Hypothesis

4,329 Matching Annotations

Mar 2021
biorxiv.org biorxiv.org

http://biorxiv.org/cgi/content/short/2020.10.31.363044

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.10.31.363044: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Photoconjugation: Cardiac Troponin I antibodies 19C7 (4T21) and 4C2 (4T21), and C-reactive protein antibodies C6 (4C28cc) and C135 (4C28) were obtained from Hytest.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C-reactive protein antibodies C6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>C135</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-adalimumab/TNFα monoclonal antibody (HCA207) and anti-infliximab (HCA213) were obtained from BioRad.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-adalimumab/TNFα</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-infliximab (HCA213</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-SARS-COV-2 antibodies 47D11 and 49F1 were produced in HEK-293T cells and purified using Protein-A affinity chromatography as described previously44.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-COV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-COV-2 spike trimer protein was expressed in HEK-293T cells with a C-terminal trimerization motif and Strep-tag using the pCAGGS expression plasmid, and purified from the culture supernatant by Strep-Tactin chromatography as described previously44.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For lentiviral production of the two vectors, encoding either the RBD-LB or RBD-SB transgene, HEK293T cells (ATCC® CRL-3216™) were transiently co-transfected with the abovementioned transfer vectors, as well as the VSV-G envelope (pMD2.G) and packaging plasmids (pCMVR8.74), as previously described58.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/short/2020.10.31.363044
biorxiv.org biorxiv.org

http://biorxiv.org/cgi/content/short/2020.10.29.361287

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.10.29.361287: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">CDR2 was randomized in stage one, PCR templates at this stage were equal molar mixtures of plasmids carrying DNA encoding frames, including three frame1 versions, one frame2, three frame3 versions and one frame4.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) with anti-Flag antibody (Sigma-Aldrich, F1804), then incubating antibody-coated beads with cell lysate or cell media containing 3xFlag tagged target proteins at 4°C for 2 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Flag</div><div>suggested: (Sigma-Aldrich Cat# F1804, RRID:AB_262044)</div></div><div style="margin-bottom:8px"><div>F1804</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For anti-Myc selection, magnetic beads were coated by anti-Myc antibody (ThermoFisher Scientific, 13-2500) only.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Myc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed three times with wash buffer, HRP conjugated anti-His tag secondary antibody (BioLegend, 652503) diluted 1:2000 in blocking buffer was then added to the plates and incubated at RT for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His tag secondary antibody ( BioLegend , 652503</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T ACE2 were a kind gift of Michael Farzan.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed once with PBST (PBS, ThermoFisher Scientific, with 0.02% TritonX-100), a 1:1 mixture of HEK293T cell culture media containing secreted RBD-3xFlag and blocking buffer (PBST with 1% nonfat dry milk) was added to the plates and incubated at RT for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Medium was then removed from HEK293T ACE2/TMPRSS2 cells and replaced with 150 μl of the VHH + pseudotyped lentivirus solution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T ACE2/TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">psPAX2 and pCMV-VSV-G were previously described 20. pTRIP-SFFV-EGFP-NLS was previously described 21 (a gift from Nicolas Manel; Addgene plasmid # 86677; http://n2t.net/addgene:86677; RRID:Addgene_86677). cDNA for human TMPRSS2 and Hygromycin resistance gene was obtained by synthesis (IDT).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_86677)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CDR-directed clustering analysis: Computational analysis for CDR-directed clustering was performed using custom python scripts.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Percentage GFP was quantified on a Cytoflex LX (Beckman Coulter) and data were analyzed with FlowJo.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/short/2020.10.29.361287
biorxiv.org biorxiv.org

http://biorxiv.org/cgi/content/short/2020.11.09.374603

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.11.09.374603: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics statement: Lung tissue samples from eight different healthy donors and nasal tissue samples from one healthy donor and one patient with chronic rhinosinusitis with nasal polyps were obtained under the approval of the ethical committee from the University Hospital Leuven (UZ Leuven Biobanking S51577 and S59864).<br>Consent: All patients were adult and provided written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The primary antibodies were mouse anti-V5 tag [Invitrogen, R960-25, 1:2000 (SARS-1-S, MERS-S and SARS-2-S) or 1:5000 (229E-S)] and mouse anti-β-actin (Sigma-Aldrich, A5447, 1:5000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-V5</div><div>suggested: (Thermo Fisher Scientific Cat# R960-25, RRID:AB_2556564)</div></div><div style="margin-bottom:8px"><div>SARS-2-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>229E-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-β-actin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A5447</div><div>suggested: (ABclonal Cat# A5447, RRID:AB_2766249)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As secondary antibody, we used a peroxidase-coupled goat anti-mouse antibody (Dako, P0447, 1:5000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Agilent Cat# P0447, RRID:AB_2617137)</div></div><div style="margin-bottom:8px"><div>P0447</div><div>suggested: (Agilent Cat# P0447, RRID:AB_2617137)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The samples were heated for 5 min at 95°C and subjected to SDS-PAGE and immunoblotting, as above, with mouse anti-V5 tag (Invitrogen, R960-25) and mouse anti-MLV p30 antibody (Abcam, ab130757) as primary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>R960-25</div><div>suggested: (Thermo Fisher Scientific Cat# R960-25, RRID:AB_2556564)</div></div><div style="margin-bottom:8px"><div>anti-MLV p30</div><div>suggested: (Creative Diagnostics Cat# DCABH-2412, RRID:AB_2476319)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells, media and compounds: Calu-3 (ATCC HTB-55) cells were grown in minimum essential medium (MEM) supplemented with 10% fetal calf serum (FCS), 0.1 mM non-essential amino acids, 2 mM L-glutamine, and 10 mM HEPES.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: ATCC Cat# HTB-55, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells (HCL4517; Thermo Fisher Scientific) and Vero E6 (ATCC CRL-1586) were grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% FCS, 1 mM sodium pyruvate, 0.075% sodium bicarbonate and (only for Vero E6) 0.1 mM non-essential amino acids.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">They were then transduced into receptor- and TMPRSS2-transfected HEK293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analysis was performed using GraphPad Prism (version 8.4.3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04455815</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">A Trial Looking at the Use of Camostat to Reduce Progression…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04321096</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">The Impact of Camostat Mesilate on COVID-19 Infection</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04353284</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Camostat Mesylate in COVID-19 Outpatients</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04355052</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Open Label Study to Compare Efficacy, Safety and Tolerabilit…</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04374019</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Novel Agents for Treatment of High-risk COVID-19 Positive Pa…</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/short/2020.11.09.374603
doi.org doi.org

https://doi.org/10.1101/2020.05.25.115618

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.05.25.115618: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Materials: Human ACE2 (his tag) (10108-H08H), ACE2 rabbit Antibody (10108-RP01), goat anti-Rabbit/HRP secondary antibody (SSA004, and SARS-CoV-2 (2019-nCoV) and RBD of spike glycoprotein (mFC tag)(40592-V05H) were purchased from Sino Biological (Beijing,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Rabbit/HRP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SSA004</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>2019-nCoV</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>40592-V05H</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibody/HRP (1:5000 dilution) in 5% BSA was incubated 37°C for 0.5 h followed by washing for three times.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody/HRP</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.05.25.115618
biorxiv.org biorxiv.org

http://biorxiv.org/cgi/content/short/2020.11.13.381533

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.11.13.381533: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Donors: This study was approved by the Harvard Medical School Office of Human Research Administration Institutional Review Board (IRB20-0365) as was the use of healthy donor control blood (IRB19-0786).<br>Consent: We received informed, written consent from a healthy adult male participant (C1) who recovered from confirmed SARS2-CoV-2 infection, with mild illness not requiring hospitalization, five weeks before blood donation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">We received informed, written consent from a healthy adult male participant (C1) who recovered from confirmed SARS2-CoV-2 infection, with mild illness not requiring hospitalization, five weeks before blood donation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing three times and resuspending the cells, we added anti-IgG-APC antibody (BD Biosciences), anti-CD19-FITC antibody (BD Biosciences), and streptavidin-PE (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IgG-APC</div><div>suggested: (Miltenyi Biotec Cat# 130-093-194, RRID:AB_1036183)</div></div><div style="margin-bottom:8px"><div>anti-CD19-FITC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We detected bound antibody with horseradish peroxidase (HRP)-coupled anti-human (Fc) antibody (Sigma Aldrich catalog number A0170).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human (Fc)</div><div>suggested: (Sigma-Aldrich Cat# A0170, RRID:AB_257868)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and viruses: We maintained HEK293T cells (ATCC CRL-11268) in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% (v/v</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A HEK293T-hACE2 stable cell line was a gift from Huihui Mou and Michael Farzan and an Expi293F-His6-tagged SARS-CoV-2 S2P stable cell line that expresses a gift from Bing Chen.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-hACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S2P</div><div>suggested: RRID:CVCL_2H49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A T225 flask of VeroE6 cells was inoculated with 90 μl starting material in 15 ml DMEM containing 2% (v/v) of heat inactivated FBS (HI-FBS) and incubated in a humidified incubator at 37 °C with periodic rocking for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For crystallography, we produced the protein by PEI transfection of GnTI-/- HEK293S cells grown in suspension or HEK293T cells grown in suspension and also in presence of kifunensine (5 μM), purified by nickel affinity purification, and removed the His6-tag by TEV digestion followed by reverse nickel affinity purification.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293S</div><div>suggested: RRID:CVCL_A784)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing three times and resuspending the cells, we added anti-IgG-APC antibody (BD Biosciences), anti-CD19-FITC antibody (BD Biosciences), and streptavidin-PE (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BD Biosciences</div><div>suggested: (BD Biosciences, RRID:SCR_013311)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used IMGT/V-QUEST31 (http://www.imgt.org) to analyze IgG gene usage and the extent of variable segment somatic hypermutation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>http://www.imgt.org</div><div>suggested: (IMGT - the international ImMunoGeneTics information system, RRID:SCR_012780)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Diffraction data were indexed and integrated using XDS (build 202 00131)36 and merged using AIMLESS (v0.5.32)37.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AIMLESS</div><div>suggested: (AIMLESS, RRID:SCR_015747)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The structure of C1A-B12 Fab:RBD (space group P212121) was determined by molecular replacement using Phaser (v2.8.3)38, with coordinates for the B38 Fab variable domain, constant domain and RBD (PDB ID: 7BZ5) (Wu et al., 2020) used as search models.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phaser</div><div>suggested: (Phaser, RRID:SCR_014219)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We performed iterative model using O39 and refinement in Phenix (v1.18.2-3874)40 and Buster (v2.10.3)41, during which we also built alternative conformations where density was apparent.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phenix</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">During refinements, we updated TLS groups calculated using Phenix40 and a python script, as well as occupancy restraints calculated in Buster.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structural Analysis: We analyzed the structures and generated figures using PyMOL (Schrödinger)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/short/2020.11.13.381533
biorxiv.org biorxiv.org

http://biorxiv.org/cgi/content/short/2020.11.06.370676

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.11.06.370676: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Five fields for microscopic analysis were randomly selected in each treated group, the numbers of fused and unfused EGFP positive cells were counted.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression and purification of recombinant SARS-CoV-2 spike RBD, human ACE2 and antibodies: The DNA sequences of codon-optimized SARS-CoV-2 spike Receptor Binding Domain (S-RBD) and human ACE2 extracellular domain (hACE2-ECD) were cloned into a pFuse-Fc expression vector (Invivogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human ACE2 extracellular domain ( hACE2-ECD )</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DNA sequences for the variable regions of the combinatorial antibodies were cloned into a full-length human IgG4 mutant construct (S228P) and expressed in HEK293F cells for 4 days and further purified by Mabselect chromatography.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IgG4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S228P</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A solution containing the secondary antibody, anti-M13 bacteriophage antibody conjugated with HRP (dilution factor 1 : 5000; Sino Biological, #11973-MM05T-H), was added into the above plates (150 μL/well) and incubated at 37 °C for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-M13</div><div>suggested: (LSBio (LifeSpan Cat# LS-C71922-5000, RRID:AB_10636908)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The recombinant hACE2-ECD was coated in PBS buffer at 2 ng/μL, 100 μL per well at 4 °C overnight, washed with PBS once, then blocked with 3% BSA in PBS. Biotinylated S-RBD (hFc tag removed by thrombin digestion) at a final concentration of 50 nM was incubated with 2-fold serial diluted S-B8, S-D4, and S-E6 antibodies (from 1 - 133 nM) at 4 °C for 30 min, in which an IgG4e1 isotype antibody was used as the negative control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S-D4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Interaction of antibodies with cell surface expressed spike by FACS: In a flow-cytometry binding experiment, the spike protein of either full-length SARS-CoV-2 or SARS, which was conjugated with P2A-EGFP, was transiently transfected into a HEK293T cell.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>P2A-EGFP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The spike protein expressing cells (50000 cells per tube) were then incubated with different anti-S-RBD antibodies for 20 min at 4 °C, and washed with 1 mL ice-cold FACS buffer, spun, and re-suspended in a 100 μL ice-cold FACS buffer containing the Alexa555 conjugated secondary antibody that recognizes human Fc (1 : 800 v/v dilution, Life technology, # A21433).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The co-cultures of cells were cultivated in a DMEM medium with 10% FBS, and treated with or without anti-SARS-CoV-2 spike antibodies at indicated concentrations.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Autoreactivity assay: The autoreactivity assay was performed using a HEp-2 anti-nuclear antibodies (ANA) kit (Medical & Biological Laboratories Co., Ltd, #4220-12CN) according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nuclear</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>#4220-12CN</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing twice (5 min each), the FITC-conjugated secondary anti-human antibody was incubated with the cells for 20 min at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: The Vero cell line (ATCC® CCL-81™) was maintained in a DMEM/F-12k media (Gibco, #C11330500CP) containing 10% (v/v</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For establishing the HEK293T/hACE2 stable cell line, HEK293T cells (ATCC® ACS-4500™) were transiently transfected with hACE2 fusion BFP encoding PB510 plasmid using PiggyBac Transposon System (System Biosciences, PB210PA-1), followed by addition of 2 μg/mL puromycin 6 h post-transfection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: ATCC Cat# ACS-4500, RRID:CVCL_4V93)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2 S-RBD-hFc and hACE2-ECD-mFc proteins were heterologously expressed in HEK293F cells by transient transfection and cultured for 4 days, then purified by Mabselect columns (Cytiva, #17-5199-01).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, HEK293T/hACE2 cells were first seeded into 96-well white bottom plates at a density of 1×104/well, and cultivated overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T/hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 35 μL of 0.1 mg/mL antibodies were loaded to the wells in a slide pre-seeded with fixed and permeabilized HEp-2 cells and incubated for 20 min at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEp-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">http://www.imgt.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>http://www.imgt.org/</div><div>suggested: (IMGT - the international ImMunoGeneTics information system, RRID:SCR_012780)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed using four-parameter logistic regression (Hill equation) in GraphPad Prism 8.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Iterative model building and refinement were carried out in COOT (47) and PHENIX (48), respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div><div style="margin-bottom:8px"><div>PHENIX</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Epitope and paratope residues, as well as their interactions, were identified by using PISA program (49) with buried surface area (BSA >0 Å2) as the criterion.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PISA</div><div>suggested: (PISA, RRID:SCR_015749)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/short/2020.11.06.370676
biorxiv.org biorxiv.org

http://biorxiv.org/cgi/content/short/2020.11.21.392753

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.11.21.392753: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Cell lines: VeroE6 and A549 cells were obtained from American Type Culture Collection (ATCC) and tested at regular intervals for mycoplasma contamination.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After three times washing with PBS, bound primary antibody was detected with a secondary antibody (anti-mouse IgG), conjugated to horseradish peroxidase.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This Heidelberg strain was passaged in VeroE6 cells, aliquoted and stored at −80° C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: VeroE6 and A549 cells were obtained from American Type Culture Collection (ATCC) and tested at regular intervals for mycoplasma contamination.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentivirus stocks were produced by transfection of HEK293T cells with a pWPI plasmid encoding for TMPRSS2 and the pCMV-Gag-Pol and pMD2-VSV-G packaging plasmids (kind gifts from D. Trono, Geneva).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For all other assays, A549+ACE2 cells were cultured in Roswell Park Memorial Institute (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549+ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PLpro expression and purification: For cloning of PLpro with an N-terminal 6xHis-SUMO1 tag, synthetic fragments of the Nsp3 coding sequence derived from the original Wuhan strain were purchased from BioCat.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioCat</div><div>suggested: (BioCAT, RRID:SCR_001440)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All data were analyzed using GraphPad Prism (v8.4)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Densitometric analysis of protein bands on gels was performed using ImageJ (v1.52p)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The LC-MS systems used was either a Thermo Fisher Finnigan Surveyor Plus equipped with an Agilent Zorbax 300SB-C18 column (3.5 μm, 3.0 × 150 mm) coupled to a Finnigan LTQ mass spectrometer or an Agilent 1100 Series HPLC equipped with a Luna 4251-E0 C18 column (3 μm, 4.6 x 150 mm) coupled to a PE SCIEX API 150EX mass spectrometer (wavelengths monitored = 220, 254 and 646 nm).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Thermo Fisher Finnigan Surveyor Plus</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04535167</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">First-In-Human Study To Evaluate Safety, Tolerability, And P…</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/short/2020.11.21.392753
biorxiv.org biorxiv.org

http://biorxiv.org/cgi/content/short/2020.12.01.406934

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.12.01.406934: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Donors & Ethics: Donors were recruited in accordance with the laws of Switzerland and under ethics approval BASEC-2016-01260 of the Cantonal Ethics Commission of Zurich.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animals were weighed prior to the start of the study and randomly distributed in the different cohorts.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">In Vivo experiments (hamster): A total of 56 Golden Syrian hamsters, 36 male and 20 female, weighing between 80g and 130g were used in the study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding of antibodies was detected using a fluorescence labeled anti human IgG.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound ACE2 was then detected using a fluorescence labeled anti His Tag antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti His Tag antibody.</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Negative control/isotype control antibody (mAb24C3) is a human-derived antibody specific for tetanus toxoid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>mAb24C3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This sort yielded RBD-specific-antibody-expressing HEK cell clones.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization of SARS-CoPsV-2: HEK293T cells stably expressing full length huACE2 (aa1-805) were seeded and left to adhere.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization of wild type SARS-CoV-2: At day 0, Vero E6 cells were seeded with a concentration of 1*105 cells/well in 300 μl medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As control cells non-transfected HEK293T and Raji B cells were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Raji B</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies were expressed in HEK293 cells after gene synthesis of the variable regions and linkage to the same constant region derived from human IgG1 (Trastuzumab) as COVAB.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analysed and IC50 values were determined using the “log [Inhibitor] vs. normalized response -- Variable slope” fitting model of GraphPad Prism 8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  A caveat for this is the fact that the target cells we used were stably transfected cells that may or may not mimic the in vivo situation in an infected individual. The only experimental evidence for ADCC against corona virus infected cells that we could identify is described in Holmes et al. Br. J. exp. Path. I986. Comparison to benchmark antibodies currently in the clinic: In an attempt to benchmark the virus neutralizing activity of MTX-COVAB to one of its peers, we compared it side-by-side with the two antibodies that form Regeneron’s cocktail (Hansen et al. Science 2020) using our pseudovirus assay. As shown in Figure 5, MTX-COVAB shows a neutralization capacity that is on par with that obtained with the better of the two antibodies as well as with the cocktail.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/short/2020.12.01.406934
biorxiv.org biorxiv.org

http://biorxiv.org/cgi/content/short/2020.12.13.420406

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.12.13.420406: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">For quantification of cell-cell fusion, three fields were randomly selected in each well to count the fused and unfused cells.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antigens and antibodies: The RBD domain of SARS-CoV-2 S protein (His-tag) were synthesized by Prof. Xuefei Cai at Key Laboratory of Molecular Biology for Infectious Diseases (Ministry of Education), Chongqing Medical University.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antigens</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>His-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The wells were incubated with mouse anti-RBD monoclonal antibody (1:1000 dilution) for 1 hour at 37°C, and then washed with PBST five times and incubated with Horseradish peroxidase (HRP)-conjugated goat anti-mouse antibody (Abmart, Shanghai, China) for 1 hour at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines and cell culture: HEK 293T, A549, and Calu3 cells were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div><div style="margin-bottom:8px"><div>Calu3</div><div>suggested: KCLB Cat# 30055, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T cells were co-transfected with pNL4-3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell-cell fusion assay: HEK 293T effector cells were transfected with plasmid pAdTrack-TO4-GFP encoding green fluorescent protein (GFP) or pS-G614 encoding the corresponding SARS-CoV-2 S protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Functional analysis of Ca2+ in pseudovirus infectivity: 293T-ACE2 cells were seeded in 96-well plate (2×104 cells/well) and incubated at 37 °C for 8h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In short, HEK 293T-ACE2 cells were assigned to 96-well plates (4×104 cells/well) and cultured for 24 hours at 37 °C with 5 μM compounds.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cytopathic effect (CPE) assay and quantification of SARS-CoV-2 infection: Vero E6 cells were dispensed into 96-well plate (4.0×104 cells/well), pre-treated with medium containing compounds or DMSO for 1 hour at 37 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses: Data were analyzed using GraphPad Prism version 6.0 software and were presented as means ± SD.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/short/2020.12.13.420406
biorxiv.org biorxiv.org

http://biorxiv.org/cgi/content/short/2020.12.18.423418

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.12.18.423418: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In a parallel experiment, the wells were washed and then incubated with polyclonal rabbit anti-human SP-D primary antibody (0.5 μg/ml) (1:5000) for 2 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human SP-D</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next day, the wells were washed and then incubated with anti-sheep IgG-HRP antibodies or anti-His antibodies (Genetex, GTX628914, 0.5 μg/ml) (1:2000) for 2 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-sheep IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the detection of RBD binding, the wells were further incubated with anti-mouse IgG antibody (Abcam, ab6728, 0.5 μg/ml) (1:2000) for 2 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (Abcam Cat# ab6728, RRID:AB_955440)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following PBS washes, the cells were probed with goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody linked to Alexa Fluor 647 (Thermo Fisher Scientific) (0.6 μl/100 μl per tube) for 1 h at room temperature in dark.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For binding experiments using rfhSP-D, SARS-CoV-2 S1 protein containing a C-terminal His-tag (Acro; S1N-C52H3) (5 μg/ml) was tagged with anti-His antibody (Genetex; GT395) (1:100) at 4°C for 1h and followed by pre-incubation with a series of two-fold dilutions of rfhSP-D (10 μg/ml) or mock (cells only) at 4°C for 1h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>His-tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, coverslips were blocked with 2% w/v BSA for 1h and incubated with ACE2 antibody [SN0754] (1:250) (GeneTex, GTX01160), followed by Goat anti-rabbit IgG (H+L) cross-adsorbed secondary antibody (1:500) (Thermo Fisher Scientific) for 1 h at room temperature in dark.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: (Thermo Fisher Scientific Cat# MA5-32307, RRID:AB_2809589)</div></div><div style="margin-bottom:8px"><div>GTX01160</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture and treatments: Human embryonic kidney (HEK) 293T or HEK293T cells overexpressing ACE2 receptor (HEK293T-ACE2) were cultured in complete Gibco Dulbecco’s Modified Eagle Medium (DMEM), supplemented with 10% v/v fetal bovine serum (FBS), 100 U/ml penicillin (Sigma-Aldrich) and 100 μg/ml streptomycin (Sigma-Aldrich), and left to grow at 37°C in the presence of 5% v/v CO2 for approximately 48 h before passaging.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T cells were seeded one day before, and then transfected with the indicated plasmids using TransIT®-LT1 transfection reagent (Mirus).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T-ACE2 cells (HEK293T cells overexpressing ACE2 receptor) (0.5×105 cells) were preincubated with rfhSP-D (0, 5, 10 and 20 μg/ml) for 24 h and then washed twice with PBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: GraphPad Prism 6.0 software was used to generate all the graphs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/short/2020.12.18.423418
biorxiv.org biorxiv.org

http://biorxiv.org/cgi/content/short/2020.12.21.423721

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.12.21.423721: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Human myocardial samples (right ventricle or atrium) were discarded material from surgical repair of congenital heart defects (ethical approval number 15/LO/1064 from the North Somerset and South Bristol Research Ethics Committee).<br>Consent: Adult patients and paediatric patients’ custodians gave informed written consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibodies (ACE2, dilution 1:100; CD147, 1:500, 6x-HIS-tag (Invitrogen MA1-21315), 1:1000) were incubated for 16 hrs at 4°C. β-Actin was used as a loading control (Sigma, A5441, 1:10000)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>6x-HIS-tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>β-Actin</div><div>suggested: (Sigma-Aldrich Cat# A5441, RRID:AB_476744)</div></div><div style="margin-bottom:8px"><div>A5441</div><div>suggested: (Sigma-Aldrich Cat# A5441, RRID:AB_476744)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Where required, cells were incubated with the anti-CD147 neutralizing antibody (20 μg/mL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD147</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PCs were pre-incubated with anti-ACE2 (20 μg/mL, as described before5) or anti CD147 (20 μg/mL) antibodies for 1 hat 37 °C and then exposed to the S protein (500 ng/mL - 2·9 nM) for 1 h at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti CD147</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western blot data were analyzed using the ImageJ software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistics: Data were analyzed using Prism version 8.0 and expressed as individual values and as means ± standard error of the mean.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/short/2020.12.21.423721
biorxiv.org biorxiv.org

http://biorxiv.org/cgi/content/short/2020.12.19.423584

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.12.19.423584: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, endogenous human NPC1 and HSP90 were purified using immobilized Recombinant Protein G Resin (Generon) and 4 µg of specific antibodies against NPC1 (Abcam, ab108921) or HSP90 (Enzo Life Sciences, ADI-SPA-835) respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HSP90</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After that, plates were washed with PBST (PBS 0.1%Tween20) and the binding of NPC1 to SARS-CoV-2 N protein was detected with a rabbit anti-NPC1 antibody (1:2000), revealed with an anti-rabbit-horseradish peroxidase (HRP) (1:2000) using a colorimetric substrate (OPD) and finally, quantified by absorbance at 492 nm in the EnSight multimode plate reader of PerkinElmer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-NPC1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit-horseradish peroxidase (HRP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture and viruses: Human embryonic kidney cells 293T/17 (HEK 293T; ATCC-CRL-11268) were cultured in Dulbecco modified Eagle medium (DMEM) at 37 °C and 5% CO2 atmosphere, supplemented with 100 IU/ml penicillin, 100 µg/ml streptomycin, 1X GlutaMAX (Thermo Fisher) and 10% heat-inactivated fetal bovine serum (FBS).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Huh-7 Lunet C3 cells, a gift from T. Pietschman (Twincore, Germany), were cultured at 37 °C in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 100 IU/ml penicillin, 100 µg/ml streptomycin, 10mM HEPES, 1X NEAA and 10% of heat-inactivated fetal bovine serum (FBS).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Lunet C3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression of tagged-N protein and EGFP in HEK 293T cells: To transfect HEK 293T cells, four 60mm dishes were seeded with 2.5 ×106 cells each 24 hours prior to transfection in DMEM complete medium described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Huh-7 cells were pre-treated with compounds at the indicated concentrations in growth medium for 1 h at 33 °C, followed by infection with 229E-GFP at a multiplicity of infection (MOI) of 1 pfu/cell for 24 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To generate the SARS-CoV-2 N with N-terminal EGFP tag (EGFP-N), a codon optimized cDNA sequence for the ORF of SARS-CoV-2 N (NCBI reference sequence number: NC_045512) was cloned into the pEGFP-C1 (by GeneArt-Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GeneArt-Thermo Fisher Scientific</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of SARS-CoV-2 N protein in the baculovirus system: The sequence of the N protein published in the NCBI database was selected (GenBank accession number: 43740575 / NCBI reference sequence number: NC_045512).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NCBI</div><div>suggested: (NCBI, RRID:SCR_006472)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant SARS-CoV-2 N protein produced in pupae was measured by band densitometry with the ChemiDoc™ XRS Gel Imaging System using Image Lab™ software (Bio-Rad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Image Lab™</div><div>suggested: (Image Lab Software, RRID:SCR_014210)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The IC50s values and dose-response curves were estimated using GraphPad Prism v6.0 with a 99% confidence interval.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In order to determine the percentage of infected cells per condition, 8,000 cells/time point were scored using FACS Canto II flow cytometer (BD Sciences) and analyzed using the FlowJo software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/short/2020.12.19.423584
biorxiv.org biorxiv.org

http://biorxiv.org/cgi/content/short/2020.12.30.424801

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.12.30.424801: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the cells were washed three times with PBS, incubated with serum free media with primary antibody anti-ACE2 (1:100</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: (Enzo Life Sciences Cat# ALX-804-722-C100, RRID:AB_11180102)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For CSNPs-binding, hACE2-overexpressed Hek293 cells were incubated with 10 uM peptide for 1 hour and then treated and incubated with 5 uM SARS-CoV-1 S1 protein-His Tag (AcroBiosystems, S1N-C52H3-100UG, USA) for 24 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Hek293</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As g_mmpbsa tool is compatible with older versions of GROMACS (versions 5 or lower), the “tpr” files created by GROMACS 2019.6 were recreated through GROMACS 5.1 and used for binding energy calculation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GROMACS</div><div>suggested: (GROMACS, RRID:SCR_014565)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Computational tools used in this study: For simple visualization and collecting structural insights of the SARS-CoV-2 spike and ACE2 proteins, free available packages of VMD (61), Pymol (https://pymol.org), and Chimera (62) were utilized.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pymol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For CSNPs-binding, hACE2-overexpressed Hek293 cells were incubated with 10 uM peptide for 1 hour and then treated and incubated with 5 uM SARS-CoV-1 S1 protein-His Tag (AcroBiosystems, S1N-C52H3-100UG, USA) for 24 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AcroBiosystems</div><div>suggested: (ACRObiosystems, RRID:SCR_012550)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  To overcome this limitation, two research groups have stabilized the α1 helix by increasing the helical bundles and designed peptide biologics that could effectively inhibit SARS-CoV-2 cell entry (44, 45). However, this modification increases the size of these peptides by ~3-4 folds, increasing the cost of synthesis and formulation. We and others have previously used peptide stapling to enhance the target specificity of therapeutic peptides (28, 51). In fact, Fiarlie and his co-workers found that the helical-constrained compounds hold comparatively similar biological potencies in PPI as their parent proteins. They constructed four such compounds and proposed that downsized-constrained peptides could be of great value in biological PPIs and medicine (52). Unfortunately, we could not synthesize the CSNP1 to compare its potency with CSNP2; however, CSNP3 (a relatively shorter version of CSNP1) was unable to bind SARS-CoV-2 S1 (Figure 5). This notion suggests that in addition to the structural integrity, optimum length and the featured pharmacophores are vital for CSNP to bind RBD. Together, we suggest that structure guided computational medicinal chemistry and click chemistry approaches might be useful in designing CSNPs to enhance tethering to their targets. Collectively, we suggest that CSNP2 and CSNP4 are stable peptide that deter the binding of ACE2 and S1 subunit of SARS-CoV-2 and could be potent antidote for COVID-19.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 28. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/short/2020.12.30.424801
medrxiv.org medrxiv.org

