh(this.b)}}; var fi=function(a,c){var d="gb_9b"==c;c="gb_yd"==c;var e=_.E(_.A(a.j,5),!1),f=_.E(_.A(a.j,2),!1);return!(_.E(_.A(a.j,10),!1)||a.Xa)&&f&&(d||c&&(e||a.M))};W.prototype.getHeight=function(){return this.f.offsetHeight};_.ii=function(a){var c=a.getHeight()+"px";a.yb!=c&&(a.yb=c,a.kb&&(a.kb.style.height=c),a.dispatchEvent("resize"))};W.prototype.Vb=function(){this.L&&_.ii(this)}; W.prototype.Ka=function(){if(!this.L){var a=_.vd(window.document,"DIV");_.Ye(a,["gb_zd","gb_0d"]);var c=this.J[0];c=c.classList.contains("gb_2d")?1:c.classList.contains("gb_1d")?2:0;oi(a,c);a.style.backgroundColor=this.J[0].style.backgroundColor;this.J.push(a);c=this.A;c.parentNode&&c.parentNode.insertBefore(a,c.nextSibling);this.L=a}return this.L};W.prototype.Xb=function(){_.Hf(this.L);this.L=null;_.ii(this)};_.pi=function(a,c){a.A&&a.A.appendChild(c)}; W.prototype.Nd=function(a){for(var c=0;c<this.J.length;c++)oi(this.J[c],a)};var oi=function(a,c){_.Ze(a,["gb_1d","gb_2d"]);1==c?_.O(a,"gb_2d"):2==c&&_.O(a,"gb_1d")};W.prototype.Ld=function(a){for(var c=0;c<this.J.length;c++)this.J[c].style.backgroundColor=a};W.prototype.ma=function(){var a=_.Uc("dd");a.b&&a.b.close();a.b=null};W.prototype.Md=function(a){if(null==this.o)throw Error("H");if(this.X)throw Error("I");if(8>a)throw Error("J");this.hb=a;ei(this)}; var ei=function(a){null!=a.D&&("gb_9b"==a.C.b?_.Of(a.D,"min-width",""):null!=a.hb&&_.Of(a.D,"min-width",a.hb-8+"px"))};W.prototype.wa=function(a){_.T(_.I("gb_1b",this.A),"gb_5a",!a)};var ci=function(a,c){a.G&&(null!=a.D&&_.T(a.D,"gb_Ld",c),null!=a.S&&_.T(a.S,"gb_5a",c||!a.M))};W.prototype.Lc=function(a){if(a){var c=_.I("gb_Fa");null!=c&&_.Pg(c,a);_.G.ra().j.then(function(c){c.If(a)})}}; var qi;var ri=_.I("gb_rc"); if(null==ri)qi=null;else{var si=_.C(_.mc,Sg,6)||new Sg,ti=new W(ri,si,_.H,_.I("gb_xd"));_.t("gbar.P",W);W.prototype.pa=W.prototype.getHeight;W.prototype.pb=W.prototype.Pi;W.prototype.pc=W.prototype.Nd;W.prototype.pd=W.prototype.Ld;W.prototype.pe=W.prototype.Ka;W.prototype.pf=W.prototype.Vb;W.prototype.pg=W.prototype.Xb;W.prototype.ph=W.prototype.Mg;W.prototype.pi=W.prototype.ma;W.prototype.pj=W.prototype.Md;W.prototype.pk=W.prototype.wa;W.prototype.pl=W.prototype.Lc;W.prototype.pm=W.prototype.ha; _.ee(_.G.ra().b,ti);qi=ti}_.X=qi; }catch(e){_._DumpException(e)} /* _Module_:qaid */ try{ var ui=window.document.querySelector(".gb_eb .gb_b");ui&&_.Oc(_.wc,ui,"click"); }catch(e){_._DumpException(e)} /* _Module_:qalo */ try{ (function(){for(var a=window.document.querySelectorAll(".gb_4b"),c=0;c<a.length;c++)_.Oc(_.wc,a[c],"click");_.G.ra().b.then(function(a){if(a){var c=_.I("gb_1b",a.A);c&&(c=new _.Lg(c,_.H,_.vc),a.Oi(c))}})})(); }catch(e){_._DumpException(e)} /* _Module_:qano */ try{ var vi=window.document.querySelector(".gb_Cc");if(vi){var wi=vi.querySelector(".gb_b");wi&&_.Oc(_.wc,wi,"click")}; }catch(e){_._DumpException(e)} /* _GlobalSuffix_ */ })(this.gbar_); // Google Inc.   if (window.parent !== window) document.querySelector('.dxu4Dd').style.display = 'none';CD4 1551-04Lisa DunphySelect themeUpload photoDue ThursdayEssay OutlineView allTopicsGeneral InfoRenameDeleteAdd topicStreamShow deleted itemsTopics (1)Topics (1)General InfoRenameDeleteAdd topicAssignment: "Essay Outline"Lisa DunphyCreated 11:25 AM11:25 AM – DeletedNot done This assignment is visible to all teachers in this class. It will be permanently deleted in 30 days.Due Oct 5Essay OutlineOpenGrease Essay OutlineGoogle DocsAdd class comment…Add class comment…CancelPostAnnouncement: "Class Policies- please print out, sign…"Lisa DunphyCreated Sep 6Sep 6 (Edited Sep 6) – Deleted This post is visible to all teachers in this class. It will be permanently deleted in 7 days.General InfoClass Policies- please print out, sign and return by 9/15.Media Literacy ~ Class PoliciesGoogle DocsAdd class comment…Assignment: "Movie Permission Form"Lisa DunphyCreated Sep 6Sep 6 – DeletedDone late This assignment is visible to all teachers in this class. It will be permanently deleted in 7 days.General InfoDue Sep 15Movie Permission FormPlease print out, have parent/guardian sign and returnOpenMovie Permission 2017-18Google DocsAdd class comment…Announcement: "Syllabus- subject to change"Lisa DunphyCreated Sep 6Sep 6 – Deleted This post is visible to all teachers in this class. It will be permanently deleted in 7 days.General InfoSyllabus- subject to changeSyllabus 2017-2018Google DocsAdd class comment…Due Oct 5Essay Outline Lisa Dunphy 11:25 AM Add class comment  Grease Essay OutlineGoogle DocsYour workNot doneFiles you add or create can be viewed and edited by your teacherMark as done or attach work to turn inNo work attachedAddGoogle DriveLinkFileCreateMark as donePrivate commentsAdd private comment…Main menu/* _GlobalPrefix_ */ this.gbar_=this.gbar_||{};(function(_){var window=this; /* _Module_:qebr */ try{ if(_.X){var xi;if(xi=_.A(_.X.j,3))for(var yi=_.Xg(xi),zi=0;zi<yi.length;zi++)_.jh(yi[zi],"ogpc","");_.ni(_.X,!!_.X.b&&_.X.b.Fb(),!1)}; }catch(e){_._DumpException(e)} /* _Module_:qein */ try{ var Ai=function(a){_.z(this,a,0,-1,null)};_.u(Ai,_.y);var Bi=function(a){_.z(this,a,0,-1,null)};_.u(Bi,_.y);var Ci=function(a){_.ad("From proto message. b/12014412");a=_.A(a,4)||"";return _.ed(a)};var Di=_.C(_.mc,Bi,17)||new Bi,Ei=_.C(Di,Ai,1),Fi=Ei?Ci(Ei):null,Gi=_.C(Di,Ai,2),Hi=Gi?Ci(Gi):null,Ii=function(a,c,d){_.vc.log(46,{att:a,max:c,url:d})},Ki=function(a,c,d){_.vc.log(47,{att:a,max:c,url:d});a<c?Ji(a+1,c):_.H.log(Error("K`"+a+"`"+c),{url:d})},Ji=function(a,c){if(Fi){var d=_.vd(window.document,"SCRIPT");d.async=!0;d.type="text/javascript";d.charset="UTF-8";d.src=_.dd(Fi);d.onload=_.Qc(Ii,a,c,d.src);d.onerror=_.Qc(Ki,a,c,d.src);_.vc.log(45,{att:a,max:c,url:d.src});_.td("HEAD")[0].appendChild(d)}}; Ji(1,2);if(Hi){var Li=_.vd(window.document,"LINK");Li.setAttribute("type","text/css");Li.rel="stylesheet";Li.href=_.dd(Hi);_.td("HEAD")[0].appendChild(Li)}; }catch(e){_._DumpException(e)} /* _GlobalSuffix_ */ })(this.gbar_); // Google Inc. Google appsNotificationsGoogle AccountEvan Liaoeliao20@medford.k12.ma.us

      HI CADEE

    1. That those who quietly enjo d The rights for which th ,yf~ h C Id b · e~ oug t and fell ou e the framers of a code ' That \.vould disgrace the fie cl . Could they have lookD<l . h n s ol· hell! D '-• WJt pr h • k own to the present ·1 . op et s en,1 S f. ev, tune een ree-born m ' C . en, uncharg d . h ons1gned unto a sl·_, . e wit crim

      The men who fought for their freedom and enjoy their rights are disgracing the concept of freedom and liberty in this "evil" time. Whitfield is saying he sees free born men made into slaves for doing nothing wrong.

    2. Stripped of those _r,•r h-~ human race. Bequeathed to a l t. d <l t.:ranl ._ no . Boun to a petty _Y • 1--h . ·1 o.-1 ler c1ce. Beca.use e wears • r • I' ... . . h 1· eedon1. 11 e~ \\"as it for this. l at r . .·., -, \,\'ere 1-.inJlcd b) your patriot _s

      This reminds me of how other African Americans such as Henry Garnet and David Walker use God as a steady reference as to why everyone has the right to be treated equal. They all seem to get the same point across that God granted everyone the same rights of freedom and liberty but the white man has stripped that away from the African Americans. Here, Whitfield refers to the white men as tyrants, signifying the oppression they afflict upon the blacks.

    3. 428 IAMFS M. WHIHIELD f erfect day: . The harhin~er ~ p's darken in~ frown, But like the midn1~h~ests rear on high. When stormy h.'ITI.I -I kes the oround. h fer s u1 ,. '"' When pealin~ l Lll~C ~nds the sky! And lurid lt~htnin~ r h· idni~ht gloom, h I. ore t an m When dot e( in 111 1_. the wmb. . f. I specter rum Like some ou · d f II control, Desp.,ir with stern an e I -0 • • • st sou -SI.ts broo<lino o'er his inmo . -, d "' · I · d as pro, e , 'Tis then the faithiu nun d G d That. true alike to man an o , B" all the ills of life unmoved, . d . Pursues its straight and narrow roa . For such a man the siren song oi· pleasure hath no lasting charm; Nor can the mighty and the strong His spirit tame with powerful arm. His pleasure is to wipe the tear, Of sorrow from the mourners cheek, The languid, fainting heart to cheer, To succor and protect the weak. \Vhen the bright face of fortune smiles Upon his path with cheering ray, And pleasure. with alluring wiles, Flatters, to lead his heart astray, His soul in conscious virtue strong, And armed with innate rectitude, Loving the right, detesting wrong, And seeking the eternal good Of all alike, the high or low. His dearest friend, or direst foe, Seeks out the hrnve and faithful few ' Who. to themselves and Maker true, Dare. in the name and fear of God To spread the living truth abroad! ' Ar~ed with th~ s_ame sustaining power, Against adversity s dark hour A~~ from th~ deep deceitful ~uile O\Nhf~ch lurhks 1~11 pleasure's hollow smile, r rom t e 1alse and fitful b .1.h k eam at mar s ambition's meteor fire Or from the dark and luri'd I ' 11 . g eam -.evealm~ passion's dead) . H. . · v ire.

      Could anyone do me the favor of explaining this to me please?

    1. 1 roars of a l o us With stre . PP ause, she turned to her c . us up in h anung eyes and heart b . orner, leaving more than one t er strong s eating with t. t d h urning the h 1 arms and carried £ gra I u e.

      Many African Americans were not awarded with much gratitude when it came to speaking upon a predominantly white crowd. Her virtue and her strength gave her the courage to speak life into these people about something they could all agree on.

    1. Please read this Arbitration Agreement carefully. It is part of your contract with Instructure and affects your rights. It contains procedures for MANDATORY BINDING ARBITRATION AND A CLASS ACTION WAIVER. (a) Applicability of Arbitration Agreement. All claims and disputes (excluding claims for injunctive or other equitable relief as set forth below) in connection with the Terms or the use of any product or service provided by Instructure that cannot be resolved informally or in small claims court shall be resolved by binding arbitration on an individual basis under the terms of this Arbitration Agreement. This Arbitration Agreement applies to you and Instructure, and to any subsidiaries, affiliates, agents, employees, predecessors in interest, successors, and assigns, as well as all authorized or unauthorized users or beneficiaries of services or goods provided under the Terms. (b) Notice Requirement and Informal Dispute Resolution. Before either party may seek arbitration, the party must first send to the other party a written Notice of Dispute (“Notice”) describing the nature and basis of the claim or dispute, and the requested relief. A Notice to Instructure should be sent to: Attn: Legal Department, 6330 South 3000 East, Suite 700, Salt Lake City, UT 84121. After the Notice is received, you and Instructure may attempt to resolve the claim or dispute informally. If you and Instructure do not resolve the claim or dispute within 30 days after the Notice is received, either party may begin an arbitration proceeding. The amount of any settlement offer made by any party may not be disclosed to the arbitrator until after the arbitrator has determined the amount of the award, if any, to which either party is entitled. (c) Arbitration Rules. Arbitration shall be initiated through the American Arbitration Association (“AAA”), an established alternative dispute resolution provider (“ADR Provider”) that offers arbitration as set forth in this section. If AAA is not available to arbitrate, the parties shall agree to select an alternative ADR Provider. The rules of the ADR Provider shall govern all aspects of this arbitration, including but not limited to the method of initiating and/or demanding arbitration, except to the extent such rules are in conflict with the Terms. The AAA Consumer Arbitration Rules governing the arbitration are available online at www.adr.org or by calling the AAA at 1-800-778-7879. The arbitration shall be conducted by a single, neutral arbitrator. Any claims or disputes where the total amount of the award sought is less than Ten Thousand U.S. Dollars (US $10,000.00) may be resolved through binding non-appearance-based arbitration, at the option of the party seeking relief. For claims or disputes where the total amount of the award sought is Ten Thousand U.S. Dollars (US $10,000.00) or more, the right to a hearing will be determined by the Arbitration Rules. Any hearing will be held in a location within 100 miles of your residence, unless you reside outside of the United States, and unless the parties agree otherwise. Any judgment on the award rendered by the arbitrator may be entered in any court of competent jurisdiction. Each party shall bear its own costs (including attorney’s fees) and disbursements arising out of the arbitration, and shall pay an equal share of the fees and costs of the ADR Provider. (d) Additional Rules for Non-appearance Based Arbitration: If non-appearance arbitration is elected, the arbitration shall be conducted by telephone, online and/or based solely on written submissions; the specific manner shall be chosen by the party initiating the arbitration. The arbitration shall not involve any personal appearance by the parties or witnesses unless otherwise mutually agreed by the parties. (e) Time Limits. If you or Instructure pursue arbitration, the arbitration action must be initiated and/or demanded within the statute of limitations (i.e., the legal deadline for filing a claim) and within any deadline imposed under the AAA Rules for the pertinent claim. (f) Authority of Arbitrator. If arbitration is initiated, the arbitrator will decide the rights and liabilities, if any, of you and Instructure, and the dispute will not be consolidated with any other matters or joined with any other cases or parties. The arbitrator shall have the authority to grant motions dispositive of all or part of any claim. The arbitrator shall have the authority to award monetary damages and to grant any non-monetary remedy or relief available to an individual under applicable law, the AAA Rules, and the Terms. The arbitrator shall issue a written award and statement of decision describing the essential findings and conclusions on which the award is based, including the calculation of any damages awarded. The arbitrator has the same authority to award relief on an individual basis that a judge in a court of law would have. The award of the arbitrator is final and binding upon you and Instructure. (g) Waiver of Jury Trial. THE PARTIES HEREBY WAIVE THEIR CONSTITUTIONAL AND STATUTORY RIGHTS TO GO TO COURT AND HAVE A TRIAL IN FRONT OF A JUDGE OR A JURY, instead electing that all claims and disputes shall be resolved by arbitration under this Arbitration Agreement. Arbitration procedures are typically more limited, more efficient and less costly than rules applicable in court and are subject to very limited review by a court. In the event any litigation should arise between you and Instructure in any state or federal court in a suit to vacate or enforce an arbitration award or otherwise, YOU AND INSTRUCTURE WAIVE ALL RIGHTS TO A JURY TRIAL, instead electing that the dispute be resolved by a judge. (h) Waiver of Class or Consolidated Actions. ALL CLAIMS AND DISPUTES WITHIN THE SCOPE OF THIS ARBITRATION AGREEMENT MUST BE ARBITRATED OR LITIGATED ON AN INDIVIDUAL BASIS AND NOT ON A CLASS BASIS, AND CLAIMS OF MORE THAN ONE CUSTOMER OR USER CANNOT BE ARBITRATED OR LITIGATED JOINTLY OR CONSOLIDATED WITH THOSE OF ANY OTHER CUSTOMER OR USER. (i) Confidentiality. All aspects of the arbitration proceeding, including but not limited to the award of the arbitrator and compliance therewith, shall be strictly confidential. The parties agree to maintain confidentiality unless otherwise required by law. This Paragraph shall not prevent a party from submitting to a court of law any information necessary to enforce this Agreement, to enforce an arbitration award, or to seek injunctive or equitable relief. (j) Severability. If any part or parts of this Arbitration Agreement are found under the law to be invalid or unenforceable by a court of competent jurisdiction, then such specific part or parts shall be of no force and effect and shall be severed and the remainder of the Agreement shall continue in full force and effect. (k) Right to Waive. Any or all of the rights and limitations set forth in this Agreement may be waived by the party against whom the claim is asserted. Such waiver shall not waive or effect any other portion of this Agreement. (l) Survival of Agreement. This Arbitration Agreement will survive the termination of your relationship with Instructure. (m) Small Claims Court. Notwithstanding the foregoing, either you or Instructure may bring an individual action in small claims court. (n) Emergency Equitable Relief. Notwithstanding the foregoing, either party may seek emergency equitable relief before a state or federal court in order to maintain the status quo pending arbitration. A request for interim measures shall not be deemed a waiver of any other rights or obligations under this Arbitration Agreement. (o) Claims Not Subject To Arbitration. Notwithstanding the foregoing, claims of defamation, violation of the Computer Fraud and Abuse Act, and infringement or misappropriation of the other party’s patent, copyright, trademark, or trade secret shall not be subject to this arbitration agreement. (p) Courts. In any circumstances where the foregoing Agreement permits the parties to litigate in court, the parties hereby agree to submit to the personal jurisdiction of the courts located within Salt Lake County, Utah, for such purpose. 14.7 Governing Law. The Terms and any action related thereto will be governed and interpreted by and under the laws of the State of Utah, consistent with the Federal Arbitration Act, without giving effect to any conflicts of law principles that provide for the application of the law of another jurisdiction. The United Nations Convention on Contracts for the International Sale of Goods does not apply to this Agreement. 14.8 Notice. Where Instructure requires that you provide an e-mail address to access certain features of the Instructure Properties, you are responsible for providing Instructure with your most current e-mail address. In the event that the last e-mail address you provided to Instructure is not valid, or for any reason is not capable of delivering to you any notices required/ permitted by the Terms, Instructure’s dispatch of the e-mail containing such notice will nonetheless constitute effective notice. You may give notice to Instructure at the following address: Attn: Legal Department, 6330 South 3000 East, Suite 700, Salt Lake City, UT 84121. Such notice shall be deemed given when received by Instructure by letter delivered by nationally recognized overnight delivery service or first class postage prepaid mail at the above address.

      Okay, your probably wondering why I highlighted this WHOLE chunk of article but I think I have a good reason. I highlighted all of this because it is what I feel like a lot of people do. People will most of the times JUMP whole sections in the terms of use barely anyone reads them now adays. People skip them all together or read the first lines in most cases since people would rather get to their new game / account / then to ' waste ' their time reading a whole terms of use.

  9. foun09856fa2017.courses.bucknell.edu foun09856fa2017.courses.bucknell.edu
    1. In all likelihood one is in the past while in the present. The present is then veiled; the past is manifest and apparent, how-ever, so transparently present that it is veiled, and one assumes o n e s e l f t o b e i n t h e p r e s e n t wh e n o n e i s n o t .

      we're never in the present almost never is one not thinking about the past or the future or contemplating the present instead of actually just experiencing it

    2. While we say it cannot be h e l d a cc o u n t ab l e fo r t h e p r e se n t , t h e e x t e n t to wh i c h i t i s i g n o r ed i s p r o b ab l y t h e e x t e n t it d o e s ac co u n t f o r wh a t i s present

      we are who we are because of all the things that have happened to us and all the things we've experienced, whether or not we chose to focus on those things

    3. we must move on to another level, from where the problem looks different and he nc e is d i f fer e nt , a nd t h e so l ut io n ma y t he n b eco me c lear .

      similar to how it's very easy to give advice to a friend but not as easy to give advice to yourself. easier to see solutions from a different perspective

    4. While we say it cannot be h e l d a cc o u n t ab l e fo r t h e p r e se n t , t h e e x t e n t to wh i c h i t i s i g n o r ed i s p r o b ab l y t h e e x t e n t it d o e s ac co u n t f o r wh a t i s

      while the past doesn't effect the present if we ignore it and make the same mistakes it will

    5. we must move on to another level, from where the problem looks different and he nc e is d i f fer e nt , a nd t h e so l ut io n ma y t he n b eco me c lear .

      This really articulates the idea of perspective and coming at learning and problem solving in particular from different vantage points in order to understand them in different ways and then solve them in different ways

    6. I f I write about my biographic situation as I see it (not as I want to s e e , a l t h o u g h t h i s c a n b e i n c l u d e d ) , t h e n i t i s a s i f I h a v e escaped from it.

      belief versus reality

    1. Initial Signatories Denny Burk President, Council on Biblical Manhood and Womanhood John Piper Founder & Teacher, Desiring God; Chancellor, Bethlehem College & Seminary James Dobson Founder & President, Family Talk Russell Moore President, Ethics & Religious Liberty Commission J. I. Packer Professor of Theology, Regent College Wayne Grudem Research Professor of Theology and Biblical Studies, Phoenix Seminary R. Albert Mohler, Jr. President, The Southern Baptist Theological Seminary Tony Perkins President, Family Research Council D. A. Carson Research Professor of New Testament, Trinity Evangelical Divinity School John MacArthur Pastor, Grace Community Church; President, The Master's Seminary & College Sam Allberry Editor, The Gospel Coalition R. C. Sproul Founder & Chairman, Ligonier Ministries Rosaria Butterfield Author of "The Secret Thoughts of an Unlikely Convert" Francis Chan Author & Pastor, We Are Church Marvin Olasky Editor in Chief, World Magazine Ligon Duncan Chancellor & CEO, Reformed Theological Seminary Steve Gaines President, The Southern Baptist Convention; Pastor, Bellevue Baptist Church Andrew T. Walker Director of Policy Studies, Ethics & Religious Liberty Commission H.B. Charles, Jr. Pastor, Shiloh Metropolitan Baptist Church of Jacksonville, Florida Christopher Yuan Speaker & Author, Moody Bible Institute Dennis Rainey Founder & Former President, FamilyLife Frank Page President & CEO, Southern Baptist Convention Executive Committee; Former President, Southern Baptist Convention Nancy DeMoss Wolgemuth Author & Speaker, Revive Our Hearts Daniel L. Akin President, Southeastern Baptist Theological Seminary Kevin DeYoung Senior Pastor, Christ Covenant Church Alistair Begg Reverend, Parkside Church Heath Lambert Executive Director, Association of Certified Biblical Counselors Jerry A. Johnson President & CEO, National Religious Broadcasters Mark Dever Pastor, Capitol Hill Baptist Church Randy Alcorn Director, Eternal Perspective Ministries Karen Swallow Prior Professor of English, Liberty University Matt Chandler Pastor, The Village Church Fred Luter Senior Pastor Franklin Avenue Baptist Church; Former President, Southern Baptist Convention James MacDonald Founder & Senior Pastor, Harvest Bible Chapel James Merritt Pastor, Cross Pointe Church; Former President, Southern Baptist Convention Jack Graham Pastor, Prestonwood Baptist Church J. D. Greear Pastor, The Summit Church Darryl Delhousaye President, Phoenix Seminary Thomas White President, Cedarville University Bryant Wright Senior Pastor, Johnson Ferry Baptist Church; Former SBC President Don Sweeting President, Colorado Christian University Jeff Purswell Director of Theology, Sovereign Grace Churches Johnny Hunt Pastor, First Baptist Church of Woodstock Jason K. Allen President, Midwestern Baptist Theological Seminary Erick-Woods Erickson Editor in Chief, The Resurgent Mark L. Bailey President & Senior Professor of Bible Exposition, Dallas Theological Seminary K. Erik Thoennes Professor & Chair of Theology, Talbot School of Theology, Biola University Vaughan Roberts Rector of St. Ebbe's Church, Oxford, UK David French Senior Writer, National Review Paige Patterson President, Southwestern Baptist Theological Seminary R. Kent Hughes Visiting Professor of Practical Theology of Evangelism and Culture, Westminster Theological Seminary Jeff Iorg President, Gateway Seminary Sam Storms Lead Pastor for Preaching and Vision, Bridgeway Church Richard Land President, Southern Evangelical Seminary Robert A. J. Gagnon Scholar & Author of "The Bible and Homosexual Practice" Samuel W. "Dub" Oliver President, Union University Ronnie Floyd Senior Pastor, Cross Church; Former President, Southern Baptist Convention C. J. Mahaney Senior Pastor, Sovereign Grace Church of Louisville Jason G. Duesing Provost, Midwestern Baptist Theological Seminary & College Matt Carter Pastor, The Austin Stone Church Chuck Kelley President, New Orleans Baptist Theological Seminary Burk Parsons Copastor, St. Andrew's Chapel Eric Teetsel President, Family Policy Alliance of Kansas Alastair Roberts Scholar & Author of "Heirs Together: A Theology of the Sexes" Kevin Ezell President, North American Mission Board Ray Ortlund Pastor, Immanuel Church O. S. Hawkins President, GuideStone SBC Thom S. Rainer President & CEO, LifeWay Christian Resources Michael Reeves President & Professor of Theology, Union School of Theology, UK Todd Wagner Pastor, Watermark Community Church John M. Frame Professor Emeritus of Systematic Theology & Philosophy, Reformed Theological Seminary Randy Stinson Senior Vice President for Academic Administration & Provost, The Southern Baptist Theological Seminary Mac Brunson Senior Pastor, First Baptist Church of Jacksonville Thomas Schreiner James Buchanan Harrison Professor of New Testament Interpretation, The Southern Baptist Theological Seminary H. Wayne House Dean & Distinguished Research Professor of Theology, Law, & Culture, Faith International University & Seminary J. P. Moreland Distinguished Professor of Philosophy, Talbot School of Theology, Biola University Bruce Ware Professor of Christian Theology, The Southern Baptist Theological Seminary Michael Goeke Associate Pastor, First Baptist Church of San Francisco Joel Belz Founder, World Magazine, World News Group Afshin Ziafat Lead Pastor, Providence Church Stephen Strang Founder & CEO, Charisma Media Christiana Holcomb Legal Counsel, Alliance Defending Freedom Jimmy Draper President Emeritus, LifeWay; Former President, Southern Baptist Convention Owen Strachan Associate Professor of Christian Theology, Midwestern Baptist Theological Seminary Anthony Kidd Pastor of Preaching, Community of Faith Bible Church James M. Hamilton, Jr. Professor of Biblical Theology, The Southern Baptist Theological Seminary Bryan Carter Senior Pastor, Concord Church Chris Larson President & CEO, Ligonier Ministries Bruce Riley Ashford Provost & Professor of Theology & Culture, Southeastern Baptist Theological Seminary Candi Finch Assistant Professor of Theology in Women's Studies, Southwestern Baptist Theological Seminary Curtis Woods Associate Executive Director, Kentucky Baptist Convention Nathan Finn Dean, Professor of Theological Studies, Union University James Robison Founder & President, LIFE Outreach International; Founder & Publisher, The Stream C. Ben Mitchell Graves Professor of Moral Philosophy, Union University Darrell Bock Senior Professor, Dallas Theological Seminary David Mathis Executive Editor, Desiring God Ken Magnuson Professor of Christian Ethics, The Southern Baptist Theological Seminary Daniel Heimbach Senior Professor of Christian Ethics, Southeastern Baptist Theological Seminary Hershael W. York Victor and Louise Lester Professor of Christian Preaching, The Southern Baptist Theological Seminary Mary Mohler Director, Seminary Wives Institute Hunter Baker Associate Professor, Union University Dorothy Kelley Patterson Professor of Theology in Women's Studies, Southwestern Baptist Theological Seminary Jim Shaddix W. A. Criswell Professor of Expository Preaching, Southeastern Baptist Theological Seminary John N. Oswalt Visiting Distinguished Professor of Old Testament, Asbury Theological Seminary Jack Deere Author & Speaker, Grace Church of St. Louis Juan R. Sanchez Senior Pastor, High Pointe Baptist Church, Austin, Texas Malcolm B. Yarnell, III Research Professor of Systematic Theology, Southwestern Baptist Theological Seminary Jonathan Leeman Editorial Director, 9Marks Mary A. Kassian Author & Director, Girls Gone Wise Mark Daniel Liederbach Vice President & Professor of Theology, Ethics and Culture, Southeastern Baptist Theological Seminary Matthew J. Hall Dean of Boyce College & Senior VP of Academic Innovation, The Southern Baptist Theological Seminary Micah Fries Senior Pastor, Brainerd Baptist Church Nathan Lino Senior Pastor, Northeast Houston Baptist Church Paul Weber President & CEO, Family Policy Alliance Bob Lepine Vice President of Content, FamilyLife Casey B. Hough Senior Pastor, First Baptist Church of Camden Russell Shubin Director, Salem Media Group Allan Coppedge Retired Professor of Theology, Asbury Theological Seminary Daniel DeWitt Director of the Center for Biblical Apologetics & Public Christianity, Cedarville University Charlotte Akin Homemaker, Southeastern Baptist Theological Seminary Don Buckley Physician, Spanish Trail Family Physicians David Schrock Pastor for Preaching and Theology, Occoquan Bible Church E. Calvin Beisner Founder & National Spokesman, Cornwall Alliance for the Stewardship of Creation Donald A. Balasa Adjunct Faculty, Trinity International University Donna Thoennes Adjunct Professor & Homeschool Mom, Biola University James A. Borland Professor of New Testament & Theology, Liberty University Eric C. Redmond Assistant Professor of Bible, Moody Bible Institute Grant Castleberry Pastor of Discipleship, Providence Church of Frisco, Texas Jose Abella Lead Pastor, Providence Road Church Phillip Bethancourt Executive Vice President, Ethics & Religious Liberty Commission Adam W. Greenway Dean, Billy Graham School of Missions, Evangelism, & Ministry, The Southern Baptist Theological Seminary Joy White Homemaker & Assistant Professor of Women's Studies, Cedarville University Gregory Wills Dean, School of Theology, The Southern Baptist Theological Seminary Katie McCoy Assistant Professor of Theology in Women's Studies, Scarborough College at Southwestern Baptist Theological Seminary Rhyne R. Putman Associate Professor of Theology & Culture, New Orleans Baptist Theological Seminary Barry Joslin Professor of Christian Theology, Boyce College Rhonda Kelley President's Wife, Adjunct Faculty, New Orleans Baptist Theological Seminary Peter Jones Executive Director, TruthXchange Bryan Baise Assistant Professor of Philosophy & Apologetics, Boyce College Kenneth Keathley Senior Professor of Theology, Southeastern Baptist Theological Seminary Jeff Struecker Lead Pastor, Calvary Baptist Church Rebecca Jones Volunteer, TruthXchange Evan Lenow Associate Professor of Ethics, Southwestern Baptist Theological Seminary Daniel Patterson Vice President for Operations & Chief of Staff, Ethics & Religious Liberty Commission David Talley Professor of Old Testament, Biola University Travis Wussow Vice President for Public Policy, Ethics & Religious Liberty Commission Sean Perron Chief of Staff, Association of Certified Biblical Counselors Michael L. Brown President, FIRE School of Ministry Keith Whitfield Assistant Professor & Dean, Southeastern Baptist Theological Seminary Jeffrey Riley Professor of Ethics, New Orleans Baptist Theological Seminary Dannah Gresh Co-founder, Pure Freedom Matt Damico Associate Pastor of Worship, Kenwood Baptist Church Colby Adams Director of Communications, The Southern Baptist Theological Seminary Paul Felix President, Los Angeles Bible Training School Dick Lucas Reverend Prebendary, Rector Emeritus, St Helen's Bishopsgate, London Paul Nyquist President, Moody Bible Institute Jackie Hill Perry Speaker, Writer, Humble Beast Recording Artist Colin Smothers Executive Director, Council on Biblical Manhood and Womanhood

      Initial signatories to the Nashville Statement

  10. Aug 2017
    1. Yo u r a i m i s t o d e v e l o p , o r b e c o m e m o r e c o n f i d e n t i n , y o u r p e r s o n a l belief system, by building on what you already know about yourself and the world. By evaluating arguments regarding controversial issues

      Philosophy can be hard to understand, especially with the difficult word choice in some cases and the main idea not being clear right away, but it is supposed to be challenging. If the reader puts the effort into understanding the passages it can be beneficial for them to learn more about their own beliefs and possibly change their views on issues.