http://medrxiv.org/cgi/content/short/2020.12.24.20248821

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.12.24.20248821: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Human samples and ethical declaration: Anonymized samples from blood donors (n=100/sampling week) and pregnant women (n=100/sampling week) were randomly selected from their respective pools by the department of Clinical Microbiology, Karolinska University Hospital.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Human samples and ethical declaration: Anonymized samples from blood donors (n=100/sampling week) and pregnant women (n=100/sampling week) were randomly selected from their respective pools by the department of Clinical Microbiology, Karolinska University Hospital.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary HRP-conjugated anti-human antibodies were diluted in blocking buffer and incubated with samples for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies (from Southern Biotech) and dilutions used: goat anti-human IgG (2014-05) at 1:10,000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (SouthernBiotech Cat# 2014-05, RRID:AB_2795580)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, we used a logistic regression over anti-RBD and -S training data (from n=595 historical blood donor controls and n=138 SARS-CoV-2 PCR+ individuals across the clinical spectrum) to model the relationship between the ELISA measurements and the probability that a sample is antibody-positive.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antibody-positive</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The RBD domain (RVQ – QFG) of SARS-CoV-2 was cloned upstream of a Sortase A recognition site (LPETG) and a 6xHIS tag, and expressed in 293F cells as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293F</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In vitro virus neutralisation assay: Pseudotyped viruses were generated by the co-transfection of HEK293T cells with plasmids encoding the SARS-CoV-2 spike protein harboring an 18 amino acid truncation of the cytoplasmic tail2; a plasmid encoding firefly luciferase; a lentiviral packaging plasmid (Addgene 8455) using Lipofectamine 3000 (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudotyped neutralisation assays were adapted from protocols validated to characterize the neutralization of HIV, but with the use of HEK293T-ACE2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/short/2020.12.24.20248821
biorxiv.org biorxiv.org

http://biorxiv.org/cgi/content/short/2020.12.29.424482

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.12.29.424482: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 2 h, infected cells were washed four times with DMEM before medium supplemented with anti-VSV-G antibody (I1-mouse hybridoma supernatant diluted 1 to 50, from CRL-2700, ATCC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-VSV-G</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, all ectodomains were produced in HEK293F cells grown in suspension using FreeStyle 293 expression medium (Life Technologies) at 37 °C in a humidified 8% (v/v) CO2 incubator rotating at 130 r.p.m.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentivirus was produced by transient transfection of HEK293T cells (ATCC) using linear 25 kDa polyethyleneimine (PEI; Polysciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK-293T cells at 70∼80% confluency were transfected with the pCAGGS expression vectors encoding full-length OC43 S with a truncation of the 17 C-terminal residues (to increase cell surface expression levels) along with fusion to a flag tag and the Fc-tagged bovine coronavirus hemagglutinin esterase protein at molar ratios of 8:1. 48 h after transfection, cells were transduced with VSVΔG/Fluc (bearing the Photinus pyralis firefly luciferase) (Kaname et al., 2010) at a multiplicity of infection of 1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For viral neutralization, Huh7 cells (for MERS-CoV S pseudotyped virus) or stable 293T cells expressing ACE2 (Crawford et al., 2020) (for SARS-CoV S and SARS-CoV-2 S pseudotyped viruses) in DMEM supplemented with 10% FBS, 1% PenStrep were seeded at 40,000 cells/well into clear bottom white walled 96-well plates and cultured overnight at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>293T</div><div>suggested: RRID:CVCL_H376)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Identification of the B6 broadly neutralizing mAb: Ten-week-old CD-1 mice were injected twice with 50 µg of MERS-CoV S formulated with Adjuplex at weeks 0 and 2 and once with 50 µg of SARS-CoV S formulated with Adjuplex at week 8 at the Fred Hutchinson Cancer Research Center Antibody Technology Resource.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The MERS-CoV S EM structure in complex with 5-N-acetyl neuraminic acid (PDB 6Q04, residue 18-1224) and the B6-MERS-CoV11 (residue 1230-1240) crystal structure were fit into the cryoEM map.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6-MERS-CoV11</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Percentage of infectivity was calculated as the ratio of luciferase readout in the presence of mAbs normalized to luciferase readout in the absence of mAb, and half maximal inhibitory concentrations (IC50) were determined using 4-parameter logistic regression (GraphPad Prism v8.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the high resolution map, particle images were subjected to Bayesian polishing (Zivanov et al., 2019) before performing non-uniform refinement, defocus refinement and non-uniform refinement again in cryoSPARC (Punjani et al., 2017).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">CryoEM model building and analysis: UCSF Chimera (Pettersen et al., 2004) and Coot (Emsley et al., 2010) were used to fit atomic models into the cryoEM maps.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Models were analyzed using MolProbity (Chen et al., 2010), EMringer (Barad et al., 2015), Phenix (Liebschner et al., 2019) and privateer (Agirre et al., 2015) to validate the stereochemistry of both the protein and glycan components.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MolProbity</div><div>suggested: (MolProbity, RRID:SCR_014226)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 20. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/short/2020.12.29.424482
biorxiv.org biorxiv.org

http://biorxiv.org/cgi/content/short/2020.12.29.424711

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.12.29.424711: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant antigen and control antibodies: For expression of the RBD subdomain of the SARS-CoV-1 (residues Arg306 to Phe527) and SARS-CoV-2 (residues Arg319 to Phe541) spike protein and human ACE2, genes encoding the proteins were synthesised and cloned upstream of either an Fc tag or rCD4-Avi tag, both with an additional 6 × His tag in mammalian expression vectors (37).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phe527</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Phe541</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VH and VL sequences of SARS-CoV-2 control antibodies (COV2-2196, COV2-2130, S309, B38, H4, and CR3022) were obtained from the CoV-AbDab database (25) and cloned into pINT3/pINT54 IgG expression vectors (4) as synthetic gene fragments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COV2-2130</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>H4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To identify unique combinations of heavy CDR3 and light CDR3, antibody frameworks and CDR regions were annotated and analysed using Geneious Biologics (Biomatters).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>light CDR3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 RBD-ACE2 blocking assay: Black 96-well immune plates (Thermo Scientific, 10030581) were coated with mouse anti-rCD4 antibody (Bio-Rad, MCA1022R) at 4 °C overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rCD4</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To identify antibodies that could block the interaction between RBD and ACE2, the anti-SARS-CoV-2 antibodies were pre-incubated with 2 nM of recombinant ACE2-Fc-His-Biotin for 30 minutes before transferring to the RBD-coated plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein expression and purification for crystallography studies: The Fab fragments for anti-SARS-CoV-2 antibodies ION_300 and ION_360 and SARS-CoV-2 receptor binding domain (RBD) were expressed in Expi293F™ cells (Thermo Fisher, A14527).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 receptor binding domain ( RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibody:RBD complexes were mixed and co-purified by size exclusion chromatography in 20 mM Tris-HCl (pH 7.5) and 50 mM NaCl.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody:RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Both complex crystal structures were solved by molecular replacement using Phaser (46) utilising the coordinates from the SARS-CoV-2 RBD domain (PDB: 7JMP) and using homology models for ION_300 and ION_360 antibodies generated using SWISSMODEL (47) to model the heavy and light chains.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ION_360</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Detailed materials and methods for library construction, neutralisation assays and biophysical characterisation of anti-SARS-CoV-2 antibodies. Fig. S1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Superposition of antibody and nanobody structures targeting the SARS-CoV-2 RBD. Fig. S7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">VH germline usage in convergent antibody response. Fig. S9.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S9</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralisation assays and combination testing: Briefly, a lentiviral pseudotyped virus was used for the infection of HEK293T/17 cells transiently expressing human ACE2 and TMPRSS2 for the pseudoviral assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T/17</div><div>suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reagents cat. no. 100980) was used to infect VERO CCL-81 cells for the authentic virus neutralisation assay.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VERO CCL-81</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For single concentration pseudovirus assay, SPR, and cross-reactivity evaluation, the antibodies expressed in 96 well plates (Expi293 cells) were purified by protein-A affinity chromatography (Generon, PC-A100), using 96 well filter plates (Whatman Polystyrene Unifilter Microplates, GE Healthcare, 11313535)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Atomic models were built using Coot (48) and refined with Refmac (49).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/short/2020.12.29.424711
biorxiv.org biorxiv.org

http://biorxiv.org/cgi/content/short/2020.12.07.414706

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.12.07.414706: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Intravenous viral administration in vivo: The animal protocol was approved by the University of South Carolina IACUC committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Male wild type C57BL/6J mice (5-6 weeks old) were intravenously administered 100 μl of Spp or VSV-G lentivirus (8×108 of viral particles) via tail venous or retro-orbital injection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-Spike S1 subunit, anti-low density lipoprotein receptor (LDLR), anti-mannose receptor C-type 1 (MRC1), anti-CD68 and anti-human immunodeficiency viruses (HIV)-1 p24 antibodies were obtained from Novus Biologicals (Littleton, CO, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Spike S1 subunit, anti-low density lipoprotein receptor (LDLR), anti-mannose receptor C-type 1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>MRC1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD68</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human immunodeficiency</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HIV)-1 p24</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The anti-His tag antibodies were obtained from Proteintech (Rosemont, IL, USA) and Thermo Fisher (Waltham, MA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>The anti-His tag antibodies</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-His tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-Spike S1 subunit, anti-HIV-1 p24 antibody, or anti-His antibodies were used to detect the expression of viral proteins and followed by HRP-labeled secondary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Spike S1 subunit,</div><div>suggested: (Active Motif Cat# 91345, RRID:AB_2847847)</div></div><div style="margin-bottom:8px"><div>anti-HIV-1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RAW264.7 cell culture, viral uptake and electroporation: Macrophage-like RAW264.7 (RAW) cells (ATCC® TIB-71™) were cultured in DMEM (10% FBS) medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RAW264.7</div><div>suggested: ATCC Cat# TIB-71, RRID:CVCL_0493)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In a parallel experiment, RAW cells (5×106) were electroporated with pcDNA3.1, EGFP-N2 or pcDNA-Spike plasmids (10 μg) using the following parameters: 2 mm gap cuvette, 250 ul sample volume and 120V (BTX Harvard Bioscience, Inc., Holliston, MA, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RAW</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Wild type C57BL/6J mice were purchased from the Jackson Laboratory (Bar Harbor, ME, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: RRID:IMSR_JAX:000664)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were acquired using ImageXpress Pico System (Molecular Device, San Jose, CA, USA) or confocal microscopy system (Carl Zeiss AG, Oberkochen, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageXpress Pico System</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/short/2020.12.07.414706
medrxiv.org medrxiv.org

http://medrxiv.org/cgi/content/short/2021.01.06.20249035

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2021.01.06.20249035: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Data and samples were collected only from voluntary, non-remunerated, adult donors as described previously [27], and who provided written informed consent as part of routine donor selection and blood collection procedures, that were approved by the Ethics Advisory Council of Sanquin Blood Supply Foundation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For anti-RBD IgG1 and IgG3, the calibrator consisted of recombinantly expressed IgG1 and IgG3 monoclonal antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ACE2 was produced in HEK cells with a HAVT20 leader peptide, 10xhis-tag and a BirA-tag as described by Dekkers et al., [28].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">African green monkey (Vero-E6) cells were added in a concentration of 2 × 104 cells per well and incubated for 3 days at 35°C in an incubator with 5% carbon dioxide.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the remaining 676 samples collected between March 30 and August 14, the longitudinal changes in IgG antibody levels were analyzed by linear mixed effects modeling in R (v3.6.0) using the LmerTest package (v3.1.2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>LmerTest</div><div>suggested: (R package: lmerTest, RRID:SCR_015656)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis were carried out using Graphpad Prism 7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  A limitation is the substantial uncertainty in the individual half-life estimates especially at the low end, since the available data will sometimes only cover a fraction of a half-life. Long-term maintenance of antibody production is provided by a pool of long-lived plasma cells and memory B-cells that can last a lifetime [35]. Several time scales may be identified, of which the longest-lasting can have half-lifes in the order of many years, and thus beyond scope of the current study [36]. It will be interesting to continue following the decline of anti-RBD IgG in time and investigate whether the longevity of the antibody response is similar to other coronaviruses, such as SARS-CoV that can still be detected in most individuals 3-years after recovery [37]. The antibody titer required for protection against re-infection in humans is not yet known, and has to be evaluated also in the context of a recall response upon re-infection. Recent studies provide evidence that upon infection, individuals develop SARS-CoV-2 specific memory B and memory T cells that can be detected for up to 240 days, with numbers of IgG memory B cells increasing over time and plateauing after ca. 150 days [20, 38]. The relationship between long-lasting antibody production and the T and B cell memory compartments requires more investigation. We also quantitatively examined the IgG1 and IgG3 subclass response and found that in our study population IgG1 appeared to be by far the dominant IgG subtype. This i...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/short/2021.01.06.20249035
biorxiv.org biorxiv.org

http://biorxiv.org/cgi/content/short/2021.01.13.426436

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2021.01.13.426436: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Animals received free access to food and water and were handled according to the approved protocols of the Animal Committee of Osaka University (Suita, Osaka, Japan) as No.28-021-028, the Ethics Committee for Animal Experiments of the Safety Research Institute for Chemical Compounds Co. Ltd. (Sapporo, Hokkaido, Japan) as No. AN20200617-03 and the Animal Committee of KAC Co. Ltd. (Kusatsu, Shiga, Japan) as No. 20–0508.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animals: The rat study was performed using 7-week-old male Crl:CD (SD) rats (Charles River Laboratories Japan Inc., Kanagawa, Japan).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All wells were washed with PBST (200 μl/well) seven times, and incubated with 1:1000 diluted Amersham ECL anti-rat IgG horseradish peroxidase-linked species-specific whole antibody (NA935, GE Healthcare UK Limited, UK) or Amersham ECL anti-mouse IgG horseradish peroxidase-linked species-specific whole antibody (NA931, GE Healthcare UK Limited, UK) in the blocking buffer for 3 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rat IgG</div><div>suggested: (GE Healthcare Cat# NA935, RRID:AB_772207)</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (GE Healthcare Cat# NA931, RRID:AB_772210)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After serum incubation, the serum samples were removed and IgG subtypes were detected using the following HRP-conjugated antibodies for 3 h at room temperature; anti-IgG1 H&L (ab106753; Abcam), anti-IgG2a H&L (ab106783; Abcam).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IgG1</div><div>suggested: (Abcam Cat# ab106753, RRID:AB_10859102)</div></div><div style="margin-bottom:8px"><div>anti-IgG2a</div><div>suggested: (Abcam Cat# ab106783, RRID:AB_10866498)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2 binding inhibition assay: To analyze the binding inhibition of S1+S2 and ACE2 by neutralizing antibodies in the immunized rat and mouse serum, 96-well plates were coated with human ACE2 recombinant protein (1μg/ml, mFc tag; #83986, Cell Signaling Technology), and then blocked using PBS containing 5% skim milk for 2 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Wells were washed with PBST and then incubated with anti-His antibody conjugated with HRP (GTX21187, GeneTex, Inc., Irvine, CA) for 2 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sixteen weeks after the first administration, sera were collected from immunized mice and tested for antibody induction against 2019-nCoV spike protein (S1+S2) and the RBD region of the spike protein, as well as for the inhibition of binding to the recombinant hACE2 protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>2019-nCoV spike protein (S1+S2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, Vero E6 cells stably expressing TMPRSS2 were seeded on 96-well plates and incubated at 37 °C for 24 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The homogenate solution was serially diluted 10 folds in DMEM containing 2% FBS and loaded on VeroE6/TMPRSS2 cells to determine the value.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6/TMPRSS2</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mouse study was performed using 8-10 weeks old C57BL/6NCrSlc mice (C57BL/6N) (Japan SLC,Inc.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6NCrSlc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>C57BL/6N</div><div>suggested: RRID:MGI:5651595)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA: Precisely 1 μg/ml of recombinant 2019-nCoV spike protein (S1+S2) (ECD, His tag) (BLPSN-0986P, BETA Life Sciences, Fairfield, NJ, USA) was immobilized on a 96-well plate (442404, MAXISORP F96 NUNC Immuno-plate, Thermo Fisher Scientific, Roskilde, Denmark) at 4 °C overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BETA</div><div>suggested: (BETA, RRID:SCR_007556)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Percentage inhibition of immunized blood serum at various time points was calculated and plotted using GraphPad Prism software, from which the neutralization titer at ID75 was derived.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/short/2021.01.13.426436
biorxiv.org biorxiv.org

http://biorxiv.org/cgi/content/short/2021.01.07.425806

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2021.01.07.425806: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Yeast scFv display levels were evaluated prior to sorting (data not shown) by incubating the yeast with a 1:1000 dilution of Chicken anti C-MYC Epitope Tag Primary Antibody from Exalpha Biologicals Inc. (Catalog No. ACMYC), followed by incubation with a 1:1000 dilution of Goat anti-Chicken IgY (H+L) Cross Adsorbed Secondary Antibody, Alexa Fluor Plus 647 from Thermo Fisher Scientific (Catalog No. A32933) RBD antigen binding during selection rounds 3 and 5 was evaluated using a 1:1000 dilution of rabbit anti-His FITC secondary antibody (Bethyl Laboratories).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti C-MYC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Chicken IgY</div><div>suggested: (Thermo Fisher Scientific Cat# A32933, RRID:AB_2762845)</div></div><div style="margin-bottom:8px"><div>anti-His FITC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After a baseline step in assay buffer, RBD-coated biosensors were dipped in a 300 nM solution of ACE2 or assay buffer for 5 min before being dipped in a 100 nM solution of a given antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant protein expression and purification: IgGs, ACE2-huFc-Avi, and coronavirus RBDs were expressed and purified from Expi293F cells cultured in 33% Expi293 Expression / 66% FreeStyle Expression medium (Thermo Fisher Scientific) and grown in baffled polycarbonate shaking flasks (Triforest) at 37 °C and 8% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293F</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 6 x 106 HEK293T cells cultured in D10 medium (DMEM, 10% fetal bovine serum (Gemini Bio-Products), 2 mM L-glutamine, 1% penicillin/streptomycin, and 10 mM HEPES [pH 7.0]) were transfected at ~50-70% confluency using calcium phosphate transfection20 with 5 lentiviral production plasmids: pHAGE_Luc packaging vector (10 μg), full-length SARS-CoV-2 spike (3.4 μg), HDM-Hgpm2 (2.2 μg), PRC-CMV-Rev1b (2.2 μg), and HDM-tat1b (2.2 μg)30.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HeLa cells overexpressing ACE219 were plated at 5,000 cells per well in clear-bottom white-walled 96-well plates 1 day prior to infection in D10 medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Medium was removed from HeLa/ACE2 cells and replaced with virus/inhibitor mixtures which were then incubated for 48 h at 37 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa/ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding curves were fit using the “association then dissociation” equation in GraphPad Prism 8.4.1 to calculate KD.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/short/2021.01.07.425806
biorxiv.org biorxiv.org

http://biorxiv.org/cgi/content/short/2021.01.09.426032

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2021.01.09.426032: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: For use of patient serum ethical approval was granted by the Ethics Committee at the Medical Faculty of LMU Munich (vote 20-225 KB) in accordance with the guidelines of the Declaration of Helsinki.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Vaccination experiments in mice: Female BALB/c mice (6 to 10 week-old) were purchased from Charles River Laboratories (Sulzfeld, Germany).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The blots were blocked in a phosphate buffered saline (PBS) buffer containing 5% Bovine Serum Albumin (BSA) (Sigma-Aldrich, Taufkirchen, Germany) and 0.1% Tween-20 (Sigma-Aldrich, Taufkirchen, Germany) and incubated for 60 min with primary antibody, monoclonal anti-HAtag antibody (1:8000; HA Tag mAb 2-2.2.14, Thermo Fisher Scientific, Planegg, Germany) or COVID-19 patient serum (1:200).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HAtag</div><div>suggested: (InvivoGen Cat# ab-hatag, RRID:AB_391833)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Permeabilized cells were probed with a monoclonal antibody against the HA-tag epitope (1:1000; HA Tag mAb 2-2.2.14, Thermo Fisher Scientific, Planegg, Germany) to detect SARS-2-S protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HA-tag epitope</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Non-permeabilized cells were stained with a mouse monoclonal antibody obtained against the S protein of SARS-CoV-1 (SARS-1-S; 1:200; GeneTex) before fixation with PFA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-1-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Polyclonal goat anti-mouse secondary antibody (1:1000; Life Technologies, Darmstadt, Germany) was used to visualize S-specific staining by red fluorescence.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Surrogate virus neutralization assay (sVNT): To test for the presence of neutralizing anti-SARS-CoV-2-S serum antibodies we used surrogate virus neutralization test as described before with slight modifications (25).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were extensively washed with phosphate-buffered saline/0.05% Tween-20 (PBST), followed by incubation for 1h at 37°C with an HRP-conjugated anti-His-tag antibody (1.2 μg/ml; clone HIS 3D5).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His-tag</div><div>suggested: (MBL International Cat# M136-3, RRID:AB_11125943)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To remove background effects, the mean percentage of inhibition from non-specific mouse serum (Invitrogen) was deducted from sample values and neutralizing anti-SARS-CoV2-S antibodies titres were determined as serum dilution that still had binding reduction > mean + 2 SD of values from sera of vehicle-treated mice.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV2-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation, we fixed the cells with 4% formaldehyde/phosphate-buffered saline (PBS) and stained the cells with polyclonal rabbit anti-SARS-CoV antibody (Sino Biological, https://www.sinobiological.com) and a secondary peroxidase-labeled goat anti-rabbit IgG (Dako, https://www.agilent.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human A549 cells (ATCC® CCL-185™) (LGC standards) were maintained in DMEM with high glucose and 10% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The replicative capacity of recombinant MVA was tested in multi-step-growth experiments on monolayers of DF-1, HaCat, HeLa or A549 cells grown in 6-well-tissue-culture plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HaCat</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western Blot analysis of recombinant protein: To monitor production of the recombinant SARS-2-S protein, DF-1 cells were infected at MOI 10 with recombinant or non-recombinant MVA or remained uninfected (mock).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DF-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunostaining of recombinant SARS-2-S protein: Vero cells were infected with 0.05 MOI MVA-SARS-2-S or non-recombinant MVA and incubated at 37 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We then added 50 μL of virus suspension (400 plaque-forming units) to each well and incubated at 37°C for 1 h before placing the mixtures on Vero-E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cytopathic effects (CPE) on VeroE6 cells (ATCC CRL1586) were analyzed 4 days after infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vaccination experiments in mice: Female BALB/c mice (6 to 10 week-old) were purchased from Charles River Laboratories (Sulzfeld, Germany).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation, we fixed the cells with 4% formaldehyde/phosphate-buffered saline (PBS) and stained the cells with polyclonal rabbit anti-SARS-CoV antibody (Sino Biological, https://www.sinobiological.com) and a secondary peroxidase-labeled goat anti-rabbit IgG (Dako, https://www.agilent.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.sinobiological.com</div><div>suggested: (Sino Biological, RRID:SCR_003697)</div></div><div style="margin-bottom:8px"><div>https://www.agilent.com</div><div>suggested: (Agilent Technologies, RRID:SCR_013575)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, cells were permeabilized using Intracellular Staining Permeabilization Wash Buffer (Perm Wash buffer; Biolegend; dilution 1:10), and stained intracellularly in 100 μl/well of anti-mouse IFN-γ (clone XMG1.2, 1:200, Biolegend) plus anti-mouse TNF-α (clone MP6-XT22, 1:200, Biolegend) diluted in Perm Wash buffer for 30 min at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Biolegend</div><div>suggested: (BioLegend, RRID:SCR_001134)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For each antibody, single colour controls were prepared using OneComp eBeads™ Compensation Beads (eBioscience, Thermo Fisher Scientific) and cells for the viability dye Zombie Aqua.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>OneComp</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was acquired by the MACSQuant VYB Flow Analyser (Miltenyi Biotec) and analyzed using FlowJo (FlowJo LLC, BD Life Sciences, Ashland, OR, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Data were prepared using GraphPad Prism version 5 (GraphPad Software Inc., San Diego CA, USA) and expressed as mean ± standard error of the mean (SEM).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/short/2021.01.09.426032
medrxiv.org medrxiv.org

http://medrxiv.org/cgi/content/short/2021.01.04.20248897

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2021.01.04.20248897: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study Approval: This study was approved by the Ethics Committees of Centro Hospitalar e Universitário de Coimbra (CHUC-084-20).<br>Consent: Participants signed an informed consent form, according to the Helsinki principles, the Oviedo Convention and according to the General Data Protection Regulation – Regulation (EU) 2016/679.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">The investigators were blinded to sample allocation during experiments.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Among the negative subjects, the median cohort age was 37.5 years (21-60 years), 9/19 (47%) were male, and 10/19 (53%) were female.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After a washing step, 100 μL anti-human IgG antibody conjugated with horseradish peroxidase (Sigma-Aldrich) diluted at 1:5000 was added and the plates were incubated at 37 °C for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>100 μL anti-human IgG antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nucleocapsid-His recombinant Protein (YP_009724397.2(335Gly/Ala)) (Met1-Ala419) expressed in Baculovirus-Insect Cells with a polyhistidine tag at the C-terminus (Reference 40588-V08B); Spike protein S1 Subunit (YP_009724390.1) (Val16-Arg685) expressed in HEK293 Cells with a polyhistidine tag at the C-terminus (Reference 40591-V08H); Spike protein Receptor Binding Domain (RBD) (YP_009724390.1) (Arg319-Phe541) expressed in HEK293 Cells with a polyhistidine tag at the C-terminus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Negative SARS-CoV-2 group (n=19) included subjects with a negative qRT-PCR performed following risk-contact tracking and monitored by IgG serology (Alinity i, Abbott).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were acquired in a LSRFortessa™ flow cytometer (BD Biosciences CA, USA) using the FACSDiva™ software v8.0 (BD Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FACSDiva™</div><div>suggested: (BD FACSDiva Software, RRID:SCR_001456)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Microsoft Excel v.14.1.0</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/short/2021.01.04.20248897
biorxiv.org biorxiv.org

http://biorxiv.org/cgi/content/short/2021.01.13.426537

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2021.01.13.426537: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) anti-mouse antibody was used to recognize VHH (4A12E6: Invitrogen Rockford, USA) followed by probing with anti-mouse IgG raised in goat (A3562: 1ml Sigma, USA) and conjugated with alkaline phosphatase for the development of the blot.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Sigma-Aldrich Cat# A3562, RRID:AB_258091)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The blocked PVDF membrane was probed with the sdAb (having both 6x(HIS)-tag and biotin-tag) and then monoclonal anti-6x(HIS)-tag antibody was probed followed by detection with anti-mouse IgG conjugated with alkaline phosphatase (A3562: 1ml Sigma, USA) was used for developing the blots.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-6x(HIS)-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Since the spike construct contains the Flag tag, immunoblotting was performed to detect the presence of spike protein in supernatant collected 24 hours post transduction as well as in cell lysate of 72 hours post transduced Vero E6 cells using anti-flag mouse antibody (F1804-50UG, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-flag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A secondary antibody anti-mouse IgG raised in goat and conjugated with alkaline phosphatase was used for the development of the blot.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detection of sdAb, anti-6x(HIS) antibody was incubated for 1 hr at RT followed by washing and incubation with anti-mouse antibody conjugated with alkaline phosphatase for 1.5 hrs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-6x(HIS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Biolayer interferometry (BLI): BLI was performed to determine the binding kinetics of anti-CS and anti-RBD antibody with the purified spike protein produced from transfected HEK293T cells (S construct with 3x FLAG-tag) using BLltz System.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Different concentrations of S protein were incubated for 5 minutes to measure the binding affinity with the immobilised anti-CS and anti-RBD antibodies, and their dissociation kinetics was measured in PBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TG1 cells were then infected with helper phage M13K07 under static conditions at 30°C for 40 mins.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Above mixture was kept at RT for 15 minutes and co-transfected in HEK239T cells (Human Embryonic Kidney).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK239T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Modified Vero cells (Vero E6) originated from kidney epithelial cells of African green monkey were used for measuring the internalization using concentrated pseudoviruses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cells infected with bald particles or the LV (VSV-G) pseudovirus particles served as a control for such experiments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry: After 72 hrs of transduction, Vero-E6 cells were treated with 1mM PBS-EDTA for 15 minutes at 37°C in CO2 incubator and the cells were removed from 96 well (flat bottom) plates by reverse pipetting.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Biolayer interferometry (BLI): BLI was performed to determine the binding kinetics of anti-CS and anti-RBD antibody with the purified spike protein produced from transfected HEK293T cells (S construct with 3x FLAG-tag) using BLltz System.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Prediction of B cell epitopes: Linear B cell epitopes were predicted by IEDB database using BepiPred 2.0 server.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BepiPred</div><div>suggested: (BepiPred-2.0, RRID:SCR_018499)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The available data was analysed using flowJo X software (TreeStar)44.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>flowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis and scaling of all the taken images were done using ImageJ software44</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Scanning electron microscopy: Field Emission Scanning Electron Microscope (FESEM) was used to measure the surface topography of LV(CoV2-S) and LV(VSV-G).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Field Emission Scanning</div><div>suggested: (Hitachi S4700 Field Emission Scanning Electron Microscope, RRID:SCR_020019)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analysis were done using Graphpad prism 8.0.2(263).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/short/2021.01.13.426537
medrxiv.org medrxiv.org

http://medrxiv.org/cgi/content/short/2021.01.13.21249429

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2021.01.13.21249429: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Informed consent was obtained from the patient, or next of kin if the patient was unable to give consent.<br>IACUC: All animal experiments were approved by the Uppsala Committee of Ethics of Animal Experiments (approved permit 5.8.18-04862-2020), in accordance with the Swedish Animal Protection Act (SFS 1988:534), and were conducted according to guidelines established by the Swedish Board of Agriculture.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">All experiments were performed in both female and male mice.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lung lysates were immunoprecipitated with a rabbit anti-mouse thrombomodulin antibody (ab230010, Abcam) attached to protein G conjugated Dynabeads (10004D, Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse thrombomodulin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blots were blocked with 5% BSA for 1 h and incubated overnight with mouse anti-6X His tag antibody (27E8, 2366, Cell Signaling).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-6X</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing and incubating with anti-mouse HRP conjugated secondary antibody (NA931, Sigma), proteins were visualized using ECL plus detection reagents (GERPN2232, Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse HRP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GERPN2232</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blots were stripped with Re-Blot Plus Strong solution (2504, Millipore), blocked, and probed with anti-thrombomodulin antibody followed by anti-rabbit HRP conjugated secondary antibody (711-035-152, Jackson Immuno Research).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-thrombomodulin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit HRP</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 711-035-152, RRID:AB_10015282)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Total thrombomodulin in lung lysates was done as above and correlated to loading control, anti-Gapdh HRP conjugated antibody (ab9482, Abcam).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Gapdh HRP</div><div>suggested: (Abcam Cat# ab9482, RRID:AB_307272)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice for other experiment came from in house breeding on a C57BL6/J background.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL6/J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Band density was quantified with ImageJ (NIH).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analysis was done in GraphPad Prism 8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  One limitation of our assay is that the measured APC levels were close to the detection limit, hence, possible differences between groups would not be detected. In contrast, a recent study did not find changes in APC in critically ill COVID-19 patients (36). However, reduced levels of APC are found in a majority of patients in sepsis and are associated with increased risk of death (42-45). APC formation may be impaired because of down-regulation or shedding of thrombomodulin induced by inflammatory cytokines (46), and, as we hypothesize herein, by ANGPT2 binding to thrombomodulin. Recent data show that circulating thrombomodulin was elevated in critically ill COVID-19 patients, suggesting shedding of thrombomodulin from the endothelium (15, 36). Furthermore, Goshua et al, reported that soluble thrombomodulin correlates with mortality in critically ill COVID-19 patients (36). In the current study, we noted that injection of ANGPT2 in mice resulted in the loss of thrombomodulin in lung tissue (Fig. 3). Further studies are needed to investigate if this is a direct or indirect effect of ANGPT2. To investigate if ANGPT2 can directly affect coagulation in vivo, we performed several experiments in mice. One simple but highly relevant experiment to evaluate coagulation is tail bleeding time (47). In these experiments, recombinant ANGPT2 and ANGPT1 fragments corresponding to the thrombomodulin and TIE2 binding region were injected before the measurement of tail bleeding time. These ex...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/short/2021.01.13.21249429
biorxiv.org biorxiv.org

http://biorxiv.org/cgi/content/short/2021.01.19.427256

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2021.01.19.427256: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 spike S1 antibody (40150-R007), SARS-CoV-2 (2019-nCoV) Spike S1-His Recombinant Protein (40591-V08B1), MERS-CoV Spike/S1 Protein (S1 Subunit, aa 1-725, His Tag) (40069-V08H) were purchased from Sino Biological (China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>40069-V08H</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 5 and 7. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/short/2021.01.19.427256
biorxiv.org biorxiv.org

http://biorxiv.org/cgi/content/short/2021.01.19.427324

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2021.01.19.427324: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Protection against wild-type SARS-CoV-2 in mice: Male and female heterozygous K18-hACE C57BL/6J mice were housed in groups of up to 5 mice per cage at 18 to 24°C ambient temperatures and 40 to 60% humidity.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The bound antibodies were detected using goat anti-human IgG conjugated with horseradish peroxidase (HRP) (Southern Biotech, cat. 2040-05, lot B3919-XD29, 1:5,000 dilution) and a 3,3′,5,5′-tetramethylbenzidine (TMB) substrate (Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (SouthernBiotech Cat# 2040-05, RRID:AB_2795644)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plates were incubated sequentially with 1 μg/mL of rCR3022 anti-S antibody or an murine anti-SARS-COV-2 mAb, SARS2-16 (hybridoma supernatant diluted 1:6,000 to a final concentration of ∼20 ng/mL) and then HRP-conjugated goat anti-human IgG (Sigma-Aldrich, A6029) in PBS supplemented with 0.1% (w/v) saponin (Sigma) and 0.1% BSA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-COV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant human ACE2 with a C-terminal Flag tag peptide was added to wells at 2 μg/mL in a 5 μL per well volume (final 0.4 μg/mL concentration of human ACE2) without washing of antibody and then incubated for 40 min at ambient temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed and bound human ACE2 was detected using HRP-conjugated anti-Flag antibody (Sigma-Aldrich, cat.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Flag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To verify escape from antibody selection, isolated viruses were assessed in a subsequent RTCA experiment in the presence of 10 μg/mL (COV2-2676) and 100 µg/mL (COV2-2489) of mAb as used for the escape virus selection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COV2-2676</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A suspension of 18,000 Vero-E6 cells in 50 μL of cell culture medium was seeded in each well, and the plate was placed on the analyzer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Triplicate wells containing virus only (maximal CPE in the absence of mAb) and wells containing only Vero cells in medium (no-CPE wells) were included as controls.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mixture was added to pre-chilled Vero or Vero+ACE2+TMPRSS2 cells at an MOI of 0.005 and incubated at 4°C for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero+ACE2+TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A plasmid encoding cDNA for each spike protein mutant was transfected into HEK-293T cells and allowed to express for 22 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A suspension of 18,000 Vero E6 cells in 50 μL of cell culture medium was seeded per each well, and plates were placed on the analyzer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protection against wild-type SARS-CoV-2 in mice: Male and female heterozygous K18-hACE C57BL/6J mice were housed in groups of up to 5 mice per cage at 18 to 24°C ambient temperatures and 40 to 60% humidity.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The samples were then analyzed by Eve Technologies Corporation (Calgary, AB, Canada).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AB</div><div>suggested: RRID:BDSC_203)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">EC50 values for binding were determined using Prism v.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 50 μL of cell culture medium (DMEM supplemented with 2% FBS) was added to each well of a 96-well E-plate using a ViaFlo384 liquid handler (Integra Biosciences) to obtain background reading.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Integra Biosciences</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image processing was performed using the cryoSPARC software package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed twice and fixed with 4% PFA prior to detection of fluorescence signal by flow cytometry (MacsQuant) and analysis using FlowJo software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Specific primers and probe were used: Forward primer: ATGCTGCAATCGTGCTACAA; Reverse primer: GACTGCCGCCTCTGCTC; Probe: /56-FAM/TCAAGGAAC/ZEN/AACATTGCCAA/3IABkFQ/.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GACTGCCGCCTCTGCTC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For analysis of mouse studies, the comparison of weight-change curves was performed using a one-way ANOVA with Dunnett’s post hoc test using Prism v.9.0 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/short/2021.01.19.427324
biorxiv.org biorxiv.org

http://biorxiv.org/cgi/content/short/2021.01.15.426463

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2021.01.15.426463: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Polyclonal rabbit anti-S1 antibody (Sinobiological, Cat: 40592-T62) and anti-S2 antibody (Abcam, Cat: ab272504) were used as primary antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed 3 × with PBS-BSA-0.5% then incubated for 1h at RT with secondary antibodies conjugated with Alexafluor488 diluted at 1:1000 in PBS-BSA 0.5% (for ChAdOx1 nCov-19 serum staining Goat Anti mouse AlexaFluor 488 (Life Tech A11029)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti mouse</div><div>suggested: (Thermo Fisher Scientific Cat# A-11029, RRID:AB_2534088)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Isolation of human monoclonal antibodies from peripheral B cells by spike-specific single B cells sorting: To isolate Spike-specific B cells, PBMCs were labelled with recombinant trimeric spike-twin-Strep and stained with antibody cocktail consisting of CD3-FITC, CD14-FITC, CD56-FITC, CD16-FITC, IgM-FITC, IgA-FITC, IgD-FITC, IgG-BV786, CD19-BUV395 and Strep-MAB-DY549 (iba) to probe the Strep tag of spike.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG-BV786</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD19-BUV395</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western blot analysis: Protein pellets from the HEK293F cell lysates were loaded onto an SDS-PAGE gel, then transferred to a PVDF membrane.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FACS analysis for cell surface spike expression: Hela S3 cells at 4 ×105 cell/ml were infected with 10 MOI ChAdOx1 nCoV-19 and incubated at 37°C for 40-48h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Hela S3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids encoding heavy and light chains were then co-transfected into the 293T cell line by the polyethylenimine method (408727; Sigma), and antibody were harvested for further study.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1.6×105 of U2OS or HeLa cells resuspended in 2 ml of DMEM 10% FBS, Pen/Strep were seeded on top of the grids in, in 6 well plate wells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>U2OS</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analysed using FlowJo v9 (TreeStar).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tilt series were acquired using SerialEM (44) at a pixel size of 2.13 Å.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Movies were subsequently gain normalised during motion correction and Fourier cropped back to physical pixel size with MotionCor2 (46).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MotionCor2</div><div>suggested: (MotionCor2, RRID:SCR_016499)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A representative glycoform presented at each site was modelled on to the N-linked carbohydrate attachment sites in Coot (50).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mass spectrometry raw files have been deposited in the MassIVE proteomics database (DOI: XXX).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MassIVE</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/short/2021.01.15.426463
doi.org doi.org

https://doi.org/10.1101/2020.04.21.053017

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.04.21.053017: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western analysis was performed on 8% SDS-PAGE and PA antibody GTX125932 (GeneTex) FluPol in vitro activity assays: The subunits of the A/WSN/33 (H1N1) influenza virus FluPol with a Tandem Affinity Purification (TAP)-tag at the C-terminus of PB2 (pcDNA3-PB1, pcDNA3-PB2-TAP, pcDNA3-PA) were expressed in HEK 293T cells and purified as heterotrimeric complex using IgG sepharose chromatography as described previously(29).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PA</div><div>suggested: (GeneTex Cat# GTX125932, RRID:AB_11175740)</div></div><div style="margin-bottom:8px"><div>H1N1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA3-PB1 , pcDNA3-PB2-TAP , pcDNA3-PA </div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>pcDNA3-PB2-TAP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plaque assays were performed on MDCK cells in MEM containing 0.5% FCS with a 1% agarose overlay and grown for 2 days at 37 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MDCK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western analysis was performed on 8% SDS-PAGE and PA antibody GTX125932 (GeneTex) FluPol in vitro activity assays: The subunits of the A/WSN/33 (H1N1) influenza virus FluPol with a Tandem Affinity Purification (TAP)-tag at the C-terminus of PB2 (pcDNA3-PB1, pcDNA3-PB2-TAP, pcDNA3-PA) were expressed in HEK 293T cells and purified as heterotrimeric complex using IgG sepharose chromatography as described previously(29).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">FAV00A-treated A549 cell extracts: Approximately 106 A549 cells treated with FAV00A in DMEM containing 10% FCS were lysed through sonication in 40 μl buffer A (10 mM HEPES-NaOH, pH 7.5, 0.1% NP-40, 150 mM NaCl, 5% glycerol, and 1 mM DTT) for 10 seconds.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analysed using ImageJ and Prism 8 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.04.21.053017
doi.org doi.org

SARS-CoV-2 specific antibody responses in COVID-19 patients

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.03.18.20038059: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the incubation, the cells were fixed and stained with polyclonal rabbit anti-SARS-CoV antibody (Sino Biological).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antigen-specific antibodies were detected using peroxidase-labeled rabbit anti– human IgG (Dako, https://www.agilent.com) and TMB as a substrate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antigen-specific</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum Samples: Protein expression: The spike ectodomains of SARS-CoV-2 (residues 1–1,213; strain Wuhan-Hu-1; GenBank: QHD43416.1), SARS-CoV (residues 1–1,182; strain CUHK-W1; GenBank: AAP13567.1) and MERS-CoV (residues 1-1262; strain EMC; GenBank: YP_009047204.1) were expressed in HEK-293T cells with a C-terminal trimerization motif and Strep-tag using the pCAGGS expression plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: CCLV Cat# CCLV-RIE 1018, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Likewise, the SARS-CoV-2 S1 subunit or its subdomains (S;S1, residues 1-682; S1A, residues 1-294; RBD, residues 329-538; GenBank: QHD43416.1) were expressed in 293T cells as described in (Chunyan Wang et al., submitted manuscript;</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following incubation, the mixtures were added on Vero-E6 cells and incubated at 37°C for 1 more hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The PRNT for the German sera was done as described previously using Vero E6 cells (Wölfel et al submitted manuscript, doi:https://doi.org/10.1101/2020.03.05.20030502) (10).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antigen-specific antibodies were detected using peroxidase-labeled rabbit anti– human IgG (Dako, https://www.agilent.com) and TMB as a substrate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.agilent.com</div><div>suggested: (Agilent Technologies, RRID:SCR_013575)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: The correlations between antibody responses detected by different ELISAs were and those detected by PRNT, as the gold standard for CoV serology, were analyzed using GraphPad Prism version 8 (https://www.graphpad.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.03.18.20038059
biorxiv.org biorxiv.org

http://biorxiv.org/cgi/content/short/2020.09.17.302232

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.09.17.302232: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">To calculate the technical variance, we normalized the UMI count by converting it to UMIs per million, then randomly chose 400 cells from each fixation method and used the 1,000 most highly expressed non-mitochondrial genes to calculate the mean and squared coefficient of variation.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing and blocking the cells in PBS supplemented with 4% BSA, staining was performed with an anti-KSHV K8.1 antibody (sc-65446, Santa Cruz, 1:50 dilution) and an Alexa Fluor 488-conjugated goat-anti-mouse secondary antibody (A10667, Life Technologies, 1:4000 dilution) in PBS/1% BSA supplemented with RNase inhibitor, murine (NEB).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-KSHV K8.1</div><div>suggested: (Advanced Biotechnologies Cat# 13-213-100, RRID:AB_1929220)</div></div><div style="margin-bottom:8px"><div>goat-anti-mouse</div><div>suggested: (Electron Microscopy Sciences Cat# 815.022, RRID:AB_2629849)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: HEK293T (ATCC) cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% (v/v</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T.rKSHV.219 cells were generated by infecting HEK293T cells with rKSHV.21924, and selecting with 1 μg/mL puromycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T.rKSHV.219</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The KSHV-positive human PEL cell line BC3 was cultured in Roswell Park Memorial Institute (RPMI) supplemented with 20% (v/v)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BC3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Infection of A549 cells: OC43 (ATCC) were grown and titrated on A549 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293T.rKSHV219 cells were reverse transfected with 0.8 μg plasmid DNA using Lipofectamine2000 (Life Technologies) following the manufacturer’s instructions and seeded in 12 or 24-well plates for analysis by live-cell imaging or qRT-PCR as indicated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T.rKSHV219</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The 3T3 cells (p65−/− 3T3 mouse embryonic fibroblast cells expressing p65-DsRed and H2B-GFP nucleus marker32) were cultured in DMEM supplemented with 10% (v/v) fetal bovine calf serum (HyClone), 1% (v/v) GlutaMAX and 1x P/S. Optimization of RNA extraction condition for fixed and permeabilized cells: BC3 cells were harvested, centrifuged at 300g for 3 min to remove the cell media, and washed once with PBS and 1% BSA (molecular biology grade, Gemini Bio-Products).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>p65−/− 3T3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alignment was performed using STAR aligner (version 2.7.3a) and counted using featureCounts.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STAR</div><div>suggested: (STAR, RRID:SCR_015899)</div></div><div style="margin-bottom:8px"><div>featureCounts</div><div>suggested: (featureCounts, RRID:SCR_012919)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Read subsampling and read mapping: In the FD-seq and methanol fixation comparison experiment, we used samtools view command34 to subsample the output BAM file from Drop-seq tools version 2.3 DetectBeadSynthesisErrors command.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To calculate the proportion of reads mapped to different genomic regions, we used Picard CollectRnaSeqMetrics command on the output BAM file directly from the STAR aligner.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Picard</div><div>suggested: (Picard, RRID:SCR_006525)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To find the enriched KEGG pathways, we uploaded the list of genes that were upregulated in TMEM119 overexpression versus GFP overexpression (log2 fold change > 1, FDR < 0.05) to g:Profiler26.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RNA velocity analysis: The output files of Drop-seq tools DetectBeadSynthesisErrors function were processed with the dropEst pipeline40 to tag spliced and unspliced transcripts, and the results were analyzed with Python velocyto package33.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>dropEst</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data availability: The raw data, metadata and count data are deposited in NBCI’s Gene Expression Omnibus (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gene Expression Omnibus</div><div>suggested: (Gene Expression Omnibus (GEO, RRID:SCR_005012)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/short/2020.09.17.302232
doi.org doi.org

https://doi.org/10.1101/2020.03.26.20042184

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.03.26.20042184: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Serum samples for assay: The protocols were approved by the institutional ethical committee of Beijing You An Hospital, Capital Medical University.<br>Consent: Informed consent was obtained from all the human subjects who participated in the study after the nature and possible consequences of this study had been fully explained and the protocols were approved by the institutional ethical committee.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK 293F cells and CHO cells and culture media were provided by Zhenge Biotech.,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293F</div><div>suggested: RRID:CVCL_6642)</div></div><div style="margin-bottom:8px"><div>CHO</div><div>suggested: CLS Cat# 603479/p746_CHO, RRID:CVCL_0213)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein expression and purification: The full length SRARS-CoV-2 S1 gene (GenBank: QIC53204.1) with C terminal were synthesized by GENEWIZ, China, and inserted into mammalian cell expression vectors with either 6* His tag or fused with human IgG Fc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GENEWIZ</div><div>suggested: (GENEWIZ, RRID:SCR_003177)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.03.26.20042184
doi.org doi.org

https://doi.org/10.1101/2020.04.19.049643

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.03.21.990770: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Study approval: This study received approval from the Research Ethics Committee of Shenzhen Third People’s Hospital, China (approval number: 2020-084).<br>Consent: The Research Ethics Committee waived the requirement informed consent before the study started because of the urgent need to collect epidemiological and clinical data.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA analysis of plasma and antibody binding to RBD, trimeric Spike, and NP proteins: The recombinant RBDs and trimeric Spike derived from SARS-CoV-2, SARS-CoV and MERS-CoV and the SARS-CoV-2 NP protein (Sino Biological, Beijing) were diluted to final concentrations of 0.5 μg/ml or 2μg/ml, then coated onto 96-well plates and incubated at 4°C overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 NP protein (Sino Biological, Beijing)</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The third staining at 4 °C for 30min involved either: Streptavidin-APC (eBioscience) and/or Streptavidin-PE (BD Biosciences) to target the Strep tag of RBD, or anti-his-APC and anti-his-PE antibodies (Abcam) to target the His tag of RBD.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-his-APC</div><div>suggested: (Miltenyi Biotec Cat# 130-101-322, RRID:AB_2800415)</div></div><div style="margin-bottom:8px"><div>anti-his-PE</div><div>suggested: (Miltenyi Biotec Cat# 130-092-691, RRID:AB_1103227)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single B cell PCR, cloning and expression of mAbs: The IgG heavy and light chain variable genes were amplified by nested PCR and cloned into linear expression cassettes or expression vectors to produce full IgG1 antibodies as previously described 29,41.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>full IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The PCR products were purified and cloned into the backbone of antibody expression vectors containing the constant regions of human IgG1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV antibodies (S230 and m396) previously isolated by others 42 were synthesized and sequences verified before expression in 293T cells and purification by protein A chromatography.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HIV-1 antibody VRC01 was a broadly neutralizing antibody directly isolated from a patient targeting the CD4 binding site of envelope glycoprotein 40.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD4 binding site of envelope glycoprotein 40</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were then stained with PE labeled anti-human IgG Fc secondary antibody (Biolegend) at a 1:20 dilution in 50 μl staining buffer at room temperature for 30 minutes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV antibodies (S230 and m396) previously isolated by others 42 were synthesized and sequences verified before expression in 293T cells and purification by protein A chromatography.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK 293T cells without transfection were also stained as background control.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Huh7 cells (ATCC) (approximately 1.5 × 104 per well) were added in duplicate to the virus-antibody mixture.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The isolate was amplified in Vero cell lines to make working stocks of the virus (1 × 105 PFU/ml).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To analyze the mAb neutralizing activities, Vero E6 cells were seeded at 104/well in 96-well culture plates and cultured at 37 °C to form a monolayer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The genes encoding the heavy and light chains of isolated antibodies were separately cloned into expression vectors containing IgG1 constant regions and the vectors were transiently transfected into HEK293T or 293F cells using polyethylenimine (PEI) (Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293F</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Finally, the cells were re-suspended and analyzed with FACS Calibur instrument (BD Biosciences, USA) and FlowJo 10 software (FlowJo, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Half-maximal inhibitory concentrations (IC50) of the evaluated mAbs were determined by luciferase activity 48h after exposure to virus-antibody mixture using GraphPad Prism 6 (GraphPad Software Inc.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The IgG heavy and light chain variable genes were aligned using Clustal W in the BioEdit sequence analysis package (https://bioedit.software.informer.com/7.2/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioEdit</div><div>suggested: (BioEdit, RRID:SCR_007361)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic analyses were performed by the Maximum Likelihood method using MEGA X (Molecular Evolutionary Genetics Analysis across computing platforms).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA X</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.04.19.049643
doi.org doi.org

https://doi.org/10.1101/2020.04.29.20085068

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.04.29.20085068: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Study Approval and Informed Consent Process: The study was conducted under the ethical principles that have their origins in the Declaration of Helsinki.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The plate was incubated with the secondary antibody (1:2000 dilution of Goat Anti-Human IgG HRP and Goat Anti-Human IgM HRP and Goat Anti-Human IgA HRP individually) for 15 minutes at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-Human IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-Human IgA</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The recombinant antigens were expressed in HEK293 cell lines using full length cDNA coding for the respective antigens fused with a hexa histidine purification tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  When it comes to serological tests the main limitations that make them suboptimal tools for diagnosing those who are sick is that it takes time for the development of antibodies after infection. Thus, they may produce a false negative result in individuals who are acutely infected. On the other hand, they can be useful to indicate exposure in individuals who are asymptomatic or were symptomatic but PCR negative or were never tested. Nevertheless, it is important to note that the serological testing should not be used as the sole basis for diagnosis of an acute COVID19 infection. Technology developments truly enable testing for multiple antibodies from small volumes of collected blood. The potential convenience and cost savings that it would bring to laboratory testing cannot be understated. Remote sampling such as with DBS cards, along with telemedicine would help providers to order tests not only in pandemic settings but also can be a great enabler in bringing healthcare costs down. Immediate application of such a platform to do multiplex testing would be in the monitoring of exposure to upper respiratory tract infections. A subset of the NP swab positive individuals are being monitored for antibody levels and symptoms at regular intervals from the time they tested positive. Initial results show that the seroconversion from IgM to IgG which is marked by a reduction in IgM titer might be co-related with recovery since it is accompanied by a negative result in the subsequent N...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.04.29.20085068
biorxiv.org biorxiv.org

https://doi.org/10.1101/2020.07.20.213249

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.07.20.213249: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Serum Samples: Serum samples for sensitivity analyses were obtained from Great Ormond Street Children’s Hospital NHS Foundation Trust (GOSH) and came from three sources; (i) healthcare workers who tested SARS-CoV-2 RT-PCR positive following signs or symptoms of COVID-19 and who gave written consent for participation in the service evaluation of SARS-CoV-2 serological assays, (ii) staff enrolling in a prospective longitudinal cohort study of SARS-CoV-Serology (COSTARS, IRAS 282713, ClinicalTrials.gov Identifier: NCT04380896) who tested positive in a commercial screening assay for anti-Nucleocapsid IgG (Epitope Diagnostics Inc, San Diego, USA) (iii) a small number of RT-PCR positive sera from hospitalised children (</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This serum was calibrated against research reagents NIBSC 20/130 and NIBSC 20/124 distributed by the National Institute for Standards and Biological Control (NIBSC, Potters Bar, UK, https://www.nibsc.org/) for the purpose of development and evaluation of serological assays for the detection of antibodies against SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation for 2 hours with shaking at 700rpm, the plates were washed three times and detection antibody was added at 2 µg/mL (MSD SULFO-TAG™ Anti-Human IgG Antibody).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analysis was performed using MSD Discovery Workbench and GraphPad Prism version 8.0 (GraphPad, San Diego, CA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04380896</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">COVID-19 Staff Testing of Antibody Responses Study (Co-Stars…</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/short/2020.07.20.213249
doi.org doi.org

https://doi.org/10.1101/2020.03.15.992883

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.03.15.992883: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To assess antibody competition, either 240CD or CR3022 or a non-specific control antibody CR1-07 was incubated with the SARS-CoV-2 RBD prior to assessment of binding to CR3022 or 240CD.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DNA encoding the SARS-Cov-2 RBD (residues 331-527) was synthesized (Genscript) with a C-terminal His6 purification tag and cloned into a CMVR plasmid, and protein was expressed by transient transfection in 293F cells for six days.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293F</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.03.15.992883
doi.org doi.org

https://doi.org/10.1101/2020.03.15.991844

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.03.15.991844: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">100μl of HRP anti-His Tag Antibody (BioLegend, USA) (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These two constructs were transfected into HEK293 cells using polyethyleneimine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells, at about 70-90% confluence, were co-transfected with 9 ug of the transfer vector (pLv-CMV), 6 ug packaging plasmid (psPAX-lentiviral), and 6 ug envelope plasmid (pCB-spike or pCB-spikeV367F).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">spike-mediated pseudovirus entry assay: To detect S variants mediated viral entry, VERO E6 and Caco2 cells (5×104) grown in 24-well plates were respectively infected with either 20 MOI of S-V367 or S-F367-bearing pseudovirus (1×107</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alignment of S protein sequences from different sources and comparison of ACE2 proteins among different species were performed using MAFFT version 7, with default parameters (https://mafft.cbrc.jp/alignmeloadnt/server/) and Bioedit[33,34].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Molecular dynamics simulation was performed using GROMACS 2019 with the following options and parameters: explicit solvent model, system temperature 37°C, OPLS/AA all-atoms force field, and LINCS restraints.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GROMACS</div><div>suggested: (GROMACS, RRID:SCR_014565)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.03.15.991844
doi.org doi.org

https://doi.org/10.1101/2020.05.13.093658

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.05.13.093658: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2 expression was detected using mouse anti-S-tag monoclonal antibody (Kyab Biotech Co. Ltd., Wuhan, China), followed by FITC-labelled goat anti-mouse IgG H&L (Abcam, Cambridge Biomedical Campus, Cambridge, UK).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S-tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6, HeLa, and HEK 293T/17 cells (ATCC) were maintained in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T/17</div><div>suggested: ATCC Cat# CRL-11268, RRID:CVCL_1926)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Titers of all viruses used in this study were determined by plaque assays on Vero E6 cells, as previously described (17).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HeLa cells were transfected with the same amount of human or R.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: CLS Cat# 300194/p772_HeLa, RRID:CVCL_0030)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic trees were built by the maximum likelihood method implemented in RAxML program in CIPRES Science Gateway (https://www.phylo.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RAxML</div><div>suggested: (RAxML, RRID:SCR_006086)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.05.13.093658
biorxiv.org biorxiv.org

http://biorxiv.org/cgi/content/short/2020.09.01.278630

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.09.01.278630: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Ethics Statement: Animal studies and related experimental procedures were approved by the University of Melbourne Animal Ethics Committee (#1714193, #1914874).<br>IRB: Human clinical study protocols were approved by the University of Melbourne Human Research Ethics Committee (#2056689), and all associated procedures were carried out in accordance with approved guidelines.<br>Consent: All participants provided written informed consent in accordance with the Declaration of Helsinki.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Eight male macaques (Macaca nemestrina) (6-15 years old) were vaccinated with 100μg of SARS-CoV-2 spike or RBD immunogens formulated with 200μg of Monophosphoryl Lipid A (MPLA) liposomes (Polymun) (Baldrick et al., 2002) intramuscularly in the right quadriceps.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Isolated cells were stained with Aqua viability dye (Thermofisher) and Fc-blocked with a CD16/32 antibody (93; Biolegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD16/32</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then surface stained with S/RBD probes and the following antibodies: B220 BUV737 (RA3-6B2), IgD BUV395 (11-26c.2a), CD45 Cy7APC (30-F11), SA BV786 (BD)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD45</div><div>suggested: (BD Biosciences Cat# 564225, RRID:AB_2716861)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then surface stained with S/RBD probes and the following antibodies: IgD AF488 (polyclonal; Southern Biotech), IgM BUV395 (G20-127), IgG BV786 (G18-145) (BD), CD14 BV510 (M5E2), CD3 BV510 (OKT3), CD8a BV510 (RPA-T8), CD16 BV510 (3G8), CD10 BV510 (HI10a)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD10</div><div>suggested: (BioLegend Cat# 312220, RRID:AB_2563835)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For intracellular transcription factor staining, cells were first stained with Aqua viability dye (Life Technologies), followed by S/RBD probes and surface antibodies: IgD AF488 (polyclonal; Southern Biotech), IgG BV786 (G18-145) (BD), CD14 BV510 (M5E2), CD3 BV510 (OKT3), CD8a BV510 (RPA-T8), CD16 BV510 (3G8), CD10 BV510 (HI10a)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD14</div><div>suggested: (BioLegend Cat# 348805, RRID:AB_2889063)</div></div><div style="margin-bottom:8px"><div>CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>OKT3</div><div>suggested: (BD Biosciences Cat# 566779, RRID:AB_2869862)</div></div><div style="margin-bottom:8px"><div>CD8a</div><div>suggested: (Meridian Life Science Cat# MAL10-078, RRID:AB_1070001)</div></div><div style="margin-bottom:8px"><div>CD16</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometric detection of ex vivo and antigen-specific TFH: For ex vivo TFH quantification from mice, freshly isolated LN single cell suspensions were stained with the following antibodies: Live/dead Red (Life Technologies), CD3 BV510 (145-2C11; Biolegend), PD-1 BV786 (29F.1A12; Biolegend), CXCR5 BV421 (L138D7; Biolegend), CD4 BUV737 (RM4-5; BD), B220 BV605 (RA3-6B2; BD), and F4/80 PE-Dazzle 594 (T45-2342; BD).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen-specific TFH</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>PD-1 BV786</div><div>suggested: (BD Biosciences Cat# 563789, RRID:AB_2738425)</div></div><div style="margin-bottom:8px"><div>B220</div><div>suggested: (BD Biosciences Cat# 563708, RRID:AB_2738383)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Non-human primate LN suspensions and PBMC were stained with the same protocol, using the following antibodies: Live/dead Aqua (Life Technologies), CD3 Alexa700 (SP34-2; BD), PD-1 BV421 (EH12.2H7; Biolegend), CXCR5 PE (MU5UBEE; ThermoFisher), CD4 BV605 (L200; BD), CD20 BV510 (2H7; BD), CD8 BV650 (RPA-T8; Biolegend), CD95 BUV737 (DX2; BD), ICOS PerCP-Cy5.5 (C398.4A; Biolegend)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CXCR5</div><div>suggested: (BD Biosciences Cat# 563105, RRID:AB_2738008)</div></div><div style="margin-bottom:8px"><div>CD8</div><div>suggested: (Leinco Technologies Cat# C666, RRID:AB_2829809)</div></div><div style="margin-bottom:8px"><div>CD95</div><div>suggested: (BD Biosciences Cat# 564710, RRID:AB_2738907)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">NHP cells were stained with the following antibodies: CD3 Alexa700 (SP34-2; BD), PD-1 BV421 (EH12.2H7; Biolegend), CXCR5 PE (MU5UBEE; ThermoFisher), CD4 BV605 (L200; BD), CD20 BV510 (2H7; BD), CD8 BV650 (RPA-T8; Biolegend), CD95 BUV737 (DX2; BD), CCR6 BV785 (G034E3; Biolegend), CXCR3 Pe-Dazzle594 (G02H57; Biolegend)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD20</div><div>suggested: (BioLegend Cat# 302356, RRID:AB_2566316)</div></div><div style="margin-bottom:8px"><div>CCR6</div><div>suggested: (BioLegend Cat# 353422, RRID:AB_2563660)</div></div><div style="margin-bottom:8px"><div>CXCR3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plates were washed prior to incubation with HRP-conjugated secondary antibodies for mouse (1:10000; anti-mouse IgG; KPL), macaque (1:10000; anti-macaque IgG; Rockland) or human (1:20000; anti-human IgG; Sigma) for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG; KPL</div><div>suggested: (SeraCare KPL Cat# 5450-0011, RRID:AB_2687537)</div></div><div style="margin-bottom:8px"><div>anti-macaque IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2-RBD inhibition ELISA: An ELISA to measure the ability of plasma antibodies to block interaction between recombinant human ACE2 (kindly provided by Merlin Thomas) and SARS-CoV-2 RBD was performed as previously described (Juno et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: (Thermo Fisher Scientific Cat# PA5-75453, RRID:AB_2719181)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, the ectodomain of SARS-CoV-2 (isolate WHU1; residues 1 – 1208) with furin cleavage site removed and P986/987 stabilisation mutations36, a C-terminal T4 trimerisation domain, Avitag and His-tag, was expressed in Expi293 cells and purified by Ni-NTA size-exclusion chromatography.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">%Inhibition was plotted against plasma dilutions and the area under curve (AUC) was calculated using Graphpad Prism. Microneutralisation Assay: SARS-CoV-2 isolate CoV/Australia/VIC01/2020 (Caly et al., 2020) was passaged in Vero cells and stored at −80 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: CLS Cat# 605372/p622_VERO, RRID:CVCL_0059)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">C57BL/6 or BALB/c mice were anesthetised by isoflurane inhalation prior to intramuscular injection of 50 μL vaccine in each hind quadriceps.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">B cell receptor sequencing and analysis: B cell receptor sequences were recovered from GC B cells (B220+IgD-GL7+) in the draining iliac lymph node of C57BL/6 mice (n=3) 14 days after a single immunisation with S.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">%Inhibition was plotted against plasma dilutions and the area under curve (AUC) was calculated using Graphpad Prism. Microneutralisation Assay: SARS-CoV-2 isolate CoV/Australia/VIC01/2020 (Caly et al., 2020) was passaged in Vero cells and stored at −80 °C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All statistical analyses were performed using Prism (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry data was analysed in FlowJo v9 or v10.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/short/2020.09.01.278630
doi.org doi.org