    2. Yo u r a i m i s t o d e v e l o p , o r b e c o m e m o r e c o n f i d e n t i n , y o u r p e r s o n a l belief system, by building on what you already know about yourself and the world.

      I like that philosophy is about supporting personal beliefs. It shows why it is so important to have evidence to support your beliefs. I also like that it builds on what I already.

  11. languagedev.wikispaces.com languagedev.wikispaces.com
    1. A word is composed of one or more meaningful linguistic units. The smallest unit of meaning in lanfil@ge is the morpherqe. There are two types of morphemes: (affree morphemes are used alone as words (e.g., house, turtle, book), and (b) bound morphemes must be attached lo free morphemes (e.g., the final-sin houses, the ·l)' in slowly, and the -ing in going).

      Very interesting how grammar skills develop before a child even has an idea of what grammar is

    2. A word is composed of one or more meaningful linguistic units. The smallest unit of meaning in lanfil@ge is the morpherqe. There are two types of morphemes: (affree morphemes are used alone as words (e.g., house, turtle, book), and (b) bound morphemes must be attached lo free morphemes (e.g., the final-sin houses, the ·l)' in slowly, and the -ing in going).

      Morpheme types

    1. B. Omalu, J. L. Hammers, J. Bailes, R. L. Hamilton, M. I. Kamboh, G. Webster, R. P. Fitzsimmons, Chronic traumatic encephalopathy in an Iraqi war veteran with posttraumatic stress disorder who committed suicide. Neurosurg. Focus 31, E3 (2011).

      Omalu et al. presented a single case of CTE in a military veteran. The authors of the present study investigated a controlled case series comparing blast-exposed military veterans and athletes

      Dr. Omalu is perhaps best known as the subject of the movie Concussion, starring Will Smith.

  12. Jul 2017
    1. ures 2(c) and 2(d), quite similar to Figure 2(b′)); 18% of sperm with several tail encirclements of the nucleus (Figures 2(j), 2(k), 2(l), and 2(m), like in Figures 2(f′) and 2(g′)); 15% of sperm with tail coiled around the nucleus more than once (Figures 2(h) and 2(i) as in Figure 2(e′)); 7% of sperm having normally straight tails, as in Figures 2(a) and 2

      a ver

    1. he Vietnam War, the press and the public went too far in blaming the military for what was a top-to-bottom failure of strategy and execu-·tion. But the military itselfrecognized its own failings, and a whole genera-tion ofreformers looked to understand and change the culture. In i978, a military-intelligence veteran named Richard A. Gabriel published, with Paul L. Savage, Crisis in Command: Mismanagement in the Army, which traced many of the failures in Vietnam to the military's having adopted a bureaucratized management style. Three years later, a broadside called Self Destruction: The Disintegration and Decay of the United States Army Dur-ing the Vietnam Era, by a military officer writing under the pen name Cin-cinnatus (later revealed to be a lieutenant colonel serving in the reserves as a military chaplain, Cecil B. Currey), linked problems in Vietnam to the ethical and intellectual shortcomings of the career military. The book was hotly debated-but not dismissed. An article about the book for the Air Force'sAir University Review said that "the author's case is airtight" and that the military's career structure "corrupts those who serve it; it is the system that forces out the best and rewards only the sycophants."

      synthesis paragraph!

    1. Jefferson also included equally lofty language describing the wrongs done to the colonists by their British brethren. They had permitted the king to send both lrirumeu and mercenaries to attack. the coloniaJs md, in so doing, had "given the last stab to agonizing aliectiou." The only course was to "endeavor to forget our former love for"' the British ptople. Here's what Jefferson wrote, ..... ~th some edits by himself, FranUin, and Adams: u this vcn rime tu<I 1hc:~· arc p.:rmittiog ilmr dud r11aglitr.ll( tll k1\d over not ouly "1lclier• of oo 1r common blood. bl.IL Scolch &: fom~1 mcrc:m;incs t.o illVadt 8c. • .i...-y .. 1'~""' "'l dduge us i:11 blood. ihese fact.9 h~vc given 1he bm tW> Lo agonizin~ affection and manyl s11irit hkb us to renounce forever thu..-u11(eding brethr1:n. we must erulcavor IO foritct our fonncr lcwc for chem., and 10 hold the rest ofmanlind. enemitf in war. in peace rricnd~. we ought h;ivc b«n a rrcc & ;a gl'l'al people 1ogctlicr: but 3 cominuniation of gnn<lcur & of freedom 11seems1s bdo" their .ligtnl)-~II'°• SJ™'c iher will ha•·c it: the rmJ ro ~ h.itppincss·•.,.,,., i~ open 1011> 1w: "'C will dirub i1 _,._.i-h1 a scpautcl• sutc. <1nd acquiesce in tltc n~ll.~il) winch I'"' uouncn our .awr.a1.......-c+e1last1145 Adieu! Aud then htre is what Congress did to shat passage: ""-••ttictV.ac chis 'ety tirnc bHJ tfJC: me pumitting; drcit dzidu1agisuare to au1d u+e1 tM o•d) svldiu s ufcxu cunn1rvo blood; but Stvtth Be l\;ccigat auucuaaiics: to juuade & ~ ..... uolFllAll""f"I' ddngc win blood. tbesc f.cta bate gi+en thclast stzb to agornamg Acuon :md na1n I spb it bacb us w 1u1omacc Mc1 cc d1CK m1kdi:ug brcdu cu. nc 11msc u1clc:ac m bJ fuabd om knuiU locc fu1 duc:m;a.1w:J cu IR>ld dtt tat ofnw•kimi mcncics ir1 w;u. 011x:vc c focuds .. we migln ha•c been w 6a &: a il!;IC3L people wgcdtu. but a comu•mnc:tt101t v.'g1andcu1 tl off1ccdcmc it sttnn is bclv" chcn dig:nit:. be il so, snKc the) cciit lracc 1c rhc 1uacl cu glo17 Be lrc1ppi11cu.........-rtsorn tu us tw. we «iJI~ dmdr .~ ........ .,_ ....... i11 a scparnt<l} scare. and ac<iu•('SlC Ul the neco--.1(')' wluch 11">"'nouocc:~our .....,.~,,ulastir1i;Adi:m! _.._.,.._ ~ .... .., \..,~ ............ _ ..... Congress had no interest in Jefferson's sentimental and romantic fantasy of the colonists as jilted lovers.

      Allen continues to reinforce the challenges of passion versus the wants of greater majority in the writing of the declaration of independance

    1. F?R GQ @GMJMEW L QGKNJC RCPKQ,  biology  GQ RFC QRSBW MD JGTGLE MPE?LGQKQ ?LB RFCGP GLRCP?ARGMLQ UGRFMLC ?LMRFCP ?LB RFCGP CLTGPMLKCLRQ. FGQ GQ ? TCPW @PM?B BCDGLGRGML @CA?SQC RFC QAMNC MD @GMJMEW GQ T?QR.GMJMEGQRQ K?W QRSBW ?LWRFGLE DPMK RFC KGAPMQAMNGA MP QS@KGAPMQAMNGA TGCU MD ? ACJJ RM CAMQWQRCKQ?LB RFC UFMJC JGTGLE NJ?LCR ( Figure 1.2 ). GQRCLGLE RM RFC B?GJW LCUQ, WMS UGJJ OSGAIJW PC?JGXC FMUK?LW ?QNCARQ MD @GMJMEW ?PC BGQASQQCB CTCPW B?W. MP CV?KNJC, PCACLR LCUQ RMNGAQ GLAJSBC  E:*9**6  ( Figure 1.3 ) MSR@PC?IQ GL QNGL?AF ?LB  465  AMLR?KGL?RGML GL NC?LSR @SRRCP. RFCP QS@HCARQGLAJSBC CDDMPRQ RMU?PB DGLBGLE ? ASPC DMP , JXFCGKCPsQ BGQC?QC, ?LB A?LACP. L ? EJM@?J QA?JC,K?LW PCQC?PAFCPQ ?PC AMKKGRRCB RM DGLBGLE U?WQ RM NPMRCAR RFC NJ?LCR, QMJTC CLTGPMLKCLR?J GQQSCQ, ?LBPCBSAC RFC CDDCARQ MD AJGK?RC AF?LEC. JJ MD RFCQC BGTCPQC CLBC?TMPQ ?PC PCJ?RCB RM BGDDCPCLR D?ACRQ MD RFCBGQAGNJGLC MD @GMJMEW

      Why is my highlight completely messed up?

  13. Jun 2017
    1. CET CODE : E30 & E241, COMED-K CODE : E016 Programs Home KLE Society'sB. V. Bhoomaraddi College of Engineering & Technology Creating value leveraging knowledge >  About Us >  Admission >  Alumni >  Research >  Placement >  Contact Us         Graduation Day 2016         KLE Tech-BVBCET Bags 4th Place on Debut         Graduation Day 2016    BVB-KLE Tech, Wins National Championship in Hybrid Vehicle Challenge-2016   International conference on 'Enabling Make in India'; Challenges & Opportunities for Engineering Education   International conference on 'Enabling Make in India'; Challenges & Opportunities for Engineering Education    BVBCET Bagged Top Two Prizes in “ICAM - 3D CAR DESIGN CONTEST”    BVBCET’s  “ELECTROBUG” was awarded as the“Fastest Ecokart-2015” 6 - 8 < > News & Events Great News - Walmart Labs has recruited 7 students from CSE/ISE Branches with a Salary Package of 14 Lakhs Walmart Labs has recruited 7 students from CSE/ISE Branches with a Salary Package of 14 Lakhs TEAM VEGADOOTH RACING fromKLE Tech-BVB participated in SAE India SUPRA competition and secured 4th position in their debut year Bagged the Best Engineering Design Award, 2nd in Durability and also finished as Runners-up at the event KLE Tech-BVBBags 4th Place on Debut BVB-KLE Tech Finish asRunners-up in SAE India E-Baja 2017 KLE Tech-BVB Wins National Championship in Hybrid Vehicle Challenge-2016 The BVB-KLE Tech, team competed against 120 teams in the first round and 52 teams from prestigious institutions of India. Upcoming Events   Graduation Day on 06 June 2017 KLE Tech - BVB Bagged Overall Championship in SRISHTI-2016 KLE Tech - BVB Wins “Ultra Golf Kart Championship (UGKC) – 2016” Initiatives KLE Tech - BVB sweeps top prizes at BOSCH - Inscribe 2015 KLE Tech - BVB has won 2nd, 3rd & 4th Prizes at prestigious Bosch Inscribe-2015 ICAM - 3D CAR DESIGN CONTEST BVBCET bagged top two and a consolation prizes in “ICAM - 3D CAR DESIGN CONTEST” organized by SAEINDIA at Chennai   BVB Initiatives   Academic initiatives Engineering Problem Solving and Design ExperienceTo solve complex engineering problems and develop solutions for real life situations, student needs to understand and practice engineering design process. To strengthen the design skills, the college has introduced ‘Engineering Design’ course across the major engineering programs.The course deals with problem solving approach to real life challenges that are generally ill-structured and open ended. It emphasizes on the creative problem solving, using structured approach.The student experiences in the course include: aspects of understanding the customer requirements, identifying the objectives, constraints, defining the problem, establishing the functions, generating alternate solutions to the problem, choosing the best alternative, modeling, analyzing and simulating, building prototype, testing and documenting. Research Experience for Undergraduates (REU)This is an initiative to promote culture of innovation and research in undergraduate students by introducing ‘Research Experience for Undergraduates’ course. The course first of its kind in India, has created a lot of excitement in the students who want to pursue research as their career and has lead to substantial increase in the paper publications by students. Introducing ‘Calculus Reform Movement’ in EngineeringUnderstanding the difficulty students face in appreciating mathematics and mathematics related courses, lead the initiative to bring about reforms in mathematics teaching on the lines of ‘ Calculus reform movement’ of Harvard University consortium. The pedagogy of mathematics teaching in the college follows rule of four i.e. every topic is dealt not only symbolically and numerically but also visually and contextually. Digital tablets with appropriate software help every student in visualising and contextualising mathematical concepts. Social InnovationA course on ‘ Social Innovation has been conceptualized and offered to the students of first year undergraduate engineering. The course was designed in association with ‘ Deshpande Foundation’ with following objectivesa. To build students’ capacity to use problem solving skills to address social issues through innovative solutions.b. To transform students' perspective on the world around them by enabling them to identify areas ripe for innovation.The course successfully implemented from last four years is first of its kind in India. Every year, over 200 projects in social space are done by First year undergraduate engineering students, which help them to connect with societal issues. Emphasis on Experiential LearningCurriculum design puts high emphasis on experiential learning by introducing Course projects, Mini-Projects, and Industry Internships. Mini-projects vertically integrated with each of the curriculum threads of the program, are carried out by the students in the pre-final year and provide an opportunity to integrate knowledge and skills acquired in a set of courses belonging to the curriculum thread to solve complex engineering problems.Introduction of mini-projects also provides sufficient resolution to directly assess student learning outcomes in each of the curriculum threads. As these projects are carried out in teams, students are able to develop and demonstrate several professional competencies that are critical for engineering practice. Innovations in teaching learning processesKeeping in mind lack of focus on education research, the college started Centre for Engineering Education Research (CEER) with an objective of bringing out innovations in curriculum frameworks, pedagogy and assessment. The centre inspired by Indo-US Collaboration for Engineering Education (IUCEE) has enabled the college to adopt Outcome Based Education Framework (OBE) and carry out many innovations in teaching learning practices and assessment. The centre also undertakes outreach activities and has trained over 1000 faculty of other engineering colleges. A group of faculty headed by Principal is recognised by ‘International Institute for Developing Engineering Academics (IIDEA)’, USA as OBE trainers. (only group recognised in India) .          Learning Factory  BVB CTIE(Centre for Technology Innovation and Entrepreneurship)Unleashing the vast potential of human resources in Tier –II cities by creating and supporting entrepreneurship can reshape the socio-economic landscape of the Nations. BVB has taken initiation to setup ‘Center for Technology Innovation and Entrepreneurship’ (BVB-CTIE), to drive, promote and support entrepreneurial community in the region.Read More... Education ResearchCentre for Engineering Education Research (CEER)Academic Autonomy granted to BVBCET in 2007 offered an opportunity to innovate and excel in Engineering Education. This also came with the responsibility of performing to the expectations of all the stake holders including the regulatory bodies. It was at this time that the leadership of the system invested in collaborations to elevate itself to the next level of performance.The first such collaboration which gave the sound foundation was with Indo US Collaboration for Engineering Education (IUCEE). The faculty leadership institutes (FLIs) organised by IUCEE in 2008 and 2009 gave the exposure to global best practices of Engineering Education leading to sprouting of innovations in teaching –learning space showing visible results.Read More... Industry Partnership It is essential that the institute continues to strengthen its association with the industries to enhance its student learning experience and relevance of its research activities. > Academic QualityEngineering education is going through a profound transformation driven by the new realities and opportunities created by the global knowledge society.> IT Platforms and Services > Governance > Student accolades > Community Radio Station > Life@BVB @kate_fox Campus Student Life Sports Clubs Social Life BVB Campus  Spread over a luxurious 50 acres, the picturesque campus comprises of various buildings with striking architecture. With state-of-the-art classrooms & laboratories, BVB gives the best opportunity for complete development of the students. Student Life BVB has around 4000 students on campus with over 2000 living on the campus in hostel. Students can avail the numerous resources on campus like the 24 hours library and ever active WiFi service. Sports Students at BVB have access to a all kinds of sports like Cricket, Volleyball, Basketball etc. to compete in the VTU annual sports meet. Moreover there are several clubs formed by the students themselves which conduct many extra curricular activites. Clubs Social Life BVB is the first college in State to introduce Humanities department which helps the engineers realise their social responsibilities through courses like Social Innovation. Students at BVB can also carry out social work with assistance of Deshpande Center for Social Entreprenuership (DCSE). BVB CTIE Examination E results BVB Alumni BVB Campusconnect BVB Pleiades BVB Media Moodle Portal B. V. Bhoomaraddi College of Engineering & Technology   Vidyanagar, Hubli 580 031. Karnataka - India. Tel. : +91 - 836 - 2374150, 2378123 Fax : +91 - 836 - 2374985 E-mail : infodesk@bvb.edu Quick Links   Annual Report TEQIP Mandatory Disclosures GENERAL INFORMATION OF THE COLLEGE if (document.location.protocol != 'https:') document.write('\x3Cscript src="http://musecdn2.businesscatalyst.com/scripts/4.0/jquery-1.8.3.min.js" type="text/javascript">\x3C/script>'); window.jQuery || document.write('\x3Cscript src="scripts/jquery-1.8.3.min.js?crc=209076791" type="text/javascript">\x3C/script>'); window.Muse.assets.check=function(d){if(!window.Muse.assets.checked){window.Muse.assets.checked=!0;var b={},c=function(a,b){if(window.getComputedStyle){var c=window.getComputedStyle(a,null);return c&&c.getPropertyValue(b)||c&&c[b]||""}if(document.documentElement.currentStyle)return(c=a.currentStyle)&&c[b]||a.style&&a.style[b]||"";return""},a=function(a){if(a.match(/^rgb/))return a=a.replace(/\s+/g,"").match(/([\d\,]+)/gi)[0].split(","),(parseInt(a[0])<<16)+(parseInt(a[1])<<8)+parseInt(a[2]);if(a.match(/^\#/))return parseInt(a.substr(1), 16);return 0},g=function(g){for(var f=document.getElementsByTagName("link"),h=0;h<f.length;h++)if("text/css"==f[h].type){var i=(f[h].href||"").match(/\/?css\/([\w\-]+\.css)\?crc=(\d+)/);if(!i||!i[1]||!i[2])break;b[i[1]]=i[2]}f=document.createElement("div");f.className="version";f.style.cssText="display:none; width:1px; height:1px;";document.getElementsByTagName("body")[0].appendChild(f);for(h=0;h<Muse.assets.required.length;){var i=Muse.assets.required[h],l=i.match(/([\w\-\.]+)\.(\w+)$/),k=l&&l[1]? l[1]:null,l=l&&l[2]?l[2]:null;switch(l.toLowerCase()){case "css":k=k.replace(/\W/gi,"_").replace(/^([^a-z])/gi,"_$1");f.className+=" "+k;k=a(c(f,"color"));l=a(c(f,"backgroundColor"));k!=0||l!=0?(Muse.assets.required.splice(h,1),"undefined"!=typeof b[i]&&(k!=b[i]>>>24||l!=(b[i]&16777215))&&Muse.assets.outOfDate.push(i)):h++;f.className="version";break;case "js":h++;break;default:throw Error("Unsupported file type: "+l);}}d?d().jquery!="1.8.3"&&Muse.assets.outOfDate.push("jquery-1.8.3.min.js"):Muse.assets.required.push("jquery-1.8.3.min.js"); f.parentNode.removeChild(f);if(Muse.assets.outOfDate.length||Muse.assets.required.length)f="Some files on the server may be missing or incorrect. Clear browser cache and try again. If the problem persists please contact website author.",g&&Muse.assets.outOfDate.length&&(f+="\nOut of date: "+Muse.assets.outOfDate.join(",")),g&&Muse.assets.required.length&&(f+="\nMissing: "+Muse.assets.required.join(",")),alert(f)};location&&location.search&&location.search.match&&location.search.match(/muse_debug/gi)?setTimeout(function(){g(!0)},5E3):g()}}; var muse_init=function(){require.config({baseUrl:""});require(["jquery","museutils","whatinput","jquery.watch","jquery.musemenu","webpro","musewpslideshow","jquery.museoverlay","touchswipe","musewpdisclosure"],function(d){var $ = d;$(document).ready(function(){try{ window.Muse.assets.check($);/* body */ Muse.Utils.transformMarkupToFixBrowserProblemsPreInit();/* body */ Muse.Utils.prepHyperlinks(true);/* body */ Muse.Utils.resizeHeight('.browser_width');/* resize height */ Muse.Utils.requestAnimationFrame(function() { $('body').addClass('initialized'); });/* mark body as initialized */ Muse.Utils.fullPage('#page');/* 100% height page */ Muse.Utils.initWidget('.MenuBar', ['#bp_infinity'], function(elem) { return $(elem).museMenu(); });/* unifiedNavBar */ Muse.Utils.initWidget('#slideshowu565', ['#bp_infinity'], function(elem) { var widget = new WebPro.Widget.ContentSlideShow(elem, {autoPlay:true,displayInterval:5000,slideLinkStopsSlideShow:false,transitionStyle:'horizontal',lightboxEnabled_runtime:false,shuffle:true,transitionDuration:500,enableSwipe:true,elastic:'off',resumeAutoplay:true,resumeAutoplayInterval:5000,playOnce:false,autoActivate_runtime:false}); $(elem).data('widget', widget); return widget; });/* #slideshowu565 */ Muse.Utils.initWidget('#accordionu3323', ['#bp_infinity'], function(elem) { return new WebPro.Widget.Accordion(elem, {canCloseAll:false,defaultIndex:0}); });/* #accordionu3323 */ Muse.Utils.initWidget('#accordionu3113', ['#bp_infinity'], function(elem) { return new WebPro.Widget.Accordion(elem, {canCloseAll:false,defaultIndex:0}); });/* #accordionu3113 */ Muse.Utils.initWidget('#pamphletu3616', ['#bp_infinity'], function(elem) { return new WebPro.Widget.ContentSlideShow(elem, {contentLayout_runtime:'stack',event:'click',deactivationEvent:'',autoPlay:false,displayInterval:3000,transitionStyle:'fading',transitionDuration:500,hideAllContentsFirst:false,shuffle:false,enableSwipe:true,resumeAutoplay:true,resumeAutoplayInterval:3000,playOnce:false,autoActivate_runtime:false}); });/* #pamphletu3616 */ Muse.Utils.showWidgetsWhenReady();/* body */ Muse.Utils.transformMarkupToFixBrowserProblems();/* body */ }catch(b){if(b&&"function"==typeof b.notify?b.notify():Muse.Assert.fail("Error calling selector function: "+b),false)throw b;}})})}; console.log("Headliner (Version 2.1) - MuseThemes"); /* * Headliner (Version 2.0) - MuseThemes * * Original Script http://jsfiddle.net/i_heart_php/o45Loeo1/ * Under MIT License * * Customized by MuseThemes * */ jQuery(document).ready(function($){ if ($('.walmart').parent('a').length) { var href = $('.walmart').parent('a').attr('href'); var target = typeof($('.walmart').parent('a').attr('target')) != 'undefined' ? $('.walmart').parent('a').attr('target') : '_self'; $('#u13460 .mt-word-1').append($('.walmart').html()).addClass('walmart').wrapInner('<a href='+href+' target='+target+'></a>'); $('[class^=walmart]').parent('a').hide(); } else if ($('a.walmart').length) { var href = $('a.walmart').attr('href'); var target = typeof($('a.walmart').attr('target')) != 'undefined' ? $('a.walmart').attr('target') : '_self'; $('#u13460 .mt-word-1').append($('.walmart').html()).addClass('walmart').wrapInner('<a href='+href+' target='+target+'></a>'); $('a.walmart').hide(); } else { $('#u13460 .mt-word-1').append($('.walmart').html()).addClass('walmart'); $('[class^=walmart]').hide(); } if ($('.mt-headliner-2').parent('a').length) { var href = $('.mt-headliner-2').parent('a').attr('href'); var target = typeof($('.mt-headliner-2').parent('a').attr('target')) != 'undefined' ? $('.mt-headliner-2').parent('a').attr('target') : '_self'; $('#u13460 .mt-word-2').append($('.mt-headliner-2').html()).addClass('mt-headliner-2').wrapInner('<a href='+href+' target='+target+'></a>'); $('[class^=mt-headliner-2]').parent('a').hide(); } else if ($('a.mt-headliner-2').length) { var href = $('a.mt-headliner-2').attr('href'); var target = typeof($('a.mt-headliner-2').attr('target')) != 'undefined' ? $('a.mt-headliner-2').attr('target') : '_self'; $('#u13460 .mt-word-2').append($('.mt-headliner-2').html()).addClass('mt-headliner-2').wrapInner('<a href='+href+' target='+target+'></a>'); $('a.mt-headliner-2').hide(); } else { $('#u13460 .mt-word-2').append($('.mt-headliner-2').html()).addClass('mt-headliner-2'); $('[class^=mt-headliner-2]').hide(); } if ($('.mt-headliner-3').parent('a').length) { var href = $('.mt-headliner-3').parent('a').attr('href'); var target = typeof($('.mt-headliner-3').parent('a').attr('target')) != 'undefined' ? $('.mt-headliner-3').parent('a').attr('target') : '_self'; $('#u13460 .mt-word-3').append($('.mt-headliner-3').html()).addClass('mt-headliner-3').wrapInner('<a href='+href+' target='+target+'></a>'); $('[class^=mt-headliner-3]').parent('a').hide(); } else if ($('a.mt-headliner-3').length) { var href = $('a.mt-headliner-3').attr('href'); var target = typeof($('a.mt-headliner-3').attr('target')) != 'undefined' ? $('a.mt-headliner-3').attr('target') : '_self'; $('#u13460 .mt-word-3').append($('.mt-headliner-3').html()).addClass('mt-headliner-3').wrapInner('<a href='+href+' target='+target+'></a>'); $('a.mt-headliner-3').hide(); } else { $('#u13460 .mt-word-3').append($('.mt-headliner-3').html()).addClass('mt-headliner-3'); $('[class^=mt-headliner-3]').hide(); } if ($('.mt-headliner-4').parent('a').length) { var href = $('.mt-headliner-4').parent('a').attr('href'); var target = typeof($('.mt-headliner-4').parent('a').attr('target')) != 'undefined' ? $('.mt-headliner-4').parent('a').attr('target') : '_self'; $('#u13460 .mt-word-4').append($('.mt-headliner-4').html()).addClass('mt-headliner-4').wrapInner('<a href='+href+' target='+target+'></a>'); $('[class^=mt-headliner-4]').parent('a').hide(); } else if ($('a.mt-headliner-4').length) { var href = $('a.mt-headliner-4').attr('href'); var target = typeof($('a.mt-headliner-4').attr('target')) != 'undefined' ? $('a.mt-headliner-4').attr('target') : '_self'; $('#u13460 .mt-word-4').append($('.mt-headliner-4').html()).addClass('mt-headliner-4').wrapInner('<a href='+href+' target='+target+'></a>'); $('a.mt-headliner-4').hide(); } else { $('#u13460 .mt-word-4').append($('.mt-headliner-4').html()).addClass('mt-headliner-4'); $('[class^=mt-headliner-4]').hide(); } if ($('.mt-headliner-5').parent('a').length) { var href = $('.mt-headliner-5').parent('a').attr('href'); var target = typeof($('.mt-headliner-5').parent('a').attr('target')) != 'undefined' ? $('.mt-headliner-5').parent('a').attr('target') : '_self'; $('#u13460 .mt-word-5').append($('.mt-headliner-5').html()).addClass('mt-headliner-5').wrapInner('<a href='+href+' target='+target+'></a>'); $('[class^=mt-headliner-5]').parent('a').hide(); } else if ($('a.mt-headliner-5').length) { var href = $('a.mt-headliner-5').attr('href'); var target = typeof($('a.mt-headliner-5').attr('target')) != 'undefined' ? $('a.mt-headliner-5').attr('target') : '_self'; $('#u13460 .mt-word-5').append($('.mt-headliner-5').html()).addClass('mt-headliner-5').wrapInner('<a href='+href+' target='+target+'></a>'); $('a.mt-headliner-5').hide(); } else { $('#u13460 .mt-word-5').append($('.mt-headliner-5').html()).addClass('mt-headliner-5'); $('[class^=mt-headliner-5]').hide(); } if ($('.mt-headliner-6').parent('a').length) { var href = $('.mt-headliner-6').parent('a').attr('href'); var target = typeof($('.mt-headliner-6').parent('a').attr('target')) != 'undefined' ? $('.mt-headliner-6').parent('a').attr('target') : '_self'; $('#u13460 .mt-word-6').append($('.mt-headliner-6').html()).addClass('mt-headliner-6').wrapInner('<a href='+href+' target='+target+'></a>'); $('[class^=mt-headliner-6]').parent('a').hide(); } else if ($('a.mt-headliner-6').length) { var href = $('a.mt-headliner-6').attr('href'); var target = typeof($('a.mt-headliner-6').attr('target')) != 'undefined' ? $('a.mt-headliner-6').attr('target') : '_self'; $('#u13460 .mt-word-6').append($('.mt-headliner-6').html()).addClass('mt-headliner-6').wrapInner('<a href='+href+' target='+target+'></a>'); $('a.mt-headliner-6').hide(); } else { $('#u13460 .mt-word-6').append($('.mt-headliner-6').html()).addClass('mt-headliner-6'); $('[class^=mt-headliner-6]').hide(); } if ($('.mt-headliner-7').parent('a').length) { var href = $('.mt-headliner-7').parent('a').attr('href'); var target = typeof($('.mt-headliner-7').parent('a').attr('target')) != 'undefined' ? $('.mt-headliner-7').parent('a').attr('target') : '_self'; $('#u13460 .mt-word-7').append($('.mt-headliner-7').html()).addClass('mt-headliner-7').wrapInner('<a href='+href+' target='+target+'></a>'); $('[class^=mt-headliner-7]').parent('a').hide(); } else if ($('a.mt-headliner-7').length) { var href = $('a.mt-headliner-7').attr('href'); var target = typeof($('a.mt-headliner-7').attr('target')) != 'undefined' ? $('a.mt-headliner-7').attr('target') : '_self'; $('#u13460 .mt-word-7').append($('.mt-headliner-7').html()).addClass('mt-headliner-7').wrapInner('<a href='+href+' target='+target+'></a>'); $('a.mt-headliner-7').hide(); } else { $('#u13460 .mt-word-7').append($('.mt-headliner-7').html()).addClass('mt-headliner-7'); $('[class^=mt-headliner-7]').hide(); } if ($('.mt-headliner-8').parent('a').length) { var href = $('.mt-headliner-8').parent('a').attr('href'); var target = typeof($('.mt-headliner-8').parent('a').attr('target')) != 'undefined' ? $('.mt-headliner-8').parent('a').attr('target') : '_self'; $('#u13460 .mt-word-8').append($('.mt-headliner-8').html()).addClass('mt-headliner-8').wrapInner('<a href='+href+' target='+target+'></a>'); $('[class^=mt-headliner-8]').parent('a').hide(); } else if ($('a.mt-headliner-8').length) { var href = $('a.mt-headliner-8').attr('href'); var target = typeof($('a.mt-headliner-8').attr('target')) != 'undefined' ? $('a.mt-headliner-8').attr('target') : '_self'; $('#u13460 .mt-word-8').append($('.mt-headliner-8').html()).addClass('mt-headliner-8').wrapInner('<a href='+href+' target='+target+'></a>'); $('a.mt-headliner-8').hide(); } else { $('#u13460 .mt-word-8').append($('.mt-headliner-8').html()).addClass('mt-headliner-8'); $('[class^=mt-headliner-8]').hide(); } if ($('.mt-headliner-9').parent('a').length) { var href = $('.mt-headliner-9').parent('a').attr('href'); var target = typeof($('.mt-headliner-9').parent('a').attr('target')) != 'undefined' ? $('.mt-headliner-9').parent('a').attr('target') : '_self'; $('#u13460 .mt-word-9').append($('.mt-headliner-9').html()).addClass('mt-headliner-9').wrapInner('<a href='+href+' target='+target+'></a>'); $('[class^=mt-headliner-9]').parent('a').hide(); } else if ($('a.mt-headliner-9').length) { var href = $('a.mt-headliner-9').attr('href'); var target = typeof($('a.mt-headliner-9').attr('target')) != 'undefined' ? $('a.mt-headliner-9').attr('target') : '_self'; $('#u13460 .mt-word-9').append($('.mt-headliner-9').html()).addClass('mt-headliner-9').wrapInner('<a href='+href+' target='+target+'></a>'); $('a.mt-headliner-9').hide(); } else { $('#u13460 .mt-word-9').append($('.mt-headliner-9').html()).addClass('mt-headliner-9'); $('[class^=mt-headliner-9]').hide(); } if ($('.mt-headliner-10').parent('a').length) { var href = $('.mt-headliner-10').parent('a').attr('href'); var target = typeof($('.mt-headliner-10').parent('a').attr('target')) != 'undefined' ? $('.mt-headliner-10').parent('a').attr('target') : '_self'; $('#u13460 .mt-word-10').append($('.mt-headliner-10').html()).addClass('mt-headliner-10').wrapInner('<a href='+href+' target='+target+'></a>'); $('[class^=mt-headliner-10]').parent('a').hide(); } else if ($('a.mt-headliner-10').length) { var href = $('a.mt-headliner-10').attr('href'); var target = typeof($('a.mt-headliner-10').attr('target')) != 'undefined' ? $('a.mt-headliner-10').attr('target') : '_self'; $('#u13460 .mt-word-10').append($('.mt-headliner-10').html()).addClass('mt-headliner-10').wrapInner('<a href='+href+' target='+target+'></a>'); $('a.mt-headliner-10').hide(); } else { $('#u13460 .mt-word-10').append($('.mt-headliner-10').html()).addClass('mt-headliner-10'); $('[class^=mt-headliner-10]').hide(); } //set animation timing var animationDelayu13460 = 2000, //loading bar effect barAnimationDelayu13460 = 3800, barWaiting = barAnimationDelayu13460 - 3000, //3000 is the duration of the transition on the loading bar - set in the scss/css file //letters effect lettersDelayu13460 = 50, //type effect typeLettersDelayu13460 = 50, selectionDurationu13460 = 1000, typeAnimationDelayu13460 = selectionDurationu13460 + 800, //clip effect revealDurationu13460 = 600, revealAnimationDelayu13460 = 1500; initHeadline(); function initHeadline() { //insert <i> element for each letter of a changing word singleLetters($('#u13460 .mt-headline.letters .mt-words-wrapper').find('div')); //initialise headline animation animateHeadline($('#u13460 .mt-headline')); } function singleLetters($words) { $words.each(function(){ var word = $(this), letters = word.text().split(''), selected = word.hasClass('is-visible'); for (i in letters) { if(word.parents('.rotate-2').length > 0) letters[i] = '<em>' + letters[i] + '</em>'; letters[i] = (selected) ? '<i class="in">' + letters[i] + '</i>': '<i>' + letters[i] + '</i>'; } var newLetters = letters.join(''); word.html(newLetters).css('opacity', 1); }); } function animateHeadline($headlines) { var duration = animationDelayu13460; $headlines.each(function(){ var headline = $(this); if(headline.hasClass('loading-bar')) { duration = barAnimationDelayu13460; setTimeout(function(){ headline.find('.mt-words-wrapper').addClass('is-loading') }, barWaiting); } else if (headline.hasClass('clip')){ var spanWrapper = headline.find('.mt-words-wrapper'), newWidth = spanWrapper.width() + 10 spanWrapper.css('width', newWidth); } else if (!headline.hasClass('type') ) { //assign to .mt-words-wrapper the width of its longest word var words = headline.find('.mt-words-wrapper div'), width = 0; words.each(function(){ var wordWidth = $(this).width(); if (wordWidth > width) width = wordWidth; }); headline.find('.mt-words-wrapper').css('width', width); }; //trigger animation setTimeout(function(){ hideWord( headline.find('.is-visible').eq(0) ) }, duration); }); } function hideWord($word) { var nextWord = takeNext($word); if($word.parents('#u13460 .mt-headline').hasClass('type')) { if(!$word.is(':last-child') || true) { var parentSpan = $word.parent('.mt-words-wrapper'); parentSpan.addClass('selected').removeClass('waiting'); setTimeout(function(){ parentSpan.removeClass('selected'); $word.removeClass('is-visible').addClass('is-hidden').children('i').removeClass('in').addClass('out'); }, selectionDurationu13460); setTimeout(function(){ showWord(nextWord, typeLettersDelayu13460) }, typeAnimationDelayu13460); } } else if($word.parents('#u13460 .mt-headline').hasClass('letters')) { if(!$word.is(':last-child') || true) { var bool = ($word.children('i').length >= nextWord.children('i').length) ? true : false; hideLetter($word.find('i').eq(0), $word, bool, lettersDelayu13460); showLetter(nextWord.find('i').eq(0), nextWord, bool, lettersDelayu13460); } } else if($word.parents('#u13460 .mt-headline').hasClass('clip')) { if(!$word.is(':last-child') || true) { $word.parents('.mt-words-wrapper').animate({ width : '2px' }, revealDurationu13460, function(){ if(!$word.is(':last-child') || true) { switchWord($word, nextWord); showWord(nextWord); } }); } } else if ($word.parents('#u13460 .mt-headline').hasClass('loading-bar')){ $word.parents('.mt-words-wrapper').removeClass('is-loading'); if(!$word.is(':last-child') || true) { switchWord($word, nextWord); setTimeout(function(){ hideWord(nextWord) }, barAnimationDelayu13460); setTimeout(function(){ $word.parents('.mt-words-wrapper').addClass('is-loading') }, barWaiting); } } else { if(!$word.is(':last-child') || true) { switchWord($word, nextWord); setTimeout(function(){ hideWord(nextWord) }, animationDelayu13460); } } } function showWord($word, $duration) { if($word.parents('#u13460 .mt-headline').hasClass('type')) { showLetter($word.find('i').eq(0), $word, false, $duration); $word.addClass('is-visible').removeClass('is-hidden'); } else if($word.parents('#u13460 .mt-headline').hasClass('clip')) { $word.parents('.mt-words-wrapper').animate({ 'width' : $word.width() + 10 }, revealDurationu13460, function(){ setTimeout(function(){ hideWord($word) }, revealAnimationDelayu13460); }); } } function hideLetter($letter, $word, $bool, $duration) { $letter.removeClass('in').addClass('out'); if(!$letter.is(':last-child')) { setTimeout(function(){ hideLetter($letter.next(), $word, $bool, $duration); }, $duration); } else if($bool) { setTimeout(function(){ hideWord(takeNext($word)) }, animationDelayu13460); } if($letter.is(':last-child') && $('html').hasClass('no-csstransitions')) { var nextWord = takeNext($word); if(!$word.is(':last-child') || true) { switchWord($word, nextWord); } } } function showLetter($letter, $word, $bool, $duration) { $letter.addClass('in').removeClass('out'); if(!$letter.is(':last-child')) { setTimeout(function(){ showLetter($letter.next(), $word, $bool, $duration); }, $duration); } else { if($word.parents('#u13460 .mt-headline').hasClass('type')) { setTimeout(function(){ $word.parents('.mt-words-wrapper').addClass('waiting'); }, 200);} if(!$bool) { setTimeout(function(){ hideWord($word) }, animationDelayu13460) } } } function takeNext($word) { return (!$word.is(':last-child')) ? $word.next() : $word.parent().children().eq(0); } function takePrev($word) { return (!$word.is(':first-child')) ? $word.prev() : $word.parent().children().last(); } function switchWord($oldWord, $newWord) { $oldWord.removeClass('is-visible').addClass('is-hidden'); $newWord.removeClass('is-hidden').addClass('is-visible'); } });