https://doi.org/10.1101/2020.05.19.104117

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.05.19.104117: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The overall study was reviewed and approved by the SHAPHC Ethics Committee (approval no.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The fluorescently labeled S1 bait was previously prepared by incubating 5 μg of His tag-S1 protein with Anti His tag antibody-PE for at least 1 hr at 4 °C in the dark.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti His tag antibody-PE for at least 1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PCR products were then purified using DNA FragSelect XP Magnetic Beads (SMART-Lifesciences) and cloned into human IgG1, lambda or kappa expression plasmids for antibody expression by seamless cloning method (see below).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HRP-conjugated anti-human IgG Fab antibody (Sigma) was added at the dilution of 1:10,000 in PBST containing 3% BSA (Sangon Biotech) and incubated at 37 C for 0.5 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HRP-conjugated anti-human IgG Fab antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 10 thousand cells in 100 μl were incubated with indicated antibodies for 30 min at room temperature, after twice washes then PE-labeled goat anti-human IgG-Fc antibody was added (1:5,000; Abcam) for 30 min, followed by flow cytometry analyses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG-Fc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For Figure S3, to test S protein expression on cell membrane, recombinant ACE2-Cter-6XHis labeled by rabbit anti-His-PE antibody in 1.2:1 (n:n) ratio was added to 10 thousand cells expressing S protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His-PE</div><div>suggested: (Miltenyi Biotec Cat# 130-092-691, RRID:AB_1103227)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines and Viruses: Vero E6, A549-Spike (A549 expressing SARS-CoV-2 S protein), and A549-ACE2 (A549 expressing human ACE2) cell lines were supplied by Shanghai Public Health Clinical Center, Fudan University</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549-Spike</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293E cells were transfected using polyethylenimine (PEI, Sigma), after 4-5 days of cell culture, antibodies purification was processed from supernatants.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293E</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry assays: For Figure 4, flow cytometry analyses were performed to detect the binding abilities of antibodies to Spike protein in HEK293T cells freshly expressing of SARS-CoV-2, SARS-CoV and MERS-CoV.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, pseudovirus were generated by co-transfection of 293T cells with pNL4-3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequences were analyzed using IMGT/ V-QUEST (http://www.imgt.org/IMGT_vquest) and IgBlast (IgBLAST, http://www.ncbi.nlm.nih.gov/igblast).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgBLAST</div><div>suggested: (IgBLAST, RRID:SCR_002873)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression and purification of human monoclonal antibodies: The antibody VH/VL and constant region genes were then amplified and cloned into expression vector pcDNA3.4 using SMART Assembly Cloning Kit (SMART-Lifesciences), subsequently antibodies plasmids were amplified in competent cells (SMART-Lifesciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SMART</div><div>suggested: (SMART, RRID:SCR_005026)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The curves and EC50 were analyzed by GraphPad Prism 8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 28 and 31. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.05.19.104117
doi.org doi.org

https://doi.org/10.1101/2020.03.25.006569

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.03.25.006569: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ModelTest-NG [6] was used to select the best-fit evolutionary model of nucleotide substitution, that is, GTR + G + I.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ModelTest-NG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The complete coding genomic sequences of 30 coronaviruses were downloaded from the National Center for Biotechnological Information (NCBI) (available at https://www.ncbi.nlm.nih.gov/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>https://www.ncbi.nlm.nih.gov/</div><div>suggested: (GENSAT at NCBI - Gene Expression Nervous System Atlas, RRID:SCR_003923)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To calculate these values we use an in-house Python script.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In this case, the three stop codons (TAA, TAG, or TGA) and the three codons for isoleucine (ATT, ATC, and ATA) were excluded in calculation of GC3, and two single codons for methionine (ATG) and tryptophan (TGG) were excluded in all three (GC1, GC2, GC3) (Sueoka 1988).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ATC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The protein sequences were aligned using Biopython.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Biopython</div><div>suggested: (Biopython, RRID:SCR_007173)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting multiple sequence alignment was used to build a phylogenetic tree by employing a maximum-likelihood (ML) method implemented in the software package MEGA version 10. 1 [15].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA</div><div>suggested: (Mega BLAST, RRID:SCR_011920)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.03.25.006569
doi.org doi.org

https://doi.org/10.1101/2020.06.11.147363

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.06.11.147363: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Samples analyzed in this study received ethical clearance for immunological evaluation and/or inclusion as controls in immunoassays, and the protocols and informed consent forms were approved by the Institutional Review Board (IRB) at HCB (Refs.<br>IRB: Samples analyzed in this study received ethical clearance for immunological evaluation and/or inclusion as controls in immunoassays, and the protocols and informed consent forms were approved by the Institutional Review Board (IRB) at HCB (Refs.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antigen-coupled beads were validated by incubating them with serial dilutions of anti-histidine-Biotin antibody for antigens with a histidine-tag (Abcam, ab27025).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-histidine-Biotin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the first option, 100 µL of biotinylated secondary antibody diluted in PBS-BN (anti-human IgG, B1140,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Sigma-Aldrich Cat# B1140, RRID:AB_258513)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Seropositivity threshold (cutoff) for optimization tests was calculated as 10 to the mean plus 3 standard deviations of log10-transformed MFIs of the negative controls for each antibody isotype and antigen.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antigen.</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.06.11.147363
doi.org doi.org

https://doi.org/10.1101/2020.05.16.099317

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.05.16.099317: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western blot: Western blot was performed either using an anti-strep tag antibody or anti-SARA-COV-2 S antibody following a protocol described previously50.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARA-COV-2 S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Membranes were blocked with 5% skimmed milk in PBS for 1 hour and incubated either with anti-strep tag antibody (IBA Lifesciences) or anti-SARS-COV-2 polyclone antibody (Sino Biological Inc.) for another hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-strep tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-COV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alkaline phosphatase conjugated anti-Rabbit IgG (1:5000) (Sigma) was used as a secondary antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Varying amount of the full-length SARS-CoV2 S protein expression construct (0.1-10 µg) and the α fragment of β-galactosidase construct (10 µg), or the full-length ACE2 expression construct (10 µg) together with the ω fragment of β-galactosidase construct (10 µg), were mixed with DMEM medium (Gibco) containing PEI (80 µg) and added to HEK293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Automated data collection was carried out using SerialEM version65 at a magnification of 105,000× and the K3 detector in counting mode (pixel size, 0.825 Å) at a dose rate of ∼1.1 electrons per physical pixels per second.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the S1 fragment data set, CrYOLO53 was used for particle picking, RELION 3.0.8 was used for 2D classification, 3D classification and refinement.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RELION</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structural biology applications used in this project were compiled and configured by SBGrid56 Model building: The initial templates for model building used the stabilized SARS-CoV-2 S ectodomain trimer structure (PDB ID 6vxx) for the prefusion conformation, and a homology model, calculated by I-TASSER, of S2 postfusion trimer structure from mouse hepatitis virus (MHV) (PDB ID: 6b3o) for the postfusion confirmation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>I-TASSER</div><div>suggested: (I-TASSER, RRID:SCR_014627)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Several rounds of manual building were performed in Coot.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 26 and 23. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.05.16.099317
doi.org doi.org

https://doi.org/10.1101/2020.06.24.169334

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.06.24.169334: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: K18-hACE2 mouse experiments: Mouse experiments are approved by the QIMR Berghofer MRI Biosafety Committee and Animal Ethics Committee (project P3600), and are conducted in accordance with the “Australian Code for the care and use of animals for scientific purposes” as defined by the National Health and Medical Research Council of Australia.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Pixatimod was randomly placed in the box.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Female 6-8 week old K18 hACE2 mice (n=4 per group) were treated once with 16 mg/kg of pixatimod in 200 µl saline i.p. on the day before infection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding of His-tagged S1-RBD was detected with Alexa Fluor 488 anti-his tag antibody (clone J095G46, Biolegend, UK) 1:5000 in 25 μL PBST + 0.1% BSA per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-his tag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 100 mL of HEK293-6E cells were seeded at a cell density of 0.5 × 106 cells/ml 24hr before transfection with polyethyleneimine (PEI).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293-6E</div><div>suggested: RRID:CVCL_HF20)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus-compound mixture was transferred onto the wells of a washed 24-well plate that had been seeded with Vero E6 cells [ECACC 85020206] the previous day at 1.5 × 105 cells/well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A cytopathic effect assay was performed with the SARS-CoV-2 DE-Gbg20 isolate and Vero cells (ATCC) plated at 2 × 104 per well in 96-well plates the day prior to the experiment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: RRID:CVCL_ZW93)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">BCi-NS1.1 cells were grown at an Air Liquid Interface (ALI) in PneumaCult-ALI Basal Medium supplemented with Pneumacult ALI supplement hydrocortisone, PneumaCult ALI maintenance supplement, heparin, nystatin and penicillin–streptomycin (all from Stemcell Technologies) at 37°C in 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BCi-NS1.1</div><div>suggested: RRID:CVCL_T029)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Age and gender matched C57BL/6J mice (n=4) were included as a drug toxicity control and received 16 mg/kg of pixatimod in 200 µl saline i.p., but were not infected with virus. hCoV-19/Australia/QLD02/2020 (QLD02) (GISAID Accession ID; EPI_ISL_407896) virus was used to inoculate K18 hACE2 mice (n=4 per group) intranasally with 104 CCID50 of virus in 50 μl medium while under light anaesthesia; 3% isoflurane (Piramal Enterprises Ltd., Andhra Pradesh, India) delivered using The Stinger, Rodent Anesthesia System (Advanced Anaesthesia Specialists/Darvall, Gladesville, NSW, Australia).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Collected data were analysed with Spectral Manager II software prior to processing with GraphPad Prism 7, using second order polynomial smoothing through 21 neighbours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tm values were calculated using MatLab softaware (R20018a, MathWorks) and ΔTm values determined from the difference between the Tm of RBD alone or in the presence of heparin or pixatimod.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MatLab</div><div>suggested: (MATLAB, RRID:SCR_001622)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were maintained at 50-75% confluence in DMEM supplemented with 10% foetal bovine serum, 20 mM L-glutamine, 100 U/mL penicillin-G and 100 U/mL streptomycin sulfate (all purchased from Gibco/ThermoFisher, UK).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gibco/ThermoFisher</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using analysis of a two-tailed Student’s t test with GraphPad Prism (GraphPad Software) unless otherwise noted.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis for the K18-hACE2 mouse work was performed using IBM SPSS Statistics for Windows, Version 19.0 (IBM Corp., Armonk, NY, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPSS</div><div>suggested: (SPSS, RRID:SCR_002865)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT02042781</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Completed</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Study of the Safety and Tolerability of IV Infused PG545 in …</td></tr></table>
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 28 and 5. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.06.24.169334
doi.org doi.org

https://doi.org/10.1101/2020.06.15.152157

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.06.15.152157: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All experiments were performed using sex- and age-matched controls and approved by the Institutional Animal Care and Use Committee of Tulane University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation with IgG-HRP-conjugated anti-human antibody, membranes were washed and incubated with SuperSignal West Pico Chemiluminescent Substrate (Thermo Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus Production: Pseudoviruses for antibody screening were generated using the following plasmids: S-Tag of SARS (pcDNA3.1(+)-SARS-S), S-Tag of SARS2 (pcDNA3.1(+)-SARS2-S), vesicular stomatitis virus (pcDNA3.1(+)-VSV-G), and the HIV-1 pro-viral vector pNL4-3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S-Tag of SARS (pcDNA3.1(+)-SARS-S), S-Tag of SARS2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We used purified anti-human IgG Fc antibody (Biolegend) as a capture antibody and anti-Human IgG Fc, Multi-Species SP ads-HRP (SouthrenBiotech) as a detection antibody and the other procedure is same as mentioned above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tissues were blocked with 10% normal goat serum (NGS) for 40 minutes, followed by a 60 minute incubation with polyclonal guinea pig anti-SARS-CoV1 antibodies (1:1000) (NR-10361, BEI Resoruces).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Coated plates were washed with washing buffer (0.05% Tween 20 in PBS), blocked for 2 h at room temperature with blocking buffer (1% BSA and 0.1% Tween 20 in PBS), and washed before the addition of the supernatants or cell lysates from transfected 293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human ACE2 neutralization of SARS-CoV2 by plaque assay: Vero E6 cells were plated in a 6 well plate at 8 × 105 cells per well and incubated overnight.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice: Female wild type C57BL/6J mice 6-10-week-old were used for in vivo studies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6J</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For this study, we utilized the murine model of SARS-CoV2 were C57Bl/6 mice were first inoculated with adenovirus encoding human ACE2 (Vector Biolabs).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57Bl/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analysis was performed with GraphPad Prism 8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.06.15.152157
doi.org doi.org

SARS-CoV-2 and SARS-CoV Spike-RBD Structure and Receptor Binding Comparison and Potential Implications on Neutralizing Antibody and Vaccine Development

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.02.16.951723: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, transfection reagent Sinofection (Cat: STF02), mammalian expression plasmids of full length S or RBD protein of SARS-CoV-2 (Cat: VG40589-UT, Wuhan/IVDC-HB-01/2019) and SARS-CoV (Cat: VG40150-G-N, CUHK-W1), ACE2 (Cat: HG10108-UT), polyclonal antibodies against SARS-CoV RP01 (Cat: 40150-RP01) and T52 (Cat: 40150-T52) were purchased from Sino Biological.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>RP01</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>T52</div><div>suggested: (Rockland Cat# 600-401-W94, RRID:AB_2614544)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV neutralizing antibodies were generated from mice (M103, M127) or rabbits (R314, R301, R325, R302, R258, R348) immunized with recombinant S1 protein of SARS-CoV.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>R302</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing away the unbound proteins, cells were incubated withPE labelled anti-his-tag antibody for 20 min and went through flow cytometer for detection of cellular binding.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-his-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then 100μL/well of the antibody-PSV mixture was added onto the 293T/ACE2 cell wells and incubated for 37°C, 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody-PSV</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Both 293T and 293T-ACE2 cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% (v/v) FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus production in 293T adherent cells: 6-8 hours before transfection, 293T cells were pre-plate on T75 flask in DMEM+10% FBS at 100,000 cells/cm2. 13μg of Luciferase-expressing HIV-1 lentiviral transfer genome (pWPXL-luc), 13μg of packaging plasmid (PSD) and 13μg of expression plasmid encoding either SARS-CoV-2-S protein (pCMV-whCoV-Spike) or SARS-S protein (pCMV-SARS-Spike) were co-transfected into pre-plated 293T cells using Sinofection transfection reagent according to the procedure recommended by manufacturer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then 100μL/well of the antibody-PSV mixture was added onto the 293T/ACE2 cell wells and incubated for 37°C, 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T/ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flowjo and Graphpad softwares were used for data analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flowjo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Software PyMol was used for preparing structural figures39.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alignment of 111 SARS-CoV RBD sequence, used for the generation of sequence conservation, was collected by BLAST via NCBI website34.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BLAST</div><div>suggested: (BLASTX, RRID:SCR_001653)</div></div><div style="margin-bottom:8px"><div>NCBI</div><div>suggested: (NCBI, RRID:SCR_006472)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
  No funding statement was detected.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.02.16.951723
doi.org doi.org

https://doi.org/10.1101/2020.03.20.999029

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.03.01.971499: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The study was approved by the Bioethical Committee of the Medical University of Silesia in Katowice, Poland (approval no: KNW/0022/KB1/17/10 dated 16.02.2010).<br>Consent: Written consent was obtained from all patients.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A mouse monoclonal anti-TMPRSS2 antibody (clone P5H9-A3; 1:500 dilution; Sigma-Aldrich, Poland), followed by incubation with a horseradish peroxidase-labeled anti-mouse IgG (65 ng/ml; Dako, Denmark) diluted in 5% skimmed milk / TBS-Tween (0.1%).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-TMPRSS2</div><div>suggested: (Santa Cruz Biotechnology Cat# sc-101847, RRID:AB_2205599)</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A horseradish peroxidase-labeled anti-His tag antibody (1:25000 dilution; Sigma-Aldrich, Poland) diluted in 5% skimmed milk / TBS-Tween (0.1%) was used to detect the His-tagged HmuY proteins.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-His tag antibody</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A horseradish peroxidase-labeled anti-His tag antibody (1:25000 dilution; Sigma-Aldrich, Poland) diluted in 5% skimmed milk / TBS-Tween (0.1%) was used to detect the His-tagged HmuY proteins.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-His tag antibody</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RD cells grown in 90% confluency were infected with HCoV-HKU1 (108 RNA copies per ml) in Dulbecco’s MEM (Thermo Fisher Scientific, Poland</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentivirus production and transduction: 293T cells were seeded on 10 cm2 dishes, cultured for 24 h at 37°C with 5% CO2 and transfected with psPAX, pMD2G and third transfer plasmid (pWPI/KLK13, pLKO.1-TRC/shrnaKLK13 or Lego-G2) using polyethyleneimine (Sigma-Aldrich, Poland). psPAX</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  As CleavEx technique is a convenient surrogate system allowing for precise mapping of the cleavage site, it has some limitations. To ensure the reliability of results, purified full-length HCoV-HKU1 S protein was subjected to the proteolytic cleavage. Also here we observed efficient cleavage of the HCoV-HKU1 S protein by KLK13. While the results presented here show that KLK13 is able to process the HCoV-HKU1 S protein, one may question whether the cleavage is sufficient for HCoV-HKU1 entry. It was previously presented for MERS-CoV that two consecutive enzymatic scissions are required for activation of the S protein. In this scenario, KLK13 would prime the HCoV-HKU1 S at S1-S2 site, enabling scission at S2-S2’ site by the TMPRSS2 or another host protease (38, 40, 93). This may be one of the factors limiting the HCoV-HKU1 replication in RD_KLK13 cells, as only minimal replication is observable. Summarizing, we show that KLK13 is a key determinant of HCoV-HKU1 tropism. This may explain why, since its first identification in 2004, all efforts to culture HCoV-HKU1 in standard cell lines have failed. We believe that this study increases our knowledge of HCoV-HKU1 and may promote the future in-depth investigation of coronaviruses. Considering the increasing number and diversity of coronaviruses, and the proven propensity of coronaviruses to cross the species barrier and cause severe diseases in humans, further research on the role of different proteases in coronaviral infections is ...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.03.20.999029
doi.org doi.org

https://doi.org/10.1101/2020.03.28.013920

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.03.28.013920: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: Crystals of the His-tag samples grew with rectangular morphology in space group P4122, however if the His-tag was removed the crystals grew in space group P6122 form with hexagonal morphology.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequent rounds of manual building and refinement were performed in Coot (Casanal et al., 2019) and PHENIX (Liebschner et al., 2019).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div><div style="margin-bottom:8px"><div>PHENIX</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Amax and KD were used as fitting parameters and nonlinear regression was performed using GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.03.28.013920
doi.org doi.org

https://doi.org/10.1101/2020.05.24.20112300

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.05.24.20112300: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Participants provided verbal and / or written informed consent and provided saliva and blood specimens for analysis.<br>IRB: Participation in these studies was voluntary and the study protocols have been approved by the respective Institutional Review Boards.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Coupling of antigens to beads was confirmed using antibody against the antigen or against the tag (e.g. anti-His(6) tag antibody), if present (Table 1), followed by a species-specific R-phycoerythrin (PE)-labelled antibody and was considered successful if the median fluorescence intensity (MFI [a.u.]) was >10,000 at 1 μg/mL of antigen-specific antibody (except the BSA-conjugated bead set).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>antibody against the antigen or against the tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-His(6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>R-phycoerythrin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>antigen-specific</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Finally, the MFI of each bead set was measured on a Bio-Plex® immunoassay instrument (Bio-Rad Laboratories, Hercules, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bio-Rad Laboratories</div><div>suggested: (Bio-Rad Laboratories, RRID:SCR_008426)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study has several limitations. First, our collection of saliva and serum samples was predominantly obtained from independent cohorts, and it contained 28 matched saliva and serum samples collected from the same participants at the same time. In future studies, the performance of this assay should be compared between saliva and serum in a large sample of matched saliva and serum samples. Second, all saliva data was cross sectional and we were not able to evaluate the temporal kinetics of saliva SARS-CoV-2 antibody responses using repeated measures within the same individual. Longitudinal analysis would allow us to evaluate the temporal kinetics and magnitude of SARS-CoV-2 IgG, IgA, and IgM responses, resolve synchronous vs. classical isotype responses (IgM followed by IgA followed by IgG) following SARS-CoV-2 infection.42 Additional investigation with convalescent phase saliva and sera are needed to determine the stability of SARS-CoV-2-specific IgG responses. Third, we did not have information on severity of SARS-CoV-2 disease from each participant in this study, and thus were not able to determine the impact of severity of infection on antibody responses.29 Prior studies suggest that antibody responses are slightly elevated among individuals with severe infection.29,30,42 Future analysis should determine how severity of infection, and infectious dose, modifies antibody responses. Fourth, we did not determine receiver operating characteristic (ROC)-optimized MFI cut offs...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.05.24.20112300
doi.org doi.org

https://doi.org/10.1101/2020.05.03.074781

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.05.03.074781: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Although values greater than 100% were observed in the experimental binding assay (and are valid)10, the assay is bounded above by an unknown quantity that in our estimation should correspond to the inverse of the ratio of immunoprecipitated ACE2 by the C-terminal tag antibody to the total amount of ACE2 in the sample.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C-terminal tag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The average overlap per residue was pulled into Jalview as features from Chimera with the Fetch Chimera attributes function.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Jalview</div><div>suggested: (Jalview, RRID:SCR_006459)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Quantitative results were extracted from figures in Li et al.10 with WebPlotDigitizer 4.240.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>WebPlotDigitizer</div><div>suggested: (WebPlotDigitizer, RRID:SCR_013996)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We transcribed data for additional mutants from Li et al.10 that were not reported in UniProt.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UniProt</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The wild-type and mutant models were downloaded from the server as PyMol sessions and detailed structural comparisons were conducted with PyMol20.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Enumerating possible ACE2 missense SNPs: The ACE2 gene (ENSG00000130234) was retrieved from Ensembl in Jalview14.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ensembl</div><div>suggested: (Ensembl, RRID:SCR_002344)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Biopython was used to process sequence data.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Biopython</div><div>suggested: (Biopython, RRID:SCR_007173)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analyses were coded in Python in Jupyter Notebooks.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Numpy, Pandas and Scipy were used for data analysis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Numpy</div><div>suggested: (NumPy, RRID:SCR_008633)</div></div><div style="margin-bottom:8px"><div>Scipy</div><div>suggested: (SciPy, RRID:SCR_008058)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Matplotlib and Seaborn were used to plot data.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Matplotlib</div><div>suggested: (MatPlotLib, RRID:SCR_008624)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04287686</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Withdrawn</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recombinant Human Angiotensin-converting Enzyme 2 (rhACE2) a…</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.05.03.074781
biorxiv.org biorxiv.org

https://doi.org/10.1101/2020.07.14.202028

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.07.14.202028: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cell lines were routinely tested for mycoplasma and found negative.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies: Mouse monoclonal antibodies (mAb): IFITM1 (#60074-1-Ig, Proteintech) 1:250 for FACS, and IF; IFITM2/3 (#66081-1-Ig, Proteintech) 1:250 for FACS, and IF; ACE2 (AC18F) (#AG-20A-0032-C100 – adipogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IFITM1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IF</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Rabbit polyclonal antibodies: FLAG-Tag DYKDDDDK (D6W5B) (#14793, Cell Signaling) 1:800 for FACS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FLAG-Tag DYKDDDDK</div><div>suggested: (Acris Antibodies GmbH Cat# AP08111PU-N, RRID:AB_1616157)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Goat polyclonal antibodies: ACE2 (AF933 – R&D).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS_Ssd3 702 antibody was used at 0.5 μg/ml for FACS and IF. Human Mab: Anti-SARS-CoV2 monoclonal antibodies 48 and 71 recognize the S1 and S2 domains of the S protein, respectively (Planchais et al, manuscript in preparation).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-SARS-CoV2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following antibodies were diluted in WB-buffer (PBS, 1% BSA, 0.05% Tween, 0.01% Na Azide): goat anti-human ACE2 (R&D cat#AF933, 1:2000), mouse anti-human ACE2 (Adipogen AC18F cat #AG-20A0032-C100, 1:1000), rabbit anti-human TMPRSS2 (Atlas antibodies cat# HPA035787, 1:1000), mouse anti-Flag tag (Sigma cat# F1804, 1:1000), rabbit anti-human actin (Sigma cat#A2066, 1:2000), mouse ascite anti-SARS S, (1:1000) (Siu, 2008 #4573).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human ACE2</div><div>suggested: (Enzo Life Sciences Cat# ALX-804-715B-C050, RRID:AB_2050611)</div></div><div style="margin-bottom:8px"><div>anti-human TMPRSS2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Flag tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human actin</div><div>suggested: (AMSBIO Cat# MA1000, RRID:AB_10920236)</div></div><div style="margin-bottom:8px"><div>anti-SARS S,</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentiviral and Retroviral vectors: For lentiviral production, 293T cells were co-transfected with pLenti6 or pLV derived vectors, packaging plasmid R8-2 and VSV-G plasmid as previously described 42.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GFP-Split fusion assay: For fusion assays with S-expressing cells, 293T-GFP1-10 and 293T-GFP11 cells (6×104 cells/well cells mixed at a 1:1 ratio) in 96 well plates (μClear, #655090) were transfected in suspension using Lipofectamine2000 (Thermo) with 100 ng of DNA. 10 ng of phCMV-SARS-CoV2-S, 25 ng of pCDNA3.1-hACE2, 25 ng of pCSDest-TMPRSS2 and 40 ng of pQCXIP-Empty or pQCXIP-IFITM-N-FLAG were used and adjusted to 100 ng DNA with pQCXIP-Empty.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-GFP11</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For donor cells, 293T-GFP1-10 cells were transfected with 10 ng of phCMV-SARS-CoV2-S, ±10 ng pCSDest-TMPRSS2, ±20 ng pQCXIP-IFITM-N-FLAG and adjusted to 50 ng with pQCXIP-Empty.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-GFP1-10</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">U2OS viral mediated cell-cell fusion, video microscopy and immunofluorescence: U2OS-ACE2 GFP1-10 or GFP11 stably expressing TMPRSS2, IFITM1, 2, 3 or control cells were mixed (1:1 ratio) and plated at 8×103 cells per well in a 96 well plate (μClear, #655090), 24 h before infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>U2OS</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Titration of viral stocks was performed on Vero E6, with a limiting dilution technique allowing a calculation of DCP50.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Recombinant DNA</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids: pQCXIP-Empty control plasmid and pQCXIP-IFITM1-N-FLAG, pQCXIP-IFITM2-N-FLAG, pQCXIP-IFITM3-N-FLAG plasmids were described 42. pQCXIP-BSR-GFP11 and pQCXIP-GFP1-10 were from Yutaka Hata 51 (Addgene plasmid #68716; http://n2t.net/addgene:68716; RRID:Addgene_68716 and Addgene plasmid #68715; http://n2t.net/addgene:68715; RRID:Addgene_68715).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_68716)</div></div><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_68715)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pcDNA3.1-hACE2 was from Hyeryun Choe 52 (Addgene plasmid # 1786; http://n2t.net/addgene:1786; RRID:Addgene_1786).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_1786)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pCSDest-TMPRSS2 was from RogerReeves 53 (Addgene plasmid # 53887; http://n2t.net/addgene:53887; RRID:Addgene_53887).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_53887)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pLenti6-H2B-mCherry was from Torsten Wittmann 54 (Addgene plasmid # 89766; http://n2t.net/addgene:89766; RRID:Addgene_89766).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div></div><div>detected: RRID:Addgene_89766)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The GFP area was quantified on ImageJ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were quantified and processed using ImageStudioLite software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageStudioLite</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Flow cytometry data were analyzed with FlowJo v10 software (TriStar).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Figures were drawn on Prism 8 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis was conducted using GraphPad Prism 8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 13, 14, 16, 22, 23 and 24. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/short/2020.07.14.202028
www.ncbi.nlm.nih.gov www.ncbi.nlm.nih.gov