      BVB SITE

  14. May 2017
    1. volksschauspielhaften

      <font color="steelblue" face="arial" size="4"> **volksschauspielhaften**</font><font color="black" face="arial" size="3"></font>

      <font color="black" face="arial" size="3">

      trans. folk spectacle stick

      ____________________

      </font><font color="steelblue" face="arial" size="4"> **Volk**</font><font color="black" face="arial" size="3"></font>

      <font color="black" face="arial" size="3">

      n. n; -(e)s, Völker 

      1. people; (Nation) auch nation; das deutsche Volk the Germans, the German people (oder nation); die Völker Afrikas the peoples of Africa

      2. nur Sg. (Einwohner) people Pl.; (Masse) the masses Pl.; pej. auch hoi polloi, the plebs Pl.; (Pöbel) mob, rabble; die gewählten Vertreter des Volkes the people's elected representatives; im Namen des Volkes in the name of the people; Volkes Stimme geh. the voice of the people; das Volk Gottes REL God's chosen people, the elect; ein Mann aus dem Volke a man of the people; ein Gerücht etc. unters Volk bringen fam. spread a rumo(u)r etc.; etwas unters Volk bringen fam. (verkaufen) sell, get rid of; sich unters Volk mischen mingle with the crowd; blödes Volk! beleidigend: you stupid lot! fam.; * auserwählt, fahrendII 2*

      ____________________

      </font><font color="steelblue" face="arial" size="4"> **fahrend**</font><font color="black" face="arial" size="3"></font>

      <font color="black" face="arial" size="3">

      adj. 

      I Part. Präs. fahren 

      II Adj. 

      1. Fahrzeug: moving; auf den fahrenden Zug aufspringen jump on the moving train (fig. on the bandwagon)

      2. (wandernd) travel(l)ing, itinerant; fahrender Ritter HIST knight errant; fahrender Sänger HIST wandering minstrel; fahrendes Volk travel(l)ers, Am. gypsies, migrants

      ____________________

      </font><font color="steelblue" face="arial" size="4"> **fahren**</font><font color="black" face="arial" size="3"></font>

      <font color="black" face="arial" size="3">

      n. fährt, fuhr, gefahren 

      I v/i. (ist);

      1. Person: (auch reisen) go (mit by); selbst lenkend: drive; auf Fahrrad, Motorrad: ride; längere Strecke: travel (by); auf Schiff: sail; mit dem Aufzug/Bus etc. fahren auch take the lift (Am. elevator) / a (oder the) bus etc.; ich fahre öffentlich (mit öffentlichen Verkehrsmitteln) I use (oder go by) public transport (Am. transportation); fahr rechts (bleib rechts) keep to the right; (bieg rechts ab) turn right; an den Straßenrand fahren pull over to the side of the road; nach Köln fährt man sieben Stunden mit dem Auto: it's a seven-hour drive to Cologne; mit dem Zug: it's a seven-hour train journey to Cologne, it's seven hours on the train to Cologne; langsamer/schneller fahren slow down / accelerate; über einen Fluss etc. fahren cross a river etc.; ich will noch mal fahren auf Karussell etc.: I want another ride

      2. (abfahren) leave, go; wir fahren in fünf Minuten we're leaving in five minutes

      3. (in Fahrt sein) be moving; * fahrend II 1* 

      4. Fähigkeit: sie fährt gut/schlecht she's a good/bad driver

      5. (verkehren) run; das Boot/der Zug fährt zweimal am Tag the boat/train goes twice a day, there are two sailings / two trains a day

      6. AUT etc. (funktionieren) go, run; das Auto fährt nicht (ist kaputt) the car isn't going (oder won't go); das Auto fährt ruhig the car is quiet(-running); mit Benzin/Diesel fahren Fahrzeug: run on petrol (Am. gas) /diesel; Person: have a petrol- (Am. gas) /diesel-engine car; mit Strom fahren be driven by electric power; mit Dampf fahren be steam-driven

      7. mit der Hand etc. durch/über etwas (Akk.) fahren run one's hand etc. through/over s.th.

      8. in etwas (Akk.) fahren Kugel, Messer etc.: go into s.th.; Blitz: hit (oder strike) s.th.; in die Kleider fahren slip into (oder slip on) one's clothes; aus dem Bett fahren jump (oder leap) out of bed; der Hund fuhr ihm an die Kehle the dog leapt at his throat; * Himmel 2, Hölle 1* 

      9. etwas fahren lassen (loslassen) let go of s.th.; alle Hoffnung etc. fahren lassen fig. give up (oder abandon) all hope; einen fahren lassen fam. let one go, fart vulg. 

      10. fig.: sie ist sehr gut/schlecht damit gefahren she did very well/badly out of it; was ist nur in ihn gefahren? what's got into him?; der Schreck fuhr ihm in die Glieder he froze with terror; * Haut 4*, Mund etc. 

      II v/t. 

      1. (hat); (lenken, besitzen) drive; (Fahrrad, Motorrad) ride; er hat das Auto gegen den Zaun gefahren he drove the car into the fence; ein Auto zu Schrott fahren drive a car into the ground; bei einem Unfall: write a car off, Am. total a car; ein Schiff auf Grund fahren run a ship aground; jemanden über den Haufen fahren fam. knock s.o. down, run s.o. over

      2. (hat); (befördern) take, drive; (Güter) auch transport; ** spazieren 

      3. (ist); (Aufzug, Skilift) ride in; (Karussell, U-Bahn etc.) ride on; (Segelboot) sail; (Ruderboot) row; Boot fahren go boating; Rad fahren cycle; Roller fahren scooter; (Motorroller) ride a scooter; Schlittschuh fahren skate; Schlitten fahren (rodeln) toboggan; (Pferdeschlitten) ride in a sledge (Am. sleigh); Ski fahren ski

      4. (hat oder ist); (Strecke) cover, travel; (Kurve, anderen Weg etc.) take; (Umleitung) follow; (Rennen) take part in; (Umweg) make; sie fuhren eine andere Strecke they took a different route; Kurven fahren weave about (Am. back and forth); Slalom fahren do a slalom

      5. (hat oder ist); (Zeit) record, clock; (Rekord) set; wir fuhren gerade 100 km/h, als ... we were doing 62 mph when ...; das Auto fährt 200 km/h (leistet) the car will do (oder can reach) 124 mph

      6. (hat); (Normal, Super) use, run on

      7. TECH (Hochofen) operate; INFORM (Programm) run

      8. (Sonderschicht) work

      III v/refl. (hat): dieser Wagen fährt sich gut this car is pleasant to drive (oder handles well); unpers.: auf dieser Straße fährt es sich gut this is a good road to drive on

      ____________________

      </font><font color="steelblue" face="arial" size="4"> **Himmel**</font><font color="black" face="arial" size="3"></font>

      <font color="black" face="arial" size="3">

      n. m; -s, - (Pl. selten, meist poet.) 

      1. sky; MET auch skies Pl.; lit. heavens Pl.; am Himmel in the sky; unter freiem Himmel in the open air; unter südlichem Himmel under southern skies; der Rauch steigt zum Himmel (auf) the smoke is rising up into the sky; der Himmel lacht fig. (die Sonne scheint) the sun has got his hat on

      2. REL heaven; im Himmel in heaven; in den Himmel kommen go to heaven; zum oder in den Himmel auffahren oder gen Himmel fahren bibl. ascend into heaven; im Himmel sein euph. be with the angels; Himmel und Hölle in Bewegung setzen fig. move heaven and earth; Himmel und Hölle Hüpfspiel: hopscotch

      3. fig. heaven, paradise; der Himmel auf Erden geh. heaven on earth; den Himmel auf Erden haben geh. live in paradise; aus heiterem Himmel fam. (completely) out of the blue; in den Himmel heben fam. praise to the skies; im sieb(en)ten Himmel sein oder sich [wie] im sieb[en]ten Himmel fühlen fam. be on cloud nine, be walking on air, be in the seventh heaven; ihm hängt der Himmel voller Geigen geh. he thinks life's a bed of roses; das schreit oder fam. stinkt zum Himmel it's a scandal; vom Himmel fallen appear from nowhere; ... fallen nicht (einfach) vom Himmel ... don't grow on trees; Erfolge, Fortschritte etc.: don't (just) happen by themselves; Wolken am politischen Himmel clouds on the political horizon; * Meister 2* 

      4. in Ausrufen: dem Himmel sei Dank! thank heavens!; der Himmel ist oder sei mein Zeuge! altm. as God is my witness!; gütiger oder du lieber Himmel! fam. my goodness!, good Heavens!; um Himmels willen! for Heaven's (oder God's) sake!; weiß der Himmel! fam. God knows; Himmel (noch mal oder Herrgott, Sakrament)! fam. for heaven's sake!; Himmel, Arsch und Zwirn oder Wolkenbruch Sl. bloody hell, Am. holy smoke

      5. vom Bett etc.: canopy; im Auto: roof; fam. (Gaumen) roof of one's mouth

      ____________________

      </font><font color="steelblue" face="arial" size="4"> **Haut**</font><font color="black" face="arial" size="3"></font>

      <font color="black" face="arial" size="3">

      n. f; -, Häute 

      1. meist Sg. skin; helle/dunkle Haut haben have a fair/dark skin; nass bis auf die Haut soaked to the skin; auf bloßer Haut tragen wear next to one's skin; er trägt die Jacke auf der bloßen Haut auch he's got nothing on under his jacket; sich (Dat.) die Haut aufschürfen graze o.s.; sich (Dat.) die Haut an den Knien etc. aufschürfen skin (oder graze) one's knees etc.; viel Haut zeigen fam. hum. Person: show a lot of bare flesh, be scantily clad; Kleidung: be very revealing

      2. abgezogene, von kleinem Tier: skin; von großem Tier: hide; abgeworfene, einer Schlange etc.: slough; auf Braten: skin; einem Tier die Haut abziehen skin an animal

      3. einer Frucht: skin; meist entfernt: peel; einer Wurst, auf der Milch: skin; auf Flüssigkeiten: film; (Membran) membrane; um Organe: tunic; am Fingernagel: cuticle; TECH, eines Ballons, Flugzeugs etc.: skin; (Überzug) sheathing

      4. nur Sg.; fam. fig.: eine ehrliche/gute Haut an honest / a good soul; mit Haut und Haar(en) completely, hook, line and sinker; aus der Haut fahren go through (oder hit) the roof, go ballistic; es ist zum Aus-der-Haut-Fahren! it's enough to drive you up the wall!; eine dicke Haut haben have a thick skin, be thick-skinned; seine Haut retten save one's skin (fam. hum. bacon); sich seiner (Gen.) Haut wehren defend o.s. (with all one's might); ihr ist oder sie fühlt sich nicht wohl in ihrer Haut she feels (rather) uncomfortable (oder uneasy); ich möchte nicht in seiner Haut stecken I wouldn't like to be in his shoes; er ist nur noch Haut und Knochen he's just skin and bones; es kann eben keiner aus seiner Haut a leopard can't change its spots; das geht einem unter die Haut it gets under your skin; seine Haut zu Markte tragen (sein Leben riskieren) risk one's neck; (sich verkaufen) sell o.s.; Frau: sell one's body; seine Haut teuer verkaufen sell one's life dearly; * faul I 2*, heil

      ____________________

      </font><font color="steelblue" face="arial" size="4"> **Mund**</font><font color="black" face="arial" size="3"></font>

      <font color="black" face="arial" size="3">

      n. m; -(e)s, Münder mouth; den Mund aufmachen open one's mouth; fam. fig. speak up; mit vollem Mund sprechen talk with one's mouth full; aus dem Mund riechen have bad breath; sie küsste seinen Mund she kissed him on the lips; ein Mund voll fig. a mouthful; Flüssigkeit: auch a gulp; von Mund zu Mund beatmen give mouth-to-mouth resuscitation; es ist in aller Munde everyone's talking about it, it's the talk of the town; Mund und Nase aufsperren oder aufreißen fam. fig gape open-mouthed (in astonishment); halt den Mund! fam. shut up!; den Mund nicht aufmachen oder auftun fam. fig. not utter a word; sie hat den Mund nicht aufgekriegt fam. fig. she didn't say a word; den Mund voll nehmen fam. fig. talk big, shoot one's mouth off; jemandem den Mund verbieten fig. stop s.o. saying anything, silence s.o.; jemandem etwas in den Mund legen fig. put words into s.o.'s mouth; jemandem das Wort aus dem Mund nehmen fam. fig. take the words (right) out of s.o.'s mouth; jemandem das Wort im Mund umdrehen twist s.o.'s words; jemandem nach dem Mund(e) reden fig. echo s.o.'s words; um zu gefallen: say what s.o. wants to hear; jemandem über den Mund fahren fam. fig. cut s.o. short; nicht auf den Mund gefallen sein fam. fig. have the gift of the gab; sich (Dat.) den Mund verbrennen fam. fig. put one's foot in it; von Mund zu Mund gehen Neuigkeit: be passed on from one person to the next, fam. do the rounds; in Redewendungen  auch Maul; * berufen IV 1, Blatt 1, fransig 2, stopfen II 1*, wässrig etc.

      ____________________

      </font><font color="steelblue" face="arial" size="4"> **spazieren**</font><font color="black" face="arial" size="3"></font>

      <font color="black" face="arial" size="3">

      v. v/i. walk (around), stroll; spazieren gehen go for a walk (oder stroll); er geht gern im Wald spazieren he likes to walk (oder go for walks) in oder through the woods; wir waren im Wald spazieren we went for a walk in (oder through) the woods; spazieren fahren go for a ride (oder run, fam. spin) (in the car); jemanden spazieren fahren take s.o. for a ride (oder run, fam. spin) (in the car); jemanden spazieren führen take s.o. (out) for a walk; den Hund spazieren führen auch walk the dog

      ____________________

      </font><font color="steelblue" face="arial" size="4"> **Meister**</font><font color="black" face="arial" size="3"></font>

      <font color="black" face="arial" size="3">

      n. m; -s, - 

      1. (im Handwerk) master (craftsman); ein Meister im Bäckerhandwerk a master baker; seinen Meister machen take one's master craftsman's diploma

      2. (Künstler, Könner) master (auch fig., iro.); alter Meister MUS, Kunst etc.: old master; ein Meister im Lügen a master at (oder in the art of) lying; seinen Meister finden fig. find (oder meet) one's match; Übung macht den Meister Sprichw. practice makes perfect; früh übt sich, was ein Meister werden will Sprichw. you can't start too young; es ist noch kein Meister vom Himmel gefallen Sprichw. you can't expect to get it right first time

      3. SPORT etc.: champion; (Mannschaft) champions Pl. 

      4. im Betrieb: foreman

      5. als Anrede, vertraulich: Sl. guv, chief, Am. Mac

      6. in Märchen: Meister Lampe Master Hare; Meister Petz Master Bruin (the Bear)

      ____________________

      </font><font color="steelblue" face="arial" size="4"> **faul**</font><font color="black" face="arial" size="3"></font>

      <font color="black" face="arial" size="3">

      adj. 

      I Adj. 

      1. Obst, Gemüse, Ei, Zähne etc.: rotten, bad; Fisch, Fleisch: bad, präd. Brit. off, Am. bad; (stinkend) putrid; Holz: rotten; Wasser: foul, brackish; Luft: foul

      2. (träge) lazy, idle; faules Aas fam. pej. Mann: lazy sod (Am. bum) Sl.; Frau: lazy bitch; fam. hum. lazybones (Sg.); auf der faulen Haut liegen oder sich auf die faule Haut legen take one's ease; er, nicht faul, handelte sofort he was on the ball and took immediate action; am Wochenende war ich mal so richtig schön faul I had a really lazy time at the weekend

      3. fig. pej. Ausrede: lame; Kompromiss etc.: shabby; Friede: phon(e)y fam.; Witz: bad; Scheck, Wechsel: dud; (verdächtig) Person: shady; Sache: fishy; fauler Zauber humbug; da ist doch etwas faul there's something fishy about it; etwas ist faul im Staate Dänemark something is rotten in the state of Denmark

      4. (säumig) Zahler: late

      II Adv.: faul herumliegen laze around (oder about); häng hier nicht faul rum, hilf mir lieber fam. instead of hanging around doing nothing you could help me

      ____________________

      </font><font color="steelblue" face="arial" size="4"> **heil**</font><font color="black" face="arial" size="3"></font>

      <font color="black" face="arial" size="3">

      n. Adj. (unversehrt) Person: unhurt, unharmed, safe and sound; Sache: undamaged, intact; (geheilt) healed, cured; Welt: intact, ideal, sugarcoated iro.; etwas heil überstehen come through (s.th.) unscathed; da bist du noch mal mit heiler Haut davongekommen iro. you got off lightly this time; wieder heil machen fix, mend; Kinderspr. (einen verletzten Finger etc.) make s.th. better; die Vase etc. ist heil geblieben didn't break, is still intact (oder in one piece)

      ____________________

      </font><font color="steelblue" face="arial" size="4"> **Maul**</font><font color="black" face="arial" size="3"></font>

      <font color="black" face="arial" size="3">

      n. n; -(e)s, Mäuler 

      1. ZOOL mouth; (Kiefer) jaws Pl.; (Schnauze) muzzle, snout

      2. Sl. von Menschen: trap, gob; ein großes Maul haben have a big mouth, be a big-mouth; ein böses/loses Maul haben have a malicious/loose tongue; das Maul halten keep one's mouth shut; halt's Maul! shut up!; sich (Dat.) das Maul zerreißen gossip (über + Akk. about); jemandem das Maul stopfen fam. shut s.o. up; er hat sechs Mäuler zu stopfen fam. fig. he's got six hungry mouths to feed; jemandem übers Maul fahren cut s.o. short; dem Volk aufs Maul schauen listen to what people are saying;  auch Mund

      ____________________

      </font><font color="steelblue" face="arial" size="4"> **berufen**</font><font color="black" face="arial" size="3"></font>

      <font color="black" face="arial" size="3">

      n. 

      I v/t. (unreg.) 

      1. zu einer Funktion: jemanden zum Vorsitzenden / zu einem Amt berufen appoint s.o. chairman / to an office; jemanden auf oder an einen Lehrstuhl berufen offer s.o. a chair (at university); an einen Ort: nach Berlin berufen werden be called to Berlin

      2. fam. ** beschreien 

      II v/refl. (unreg.): sich berufen auf (+ Akk.) als Autorität, Quelle etc.: cite, quote, refer to; auf jemanden persönlich: mention s.o.'s name; sich auf jemanden als Zeugen berufen appeal to s.o. as a witness; sich darauf berufen, dass ... plead that ...; darf ich mich auf Sie berufen? may I mention your name?; (zitieren) may I quote you?

      III v/i. (unreg.) österr. JUR appeal

      IV Adj. 

      1. (befähigt) qualified, competent; aus berufenem Munde from a reliable source, on good authority, straight from the horse's mouth fam.; berufen sein / sich berufen fühlen zu (+ Inf.) be/feel competent enough (oder qualified) to (+ Inf.); moralisch: have / feel one has a mission to (+ Inf.); ich fühlte mich (nicht) berufen einzugreifen I felt called upon / I didn't feel it was for me to intervene

      2. zum Priester etc. berufen sein have a calling to be a priest (oder to the priesthood etc. ); zur Malerei etc. berufen sein have a vocation for painting etc.; sich zu Höherem berufen fühlen feel one is destined for higher things

      ____________________

      </font><font color="steelblue" face="arial" size="4"> **Blatt**</font><font color="black" face="arial" size="3"></font>

      <font color="black" face="arial" size="3">

      n. n; -(e)s, Blätter 

      1. BOT leaf; von Blüte: petal; Kelch: sepal; kein Blatt vor den Mund nehmen fig. not mince matters (oder one's words)

      2. Buch: leaf; (Seite) page; (Papier) sheet; hast du ein Blatt Papier? do you have a piece of paper?; 500 Blatt Papier 500 sheets of paper; ist das Blatt voll geschrieben? have you used (oder filled) up that page?; das steht auf einem anderen Blatt fig. 

      a) that's a completely different matter,

      b) that's another story fam.; ** unbeschrieben 

      3. MUS (Notenblatt) sheet; vom Blatt spielen/singen sight-read / sight-sing; etwas vom Blatt spielen/singen auch play/sing s.th. at sight

      4. (Zeitung) (news)paper

      5. Kunst: (Druck) print; (Zeichnung) drawing; (Stich) engraving

      6.

      a) (Spielkarte) card; (gezogene Karten) hand; ein gutes/schlechtes Blatt haben have a good/bad hand; das Blatt hat sich gewendet fig. the tide has turned

      b) Spielfarbe im deutschen Kartenspiel: spade

      7. TECH plate, lamina, (Folie) foil; Säge, Ruder etc.: blade (auch FLUG)

      8. MUS für Blasinstrumente: reed

      9. Jagd: shoulder

      ____________________

      </font><font color="steelblue" face="arial" size="4"> **fransig**</font><font color="black" face="arial" size="3"></font>

      <font color="black" face="arial" size="3">

      adj. Adj. 

      1. verziert: fringed

      2. (ausgefranst) frayed; sich (Dat.) den Mund fransig reden fam. fig. talk till one is blue in the face

      ____________________

      </font><font color="steelblue" face="arial" size="4"> **stopfen**</font><font color="black" face="arial" size="3"></font>

      <font color="black" face="arial" size="3">

      v. 

      I vt/i. (Strümpfe etc.) darn, mend; Oma stopft beim Fernsehen Granny does her darning while watching TV

      II v/t. 

      1. (hineinstopfen) stuff (in + Akk. into); (füllen) (Kissen etc.) stuff; (Pfeife, Wurst) fill; sich (Dat.) das Hemd in die Hose stopfen tuck one's shirt into one's trousers; sich (Dat.) Süßigkeiten in den Mund stopfen stuff sweets into one's mouth; jemandem den Mund stopfen fig. silence s.o., shut s.o. up fam.; ** gestopft 

      2. (ausfüllen, zumachen) (Lücke) fill; (Loch) auch plug

      3. (mästen) stuff, fatten

      III v/i. 

      1. (sättigen) be filling; Reis stopft auch rice fills you up

      2. (verstopfen) cause constipation; das stopft auch that gives you constipation

      ____________________

      </font><font color="steelblue" face="arial" size="4"> **beschreien**</font><font color="black" face="arial" size="3"></font>

      <font color="black" face="arial" size="3">

      v. v/t. (unreg.); fam.: ich will es nicht beschreien touch (Am. knock on) wood, I don't want to put the kiss of death on it

      ____________________

      </font><font color="steelblue" face="arial" size="4"> **unbeschrieben**</font><font color="black" face="arial" size="3"></font>

      <font color="black" face="arial" size="3">

      adj. Adj. Papier: blank; INFORM empty; ein unbeschriebenes Blatt sein fig. (unbekannt) be an unknown quantity; (unerfahren) be inexperienced; er ist kein unbeschriebenes Blatt fam. fig. (hat schon einiges auf dem Kerbholz) he hasn't kept clear of trouble

      ____________________

      </font><font color="steelblue" face="arial" size="4"> **gestopft**</font><font color="black" face="arial" size="3"></font>

      <font color="black" face="arial" size="3">

      adj. 