https://doi.org/10.1101/2020.06.14.150607

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.06.14.150607: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: After obtaining informed consent, serum was obtained by venipuncture (BD Vacutainer, serum), centrifuged, aliquoted and stored at -80°C prior to use.<br>IRB: Protocol approval was obtained by the Institutional Review Board (protocol IRB# 2016-6137) of the Albert Einstein College of Medicine.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">COVID-19 convalescence sera samples (2, 3, 5, 6, 7) were previously validated to be negative with RT-PCR for SARS-CoV-2 and positive ELISA for antibodies against SARS-CoV-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The arrays were rinsed with 5% milk-PBST briefly and incubated for 1 hour at room temperature with a fluorescently labeled secondary antibody (Alexa Fluor 647 labeled goat anti-human IgG (H+L) cross-adsorbed secondary antibody, Thermo Fisher Scientific, Cat # A21445) diluted 1:150 in 5% milk-PBST.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Molecular Probes Cat# A-21445, RRID:AB_2535862)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then incubated with a PE-labeled anti-6x His tag antibody (Abcam Cat # ab72467), to detect Spike protein binding.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-6x</div><div>suggested: (Abcam Cat# ab72467, RRID:AB_1267596)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 45 minutes, cells were pelleted and washed twice, and then incubated with an anti-HIS PE antibody, washed twice, and analyzed on a SONY Spectral Analyzer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HIS PE</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression of hACE2, mACE2, CD147, CD26, Siglec9, Siglec10, Ceacam1, and Ceacam5 were confirmed by antibody staining of transfected HEK293F cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD147</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Siglec10</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Ceacam1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Ceacam5</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies used: hACE2 and mACE2 (RND Cat # AF933-SP), CD147 (Biolegend Clone HIM6), CD26 (Biolegend Clone BA5b), Siglec9 (Biolegend Clone K8), Siglec10 (Biolegend Clone FG6), Ceacam1 and Ceacam5 (Biolegend Clone ASL-32).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD26</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Siglec9</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293F Transient Transfections and Culture: HEK 293 suspension cells were cultured in HEK Freestyle Media (Invitrogen) at 37 C in a humidified shaking platform incubator (Kuhner) with 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">High-throughput Screening of Human Plasma Membrane Protein Library: The human plasma membrane protein library was transfected into HEK293F cells in 48-well format.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nickel eluates were concentrated by centrifugation in 100K concentrator (ThermoFisher Cat # 88533) by spinning at 1100 g for intervals of 8 minutes (if necessary) and further purified by gel filtration on a HiLoad™ 16/600 Superdex™ 200 column (GE) equilibrated with 50 mM TRIS, 100 mM ArgCl, 150 mM NaCl, 10% Glycerol, pH 8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher Cat</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein concentration was determined using an extinction coefficient (1468500 M-1cm-1) estimated from amino acid sequence by Expasy online ProtParam tool[20]</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ProtParam</div><div>suggested: (ProtParam Tool, RRID:SCR_018087)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein concentration was determined using an extinction coefficient (33350 M-1cm-1), estimated from amino acid sequence by Expasy online ProtParam, and was further analyzed by SDS-PAGE.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expasy online ProtParam</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting supernatant was purified on an AKTA FPLC (GE Biosciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GE Biosciences</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data was exported in Excel, and then analyzed and graphed by GraphPad Prism.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The program Prism v8 was used to generate the AUC figures shown in the text and supplement.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Absorption was measured at OD450 using a Synergy4 plate reader (Biotek), and data was analyzed using GraphPad Prism7.0 to calculate IC50 values.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  It is important to note the limitations of the current platform. In particular, we stress that at present this is a qualitative approach, as a number of variables can impact the ability to detect antibody reactivity, including patient titers for specific antigens and the relative affinities of an antigen-specific pool. Furthermore, it should be appreciated that the current platform is programmed to detect the capture of IgG antibodies; thus, the resultant signal (or lack thereof) for a particular antigen could be the consequence of prevalences between different isotypes (IgA, IgD, IgE, IgG, IgM), which are known to evolve during the course of infection and subsequent resolution. Although currently focused on three antigens, this platform can be readily expanded to study differential antibody responses to different SARS-CoV-2 antigens and subdomains of those antigens amongst individuals, which are actively being investigated by others [52-55]. We are currently working to include not only other antigens from SARS-CoV-2 (E protein, M protein, etc.), but also antigens from other coronaviruses that may be cross reactive with SARS-CoV-2 antibodies. The analysis of antibody reactivity to multiple SARS-CoV-2 and related antigens will provide broad insight into the humoral immune response to SARS-CoV-2. Collectively, we provide standards and metrics for high quality protein reagents that can yield comparable clinical, biological and structural data as we continue to combat the global ...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

ncbi.nlm.nih.gov/pmc/articles/PMC7310628/
doi.org doi.org

https://doi.org/10.1101/2020.06.09.141580

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.06.09.141580: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: The experiments were carried out using the protocols approved by the Scientific Ethics Committee of Huazhong Agricultural University (permit number: HZAUSW-2018-009).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animal immunization: Female BALB/c mice aged 6 weeks were immunized with different proteins at 0 and 3 weeks.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, horseradish peroxidase (HRP)-conjugated goat anti-mouse/rabbit IgG (1:10,000 diluted in PBST with 1% BSA (w/v), Boster) was used as the secondary antibody, and 3,3’,5,5’-tetramethylbenzidine (TMB) (Beyotime) was used as the substrate for detection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse/rabbit IgG</div><div>suggested: (Biorbyt Cat# orb27530, RRID:AB_10954533)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, the mouse anti-Strep-tag II antibody (SAB, 1:3,000 diluted in PBST with 1% BSA (w/v)) and HRP-conjugated goat anti-mouse IgG (1:5,000 diluted in PBST with 1% BSA (w/v), Boster) was used for detection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Strep-tag II</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Three days after the last injection, spleen cells were collected and fused with SP2/0 cells with PEG1450 (Sigma-Aldrich, P7181) to generate hybridoma cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SP2/0</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production and entry assay of pseudoviruses: Pseudo-typed viruses were produced as previously described (50), 293T (ATCC, CRL-3216), Huh-7 and Vero (ATCC, CCL-81) cells were maintained in high glucose DMEM (Gibco, USA) supplemented with 10% FBS (FBS; Natocor, Argentina), penicillin (100 IU/ml) and streptomycin (100 μg/ml).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animal immunization: Female BALB/c mice aged 6 weeks were immunized with different proteins at 0 and 3 weeks.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: RRID:IMSR_ORNL:BALB/cRl)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, structure-based B-cell epitope prediction was performed by DiscoTope 2.0 with a positive cutoff greater than −3.7 (corresponding to a specificity greater than or equal to 0.75 and a sensitivity less than 0.47) using the following protein structures: the HCoV-229E S-trimer and RBD (PDB IDs: 6U7H and 6ATK, respectively), the SARS-CoV S-trimer and RBD (PDB IDs: 5X5B and 2AJF, respectively), the SARS-CoV-2 S-trimer and RBD (PDB IDs: 6VYB and 6M0J, respectively), the PEDV RBD (PDB ID: 6U7K), the FIPV RBD (PDB ID: 6JX7), the PRCoV RBD (PDB ID: 4F5C), and the transmissible gastroenteritis virus (TGEV) RBD (PDB ID: 4F2M).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DiscoTope</div><div>suggested: (DiscoTope, RRID:SCR_018530)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All the predicted residues were then labeled in corresponding structures using PyMOL (Schrödinger).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Additionally, the amino acid sequences of alpha-CoVs RBDs were aligned using ClustalW2 (52).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ClustalW2</div><div>suggested: (ClustalW2, RRID:SCR_002909)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 38. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.06.09.141580
doi.org doi.org

https://doi.org/10.1101/2020.06.13.149930

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.06.13.149930: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detection of S protein, the membrane was incubated with anti-HA tag mouse monoclonal antibody (bimake, USA, 1:2000), and the bound antibodies were detected by Horseradish Peroxidase (HRP)-conjugated goat anti-mouse IgG (Abbkine, China, 1:5,000).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detection of HIV-1 p24 in supernatants, monoclonal antibody against HIV p24 (p24 MAb) was used as the primary antibody at a dilution of 1:8,000, followed by incubation with HRP-conjugated goat anti-mouse IgG at the same dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HIV-1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HIV</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To detect the expression of 20 ACE2s in HeLa cells, Mouse anti-His tag monoclonal antibody (Bioworld, USA, 1:5000) was used as the first antibody, followed by incubation with HRP-conjugated goat anti-mouse IgG at the same dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His tag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines and plasmids: HEK293T and HeLa cells were obtained from the American Tissue Culture Collection and cultured in Dulbecco’s modified Eagle medium (DMEM) (Gibco, USA) supplemented with 10% fetal bovine serum (FBS) in a humidified 5% CO2 incubator at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To detect the expression of 20 ACE2s in HeLa cells, Mouse anti-His tag monoclonal antibody (Bioworld, USA, 1:5000) was used as the first antibody, followed by incubation with HRP-conjugated goat anti-mouse IgG at the same dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Phylogenetic analysis: Multiple sequence alignment was performed for the whole aa sequences of ACEs using MAFFT with a local alignment strategy FFT-NS-2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The phylogenetic tree was constructed by MEGA7 using the neighbor-joining (NJ) method with 1,000 bootstrap replicates and visualized using FigTree.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEGA7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>FigTree</div><div>suggested: (FigTree, RRID:SCR_008515)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.06.13.149930
doi.org doi.org

https://doi.org/10.1101/2020.03.29.013490

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.03.29.013490: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A primary anti-spike rabbit monoclonal antibody (40150-R007, Sino Biological, 1:100) and a goat anti-rabbit secondary antibody (Alexa Fluor 488, Invitrogen, Thermo Fisher Scientific) were employed to stain 2019-nCoV S1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike</div><div>suggested: (Sino Biological Cat# 40150-R007, RRID:AB_2827979)</div></div><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A primary anti-His-tag mouse monoclonal antibody (AF5060, Beyotime, 1:1000) and a goat anti-mouse secondary antibody (A0216, Beyotime, 1:2000) were employed to detect S1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His-tag</div><div>suggested: (AnaSpec; EGT Group Cat# 29673-1000, RRID:AB_11232932)</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Beyotime Cat# A0216, RRID:AB_2860575)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">β-actin determined by a mouse monoclonal antibody (AA128, Beyotime, 1:1000) was used as a reference.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AA128</div><div>suggested: (Beyotime Cat# AA128, RRID:AB_2861213)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunofluorescence microscopy: Caco-2 and HK-2 obtained from the cell bank of Chinese Academy of Sciences (CAS, Shanghai) and cultured in Dulbecco’s modified Eagle medium (DMEM, Gibco, Thermo Fisher Scientific, Shanghai</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.03.29.013490
doi.org doi.org

https://doi.org/10.1101/2020.06.23.165415

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.06.23.165415: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Periplasmic extracts were transferred to a microtiter plates, previously coated with Protein A (Sigma), blocked in TBS-BSA buffer and subsequently incubated with anti-myc antibody (Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-myc</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Suspension adapted HEK293-F cells were grown in 600-ml Bioreactors in 250 ml of serum free FreeStyle medium in an incubator at 37°C with humidified atmosphere at 8% CO2 on an orbital shaker platform rotating at 220 rpm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293-F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization Assay: Pseudotyped neutralization assays were adapted from protocols previously validated to characterize the neutralization of HIV 38, but with the use of HEK293T-ACE2 cells as previously described 25.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, pseudotyped lentiviruses displaying the SARS-CoV-2 spike protein (harboring an 18 amino acid truncation of the cytoplasmic tail 39) and packaging a luciferase reporter gene were generated by the co-transfection of HEK293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The gene for RBD expression comprises residues (319 − 566) of 2019-nCoV RBD-SD1 and was cloned into a pαH mammalian expression vector containing a secretion signal, a C-terminal Sortase recognition motif and a non-cleavable Histidine tag 25</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RBD-SD1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Biophysical methods: Small angle X-ray scattering measurements (SAXS): The SAXS data were collected at the EMBL P12 beamline of the storage ring PETRA III (DESY, Hamburg, Germany) using a robotic sample changer 41.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EMBL</div><div>suggested: (ChEMBL, RRID:SCR_014042)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The radial average was performed and solvent scattering was subtracted using the SASFLOW pipeline 42.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SASFLOW</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The distance distributions were computed by GNOM 43 and the overall parameters were determined from the reduced data using relevant programs from the ATSAS suite 42.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ATSAS</div><div>suggested: (ATSAS, RRID:SCR_015648)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Hybrid models of the sybodies and of the RBD were constructed by CORAL 45 using the available high-resolution portions as rigid bodies and amending them by chains of dummy residues to represent the fragments not present in the crystal.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CORAL</div><div>suggested: (Coral, RRID:SCR_011849)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Extracted particles were imported into cryoSPARC v2.15.0 49 for 2D classification, heterogenous refinement and non-uniform 3D refinement 50.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The model was extended and manually adjusted in COOT 51.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.06.23.165415
doi.org doi.org

https://doi.org/10.1101/2020.05.29.20116004

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.05.29.20116004: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants provided informed consent under the Western IRB approved IRB protocol #20180015 to Enable Biosciences.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the testing, the eluent was assayed using a modified Antibody Detection by Agglutination-PCR (ADAP) protocol12–14.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ADAP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">If present, the SARS-CoV-2 antibodies in the specimen engage with S1-DNA conjugate to agglutinate into a dense immune complex.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Materials: The SARS-CoV-2 spike protein (S1) containing amino acids 1–674 with an Fc-tag at the C-terminus (#31806), expressed in HEK293 cells, was purchased from the Native Antigen Company (Oxford, United</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.05.29.20116004
doi.org doi.org

https://doi.org/10.1101/2020.06.05.131748

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.06.05.131748: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fiberglass pads, absorbent pads and plastic boards were purchased from Shanghai Kinbio Tech. Co. Ltd. Ab1, Ab2, TP52, RP01 antibodies against SARS-CoV-2 spike antigen were provided by Academy of Military Medical Sciences and Sino Biological Inc. (Beijing, China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TP52</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-Spike antibodies were generated by sorting single memory B cells as previously reported19.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Spike</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, anti-CD19, anti-CD38, anti-CD27 and anti-His antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-CD19</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD38,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD27</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fabrication of nanozyme-based chemiluminescence test paper: Anti-S-RBD antibody pairs were screening using ELISA method and nanozyme-based colorimetric strips15.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-S-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The paired capture antibody of S-RBD (S-cAb) was immobilized on a nitrocellulose membrane at 1 mg/ml to form the test line (T-line), as well as the anti-human IgG antibody as the control line (C-line).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nanozyme probes uncombined with antigen bound with the control IgG antibody at C-line.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>control IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A cDNA sequence encoding S-RBD was expressed containing both N-terminal natural signal peptide as well as a 6×His tag at the C-terminus, after transfection into HEK293 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Rapid testing of pseudo-SARS-CoV-2: The pseudo-SARS-CoV-2 were packaged by transfecting 293T cells with a HIV-1-based retroviral vector coding SARS-CoV-2 spike S1 protein and luciferase reporter gene.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antibody binding affinity for S-RBD was evaluated by BIAcore 8K.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BIAcore</div><div>suggested: (Biacore T100 System, RRID:SCR_019679)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.06.05.131748
medrxiv.org medrxiv.org

http://medrxiv.org/cgi/content/short/2020.10.05.20206664

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.10.05.20206664: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: To minimize recruitment bias, all adults who responded to the invitation email and returned their signed consent form were enrolled sequentially and invited to give a blood sample, without triaging.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sulfo-tag-labelled anti-IgG detection antibody were added and the electrochemiluminescence signal was read using the MSD Sector 600 instrument.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Commercial chemiluminescent (CLIA) antibody assay: Total antibody (IgA, IgG and IgM) against recombinant spike (S1) protein was determined using the VITROS 5600 analyser (Ortho-Clinical Diagnostics, Rochester, NY) according to manufacturer instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgA, IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analyses were conducted in R version 4.0.2, R Studio version 3.6.2 and GraphPad Prism version 8.4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  This study has limitations. First, due to the lack of follow-up, findings from this study should not be used to predict whether the antibody reactivity to SARS-CoV-2 in unexposed individuals may confer any immune protection or harm. Second, infection with SARS-CoV-2 prior to 7 days may be underestimated by serology (21). However, this is unlikely to have had a significant effect on our estimates considering the low number of reported cases in BC. Third, the small sample size limited the power for correlation analyses and the precision of estimates of the overall prevalence from a direct SARS-CoV-2 exposure. In conclusion, this study reveals that pre-existing antibody reactivity against SARS-CoV-2 antigens in sera from unexposed adults and in young infants is common, although it has been largely overlooked in previous serology studies. These findings warrant urgent studies of the impact such pre-existing seroreactivity may have on seroconversion following an exposure to SARS-CoV-2, likelihood of acquiring the infection, COVID-19 severity or vaccine responses.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/short/2020.10.05.20206664
doi.org doi.org

https://doi.org/10.1101/2020.05.21.107870

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.05.21.107870: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fondaparinux was purchased from Merck, UK. Goat anti-human ACE2 antibody AF933 (Biotechne), goat control IgG AB-108-C (Biotechne), rabbit anti-human TMPRSS2 (MBS9215011, Gentaur), rabbit IgG control (Biolegend) were used as per manufacturers’ instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human TMPRSS2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>rabbit IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed once and then incubated with the appropriate fluorescently labelled secondary antibody (anti-mouse polyvalent Ig-FITC (Merck) or anti-His6 HIS.H8 DyLight 488, (Invitrogen) for 30 min at 21°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse polyvalent Ig-FITC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-His6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The A549 cell line was obtained from the European Collection of Animal Cell Cultures (ECACC) and cultured in DMEM supplemented with 10% FCS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293TACE2 cells were kindly provided by Paul Bieniasz (The Rockefeller University, USA), cultured as described for 293T cells including selection with 5ug/ml blasticidin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293TACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A human keratinocyte cell line, HaCaT (300493), was obtained from Cell Line Services (CLS GmbH, Germany) and routinely cultured in DMEM supplemented with 10% FCS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HaCaT</div><div>suggested: CLS Cat# 300493/p800_HaCaT, RRID:CVCL_0038)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Caco2 cell line (ATCC® HTB-37), derived from a colorectal adenocarcinoma, was obtained from Dr. Michael Trikic (University of Sheffield, UK).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco2</div><div>suggested: ATCC Cat# HTB-37, RRID:CVCL_0025)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Real time quantitative PCR (RT-qPCR): HaCaT, RT4, A549, 293T, 293TACE2 and Caco2 cell lines were cultured for 48hrs under standard media conditions and harvested using trypsin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Wild-type S1S2 (wt S1S2; Val16-Pro1213; Stratech UK) with a His6 tag at the C-terminus was expressed in baculovirus-insect cells, while S1-Fc (Val16-Arg685; Stratech UK) with a mouse IgG1 Fc region at the C-terminus was expressed in HEK293 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.05.21.107870
doi.org doi.org

https://doi.org/10.1101/2020.04.15.042085

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.04.15.042085: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A monoclonal mouse antibody against the C-terminal Myc-tag was purchased from CellSignaling Technology (2276S)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Myc-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A monoclonal mouse anti-beta actin antibody was purchased from Abcam (ab6276)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A monoclonal mouse anti-beta actin antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-beta actin</div><div>suggested: (Abcam Cat# ab6276, RRID:AB_2223210)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 (ATCC® CRL-1586) and HEK293 (ATCC® CRL-1573) cells were maintained in DMEM supplemented with 10 % FCS, antibiotics and glutamine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For analysis of multicycle replication kinetics Calu-3 cells were seeded in 12-well plates and grown to 90 % confluence.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transient expression of SARS CoV-2 S protein in HEK293 cells: For transient expression of SARS-CoV-2 S protein 60 % confluent HEK293 cells were co-transfected with 1.6 µg of pCAGGS-S-Myc-6xHis and either 15 ng of empty pCAGGS vector or pCAGGS-TMPRSS2 using Liopfectamine® 2000 (Invitrogen) according to the manufacturers protocol for 48 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.04.15.042085
doi.org doi.org

https://doi.org/10.1101/2020.04.02.021469

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.04.02.021469: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies: Monoclonal antibody against FLAG tag (ANTI-FLAG M2) and β-Actin were purchased from Sigma (Cat.No. F1804 and A2228, respectively).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Antibodies</div><div>suggested: (Sigma-Aldrich Cat# A2228, RRID:AB_476697)</div></div><div style="margin-bottom:8px"><div>ANTI-FLAG</div><div>suggested: (Sigma-Aldrich Cat# F1804, RRID:AB_262044)</div></div><div style="margin-bottom:8px"><div>β-Actin</div><div>suggested: (Sigma-Aldrich Cat# F1804, RRID:AB_262044)</div></div><div style="margin-bottom:8px"><div>A2228</div><div>suggested: (Sigma-Aldrich Cat# A2228, RRID:AB_476697)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monoclonal antibody against human IFITM1 (Cat.No. 60047-1), rabbit polyclonal antibody against human IFITM3 (Cat.No. 11714-1-AP), which also efficiently recognizes IFITM2 and weakly cross-reacts with IFITM1, were purchased from Proteintech Group, Inc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IFITM1</div><div>suggested: (Novus Cat# NB 600-471, RRID:AB_535506)</div></div><div style="margin-bottom:8px"><div>human IFITM3</div><div>suggested: (Proteintech Cat# 11714-1-AP, RRID:AB_2295684)</div></div><div style="margin-bottom:8px"><div>IFITM1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse monoclonal antibody against HCoV-OC43 nucleocapsid (NP) protein was purchased from Millipore (Cat.No. MAB9012).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-OC43 nucleocapsid (NP) protein</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HCoV-OC43 nucleocapsid (NP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After permeabilization with 0.1% Triton X-100, the cells were stained with a monoclonal antibody (541-8F) recognizing HCoV-OC43 NP protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCoV-OC43 NP protein.</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The bound antibodies were visualized by using Alexa Fluor 488-labeled (green) goat anti-mouse IgG or Alexa Fluor 555-labeled (red) goat anti-mouse IgG, Cell nuclei were counterstained with DAPI.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: Human hepatoma cell lines HepG2 and C3A, a sub-clone of HepG2 (ATCC HB-8065) were purchased from ATCC and cultured in DMEM/F12 medium supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HepG2</div><div>suggested: ATCC Cat# HB-8065, RRID:CVCL_0027)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lung cancer cell line A549 were obtained from ATCC and maintained in DMEM supplemented with 10% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GP2-293 and Lenti-X 293T cell Lines were purchased from Clontech and cultured in DMEM supplemented with 10% FBS and 1 mM Sodium pyruvate (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flp-In TREx 293 cells were purchased from Invitrogen and maintained in DMEM supplemented with 10% FBS, 10 μg/ml blasticidin (Invitrogen) and 100 µg/ml Zeocin (Invivogen) (64).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flp-In TREx 293</div><div>suggested: RRID:CVCL_U427)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flp-In TREx 293-derived cell lines expressing LY6E, GILT, ADAP2, or IFITM3 were cultured in DMEM supplemented with 10% FBS, 5 μg/ml blasticidin and 250 μg/ml hygromycin. Viruses: HCoV-OC43 (strain VR1558) were purchased from ATCC and amplified in HCT-8 cells according to the instruction from ATCC.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCT-8</div><div>suggested: ICLC Cat# HTL99005, RRID:CVCL_2478)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Establishment of cell lines stably expressing wild-type and mutant IFITM or LY6E proteins or shRNA: HepG2, C3A or A549 cells in each well of 6-well plates were incubated with 2 ml of Opti-MEM medium containing pseudotyped retroviruses and centrifuged at 20 °C for 30 minutes at 4,000×g.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C3A</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 33. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.04.02.021469
doi.org doi.org

https://doi.org/10.1101/2020.05.28.20105692

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.05.28.20105692: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: These were sourced from discarded clinical laboratory specimens exempted from informed consent and IRB approval under condition of patient anonymity.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In contrast, samples without neutralizing antibodies will benefit from the strong binding between S1 and ACE2 proteins to generate a large amount of DNA amplicons, thus a stronger qPCR signal (lower Ct).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Materials: The SARS-CoV-2 spike protein (S1) containing amino acids 1-674 with an Fc-tag at the C-terminus (#31806) expressed in HEK293 cells was purchased from the Native Antigen Company (Oxford, United Kingdom).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.05.28.20105692
biorxiv.org biorxiv.org

http://biorxiv.org/cgi/content/short/2020.11.24.390039

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.11.24.390039: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ipom-F and Antibodies: Ipom-F was synthesised as previously described (Zong et al., in press).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ipom-F</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following transfer to a PVDF membrane in transfer buffer (0.06 M Tris, 0.60 M glycine, 20% MeOH) at 300 mA for 2.5 h, PVDF membranes were incubated in 1X Casein blocking buffer (10X stock from Sigma-Aldrich, B6429) made up in TBS, incubated with appropriate primary antibodies (1:500 or 1:1000 dilution) and processed for fluorescence-based detection as described by LI-COR Biosciences using appropriate secondary antibodies (IRDye 680RD Donkey anti-Goat, IRDye 680RD Donkey anti-Rabbit, IRDye 800CW Donkey anti-Mouse) at 1:10,000 dilution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>B6429</div><div>suggested: (LSBio (LifeSpan Cat# LS-B6429-50, RRID:AB_11134145)</div></div><div style="margin-bottom:8px"><div>anti-Goat</div><div>suggested: (LI-COR Biosciences Cat# 926-68074, RRID:AB_10956736)</div></div><div style="margin-bottom:8px"><div>anti-Rabbit</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-Mouse</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ORF6-OPG2, ORF8-OPG2, M-OPG2 and S-OPG2 were generated by inserting the respective cDNAs in frame between NheI and AflII sites of a pcDNA5/FRT/V5-His vector (Invitrogen) containing a C-terminal OPG2 tag (MNGTEGPNFYVPFSNKTG).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S-OPG2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Microsomal translation reactions (20 μL) were performed for 30 min at 30°C whereas those using SP HeLa cells were performed on a 1.5X scale (30 μL translation reactions) for 1 h at 30°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/short/2020.11.24.390039
doi.org doi.org

https://doi.org/10.1101/2020.05.14.093054

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.05.14.093054: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: The animal study has complied with the guidelines of the Institutional Animal Care and Use Committee (IACUC) of the Shanghai Jiao Tong University.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mice: 6-8 weeks old, male, specific-pathogen-free (SPF) C57BL/6 mice were inoculated with VSP, IDLV, or PBS by foot-pad injection.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The membrane was blocked by 5% fat-free milk dissolved in TBS/0.05% Tween-20 for 1 hr then cut off according to the marker and incubated with anti-flag monoclonal antibody (Sigma) overnight at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-flag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The membranes were incubated with anti-mouse secondary antibodies (Cell Signaling Technology) for 1 hr at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse secondary antibodies ( Cell Signaling Technology ) for 1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then stained by anti-flag tag antibody (Proteintech) followed by Alexa Fluor 555 IgG incubation (Cell Signaling Technology) and nuclei staining with DAPI (Beyotime Biotechnology).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-flag tag</div><div>suggested: (Cell Signaling Technology Cat# 3768, RRID:AB_1642183)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell cultures: 293T and Huh-7 cells were cultured in DMEM (Gibco, USA) supplemented with 10% fetal bovine serum (Gibco, USA) and 1% penicillin/streptomycin (P/S) (Thermo Fisher Scientific,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">THP-1 cells were differentiated into macrophage-like cells with 150 nM phorbol 12-myristate 13-acetate (PMA) (Sigma) before the experiment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>THP-1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Huh-7 cells were subsequently lysed with 50 μL lysis reagent (Promega), and 30 μL lysates were transferred to 96-well Costar flat-bottom luminometer plates (Corning Costar) for the detection of relative light units using the Firefly Luciferase Assay Kit (Promega) with an Ultra 384 luminometer (Tecan).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mice: 6-8 weeks old, male, specific-pathogen-free (SPF) C57BL/6 mice were inoculated with VSP, IDLV, or PBS by foot-pad injection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A nonlinear regression analysis was performed on the resulting curves using Prism (GraphPad) to calculate half-maximal inhibitory concentration (EC50) values.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.05.14.093054
doi.org doi.org

https://doi.org/10.1101/2020.06.09.20127050

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.06.09.20127050: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Samples from negative controls ranged in age from 19 to 66 years of age (median 37) and 18/30 were female (60%).</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Successful coupling was confirmed by staining ∼0.5 μL coupled beads with PE-conjugated anti-HIS tag antibodies (Santa Cruz, CAT #8036, USA) and compared to positive and negative controls by flow cytometry.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HIS tag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analyses: Technical replicates were averaged and data were imported to Prism 8.0 (GraphPad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  There are several limitations to our study that should be noted. First, our cases were all relatively mild (none requiring hospitalization or ventilation), and predominantly middle-aged females. Future studies comparing the responses of older or more severely ill subjects would be informative. Secondly, our study focuses solely on binding of ACE2 to the spike protein and ignores other potential antigens or other immune mechanisms such as inhibition of protease cleavage that might prevent viral entry into the cell. The results of our bead-based assay should be confirmed using a pseudovirus assay, or ideally using live SARS-CoV-2 virus. Third, it is unclear what level of inhibition would correlate with functional resistance to re-infection. Follow-up studies tracking inhibition in our assay over time while simultaneously monitoring subjects for re-infection will be necessary, given the ethical impossibility of experimental human inoculation. Finally, our SARS-CoV-2 PCR+, antibody negative samples leave many questions. For example, did they clear the virus through mechanisms beyond our detection, such as antibodies targeted to alternative viral proteins or non-B-cell dependent mechanisms? Or were their rtPCR results false positives? Most importantly, are they susceptible to future infections? Follow-up with these or similar individuals will be important. In conclusion, the trimer inhibition assay presented here could be broadly useful in the settings of routine clinical evaluati...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.06.09.20127050
biorxiv.org biorxiv.org

https://doi.org/10.1101/2020.06.27.174953

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.06.27.174953: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All animal procedures were performed in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals, under protocols approved and strictly followed by the Institutional Animal Care and Use Committees (IACUC)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">All image data shown are representative of at least three randomly selected fields.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Male C57BL/6 mice were obtained from Shanghai SLAC Laboratory Animal Co., Ltd.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Blots were probed with antibodies against HA-Tag (C29F4) (3724, CST, USA), GSDMD (L60) (93709, CST, USA),</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HA-Tag</div><div>suggested: (Cell Signaling Technology Cat# 3724, RRID:AB_1549585)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture and treatment: HEK293, MCF-7, Caco2, Vero E6, HeLa, HepG2, SH-SY5Y cells were grown in 90% DMEM basal medium (Gibco, USA) supplemented with 10% fetal bovine serum (Gibco, USA), 2 mM L-glutamine and 100 units /mL penicillin/streptomycin (Gibco, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MCF-7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Caco2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HepG2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SH-SY5Y</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">1% NEAA (Gibco, USA) was added in above medium for A498 cells culture.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A498</div><div>suggested: NCI-DTP Cat# A498, RRID:CVCL_1056)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Besides, HCT116 and HT-29 cells were grown in McCoy’s 5A basal medium (Gibco, USA), PC3 and A549 cells were grown in RPMI-1640 basal medium (Hyclone, USA) and CHO cells were grown in DMEM/F-12 basal medium (Gibco, USA) supplemented as above. 16HBE cells were grown in KM (ScienCell, USA) medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HCT116</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HT-29</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>PC3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CHO</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Male C57BL/6 mice were obtained from Shanghai SLAC Laboratory Animal Co., Ltd.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C57BL/6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The percentages of differently labeled cells were calculated by FlowJo 7.6.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The MS raw data were analyzed with MaxQuant (http://maxquant.org/,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MaxQuant</div><div>suggested: (MaxQuant, RRID:SCR_014485)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The currents were digitized using pClamp 10.2 software (Molecular Devices, US).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pClamp</div><div>suggested: (pClamp, RRID:SCR_011323)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  One limitation of our study is the lack of evidence in the context of SARS-CoV-2 infection in vivo, which can technically be achieved by generating of SARS-CoV-2 without 2-E using reverse genetics. However, the 2-E deleted SARS-CoV-2 may replicate more effectively and thus this experiment was not conducted. Although the in vivo antiviral activity of the newly identified channel inhibitors needs further studies, their potent antiviral activity in vitro and excellent protection effects against ARDS-like damage in vivo shed light on the drug development of 2-E channel inhibitors. Given that 2-E can function as ion channels in the viral membranes, similar to how they function in host cells, we propose that 2-E channels may represent a new class of dualfunction targets against SARS-CoV-2.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 21. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/short/2020.06.27.174953
doi.org doi.org

https://doi.org/10.1101/2020.04.10.036418

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.04.10.036418: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Immunizations and sera collection: All rats used in these studies were handled and maintained in accordance with NIH guidelines and approved by Institutional Animal Care and Use Committee (IACUC) of Scripps Research (Protocol 18-025).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Female Sprague Dawley rats were immunized with incremental increasing doses of antigen over seven days starting at day 0, and boosted with a similar regimen at day 30.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">hACE2 expression was confirmed by SARS1-PV and SARS2-PV entry assays and by immunofluorescence staining using mouse monoclonal antibody recognizing c-Myc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>c-Myc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, cells were stained with anti-rabbit IgG-Alexa647 antibody for 45 minutes at 4°C, and mean fluorescence intensities were measured for each well by flow cytometry.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit IgG-Alexa647</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Measurement of antibody-dependent enhancement: The ability of anti-SARS-CoV-2 RBD immune plasma to mediate antibody-dependent enhancement (ADE) was measured using HEK293T cells or HEK293T cells stably expressing human ACE2 (293T-ACE2 cells), transfected using the calcium phosphate transfection method to express the rat ortholog of FcγRI (CD64).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD64</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T-hACE2 cells were selected and maintained with medium containing puromycin (Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein Production: Expi293 cells (Thermo-Fisher) were transiently transfected using FectoPRO (Polyplus) with plasmids encoding SARS-CoV2 RBD with a human or rabbit-Fc fusion or a C-terminal C-tag (-EPEA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One hour later, 104 ACE2-239T cells were added along with DEAE-Dextran (final concentration 5 µg/ml), and media was exchanged 6 hours later with fresh media without rat sera.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2-239T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Measurement of antibody-dependent enhancement: The ability of anti-SARS-CoV-2 RBD immune plasma to mediate antibody-dependent enhancement (ADE) was measured using HEK293T cells or HEK293T cells stably expressing human ACE2 (293T-ACE2 cells), transfected using the calcium phosphate transfection method to express the rat ortholog of FcγRI (CD64).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The human monocytic cell line K562 (ATCC CCL-243), which endogenously expresses FcγRII, was also used for ADE assays.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K562</div><div>suggested: ATCC Cat# CCL-243, RRID:CVCL_0004)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Female Sprague Dawley rats were immunized with incremental increasing doses of antigen over seven days starting at day 0, and boosted with a similar regimen at day 30.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sprague Dawley</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses: The statistical significance of differences between preimmune and immune sera, or ACE2-Ig, in their abilities to neutralize, bind the S protein, and mediate ADE was analyzed by two-way ANOVA calculated using GraphPad Prism 8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.04.10.036418
doi.org doi.org

https://doi.org/10.1101/2020.04.10.032342

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.04.10.032342: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were then stained with 5 μg/mL RBD-Fc proteins at 37 °C for 10 min, washed three times, and then stained with 2 μg/mL Alexa488 conjugated goat anti-mouse IgG secondary antibody (Invitrogen, Cat. No. A-11001) at room temperature for 20 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (Thermo Fisher Scientific Cat# A-11001, RRID:AB_2534069)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2-S-tag expression was detected by using 6.2, a mouse anti-S-tag monoclonoal antibody (Invitrogen, Cat. No. MA1-981), and an HRP-conjugated goat anti-mouse IgG Fc secondary antibody (Invitrogen, Cat. No. 31437).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S-tag</div><div>suggested: (Thermo Fisher Scientific Cat# MA1-981, RRID:AB_347008)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike-C9-tag expression was then detected by using 1D4, a mouse anti-C9-tag monoclonal antibody (Invitrogen, Cat. No. MA1-722), and the HRP-conjugated goat anti-mouse IgG Fc secondary antibody (Invitrogen, Cat. No. 31437).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-C9-tag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T-based stable cells expressing human ACE2 were maintained under the same culture condition as 293T, except that 3 μg/mL of puromycin was added to the growth medium.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-based</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293F cells for recombinant protein production was generously provided by Dr. Yu J.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293F</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of reporter retroviruses pseudotyped with coronavirus spike proteins or VSV-G: 293T cells were seeded at 30% density in 150 mm dish at 12-15 hours before transfection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using two-sided two-sample Student’s t-test using GraphPad Prism 6.0 software when applicable.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on page 12. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.04.10.032342
doi.org doi.org

https://doi.org/10.1101/2020.06.02.130161

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.06.02.130161: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">In brief, the adult male alpaca Tyson at PreClinics, Germany, was immunized 4 times in a 60-day immunization schedule.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cell lines used for experiments were negative for Mycoplasma as determined by PCR.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound nanobodies were detected with anti-E tag (Bethyl laboratories) secondary antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-E tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were incubated with anti-dsRNA antibody (1:2000, J2 Scicons) for 1 hour at room temperature followed by 1 hour staining with the secondary antibody anti-mouse-Alexa Fluor 488 (1:2000, Thermo Fisher Scientific), Hoechst (1:1000, Invitrogen) and Ty1-AS635P (0.05 μg/mL).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-dsRNA</div><div>suggested: (Millipore Cat# MABE1134, RRID:AB_2819101)</div></div><div style="margin-bottom:8px"><div>anti-mouse-Alexa</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A HEK293T cell line engineered to overexpress human ACE2 (HEK293T-ACE2) was generated by the lentiviral transduction of HEK293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">TG1 cells (Lucigen) were transformed with this library by electroporation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TG1</div><div>suggested: RRID:CVCL_0P34)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Approximately 15,000 HEK293T-ACE2 cells were then added to each well and the plates were incubated at 37°C for 48 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunofluorescence: Vero E6 cells were seeded onto coverslips in a 24-well plate and incubated overnight at 37°C/5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fluorescence was quantified using a BD FACSCelesta and the FlowJo software package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Coverslips were mounted in mounting media and images were obtained using Zeiss Axiovert microscope and processed using Adobe Photoshop.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Adobe Photoshop</div><div>suggested: (Adobe Photoshop, RRID:SCR_014199)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Extracted particles were imported into cryoSPARC v2.15.036 for 2D classification, 3D classification and non-uniform 3D refinement.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>cryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structure refinement and manual model building were performed using COOT and PHENIX44 in interspersed cycles with secondary structure and geometry restrained.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.06.02.130161
doi.org doi.org

Structural Basis for Potent Neutralization of Betacoronaviruses by Single-domain Camelid Antibodies

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.03.26.010165: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Immunizations and handling of the llama were performed according to directive 2010/63/EU of the European parliament for the protection of animals used for scientific purposes and approved by the Ethical Committee for Animal Experiments of the Vrije Universiteit Brussel (permit No. 13-601-1).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Periplasmic ELISA screen to select MERS- and SARS-CoV directed VHHs: After panning, 45 individual colonies of phage infected bacteria isolated after the first panning round on MERS-CoV S-2P or SARS-CoV-1 S-2P protein and 45 individual colonies isolated after the second panning round on MERS-CoV S-2P or SARS-CoV-1 S-2P protein were randomly selected for further analysis by ELISA for the presence of MERS-CoV and SARS-CoV-1 specific VHHs, respectively.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Llama immunization: A llama, negative for antibodies against MERS-CoV and SARS-CoV-1 S glycoprotein, was subcutaneously immunized with approximately 150 µg recombinant SARS-CoV-1 S-2P protein on days 0, 7, 28 and 150 µg recombinant MERS-CoV S-2P protein on days 14 and 28 and 150 µg of both MERS-CoV S-2P and SARS-CoV-1 S-2P protein on day 35 (Kirchdoerfer et al., 2018; Pallesen et al., 2017).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-1 S glycoprotein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In the PE-ELISA screen after panning on SARS-CoV-1 S protein wells of microtiter plates (type II, F96 Maxisorp, Nuc) were coated with 100 ng SARS-CoV-1 S-2P protein (with foldon), SARS-CoV-1 S-2P protein captured with an anti-foldon antibody (with foldon) or as negative controls coated with MERS-CoV S-2P (without foldon), HCoV-HKU1 S-2P (without foldon), DS-Cav1 (with foldon) or bovine serum albumin (BSA, Sigma-Aldrich).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-foldon</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding was detected by incubating the plates sequentially with either mouse anti-Histidine Tag antibody (MCA1396, Abd Serotec) followed horseradish peroxidase (HRP)-linked anti-mouse IgG (1/2000, NXA931, GE Healthcare) or Streptavidin-HRP (554066, BD Biosciences) or by an HRP-linked rabbit anti-camelid VHH monoclonal antibody (A01861-200, GenScript).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Histidine Tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>MCA1396</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG ( 1/2000 , NXA931 , GE Healthcare )</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Streptavidin-HRP</div><div>suggested: (BD Biosciences Cat# 554066, RRID:AB_2868972)</div></div><div style="margin-bottom:8px"><div>anti-camelid VHH</div><div>suggested: (GenScript Cat# A01860, RRID:AB_2734123)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding of the VHH-72-Fc and VHH-72-Fc (S) to cells was determined by an AF633 conjugated goat anti-human IgG antibody and binding to SARS-CoV-1 or SARS-CoV-2 S was calculated as the mean AF633 fluorescence intensity (MFI) of GFP expressing cells (GFP+) divided by the MFI of GFP negative cells (GFP-).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (R and D Systems Cat# AF633, RRID:AB_355491)</div></div><div style="margin-bottom:8px"><div>SARS-CoV-1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GFP-</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, the cells were washed 3 times with PBS containing 0.5% BSA and stained with an AF647 conjugated donkey anti-mouse IgG antibody (Invitrogen) for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, pseudoviruses expressing spike genes for MERS-CoV England1 (GenBank ID: AFY13307) and SARS-CoV-1 Urbani (GenBank ID: AAP13441.1) were produced by co-transfection of plasmids encoding a luciferase reporter, lentivirus backbone, and spike genes in 293T cells (Wang et al., 2015).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serial dilutions of VHHs were mixed with pseudoviruses, incubated for 30 min at room temperature, and then added to previously-plated Huh7.5 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7.5</div><div>suggested: RRID:CVCL_7927)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the VSV pseudotype neutralization experiments, the pseudoviruses were incubated for 30 min at 37 °C with different dilutions of purified VHHs or with dilution series of culture supernatant of 293S cells that had been transfected with plasmids coding for SARS VHH-72 fused to human IgG1 Fc (VHH-72-Fc) or with GFP-binding protein (GBP: a VHH specific for GFP).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293S</div><div>suggested: RRID:CVCL_A784)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The incubated pseudoviruses were subsequently added to confluent monolayers of Vero E6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, suspension-adapted and serum-free HEK 293S cells were seeded at 3 x 106 cells/mL in Freestyle-293 medium (ThermoFisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293S</div><div>suggested: RRID:CVCL_A784)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Supernatant of non-transfected and VHH-72-Fc transfected HEK293-S cells was applied in a three-fold dilution series in kinetics buffer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293-S</div><div>suggested: RRID:CVCL_A784)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Curve fitting was performed using nonlinear regression (Graphpad 7.0)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting molecular replacement solutions were iteratively rebuilt and refined using Coot, ISOLDE and Phenix (Adams et al., 2002; Croll, 2018; Emsley and Cowtan, 2004).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.03.26.010165
biorxiv.org biorxiv.org

http://biorxiv.org/cgi/content/short/2021.01.13.426626

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2021.01.13.426626: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All animal studies were approved by the Institutional Animal Ethics committee (IAEC) (RR/IAEC/61-2019, Invivo/GP/084).<br>IRB: The ethics approval of human clinical samples were approved by Institute Human Ethical Committee (Approval No: CSIR-IGIB/IHEC/2020-21/01) CPE based viral Neutralization assay: Mice and Guinea pig pre-immune (negative control) sera and post boost sera were assayed for virus neutralization.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Mice and Guinea Pig Immunizations: Immunizations of BALBc mice (n=5/group, female, 3-4 weeks old, ∼16-18 g) and Hartley strain guinea pigs (n=5/group, female, 6-8 weeks old, ∼300 g) were performed with freshly adjuvanted (AddaVax™ (vac-adx-10)) protein (1:1 v/v Antigen : AddaVax™ ratio per animal/dose, 20 µg protein in 50 µl PBS (pH 7.4) and 50 µl AddaVax™) (InvivoGen, USA).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Trimeric RBD, ACE2-hFc and antibody expression constructs: The present trimeric mRBD construct consists of an N-terminal trimerization domain of human cartilage matrix protein (hCMP) (hCMP residues 298-340) (accession number AAA63904) linked by a 14-residue flexible linker (ASSEGTMMRGELKN) derived from the V1 loop of HIV-1 JR-FL gp120 linked to RBD residues 332-532 (accession number YP_009724390.1) with an engineered glycosylation site (NGS) at N532 fused to an HRV-3C precision protease cleavage site linked to a 10x Histidine tag by a GS linker.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>gp120</div><div>suggested: (Fitzgerald Industries International Cat# 10R-G114a, RRID:AB_1285924)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The expression levels were checked using a dot blot analysis with Anti-his tag antibodies conjugated with HRP enzyme.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-his tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SPR-binding of hCMP-mRBD analyte to immobilized ACE2-hFc/CR3022: hCMP-mRBD protein kinetic binding studies to ACE2-hFc and CR3022 antibody were performed on a ProteOn XPR36 Protein Interaction Array V.3.1 (Bio-Rad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CR3022</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Next, three washes were performed (200 µL of PBST/well) and anti-Human IgG secondary antibody (Sigma-Aldrich)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human IgG</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of adherent polyclonal Flp-In stable lines: T25 flasks (5 ml media) having either adherent Flp-In™-293 or Flp-In™-CHO cells (∼80 % confluent) were co-transfected with pOG44 (10 µg) and hCMP-mRBD-HRV-Tg-pcDNA5/FRT/TO (5µg) plasmid DNA using 35 µg of Lipofectamine™ 2000 Transfection Reagent (Thermo Fisher Scientific, Cat # 11668030) in serum free media as per the manufacturers instruction for 4 hr.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flp-In</div><div>suggested: RRID:CVCL_U423)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(Thermofisher Scientific Cat# 10687010) for Flp-In™-293 and 750 µg/ ml for Flp-In™-CHO cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flp-In™-293</div><div>suggested: RRID:CVCL_U421)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Tagless protein purification: The spent media from stable hCMP-mRBD-HRV-Tg-Flp-In™-293 or Flp-In™-CHO grown cells contained the expressed protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Flp-In™-CHO</div><div>suggested: RRID:CVCL_U424)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The virus-serum incubated premix samples were serially diluted and plated in duplicates in VeroE6 cell containing 96 well plate (104/well) and cultured for 48/96 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293T cells were transiently transfected with plasmid DNA pHIV-1 NL4.3Δenv-Luc and Spike-Δ19-D614G by using Profection mammalian transfection kit (Promega Inc) following the instructions in the kit manual.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Patient derived convalescent sera (n = 40) were tested for neutralization in both 293T-ACE-2 and Vero/TMPRSS2 cells whereas animal sera were tested only in Vero/TMPRSS2 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero/TMPRSS2</div><div>suggested: JCRB Cat# JCRB1818, RRID:CVCL_YQ48)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The correlation coefficients for ACE2-hFc receptor competition, pseudovirus, live virus and 293T-ACE2/VeroE6-TMPRSS2 cell line pseudovirus neutralizations were analysed by Spearman correlation using the GraphPad Prism software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2/VeroE6-TMPRSS2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The unbound tagless proteins concentration was determined by absorbance (A280) using NanoDrop™2000c with the theoretical molar extinction coefficient calculated using the ProtParam tool (ExPASy)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ProtParam</div><div>suggested: (ProtParam Tool, RRID:SCR_018087)</div></div><div style="margin-bottom:8px"><div>ExPASy</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reference-free 2D classification using single-particle analysis: The evaluation of micrographs was done with EMAN 2.1 (58).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EMAN</div><div>suggested: (EMAN, RRID:SCR_016867)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reference free 2D classification of different projections of particle were calculated using simple_prime2D of SIMPLE 2.1 software (59).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SIMPLE</div><div>suggested: (SIMPLE, RRID:SCR_009389)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical Analysis: The p values for ELISA binding titers, neutralization titers, ACE2 receptor competition titers were analysed with a two-tailed Mann-Whitney test using the GraphPad Prism software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/short/2021.01.13.426626
doi.org doi.org

https://doi.org/10.1101/2020.05.19.104281

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.05.19.104281: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alternatively, 10 μg/ml antibody A was captured by anti-human Fc biosensor (ForteBio, cat# 18-5060) until saturation, followed by sequential binding of 10 μg/ml RBD, antibody B.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human Fc biosensor</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To examine if the antibody hits from ELISA screening were still capable of binding to native spike trimer, the individual antibody hit at 5 μg/ml and/or ACE2-mFc was incubated with 1-2 million 1D8 spike+ cells and detected by anti-human-Fc PE (invitrogen, 12-4998-82) and FITC Goat anti-mouse-IgG (Biolegend, cat#405305) or APC Goat anti-mouse-IgG (Biolegend, cat# 405308) following standard FACS protocol and analyzed by Beckman FACS (CytoFLEX, CytExpert2.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human-Fc PE</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse-IgG</div><div>suggested: (Proteintech Cat# 10283-1-AP, RRID:AB_2877728)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Neutralization assay of RBD-antibodies by FACS: To check whether ACE2-Spike interaction can be blocked by the isolated nAbs, individual titrated antibody from 10 ug/ml down to 0.31 ug/ml (2 times down) was incubated with 1-2 spike+ cells for 1 hour at 4°C before adding of 0.02 ug/ml ACE2-mFc followed by FITC conjugated anti-mouse IgG (Biolegend, cat#405305) and the MFI of FITC and positive percentage were collected.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (BioLegend Cat# 405305, RRID:AB_315008)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Construction of Covid-19 spike-expressing cell line: To express the spike (S) protein of SARS-CoV-2 in mammalian cells, a codon optimized cDNA (GenBank:NC_045512.2) encoding the full-length S protein, a transmembrane motif (TM) and 3xFLAG tag was synthesized and cloned into a pRRL-derived vector (R48) by XbaI/XmaI, yielding pRRL-19S-FLAG-BSD. 293FT cells were transfected with lenti-viral made from SARS-CoV-2 S plasmid and other vectors (pLP-1-Gag/Pol, pLP-2-Rev and pLP-VSVG, all in-house made) containing packaging elements.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293FT</div><div>suggested: ATCC Cat# PTA-5077, RRID:CVCL_6911)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One each of Kappa and lambda EHL Library aliquots were mixed and blocked with 4% milk PBS (MPBS), 10 million 293F cells (to deplete potential binders to residual protein contaminated in vendor’s RBD) and 10μg/ml mouse IgG (to deplete mouse Fc binders) before adding the library stock to the RBD-coating wells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293F</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

doi.org/10.1101/2020.05.19.104281
biorxiv.org biorxiv.org

http://biorxiv.org/cgi/content/short/2020.11.18.388934

1
1. sciscore 23 Mar 2021
  
  in Public
  
  SciScore for 10.1101/2020.11.18.388934: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: Protein immunizations and sera collection in rats: All animals used in these studies were handled and maintained in accordance with NIH guidelines and approved by Institutional Animal Care and Use Committee (IACUC) of Scripps Research (Protocol 18-025).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Female Sprague Dawley rats were immunized with incremental increasing doses of antigen over seven days starting at day 0, and boosted with a similar regimen at day 30.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">hACE2 expression was confirmed by SARS1-PV and SARS2-PV entry assays and by immunofluorescence staining using mouse monoclonal antibody recognizing c-Myc.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>c-Myc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing, cells were stained with anti-rabbit IgG-Alexa647 antibody for 45 minutes at 4°C, and mean fluorescence intensities were measured for each well by flow cytometry.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit IgG-Alexa647</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Measurement of antibody-dependent enhancement: The ability of anti-SARS-CoV-2 RBD immune sera to mediate antibody-dependent enhancement (ADE) was measured using HEK293T cells or HEK293T cells stably expressing human ACE2 (293T-hACE2 cells), transfected using the calcium phosphate transfection method to express the rat ortholog of FcγRI (CD64).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD64</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T-hACE2 cells transduced with MLV vectors were selected and maintained with medium containing puromycin (Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein Production: Expi293 cells (Thermo-Fisher) were transiently transfected using FectoPRO (Polyplus) with plasmids encoding SARS-CoV2 RBD with a human or rabbit-Fc fusion or a C-terminal C-tag (-EPEA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For mouse studies, one hour later, 104 ACE2-239T cells were added and spun at 3000×g for 30 minutes at 4°C, was then returned to 37°C, and media was exchanged 2 hours later with fresh media without mouse sera.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2-239T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Measurement of antibody-dependent enhancement: The ability of anti-SARS-CoV-2 RBD immune sera to mediate antibody-dependent enhancement (ADE) was measured using HEK293T cells or HEK293T cells stably expressing human ACE2 (293T-hACE2 cells), transfected using the calcium phosphate transfection method to express the rat ortholog of FcγRI (CD64).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The human monocytic cell line K562 (ATCC CCL-243), which endogenously expresses FcγRII, was also used for ADE assays.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K562</div><div>suggested: ATCC Cat# CCL-243, RRID:CVCL_0004)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Female Sprague Dawley rats were immunized with incremental increasing doses of antigen over seven days starting at day 0, and boosted with a similar regimen at day 30.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sprague Dawley</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Female 8 to 9-week-old BALB/cJ mice were electroporated with 60 μg DNA in each hindquarter for a total dose of 120 μg on day 0 and day 14.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/cJ</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/short/2020.11.18.388934
stackoverflow.com stackoverflow.com

Chrome on Android resizes font

1
1. gyuri 22 Mar 2021
  
  in Public
  
  Include the following <meta> tag in the document <head>: <meta name="viewport" content="width=device-width, initial-scale=1"> This will correctly establish the view frame, and thus eliminate the need for "FontBoosting".
  
  web - gotcha : fontboosting
Visit annotations in context

Annotators

gyuri

URL

stackoverflow.com/questions/11289166/chrome-on-android-resizes-font
drive.google.com drive.google.com

PDF.js viewer

1
1. Acarroll_Ksc 21 Mar 2021
  
  in Public
  
  The@featurewehavejustdiscussedhelpedpeopleorganizeintopairsandcreateconversationalstreams.
  
  The only time I really used the @ symbol, is really just to tag friends In pictures online or tag them in a video so it will pop up in their notifications. Never really looked at it as a pairing tool but more of a social tool.
Visit annotations in context

Annotators

Acarroll_Ksc

URL

drive.google.com/uc
vitalik.ca vitalik.ca

An Incomplete Guide to Rollups

1
1. mmliu 21 Mar 2021
  
  in Public
  
  via https://news.ycombinator.com/item?id=25640976
  
  LOL, my tag makes me laugh
  
  read-it-never ETH
Visit annotations in context

Tags

read-it-never

ETH

Annotators

mmliu

URL

vitalik.ca/general/2021/01/05/rollup.html
impedagogy.com impedagogy.com

Muse Matters

2
1. tellio 20 Mar 2021
  
  in Public
  
  the Hypothes.is extension called “Fetch”:
  
  Browser extension for fetching and formatting Hypothes.is annotations into markdown bullet points, ready for copying into Roam, Notion or similar apps.
  
  Here are our annotations so far fetched by Fetch:
  
  Muse Matters
  
  Source: https://impedagogy.com/wp/blog/2021/03/19/muse-matters/
  
  ^^Please respond in any way you wish to the blog post. I will take our responses and share them in another blog post as well as use the responses for remix, sharing, and other creative uses. Please tag your responses if it seems appropriate.^^
  
  Muse
  
  ^^Reminded of Chapter 11 in The Odyssey: I am likely going to retire this year and I find resonance in this as it appears that I will be accepting a "voluntary" buyout at the end of this fiscal year. My long sea journey, 25 years worth in teaching, will be officially over. Hence...the appeal to propitiate the gods, to let all the pain go, to ask forgiveness of the implacable Poseidon. ^^
  
  then convert that
  
  "then have them convert that"
  
  describe how you might go about creating a poem, short story, or play from the blog post.
  
  ^^I am always a little surprised by how few students choose this option. I should ask them. ^^
  
  using Fetch
2. tellio 20 Mar 2021
  
  in Public
  
  Please respond in any way you wish to the blog post. I will take our responses and share them in another blog post as well as use the responses for remix, sharing, and other creative uses.
  
  Please tag your responses if it seems appropriate.
Visit annotations in context

Tags

using Fetch

Annotators

tellio

URL

impedagogy.com/wp/blog/2021/03/19/muse-matters/
twitter.com twitter.com

TrailHub on Twitter

1
1. gyuri 20 Mar 2021
  
  in Public
  
  So few retweets and likes. Yet it is IHO is the best thing since sliced bread: https://hyp.is/z4Pv0IiUEeuXsdeOc5Pikw/hackernoon.com/tagspaces-the-welcome-screen-is-a-welcome-sight-yh383572… Privacy focused Open Core no-backend n- vendor lock-in Cloudless Computing Stable Reliable Continuity It's Own Ecosystem photo, file, tag organizer gateway to cloud storage
  
  about : TagSpaces
Visit annotations in context

Annotators

gyuri

URL

twitter.com/TrailHub1/status/1372847080704737280
twitter.com twitter.com

Tweet / Twitter

2
1. NatasjaDerbyMcCabe 19 Mar 2021
  
  in BehSci
  
  You can always see the latest SocArXiv papers on COVID-19 topics here: https://bit.ly/2XNVF7b. You can comment using the @hypothes_is tool, and endorse using the @PlauditPub button. And add your own work, using the covid-19 tag.
  
  ann:text
2. NatasjaDerbyMcCabe 02 Mar 2021
  
  in BehSci
  
  SocArXiv. (2020, May 30). You can always see the latest SocArXiv papers on COVID-19 topics here: Https://t.co/pzqftUqY81. You can comment using the @hypothes_is tool, and endorse using the @PlauditPub button. And add your own work, using the covid-19 tag. Https://t.co/owGxoaDfsJ [Tweet]. @socarxiv. https://twitter.com/socarxiv/status/1266796731527806983
  
  is:tweet lang:en SocArXiv papers pandemic latest topics informative social science
Visit annotations in context

Tags

is:tweet

latest

informative

pandemic

SocArXiv

lang:en

papers

topics

social science

ann:text

Annotators

NatasjaDerbyMcCabe

URL

twitter.com/socarxiv/status/1266796731527806983
github.com github.com

Speed up Vim startup by rainux · Pull Request #98 · VundleVim/Vundle.vim

1
1. TylerRick 18 Mar 2021
  
  in Public
  
  Here are my thoughts: making vim startup time shorter is GOOD added complexity - BAD my main concern is with the complexity that gets added to get startup time improvements. User has to tag scripts, and then manually BundleBind to get scripts loaded. This seems like too much hassle(manual involvement) to me. Fixing 1 time thing (startup) we're adding many more (like BundleBinding required scripts once they're used) For instance in my case i don't start Vim often because i'm using --remote-tab-silent option. So i'll get no benefit along with complexity (
  
  avoid complexity fast startup times
Visit annotations in context

Tags

avoid complexity

fast startup times

Annotators

TylerRick

URL

github.com/VundleVim/Vundle.vim/pull/98
loganhr.online loganhr.online

Home - Logan HR Test Site

1
1. lizg 18 Mar 2021
  
  in Public
  
  Partnering with businesses to help them think forward,guide their people onward, and grow upwards
  
  Maybe a little long for tag line? Although haven't come up with anything else?
Visit annotations in context

Annotators

lizg

URL

loganhr.online/
drive.google.com drive.google.com

PDF.js viewer

3
1. Ashley_Jewell 17 Mar 2021
  
  in Public
  
  Theaggregation,andcounting,ofthesemarkersofconversationalitycreatedanewsetofmetrics,andwiththatanewsetofaspirationsandex-ploitsthatcontinuetoreshapetheplatform.
  