      I P.P. stopfen 

      II Adv. fam.: gestopft voll jampacked, chock-a-block, chock-full

      ____________________

      </font><font color="steelblue" face="arial" size="4"> **Schauspiel**</font><font color="black" face="arial" size="3"></font>

      <font color="black" face="arial" size="3">

      n. n 

      1. THEA play; drama

      2. fig. spectacle, sight

      ____________________

      </font><font color="steelblue" face="arial" size="4"> **haften**</font><font color="black" face="arial" size="3"></font>

      <font color="black" face="arial" size="3">

      n. v/i. (für for) (bürgen) be liable, be responsible, answer; (bei einem Schaden etc. belangt werden) be held responsible; haften für (garantieren) guarantee; Sie haften mir persönlich für etwaige Schäden I shall hold you personally responsible for any damage</font>

      </font></font></font></font></font></font></font></font></font></font></font></font></font></font></font></font></font></font></font></font></font>
    1. Proca, t next king, had two sons, Numitor and Amulius, t · elder of whom, Numitor, he left the hereditary realm e Silvian family; that, at least, was his intention, b respect seniority was flouted, the father's will igno a and Amulius ove out his brother and seized the t ne. One act of violen led to another; he proceede o murder his brother's male c · en, and made his ni , Rirea S:H,b:, a ¥e .. tal,,-etliel!!l!Mt,i.,.lf.'ell~,,.~-INII..._ bu actually, by condemning her to perpetual vir · 'ty, to reclude the possibility of issue

      Go ahead and read this bit about Numitor and Amulius (even though I crossed it out).

    1. Bahn

      <font face="arial" size="4"> **Bahn**</font><font face="arial" size="3"></font>

      <font face="arial" size="3">

      n. f; -, -en 

      1. (Weg) way, path; Bahn frei! make way!, stand aside!

      2. fig.: die Bahn ist frei the road is clear; freie Bahn haben have the go-ahead, have the green light fam. (für for); du hast freie Bahn it's all yours; sich (Dat.) Bahn brechen (sich durchsetzen) win through; Idee etc.: gain acceptance; (vorwärts kommen) forge ahead; einer Sache Bahn brechen pioneer s.th., blaze the trail for s.th.; auf die schiefe Bahn geraten oder kommen go astray, stray off the straight and narrow; in die richtigen Bahnen lenken direct into the right channels; sich in den gewohnten Bahnen bewegen move along the same old track, be stuck in the same old rut pej.; bewusst: keep to the well-trodden paths; wieder in geregelten Bahnen verlaufen be back to normal again; jemanden aus der Bahn werfen oder bringen throw s.o. off track; seelisch etc.: knock s.o. sideways

      3.

      a) (Eisenbahn) railway, Am. railroad; (Zug) train; (Straßenbahn) tram, Am. streetcar, trolley; in der Bahn on the train; mit der Bahn by train; Waren per Bahn schicken ÖKON send goods by rail; (mit der) Bahn fahren travel by train; ich fahre gern (mit der) Bahn auch I enjoy travel(l)ing on trains, I enjoy rail travel; jemanden zur Bahn bringen take s.o. to the station, see s.o. off (at the station); jemanden von der Bahn abholen (go and) meet s.o. at the station

      b) nur Sg.; Unternehmen: railway (Am. railroad) authorities Pl. (oder operators Pl. ); bei der Bahn arbeiten work for the railway (Am. railroad)

      4. (Fahrbahn) lane

      5. (Flugbahn) trajectory

      6. ASTR, von Mond, Sonne: course; (Umlaufbahn) orbit (auch eines Elektrons); von Komet: path

      7. SPORT 

      a) Anlage: (Rennbahn) track; (Eis-, Rollschuhbahn) rink; (Schlitten-, Bobbahn) run; (Kegelbahn) alley

      b) für einzelne Läufer, Schwimmer etc.: lane

      8. von Tapete: length; aus Papier, Kunststoff: web; Tuch etc.: width; eines Rocks: gore

      9. TECH, Amboss, Hammer, Hobel: face

      10. TECH (Führung) guide, track

      ____________________

      </font><font face="arial" size="4"> **bahnen**</font><font face="arial" size="3"></font>

      <font face="arial" size="3">

      n. v/t.: einen Weg bahnen clear a path (+ Dat. for); sich (Dat.) einen Weg durch etwas bahnen fight (oder force) one's way through s.th.; jemandem den Weg nach oben bahnen fig. put s.o. on the road (oder path) to the top</font>

      </font></font>
    1. H. Tang, C. Hammack, S. C. Ogden, Z. Wen, X. Qian, Y. Li, B. Yao, J. Shin, F. Zhang, E. M. Lee, K. M. Christian, R. A. Didier, P. Jin, H. Song, G. L. Ming, Zika virus infects human cortical neural progenitors and attenuates their growth. Cell Stem Cell 18, 1–4 (2016).

      Tang’s article highlights the impact of ZIKV infection on both cell death and dysregulation of the cell cycle.

    2. G. Calvet, R. S. Aguiar, A. S. Melo, S. A. Sampaio, I. de Filippis, A. Fabri, E. S. Araujo, P. C. de Sequeira, M. C. de Mendonça, L. de Oliveira, D. A. Tschoeke, C. G. Schrago, F. L. Thompson, P. Brasil, F. B. Dos Santos, R. M. Nogueira, A. Tanuri, A. M. de Filippis, Detection and sequencing of Zika virus from amniotic fluid of fetuses with microcephaly in Brazil: A case study. Lancet Infect. Dis. (2016).

      In this article, the authors were able to detect the Brazilian Zika virus in amniotic fluid and compare its genome to other Zika strains and flaviviruses. In doing so, they hoped to find out if there had been recombination events between them.

      The authors collected amniotic fluid samples from women whose fetuses were diagnosed with microcephaly, extracted DNA purified virus particles, and analyzed the samples with qRT-PCR.

      They found that the different viruses share 97–100% of their genomes and that there had been no recombination events.

    1. gelöster

      /Users/jeromecarney/Desktop/Dropbox/Python/StarDict/share/pystardict/morph.py:131: UnicodeWarning: Unicode equal comparison failed to convert both arguments to Unicode - interpreting them as being unequal

        if theBword not in theMorphList:

      \<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"\>

      \<html xmlns="http://www.w3.org/1999/xhtml"\>

      \<head>

      \<meta content="en-us" http-equiv="Content-Language" />

      \<meta content="text/html charset=utf-8" http-equiv="Content-Type" />

      \<title>Word Tap\</title>

      \<style> body {font-size: 16px;} h3 {font-size: 18px;}\</style>

      \</head>

      \<body data-kmwindow="400,250">\<font face="Arial">

      \<h3>gelöst\</h3>\<font color="blue">adj.\</font> \<BR>\<B>I\</B>\<I> P.P. \<IMG src="file:///Users/jeromecarney/Desktop/Dropbox/Python/StarDict/share/pystardict/Lang_Hand_Ger_Eng/res/502F5DDA.bmp" align="center" width="17" height="13">\</I> \<A href="dict:// lösen"> l\ösen\</A> \<BR>\<B>II\</B>\<I> Adj.\</I> \<BR>\<B>1.\</B>\<I> fig.\</I> \<I> Person\</I>: relaxed\<BR>\<B>2.\</B>\<I> Substanz\</I>: dissolved (\<B>in\</B>\<I> + Dat.\</I> in)\<br>____________________\<br>\<br>\<h3>lösen\</h3>\<font color="blue">v.\</font> \<BR>\<B>I\</B>\<I> v/t.\</I> \<BR>\<B>1.\</B>\<I> (losbinden)\</I> untie;\<I> (aufbinden) auch\</I> undo\<BR>\<B>2.\</B>\<I> (lockern)\</I> loosen;\<I> (Bremse, Griff)\</I> release\<I> (auch Spannung)\</I>;\<I> (Husten)\</I> loosen (up);\<B> den Blick\</B>\<I> oder\</I>\<B> seine Blicke von etwas nicht l\ösen k\önnen\</B> be unable to take one's eyes off s.th.;\<EXAMPLEU> jemandem die Zunge l\ösen\</B>\<I> fig.\</I> loosen s.o.'s tongue;\<I> \<IMG src="file:///Users/jeromecarney/Desktop/Dropbox/Python/StarDict/share/pystardict/Lang_Hand_Ger_Eng/res/502F5DDA.bmp" align="center" width="17" height="13">\</I> \<A href="dict:// gelöst"> gel\öst\</A> \<BR>\<B>3.\</B>\<I> (entfernen)\</I> remove;\<I> (trennen)\</I> separate (\<B>von\</B> from)\<BR>\<B>4.\</B>\<I> (aufl\ösen)\</I> dissolve\<BR>\<B>5.\</B>\<I> (entwirren)\</I> disentangle;\<I> auch fig.\</I> unravel\<BR>\<B>6.\</B>\<I> fig.\</I> \<I> (Aufgabe, R\ätsel, Schwierigkeit)\</I> solve;\<I> (Frage)\</I> answer;\<I> (Konflikt)\</I> resolve, settle\<BR>\<B>7.\</B>\<I> fig.\</I> \<I> (Verbindung, auch Verlobung)\</I> break off;\<I> (Ehe)\</I> dissolve\<BR>\<B>8.\</B>\<I> (Vertrag)\</I> cancel\<BR>\<B>9.\</B>\<I> (Fahrkarte etc.)\</I> buy\<BR>\<B>II\</B>\<I> v/refl.\</I> \<BR>\<B>1.\</B>\<I> Knoten etc.\</I>: come undone\<BR>\<B>2.\</B>\<I> (sich lockern)\</I> come loose;\<I> Husten\</I>;\<I> fig. Zunge\</I>: loosen up;\<I> Spannung\</I>: ease\<BR>\<B>3.\</B>\<I> (sich losl\ösen)\</I> come off;\<I> Schuss\</I>: go off\<BR>\<B>4.\</B>\<I> fig.\</I>:\<B> sich l\ösen von\</B>\<I> (verlassen)\</I> leave;\<I> (ausbrechen aus)\</I> break away from;\<I> (einer Vorstellung, Verpflichtung etc.)\</I> free (\<I>oder\</I> rid) o.s. of\<BR>\<B>5.\</B>\<I> (sich aufl\ösen)\</I> dissolve\<BR>\<B>6.\</B>\<I> Problem etc.\</I>: be solved;\<I> Konflikt\</I>: be settled;\<B> sich von alleine l\ösen\</B> solve (\<I>oder\</I> resolve) itself\<br>

      \</font>\</body>

      \</html>

    1. B. A. Jacob, L. Lefgren, J. Public Econ. 95, 1168–1177 (2011).

      The authors of this paper evaluated the impact of NIH grants on publications. They concluded that researchers who did not get an NIH grant but simultaneously applied for others grants saw one more publication (+7%).

    1. Atheism has no rational basis upon which to call anything objectively just or unjust, including racism. If mankind is merely the result of billions of years of mindless evolution and is nothing more than animals (as atheistic evolution contends; Marchant, 2008), then man can logically make evolutionary-based racist remarks that are consistent with the godless General Theory of Evolution. In fact, Charles Darwin’s “Bulldog,” atheist Thomas Huxley, did just that in his 1865 essay, “Emancipation—Black and White.” He alleged, for example, “no rational man, cognizant of the facts, believes that the average Negro is the equal, still less superior, of the white man.” In truth, if there is no God, mankind could just as easily look down upon and mistreat others (whom he deems are less evolved), as he does roaches, rats, and orangutans (Lyons, 2011; Lyons and Butt, 2009). Those who are Christians, however, logically contend that since (1) God exists, and (2) the Bible is the Word of God, racism is morally wrong—and completely ridiculous for the following five reasons. #1—All Human Beings Are Made in the Image of God Not only did God specially create Adam and Eve in His image and vastly different than all other living things on Earth (Genesis 1:26-27), since then, every human being has been made according to God’s likeness. While preaching to Gentiles in Athens thousands of years after the Creation, Paul, a Jew, did not contend that man was once the offspring of God; he said, “We are” the offspring of God (Acts 17:28-29). [The Greek word esmen in 17:28 is the first person plural of eimi (to be). This recognition of being God’s offspring served as a basis for his argument, as the next verse indicates: “Being then the offspring of God….”] James wrote: “But the tongue can no man tame; it is a restless evil, it is full of deadly poison. Therewith bless we the Lord and Father; and therewith curse we men, who are made after the likeness of God: out of the same mouth cometh forth blessing and cursing. My brethren these things ought not so to be” (3:8-9, ASV, emp. added). [The English verb “are made” (ASV) derives from the Greek gegonotas, which is the perfect participle of the verb ginomai. The perfect tense in Greek is used to describe an action brought to completion in the past, but whose effects are felt in the present (Mounce, 1993, p. 219).] The thrust of the expression, “who are made after the likeness of God” (Greek kath’ homoisosin theou gegonotas), is that humans in the past have been made according to the likeness of God, and they are still bearers of that likeness. For this reason, praising the Creator at one moment, while hurling unkind, racist remarks at another time, is terribly inconsistent in a most unChristlike way. All human beings (of every color and ethnicity) are divine image bearers. #2—God Only Made One Race—The Human Race Although people come in different colors, shapes, and sizes, and although they often associate more closely with those whom they find more similar in ways to themselves, the fact is, there is only one human race. Racism is ridiculous because we are all related, not by means of naturalistic evolution, but by special Creation. No one person is inherently of more value than another person. We are all sons and daughters of Adam and Eve—the specially created couple whom God made thousands of years ago in the Garden of Eden (Genesis 3:20). What’s more, we are also sons and daughters of Noah and his wife, through whom the Earth was repopulated after the worldwide Flood of Genesis 6-8. As the apostle Paul informed the idolatrous Athenians 2,000 years ago, God “made from one blood every nation to dwell on all the face of the earth” (Acts 17:26). Adam and Eve had children, who had children, who had children…who had you and me. We are all physically related. We are all of one race—the one human race. We are all (as modern science classifies us) of the same human species—Homo sapiens. We all trace our ancestry back to Noah, and then back to Adam. We may have different skin color, facial features, hair texture, etc., but we are all brothers and sisters! We are family—a part of the same human race. #3—God Doesn’t Play Favorites…and Neither Should We Although God is omnipotent, He is actually color-blind. His all-loving, perfectly just nature will not allow Him to love someone more than another based upon the color of a person’s skin or the nation in which one was born. Similar to how God cannot lie (Titus 1:2), God cannot show favoritism. Moses wrote: “For the Lord your God is God of gods and Lord of lords, the great God, mighty and awesome, who shows no partiality nor takes a bribe. He administers justice for the fatherless and the widow, and loves the stranger, giving him food and clothing. Therefore love the stranger, for you were strangers in the land of Egypt” (Deuteronomy 10:17-19). Peter said: “God shows no partiality. But in every nation whoever fears Him and works righteousness is accepted by Him” (Acts 10:34-35, emp. added). According to Paul, God “does not receive a face” (Galatians 2:6, NASB literal footnote rendering); that is, “God does not judge by external appearance” (Galatians 2:6, NIV). In short, it is impossible to hold “the faith of our Lord Jesus Christ, (the Lord) of glory, with respect of persons” (James 2:1, ASV). The Christian’s care and concern for his fellow brother by Creation and by Christ is to be color-blind. #4—Love is Not Racist Whereas racism is fueled by earthly ignorance and hate, the Christian is filled with the fruit of Heaven’s Spirit (Galatians 5:22-23). The child of God is directed by an omniscient, omni-benevolent Father Who expects His children to “grow in the grace and knowledge of our Lord and Savior Jesus Christ” (2 Peter 3:18). To the Philippians Paul wrote, “And this I pray, that your love may abound still more and more in knowledge and all discernment, that you may approve the things that are excellent, that you may be sincere and without offense till the day of Christ, being filled with the fruits of righteousness which are by Jesus Christ, to the glory and praise of God” (1:9-11, emp. added).  In two of the more challenging sections of Scripture, Paul wrote: “Love is patient and kind; love does not envy or boast; it is not arrogant or rude. It does not insist on its own way; it is not irritable or resentful; it does not rejoice in wrongdoing, but rejoices with the truth” (1 Corinthians 13:4-6, ESV). “Let love be without hypocrisy. Abhor what is evil. Cling to what is good. Be kindly affectionate to one another with brotherly love, in honor giving preference to one another…. Bless those who persecute you; bless and do not curse…. Repay no one evil for evil…. If it is possible, as much as depends on you, live peaceably with all men” (Romans 12:9-18). No Christian can be a racist, and any racist who claims to be a Christian is, in truth, a liar. As the apostle John explained, “If someone says, ‘I love God,’ and hates his brother, he is a liar; for he who does not love his brother whom he has seen, how can he love God whom he has not seen? And this commandment we have from Him: that he who loves God must love his brother also” (1 John 4:20-21). “[W]hatever other commandment there may be, are summed up in this one rule: ‘Love your neighbor as yourself.’ Love does no harm to its neighbor [regardless of his or her color and ethnicity—EL]. Therefore love is the fulfillment of the law” (Romans 13:9-10, NIV). #5—Jesus is EVERYONE’S Savior In one of the earliest Messianic prophecies, God promised Abraham that it would be through One of his descendants that “all the nations” and “all the families of the earth shall be blessed” (Genesis 22:18; 12:3, emp. added). It certainly was an honor for Abraham’s family to be chosen as the one through whom the Savior of the world would come, but Jesus did not come only to save the Jews. God did not enact a plan of salvation to save one particular color of people. He did not send Jesus to take away the sins of a particular ethnic group or nation. Jesus is the answer to the whole world’s sin problem; He is “the Savior of the world” (1 John 4:14). “For God so loved the world that He gave His only begotten Son, that whoever believes in Him should not perish but have everlasting life. For God did not send His Son into the world to condemn the world, but that the world through Him might be saved” (John 3:16-17, emp. added). “God…desires all men to be saved and to come to the knowledge of the truth” (1 Timothy 2:3-4, emp. added). For this reason, “repentance and remission of sins should be preached in His name to all nations” (Luke 24:47, emp. added)—to people of all colors, in all cultures, in whatever countries. The Gospel “is the power of God to salvation for everyone who believes” (Romans 1:16, emp. added). And when individuals in the world “obey the Gospel” (2 Thessalonians 1:8; see Lyons and Butt, n.d.) and are added to the Lord’s Church by God Himself (Acts 2:47), we all become one in Christ Jesus. “There is neither Jew nor Greek, there is neither slave nor free, there is neither male nor female; for you are all one in Christ Jesus” (Galatians 3:29). Conclusion I do not claim to be an expert on race relations, but I know that some people genuinely struggle with the sin of racism. Some struggle with being the recipients of racism, which in turn may cause them to be tempted to react in racist ways. Others struggle with cowardly silence as they tolerate the sin of racism in their homes, churches, schools, businesses, and communities. Still others seem so preoccupied with advancing their own racial agenda that they appear to hastily interpret most everything as a racial problem, when most things are not. Jesus once taught the hypocrites of His day, saying, “Do not judge according to appearance, but judge with righteous judgment” (John 7:24). May God help us to see as He sees: “for man looks at the outward appearance, but the Lord looks at the heart” (1 Samuel 16:7). What a better world this would be if everyone realized the foolishness of judging a book by its cover. Racism really is ridiculous. REFERENCES Huxley, Thomas (1865), “Emancipation—Black and White,” http://aleph0.clarku.edu/huxley/CE3/B&W.html. Lyons, Eric (2011), “The Moral Argument for the Existence of God,” Apologetics Press, http://www.apologeticspress.org/APContent.aspx?category=12&article=4101&topic=95. Lyons, Eric and Kyle Butt (no date), Receiving the Gift of Salvation (Montgomery, AL: Apologetics Press), http://www.apologeticspress.org/pdfs/e-books_pdf/Receiving%20the%20Gift%20of%20Salvation.pdf. Lyons, Eric and Kyle Butt (2009), “Darwin, Evolution, and Racism,” Apologetics Press, http://www.apologeticspress.org/apcontent.aspx?category=9&article=2654. Marchant, Jo (2008), “We Should Act Like the Animals We Are,” New Scientist, 200[2678]:44-45, October 18-24. Mounce, William D. (1993), Basics of Biblical Greek (Grand Rapids, MI: Zondervan). Copyright © 2015 Apologetics Press, Inc. All rights reserved. We are happy to grant permission for this item to be reproduced in its entirety, as long as the following stipulations are observed: (1) Apologetics Press must be designated as the original publisher; (2) the specific Apologetics Press Web site URL must be noted; (3) the author’s name must remain attached to the materials; (4) textual alterations of any kind are strictly forbidden; (5) Some illustrations (e.g., photographs, charts, graphics, etc.) are not the intellectual property of Apologetics Press and as such cannot be reproduced from our site without consent from the person or organization that maintains those intellectual rights; (6) serialization of written material (e.g., running an article in several parts) is permitted, as long as the whole of the material is made available, without editing, in a reasonable length of time; (7) articles, excepting brief quotations, may not be offered for sale or included in items offered for sale; and (8) articles may be reproduced in electronic form for posting on Web sites pending they are not edited or altered from their original content and that credit is given to Apologetics Press, including the web location from which the articles were taken. For catalog, samples, or further information, contact: Apologetics Press 230 Landmark Drive Montgomery, Alabama 36117 U.S.A. Phone (334) 272-8558 http://www.apologeticspress.org //<![CDATA[ WebForm_AutoFocus('lnkBtnSearchSite');//]]> (function (i, s, o, g, r, a, m) { i['GoogleAnalyticsObject'] = r; i[r] = i[r] || function () {(i[r].q = i[r].q || []).push(arguments);}, i[r].l = 1 * new Date(); a = s.createElement(o),m = s.getElementsByTagName(o)[0];a.async = 1;a.src = g;m.parentNode.insertBefore(a, m); })(window, document, 'script', '//www.google-analytics.com/analytics.js', 'ga'); ga('create', 'UA-37392589-1', 'auto'); ga('require', 'linkid'); ga('send', 'pageview'); 010000

      This page is ridiculous and bias shining all this light on one religion and doing the exact opposite of what I was hoping to see, doing my research on another page

  15. Apr 2017
    1. B. I. Omalu, S. T. DeKosky, R. L. Minster, M. I. Kamboh, R. L. Hamilton, C. H. Wecht, Chronic traumatic encephalopathy in a National Football League player. Neurosurgery 57, 128–134 (2005).

      A report of the long-term effects of repetitive head injury linked to American football.

    1. Jean Chrétien

      Jean Chrétien

      Joseph-Jacques-Jean born January 11, 1934 was Canada's twentieth Prime Minister. Jean Chrétien was a Canadian Lawyer and a Liberal Party Politician who served as the Prime Minster of Canada from 1993-2003 during three terms. Chrétien was born into a working-class family in Shawinigan, Quebec, and educated at St-Joseph Seminary in Trois-Rivières and at Laval University. Chrétien practiced law from 1958 to 1963, when he was elected to Parliament. Chretien has a long political career in Canada. He sat in Parliament for a total of twenty seven years. Chretien’s first political accomplishment came in 1963 when he won election to the House of Commons as a Liberal. (Bothwell, Robert. 2006) He ran for parliament with very poor English speaking proficiency. Early in his political career he served in Prime Minister Lester B. Pearson's Cabinet as parliamentary secretary, then later in 1968 was appointed as the parliamentary secretary under Mitchell Sharp who was the Minister of Finance. Later that year in 1968, Pierre Trudeau was elected as Liberal leader and Prime Minister. Chrétien participated in many different roles during his political career. Trudeau appointed Chrétien as Minister of National Revenue. Under Trudeau Chrétien held the title as President of the Treasury Board from 1974–1976, Minister of industry, trade, and commerce from 1976–1977, and the first French Canadian minister of finance from 1977–1979. (Jean Chrétien. Encyclopedia)

      One of Chrétien’s important positions during his time under Prime Minister Pierre Trudeau, was as Minister of Indian Affairs and Norther Development. During his time as Minister of Indian Affairs he proposed a number of reforms to Canadian Indigenous peoples. One of his major contributions to Indian Policy and the Indigenous peoples of Canada was through what is called the 1969 White Paper. Officially entitled, Statement of the Government of Canada on Indian policy, was a policy presented to Parliament in 1969. The core of the White Paper proposed to end discriminatory practices and viewpoints towards the Indigenous peoples of Canada. The Canadian government promised to end Canada’s discriminatory Indian policy, repeal the Indian Act, do away with the Department of Indian Affairs and abolish previous legal documents pertaining to Indigenous peoples in Canada. Also to give control of Indian lands to Indian bands and terminate Indian treaties. (Tobias, John. 2006) It was also made clear that it would not recognize any Aboriginal rights or Aboriginal title. Chretien and Trudeau faced a large amount of criticism and the 1969 White Paper was terminated in 1970. However the White Paper sparked a movement that increased political awareness regarding the Indigenous peoples of Canada.

      Chrétien first ran for leader of the Liberal Party of Canada in 1984, but was defeated by John Turner. Chrétien subsequently left politics in 1986, returning to private law practice but returned in 1990 as Leader of the Liberal Party. In 1993 Chrétien won the majority government and became Canadas Prime Minister. Chretien served three terms as Prime Minster of Canada and under Chrétien, the Liberals won three consecutive majority governments due to his vast political experience. Major accolades were prominent with Chretien. Chrétien led a cautious and fiscally conservative government, restoring federal finances after 20 years of deficits by cutting into sensitive government programs. Chretien eliminated the deficit and lowered the federal debt by the late 1990s that been around since the 1970s. By 1997-98, the federal government recorded its first annual surplus in 28 years. (Bothwell, Robert. 2006) In 1995, Quebec held a second sovereignty referendum. Parti Québécois, which was governing Quebec at the time looked for withdrawal from Canada. The end results were very close with the “No” vote for referendum winning with 50.58% of the vote. Following Quebec’s referendum attempt Chrétien took several steps to counter future Quebec sovereignty movements. He passed a bill in the House of Commons recognising Quebec as a distinct society with French background. (Jean Chrétien. Encyclopedia) In 2003 Chretien stepped down as prime minister and was succeeded by Paul Martin.

      Bashevkin, Sylvia. 2000. "Rethinking Retrenchment: North American Social Policy during the Early Clinton and Chretien Years." Canadian Journal Of Political Science 33, no. 1: 7-36. America: History and Life with Full Text, EBSCOhost (accessed April 9, 2017).

      TOBIAS, JOHN L. 2006. "White Paper on Indian Policy." Oxford Companion To Canadian History 661-662. America: History and Life with Full Text, EBSCOhost (accessed April 9, 2017).

      BOTHWELL, ROBERT. 2006. "Chrétien, Joseph-Jacques-Jean." Oxford Companion To Canadian History 129-130. America: History and Life with Full Text, EBSCOhost (accessed April 9, 2017).

      “Jean Chretien.” The Canadian Encyclopedia http://www.thecanadianencyclopedia.ca/en/article/joseph-jacques-jean-chretien/ (accessed April 11, 2017)

      Joseph Jacques Jean Chrétien - Canada's 20th Prime Minister.” Library and Archives Canada. http://www.bac-lac.gc.ca/eng/discover/politics-government/prime-ministers/pmportrait/Pages/item.aspx?PersonId=20 (accessed April 9, 2017)

    1. Works cited Source texts Betabroti­ (Njрls saga). AM 162 B fol. ▀, Stofnun ┴rna MagnЩssonar ь ьslenskum frТ­um, Reykjavik.? Cook, Robert, trans. 2001. Njalњs Saga. (World of the Sagas). London: Penguin.? Egilsson, Sveinn Yngvi, ed. 2003. Brennu-Njрls saga. Texti Reykjabзkar. Reykjavik: Bjartur.? First Grammatical Treatise. Nordal, Sigur­ur, ed. 1931. Codex Wormianus (The Younger Edda). MS. No. 242 in The Arnemagnean Collection in the University Library of Copenhagen (Corpus Codicum Islandicorum Medii Aevi, 2). Facsimile. Copenhagen: Levin & Munksgaard.? Gьslason, Konrр­, and Eirьkur Jзnsson, eds. 1875. Njрla. Udgivet efter gamle hтndskrifter. FШrste bind. Copenhagen: Det kongelige nordiske oldskrift-selskabet.? Grрskinna (Njрls saga). GKS 2870 4to, Stofnun ┴rna MagnЩssonar ь ьslenskum frТ­um, Reykjavik.? Helgason, Jзn, ed. 1962. Njрls Saga. The Arna-MagnТan manuscript 468, 4TO (Reykjabзk) (Manuscripta Islandica, 6). Facsimile. Copenhagen: Ejnar Munksgaard.? KрlfalТkjarbзk (Njрls saga). AM 133 fol., Stofnun ┴rna MagnЩssonar ь ьslenskum frТ­um, Reykjavik.? Мssbзk (Njрls saga). AM 162 B fol. ?, Stofnun ┴rna MagnЩssonar ь ьslenskum frТ­um, Reykjavik.? яormз­sbзk (Njрls saga). AM 162 B fol. d, Stofnun ┴rna MagnЩssonar ь ьslenskum frТ­um, Reykjavik.? RaschellЯ, Fabrizio D., ed. 1982. The so-called Second Grammatical Treatise. An orthographic pattern of late thirteenth-century Icelandic (Filologia Germanica. Testi e studi, 2). Florence: Felice le Monnier.? Skafinskinna (Njрls saga). GKS 2868 4to, Den ArnamagnТanske Samling, Copenhagen.? Snerpa.is. 2015. Accessed May 10. http://www.snerpa.is/. ? Van Arkel-De Leeuw van Weenen, Andrea, ed. 1987. MШ­ruvallabзk. AM 132 Fol. Volume two. Text. Leiden: E. J. Brill.? Secondary Sources About Juxta. 2015. Accessed May 10. http://www.juxtasoftware.org/about. ? Andrews, Tara. 2013.The third way. Philology and critical edition in the digital age. Variants. The Journal of the European Society for Textual Scholarship 10: 61-76.? Beltrami, Pietro G. 2013. Textual criticism and historical dictionaries. Variants. The Journal of the European Society for Textual Scholarship 10: 41-59.? Benediktsson, Hreinn. 1965. Early Icelandic script. As illustrated in vernacular texts from the twelfth and thirteenth centuries (═slenzk handrit. Series in folio, 2). Reykjavik: The Manuscript Institute of Iceland.? Bischoff, Bernhard. 1986. PalСographie des rШmischen Altertums und des abendlСndischen Mittelalters (Grundlagen der Germanistik, 24). Berlin: Erich Schmidt.? Bollason, ArthЩr, ed. 2011. Die schШnsten islСndischen Sagas. Berlin: Insel.? Cappelli, Adriano. 1967. Lexicon Abbreviaturarum. Dizionario di abbreviature latine ed italiane. Milan: Ulrico Hoepli.? Chesnutt, Michael, ed. 2006. Egils saga Skallagrьmssonar. Bind III. C-Redaktionen (Editiones ArnamagnТanТ. Series A, 21). Copenhagen: C. A. Reitzel.? Christoffersen, Marit. 2002. Nordic language history and research on word order. In The Nordic languages. An international handbook of the history of the North Germanic languages. Volume 1 (Handbooks of linguistics and communication science, 22.1), ed. Oskar Bandle: 182-191. Berlin, New York: Walter de Gruyter.? Comrie, Bernard, Martin Haspelmath, and Balthasar Bickel. 2008. The Leipzig glossing rules. Conventions for interlinear morpheme-by-morpheme glosses. Max Planck Institute for Evolutionary Anthropology. Department of Linguistics. Accessed May 9, 2015. http://www.eva.mpg.de/lingua/pdf/LGR08.02.05.pdf.? Coseriu, Eugenio. 1988. Sprachkompetenz. GrundzЧge der Theorie des SpreГchens (UTB, 1481). TЧbingen: Francke.? Derolez, Albert. 2006. The Palaeography of Gothic manuscript books. From the twelfth to the early sixteenth century (Cambridge Studies in Palaeography and Codicology, 9) (1st edition 2003). Cambridge: Cambridge University Press. ? Driscoll, Matthew James. 2006. Levels of transcription. In Electronic textual editing, eds. Lou Burnard, Katherine OњBrien OњKeeffe, and John Unsworth, 254-261. New York: The Modern Language Association of America.? Gunnlaugsson, Gu­var­ur Mрr. 2003. Stafrжtt e­a samrТmt? Um frТ­ilegar Щtgрfur og notendur ■eirra. Gripla 14: 197-235.? Hallberg, Peter. 1968. Stilsignalement och fШrfattarskap i norrШn sagalitteratur (Nordistica Gothoburgensia, 3). Gothenburg: Acta Universitatis Gothoburgensis.? Hallberg, Peter. 1969. Den islСndska sagan (Verdandis skriftserie, 6). (N.p.): LСromedelsfШrlagen/Svenska bokfШrlaget.? Haugen, Odd Einar. 2004. Tekstkritik og tekstfilologi. In Handbok i norrЭn filologi, ed. Odd Einar Haugen, [Bergen]: Fagbokforlaget, 81-118.? Hauksson, яorleifur, and язrir Мskarsson. 1994. ═slensk stьlfrТ­i. Reykjavik: Mрl og menning.? Jensen, Helle. 1989. Om udgivelse af vestnordiske tekster. In Forskningsprofiler, eds Bente Holmberg, Britta Olrik Frederiksen, and Hanne Ruus. Copenhagen: Gyldendal, 208-220.? Karlsson, Stefрn. 2004. The Icelandic language. London: Viking Society for Northern Research.? Knirk, James. 1985. The role of the editor of a diplomatic edition. In The Sixth International Saga Conference. 28.7. - 2.8.1985. Workshop papers II. Copenhagen: Det arnamagnТanske Institut, KЭbenhavns Universitet. ? Kondrup, Johnny. 2011. Editionsfilologi. Copenhagen: Museum Tusculanums Forlag.? Marquжs-Aguado, Teresa. 2013. Editions of Middle English texts and linguistic research. Desiderata regarding palaeography and editorial practices. Variants. The Journal of the European Society for Textual Scholarship 10: 17-40.? Mazal, Otto. 1986. Lehrbuch der Handschriftenkunde (Elemente des Buch- und Bibliothekswesens, 10). Wiesbaden: Ludwig Reichert.? Norberg, Dag. 1968. Manuel pratique de latin medieval (Connaissance des langues, 4). Paris: A. and J. Picard.? Sigtryggsson, Jзhannes B. 2005. Huglei­ingar um stafrжttar uppskriftir. Gripla 16: 265-286. ? Sveinsson, Einar Мlafur. 1933. Um Njрlu. 1. Bindi. Reykjavik: Menningarsjз­ur. ? Sveinsson, Einar Мlafur. 1953. Studies in the manuscript tradition of Njрlssaga (Studia Islandica, 13). Reykjavik: Leiftur.? Sveinsson, Einar Мlafur. 1954. Formрli. In Brennu-Njрls saga (═slenzk fornrit, 12), ed. Einar Мlafur Sveinsson, V-CLXIII. Reykjavik: Hi­ ьslenzka fornritafжlag.? Szokody, Oliver, 2002. Old Nordic types of texts I: Old Icelandic and Old Norwegian. In The Nordic languages. An international handbook of the history of the North Germanic languages. Volume 1 (Handbooks of Linguistics and Communication Science, 22.1), ed. Oskar Bandle. Berlin, New York: Walter de Gruyter, 981-989.? язrзlfsson, BjШrn K. 1925. Um ьslenskar or­myndir р 14. og 15. Шld og breytingar ■eirra Щr fornmрlinu (Rit um ьslenska mрlfrТ­i, 2). Reykjavik: Fjelagsprentsmi­jan.? Um Brennu-Njрls sШgu. 1991. In Brennu-Njрls saga. Me­ formрla, sk§ringum og eftirmрla um ═slendinga sШgur (Sьgildar sШgur, 1), ed. оrnзlfur Thorsson. Reykjavьk: Mрl og menning, VII-XXV. ? Zeevaert, Ludger. 2009. Deutscher Einfluss und syntaktischer Wandel im Schwedischen. In Deutsch im Norden. Akten der nordisch-germanistischen Tagung zu ┼bo/Turku, Finnland, 18.-19. Mai 2007 (NordeuropСische BeitrСge, 28), eds Lars Wollin, Dagmar Neuendorff, and Michael Szurawitzki. Frankfurt am Main: Peter Lang, 279-306.? Zeevaert, Ludger. 2012. Low German influence and typological change in Swedish: Some results from a research project. In Contact between Low German and Scandinavian in the Late Middle Ages. 25 Years of Research (Acta Academiae Regiae Gustavi Adolphi, 121), eds Lennart Elmevik, and Ernst-Hтkon Jahr. Uppsala: Kungl. Gustav Adolfs Akademien fШr svensk folkkultur, 171-190.? Zeevaert, Ludger. 2014. MШrkum Njрlu! An annotated corpus to anlayse and explain grammatical divergences between 14th-century manuscripts of Njрls saga. In Proceedings of the Ninth International Conference on Language Resources and Evaluation (LREC 14), eds Nicoletta Calzolari, Khalid Choukri, Thierry Declerck et al.. Paris: ELRA, 981-987.?