  I remember being younger and getting an adrenaline rush whenever I would get a mention or someone would tag me in something. I think it's because it's a different way of showing someone that you are thinking about them.
2. Jacquelyn.Lanahan 16 Mar 2021
  
  in Public
  
  Thisuseofthe@symbolprecedinganotherusersnamestartedtobecomearegularconventionforaddressingotherusers
  
  From my time on Twitter, this has been the most common way "@" was used - to "tag" a certain account.
3. cem1082 16 Mar 2021
  
  in Public
  
  Thisgavethe@symbolbothlocativeandcommunicativeproperties,specifyingwhereamessageshouldgo,andalsoforwhomitwasmeant
  
  Like it was stated above. the @ symbol can be used to tag somebody or an account and it can be used to show a location! There is many different meanings to it!
Visit annotations in context

Annotators

Jacquelyn.Lanahan

Ashley_Jewell

cem1082

URL

drive.google.com/uc
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.03.01.433503

1
1. sciscore 15 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.03.01.433503: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies and reagents: Antibodies used in this study include: SARS-CoV-2 spike (GeneTex, Taiwan), HA tag, EEA1 (Cell Signaling Technology, Danvers, MA), HIV-p24 (SinoBiological, Beijing, China)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HA tag , EEA1 ( Cell Signaling Technology , Danvers , MA)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HIV-p24</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">PI4P and PI(4,5)P2 antibodies were purchased from Echelon Biosciences.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PI(4,5)P2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines and constructs: Huh 7, Vero E6 and 293T cells were grown in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">293T-ACE2 stable cell lines were generated by transfecting 293T cells with pSMPUM-ACE2 and selected with blasticidin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For phosphatase inhibition test, 293T-ACE2 cells were first transfected with Sac1 or INPP5E.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.03.01.433503
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.03.05.21249174

1
1. sciscore 15 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.03.05.21249174: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: The email provided information about the study and links to a screening eligibility survey, informed consent document, initial survey regarding COVID-19 risk factors, and information regarding shipping addresses.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">A total of 1,001 individuals were then randomly selected to receive a sampling kit.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were then assayed for SARS-CoV-2 antibodies according to published protocols.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Batches were control for purity by SDS-PAGE followed by Coomassie staining and ELISA using an anti His-tag monoclonal antibody.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti His-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were tested against IgG and positive samples were confirmed and tested with anti IgM antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti IgM</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">18,19 The RBD protein was produced in-house via transfection of HEK293T cells using polyethylenimine (Plasmid was a generous gift from Pr. F. Kramer mount Sinai School of Medicine).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All survey responses were collected and stored in REDCap.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  These results reinforce results from other studies: asymptomatic illness is an important contributor to observed force of infection; and important limitations of testing availability at the time of survey. Differing antibody dynamics have been reported in other studies. A number of studies have found sustained antibody levels for over 3 months,29,30 while others have found IgG levels can remain 6 months or more.31–33 An additional study has reported rapid waning of routine serological markers in individuals who had lower initial antibody responses.34. Only 7.1% of those with high titers at baseline seroreverted to a level below the threshold for positivity within 60 days, compared to 64.9% of those with lower titers at baseline.34 Evidence for IgM seropositivity was not detected in any of IgG positive samples, which is consistent with results from other surveys studies that included asymptomatic or subclinical populations due to rapidly waning titers.32,35 Studies have shown that IgM levels decline more rapidly after infection than IgA and IgG levels, 30,36,37, and this is especially apparent with asymptomatic and sub-clinical infections.32,35 Trends in the patterns of SARS-CoV-2 antibody levels vary greatly depending on the timing of sampling and severity of disease.31,32,35 Seroconversion times vary depending on the study, but one study found a median time-to-seroconversion for IgM of 8 days and median seroconversion for IgG of 10 days. Additionally, the SARS-CoV-2 IgG resp...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  Thank you for including a protocol registration statement.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.03.05.21249174
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.03.08.433449

1
1. sciscore 15 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.03.08.433449: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All experiments were in compliance with the German animal protection law and approved by the animal welfare committee of the Regierungspräsidium Freiburg (permit G-20/91).<br>IRB: Housing conditions and experimental procedures were approved by the ethics committee of animal experimentation of KU Leuven (license P065-2020).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">In brief, female Syrian hamsters (Mesocricetus auratus) of 6-8 weeks’ old were anesthetized with ketamine/xylazine/atropine and inoculated intranasally with 50 µL containing 2×106 TCID50 SARS-CoV-2 BetaCov/Belgium/GHB-03021/2020.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Open reading frames corresponding to the light and heavy chains of the hIgG1 anti-SARS-CoV-2 antibody S309 were ordered synthetically at IDT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding was detected by incubating the plates sequentially with either mouse anti-Histidine Tag antibody (MCA1396, Abd Serotec) followed by horseradish peroxidase (HRP)-linked anti-mouse IgG (1/2000, NXA931, GE Healthcare) or Streptavidin-HRP (554066, BD Biosciences) or by HRP-linked rabbit anti-human IgG (A8792, Sigma).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Histidine Tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>MCA1396</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-mouse IgG ( 1/2000 , NXA931 , GE Healthcare )</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Streptavidin-HRP</div><div>suggested: (Cell Signaling Technology Cat# 3999, RRID:AB_10830897)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding of human monoclonal antibodies palivizumab, CB6, and S309 and VHH72-Fc or variants thereof was detected with an AF633 conjugated goat anti-human IgG antibody (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CB6</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>VHH72-Fc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding of monomeric VHHs to SARS-CoV-1 or SARS-CoV-2 S was detected with a mouse anti-HisTag antibody (AbD Serotec) and an AF647 conjugated donkey anti-mouse IgG antibody (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-HisTag</div><div>suggested: (RevMAb Biosciences Cat# 54-1161-00, RRID:AB_2716428)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, the cells were washed 3 times with PBS containing 0.5% BSA and stained with an AF647 conjugated donkey anti-mouse IgG antibody (Invitrogen) for 1 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">First, a pre-screen was undertaken to determine the levels of background binding of the test antibody to untransfected HEK293 cells, and to slides spotted with gelatin +/- SARS-CoV-2 spike protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 spike protein .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-His monoclonal antibody was immobilized on S sensor chip CM3 by covalent coupling and used to capture the His-tagged Fcγ receptors.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-His</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing in PBS, the cells were fixed in 1% PFA, washed twice with PBS, blocked with 1% BSA and stained with dilution series of anti-RBD antibodies or palivizumab.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding of the antibodies was detected using Alexa fluor 633 conjugated anti-human IgG antibodies (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression of the surface-displayed myc-tagged RBDs was detected using a FITC conjugated chicken anti-myc antibody (Immunology Consultants Laboratory, Inc.).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-myc</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Where data are labeled as ‘XVR011’, protein material manufactured from a stable CHO cell line has been used in the experiments, of identical sequence as humVHH_S56A/LALA-Fc/Gen2 (which is the naming we use for the protein produced in ExpiCHO transient transfection).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Two days after transfecting HEK293T cells or HEK293S cells with spike expression plasmids each combined with a GFP expression plasmid, the cells were collected, washed once with PBS and fixed with 1% PFA for 30 minutes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293S</div><div>suggested: RRID:CVCL_A784)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV pseudovirus neutralization assay: To generate replication-deficient VSV pseudotyped viruses, HEK293T cells, transfected with SARS-CoV-1 S or SARS-CoV-2 S were inoculated with a replication deficient VSV vector containing eGFP and firefly luciferase expression cassettes77, 78.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The incubated pseudoviruses were subsequently added to subconfluent monolayers of VeroE6 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human HEK293 cells were used for reverse transfection/expression.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mouse challenge experiments: Transgenic (K18-hACE2)2Prlmn mice were originally purchased from The Jackson Laboratory.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>K18-hACE2)2Prlmn</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Simulations of the VHH72(mutant)-RBD complex were with Gromacs version 2020.141 using the Amber ff99SB-ILDN force field70 and were run for 5 nanoseconds.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gromacs</div><div>suggested: (GROMACS, RRID:SCR_014565)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike coding sequences were retrieved by aligning the genomes to the reference spike sequence annotated in NC_045512.2 (Wuhan-Hu-1 isolate, NCBI RefSeq).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RefSeq</div><div>suggested: (RefSeq, RRID:SCR_003496)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For this purpose, pairwise alignments were performed using the R package Biostrings version 2.54.0 , a fixed substitution matrix in the “overlap” mode with the following parameters according to Biostrings documentation: 1 and -3 for match and mismatch substitution scores; 5 as gap opening and 2 as gap extension penalties.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Biostrings</div><div>suggested: (Biostrings, RRID:SCR_016949)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data collected for spike protein RBD (positions 333 – 516) was visualized using ggplot2 version 3.3.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ggplot2</div><div>suggested: (ggplot2, RRID:SCR_014601)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were prepared by mixing the following: 30 µl sample (from a 1 mg/ml stock in HPLC grade water), 35 µL of 1% methylcellulose solution (ProteinSimple, 101876), 4 µl pH 3-10 pharmalytes (ProteinSimple, 042-848), 0.5 µl of 4.65, 0.5 µl 9.77 synthetic pI markers (ProteinSimple, 102223 and 102219), and 12.5 µl of 8 M urea solution (Sigma Aldrich®)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sigma Aldrich®</div><div>suggested: (Sigma-Aldrich, RRID:SCR_008988)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting MS/MS spectra were analyzed with the BioPharma FinderTM 3.0 software (Thermo Fischer Scientific) and mapped onto the appropriate protein sequence.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioPharma</div><div>suggested: (TransCelerate BioPharma, RRID:SCR_003728)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data analysis was carried out using the ASTRA 7.3.2 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ASTRA</div><div>suggested: (ASTRA, RRID:SCR_016255)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, 2019-nCoV S protein RBD that was biotinylated through an Avi-tag (AcroBiosystems, Cat nr.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AcroBiosystems</div><div>suggested: (ACRObiosystems, RRID:SCR_012550)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This is achieved by visual inspection using the images gridded on the ImageQuant software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageQuant</div><div>suggested: (ImageQuant, RRID:SCR_014246)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical evaluation (mean, SD) was conducted using Excel (Microsoft).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The binding curves were fitted using nonlinear regression (Graphpad 8.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Concentrations were back-calculated by 4PL interpolation using Graphpad Prism (9.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  While the field of SARS-CoV-2 antibody development currently sees arguments in both directions with regard to the desired extent of Fc effector functionality in diverse settings (prophylactic, therapeutic, route and frequency of administration), our LALA-Fc choice attempts to strike an optimal balance between safety and efficacy in diverse application modalities, within the limitations of relevant current clinical data, while ascertaining an established regulatory track record and freedom to operate. It was recently reported that in a therapeutic setting, some human neutralizing antibodies require intact Fc effector functions to control SARS-CoV-2 replication in the K18-hACE2 transgenic mouse and Syrian hamster challenge models68, using the LALAPG mutations to remove effector function of those antibodies. In contrast to that report, we found that Fc effector silent humVHH_S56A/LALA(PG)-Fc/Gen2 administered 4, 16 or 24 hours after viral challenge resulted in a very strong reduction of lung viral RNA and infectious virus levels. This suggests that the non-RBM binding mode of neutralization, likely including spike destabilization, perhaps combined with a faster biodistribution compared with a conventional antibody, allows for efficacious viral control. The requirement of effector functionality for therapeutic efficacy appears to be very antibody-dependent even with human antibodies, as a very recent study also demonstrated therapeutic efficacy in the same hamster model of other ...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.03.08.433449
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.03.07.21253098

1
1. sciscore 15 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.03.07.21253098: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Human subjects and specimen collection: The study protocols for the collection of clinical specimens from individuals with and without SARS-CoV-2 infection by the Personalized Virology Initiative were reviewed and approved by the Mount Sinai Hospital Institutional Review Board (IRB-16-16772; IRB-16-00791; IRB-20-03374).<br>Consent: All participants provided written informed consent prior to collection of specimen and clinical information.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For mouse samples, anti-mouse IgG conjugated to HRP was used at the same dilution (Rockland antibodies and assays; catalog #610-4302).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse IgG</div><div>suggested: (Rockland Cat# 610-4302, RRID:AB_219682)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Specifically, a mouse anti-histidine antibody (Takara; catalog #631212) was used as a positive control to detect proteins with a hexa-histidine tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-histidine</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 24 hours, cells were permeabilized and stained using an anti-nucleoprotein antibody 1C7 as discussed in detail earlier (Amanat et al., 2020b; Sun et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-nucleoprotein</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viruses and cells: Vero.E6 cells (ATCC #CRL-1586) cells were maintained in culture using Dulbecco’s Modified Eagles Medium (DMEM, Gibco) which was supplemented with 10% fetal bovine serum (FBS, Corning) and antibiotics solution containing 10,000 units/mL of penicillin and 10,000 µg/mL of streptomycin (Pen Strep, Gibco)(10).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero.E6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA: Ninety-six well plates (Immulon 4 HBX; Thermo Scientific) were coated overnight at 4°C with recombinant proteins at a concentration of 2 ug/ml in PBS (Gibco; Life Technologies) and 50 uls/well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Gibco</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All data was analyzed in Graphpad Prism 7.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Graphpad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serial dilutions of serum samples were made in 1X minimal essential medium (MEM; Life Technologies) starting at a dilution of 1:20.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MEM</div><div>suggested: (E-mem, RRID:SCR_016081)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For mutation analysis, heavy chains of mAbs and single-cell BCRs first underwent V(D)J gene annotation using IgBLAST (v1.14.0) (Ye et al., 2013) with human reference (release 201931-4) from the international ImMunoGeneTics information system (IMGT) (Giudicelli et al., 2005) and then parsing using Change-O (v0.4.6)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgBLAST</div><div>suggested: (IgBLAST, RRID:SCR_002873)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structure visualization: Structural figures were modeled and rendered in Pymol (The PyMOL Molecular Graphics System, Version 2.4 Schrödinger, LLC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  In one vaccinee not a single RBD binding mAbs was isolated with the caveats that the overall number of mAbs derived from that individual were low and their polyclonal serum antibody responses included RBD recognition. These data suggest that the NTD, which also harbors neutralizing epitopes, is - at least - as important as the RBD and warrants as much attention. In fact, five out of seven neutralizing antibodies isolated in this study bound to the NTD and only two targeted the RBD. Thus, a re-evaluation of the B cell responses to natural SARS-CoV-2 infection with unbiased approaches is needed to understand if the co-dominance of NTD and RBD is vaccine specific or also seen upon natural infection. Further characterization of the mAbs obtained in this study showed a complete loss of neutralization against an authentic, replication-competent variant virus that harbored extensive changes in the NTD. These observations may explain why a reduction in neutralization against the viral variant of concern B.1.17 is seen in some studies despite the fact the N501Y substitution in the RBD of this variant does not significantly impact binding and neutralizing activity (Emary et al., 2021). We also assessed the impact of different RBD mutations on affinity towards human ACE2. Interestingly, N501Y increased the affinity by five-fold. This increase in receptor binding affinity may contribute to the higher infectivity of B.1.1.7, which carries this mutation in its RBD. In contrast, introductio...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.03.07.21253098
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.03.09.434592

1
1. sciscore 15 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.03.09.434592: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-T7 tag HRP-conjugated secondary antibodies were diluted at 1:5000 and incubated at room temperature for 1 hour.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-T7 tag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To express the S protein, HEK293-ES cells were transiently transfected with the plasmid using polyethyleneimine and 3.5 mM valproic acid sodium salt to enhance protein production.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293-ES</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudovirus neutralization assay: The 293T-hsACE2 stable cell line and the pseudotyped SARS-CoV-2 particles (wild-type and mutants) with luciferase reporters were purchased from the Integral Molecular.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-hsACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Movies of the specimen were recorded with a nominal defocus setting in the range of −0.5 to −2.5 μm using SerialEM with beam-tilt image-shift data collection strategy with a 3 x 3 pattern and 3 shot per hole.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SerialEM</div><div>suggested: (SerialEM, RRID:SCR_017293)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Beam-induced motion correction was performed using the motion correction program implemented in Relion to generate average micrographs and dose-weighted micrographs from all frames.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Relion</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For other structures, each movie stack was processed on-the-fly using CryoSPARC live (version 3.0.0) 44,45.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CryoSPARC</div><div>suggested: (cryoSPARC, RRID:SCR_016501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After refinement, each residue of the sequence-updated models was manually checked and refined iteratively in Coot and Phenix.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div><div style="margin-bottom:8px"><div>Phenix</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structural models were validated by MolProbity.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MolProbity</div><div>suggested: (MolProbity, RRID:SCR_014226)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The Nb-RBD complex structure was superimposed on its best matched Fab-RBD structure and protein volume was calculated using ProteinVolume51.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ProteinVolume51</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The data was then processed by Prism GraphPad 9.0 to fit into a 4PL curve and to calculate the logIC50 (half-maximal inhibitory concentration).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Analysis of the data was performed using Excel.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.03.09.434592
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.03.09.434529

1
1. sciscore 15 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.03.09.434529: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Biospecimens may be collected under an IRB-approved initial waiver of consent with subsequent attempts to consent surrogates and study subjects for full study participation.<br>IRB: This study is approved by the Institutional Review board: UCSF Human Research Protection Program (HRPP) IRB# 20-30497.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Differential proportion analysis was performed using a permutation-based approach that compares observed cell type proportion differences with those calculated from a null-distribution that is generated by randomly shuffling cell type labels (100,000 permutations) for a fraction (w=0.1) of the total cells, as described previously (38).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Radioligand binding assay for anti-IFN-α2 autoantibody detection: A DNA plasmid containing full-length cDNA sequence with a Flag-Myc tag (Origene #RC221091) was verified by Sanger sequencing and used as template in T7-promoter-based in vitro transcription/translation reactions (Promega, Madison, WI: #L1170) using [S35]-methionine (PerkinELmer, Waltham, MA; #NEG709A).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IFN-α2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IFN-α2 protein was column-purified using Nap-5 columns (GE Healthcare, Chicago, IL; #17-0853-01), incubated with 2.5ul serum, or 2.5ul plasma, or 1ul anti-myc positive control antibody (CellSignal, Danvers, MA; #2272), and immunoprecipitated with Sephadex protein A/G beads (Sigma Aldrich, St. Louis, MO; #GE17-5280-02 and #GE17-0618-05, 4:1 ratio) in 96-well polyvinylidene difluoride filtration plates (Corning, Corning, NY; #EK-680860).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>1ul anti-myc positive control</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-myc</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Luciferase reporter assays: The blocking activity of anti-IFN-α autoantibodies was determined by assessing a reporter luciferase activity.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-IFN-α</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293T cells were transfected with the firefly luciferase plasmids under the control human ISRE promoters in the pGL4.45 backbone, and a constitutively expressing Renilla luciferase plasmid for normalization (pRL-SV40).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We selected samples from 69/101 of subjects enrolled in COMET between 4/8/2020 and 6/20/2020.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>COMET</div><div>suggested: (CoMet, RRID:SCR_011925)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This study is approved by the Institutional Review board: UCSF Human Research Protection Program (HRPP) IRB# 20-30497.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UCSF Human Research Protection Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Peripheral blood mononuclear cells (PBMCs) were isolated at RT using SepMate PBMC Isolation Tubes (STEMCELL Technologies) by the UCSF Biospecimen Resource Program.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Biospecimen Resource Program</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single-cell epitope and RNA-sequencing preprocessing and alignment: CellRanger v3.1.0 (run 1 to 7, cDNA library generation of run 6 failed) or v4.0.0 (run 8 to 10) software with the default settings was used to demultiplex the sequencing data and generate FASTQ files (Cellranger mkfastq), align the sequencing reads to the hg38 reference genome, and generate a unique molecular identifier (UMI)-filtered gene and protein expression count matrix for each lane (Cellranger count for scRNA-seq and CITE-seq data).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CellRanger</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Single-cell epitope and RNA-sequencing processing and quality control: Resulting gene and protein expression count matrices were further processed in the Python package Scanpy v1.5.1 (36).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Differential expression analysis was performed per run on the raw gene expression matrix using Memento v0.0.4 (unpublished, Kim MC et al. https://github.com/yelabucsf/scrna-parameter-estimation), after which results were meta-analyzed over all runs.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Memento</div><div>suggested: (Memento, RRID:SCR_002634)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">IFN-α2 protein was column-purified using Nap-5 columns (GE Healthcare, Chicago, IL; #17-0853-01), incubated with 2.5ul serum, or 2.5ul plasma, or 1ul anti-myc positive control antibody (CellSignal, Danvers, MA; #2272), and immunoprecipitated with Sephadex protein A/G beads (Sigma Aldrich, St. Louis, MO; #GE17-5280-02 and #GE17-0618-05, 4:1 ratio) in 96-well polyvinylidene difluoride filtration plates (Corning, Corning, NY; #EK-680860).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MA</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.03.09.434529
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.03.08.434440

1
1. sciscore 15 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.03.08.434440: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">) and THE anti-Strep II tag FITC (Genescript, A01736-100) antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Strep II tag FITC</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A01736-100 </div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, M2 anti-FLAG (Sigma-Aldrich, F1804), and anti-GAPDH (GeneTex, GTX627408) antibodies in 5% BSA.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-FLAG</div><div>suggested: (Sigma-Aldrich Cat# F1804, RRID:AB_262044)</div></div><div style="margin-bottom:8px"><div>F1804</div><div>suggested: (Sigma-Aldrich Cat# F1804, RRID:AB_262044)</div></div><div style="margin-bottom:8px"><div>anti-GAPDH</div><div>suggested: (GeneTex Cat# GTX627408, RRID:AB_11174761)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">During the first IP for each construct, immunoprecipitation was confirmed by silver stain using a Pierce Silver Stain Kit (Thermo Fisher) and by western blotting with anti-FLAG antibody (Sigma-Aldrich, F1804) Nsp3.1-ST & ATF6-FT Co-immunoprecipitation: HEK293T-REx cells expressing doxycycline-inducible 6xHis-3xFLAG-HsATF6α were seeded in 15cm tissue culture dishes67.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-REx</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western blot and RT-qPCR analysis of UPR activation: HEK293T cells were transfected with nsp3.1-FT homologs or tdTomato (mock) in 6-well plates as previously described.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The amino acid sequences of full-length nsp3 for the remaining hCoV strains were aligned using ClustalOmega to the SARS-CoV fragments to determine the corresponding starting/ending positions for each fragment.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ClustalOmega</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Peptide IDs were filtered using Percolator with an FDR target of 0.01.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Percolator</div><div>suggested: (OMSSAPercolator, RRID:SCR_000287)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pairwise ratios between conditions were calculated in Proteome Discoverer based on total protein abundance, and ANOVA was performed on individual proteins to test for change in abundances and report adjusted P-values.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Proteome Discoverer</div><div>suggested: (Proteome Discoverer, RRID:SCR_014477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Geneset enrichment analysis, comparative heatmaps, and network plots: A gene ontology (GO) enrichment analysis for biological processes was conducted in EnrichR.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EnrichR</div><div>suggested: (Enrichr, RRID:SCR_001575)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Network plots were generated in Cytoscape71; human protein interactions were validated based on the STRING database.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STRING</div><div>suggested: (STRING, RRID:SCR_005223)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.03.08.434440
forum.obsidian.md forum.obsidian.md

Research/PhD/Academics - Knowledge management - Obsidian Forum

2
1. shaolin 13 Mar 2021
  
  in Public
  
  When I run across interesting questions or topics that would make good papers or areas of future research I’ll use a tag like #OpenQuestion, so when I’m bored I can look at a list of what I might like to work on next.
2. shaolin 07 Mar 2021
  
  in Public
  
  Now, I simply (1) highlight what I find relevant and useful in journal articles or book chapters, (2) tag each highlight as I go in Acrobat Reader for articles or Kindle for chapters, (3) import them into Obsidian in a folder called ‘Highlight notes’, and (4) rework them with my own ideas into outputs. Perhaps the key to this system is that I not only tag each highlight for its key concepts, I also tag their ‘rhetorical purposes’ which will help me to find them again later. So, an example for a useful quote that defines the writing prompts used in an assessment like NAPLAN (Australia’s national writing test) might be:
  
  阅读
  
  笔记转移到obsidian中的高亮笔记文件夹
  
  编辑笔记，用自己的语言表达
  
  打标签，想到什么打什么？基于目的的想象
  
  xushaolin
Visit annotations in context

Tags

xushaolin

Annotators

shaolin

URL

forum.obsidian.md/t/research-phd-academics/1446
blog.fission.codes blog.fission.codes

Zettelkasten Method, Fission and TiddlyWiki

1
1. shaolin 13 Mar 2021
  
  in Public
  
  Categorizing your ideas with different tags allows you to find relevant information in a note-taking system quickly. And because one idea may have more than one tag, you can easily find the relevant idea from any number of search terms.
  
  使用标签，可以赋予我们的笔记更多的入口
  
  tags
Visit annotations in context

Tags

tags

Annotators

shaolin

URL

blog.fission.codes/zettelkasten-method-and-digital-notetaking/
laulima.hawaii.edu laulima.hawaii.edu

someTitle

1
1. carsongrosse 12 Mar 2021
  
  in Public
  
  $33 million per
  
  This $33million price tag should be raised substantially. The use of their oceans and land is worth more than that number.
Visit annotations in context

Annotators

carsongrosse

URL

laulima.hawaii.edu/access/content/group/MAN.92749.202130/Dvorak, Coral and Concrete.pdf
www.sitepoint.com www.sitepoint.com

Avoiding a JavaScript Monoculture - SitePoint

2
1. TylerRick 12 Mar 2021
  
  in Public
  
  We standardize on a finite subset of JS (such as asm.js) — and avoid the endless struggle through future iterations of the JavaScript language, competing super-sets and transpilers
  
  asm.js and RPython sound similar (restrictive subsets)
  
  the high churn in JavaScript tooling standardization annotation meta: may need new tag asm.js JavaScript: as a process VM RPython
2. TylerRick 11 Mar 2021
  
  in Public
  
  As to opinions about the shortcomings of the language itself, or the standard run-times, it’s important to realize that every developer has a different background, different experience, different needs, temperament, values, and a slew of other cultural motivations and concerns — individual opinions will always be largely personal and, to some degree, non-technical in nature.
  
  reaction / reacting to software project created to address shortcomings in another project what is important/necessary for one person may not be for another everyone has different preferences software preferences are personal non-technical reasons everyone has different background/culture/experience good point +0.9 runtime environment JavaScript annotation meta: may need new tag
Visit annotations in context

Tags

standardization

JavaScript

JavaScript: as a process VM

annotation meta: may need new tag

+0.9

software project created to address shortcomings in another project

asm.js

non-technical reasons

what is important/necessary for one person may not be for another

reaction / reacting to

everyone has different background/culture/experience

everyone has different preferences

good point

RPython

software preferences are personal

the high churn in JavaScript tooling

runtime environment

Annotators

TylerRick

URL

sitepoint.com/javascript-monoculture/
github.com github.com

requirejs/requirejs

1
1. TylerRick 11 Mar 2021
  
  in Public
  
  Normally you should not register a named module, but instead register as an anonymous module: define(function () {}); This allows users of your code to rename your library to a name suitable for their project layout. It also allows them to map your module to a dependency name that is used by other libraries.
  
  anonymous/placeholder/unlabeled object/node flexibility to use the tool that you prefer interchangeable modularity annotation meta: may need new tag
Visit annotations in context

Tags

flexibility to use the tool that you prefer

modularity

anonymous/placeholder/unlabeled object/node

interchangeable

annotation meta: may need new tag

Annotators

TylerRick

URL

github.com/requirejs/requirejs
github.com github.com

d3/d3

2
1. TylerRick 11 Mar 2021
  
  in Public
  
  The non-minified default bundle is no longer mangled, making it more readable and preserving inline comments.
  
  readability annotation meta: may need new tag bundlers
2. TylerRick 11 Mar 2021
  
  in Public
  
  D3 now passes events directly to listeners, replacing the d3.event global and bringing D3 inline with vanilla JavaScript and most other frameworks.
  
  compatibility it's just plain JavaScript newer/better ways of doing things standard ways of doing things annotation meta: may need new tag
Visit annotations in context

Tags

compatibility

annotation meta: may need new tag

readability

it's just plain JavaScript

standard ways of doing things

bundlers

newer/better ways of doing things

Annotators

TylerRick

URL

github.com/d3/d3/blob/v6.6.0/CHANGES.md
forum.paradoxplaza.com forum.paradoxplaza.com

Stellaris - [v2.6.1][65d2] Transport Ship Fleet Stance resets after invasion

1
1. TylerRick 11 Mar 2021
  
  in Public
  
  This thread is more than 5 months old. It is very likely that it does not need any further discussion and thus bumping it serves no purpose. If you feel it is necessary to make a new reply, you can still do so though. I am aware that this thread is rather old but I still want to make a reply.
  
  to annotate rules/policies necroposting (posting to a long-inactive discussion thread) annotation meta: may need new tag
Visit annotations in context

Tags

to annotate

necroposting (posting to a long-inactive discussion thread)

annotation meta: may need new tag

rules/policies

Annotators

TylerRick

URL

forum.paradoxplaza.com/forum/threads/stellaris-v2-6-1-65d2-transport-ship-fleet-stance-resets-after-invasion.1363281/
github.com github.com

sprockets 4 makes Chrome browser identification of SCSS css lines _worse_ · Issue #656 · rails/sprockets

1
1. TylerRick 11 Mar 2021
  
  in Public
  
  I don't understand why this isn't being considered a bigger deal by maintainrs/the community. Don't most Rails developers use SCSS? It's included by default in a new Rails app. Along with sprockets 4. I am mystified how anyone is managing to debug CSS in Rails at all these days, that this issue is being ignored makes sprockets seem like abandonware to me, or makes me wonder if nobody else is using sprockets 4, or what!
  
  is anyone even still using it anymore? sprockets why aren't people talking about/asking this? annotation meta: may need new tag why aren't the maintainers more concerned about / fixing this?
Visit annotations in context

Tags

sprockets

why aren't the maintainers more concerned about / fixing this?

is anyone even still using it anymore?

why aren't people talking about/asking this?

annotation meta: may need new tag

Annotators

TylerRick

URL

github.com/rails/sprockets/issues/656
github.com github.com

Testing beta9, things I had trouble configuring (Better docs needed?) · Issue #615 · rails/sprockets

1
1. TylerRick 11 Mar 2021
  
  in Public
  
  but I still have no idea if I'm writing this new file correctly.
  
  annotation meta: may need new tag easy to get wrong how do you know if you are doing it correctly? (need better feedback/discoverability) Sprockets: manifest.js
Visit annotations in context

Tags

easy to get wrong

annotation meta: may need new tag

how do you know if you are doing it correctly? (need better feedback/discoverability)

Sprockets: manifest.js

Annotators

TylerRick

URL

github.com/rails/sprockets/issues/615
github.com github.com

Only compile source maps in the debug pipeline · Issue #410 · rails/sprockets

1
1. TylerRick 10 Mar 2021
  
  in Public
  
  For the $$$ question, nothing comes to mind. These problems i'm hitting up against are larger than a contractor could solve in a few hours of work (which would be hundreds/thousands of dollars).
  
  difficult/hard problem open-source software: funding annotation meta: may need new tag
Visit annotations in context

Tags

open-source software: funding

annotation meta: may need new tag

difficult/hard problem

Annotators

TylerRick

URL

github.com/rails/sprockets/issues/410
hyperstack.org hyperstack.org

Hyperstack.org

1
1. TylerRick 10 Mar 2021
  
  in Public
  
  we used `backticks` to jump into native Javascript to use moment.js
  
  In regular Ruby, `` executes in a shell, but obviously there is no shell of that sort in JS, so it makes sense that they could (and should) repurpose that syntax for something that makes sense in context of JS -- like running native JavaScript -- prefect!
  
  good idea good analogy annotation meta: may need new tag Ruby JavaScript JavaScript transpiler Opal good translation/replacement/analogue repurpose
Visit annotations in context

Tags

JavaScript

Ruby

good translation/replacement/analogue

repurpose

annotation meta: may need new tag

good idea

good analogy

JavaScript transpiler

Opal

Annotators

TylerRick

URL

hyperstack.org/
via4.hypothes.is via4.hypothes.is

Untitled document

3
1. hopedaley 10 Mar 2021
  
  in Public
  
  For example, when news broke of TigerWoods’extramarital infidelities in late 2009, several sponsors suspended their contractswith him almost immediately, including Accenture, AT&T, Gatorade, General Motors,Gillette and TAG Heuer.
  
  This examplifies how brands can drop people who don't supporttheir image
2. HenryPoitras 10 Mar 2021
  
  in Public
  
  broke of TigerWoods’extramarital infidelities in late 2009, several sponsors suspended their contractswith him almost immediately, including Accenture, AT&T, Gatorade, General Motors,Gillette and TAG Heuer.
  