      Need line spaces between Works cited and Acknowledgements section, and Works cited. Remove Source texts section heading. Add hanging indents. Remove question marks. Need quotation marks for article or chapter titles.

    1. Works cited Barceló, J. A. 2007. Automatic archaeology: Bridging the gap between virtual reality, artificial intelligence, and archaeology. In Theorizing digital cultural heritage. A critical discourse. Edited by F. Cameron and S. Kenderdine, 437-56. Cambridge: MIT Press. ? Benjamin, W. [1936] 1968. The work of art in the age of mechanical reproduction. Edited by Hannah Arendt. London: Fontana.? Bentkowska-kafel, A., H. Denard & D. Baker, eds. 2012. Paradata and transparency in virtual heritage. Surrey: Ashgate. ? Bertani, D. & L. Consolandi. 2006. High resolution imaging in the near infrared. In Digital heritage. Applying digital imaging to cultural heritage. Edited by L. MacDonald, 211-39. Oxford: Elsevier Ltd. ? Cameron, F. 2007. Beyond the cult of the replicant: Museums and historical digital objects—traditional concerns, new discourses. In Theorizing digital cultural heritage, a critical discourse. Edited by F. Cameron and S. Kenderdine, 49-76. Cambridge: MIT Press. ? Capell, L. 2010. Digitization as a preservation method for damaged acetate negatives: A case study. The American Archivist 73.1: 235-49. ? Cerquiglini, B. 1989. Éloge de la variante. Translated by Betsy Wing. Baltimore: Johns Hopkins University Press.? Chambers, R. W., M. Förster & R. Flower, eds. 1933. The Exeter Book of Old English poetry. London: Percy Lund, Humphries & Company.? Ciula, A. 2005. Digital palaeography: Using the digital representation of medieval script to support palaeographic analysis. Digital Medievalist 1. Accessed on June 22, 2009. http://www.digitalmedievalist.org/journal/1.1/ciula/. ? Cramer, J., ed. 1897. Quelle, verfasser und text des altenglischen gedichtes 'Christi Höllenfahrt. Anglia Beibl 19.7: 137-174.? Diggle, J. & F. R. D. Goodyear, eds. 1972. The classical papers of A. E. Housman, vol. 3, 1915-1936. Cambridge: CUP. ? Duranti, L. & E. Shaffer, eds. 2012. Conference proceedings. The memory of the world in the digital age: Digitization and preservation. Published by UNESCO. http://www.ciscra.org/docs/UNESCO_MOW2012_Proceedings_FINAL_ENG_Compressed.pdf ? Fulk, R. D. 2005. Some contested readings in the Beowulf manuscript. RES 56.224: 192-223. ? Gigante, M. & M. Capasso. 1990. Papyrology and computers. In Rediscovering Pompeii. 56-61. Rome: L’Erma’di Bretschneider.? Green, P. 2006. Colour management in heritage photography. In Digital heritage. Applying digital imaging to cultural heritage. Edited by L. MacDonald, 293-324. Oxford: Elsevier Ltd.? Grein, C & B. Assmann. 1898. Bibliothek der angelsächsischen Poesie. 3.1. Revised by B. Assmann. Leipzig: Georg H. Wigland. ? Hazan, S. 2007. A crisis of authority: New lamps for old. In Theorizing digital cultural heritage: A critical discourse. Edited by F. Cameron and S. Kenderdine, 133-45. Cambridge: MIT Press. ? Holthausen, F. 1935. Sprache und literatur. Anglia Beibl 46: 5-10. ? Hunt, R. G. W. 2004. The reproduction of colour. Hoboken: Wiley. ? Irving, E. B., Jr. 1998. Editing Old English verse: The ideal. In New approaches to editing Old English verse. Edited by S. Larratt Keefer and K. O’Brien O’Keeffe, 11-20. Cambridge: D. S. Brewer.? Kiernan, K. S., ed. 2013. Electronic Beowulf, 3rd ed. London: British Library. http://ebeowulf.uky.edu/? ———. 1994. Old manuscripts / new technologies. In Anglo-Saxon manuscripts. Basic readings. Edited by M. P. Richards, 37-54. London: Routledge.? ———. 2000. Restoring damaged manuscripts. The Digital Atheneum 20.2. Accessed on July 27, 2009. http://www.infotoday.com/cilmag/feb00/seales.htm. ? Krapp, G. P. & E. V. K. Dobbie, eds. 1936. The Exeter Book. ASPR III. New York: Columbia University Press.? Lamb, D. E. S. 2007. The eyes of a stranger: Using other disciplines to construct an Archaeological model. In Crossing frontiers. The opportunities and challenges of interdisciplinary approaches to Archaeology. Edited by H. Schroeder, P. Bray, P. Gardner, V. Jefferson, and E. Macaulay-Lewis, 29-44. Oxford: Oxford School of Archaeology.? Larratt Keefer, S. 1998. Respect for the book. In New approaches to editing Old English verse. Edited by S. Larratt Keefer and K. O’Brian O’Keeffe, 21-44. Cambridge: D.S. Brewer.? Lee, S. 2001a. Digital imaging: A practical handbook. New York: Newal-Schuman Publishers, Inc.? ——. 2001b. Digitization: Is it worth it? Computers in Libraries 21.5: 28. Accessed on April 12, 2014. http://www.infotoday.com/cilmag/may01/lee.htm. ? MacDonald, L., ed. 2006. Digital heritage. Applying digital imaging to cultural heritage. Oxford: Elsevier Ltd. ? ———. & R. Jacobsen. 2006. Assessing image quality. In Digital heritage, applying digital imaging to cultural heritage. Edited by L. MacDonald, 351-72. Oxford: Elsevier, Ltd. ? Mackie, W., ed. 1934. The Exeter Book. Part II: Poems IX-XXXII. EETS. London: OUP.? Muir, B. J. 1989. A preliminary report on a new edition of the Exeter Book. Scriptorium 43.2: 273-88. ? ———., ed. 2000. The Exeter anthology of Old English poetry, 2nd ed. 2 Vols. Exeter: Short Run Press, Ltd.? ———., ed. 2006. The Exeter anthology of Old English poetry. DVD. Software & Design, N. Kennedy. Exeter: University of Exeter Press.? O’Brien O’Keeffe, K. 1998. Introduction. In New approaches to editing Old English verse. Edited by S. Larratt Keefer and K. O’Brien O’Keeffe, 1-10. Cambridge: D.S. Brewer.? Owen-Crocker, G.R., ed. 2009. Working with Anglo-Saxon manuscripts. Exeter: Exeter Univ. Press.? Phillpott, M., ed. 2014a. InScribe: Palaeography learning materials (free course). Institute of Historical Research. University of London. School of Advanced Study. Accessed on April 12, 2014. http://www.history.ac.uk/research-training/courses/online-palaeography. ? Phillpott, M., ed. 2014b. InScribe: Page fo. 115r of Exeter, Cathedral Library, MS 3501. Institute of Historical Research. University of London. School of Advanced Study. Accessed on April 12, 2014. https://sas-vle-dev.cch.kcl.ac.uk/page/26/. ? Pope, J. C. 1978. Palaeography and poetry: Some solved and unsolved problems of the Exeter Book. In Medieval scribes, manuscripts and libraries: Essays presented to N. R. Ker. Edited by M. B. Parkes and A. G. Watson, 25-65. London: Scolar Press.? Rambaran-Olm, M. 2014. 'John the Baptist’s Prayer' or 'The descent into hell' from the Exeter Book. Text translation and critical study. Woodbridge: D.S. Brewer. ? ———. 2007. Two remarks concerning Folio 121 of the Exeter Book. Notes and Queries 54.3: 207-208. ? Reynolds, L. & N. Wilson. 1974. Scribes and scholars. Oxford: OUP.? Russo, A. & J. Watkins. 2007. Digital cultural communication: Audience and remediation. In Theorizing digital heritage: A critical discourse. Edited by F. Cameron and S. Kenderdine, 149-163. Cambridge: MIT Press. ? Saenger, P. 1982. Silent reading: Its impact on Late Medieval script and society. Viator 13: 367-414.? Schroeder, H., P. Bray, P. Gardner, et al., eds. 2007. Crossing Frontiers. The opportunities and challenges of interdisciplinary approaches to archaeology. Oxford: Oxford School of Archaeology.? Scragg, D. G. 1974. A history of English spelling. Manchester: Manchester Univ. Press. ? Terras, M. M. 2011. Artefacts and errors: Acknowledging issues of representation in the digital imaging of ancient texts. In Codicology and papyrology in the digital age, II. Institut für Dokumentologie und Editorik. Edited by G. Vogeler et al., 43-61, vol. B and 3. Accessed on April 3, 2014. http://www.i-d-e.de/schriften-2/bd-3-kpdz2. ? Thorpe, B. 1842. Codex exoniensis: A collection of Anglo-Saxon poetry... with an English rranslation, notes and indexes. London: The Society of Antiquaries of London.? Torborg, W. W., T. M. Van & C. Stewart. 2012. The challenges of manuscript rreservation in the digital age. In Conference proceedings. The memory of the world in the digital age: Digitization and preservation. Edited by L. Duranti and E. Shaffer, 851-863. Published by UNESCO. Accessed on April 18, 2014. http://www.ciscra.org/docs/UNESCO_MOW2012_Proceedings_FINAL_ENG_Compressed.pdf. ? Turner, M. J. 2012. Lies, damned lies and visualizations: Will metadata and paradata be a solution or a curse? In Paradata and transparency in virtual heritage. Edited by A. Bentkowska-kafel, H. Denard, and D. Baker. Surrey: Ashgate? Zumthor, P. 1972. Essai de poétique medieval. In Collection poétique. Paris: Seuil.?

      Remove question marks (?), and add quotation marks around article and chapter titles.

  16. Mar 2017
    1. SHOWS

      In the original article, it was said that vaccines directly cause brain disorders, which is not what the study found. The study said that there was a time-oriented association (not even a coorelation) between the amount of certain diagnosed brain disorders and antecendant vaccines. The study never makes the claim of causation, though the phrasing of the title (out of onctext, that is) is common for clickbait articles such as this. While not completely made up, the original research as a completely different tone than what is being presented by this article. In addition, the original artice discuses limitation that are completely thrown out by this article: they mention that doctors diagnose disorders differently than other doctors, which is something readers/sharers of the article ought to be aware of.

      Though I found the original research, the message of this article has completely distorted Yale's findings. The study was writen from a HINDSIGHT perspective. Meaning, they mentioned vaccines are received more often by those who have any of the aforementioned disorders. For exaple, they say, "The principal findings of this study are as follows: (i) children with OCD, AN, anxiety disorder, and tic disorder were more likely to have received influenza vaccine during the preceding 1-year period". The entire study was merely showing (seemingly unintentionaly so) that those who have mental disorders are more likely to hae received vaccinations in the past several years. Not even close to stating that they are directly caused by vaccines. The article doesn't mention this, but one reason may be socioeconomic status, IE the wealthy have better doctors who diagnose, and they can afford more vaccines for their cildren. The article has completely distorted the findings and ignored the mentioned limitations of the article.

      Citations: Webber, P. (2017, February 10). BREAKING: Yale Study SHOWS Vaccines Cause Brain Disorders - RFK Jr. Retrieved March 30, 2017, from http://newamericannews.com/yale-study-shows-vaccines-cause-brain-disorders-rfk-jr/#

      Leslie, D. L., Kobre, R. A., Richmand, B. J., Guloksuz, S. A., & Leckman, J. F. (2017, January 04). Temporal Association of Certain Neuropsychiatric Disorders Following Vaccination of Children and Adolescents: A Pilot Case–Control Study. Retrieved March 30, 2017, from http://journal.frontiersin.org/article/10.3389/fpsyt.2017.00003/full

    1. Most often it is a bishop of a diocese but at common law it seems to be recognised that it can also be other clerics. Some jurisdictions such as the United States continue to recognise the corporation sole; see James B O’ Hara - The Modern Corporation Sole (1988) 93 Dick L Rev 23. The concept was imported at common law into that jurisdiction but has for centuries been regulated by statute for the purpose of holding property and for the succession of rights of action or liability for civil wrongs committed by its servants. Now, because of statutory recognition within the states of that union, corporations sole are entirely creatures of statute and the common law concept has ceased; Wright v Morgan (1903) 191 US 55 at 59. 57. Nonetheless, within that jurisdiction corporations sole as applying to the Catholic Church were recognised at common law following the Declaration of Independence. That had been the case in England, and by extension also in Ireland at least prior to the application of the Reformation. Blackstone, in his Commentary on the Laws of England (1765-1769) at 457 distinguishes corporations sole from corporations having “many persons united together into one society, and are kept up by a perpetual succession of members”. Blackstone extends the scope of the concept outside that of the English monarch and bishops in the same passage: Corporations sole consist of one person only and his successors, in some particular station, who are incorporated by law, in order to give them some legal capacities and advantages, particularly that of perpetuity, which in their natural persons they could not have had. In this sense the king is a sole corporation: so is a bishop: so are some deans, and prebendaries, distinct from their several chapters: and so is every parson and vicar.

      History of corporations sole

    1. '10 ........... ~ k-w ~r..J (!)00 a,,-..&,w1 +-l;lw ... 1111 OV\.b~ eo~u( ~ saying clearly what one wishes to say when there is an abundance of material; and conversation will seldom attain even the level of an intellectual pas-time if adequate methods of Interpretation are not also available.

      It is a clear skill to know exactly what someone wants to hear out of anything that could be said, but this will not amount to anything productive unless both parties recognize the merit in the discussion and not just in hearing what they desire

    1. gave $10,000 to conservative activist James O’Keefe’s Project Veritas, which works closely with Breitbart and is an unofficial arm of the Trump campaign. Ironically, Project Veritas did actually attempt to infiltrate the campaign of rival candidate Hillary Clinton. It successfully infiltrated outside groups aligned with it, secretly recording and then publishing internal campaign details, which Trump used repeatedly on the stump. The tweets come after multiple investigations into Russian interference in the election. The CIA, FBI and National Security Agency concluded that operatives for Russian President Vladimir Putin did intervene during the campaign. Trump’s administration is under mounting pressure over its alleged communications with Russian officials in the weeks before Trump officially entered the White House. National security adviser Michael Flynn was forced to resign just 24 days into the role over allegations that he’d discussed U.S. sanctions against Russia with its ambassador in the lead-up to Trump taking office. This week, it was widely reported that Attorney General Jeff Sessions met with Russian officials during the presidential campaign, even though he’d previously denied doing so, under oath, to the Senate Judiciary Committee. Sessions has since recused himself from the Russia investigations. This article has been updated with more details, including comment from Kevin Lewis. Related Coverage White House Weighing Policy Of Separating Mothers And Children Crossing U.S. Border Jeff Sessions Recuses Himself From Russia Investigations Bill Maher Shreds The Media For Praising ‘Defective’ Trump’s Speech To Congress Chelsea Clinton And Kellyanne Conway Share Unlikely Friendly Moment On Twitter Do you have information you want to share with the Huffington Post? Here’s how. .before_related_media .advertisement__label { display: none !important; }.mobileweb .before_related_media p{margin:0px 16px} (function(){ document.getElementById('open-secure-contact').addEventListener('click', function(e){ e.preventDefault(); e.stopPropagation(); e.stopImmediatePropagation(); var secureModal = new HP.modules.Modal({name: "secure-contact", closeColor: "black", html: "<h1>How To Leak To The Huffington Post</h1><p>We tell big stories on difficult subjects. We’ve reported on <a rel=\"noopener noreferrer\" target=\"_blank\" href=\"http://projects.huffingtonpost.com/dying-to-be-free-heroin-treatment\">the inequities of the drug treatment system</a>, <a rel=\"noopener noreferrer\" target=\"_blank\" href=\"http://highline.huffingtonpost.com/articles/en/sandra-bland-jail-deaths/\">deaths in police custody</a>, and <a rel=\"noopener noreferrer\" target=\"_blank\" href=\"http://www.huffingtonpost.com/entry/unaoil-scandal-explained_us_56fbd2f0e4b0daf53aee0cff\">a massive bribery scandal</a> involving some of the world’s biggest corporations. To tell these stories, we must work with people who know what is really going on inside government and private institutions. That’s where you come in. </p><p>Are you getting new directives that flout established practice? Are new rules making you uncomfortable? Is an important program on the chopping block? Are you being asked to do something unethical? We want to see whatever evidence and documentation you can provide. </p><p>Your employer, hackers and the government can all read your emails (or at least see that you contacted us). But if that doesn’t bother you, email us at <a rel=\"noopener noreferrer\" target=\"_blank\" href=\"mailto:scoops@huffingtonpost.com\">scoops@huffingtonpost.com</a>.</p><h2>Need privacy?</h2><p>If you’re concerned that being a source for a story poses a significant risk, take precautions:</p><ul><li><strong>Know your risks</strong>. No form of communication is 100 percent safe from all observers. Make a plan about what you’ll do if the wrong person finds out you contacted us.</li><li><strong>Do not contact us from your work computer or phone</strong>. Your bosses can track your use of these devices. The same goes for your personal mobile phone, if you’ve ever installed apps from your employer — even if you later uninstalled them.</li><li>Consider using <strong>postal mail</strong>. We’re at “Huffington Post, PO Box 28154, Washington, DC 20038-8154.” Send from a public mailbox and don’t write a return address. Only we can read your message (unless a court provides a warrant).</li><li>Use the same <strong>encrypted email</strong> service we do. Create a new <a rel=\"noopener noreferrer\" target=\"_blank\" href=\"http://protonmail.com/\">protonmail.com</a> account — separate from your other email accounts — and use it to write us at <a rel=\"noopener noreferrer\" target=\"_blank\" href=\"mailto:huffpostscoops@protonmail.com\">huffpostscoops@protonmail.com</a>. As long as you write to our Protonmail address from your Protonmail address, only we or someone who knows your password can read your message. <a rel=\"noopener noreferrer\" target=\"_blank\" href=\"https://www.wired.com/2015/10/mr-robot-uses-protonmail-still-isnt-fully-secure/\">Read more about Protonmail</a>.</li><li><strong>Use your browser’s “incognito” or “private browsing” mode</strong>. Some sites (including, potentially, your employer’s) can access your browser history and see what websites you’ve visited. An incognito window masks this data. Open a new incognito browser window to contact us, and close it immediately afterward. If you don’t, your browser can display your online history to sites that ask for it.</li><li><strong>Do not contact us during work hours</strong>.<strong> </strong>You could get into trouble if your employer found out.</li><li>If you are concerned you are under active surveillance, <strong>do not contact us from home</strong> and <strong>do not contact us from your regular phone</strong>. Public wifi hotspots can help keep you anonymous. Use the <a rel=\"noopener noreferrer\" target=\"_blank\" href=\"https://tails.boum.org/\">Tails</a> operating system to access ProtonMail at <a rel=\"noopener noreferrer\" target=\"_blank\" href=\"https://protonirockerxow.onion/\">https://protonirockerxow.onion/</a> instead of the normal protonmail.com address. Start your Tails session immediately before contacting us, and close it immediately afterward.</li><li><strong>Do not tell others that you are a source</strong>, and <strong>do not contact us on social media</strong>.</li><li>If you email us documents,<strong> strip document metadata</strong>.<strong> </strong>Metadata can include evidence of where a document originated and who has handled it. Here are <a rel=\"noopener noreferrer\" target=\"_blank\" href=\"https://www.cnet.com/how-to/remove-metadata-from-office-files-pdfs-and-images/\">removal instructions</a>.</li></ul><p>In most cases, our reporters or editors will need to know your identity so we can verify and authenticate the information you provide to us. Your identity will only be shared with HuffPost staff who absolutely need to know it.</p><p>We will do everything we can to protect your identity, but if you feel you must remain completely anonymous, we will ask you to provide us with sources or contacts who can corroborate the information you send us.</p><style>.popup-window__container.secure-contact .popup-window__inner-container{max-width:736px;position:relative;margin:0 auto;background-color:#fff}.popup-window__container.secure-contact .popup-window__modal-body-container{background-color:#fff;text-align:left;padding:30px;height:100vh;overflow:scroll}.secure-contact p,.secure-contact ul{line-height:28px;margin-bottom:20px;font-size:1.0625rem}.secure-contact ul{padding:0 30px}</style>"}); secureModal.attachEventListeners = function(){ this.$element.find('a').on('click', function(e){ e.stopPropagation(); e.stopImmediatePropagation(); }); }; secureModal.open(); }); }()); ALSO ON HUFFPOST We Are Sorry,This video has been removedEcode: 06 Suggest a correction Lee Moran Trends Editor, The Huffington Post MORE: Donald Trump U.S. News Barack Obama International News Republican Politics Sign Your Name: Make Voter Registration Automatic Target: American Lawmakers We should be making it easier for people to vote, not harder. That's why voter registration should be automatic for every eligible citizen. Sign our petition if you agree that voter registration should be automatic. This petition is hosted by The Action Network. By adding your name, you are sharing your information with The Action Network, whose Privacy Policy (https://actionnetwork.org/privacy) applies. .action_letter {display: none;} Petition by Progressive Turnout Project Northbrook, Illinois To: American Lawmakers From: [Your Name] We should be making it easier for people to vote, not harder. That's why voter registration should be automatic for every eligible citizen. Sign our petition if you agree that voter registration should be automatic. Sign This Petition Not in the US? Country * Afghanistan Aland Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia, Plurinational State of Bonaire, Sint Eustatius and Saba Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory Brunei Darussalam Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cabo Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Congo, the Democratic Republic of the Cook Islands Costa Rica Côte d'Ivoire Croatia Cuba Curaçao Cyprus Czech Republic Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands (Malvinas) Faroe Islands Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Gambia Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and McDonald Islands Holy See (Vatican City State) Honduras Hong Kong Hungary Iceland India Indonesia Iran, Islamic Republic of Iraq Ireland Isle of Man Israel Italy Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati Korea, Democratic People's Republic of Korea, Republic of Kuwait Kyrgyzstan Lao People's Democratic Republic Latvia Lebanon Lesotho Liberia Libya Liechtenstein Lithuania Luxembourg Macao Macedonia, the former Yugoslav Republic of Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Micronesia, Federated States of Moldova, Republic of Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island Northern Mariana Islands Norway Oman Pakistan Palau Palestine, State of Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Réunion Romania Russian Federation Rwanda Saint Barthélemy Saint Helena, Ascension and Tristan da Cunha Saint Kitts and Nevis Saint Lucia Saint Martin (French part) Saint Pierre and Miquelon Saint Vincent and the Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Sint Maarten (Dutch part) Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia and the South Sandwich Islands South Sudan Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Swaziland Sweden Switzerland Syrian Arab Republic Taiwan Tajikistan Tanzania, United Republic of Thailand Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu Uganda Ukraine United Arab Emirates United Kingdom United States United States Minor Outlying Islands Uruguay Uzbekistan Vanuatu Venezuela, Bolivarian Republic of Viet Nam Virgin Islands, British Virgin Islands, U.S. Wallis and Futuna Western Sahara Yemen Zambia ZimbabweUnited States You may receive updates from Progressive Turnout Project, the creator of this petition. Edit Subscription PreferencesClose Preferences Opt in to updates from Progressive Turnout Project     by Taboola by Taboola Sponsored Links Sponsored Links Promoted Links Promoted Links You May LikeSmart Financial LivingSan Jose Giving Solar Panels To Middle Class Homeowners At No Cost DownSmart Financial LivingUndoTaskRabbitPeople In San Francisco Are Loving This Home Improvement ServiceTaskRabbitUndoHot RosterWatch Today's Must See Hot Roster Fantasy Sports Preview ShowHot RosterUndoHome ChefSan Jose: This Meal Service is Cheaper Than Your Local StoreHome ChefUndoEverQuote Insurance QuotesSan Jose, California Residents Wish They Knew This EarlierEverQuote Insurance QuotesUndoTruthfinder People Search SubscriptionJust Type in Your Name, Wait 10 Seconds, Then Brace YourselfTruthfinder People Search SubscriptionUndo (function(){ var c = document.getElementById('taboola-below-article-thumbnails'); c.id += '-' + Math.round(Math.random()*1e16); var taboolaParams = { loader: "http://cdn.taboola.com/libtrc/aol-huffingtonpost/loader.js", mode: "thumbnails-o", container: c.id, placement: "Below Article Thumbnails", target_type: "mix" }; window.modulousQueue.add(function(){ doTaboola(taboolaParams); }); }()); (function() { var zergnet = document.createElement('script'); zergnet.type = 'text/javascript'; zergnet.async = true; zergnet.src = (document.WB_wombat_location.protocol == "https:" ? "https:" : "http:") + '//www.zergnet.com/zerg.js?id=49203'; var znscr = document.getElementsByTagName('script')[0]; znscr.parentNode.insertBefore(zergnet, znscr); })(); window.HP.modules.smarten.selector('.js-entry'); CONVERSATIONS (function(d, s, id, locale){ var js, fjs = d.getElementsByTagName(s)[0]; locale = (locale == "ar_SA" ? "ar_AR" : locale); if (d.getElementById(id)) {return;} js = d.createElement(s); js.id = id; js.async = true; js.src = "https://connect.facebook.net/"+locale+"/sdk.js#xfbml=1&version=v2.4"; fjs.parentNode.insertBefore(js, fjs); }(document, 'script', 'facebook-jssdk', 'en_US')); if ( "function" === typeof(adSetSyncDelay) ) { adSetSyncDelay('125'); } (function() { var adsDiv = document.querySelector('#adtech_right_rail_flex'); adsDiv.removeAttribute('id'); window.modulousQueue.add(function(){ waitForGlobal('htmlAdWH', function() { adsDiv.reloadCount = 0; var recoveryId = ''; var needsRecovery = recoveryId && recoveryId.length && kraken__adBlock && kraken__adBlock.active; var adId = needsRecovery ? recoveryId : '93314268'; try { adId = io_c3sd.ads["right_rail_flex"] || adId; } catch(e) {} // Override adtech_call_type var delivery_type = "" || ""; var adtech_call_type = ""; switch (delivery_type) { case "by_request": adtech_call_type = "ajax"; break; case "text": adtech_call_type = "text"; break; case "iframe": adtech_call_type = "iframe"; break; case "iframe_proxy": adtech_call_type = "f"; break; case "collapsed": adtech_call_type = "fc"; break; default: adtech_call_type = "f"; break; } var args = ['RR', 'RR' ]; if(needsRecovery) { waitForGlobal('readyToRecover', function() { adsDiv = document.querySelector('.right_rail_flex'); //htmlAdWH(adId, args[0], args[1], "fileless", adsDiv); }); } else { htmlAdWH(adId, args[0], args[1], adtech_call_type, adsDiv); } if (typeof debugadcode == 'function') { debugadcode('AdTech', {placement: 'right_rail_flex', mnid: adId}, adsDiv); } jQuery(document).on('reloadAd', function(ev, elem) { if (elem && !elem.contains(adsDiv)) { return; } var refreshRate = 1; adsDiv.reloadCount++; if (adsDiv.reloadCount % refreshRate === 0 && typeof adsReloadAd === 'function') { adsReloadAd(adsDiv); } }); adSetInView('0'); }); // wFG:htmlAdWH }); }()); TRENDING Donald Trump Tweeted About International Women’s Day. It Backfired. Conservatives Pick Up ‘Mixed Messages’ From White House On Health Care Alec Baldwin Says He Won’t Do Trump Impression Much Longer Due To ‘Maliciousness’ Samuel L. Jackson On Ben Carson’s Slavery Comment: ‘Mothaf***a Please’ Donald Trump Met Russian Ambassador During The Campaign, Despite Repeated Denials HealthiNation The Best Snacks For Managing Blood Sugar Levels (function(){ console.log("[MediaVoice]: BizDev PF - Backfill Tag Loaded"); window.NATIVEADS = window.NATIVEADS || {}; window.NATIVEADS_QUEUE = window.NATIVEADS_QUEUE || []; window.NATIVEADS_QUEUE.push(["setPropertyID", "NA-HUFFPOSTUS-11238434"]); var PolarCreativeLabel = "pf-"; var PolarPF = ""; if((window.location.href.indexOf("entry")>-1)||(window.location.href.indexOf("/b/")>-1)){ //desktop B Page PolarPF = "promofeed_4a62c2b94e6f4c2cbe5c91c5325bf6dd"; PolarCreativeLabel = PolarCreativeLabel + "Desktop article pages - right rail backfill"; } else { //desktop Homepage PolarPF = "promofeed_d08c1294f5eb432cb8d8f8743e26b93b"; PolarCreativeLabel = PolarCreativeLabel + "Desktop front pages - right rail backfill"; } window.NATIVEADS_QUEUE.push(["insertPreview", { label: PolarCreativeLabel, unit: { "server":"mvdirect", "id": PolarPF }, location: "#mediaconductor-nonce-3", onRender: function($element) { mediaconductor("partner:fill", true, "mediaconductor-nonce-3"); }, onFill: function(data) { }, onError: function(error) { mediaconductor("partner:fill", false, "mediaconductor-nonce-3"); }, template: function (Handlebars,depth0,helpers,partials,data) { this.compilerInfo = [4,'>= 1.0.0']; helpers = this.merge(helpers, Handlebars.helpers); data = data || {}; var buffer = "", stack1, stack2, functionType="function", escapeExpression=this.escapeExpression; buffer += "<div class=\"plr-frame\">\n <a href=\""; if (stack1 = helpers.link) { stack1 = stack1.call(depth0, {hash:{},data:data}); } else { stack1 = depth0.link; stack1 = typeof stack1 === functionType ? stack1.apply(depth0) : stack1; } buffer += escapeExpression(stack1) + "\" target=\"_blank\">\n <div class=\"plr-ad\">\n <div class=\"plr-line\" style=\"text-align:center;\">\n <div class=\"plr-sponsor-name plr-line-text\">" + escapeExpression(((stack1 = ((stack1 = depth0.sponsor),stack1 == null || stack1 === false ? stack1 : stack1.name)),typeof stack1 === functionType ? stack1.apply(depth0) : stack1)) + "</div>\n </div>\n <div class=\"plr-img-wrapper\">\n <div style=\"background: url('"; if (stack2 = helpers.getThumbHref) { stack2 = stack2.call(depth0, {hash:{},data:data}); } else { stack2 = depth0.getThumbHref; stack2 = typeof stack2 === functionType ? stack2.apply(depth0) : stack2; } buffer += escapeExpression(stack2) + "') no-repeat center center;\"></div>\n </div>\n <div class=\"plr-title\">"; if (stack2 = helpers.title) { stack2 = stack2.call(depth0, {hash:{},data:data}); } else { stack2 = depth0.title; stack2 = typeof stack2 === functionType ? stack2.apply(depth0) : stack2; } buffer += escapeExpression(stack2) + "</div>\n </div>\n </a>\n</div>"; return buffer; } }]); window.NATIVEADS_QUEUE.push(["injectCSS", " .plr-frame { box-sizing: content-box; width: 300px; height: 250px; margin: auto; padding-bottom: 20px; background-color: white; } .plr-img-wrapper { position: relative; overflow: hidden; width: 300px; height:168px} .plr-img-wrapper div { position: absolute; top: 0; right: 0; bottom: 0; left: 0; background-size: cover !important; } .plr-disclosure { font-family: Arial; font-size: 12px; letter-spacing: 1px; color: #2c7061; } .plr-sponsor-name { font-family: ProximaNovaCond-Extrabld, NotoKufiArabic-Bold, Helvetica Neue, Helvetica, Roboto, Arial, sans-serif; font-size: 14px; font-weight: bold; display: inline-block; padding-right: 6px; padding-left:10px; text-transform: uppercase; color: #000; background-color: white} .plr-ad::before { position: relative; z-index: -1; top: 25px; display: inherit; content: ''; border-top: 3px solid #2c7061; } .plr-ad { padding: 10px 0x 0 0px; } .plr-line { position:relative; font-family: ProximaNovaCond-Extrabld, NotoKufiArabic-Bold, Helvetica Neue, Helvetica, Roboto, Arial, sans-serif; font-size: 0.875rem; margin-bottom: 10px; -webkit-box-ordinal-group: 2; color:#000; } .plr-line:after{ content: ''; border-bottom: 3px solid #000; position: absolute; top: 50%; left: 0; margin-top: -2px; width: 100%; z-index: 1; } .plr-line-text{ position: relative; padding-right: 10px; letter-spacing: 1.4px; background: #ffffff; display: inline-block; z-index: 2; } .plr-title { font-family: ProximaNovaCond-bold, ProximaNovaCond-Extrabld, NotoKufiArabic-Bold, Helvetica Neue, Helvetica, Roboto, Arial, sans-serif; font-size: 18px; line-height: 20px; margin-top: 8px; } .plr-frame a{ text-decoration:none; color:inherit; } ", "head"]); if (window.insertCount < 2) { window.insertCount++; } })(); (function(){ window.NATIVEADS = window.NATIVEADS || {}; window.NATIVEADS_QUEUE = window.NATIVEADS_QUEUE || []; window.NATIVEADS_QUEUE.push(["setPropertyID", "NA-HUFFPOST-11235841"]); window.NATIVEADS_QUEUE.push(["insertPreview", { label: "Article Page- Right Rail Unit", unit: {"server":"ibw","id":93416621,"mobile":false}, location: "#mediaconductor-nonce-2", onRender: function($element) { polartag('partner:fill', true, 'mediaconductor-nonce-2'); if ($element.hasClass('plr-360-huffpo-autoload')) { load360($element); } }, onFill: function(data) { var time_value = new Date(data.pubDate); if (time_value) { var month = pad(time_value.getMonth() + 1, 2); var day = pad(time_value.getDate(), 2); var year = time_value.getFullYear(); var dateTime = month + '.' + day + '.' + year; data.pubDate = dateTime; } if (data.custom.content_type === "RYOT 360") { data.ryot = true; } //Temp Check for Curate Content else if (data.sponsor.name.toLowerCase().indexOf("wellness") >= 0) { data.curate = true; data.custom.category = "Sleep+Wellness"; } else { data.studio = true; } }, onError: function(error) { console.log("[Mediavoice Plugin] Right Rail Unit onError: " + error); polartag('partner:fill', false, 'mediaconductor-nonce-2'); }, template: function (Handlebars,depth0,helpers,partials,data) { this.compilerInfo = [4,'>= 1.0.0']; helpers = this.merge(helpers, Handlebars.helpers); data = data || {}; var stack1, functionType="function", escapeExpression=this.escapeExpression, self=this; function program1(depth0,data) { var buffer = "", stack1, stack2; buffer += "\n<div class=\"plr-360-huffpo-autoload\">\n <div class=\"plr-pnlm-wrapper\"></div>\n <div class=\"plr-ad-info\" style=\"display:none;\">\n <div class=\"pnlm-img-url\">" + escapeExpression(((stack1 = ((stack1 = depth0.custom),stack1 == null || stack1 === false ? stack1 : stack1.image_url_360)),typeof stack1 === functionType ? stack1.apply(depth0) : stack1)) + "</div>\n <div class=\"preview-img-url\">"; if (stack2 = helpers.getThumbHref) { stack2 = stack2.call(depth0, {hash:{},data:data}); } else { stack2 = depth0.getThumbHref; stack2 = typeof stack2 === functionType ? stack2.apply(depth0) : stack2; } buffer += escapeExpression(stack2) + "</div>\n </div>\n <a href=\""; if (stack2 = helpers.link) { stack2 = stack2.call(depth0, {hash:{},data:data}); } else { stack2 = depth0.link; stack2 = typeof stack2 === functionType ? stack2.apply(depth0) : stack2; } buffer += escapeExpression(stack2) + "\">\n <div class=\"title\">\n <img src=\"http://d3819ii77zvwic.cloudfront.net/wp-content/uploads/2015/08/mstile-310x150.png\">\n <div class=\"inner-title\">\n "; if (stack2 = helpers.title) { stack2 = stack2.call(depth0, {hash:{},data:data}); } else { stack2 = depth0.title; stack2 = typeof stack2 === functionType ? stack2.apply(depth0) : stack2; } buffer += escapeExpression(stack2) + "\n <br>\n <span class=\"cta\">View full experience</span>\n </div>\n </div>\n </a>\n</div>\n"; return buffer; } function program3(depth0,data) { var buffer = "", stack1; stack1 = helpers['if'].call(depth0, depth0.curate, {hash:{},inverse:self.program(6, program6, data),fn:self.program(4, program4, data),data:data}); if(stack1 || stack1 === 0) { buffer += stack1; } buffer += "\n"; return buffer; } function program4(depth0,data) { var buffer = "", stack1, stack2; buffer += "\n<div class=\"plr-rr\">\n <a href="; if (stack1 = helpers.link) { stack1 = stack1.call(depth0, {hash:{},data:data}); } else { stack1 = depth0.link; stack1 = typeof stack1 === functionType ? stack1.apply(depth0) : stack1; } buffer += escapeExpression(stack1) + ">\n <div class=\"plr-rr__badge\">" + escapeExpression(((stack1 = ((stack1 = depth0.custom),stack1 == null || stack1 === false ? stack1 : stack1.category)),typeof stack1 === functionType ? stack1.apply(depth0) : stack1)) + "</div>\n <div class=\"plr-rr__title\">"; if (stack2 = helpers.title) { stack2 = stack2.call(depth0, {hash:{},data:data}); } else { stack2 = depth0.title; stack2 = typeof stack2 === functionType ? stack2.apply(depth0) : stack2; } buffer += escapeExpression(stack2) + "</div>\n <img src=\""; if (stack2 = helpers.getThumbHref) { stack2 = stack2.call(depth0, {hash:{},data:data}); } else { stack2 = depth0.getThumbHref; stack2 = typeof stack2 === functionType ? stack2.apply(depth0) : stack2; } buffer += escapeExpression(stack2) + "\">\n </a>\n</div>\n"; return buffer; } function program6(depth0,data) { var buffer = "", stack1, stack2; buffer += "\n<div class=\"plr-frame\">\n <a href=\""; if (stack1 = helpers.link) { stack1 = stack1.call(depth0, {hash:{},data:data}); } else { stack1 = depth0.link; stack1 = typeof stack1 === functionType ? stack1.apply(depth0) : stack1; } buffer += escapeExpression(stack1) + "\">\n <div class=\"plr-ad\">\n <div class=\"plr-line\" style=\"text-align:center;\">\n <div class=\"plr-sponsor-name plr-line-text\">" + escapeExpression(((stack1 = ((stack1 = depth0.sponsor),stack1 == null || stack1 === false ? stack1 : stack1.name)),typeof stack1 === functionType ? stack1.apply(depth0) : stack1)) + "</div>\n </div>\n <div class=\"plr-img-wrapper\">\n <div style=\"background: url('"; if (stack2 = helpers.getThumbHref) { stack2 = stack2.call(depth0, {hash:{},data:data}); } else { stack2 = depth0.getThumbHref; stack2 = typeof stack2 === functionType ? stack2.apply(depth0) : stack2; } buffer += escapeExpression(stack2) + "') no-repeat center center;\"></div>\n </div>\n <div class=\"plr-title\">"; if (stack2 = helpers.title) { stack2 = stack2.call(depth0, {hash:{},data:data}); } else { stack2 = depth0.title; stack2 = typeof stack2 === functionType ? stack2.apply(depth0) : stack2; } buffer += escapeExpression(stack2) + "</div>\n </div>\n </a>\n</div>\n"; return buffer; } stack1 = helpers['if'].call(depth0, depth0.ryot, {hash:{},inverse:self.program(3, program3, data),fn:self.program(1, program1, data),data:data}); if(stack1 || stack1 === 0) { return stack1; } else { return ''; } }, }]); window.NATIVEADS_QUEUE.push(["injectCSS", " .plr-frame { box-sizing: content-box; width: 300px; height: 250px; margin: auto; padding-bottom: 20px; padding-top: 30px; background-color: white; } .plr-img-wrapper { position: relative; overflow: hidden; width: 300px; height:168px} .plr-img-wrapper div { position: absolute; top: 0; right: 0; bottom: 0; left: 0; background-size: cover !important; } .plr-disclosure { font-family: Arial; font-size: 12px; letter-spacing: 1px; color: #2c7061; } .plr-sponsor-name { font-family: ProximaNovaCond-Extrabld, NotoKufiArabic-Bold, Helvetica Neue, Helvetica, Roboto, Arial, sans-serif; font-size: 14px; font-weight: bold; display: inline-block; padding-right: 6px; padding-left:10px; text-transform: uppercase; color: #000; background-color: white} .plr-ad::before { position: relative; z-index: -1; top: 25px; display: inherit; content: ''; border-top: 3px solid #2c7061; } .plr-ad { padding: 10px 0x 0 0px; } .plr-line { position:relative; font-family: ProximaNovaCond-Extrabld, NotoKufiArabic-Bold, Helvetica Neue, Helvetica, Roboto, Arial, sans-serif; font-size: 0.875rem; margin-bottom: 10px; -webkit-box-ordinal-group: 2; color:#000; } .plr-line:after{ content: ''; border-bottom: 3px solid #000; position: absolute; top: 50%; left: 0; margin-top: -2px; width: 100%; z-index: 1; } .plr-line-text{ position: relative; padding-right: 10px; letter-spacing: 1.4px; background: #ffffff; display: inline-block; z-index: 2; } .plr-title { font-family: ProximaNovaCond-bold, ProximaNovaCond-Extrabld, NotoKufiArabic-Bold, Helvetica Neue, Helvetica, Roboto, Arial, sans-serif; font-size: 18px; line-height: 20px; margin-top: 8px; } .plr-frame a{ text-decoration:none; color:inherit; } /********** CSS for 360 ***********/ .plr-360-huffpo-autoload { position: relative; max-width: 300px; margin: auto; padding-top: 10px; border-top: 1px solid #e5e5e5; border-bottom: 1px solid #e5e5e5; } @media (max-width: 320px) { .plr-360-huffpo-autoload { width: 300px; margin: -10px; } } .plr-360-huffpo-autoload a { text-decoration: none; color: initial; } .plr-360-huffpo-autoload .plr-pnlm-wrapper { width: 100%; height: 200px; } .plr-360-huffpo-autoload .pnlm-load-box { height: 100px !important; } .plr-360-huffpo-autoload .pnlm-lmsg { display: none; } .plr-360-huffpo-autoload .plr-pnlm-wrapper { overflow: visible; } .plr-360-huffpo-autoload .title { font-family: 'ProximaNovaCond-Bold', 'NotoKufiArabic-Bold', 'Helvetica Neue', 'Helvetica', Roboto, Arial, sans-serif; font-size: 18px; font-weight: normal; position: relative; width: 100%; margin: 0; padding-top: 5px; padding-bottom: 10px; text-transform: none; color: #2e7061; background: white; } .plr-360-huffpo-autoload .title img { position: absolute; top: 50%; right: 0; float: right; width: 60px; height: 30px; transform: translateY(-50%); } .plr-360-huffpo-autoload .title .inner-title { display: block; width: 235px; } .plr-360-huffpo-autoload .title .cta { font-size: 14px; position: relative; top: 3px; left: -3px; padding: 2px 5px; text-transform: none; color: grey; border-radius: 3px; background-color: #f1f1f1; } .plr-360-huffpo-autoload .pnlm-load-button { top: 0; right: 0; left: initial; width: 100%; height: 100%; margin: 0; border-radius: 0; background-color: transparent; } .plr-360-huffpo-autoload .pnlm-load-button:hover { background-color: transparent; } .plr-360-huffpo-autoload .pnlm-load-button p { position: absolute; top: 10px; right: 10px; display: block; margin: 0; padding: 0 10px; background-color: rgba(46, 112, 97, 0.6); } .plr-360-huffpo-autoload .plr-learn-more { line-height: 30px; position: absolute; right: 5px; bottom: 5px; display: none; height: 30px; margin: 0; padding: 0 10px; background-color: rgba(1, 117, 102, 0.7); } /********** CSS for Right Rail Curate ***********/ .plr-rr { position: relative; display: flex; margin-bottom: 20px; padding: 20px 0; border-top: 3px solid black; border-bottom: 1px solid #e5e5e5; } .plr-rr a { display: inherit; text-decoration: initial; color: initial; } .plr-rr__title { font: normal normal normal normal 18px / 20px ProximaNovaCond-bold, ProximaNovaCond-Extrabld, NotoKufiArabic-Bold, 'Helvetica Neue', Helvetica, Roboto, Arial, sans-serif; flex: 2; } .plr-rr img { flex: 1; } .plr-rr__badge { font: normal normal normal normal 14px / normal ProximaNovaCond-Extrabld, NotoKufiArabic-Bold, 'Helvetica Neue', Helvetica, Roboto, Arial, sans-serif; position: absolute; top: -8px; left: 0; padding: 0 10px 0 0; text-transform: uppercase; background-color: white; } ", "head"]); window.NATIVEADS_QUEUE.push(["injectCSS", ".preview { border: 1px solid #949494; border-radius: 5px; overflow: hidden; margin-top: 12px; width: 300px; margin-bottom: 10px } .preview a { text-decoration: none; color: #333; font-weight: 700 } .preview .preview_image_wrapper { margin-bottom: 10px } .preview .carousel { padding: 0; margin-top: 5px } .preview .preview_h4 { font-size: 16px; line-height: 18px } .preview li { padding: 4px 8px 8px } .preview .preview_image_wrapper { text-align: center } .preview .preview_meta_links { font-size: 13px; margin-top: 5px; text-align: center; padding: 0 } .preview_meta_links a { color: #2e7060 } .preview .preview_entry { margin-bottom: 5px; width: 282px } .preview ul.preview_meta_links li { display: inline; color: #aaa; padding: 0; margin-right: 1px } .commercial_title { position: absolute; margin: -14px 8px; text-transform: uppercase; color: #fff; padding: 2px 8px; border-radius: 5px; background-color: #2e7060; font: 700 10px/15px Arial, Helvetica, sans-serif } ", "head"]); })(); Close SUBSCRIBE TO & FOLLOW TRUMP'S FIRST 100 DAYS How will Donald Trump’s first 100 days impact YOU? Subscribe, choose the community that you most identify with or want to learn more about and we’ll send you the news that matters most once a week throughout Trump’s first 100 days in office. Learn more Newsletter 2.06 M 1.15 M 472 K Podcast Add us on Snapchat

      There's a lot you can do with 10,000 dollars good for trump for giving back to the community

    1. The importance of fuel spills should not be underestimated, particularly if the fuel gets into water.
      Oil spills are potentially catastrophic events for the local environment. Published in 1977, Mr. Berger would have recently seen Alaska’s decision to reverse its ruling on drilling in the Kachemak Bay after a relatively minor spill.1 Oil spills on land, such as those from a pipeline, can be tremendously damaging and kills all currently growing tissue.2 Across water, the potential for the spill to spread is greatly increased, and any damage is exacerbated by the Arctic climate, where its slow rate of degradation would allow it to remain for as long as 50 years.3 The spills are most dangerous on the surface, where they prove especially deadly to birds, and there is concern that a spill could quickly diffuse over a large area, increasing the radiation absorbed and greatly facilitating ice melt. Given the event of a catastrophic failure, the pipeline would have the potential to leak tens of thousands of barrels, not including smaller leaks and the time necessary to detect and repair them. Furthermore, attempts to prevent the spill from reaching the water using temperate containment techniques may be more damaging than helpful due to the use of heavy equipment and the risk this poses to the permafrost.4 In 1967, the Torrey Canyon Oil Spill illustrated the dangers posed by a spill. A supertanker ran aground off the coast of England, spilling between 857,600 and 872,300 barrels of oil, contaminating 300 miles of coastline and killing 25,000 birds as well as various seals and other marine life.5 Therefore, any spill is detrimental to the environment, and if it allowed to reach water, these effects will only be compounded.
      
      1. Panitch, Mark. "Kachemak Bay: Oil Spill Leads Alaska to Reverse Drilling OK." Science 193, no. 4248 (1976): 131. http://www.jstor.org/stable/1743047.
      2. Wein, Ross W., and L. C. Bliss. "Experimental Crude Oil Spills on Arctic Plant Communities." Journal of Applied Ecology 10, no. 3 (1973): 671-82. doi:10.2307/2401861.
      3. Campbell, W. J., and S. Martin. "Oil and Ice in the Arctic Ocean: Possible Large-Scale Interactions." Science 181, no. 4094 (1973): 56-58. http://www.jstor.org/stable/1735934.
      4. Shelton, R. G. J. "Effects of Oil and Oil Dispersants on the Marine Environment." Proceedings of the Royal Society of London. Series B, Biological Sciences 177, no. 1048 (1971): 411-22. http://www.jstor.org/stable/75994.
      5. "Torrey Canyon." Joye Research Group. Accessed March 5, 2017. http://www.joyeresearchgroup.uga.edu/public-outreach/marine-oil-spills/other-spills/torrey-canyon.
  17. Feb 2017
  18. msheathersfihs.weebly.com msheathersfihs.weebly.com
    1. References Atchley, R.A., Staryer, D.L., & Atchley, P. (2012) Creativity in the Wild: Improving Creative Reasoning through Immersion in Natural Settings. PLos ONE, 7(12): e5147. Doi:101371/journal. Pone.0051474 Barbiero, G., Berto, R., Freire, D.D., Ferrando, M., & Camino, E. (2014). Unveiling biophilia in children using active silence training: an experimental approach. Visions for Sustainability, 1, 31-38. Bender, R. & Parman, J. (2005). New campuses for new communities: The university and exurbia. Places, 17 (1): 54-59. Berman, M.G., Jonides, J., & Kaplan, S (2008). The cognitive benefits of interacting with nature. Psychology Science, 19, 1207-1212. Berto, R. (2005). Exposure to restorative environments helps restore attentional capacity. Journal of Environmental Psychology, 25 (3): 249-259. de Bloom, J., Kinnunen, U., & Korpela, K. (2014). Exposure to nature versus relaxation during lunch breaks and recovery from work: development and design of an intervention study to improve workers' health, well-being, work performance and creativity. BMC Public Health, 14(1), 488. Bowman, A. (2011). Beyond the Ivory Tower: In Search of a New form for Campus-Community Relationships. Unpublished Master’s Thesis: Massachusetts Institute of Technology. Boyer, E. L. 1987. College: The Undergraduate Experience in America. New York: Harper & Row. Bratman, G.N., Hamilton, J.P., & Daily, G.C. (2012). The impacts of nature experience on human cognitive function and mental health. Annals of the New York Academy of Science, 1249, 118-136. Cornell University Campus Master Plan http://www.masterplan.cornell.edu/doc/cmp_part_1/campus_landscape/cmp_campus_landscape.pdf  retrieved July 16, 2014 Dober, R. (1996). Campus Architecture: Building in the Groves of Academe. NY, NY: McGraw-Hill. Eckert, E. (2012). Assessment and the outdoor campus environment: using a survey to measure student satisfaction with the outdoor physical campus. Planning for Higher Education, 41.1: 141+. Academic OneFile. Web. 10 July 2014. Felsten, G. (2009). Where to take a study break on the college campus: An attention restoration theory perspective. Journal of Environmental Psychology, 29(1), 160-167. Fried, C. B. (2008). In-class laptop use and its effects on student learning. Computers & Education, 50(3), 906-914. Greene, T. (2013). Imaging Science Communities. Learning Spaces Collaboratory. Retrieved online: http://pkallsc.org/sites/all/modules/ckeditor/ckfinder/userfiles/files/Imagining%20Science%20Communities_Greene%20-%20LSC.pdf Griffith, J. (1994). Open Space Preservation: An imperative for quality campus environments. Journal of Higher Education, 65(6), 645-669. Grummon, P. T. (2009). Best practices in learning space design: Engaging users. Educause Quarterly: A Special Issue on Learning Spaces, 32(1). Gumprecht, B. (2003). The American College Town. Geographical Review, 93(1), 51-80. Gumprecht, B. (2007). The campus as a public space in American College town. Journal of Historical Geography, 33, 72-103. Gutierrez, J. (2013). Restorative Campus Landscapes: Fostering Education through Restoration. Master’s thesis in Landscape Architecture. Kansas State University. Manhattan, Kansas. Hanan, H. (2013). Open Space as Meaningful Place for Students in ITB Campus. Procedia-Social and Behavioral Sciences, 85, 308-317. Harper, D. (n.d). “Campus.” Online Etymology Dictionary, accessed May 30, 2013 online: http://www.etymonline.com/index.php?term=campus. Hartig, T., Mitchell, R., de Vries, S., & Frumkin, H. (2014). Nature and Health. Annual Review of Public Health, 7(44) doi: 10.1146/annurev-publhealth-032013-182443. Hashimshony, R., and Haina, J. (2006). Designing the University of the Future. Planning for Higher Education. January-March 2006. 34 (2): 4-19. James, W. (1890). Principles of Psychology Vol. 1, 437. Dover Publications Inc. Kaplan, S., & Kaplan, R. (1982). Cognition and environment: Functioning in an uncertain world. New York: Praeger. Kaplan, R. (1983). The role of nature in the urban context. In Behavior and the natural environment (pp. 127-161). Springer US. Kaplan, R., & Kaplan, S. (1989). The experience of nature: A psychological perspective. Cambridge University Press Archive. Keniger, L., Gaston, K., Irvine, K., & Fuller, R. (2013). What are the benefits of interacting with Nature?nature?  International Journal of Environmental Research and Public Health, 10, 913-935; doi: 10.3390/ijerph10030913 Kenney. D.R., Dumont, R., & Kenny, G. (2005). Mission and place: Strengthening learning and community through campus design. Westport, CT: Praeger Publishers. Koester, R. J., Eflin, J., & Vann, J. (2006). Greening of the campus: a whole-systems approach. Journal of Cleaner Production, 14(9), 769-779. Lindal, P. J. & Hartig, T. (2013). Architectural variation, building height, and the restorative quality of urban residential streetscapes. Journal of Environmental Psychology. 33, 26-36. Matsuoka, R. H. (2010). Student performance and high school landscapes: Examining the links. Landscape and Urban Planning, 97(4), 273-282. Nash, R. (1982). Wilderness and the American mind. New Haven, London: Yale University Press. Orr, D. W. (2004). Earth in mind: On education, environment, and the human prospect. Island Press. Painter, S., Fournier, J., Grape, C., Grummon, P., Morelli, J., Whitmer, S., & Cevetello, J. (2013). Research on Learning Space Design: Present State, Future Directions. Society for College and University Planning. Retrieved online: http://www.acmartin.com/sites/default/files/LearningSpaceDesign-L_0.pdf Perry, D., & Wiewel, W. (2005). Eds., the University as Urban Developer: Case studies and analysis. Cambridge, MA: Lincoln Institute of Land Policy. Posner, M. I., & Snyder, C. R. (1975). Attention and Cognitive Control. In R. L. Solso (Ed.), Information processing and cognition: The Loyola symposium (pp.55–85). Hillsdale, NJ: Lawrence Erlbaum. Proctor, J. D. (1998). The social construction of nature: Relativist accusations, pragmatist and critical realist responses. Annals of the Association of American Geographers, 88(3), 352-376. Radloff, P. (1998, February). Do we treat time and space seriously enough in teaching and learning. In Teaching and Learning in Changing Times. Proceedings of the 7th Annual Teaching Learning Forum. The University of Western Australia. Ratcliffe, E., Gatersleben, B., & Sowden, P. T. (2013). Bird sounds and their contributions to perceived attention restoration and stress recovery. Journal of Environmental Psychology, 36, 221-228. Schuyler, D. (1996-1997). Frederick Law Olmstead and the origins of Modern Campus Design. Planning for Higher Education, 25, 1-10. Snyder, T. D., & Dillow, S. A. (2011). Digest of Educational Statistics, 2010. U.S. Department of Education, National Center for Educational Statistics (NCES 2011-015). Speake, J., Edmondson, S., & Nawaz, H. (2013). Everyday encounters with nature: Students’ perceptions and use of university campus green spaces. Human Geographies--Journal of Studies & Research in Human Geography, 7(1). Strange, C. C., & Banning, J. H. (2001). Education by Design: Creating Campus Learning Environments That Work. The Jossey-Bass Higher and Adult Education Series. Jossey-Bass, Inc.: San Francisco. Taylor, A.F., Kuo, E. E., Sullivan, W.C. (2002). Views of nature and self-discipline: evidence from inner city children. Journal of Environmental Psychology, 22, 49-63. Tennessen, C.M., & Cimprich, B. (1995). Views to nature: effects on attention. Journal of Environmental Psychology, 15, 77-85. Turner, P. (1984). Campus: An American Planning Tradition. Cambridge, MA: MIT Press. Valles-Planells, M., Galinan, F., Van Eetvelde, V. (2014). A Classification of landscape services to support local landscape planning. Ecology and Society, 19(1), 44. Retrieved online http://ecologyandsociety.org/vol19/iss1/art44/ Way, T., Matthews, C., Rottle, N, and Toland, T. R. (2012). Greening the American campus: Lessons from Campus Projects. Planning for Higher Education. 40 (2): 25-47. Wentworth, D. K., & Middleton, J. H. (2014). Technology use and academic performance. Computers & Education, 78, 306-311.

      I believe that Kathleen G Scholl and Gowri Betrabet Gulwadi are credible sources on this topic. Their writing in, "Recognizing Campus Landscapes as Learning Spaces" was published in an academic journal, giving us reason to believe it is credible. Also taking a look at their references, it is clear that they did an extensive amount of research to write a relatively short article. The references they cited all seem to be academic and credible as well. A quick google search of their names turns up more to support their credibility. Kathleen G Scholl is a professor of leisure, youth, and human services at the University of Northern Iowa. Scholl also has a Ph.D and is a Certified Therapeutic Recreation Specialist. More information about her can be found in the following link: https://coe.uni.edu/departments/school-health-physical-education-leisure-services/faculty-staff/kathleen-g-scholl Gowri Betrabet Gulwadi is a professor of interior design at the University of Northern Iowa. She also has a Ph.D and has many publications listed under her name. More information about her can be found in the following link: https://csbs.uni.edu/sahs/interior-design/faculty-directory/gowri-betrabet-gulwadi Based on the amount of research proven to have been done along with the topic of the article falling into Scholl and Gulwadi's areas of expertise, I have concluded that they are credible sources to get this information from.

    1. A Summary of Housing and Wealth Inequality: Racial-Ethnic Differences in Home Equity in the United States By: B. Stebbins

      Home equity is the largest component of wealth for most households. Therefore, persons who “have previously owned a house are able to use the money earned from its sale to invest in and increase the equity of subsequent housing” (Krivo, Kaufman). However, minorities who already face substantial obstacles in buying homes because of residential segregation and other forms of discrimination in housing and mortgage markets are less capable of accumulating equity to bankroll previous purchases into the next one.

      For example, minorities face discrimination from brokers, racial-ethnic steering, redlining, and other forms of mortgage-lending discrimination. This in turn limits access to communities with greater status and amenities, such as good quality schools, parks, and shopping which have important ramifications for long-term health and well-being. Since social and historical contexts disadvantage minorities prior to their entrance into the housing market, the inequalities reproduced as a result of their active participation in the housing market only compound existing disparities further in their accumulation of housing wealth.

      The microeconomic factors identified above were found to be central determinants of the acquisition and value of housing. The impact being that the social, locational, and financial characteristics of mortgage and housing markets systematically disadvantage minorities in comparison to whites. The social and historical contexts of racial and ethnic groups also strongly influence their ability to obtain more financially and socially advantageous housing. Minority groups were found to be dealt with less favorably throughout each stage of the housing process in comparison to whites, which reduces their overall accumulation of wealth and makes it more difficult to purchase homes, obtain favorable mortgage terms, and break into areas with high home values and levels of appreciation.

      Additionally, it was noted that minority groups are more susceptible to FHA, VA, or FMHA loans which have low down payments but high interest rates contributing to their slower accumulation of equity. While low down payments are beneficial and encourage minorities to enter the market, these loans put minority households at risk as they may not be able to afford the house payments over the long run. Lastly, Krivo and Kaufman noted that it is important to recognize that historical and contemporary processes of discrimination in schools, labor markets, and other social institutions help explain the socioeconomic differences among groups and the reproduction of intergenerational inequality.

      Citation: Krivo, L., & Kaufman, R. (2004). Housing and Wealth Inequality: Racial-Ethnic Differences in Home Equity in the United States. Demography, 41(3), 585-605. Retrieved from http://www.jstor.org/stable/1515194

    1. It u evident th8lt mmtructiD1 or ~nn~ Byron11 :nmmdve of mlebd~ or ~ of creatiDI die "aurhendc0 Bymn apart fmm die cclebri11y, from die multitude of muroes ava .. le,, including die poet's 'd '1-L _a:_ ·•· '---both IL! __ ,.,U• ti' • owa wns1 er.111ua: c:norts to Dllml!pUllilu:: __ 1m r ..... tc or uteury •mage sod his priviue or pmorud identity, u well a dKl imende-4 or umntrend~ ed mmvendom .~ by radlm. pubUahm, CDCUU>ri, biopaphen. sod othm, ~a eomplex sod dmintln1 ~wk, aubhe eone dudei his essay with a Clll for "all mother major biography ••• written hy someone ... caring of the words roo Ile11 than rivaed by the ~ife. some--om alble to forge lab between dKlm u vital! u their realio/ meritl .. (15). Sudl a biopap!iy would not mie B,mn's ~n a a eelebri~ for he diarly \WI OM, but would pm k m the proper mnfat reJMive ID lhe mmt important huU of our in~ m him: die worb themsehe&

      The author is saying that no matter how someone views Bryon he is seen as a celebrity. A key term here is celebrity. The paragraph quotes Clubbe and mentions Bryon's works.

    2. hiit idea-of a diltance ~the edehrky as public fipte imd the peaoa wilbin the eelebdcy oarmhe--i1, iodscL the bull for llhnmt ~ eelebricy ' .. ,.ft\ WliL~ ,_ I! B-• l . •..L L!-ommuve ...

      Whether Byron's true personality was that of the one he personified in his poetry, it was difficult to be himself and not take the role of his characters in public.

  19. Jan 2017
    1. e.g., Darnell, 2015 Darnell, B. (2015). The value of Iowa school district demographic data in explaining school district ITBS/ITED 3rd and 11th grade language arts and mathematics scores. Seton Hall University Dissertations and Theses (ETDs). Paper 2075.; Maylone, 2002 Maylone, N. (2002). The relationship of socioeconomic factors and district scores on the Michigan educational assessment program tests: An analysis. Unpublished, Eastern Michigan University, Ypsilanti, Michigan.; Sackey, 2014 Sackey, A. N. L. (2014). The influence of community demographics on student achievement on the Connecticut mastery test in mathematics and English language arts in grade 3 through 8. Seton Hall University Dissertations and Theses (ETDs). Paper 2010.; Tienken, 2016 Tienken, C. H. (2016). Standardized test results can be predicted, so stop using them to drive education policymaking. In C. Tienken & C. Mullen (Eds.), Education policy perils: Tackling the tough issues (pp. 157–185). Philadelphia, PA: Taylor Francis Routledge.).

      There's a problem here: All these links point back to this paper!

    1. the percentage of students in a school or district who will score proficient or above on state standardized tests in language arts and mathematics at the district level can be predicted, with a good deal of accuracy, by using only community- and family-level demographic variables found in U.S. census data (e.g., Darnell, 2015 Darnell, B. (2015). The value of Iowa school district demographic data in explaining school district ITBS/ITED 3rd and 11th grade language arts and mathematics scores. Seton Hall University Dissertations and Theses (ETDs). Paper 2075. ; Maylone, 2002 Maylone, N. (2002). The relationship of socioeconomic factors and district scores on the Michigan educational assessment program tests: An analysis. Unpublished, Eastern Michigan University, Ypsilanti, Michigan. ; Sackey, 2014 Sackey, A. N. L. (2014). The influence of community demographics on student achievement on the Connecticut mastery test in mathematics and English language arts in grade 3 through 8. Seton Hall University Dissertations and Theses (ETDs). Paper 2010. ; Tienken, 2016 Tienken, C. H. (2016). Standardized test results can be predicted, so stop using them to drive education policymaking. In C. Tienken & C. Mullen (Eds.), Education policy perils: Tackling the tough issues (pp. 157–185). Philadelphia, PA: Taylor Francis Routledge. ).
  20. Dec 2016
    1. (a) that every point R on l has its image R' on m and (b) that every pointS' on m has its preimage Son l.

      I would love to see a drawing where these things are preserved instead of just assuming or stating that it is true.

  21. Nov 2016
    1. We must check two things: (a) that every point R on l has its image R' on m and (b) that every pointS' on m has its preimage Son l.

      How are we supposed to check these facts? It appears that the author simply rushes to the end rather than take the time to show us how to check each of these to help clarify the proof.

    1. Effective D e scrip tive A - and B -L e v e l H e ad in gs

      This section is made up of an incredibly important realization about headers. There is a way for descriptive headers (A and B level headers) to exist without being exhaustively long or too general. With a proper summarizing header, you're allowing your audience to digest your information completely by telling them what the message is. This helps readers focus on your message and its relationship to the topic, rather than deciphering text walls for meaning.

    2. C H A R T S A N D G R A P H S■ R e p re se n t d a ta vlsu a lya S h o w tr e n d s and relatio n sh ip s a m o n g variables■ D m * a tte n tio n to tlx* m o s t Im p o r­ta n t c o n clu sio n s t o b e draw n from nn analysis o f d a ta■ C o lle c t d a ta th ro u g h orig in a l re- s e a rc h o r n t Hera r e p o sito rie s e U se a sp re a d sh e e t p ro g ra m to c re ­a te c h a rts and g rap h

      Because visual content serves different functions, their utilization depends on the rhetorical situation. For example, in a peer-reviewed journal article for the Harvard Law Review, the primary visual aid that could be used, but still deemed appropriate for the content would be charts and graphs. In terms of design and layout, a peer reviewed article should also include a minimalist design that adheres to APA format, in order to ensure that design elements do not take away from the content and that the article itself follows the status quo of journal article format.

    1. H. Tang, C. Hammack, S. C. Ogden, Z. Wen, X. Qian, Y. Li, B. Yao, J. Shin, F. Zhang, E. M. Lee, K. M. Christian, R. A. Didier, P. Jin, H. Song, G. L. Ming, Zika virus infects human cortical neural progenitors and attenuates their growth. Cell Stem Cell 18, 1–4 (2016).

      Tang’s article highlights the impact of ZIKV infection on both cell death and dysregulation of the cell cycle.

    2. G. Calvet, R. S. Aguiar, A. S. Melo, S. A. Sampaio, I. de Filippis, A. Fabri, E. S. Araujo, P. C. de Sequeira, M. C. de Mendonça, L. de Oliveira, D. A. Tschoeke, C. G. Schrago, F. L. Thompson, P. Brasil, F. B. Dos Santos, R. M. Nogueira, A. Tanuri, A. M. de Filippis, Detection and sequencing of Zika virus from amniotic fluid of fetuses with microcephaly in Brazil: A case study. Lancet Infect. Dis. (2016).

      In this article, the authors were able to detect the Brazilian Zika virus in amniotic fluid and compare its genome to other Zika strains and flaviviruses. In doing so, they hoped to find out if there had been recombination events between them.

      The authors collected amniotic fluid samples from women whose fetuses were diagnosed with microcephaly, extracted DNA purified virus particles, and analyzed the samples with qRT-PCR.

      They found that the different viruses share 97–100% of their genomes and that there had been no recombination events.

    1. Jay, K. L., & Jay, T. B. (2015). Taboo word fluency and knowledge of slurs and general pejoratives: deconstructing the poverty-of-vocabulary myth. Language Sciences, 52251-259. doi:10.1016/j.langsci.2014.12.003

      https://mcla.edu/Assets/MCLA-Files/Academics/Undergraduate/Psychology/fluency%202015.pdf

      This study completed by K. L. Jay and T. B. Jay discusses the use of taboo language as it related to the myth that foul language is typically used by those people who have a small vocabulary, lower level of comprehension, and lower IQ. The idea behind the three studies shown in this paper was to measure the use of taboo word fluency and then to relate that measurement to traditional fluency as typically measured by the Controlled Oral Word Association Test (COWAT).

      “The study revealed that people who could name the most swear words in one minute tend to have a greater overall vocabulary.”

      The time frame used for the three language studies differed for test one compared to test two and three. In test one, participants were given one minute to come up with as many swear words as they could; in this study the participants also verbally indicated their words into a microphone and they were recorded. In tests two and three the participants wrote the taboo words as a list as there was some indicators that some participants from study one may have been reluctant to use taboo words out loud in the laboratory.

      The study did find that verbal fluency and taboo word usage are positively correlated with “other measures of verbal fluency.” So in other words, knowing a large amount of taboo words and being able to use them properly is an indicator that you have a healthy vocabulary.

      “In the end, the participants of the study were able to come up with 533 different taboo words.”

      Ultimately there were three separate correlational studies completed that were all assessed prior to coming up with the end result. Study one participants came up with a total of 400 taboo words, study two came up with the indicated 533 taboo words, and study three came up with 1,396 different taboo words.

      “Curse word fluency was found to be connected to traits of neuroticism and openness.”

      Connected is one way to put this. The study shows that use of taboo words is negatively correlated with agreeableness and conscientiousness while being positively correlated to neuroticism and openness.

      “The study also showed no major difference in results between men and women”

      This is accurate. The study or group of studies were able to state that men and women showed similar lexical access or access to a large number of words, when assessed for the use of taboo words.

      “So congratulations, you're a f***ing genius!”

      No actual IQ testing was completed during this study; however they did use the following line at the beginning of the paper when discussing beliefs about word fluency: “Verbal fluency is the hallmark of intellectual acumen; the more words one knows and uses, the greater ones verbal prowess or intelligence.” This could suggest that those who have a larger vocabulary also have a larger overall IQ; however, I believe the distinction for this testing is verbal intelligence, which the study found to be accurate.

    1. How different we,.., rhtse ennyways from rho..<e 112 d• l'1nfnnal11 cht qu1oi pn-cann of Hell• For h= 11 JS ,.,th JuDg one enters; s'mtn. e U &i~ pn-lomenti feroci. down lhert:.IIIS Wllh $2\age lamenraUOI\S.. Cu monto\om super It tcagltoo sann. liS :-;ow we ucendtd b} the socttd <tairs,

      Here, the text contrasts the entries of Inferno to those of Purgatorio. The tone of the choice of words in these lines is that of relieve and happiness at having left behind such horror and suffering. By saying that "hermit is with song one enters," is huge because the joy of the music and singing is what differentiates Inferno and Purgatorio from the beginning because instead of hearing lamentations and painful cries, Dante hears soothing and sweet music. It is as if he is been welcomed with high honors and all. This is why Dante's journey through Purgatorio is easier than Hell.

    1. B. A. Jacob, L. Lefgren, J. Public Econ. 95, 1168–1177 (2011).

      The authors of this paper evaluated the impact of NIH grants on publications. They concluded that researchers who did not get an NIH grant but simultaneously applied for others grants saw one more publication (+7%).

  22. Oct 2016
    1. metavariables

      In logic, a metavariable (also metalinguistic variable or syntactical variable) is a symbol or symbol string which belongs to a metalanguage and stands for elements of some object language. For instance, in the sentence Let A and B be two sentences of a language ℒ

    1. Until the remainder of the was a owed to remam th l h pay a rent to be detem1ined b h ere, at ough she must . . Y t e agents for fc rfc · d Justice had assured Francis H k' .. o e1te est,1tes

      I found this particularly intriguing, because I wonder if it was the rebels idea for Elizabeth to pay rent or if she implanted or suggested the idea herself and proposed it as a win win situation. From what I have read so far Elizabeth isn't only smart but also well informed. I also found the concept of paying rent interesting, because I don't believe that she (or women) worked so where would she get the money to pay rent? Since she was paying rent on a house that now belonged to the rebel army I was surprised to find that she didn't Quarter as many soldiers as the other women we have read had.

    2. se to or~ • b . . t d and left without major de-h·1 d l h . w·1s to e ev.1cu.1 e . . from them: P i a e P ia ' h C s refitised to discuss the s1tua-.. h . 1

      This kind reminds me of more modern day "treaties" that never turn out to work the way it was expected. When America left Iraq we left the country falling apart.

    1. There will be no end to this catalogue. The ogres are eve where. Number thirteen: A l i b h ai M. M o o s a j ee of Mombasa

      The assumption that i am making through this statement is that Alibhai is an ogre himself. Which would make sense considering he'd like to know so much about the ogre's, and he also explains how he has a hunchback which is similar to the ogre Rakakabe.

  23. Sep 2016
    1. L. Alibardi, Adaptation to the land: The skin of reptiles in comparison to that of amphibians and endotherm amniotes. J. Exp. Zool. B Mol. Dev. Evol. 298, 12–41 (2003).

      this review focusses on the adaptation of skin of reptiles as they evolved from water-dwelling amphibians to

    1. B u t e v e n n o n f i c t i o n a l b l o g s p r e s e n t t h e m s e l v e s a s c h a r a c t e r s .

      This is very true. Even if somebody blogs about their beliefs the readers only experience one aspect of the author. This is where interactions on the internet fall short when compared to real life interactions. You can read someones thoughts on the internet, but you can't establish an emotional connection that comes from the authors physical tendencies and expressions. You can read a bloggers beliefs and try to understand them, but its hard to grasp the context of their beliefs without physically talking to them.

    2. T h e p e r s o n a l a s p e c t o f b l o g s h a s p e r s i s t e d o v e r t h e p a s t d e c a d e , s i m u l t a -neously complemented by other interpretations: group blogs, community blogs, intranet blogs for corporate knowledge management, newspaper blogs, and so on.

      I think this statement displays the broad range of different benefits that can be seen in blogging. As the first sentence of my annotation states, over the past decade blogging has exploded and evolved into and internet empire. Blogs can be used at communal and international levels. No longer are they just used for personal intimacy, but to portray updated information in chronological order to others about pretty much any anything. The best thing about it is that its all in one place. From news, to business information, to education, all the materials you need to comprehend a site are just a view away.

    1. J. B. Silk, in The Oxford Handbook of Evolutionary Psychology, R. I. M. Dunbar, L. Barrett, Eds. (Oxford Univ. Press, Oxford, 2007), pp. 115–126.

      Chapter 10: Empathy, sympathy, and prosocial preferences in primates.

      There are several potential lines of evidence for the existence of empathy in nonhuman primates. Because of the subjectivity in interpretation of animals' intentions as well as no defined assay for empathy or sympathy, "we cannot be certain whether any given interpretation is right or wrong."

      "To transform singular observations of behavior into more robust findings we need to develop theoretically grounded hypotheses that we can subject to empirical testing."

      http://www.amazon.com/Oxford-Handbook-Evolutionary-Psychology-Handbooks/dp/0199561788

  24. eng110scsuannotations.wordpress.com eng110scsuannotations.wordpress.com
    1. A decade ago, two of the co-authors of the Flagship State study, Gregory M. Walton and Geoffrey L. Cohen, social psychologists at Stanford, began tracking the progress of black students at an elite private university. As freshmen, they had participated in a similar exercise. By the time they graduated, their grades were a third of a grade-point average point higher than their peers in the control group (the difference between B+ and A-), and they had halved the black-white achievement gap. They also reported being healthier and happier.

      does this work and has it recently been proven?

    2. A decade ago, two of the co-authors of the Flagship State study, Gregory M. Walton and Geoffrey L. Cohen, social psychologists at Stanford, began tracking the progress of black students at an elite private university. As freshmen, they had participated in a similar exercise. By the time they graduated, their grades were a third of a grade-point average point higher than their peers in the control group (the difference between B+ and A-), and they had halved the black-white achievement gap. They also reported being healthier and happier.

      hardwork is a great feeling

  25. inst-fs-iad-prod.inscloudgate.net inst-fs-iad-prod.inscloudgate.net
    1. As distinguished from problems in the natural sciences, which are definableand separable and may have solutions that are findable, the problemsof governmental planning—and especially those of social or policyplanning—are ill-defined; and they rely upon elusive political judgmentfor resolution. (Not “solution.” Social problems are never solved. At bestthey are only re-solved—over and over again) [p. 160].

      Even more complicated problems arise when they are interdisciplinary, that is, encapsulating both natural sciences and governmental planning problems. An example would be disease epidemics, such as the HIV/AIDS epidemic of the 1980s (even though HIV/AIDS continues to be an ongoing epidemic). It posed a problem to researchers in the field of natural sciences as they tried to determine what caused the disease, and it posed a problem to the general public due to social discrimination that was ongoing against homosexual men during the decade. I would classify the HIV/AIDS epidemic as a "wicked problem" because it meets at least four of the 10 characterizations of a wicked problem that were discussed in this article.

      (1) It (currently) has no stopping rule, people are on antiretroviral drugs, but they do not cure the disease, and individuals and their relationships are still being impacted by the disease

      (2) Solutions may or may not be effective; not every solution works (or is accessible) to every individual.

      (3) Uniqueness: the virus itself is unique, and its structure is part of what makes it so difficult to "fix" the disease.

      (4) Wicked problems do not have an enumerable set of potential solutions; as mentioned beforehand, not every solution is feasible to implement.

      Both cover pages create a sense of unease, which elicits an emotional response from the audience.

      Rothman, L. (2015, April 20). What Caused the Worst Oil Spill in American History. Retrieved September 06, 2016, from http://time.com/3818144/deepwater-horizon-anniversary/

      Pierce, B. (n.d.). TIME Magazine Cover: AIDS Hysteria - July 4, 1983. Retrieved September 06, 2016, from http://content.time.com/time/covers/0,16641,19830704,00.html

  26. Aug 2016
    1. Although the Atlanta, Georgia, metropolitan area is known for its car-centric, sprawling development patterns, it has a subway system: the Metropolitan Atlanta Regional Transit Authority (MARTA).

      In my experience with public transport including cities in the US such as Chicago, and cities in Europe such as London, I personally find MARTA comparably hard to use and not easily accessible. Chicago's "L" is widely used among all people across very diverse socioeconomic groups. Practically everyone in London uses the "Tube" to get from point A to point B. Atlanta's public transport is subpar at best.

  27. Jun 2016
    1. L. H. Hartwell and M. B. Kastan, Science 266, 1821 (1994); A. B. Niculescu et al., Mol. Cell. Biol. 18, 629 (1998)

      This review discusses what was known at the time about the regulation of the cell cycle and how we could potentially use this information to design new cancer drugs.

    1. B. Ajami, J. L. Bennett, C. Krieger, W. Tetzlaff, F. M. Rossi, Nat. Neurosci. 10, 1538 (2007). 

      Using parabiosis and irradiation in an experimental autoimmune encephalitis mouse model of multiple sclerosis, the authors found that peripheral monocytes infiltrate the brain and contribute to the progression of the disease but do not contribute to the pool of resident microglial cells.

  28. www.seethingbrains.com www.seethingbrains.com
    1. But Grete’s words had immediately made the mother very uneasy. She walked to the side, caught sight of the enormous brown splotch on the flowered wallpaper, and, before she became truly aware that what she was looking at was Gregor, screamed out in a high pitched raw voice

      We chose to represent Gregor’s deterioration outwardly and inwardly through our two collages.

      The first collage is a representation of his physical deterioration in his room through the the images of food and cleaning objects. The reality of him dying slowly is also mirrored by his inner turmoil as shown in the second collage. We chose to use the color pink to represent his love for his family despite their disgust towards him and the reversal of his role in the family with Grete.

      (Joy L., Alessandria G., Erisha B., Julia M., Katerina H., and Kiara C.)

  29. May 2016
  30. www.seethingbrains.com www.seethingbrains.com
    1. But Grete’s words had immediately made the mother very uneasy. She walked to the side, caught sight of the enormous brown splotch on the flowered wallpaper, and, before she became truly aware that what she was looking at was Gregor, screamed out in a high pitched raw voice

      As Gregor adapts to his metamorphosis, his climbing on the walls of his room draws the attention of his mother and sister Grete to arrange his furniture. Johnston’s interpretation of their acknowledgement of Gregor by entering the room together for the first time is significant in that it emphasizes the process of Grete’s growing influence in the family. First and foremost, while Muir describes Gregor as a ‘mass’, Johnston calls him a ‘splotch’, which effectively lowers his status and value but also denotes the insignificance shown towards him in the scene. He is equivalent to a mere speck on the wall. Johnston’s translation treats Gregor and the situation like a foreign subject that his mother and Grete are unable to empathize with or understand. The tone and mood of Johnston’s translation are more tense and filled with anticipation; it is obvious that fear and confusion are very present as the main theme of his novella. In the first line, Muir’s word choices focus on Grete’s impact on and relationship with her mother. Through Muir’s use of the word “succeeded,” it makes it seem that Grete intentionally aimed to frighten her mother. Muir’s translation makes Grete sound manipulative while Johnston’s translation does not imply a correspondence between Grete and a continuous intention to exert control. Interestingly, Johnston’s use of the word ‘raw’ to describe the mother's scream makes her sound barbaric, while Muir's use of “loud, hoarse voice’ makes her seem as if she had been straining herself through the difficult time period of Gregor’s metamorphosis. Johnston’s choice of wording might have been for the intent to highlight the paradox between Gregor’s increasing dehumanization despite his steadfast love for his family members, versus the increasing vitality of his family despite their lack of genuine love for Gregor.<br> (Julia M., Joy L., Alessandria G., Kiara C., Erisha B., Katerina H.)

    1. L. Valdevit, A. J. Jacobsen, J. R. Greer, W. B. Carter, J. Am. Ceram. Soc. 94, s15–s34 (2011).

      This article is a review of the manufacturing techniques available to produce microarchitectured materials.

      The conclusion of the review is that the technology is mature for the development, characterization, and optimal design of a novel class of multifunctional materials with the potential to achieve unprecedented combination of properties.

    1. dc.contributor.author Vrana, Andrea dc.contributor.author Hotz-Boendermaker, Sabina dc.contributor.author Stämpfli, Philipp dc.contributor.author Hänggi, Jürgen dc.contributor.author Seifritz, Erich dc.contributor.author Humphreys, B. Kim dc.contributor.author Meier, Michael L.

      Data creators/authors: The person(s) and/or organizations who generated the dataset and are responsible for its integrity.

      Note that Dryad uses the Dublin Core (dc) metadata attributes to make this page machine-parseable.

    1. S. S. Saatchi, N. L. Harris, S. Brown, M. Lefsky, E. T. Mitchard, W. Salas, B. R. Zutta, W. Buermann, S. L. Lewis, S. Hagen, S. Petrova, L. White, M. Silman, A. Morel , Benchmark map of forest carbon stocks in tropical regions across three continents. Proc. Natl. Acad. Sci. U.S.A. 108, 9899–9904 (2011). Baccini, S. J. Goetz, W. S. Walker, N. T. Laporte, M. Sun, D. Sulla-Menashe, J. Hackler, P. S. A. Beck, R. Dubayah, M. A. Friedl, S. Samanta, R. A. Houghton , Estimated carbon dioxide emissions from tropical deforestation improved by carbon-density maps. Nature Clim. Change 2, 182–185 (2012). N. L. Harris, S. Brown, S. C. Hagen, S. S. Saatchi, S. Petrova, W. Salas, M. C. Hansen, P. V. Potapov, A. Lotsch , Baseline map of carbon emissions from deforestation in tropical regions. Science 336, 1573–1576 (2012).

      In references 16–18, the authors describe baseline measurements for carbon emissions and stocks in tropical forests/regions.

      Now, what is the difference between a carbon stock and a carbon emission?

      A carbon stock is stored carbon. (Think of a tree trunk made of carbon-rich cellulose and lignin.)

      A carbon emission, however, is carbon that has been released into the atmosphere. (Now, consider a tree trunk that has been burnt to ash, thereby releasing carbon.)

    2. P. Gong, J. Wang, L. Yu, Y. Zhao, Y. Zhao, L. Liang, Z. Niu, X. Huang, H. Fu, S. Liu, C. Li, X. Li, W. Fu, C. Liu, Y. Xu, X. Wang, Q. Cheng, L. Hu, W. Yao, H. Zhang, P. Zhu, Z. Zhao, H. Zhang, Y. Zheng, L. Ji, Y. Zhang, H. Chen, A. Yan, J. Guo, L. Yu, L. Wang, X. Liu, T. Shi, M. Zhu, Y. Chen, G. Yang, P. Tang, B. Xu, C. Giri, N. Clinton, Z. Zhu, J. Chen, J. Chen , Finer resolution observation and monitoring of global land cover: First mapping results with Landsat TM and ETM+ data. Int. J. Remote Sens. 34, 2607–2654 (2013).

      In reference 36, Gong and colleagues describe the first study that uses Landsat satellite images that photograph Earth's surface at a 30 m by 30 m resolution.

      With these photos, they characterized Earth's surface into different land types (e.g., agricultural land, forests, grasslands, ice).

      They found that "forests, grasslands, and shrublands cover 28.35%, 13.37%, and 11.49% of the world, respectively. … Inland waterbodies, barren lands, and snow and ice cover 3.56%, 16.51%, and 12.81% of the world, respectively."

  31. Apr 2016
    1. Peng, C; Yao, G; Gao, B; Fan, C; Bian, C; Wang, J; Cao, Y; Wen, B; Zhu, Y; Ruan, Z; Zhao, X; You, X; Bai, J; Li, J; Lin, Z; Zou, S; Zhang, X; Qiu, Y; Chen, J; Coon, S, L; Yang, J; Chen, J; Shi, Q (2016): Supporting material for "High throughput identification of novel conotoxins from the Chinese tubular cone snail (Conus betulinus) by multi-transcriptome sequencing". GigaScience Database. http://dx.doi.org/10.5524/100169

      interesting data for mining potential new drugs

  32. www.glottotopia.org www.glottotopia.org
    1. “It seems clearthat [...] [the] stops systematically become/became the corresponding sonorants.This is relatively clear from the inventory of reflexes [...] alone: of these, m, n,ŋ and l are sonorants. Only b and g are stops and phonetic obstruents. But al-though they are phonetic stops, they have residual voicing left over from theirsonorant phonological status. I would claim that, even synchronically, the mys-terious voiced stop codas are actually variants not of the underlying, voicelessstops but of voiced sonorants.”

      This quotation is long enough to be treated as a block quote.

  33. Mar 2016
    1. OED entry

      innovation

      (ɪnəʊˈveɪʃən)

      [ad. L. innovātiōn-em, n. of action f. innovāre to innovate: cf. F. innovation (1297 in Hatz.-Darm.).]

      1. a.1.a The action of innovating; the introduction of novelties; the alteration of what is established by the introduction of new elements or forms. †Formerly const. of (the thing altered or introduced).

         1553 Brende Q. Curtius 221 b, Perdicas, whose ambicious mynde desirous of innouation, was (he sayde) to be preuented in time.    1561 T. Norton Calvin's Inst. Table Contents, It is the duty of private men to obey, and not to make innovation of states after their own will.    1597 Hooker Eccl. Pol. v. xlii. §11 To traduce him as an authour of suspitious innouation.    1614 Selden Titles Hon. 286 Thanes remained as a distinct name of dignitie, and vanisht not at the innouation of new honors.    a 1639 Webster Appius & V. v. iii, The hydra-headed multitude That only gape for innovation.    1796 Burke Corr. (1844) III. 211 It is a revolt of innovation; and thereby, the very elements of society have been confounded and dissipated.    1824 L. Murray Eng. Gram. (ed. 5) I. 65 This spirit of innovation has extended itself to other parts of grammar, and especially to the names of the Tenses.    1874 Green Sh. Hist. vii. §1 Cranmer and his colleagues advanced yet more boldly in the career of innovation.

      †b.1.b Revolution (= L. novæ res). Obs.

         1596 Shakes. 1 Hen. IV, v. i. 78 Poore Discontents, Which gape, and rub the Elbow at the newes Of hurly burly Innouation.    1633 T. Stafford Pac. Hib. i. xx. (1821) 206 For the same reason of innovation, he besought them to send unto him fiue Lasts of powder with match and lead.

      1. a.2.a A change made in the nature or fashion of anything; something newly introduced; a novel practice, method, etc.

         1548 Act 2 & 3 Edw. VI, c. 1 To staye Innovacions or newe rites.    1641 (title) A Discovery of the notorius Proceedings of William Laud, Archbishop of Canterbury, in bringing Innovations into the Church.    1717 J. Keill Anim. Oecon. Pref. (1738) 47 This Attraction‥is no Innovation in Philosophy.    1800 Asiatic Ann. Reg., Misc. Tr. 106/1 The tribute you demand from the Hindûs‥is an innovation and an infringement of the laws of Hindustân.    a 1862 Buckle Civiliz. (1873) II. viii. 595 To them antiquity is synonymous with wisdom, and every improvement is a dangerous innovation.    1868 Freeman Norm. Conq. II. viii. 297 The sturdiest champions of Norman innovations.

      †b.2.b A political revolution; a rebellion or insurrection. (= L. novæ res.) Obs.

         1601 R. Johnson Kingd. & Commw. (1603) 227 Neither doth he willingly arme them for feare of sedition and innovations.    1726 Leoni Alberti's Archit. I. 77/2 A Province so inclined to tumults and innovations.

      3.3 spec. in Sc. Law. The alteration of an obligation; the substitution of a new obligation for the old: see quot.

         1861 W. Bell Dict. Law Scot. 450/1 Innovation, is a technical expression, signifying the exchange, with the creditor's consent, of one obligation for another; so as to make the second obligation come in the place of the first, and be the only subsisting obligation against the debtor, both the original obligants remaining the same.

      4.4 Bot. The formation of a new shoot at the apex of a stem or branch; esp. that which takes place at the apex of the thallus or leaf-bearing stem of mosses, the older parts dying off behind; also (with pl.) a new shoot thus formed.

         1835 Lindley Introd. Bot. (1848) I. 168 Shoots which have not completed their growth have received the name of innovations, a term usually confined to mosses.    1845 Florist's Jrnl. 130 The lateral ones‥terminate a two-leaved branch, or innovation, while the central peduncle springs from the apex of the older branch.    1863 Berkeley Brit. Mosses iii. 13 One mode of branching‥is known under the name of innovations.    Ibid. Gloss. 312 Innovations, accessory branches produced generally after the fruit is perfect.

      5.5 Comm. The action of introducing a new product into the market; a product newly brought on to the market.

         1939 J. A. Schumpeter Business Cycles I. iii. 84 Innovation is possible without anything we should identify as invention, and invention does not necessarily induce innovation.    1958 J. Jewkes et al. Sources Invention ix. 249 It seems impossible to establish scientifically any final conclusion concerning the relation between monopoly and innovation.    1962 E. M. Rogers Diffusion of Innovations v. 124 It matters little whether or not an innovation has a great degree of advantage over the idea it is replacing. What does matter is whether the individual perceives the relative advantage of the innovation.    1967 J. A. Allen Sci. Innovation & Industr. Prosperity ii. 8 Innovation is the bringing of an invention into widespread, practical use.‥ Invention may thus be construed as the first stage of the much more extensive and complex total process of innovation.

      6.6 innovation trunk, a kind of wardrobe trunk.

         1912 Bag, Portmanteau & Umbrella Trader 20 Nov. 18/1 The Innovation Trunk Company‥makes a striking show of wardrobe trunks. They also specialise in the refitting of ordinary wardrobes according to their principle.    1913 A. Bennett Regent iii. 83 Many parcels and boxes, comprising diverse items in the equipment of a man-about-town, such as tie-clips and Innovation trunks.    1915 E. Phillpotts Angel in House i. 17 Robert and Manservant enter through the main entrance carrying Innovation trunk.

      Hence innoˈvational a., of, pertaining to, or characterized by innovation; also in Comm.; innoˈvationist, one who favours innovations.

         1800 W. Taylor in Monthly Mag. VIII. 684 Writers, who bring against certain philosophic innovationists a clamorous charge of Vandalism.    1817 Bentham Plan Parl. Reform Introd. 194 A proposition so daring, so innovational.    1873 R. Black tr. Guizot's France II. xxv. 492 His kingly despotism was new, and, one might almost say, innovational.    1959 J. P. Lewis Business Conditions Analysis v. xxiv. 534 The insights of economics do not illuminate the process of innovation very much.‥ On the optimistic side of the innovational outlook, it can be argued, [etc.].    1960 L. S. Silk Research Revolution iii. 50 In the past, the United States has had three great innovational pushes.

  34. willrichardson.com willrichardson.com
    1. “innovation”

      OED entry innovation

      (ɪnəʊˈveɪʃən)

      [ad. L. innovātiōn-em, n. of action f. innovāre to innovate: cf. F. innovation (1297 in Hatz.-Darm.).]

      1. a.1.a The action of innovating; the introduction of novelties; the alteration of what is established by the introduction of new elements or forms. †Formerly const. of (the thing altered or introduced).

         1553 Brende Q. Curtius 221 b, Perdicas, whose ambicious mynde desirous of innouation, was (he sayde) to be preuented in time.    1561 T. Norton Calvin's Inst. Table Contents, It is the duty of private men to obey, and not to make innovation of states after their own will.    1597 Hooker Eccl. Pol. v. xlii. §11 To traduce him as an authour of suspitious innouation.    1614 Selden Titles Hon. 286 Thanes remained as a distinct name of dignitie, and vanisht not at the innouation of new honors.    a 1639 Webster Appius & V. v. iii, The hydra-headed multitude That only gape for innovation.    1796 Burke Corr. (1844) III. 211 It is a revolt of innovation; and thereby, the very elements of society have been confounded and dissipated.    1824 L. Murray Eng. Gram. (ed. 5) I. 65 This spirit of innovation has extended itself to other parts of grammar, and especially to the names of the Tenses.    1874 Green Sh. Hist. vii. §1 Cranmer and his colleagues advanced yet more boldly in the career of innovation.

      †b.1.b Revolution (= L. novæ res). Obs.

         1596 Shakes. 1 Hen. IV, v. i. 78 Poore Discontents, Which gape, and rub the Elbow at the newes Of hurly burly Innouation.    1633 T. Stafford Pac. Hib. i. xx. (1821) 206 For the same reason of innovation, he besought them to send unto him fiue Lasts of powder with match and lead.

      1. a.2.a A change made in the nature or fashion of anything; something newly introduced; a novel practice, method, etc.

         1548 Act 2 & 3 Edw. VI, c. 1 To staye Innovacions or newe rites.    1641 (title) A Discovery of the notorius Proceedings of William Laud, Archbishop of Canterbury, in bringing Innovations into the Church.    1717 J. Keill Anim. Oecon. Pref. (1738) 47 This Attraction‥is no Innovation in Philosophy.    1800 Asiatic Ann. Reg., Misc. Tr. 106/1 The tribute you demand from the Hindûs‥is an innovation and an infringement of the laws of Hindustân.    a 1862 Buckle Civiliz. (1873) II. viii. 595 To them antiquity is synonymous with wisdom, and every improvement is a dangerous innovation.    1868 Freeman Norm. Conq. II. viii. 297 The sturdiest champions of Norman innovations.

      †b.2.b A political revolution; a rebellion or insurrection. (= L. novæ res.) Obs.

         1601 R. Johnson Kingd. & Commw. (1603) 227 Neither doth he willingly arme them for feare of sedition and innovations.    1726 Leoni Alberti's Archit. I. 77/2 A Province so inclined to tumults and innovations.

      3.3 spec. in Sc. Law. The alteration of an obligation; the substitution of a new obligation for the old: see quot.

         1861 W. Bell Dict. Law Scot. 450/1 Innovation, is a technical expression, signifying the exchange, with the creditor's consent, of one obligation for another; so as to make the second obligation come in the place of the first, and be the only subsisting obligation against the debtor, both the original obligants remaining the same.

      4.4 Bot. The formation of a new shoot at the apex of a stem or branch; esp. that which takes place at the apex of the thallus or leaf-bearing stem of mosses, the older parts dying off behind; also (with pl.) a new shoot thus formed.

         1835 Lindley Introd. Bot. (1848) I. 168 Shoots which have not completed their growth have received the name of innovations, a term usually confined to mosses.    1845 Florist's Jrnl. 130 The lateral ones‥terminate a two-leaved branch, or innovation, while the central peduncle springs from the apex of the older branch.    1863 Berkeley Brit. Mosses iii. 13 One mode of branching‥is known under the name of innovations.    Ibid. Gloss. 312 Innovations, accessory branches produced generally after the fruit is perfect.

      5.5 Comm. The action of introducing a new product into the market; a product newly brought on to the market.

         1939 J. A. Schumpeter Business Cycles I. iii. 84 Innovation is possible without anything we should identify as invention, and invention does not necessarily induce innovation.    1958 J. Jewkes et al. Sources Invention ix. 249 It seems impossible to establish scientifically any final conclusion concerning the relation between monopoly and innovation.    1962 E. M. Rogers Diffusion of Innovations v. 124 It matters little whether or not an innovation has a great degree of advantage over the idea it is replacing. What does matter is whether the individual perceives the relative advantage of the innovation.    1967 J. A. Allen Sci. Innovation & Industr. Prosperity ii. 8 Innovation is the bringing of an invention into widespread, practical use.‥ Invention may thus be construed as the first stage of the much more extensive and complex total process of innovation.

      6.6 innovation trunk, a kind of wardrobe trunk.

         1912 Bag, Portmanteau & Umbrella Trader 20 Nov. 18/1 The Innovation Trunk Company‥makes a striking show of wardrobe trunks. They also specialise in the refitting of ordinary wardrobes according to their principle.    1913 A. Bennett Regent iii. 83 Many parcels and boxes, comprising diverse items in the equipment of a man-about-town, such as tie-clips and Innovation trunks.    1915 E. Phillpotts Angel in House i. 17 Robert and Manservant enter through the main entrance carrying Innovation trunk.

      Hence innoˈvational a., of, pertaining to, or characterized by innovation; also in Comm.; innoˈvationist, one who favours innovations.

         1800 W. Taylor in Monthly Mag. VIII. 684 Writers, who bring against certain philosophic innovationists a clamorous charge of Vandalism.    1817 Bentham Plan Parl. Reform Introd. 194 A proposition so daring, so innovational.    1873 R. Black tr. Guizot's France II. xxv. 492 His kingly despotism was new, and, one might almost say, innovational.    1959 J. P. Lewis Business Conditions Analysis v. xxiv. 534 The insights of economics do not illuminate the process of innovation very much.‥ On the optimistic side of the innovational outlook, it can be argued, [etc.].    1960 L. S. Silk Research Revolution iii. 50 In the past, the United States has had three great innovational pushes.

    1. Nesmie sa uzatvárať zmluva na diaľku,15a) ktorej predmetom je nákup a predaj zbranekategórie A, kategórie B, kategórie C alebo streliva do týchto zbraní, expanznej zbrane, zbrane,ktorá bola znehodnotená zo zbrane kategórie A, kategórie B a kategórie C a zbrane kategórie Duvedenej v§ 7 ods. 1 písm. l), ak v odseku 2 nie je ustanovené inak

      Nesmie sa uzatvárať zmluva na diaľku,15a) ktorej predmetom je nákup a predaj zbranekategórie A, kategórie B, kategórie C alebo streliva do týchto zbraní, expanznej zbrane, zbrane,ktorá bola znehodnotená zo zbrane kategórie A, kategórie B a kategórie C a zbrane kategórie Duvedenej v§ 7 ods. 1 písm. l), ak v odseku 2 nie je ustanovené inak

    2. Nesmie sa uzatvárať zmluva na diaľku,15a) ktorej predmetom je nákup a predaj zbranekategórie A, kategórie B, kategórie C alebo streliva do týchto zbraní, expanznej zbrane, zbrane,ktorá bola znehodnotená zo zbrane kategórie A, kategórie B a kategórie C a zbrane kategórie Duvedenej v§ 7 ods. 1 písm. l), ak v odseku 2 nie je ustanovené inak

      May not be concluded distance contract, relating to the purchase and sale of Category A, Category B, Category C or munition for these weapons, the expansion weapons, weapons that has been degraded from Category A, Category B and Category C and D categories of weapons listed in § 7. 1 point. l), if there is not provided otherwise in paragraph 2.

    1. #61. Sports Drinks Work (and You Don't Even Need to Drink Them) There were two other articles that backed up their claim and it has to do with how our brain receptors react to the sugary taste when it hits our tongue and our brain thinks that we have consumed the product (Carter, Jeukendrup & Jones, 2004). This post clearly follows inline with the below researched articles. They have a great article linked in their description of how and why it works and these two back up what they have to say.

      Carter, J. M., Jeukendrup, A. E., & Jones, D. A. (2004). The effect of carbohydrate mouth rinse on 1-h cycle time trial performance. Medicine and Science in Sports and Exercise, 36, 2107-2111.

      Cycling performance of mouth rinse only using water and CHO

      Burke, L. M., Wood, C., Pyne, D. B., Telford, R. D., & Saunders, P. U. (2005). Effect of carbohydrate intake on half-marathon performance of well-trained runners. International journal of sport nutrition and exercise metabolism, 15(6), 573.

      Controlled study of half-marathon runners using water, a flavored placebo and commercial gel

  35. Feb 2016
    1. The filmsWa l t z w i t h B a s h i r,Wa s t e d,BeaufortandLebanon7are less concerned with thehistory of the First Lebanon War, and more with the private and subjective experiences andmemories of the soldiers who fought in it.

      That is why people who don't have background knowledge can also feel sympathy when watching the movie.

    1. To test whether this environment may inhibit our lysins, we tested the efficacy of the lysin λSa2 and LysA to reduce viable L. fermentum (BR0315-1) and L. reuteri (B-14171) in mock fermentations of corn fiber hydrolysates.

      This also has to do with testing the activity levels of the enzymes in the context of fermentation.

    1. F877

      Rhyme scheme is as follows:

      Stanza 1 = A B C B

      Stanza 2 = D E F E

      Stanza 3 = G H I H/

      Stanza 4 = J K L K/

      The first two stanzas flow together rhythmically quite easily while the second two feature more slant rhyme; it's like the introduction of the "Horror" and "fear" in stanzas three and four literally shook the writer.

  36. Dec 2015
    1. He was about 5ix feet in height, of a tawny complexion, and haJ no other clothing than a piece of wookn cloth wrapped round his body, and which exrended from below his bt·east to his knees : his hair was stout <v.~d bushy, and stuck up in every direction like brus· tles upon the b?.ck of a hog; his eyes were smal! but were 1ed and fiery, reaembling those of a 5er-pent when in·itated ; and to add to his horrid ap· pearance, his beard (which was of a jet black and cutly) was of more than a foot in length !--such I a1sure the reader is a true description of the mon-ster, in human swape, by whom l was doomed to be held in servitude,

      Bradley's first descirption of her "master" as a monster

  37. Nov 2015
    1. M. A. Wilson, B. L. McNaughton , Reactivation of hippocampal ensemble memories during sleep. Science 265, 676–679 (1994).

      In this a seminal study in the area of sleep and memory. Rats have brain cells called 'place cells' that activate when they are in specific locations in their environment. In a series of experiments these researchers demonstrated that place cells that fired in a specific order as the Rat moved around its environment activated in the same order during sleep.

      This was the first evidence that memories may be replayed during sleep after learning.

    2. A. Nosek, F. L. Smyth, N. Sriram, N. M. Lindner, T. Devos, A. Ayala, Y. Bar-Anan, R. Bergh, H. Cai, K. Gonsalkorale, S. Kesebir, N. Maliszewski, F. Neto, E. Olli, J. Park, K. Schnabel, K. Shiomura, B. T. Tulbure, R. W. Wiers, M. Somogyi, N. Akrami, B. Ekehammar, M. Vianello, M. R. Banaji, A. G. Greenwald , National differences in gender-science stereotypes predict national sex differences in science and math achievement. Proc. Natl. Acad. Sci. U.S.A. 106, 10593–10597 (2009).

      In this study more than 500,000 participants completed the gender and academics Implicit Association Test (a test that measures your unconscious associations between different genders (males and females) and different academic areas (liberal arts and sciences).

      The researchers found that countries where participants had higher

      Nations with higher implicit bias scores (associating males with science and females with liberal arts) had larger differences between males' scores and females' scores on an international standardized 8th grade science test.

  38. Oct 2015
    1. Interestingly, the modulation of microbiota has been suggested as preventative against the common cold and influenza-like symptoms in children.98 In a double-blind, placebo-controlled study, 326 children aged between 3years and 5years were randomly assigned to receive Lactobacillus acidophilus (n=110), L. acidophilus and B. animalis lactis Bi-07 (n=112), or a placebo (n=104), treated twice daily for 6 months. At the end of the study, it was found that relative to the placebo group, those who received single and combi-nation probiotics reduced their incidences and duration of fever, coughing, and rhinorrhea significantly.

      This can be valuable with over-the-counter products; though, the DIETARY ACT OF 1994 can be dangerous here. Good thing ConsumerLab.com tries to keep on eye on such things.

    1. §314.53   Submission of patent information.

      The following must be disclosed when submitting patent information.

      A) New Drug application number B) Name of new drug application sponsor C) Trade name (or proposed trade name) of new drug D) Active ingredient(s) of new drug E) Strength(s) of new drug F) Dosage form of new drug G) United States patent number, issue date, and expiration date of patent submitted H) The patent owner's name, full address, phone number and, if available, fax number and e-mail address I) The name, full address, phone number and, if available, fax number and e-mail address of an agent or representative who resides or maintains a place of business within the United States authorized to receive notice of patent certification under sections 505(b)(3) and 505(j)(2)(B) of the act and §§314.52 and 314.95V J) Information on whether the patent has been submitted previously for the new drug application K) Information on whether the expiration date is a new expiration date if the patent had been submitted previously for listing L) Information on whether the patent is a product-by-process patent in which the product claimed is novel M) Information on the drug substance (active ingredient) patent N) Information on the drug product (composition/formulation) patent O) Information on each method-of-use patent P) Whether there are no relevant patents that claim the drug substance (active ingredient), drug product (formulation or composition) or method(s) of use, for which the applicant is seeking approval and with respect to which a claim of patent infringement could reasonably be asserted if a person not licensed by the owner of the patent engaged in the manufacture, use, or sale of the drug product Q) Signed verification R) Information on whether the applicant, patent owner or attorney, agent, representative or other authorized official signed the form; the name of the person; and the full address, phone number and, if available, the fax number and e-mail address

      CTD is related to 314.53 as CTD is the format the NDA application should be submitted and this particular section is information that is included in the NDA application.

      Source:

      https://via.hypothes.is/https://via.hypothes.is/http://www.ecfr.gov/cgi-bin/text-idx?SID=7f94804791c87afdb06ef4e078b3199c&mc=true&node=pt21.5.314&rgn=div5#se21.5.314153

    2. (A) New drug application number;

      The following items must be disclosed when submitting patent information: A. New Drug Application (NDA) number B. Name of new drug application sponsor C. Trade name (or planned name) D. Active ingredient(s) E. Strength(s) of new drug F. Dosage form G. US patent number, issue date, and expiration date of patent submitted H. Patent owner's name, address, phone number and if available fax number and email address I. Agent of Representative in the US's name, address, phone number and if available fax number and email address J. If the patent has been submitted before K. If the expiration date is new or from a previous patent L. Information on whether the product is novel M. Information on drug substance N. Information on drug product O. Information on method of use P. Confirmation there are no relevant patents that claim the drug substance, drug product, or methods of use, for which the applicant is seeking approval with respect to which a claim of patent infringement could be asserted Q. Signed verification R. Information on who signed the form their name, address, phone number, and if available fax number and email address.

      The CTD is the format in which NDAs should be completed. According to the CTD information from 314. 53 regarding patent information and certification is included in Module 1 of the NDA.

  39. Sep 2015
    1. 11/10/20~4 ' . ~·· vi Editor Commands· A w w b" B e E H M L move tursor to the first column on the current line move cursor to first nonblank column on the current line move to the beginning of the next word or punctuation mark move past the next space move to the beginning of the previous word or punctuation mark move to the beginning of the previous word, ignores punctuation end of ne

      This is my latest annotation

    1. Article: Opening Pandora’s Box: How Does Defendant Race Influence Plea Bargaining? by Besiki Luka Kutateladze, Nancy R. Andiloro & Brian D. Johnson

      "Opening Pandora’s Box: How Does Defendant Race Influence Plea Bargaining?" Is an article that was published in Justice Quarterly in May 2015, which examines a possible cause of minority overrepresentation in prisons. Specifically, how the discretionary nature of plea bargains leads to mass incarceration of minority populations- particularly African Americans. The authors go on to define plea bargaining as a defendant agreeing to plea guilty for the benefit of the prosecutor in return for a lesser sentence (Kutateladze, Andiloro & Johnson, 2014). The article goes on to mention a few troubling facts about plea bargaining that are not commonly known. For example, plea bargaining is not legally binding. According to the authors, this can lead to a degree of inconsistency and bias in sentencing on the part of the prosecutor because they are only expected to follow a set of loosely defined guidelines when proposing a plea bargain. The individual bias of the prosecutor is able to play a significant role in determining the sentence for each defendant because there is no streamlined standard for every crime when it comes to discretionary sentencing.

      Implicit Bias is also an important element in plea bargaining, because it is the main factor in discretion of the prosecutor or court official making sentencing decisions. As Banaji and Greenwald (2013) put it, “Implicit bias involves cognitive decision-making processes in which ascriptive offender characteristics affect court actor judgments, often in automatic and unintentional ways “ (Kutateladze, Andiloro & Johnson, 2014). It is natural for all people to have certain biases due to societal cues and subtle messages intended to make people think certain ways. Everyone has bias whether or not they want to admit it. The point of the authors here is exactly that: prosecutors are just as susceptible to these biases as anyone else. That is why plea bargaining and other determinate sentencing methods should not be based on the discretion of court officials.

      Even more troubling are caseloads of prosecutors and public defenders. With ever-increasing arrests and criminal caseloads, prosecutors are less likely to be adequately thorough in determining sentences for those they are prosecuting. As stated by the authors, “Given their often heavy caseloads, court actors may rely on mental shortcuts, or schemas… Such schemas often involve defendant traits, such as race and ethnicity, which subsequently shape future interactions and decision-making outcomes” (Kutateladze, Andiloro & Johnson, 2014). Because the primary purpose of plea bargaining is expediency, it is likely that there will be shortcomings on the part of the prosecutors. This however, entirely negates the purpose of the trial in the criminal process. In fact, defendants are now essentially afraid of trials because they feel they will get an unfair or harsher sentence.

      The data from this research was gathered through working closely with the New York County District Attorney’s Office to collect and analyze date in the prosecution of drug cases (Kutateladze, Andiloro & Johnson, 2014). The research findings were that minority offenders who were being charged with drug offenses- many for marijuana- received harsher sentences than their white counterparts. It is also important to note that three quarters of prosecutors studied were white. Furthermore, “the odds of custodial pleas increased slightly when prosecutors had heavier caseloads… In addition, defendants living in poorer areas were significantly more likely to receive custodial sentence offers” (Kutateladze, Andiloro & Johnson, 2014). The idea of assembly-line justice has made it difficult to grant fair and stream-lined sentences to defendants- particularly minority defendants. They are receiving more custodial sentence offers and are entering prison at higher rates than white defendants for similar crimes.

      Kutateladze, B. L., Andiloro, N. R., & Johnson, B. D. (2014). Opening Pandora’s Box: How Does Defendant Race Influence Plea Bargaining?. Justice Quarterly, (ahead-of-print), 1-29.

      http://ntserver1.wsulibs.wsu.edu:2382/doi/citedby/10.1080/07418825.2014.915340#tabModule

    1. Ever since the Great Awakening, the official power and prestige of the American clergy had be~n in a state of decline. With the coming of the American Revoluuon, and espe-cially by the nineteenth century, ministers--l,.~~ ?egun to sh?re up their failing status by claiming major responsibility for formu~g the character of the rising generation in the young republic. 88 But m the confidence man, they found what they perceived to b~ a serious competitor for the power to shape the character of Amencan Y?uth.

      This seems to be a recurring thing throughout history. When rock and roll started teenagers started acting differently and parents thought they lost control of their kids behavior. Now, some older people think technology has almost corrupted our generation socially. It is always the older generation worried about the younger ones. If confidence men were the competition for shaping the youth, what were they up against? How did the older people want to shape the youth? Is having a competitor is this area inevitable?

  40. Aug 2015
    1. We b e l i e v e t h a t p h o n e m i c a w a r e n e s s c a n b estimulated in many students in large part by pro-viding them with linguistically rich environ-ments—ones in which they are exposed to richvocabulary, syntactic complexity, and decontextu-alized language as well as ones in which languageitself is explored and experimented with deliber-ately.
    2. We u rg e t e a c h e r s t o b e w a t c h f u l f o r c h i l d r e nwho are not catching on—after multiple expo-sures—to games and activities such as those pre-sented here. These children may need extrasupport in phonemic awareness development.

      I wonder if overcrowded classrooms, or classrooms with children who have behavioral issues, impact this?

    1. L. Zhang, A. Eisenberg, Multiple morphologies of “crew-cut” aggregates of polystyrene-b-poly(acrylic acid) block copolymers. Science 268, 1728 (1995).

      This paper was one of the first papers to establish the ability to form micelles of different morphologies (beyond just spherical) for systems using amphiphilic block copolymers

  41. Jul 2015
  42. edu305.networkedlearningcollaborative.com edu305.networkedlearningcollaborative.com
    1. English has 25 consonants that are separated into two broad types according to how the speech organs are used in their production;

      1. pairs - two consonants are produced the same way, except one can be heard and the other cannot
      2. stop pairs - sound production stops air flow (/p/ and /b/, /t/ and /d/, /k/ and /g/)
      3. fricative pairs - air flow is constricted, not completely blocked like stop pairs (/f// and /v/, /th/, /s/ and /z/, /sh/ and /zh/)
      4. affricative pairs - when a stop is followed by a fricative sound (/ch/ and /j/)

      5. groups - not easily distinguishable

      6. nasals - consonant sounds that are produced by exhaling all air through nose (/m/, /n/, /ng/)
      7. glides - do not obstruct air flow; have vowel-like qualities (/w/, /h/, /wh/, /y/
      8. liquids - most difficult to produce; develops later; smooth and flows easily (/l/, /r/ some students produce as /w/)
  43. edu305.networkedlearningcollaborative.com edu305.networkedlearningcollaborative.com
    1. Ch. 3 The Building Blocks of Literacy: Understanding the Consonants

      -pairs -stop pair - sound completely stops airflow through mouth /p/, /b/, /k/, /g/, /t/, /d/ -fricative pairs - airflow is substantially, but not totally constricted /f/, /v/, /th/,/s/, /z/, /sh/, /zh/ -affricative pair - when a stop is followed by a fricative sound /ch/, /j/ -groups -nasal phoneme - consonant phonemes produced by exhaling through nose /m/, /n/, /ng/ -glide phoneme - do not really obstruct airflow /w/, /h/, /wh/, /y/ -liquid phoneme - most problematic; later developing /l/, /r/

      It is important for students to be able to create these sounds for speech and future reading.

    1. 15 phone 703.661.1580 • in the U.S. phone 1.800.645.7247 • fax 703.661.1501 J UL y- DECEMBER 2013 C ATALOG o nl I ne r e S ource S Wo RLD B AN k eL IBRAR y elibrary.worldbank.org World b ank e l ibrary is a subscription-based website designed to meet the unique needs of researchers and librarians. Now in its 10th year and built on a state-of-the-art platform, access to World Bank research and knowledge is faster, easier, and more convenient than ever. eLibrary subscribers are assured full and immediate access to the complete collection of 9,000+ World Bank publications. Beyond its exhaustive content, eLibrary offers a variety of tools and added functionality that save users valuable time during their research. Personalization tools and time-saving conveniences for users: n Bookmarking content for quick retrieval n Saving and emailing search results n eAlerts and RSS feeds based on content type or search criteria n Citation alerts and exporting tools n Easy sharing through social media

      tester

  44. May 2015
    1. D i e I n s t i t u t i o n S c h u l e i s t n i c h t a u f d i g i t a l e M e d i e n v o r b e r e i t e t . H i n d e r n i s s e l i e g e n i n s t r u k t u r e l l e n B e s c h a f - f u n g s b a r r i e r e n u n d r e s t r i k t i v e n

      Das wäre zu überprüfen

  45. Apr 2015
    1. W h e n   n o n v i o l e n c e   i s   p r e a c h e d   a s   a n   a t t e m p t   t o   e v a d e   t h e   r e p e r c u s s i o n s   o f p o l i t i c a l   b r u t a l i t y ,   i t   b e t r a y s   i t s e l f .   W h e n   n o n v i o l e n c e   b e g i n s   h a l f w a y   t h r o u g h t h e   w a r   w i t h   t h e   a g g r e s s o r   c a l l i n g   t i m e   o u t ,   i t   e x p o s e s   i t s e l f   a s   a   r u s e .   W h e n n o n v i o l e n c e   i s   p r e a c h e d   b y   t h e   r e p r e s e n t a t i v e s   o f   t h e   s t a t e ,   w h i l e   t h e   s t a t e d o l e s   o u t   h e a p s   o f   v i o l e n c e   t o   i t s   c i t i z e n s ,   i t   r e v e a l s   i t s e l f   t o   b e   a   c o n .   A n d n o n e   o f   t h i s   c a n   m e a n   t h a t   r i o t i n g   o r   v i o l e n c e   i s   " c o r r e c t "   o r   " w i s e , "   a n y   m o r e t h a n   a   f o r e s t   f i r e   c a n   b e   " c o r r e c t "   o r   " w i s e . "   W i s d o m   i s n ' t   t h e   p o i n t   t o n i g h t . D i s r e s p e c t   i s .   I n   t h i s   c a s e ,   d i s r e s p e c t   f o r   t h e   h o l l o w   l a w   a n d   f a i l e d   o r d e r   t h a t s o   r e g u l a r l y   d i s r e s p e c t s   t h e   c o m m u n i t y .

      The power of this concluding paragraph says it all! Wow. And it's not just cops who show this disrespect.

    1. most Americans (87%) can be uniquely identified from just three pieces of personal data: a birth date, five-digit zip code and gender

      This 87% re-identification risk estimate, incorrectly cited in http://smartdatacollective.com/tamaradull/298401/pii-anonymized-data-and-big-data-privacy as having been initially reported in a 2001 AT&T research paper [1], actually comes from work done by Latanya Sweeney using the 1990 U.S. Census data.[2]

      The cited 87% estimate, in fact, has never been reproduced by other scientists. In 2006, Philippe Golle, a Palo Alto Research Center Computer Scientist, attempted to replicate Sweeney's 1990 Census results and additionally estimated the results using the 2000 Census data. [3] Using well-documented and more accurate estimation methods, Golle found that in 1990 only 61% of the US population was actually unique with regard to this combination of three characteristics. Additionally, Golle found that only 63% of the US population was unique using the 2000 Census data. Subsequently, Barth-Jones, using Golle's method, additionally found that only 62% were unique in the 2010 Census data. [Unpublished work, Personal communication Daniel Barth-Jones, db2431@columbia.edu].

      It should also be understood that the estimates made by both Golle and Sweeney will necessarily produce overestimates of practically realizable re-identification risks because the calculations assume that the entity attempting re-identification will be capable of producing a perfect (or nearly perfect) population register of the entire U.S. population with respect to their Date of Birth, Gender and current 5-digit Zip Code. This re-identification challenge has been described by Barth-Jones as the "myth of the perfect population register" [4].

      In 2013, Sweeney provided an illustrative demonstration of the extent to which perfect population register challenges can practically reduce re-identification risks quite dramatically by using the same three Zip, Gender and Birth Date data elements in an attempt to re-identify participants in the Personal Genome Project [5]. Once participants names (which were embedded the the project's data files were excluded from the re-identification risk calculations), only 28% of the participants with data for their Date of Birth, Gender and 5-digit Zip Code could be actually be re-identified in spite of the study's use of both voter registration and commercial data broker data to attempt to create a suitable population register for re-identification. [6]

      Notably, this real-world demonstration by Sweeney of the realized re-identification risks when attempting to construct a population register using currently available commercial and governmental data sources revealed re-identification risks only one third of the 87% level originally cited by Sweeney, and less than half of the 61-63% levels found by Golle and Barth-Jones. [7]

      References: 1) http://www2.research.att.com/~bala/papers/wosn09.pdf Krishnamurthy, B. Wills, CE. On the Leakage of Personally Identifiable Information Via Online Social Networks. 2001. ACM, 2) http://dataprivacylab.org/projects/identifiability/paper1.pdf L. Sweeney, Uniqueness of Simple Demographics in the U.S. Population, LIDAPWP4. Carnegie Mellon University, Laboratory for International Data Privacy, Pittsburgh, PA, 2000. 3) https://crypto.stanford.edu/~pgolle/papers/census.pdf Golle, P. Revisiting the Uniqueness of Simple Demographics in the US Population. Proceedings of the 5th ACM Workshop on Privacy in Electronic Society, 2006, p. 77-80. 4) Barth-Jones, Daniel C., The 'Re-Identification' of Governor William Weld's Medical Information: A Critical Re-Examination of Health Data Identification Risks and Privacy Protections, Then and Now (June 4, 2012). Available at SSRN: http://ssrn.com/abstract=2076397 or http://dx.doi.org/10.2139/ssrn.2076397 5) Sweeney, Latanya and Abu, Akua and Winn, Julia, Identifying Participants in the Personal Genome Project by Name (April 29, 2013). Available at SSRN: http://ssrn.com/abstract=2257732 or http://dx.doi.org/10.2139/ssrn.2257732 6) Bambauer, J. https://blogs.law.harvard.edu/infolaw/2013/05/01/reporting-fail-the-reidentification-of-personal-genome-project-participants/comment-page-1/ 7) Barth-Jones, DC http://blogs.law.harvard.edu/billofhealth/2013/10/01/press-and-reporting-considerations-for-recent-re-identification-demonstration-attacks-part-2-re-identification-symposium/

    1. s u b s t a n c e   o f   a r g u m e n t s   i s   a l s o   a n   i m p o r t a n t   c o n s i d e r a t i o n   f o r   j u d g i n g   t h e   q u a l i t y   o f   i n d i v i d u a l   s t u d i e s .

      I would argue Way more important. The text structure provides important cues to signify meaning to the audience but I would rather read a poorly argued substansive study than an empty but well structured study.

    2. a r g u m e n t a t i v e   g r a m m a r . ​   H e   d e f i n e s   a n   a r g u m e n t a t i v e   g r a m m a r   i s   “ t h e   l o g i c   t h a t   g u i d e s   t h e   u s e   o f   a   m e t h o d   a n d   t h a t   s u p p o r t s   r e a s o n i n g   a b o u t   i t s   d a t a ”

      Key definition of argumentative grammar.

  46. Jan 2015
    1. c i t i z e n s   o f   t h e   w e b   l e a r n   t h e   m o s t   i m p o r t a n t   s k i l l s   o f   o u r   a g e :   t h e   a b i l i t y   t o   r e a d ,   w r i t e   a n d   p a r t i c i p a t e   i n   t h e   d i g i t a l   w o r l d

      I enjoy this sentence. It does not recreate a false dichotomy between our offline and online places, spaces, and identities.

      This is where I struggle the most when trying to envision the web literayc map. Where do traditional reading,writing, and participating end and where does reading, writing, and participating on the open web begin?

      Of course this isn't a permanent border. Where these two elements of meaning making meet ebb and flow depending on contexts and purpose.

  47. dione.library.uvic.ca dione.library.uvic.ca
    2
    1
    1. M a y b e   t h e i r   d e v i c e s   g e t   a d d e d   t o   t h e   i n d e n t i f i c a t i o n   p r o c e s s .   L e t ’ s   s a y   t h e   l a p t o p   i s   t h e i r   p r i m a r y   d e v i c e .   W h e n   t h e i r   c e l l p h o n e   i s   p u t   i n t o   t h e   f i g u r i n g   i t   i s   t h e   s e c o n d   d e v i c e   t h a t   i s   a s s o c i a t e d   w i t h   t h e   u s e r :   U S 0 0 1 2 0 0 G H K 4 2 .   T h e   “ 2 ”   s t a n d s   f o r   t h a t   s e c o n d   d e v i c e .

      This is an entry