  It was pretty entertaining i must say, especially when they had like 25 women on the magazine covers.
3. hannahfreed 08 Mar 2021
  
  in Public
  
  broke of TigerWoods’extramarital infidelities in late 2009, several sponsors suspended their contractswith him almost immediately, including Accenture, AT&T, Gatorade, General Motors,Gillette and TAG Heuer
  
  This reminds me of one of Apple's policies; The villain in a movie/TV show is not allowed to use an Apple device. This is because they don't want a negative connotation with their brand.
Visit annotations in context

Annotators

hopedaley

hannahfreed

HenryPoitras

URL

via4.hypothes.is/proxy/static/AZm_QMKfpitQ_GKKC0P7bw/1615388400/https://inst-fs-iad-prod.inscloudgate.net/files/404a62f4-b22c-45db-8d51-8e64c02a408f/Micro-Celebrity.pdf
runestone.academy runestone.academy

2.2. Basic HTML Tags — Fundamentals of Web Programming

1
1. Matthew_Gunai 10 Mar 2021
  
  in Public
  
  Another aspect of the heading tag is that it is what we call a block tag.
  
  intresting
Visit annotations in context

Annotators

Matthew_Gunai

URL

runestone.academy/runestone/books/published/webfundamentals/HTML/basic.html
via4.hypothes.is via4.hypothes.is

PDF.js viewer

1
1. hopedaley 08 Mar 2021
  
  in Public
  
  Positive high-arousal is embedded in what the au-thors tag as “Awa” stories: pieces that generate a feeling of elevation in the face of something greater than oneself
  
  This is a definition of a term that could be useful later
Visit annotations in context

Annotators

hopedaley

URL

via4.hypothes.is/proxy/static/kKD6AkByiAARPX5fdUnqnA/1615154400/https://inst-fs-iad-prod.inscloudgate.net/files/9f3653fa-4088-4abd-a9a5-5e682e5e81cb/Meme Culture Part 3.pdf
futurism.com futurism.com

All the reasons why humans shouldn't colonize Mars, according to experts

1
1. DannyNunez 07 Mar 2021
  
  in Public
  
  One of the biggest obstacles standing in the path of a human colony on Mars is the price tag. Getting to Mars will be prohibitively expensive, and figuring out a method of paying for the project isn’t so easy.“I think it would be a natural next step in our human exploration to visit the Moon and/or Mars, but to stay for the long term probably requires an economic justification,” said Hendrix.
  
  The amount of money being spent to be able to achieve a colony on Mars seems to be the biggest drawback that we face in order to achieve this mission. I think that people have to look at the mission as a whole instead of pinpointing reasons why going there isn't the best use of our resources.
Visit annotations in context

Annotators

DannyNunez

URL

futurism.com/humans-shouldnt-colonize-mars-experts
www.biorxiv.org www.biorxiv.org

TXN, a Xanthohumol Derivative, Attenuates High-Fat Diet Induced Hepatic Steatosis by Antagonizing PPARγ

1
1. samporteous 05 Mar 2021
  
  in eLife
  
  Reviewer #3 (Public Review):
  
  Using high fat diet (HFD)-fed male mice and a variety of experimental approaches, the authors demonstrated the efficacy of xanthohumol (XN) and tetrahydro-xanthohumol (TXN) in attenuating weight gain and hepatic steatosis independently of calorie intake and identify inhibition of PPARγ as a mechanism. A strength of the study design was the incorporation of the test compounds into isocaloric, ingredient matched high-fat diet (HFD) formations and inclusion of a LFD control group. A weakness of the study, although minor, is that the dose of compound consumed will vary between mice and from day-to-day depending on how much food each animal consumes. The lower dose of XN (LXN, given as 30 mg/kg of diet) was found ineffective compared to the higher dose of XN (HZN, 60 mg/kg of diet) and TXN (30 mg/kg of diet) was most effective in attenuating weight gain and reversing HFD-induced liver steatosis. TXN almost completely suppressed hepatic lipid vacuole accumulation and showed greatest reduction in liver mass relative to body weight. TXN increased fasting plasma triglycerides compared to all other groups, but explanation is uncertain. Fecal excretion of TAG between groups was similar and therefore could not explain the decreased weight gain or improved liver phenotypes in XN- or TXN-treated groups. Whole body energy metabolism suggested that XN and TXN supplemented mice were more physically active then HFD-fed mice. HXN and TXN supplemented mice showed less accumulation of subcutaneous and mesenteric fat mass, but these groups had somewhat higher levels of epididymal fat mass.
  
  After 16 weeks on diets, RNAseq performed on murine liver tissues. Compared to HFD group, TXN group had 295 differentially expressed genes (DEGs), HXN group had 6 DEGs, and LFD group had 212 DEGs. TXN supplementation upregulated 6 and down regulated 25 KEGG pathways. SVM was used to identify signature genes that significantly differentiated HFD and TXN group transcriptomes. Of 13 identified genes, 8 showed significant, differential hepatic expression between TXN and HFD groups. Of these 8 genes, 3 genes (Ucp2, Cidec, Mogat1) were identified as known target genes of PPARγ with roles in lipid metabolism. qPCR of liver tissues was used to verify these RNAseq results.
  
  XN or TXN were shown to inhibit murine preadipocyte 3T3-L1 differentiation and adipogenesis and lipid accumulation in a dose dependent manner. In a second dose escalating experiment, TXN or XN were shown to block the ability of rosiglitazone (RGZ), a PPARγ agonist, to promote adipogenesis of 3T3-L1. These data suggested that XN and TXN may interfere or compete with binding of RGZ to the PPARγ receptor. qPCR of 3T3-L1 cells confirmed that TXN or XN could inhibit gene expression of RGZ-induced PPARγ target genes (Cd36, Fabp4, Mogat1, Cidec, Plin4, Fgf21) and further supported the hypothesis that TXN and XN are PPARγ antagonists. To further test this idea the authors performed a competitive PPARγ TR-FRET binding assay and showed that XN and TXN could displace a labelled pan-PPARγ ligand in a dose-dependent manner. Finally, molecular docking experiments confirmed the putative binding pose and position of XN/TXN and estimated the relative binding affinities of various ligands for PPARγ. XN and TXN may serve as scaffolds for the development of more potent therapeutics in structure-activity relationship (SAR) studies. Overall, this work contributes compelling preclinical data to support future clinical investigations to determine dosing, efficacy, and safety of XN and TXN as therapeutics for diet-induced NAFLD.
  
  scietyType:PeerReview scietyCreator:Reviewer 3
Visit annotations in context

Tags

scietyCreator:Reviewer 3

scietyType:PeerReview

Annotators

samporteous

URL

biorxiv.org/content/10.1101/2021.01.11.426043v2
book.douban.com book.douban.com

书之极 (豆瓣)

1
1. conanxin 05 Mar 2021
  
  in Public
  
  本书作者王骥是迄今为止中国唯一的艺术家手作书藏家，十几年来，他斥巨资收藏了200多本艺术家手作书，却始终蜗居在30㎡的小房子里。
  
  2020年末，《书之极》一出版，旋即获选2020年“中国最美的书”。
  
  书中呈现了24位艺术家的作品：有常玉、赵无极、萨尔瓦多·达利、安迪·沃霍尔、亨利·马蒂斯……甚至还有诺贝尔文学奖获得者君特·格拉斯。它展现了“书”这个载体做到极致能做成什么样子。
  
  书
Visit annotations in context

Tags

书

Annotators

conanxin

URL

book.douban.com/subject/35251618/
osf.io osf.io

ICMJE and patient partners manuscript- 2021-1-13.docx

1
1. KarenWoolley 03 Mar 2021
  
  in Public
  
  Congratulations on this research and best wishes for a helpful and robust peer review experience! I offer the following feedback, which I hope you can consider:
  
  Given the involvement of a patient author and the recommended reporting guidelines for patient involvement, would you be able to include the GRIPP2 Short Form in your manuscript? See EQUATOR Network/BMJ/Res Involvement and Engagement for GRIPP2. By sharing insights via this best practice reporting guideline we can all learn from each other. The table could be added in your existing Methods section in the Patient and Public Involvement paragraph.
  
  To assist with meta-research on patient authorship and facilitate listing and searchability in PubMed via the 'Patient Author' affiliation tag, would Laurie Proulx be able to add 'Patient Author' to her existing affiliation? We are working with publishers now to help boost use of this affiliation tag as trying to identify patient-authored publications right now relies on hand searching. A quick, free, and easy alternative is possible via PubMed if the 'Patient Author' affiliation is used. Wide use of this tag would help answer the Table 7 question re, has your journal published a paper with a patient author? We are presenting research on the use of this tag at a US conference this year and would be happy to share our results with you.
  
  It is a concern that almost 1 in 5 of the respondents were not sure whether their journal adhered to the ICMJE criteria for authorship (Table 7). It could be useful from a hypothesis-generating perspective to see if the answers from this cohort influenced the broader results.
  
  While not peer reviewed, there is reported documentation from ICMJE about patient authorship in the grey literature from Peter Bates "anyone (including patients) who meet all the criteria for authorship should be provided the option / opportunity to be so. Our document says so, and you should point to that if others think patients who meet all 4 criteria should not be authors.
  
  In short, we believe that our statements apply to patients just as they do to anyone involved in a study and its reporting.
  
  Personal communication from the Secretary of the ICMJE, December 2018"<br> https://peterbates.org.uk/home/garden-shed/payment-for-authors/
  
  We have partnered with patients to conduct and author the first systematic review on the benefits and risks of patient authorship. It has been published in the peer-reviewed journal, Research Involvement and Engagement. I thought this might be of interest to your team for this or future work you do in this area. https://researchinvolvement.biomedcentral.com/articles/10.1186/s40900-020-00190-w
  
  We have also partnered with patients to create a free and online plain language guide to help patients review the rights and responsibilities of authorship...before they commit to authorship. It is CC BY 4.0 so can be shared easily https://figshare.com/articles/poster/Plain_Language_Summary_of_Good_Publication_Practice_Guideline/11292047
  
  Patient authorship is likely to increase as more patients lead robust research projects. One wonders who the 33 editors (who don't believe patients can be authors) would expect to author the resulting publications. If the researchers involved can't author publications, then could this lead unethical guest authorship?
  
  Relevant to the advocacy from patients for authorship, we are working with WECAN to develop the first, online, co-created 'Publication Training Course for Patient Advocates'. This course will be released under a CC BY 4.0 license to facilitate free sharing and re-use. We would be happy to speak with you about the course.
  
  Again, I hope these comments are useful and I look forward to seeing this preprint progress to a peer-reviewed publication.
  
  Professor Karen L. Woolley Twitter: @KWProScribe
Visit annotations in context

Annotators

KarenWoolley

URL

osf.io/n4rg6/
www.biorxiv.org www.biorxiv.org

Misoprostol Treatment Prevents Hypoxia-Induced Cardiac Dysfunction, Aberrant Cardiomyocyte Mitochondrial Dynamics and Permeability Transition Through Bnip3 Phosphorylation

2
1. EMBOpress 03 Mar 2021
  
  in Review Commons
  
  Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.
  
  Learn more at Review Commons
  
  Reply to the reviewers
  
  We wish to thank the reviewers for their detailed and constructive comments on our manuscript. This valuable feedback has resulted in substantial improvements to our paper. A detailed list addressing the reviewers’ comments and the changes to our manuscript since the first submission is outlined below:
  
  Reviewer #1:
  
  The manuscript by Martens et al investigates the mechanisms of Bnip3-mediated cell damage during hypoxia. The Authors show that modulation of prostaglandin (PG) E1 signaling with misoprostol prevents cardiac dysfunction, mitochondrial impairment and cell death induced by hypoxia. In addition, they show that the effect of misoprostol is dependent on PKA-mediated Thr181 phosphorylation. The Authors also suggest that there is a possible interaction between Bnip3 and 14-3-3beta that prevents ER Ca2+ release and mitochondrial Ca2+ overload. The Authors conclude that Bnip3 phosphorylation plays a key role in the regulation of cardiac and metabolic dysfunction and identify misoprostol treatment as a therapeutic intervention to prevent hypoxia-induced cardiac injury.
  
  **Major Comments:**
  
  1.Results presented in Figs. 1, 2 and 3 pertaining to hypoxia-induced changes in Bnip3 expression, changes in mitochondrial function, cell death, Bnip3-dependent Ca2+ transfer from ER to mitochondria and the effect of misoprostol have partially been demonstrated in a previous publication from the same group (PMID: 30275982).
  
  Thank you for noting our previous work using predominantly the HCT-116 cell line and a rat model of neonatal hypoxia published in the journal Cell Death Discovery. The work in the current manuscript builds on our previous papers, and extends these findings utilizing a neonatal mouse model, primary neonatal ventricular myocytes, human iPSC-derived cardiomyocytes, and H9c2 cells. These models not only demonstrate the robust nature of the effects of misoprostol treatment on the hypoxic neonatal cardiomyocytes, but they also allowed us to utilize powerful genetic models, such as the Bnip3 knockout mouse, and knockout mouse embryonic fibroblasts (MEFs), which phenocopy many of the effects of misoprostol treatment. These findings strongly implicate Bnip3 as a primary target of misoprostol treatment in the hypoxic neonatal heart in rodents.
  
  In addition, Figure 1 contains very important in vivo endpoints that we have not previously utilized, including echocardiography to assess neonatal cardiac function, transmission electron microscopy to assess mitochondrial ultrastructure, cardiac ATP and lactate levels, an array of gene expression, and HMGB1 immunofluorescence (Fig.1 I in the current version of the manuscript) implicating a necro-inflammatory phenotype that is modulated by misoprostol treatment. Moreover, in Figures 2 and 3 we confirm previous observations related to hypoxia- and Bnip3-mediated mitochondrial function, and calcium signaling, but also extend these observations to include the impact of hypoxia, Bnip3 and misoprostol treatment on mitochondrial morphology and necro-inflammatory markers, in additional to utilizing human cardiomyocytes and knockout MEFs. Finally, Figures 4-7 of our manuscript describes a novel mechanism by which misoprostol treatment can therapeutically target Bnip3 function both in vivo and in cell models (see below).
  
  Although based on our previous observations, we feel the work in the present manuscript is highly novel and original, and adds substantially to our knowledge of both Bnip3 function, and neonatal hypoxic injury, which currently represents a world-wide health crisis that is underrepresented in the biomedical literature.
  
  2.The very same publication from 2018 shows that misoprostol treatment of pups exposed to hypoxia for 7 days is able to prevent the increase in Bnip3 protein levels. Yet, in the present manuscript misoprostol treatment had no effect on Bnip3 protein levels in the same model (Fig. 1E). This raises some concerns regarding the solidity and soundness of the results presented. Thank you for noting this in our previous work. In our 2018 paper, we treated hypoxic neonatal rats with misoprostol and observed a complete repression of Bnip3 expression in the gut and hippocampus, but only a partial repression in the heart. This observation prompted us to explore other mechanisms by which misoprostol could inhibit Bnip3 function. We have increased our sample size for the data in Figure 1 J and K to be more statistically conclusive. The evidence is now stronger that misoprostol only the partial represses Bnip3 expression in the neonatal mouse heart. In addition, we provided a representative western blot (Fig. 1 J), which is consistent with the result in Figure 3C in MEF cells.
  
  3.The validation of the custom antibody against p-Thr181 needs to be shown. Fig. 4E shows that p-Bnip3 band is quite strong in H9c2 cells, despite total endogenous Bnip3 levels are barely detectable. In addition, phosphorylation of the Bnip3 Thr181 residue in cells and/or in vivo should be confirmed by mass spectrometry.
  
  Our plan in the next revision, we will be to provide additional validation of the p-Thr181 antibody, as we have done previously (PMID: 33044904). In addition, we will re-run the western blots noted above to improve their quality, as the difference between total Bnip3 and p-Bnip3 in H9c2 cells is likely due to different exposures of the two blots. Confirmation of Bnip3 phosphorylation using mass spectrometry in extracts from intact cells was previously published (PMID: 26102349), however, the nature of the signaling pathways leading to phosphorylation was not determine, nor was the mechanism of Bnip3 inhibition previously determined.
  
  4.Fig. 4L shows that misoprostol treatment of H9c2 cells leads to an increase in Bnip3 phosphorylation, but this does not seem to be the case in normoxic conditions in vivo (Fig. 4N). Moreover, shouldn't this presumable increase in phosphorylation induced by misoprostol in normoxic conditions lead to Bnip3 accumulation in the cytosol thereby reducing its colocalization with mitochondria (Fig. 6B)? The results obtained with the colocalization method should be corroborated using different methods, such as cell fractionation.
  
  In the previous version of the manuscript, we reported that misoprostol treatment increases Bnip3 phosphorylation in H9c2 cells following acute exposure (Supplement 5 B). In the updated version of the manuscript, we confirmed this in vitro observation in PVNC’s, demonstrating that in culture, acute misoprostol drug treatments during normoxia result in Bnip3 phosphorylation (Supplement 5 C). However, when we increased our N in the revised manuscript this difference remained not statistically sustained after 7 days of misoprostol treatment in vivo (Fig. 4 M, N). Importantly though, our observation that hypoxia exposure resulted in reduced Bnip3 phosphorylation, and that misoprostol drug treatment was sufficient to restore it is particularly novel, and ties together with our new colocalization data (Fig. 4 M, N). What is very intriguing about the data in Figure 6B is that myc-Bnip3 did not colocalize with the mitochondrial matrix-targeted mito-Emerald under normoxic conditions, and thus was not impacted by misoprostol treatment in normoxia. However, in hypoxic cells the colocalization coefficient between myc-Bnip3 and mito-Emerald increased and was abrogated by misoprostol treatment. This observation suggests that Bnip3 is actively translocated deeper into the mitochondria ultrastructure during hypoxic stress, and that misoprostol treatment can prevent this phenomenon. This observation is consistent with the pBnip3 data shown in Figure 4M. In the most recent version of the manuscript, we have performed additional confocal experiments to substantiate this novel observation. New data clearly demonstrates that hypoxia exposure in vivo increases the colocalization of Bnip3 with the inner mitochondrial membrane protein Opa1 (Fig. 6 C). However, when mice are treated with misoprostol, the colocalization with Opa1 is reduced and the colocalization of Bnip3 with 14-3-3b increases (Fig. 6 M). We have also shown in H9c2 cells that expression of Opa1 prevents Bnip3-induced mitochondrial fission (Fig. 3 J), and that when both Bnip3 and 14-3-3b are ectopically expressed, misoprostol treatment can increase their colocalization (Fig. 6 N, O), suggesting that this is regulated by post-translational modification and not alterations in Bnip3 expression due to hypoxia. Our plan is to include additional fractionation experiments in the next revision of the manuscript; however, this approach may not be as sensitive as confocal microscopy.
  
  5.In relation to Fig. 4 M, N (page 19), the Authors concluded that the reduction in Bnip3 phosphorylation suggests an increase in Bnip3 activity in the hypoxic neonatal hearts. Nevertheless, this has not been demonstrated.
  
  Thank you for pointing this out. At this time, we do not have data to suggest that a reduction in Bnip3 phosphorylation increases its activity in vivo. In the revised manuscript, we have new confocal-based colocalization experiments using fixed sections from hypoxic and misoprostol treated hearts that provide insightful information into the subcellular localization of Bnip3 (Please see above; Fig. 6 C, M). Importantly, based on our data in figure 5, particularly Fig.5F using Bnip3-null MEFs, the protective effect of misoprostol is completely prevented by reconstitution of the T181A mutant, but not wild-type Bnip3, suggesting phosphorylation at T181 is an important mechanism by which misoprostol inhibits Bnip3-induced mitochondrial depolarization. Finally, we have also been careful not to overstate our conclusions is the most recent version of the manuscript, have been more specific with our language, and have avoided vague terms like ‘activity’.
  
  6.Along that line, the Authors concluded that misoprostol-induced cytoprotection is dependent on PKA Thr181 phosphorylation. Nevertheless, this dependence has not been convincingly demonstrated in hypoxic cells and in vivo.
  
  The new data described outline above, in point #4 and #5, have provided assurances regarding the role of Bnip3 phosphorylation on its subcellular location in vivo and in cultured cells. To further address the dependency of PKA on T181 phosphorylation, we have performed experiments using the PKA inhibitor, H89, in cellular experiments and evaluate whether the protective effect of misoprostol is lost in the presence of this inhibitor. This new data has been added to the most recent version of the manuscript (Fig. 4 G).
  
  7.Previous studies showed that Bnip3 induces mitochondrial fragmentation and mitophagy (PMID: 16645637, 20436456). What is the hypothesis for the inhibition of mitochondrial fragmentation induced by misoprostol in the present study? Does it prevent Bnip3 interaction with Opa1 or is this event downstream of ER Ca2+ release and mitochondrial Ca2+ overload? Does misoprostol affect mitophagy?
  
  We have added new experimental data to address the hypothesis that Bnip3 colocalizes with Opa1 to induce mitochondrial fragmentation (as noted by the reviewer, they were previously shown to physically interact), and that this is inhibited by misoprostol treatment (Fig. 6 C). We have also added new data to the supplemental material demonstrating that misoprostol inhibits hypoxia- and Bnip3-induced mitophagy. Based on our data, we proposal that misoprostol inhibits both Bnip3-induced ER-calcium release and Opa1-dependent mitochondrial fusion. This is based on our data that misoprostol prevents Bnip3 accumulation at both the ER and mitochondria, respectively.
  
  8.The link between Bnip3 interaction with 14-3-3 and Bnip3 Thr181 phosphorylation, if there is any, is not clear. The Authors mention that Thr181 lies within the 14-3-3 binding domain. Is Thr181 phosphorylation required for 14-3-3 binding or are these events unrelated? What is the significance of these events in hypoxia, does 14-3-3 binding to Bnip3 occur in vivo? Is Bnip3 localization affected by hypoxia, 14-3-3 binding and/or misoprostol treatment in vivo?
  
  Previously, we described the role of phosphorylation of Bnip3L (Nix) at Ser-212 how this regulates the interaction with 14-3-3 (PMID: 33044904). This phosphorylation site is conserved in Bnip3 as T181. Interestingly, phosphorylation of Nix by PKA was not required for interested with 14-3-3b, but the interaction between Nix and 14-3-3b was enhanced by phosphorylation. Our plan is to perform similar experiments with Bnip3 and 14-3-3b to determine if this mechanism is conserved. However, as noted above we have new in vivo data showing that misoprostol increased the colocalization of Bnip3 and 14-3-3b in the hypoxic heart (Fig. 6 M).
  
  9.Fig. 6P shows the presence of myc-tag after IP for HA-tag, even when HA-14-3-3 was not expressed (middle lane). How is this possible?
  
  This appears to be a small amount of non-specific interaction between the HA antibody and myc-Bnip3. This is relatively small compared to the band in lane 3, which demonstrates specificity, and the importance of including this control condition. Our plan is to re-run this CO-IP to improve the western blot quality.
  
  **Minor Comments:**
  
  1.Please co-stain with the cardiomyocyte marker in Fig. 2A (such as alpha-actinin).
  
  Yes, good suggestion.
  
  2.The Methods are not sufficiently detailed. For instance, it is not clear what is the Ca2+ concentration used for Ca2+ pulses in the CRC experiment. The fact that cardiac mitochondria are able to uptake only two Ca2+ pulses raises some concerns regarding the quality of mitochondrial preparation. What is the reason for isolating mitoplasts instead of intact mitochondria?
  
  We have provided more detail in the revised manuscript.
  
  3.TMRM fluorescence should be measured before and after FCCP administration, to account for the difference in plasma membrane potential (the results should be expressed as F/FFCCP).
  
  We can provide some additional control experiments in the revised manuscript, if necessary.
  
  4.Measurement of extracellular acidification is mentioned in the methods, but the relative results are not shown.
  
  Thank you, this has been removed.
  
  5.RNAi experiments targeting Bnip3 are also mentioned in the methods, but the results are not described.
  
  Thank you. This has been fixed.
  
  Reviewer #1 (Significance (Required)):
  
  Previous studies have demonstrated that Bnip3 is upregulated by hypoxia and plays a key role in inducing mitochondrial dysfunction and PTP opening that eventually results in cell death (PMID: 12169648, 10922063). Along that line, misoprostol has been shown to prevent damaging effects of hypoxia by repressing Bnip3 and promoting the expression of pro-survival alternative splicing isoforms (PMID: 30275982). Indeed, the same study showed that misoprostol treatment prevents loss of mitochondrial membrane potential, ROS formation and impairment in mitochondrial oxygen consumption caused by hypoxia in primary neonatal cardiomyocytes. The present manuscript recapitulates these previously published findings. The truly novel findings concern the identification of Bnip3 residue Thr181 as target for PKA phosphorylation and the possible interaction of Bnip3 with 14-3-3. However, the role and/or involvement of these events has not been thoroughly investigated in relation to hypoxia and misoprostol treatment in cells or in vivo.
  
  Thank you for noting our previous work and identifying the novelty in our present work. As stated above, for Reviewer #1 comments 4, 6, and 8. We have provided additional mechanistic and in vivo data to more fully describe the role of T181 phosphorylation and the interaction with 14-3-3 chaperones in the revised manuscript.
  
  Reviewer #2:
  
  Systemic hypoxia, a major complication associated with reduced gestational time, affects more 60% of preterm infants and is a known driver of hypoxia-induced Bcl-2-like 19kDa-interacting protein 3 (Bnip3) expression in neonatal heart. At the level of the cardiomyocyte, Bnip3 activity plays a prominent role in the evolution of necrotic cell death, disrupting subcellular calcium homeostasis and initiating mitochondrial permeability transition (MPT). Emerging evidence suggests both a cardioprotective role for protein kinase A (PKA) through stimulatory prostaglandin (PG) E1 signalling during prolonged periods of hypoxia, and a cytoprotective role for Bnip3 phosphorylation, indicating that post-translational modifications of Bnip3 may be a point of convergence for these two protective pathways. Using a combination of in vivo and multiple cell models, including human iPSC-derived cardiomyocytes, the authors tested if the PGE1 analogue misoprostol is cardioprotective during neonatal hypoxic injury by altering the phosphorylation status of Bnip3. Here we report that hypoxia exposure significantly increases Bnip3 expression, mitochondrial-fragmentation, -ROS, -calcium accumulation and -permeability transition, while reducing mitochondrial membrane potential, all of which were restored to control levels with addition of misoprostol, despite elevated Bnip3 protein expression. Through both gain- and loss-of function genetic studies, the authors show that misoprostol-induced protection directly affects Bnip3, preventing mitochondrial perturbations. They demonstrate that this is a result of PG EP4 receptor signalling, PKA activation, and direct Bnip3 phosphorylation at threonine-181. Furthermore, when this PKA phosphorylation site within Bnip3 is neutralized, the protective misoprostol effect is lost. They also provide evidence that misoprostol traffics Bnip3 away from the ER through a physical interaction with 14-3-3β, thereby preventing aberrant ER calcium release and MPT. In vivo studies further demonstrate that misoprostol treatment increases Bnip3 phosphorylation at threonine-181 in the mouse heart, while both misoprostol treatment and genetic ablation of Bnip3 prevented hypoxia-induced reductions in contractile function. Taken together, these results demonstrate a foundational role for Bnip3 phosphorylation in the molecular regulation of cardiomyocyte contractile and metabolic dysfunction and identifies EP4 signaling as a potential pharmacological mechanism to prevent hypoxia-induced neonatal cardiac injury. While this work is interesting, a number of issues remain.
  
  1.English expression needs some attention. For example, the first sentence of the abstract - "more than 60%...."; Page 20, line 9 "We observed that misoprostol's ability to to". Many sections should be broken into 2 or 3 sentences.
  
  Thank you, we have made these changes and have fully proof-read our manuscript.
  
  2.Evidence from In vivo studies such as those described in section 3.7 is minimal. Much more in vivo evidence is needed. It is unclear the authors established this in vivo model of hypoxia - supposedly gestational hypoxia should be considered. Consider citing these reviews on maternal over- and under-nutrition for postnatal heath (PMID 33181042; 22982026).
  
  Thank you, we will cite these papers and have clarified our in vivo model, related to comparable human gestation time, in the Methods section. We have also revised the Introduction and Discussion to be more consistent with our in vivo model. In addition, and noted above, we have preformed addition in vivo experiments in both the hypoxia/misoprostol model, and in Bnip3 KO mice to more fully support our conclusions. Additional HMGB1 immunofluorescence has already been added to Figures 1 and 7, and we have include additional confocal-based colocalization experiments from fixed tissues (described in more detail above; Fig. 7 D).
  
  3.Which one does misoprostol exactly execute its action? Phosphorylation through PKA or trafficking Bnip3 away from the ER through a physical interaction with 14-3-3β?
  
  This is a very good question. Based on our previous work on Bnip3L (Nix; PMID: 33044904,) PKA-induced phosphorylation of the transmembrane domain increased the physical interaction with 14-3-3b, which acts as a chaperone to translocate Nix away from the mitochondria and ER/SR. We will preform similar experiments with Bnip3 and 14-3-3b for the next revision to provide additional support for this conclusion.
  
  4.More in vivo proof of concept studies are needed to validate the signaling mechanism - this is an invitro-based study (hypoxia challenge occurs in vitro).
  
  We have already included additional in vivo immunofluorescence to Figure 1 and 7, and have performed additional colocalization experiments to validate the signaling pathway in this revision. Many of these experiments are described above.
  
  5.Quality of figures is somewhat poor.
  
  Our images are the highest possible resolution within the confines of the figure size limit. Perhaps the reviewer received a web-optimized version of the figures for review.
  
  Reviewer #2 (Significance (Required)):
  
  Relatively high - although in vivo evidence is needed.
  
  Thank you. This is provided in the revised manuscript.
  
  PeerReviewed
2. EMBOpress 03 Mar 2021
  
  in Review Commons
  
  Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.
  
  Learn more at Review Commons
  
  Referee #1
  
  Evidence, reproducibility and clarity
  
  The manuscript by Martens et al investigates the mechanisms of Bnip3-mediated cell damage during hypoxia. The Authors show that modulation of prostaglandin (PG) E1 signaling with misoprostol prevents cardiac dysfunction, mitochondrial impairment and cell death induced by hypoxia. In addition, they show that the effect of misoprostol is dependent on PKA-mediated Thr181 phosphorylation. The Authors also suggest that there is a possible interaction between Bnip3 and 14-3-3beta that prevents ER Ca2+ release and mitochondrial Ca2+ overload. The Authors conclude that Bnip3 phosphorylation plays a key role in the regulation of cardiac and metabolic dysfunction and identify misoprostol treatment as a therapeutic intervention to prevent hypoxia-induced cardiac injury.
  
  Major Comments:
  
  1.Results presented in Figs. 1, 2 and 3 pertaining to hypoxia-induced changes in Bnip3 expression, changes in mitochondrial function, cell death, Bnip3-dependent Ca2+ transfer from ER to mitochondria and the effect of misoprostol have partially been demonstrated in a previous publication from the same group (PMID: 30275982).
  
  2.The very same publication from 2018 shows that misoprostol treatment of pups exposed to hypoxia for 7 days is able to prevent the increase in Bnip3 protein levels. Yet, in the present manuscript misoprostol treatment had no effect on Bnip3 protein levels in the same model (Fig. 1E). This raises some concerns regarding the solidity and soundness of the results presented.
  
  3.The validation of the custom antibody against p-Thr181 needs to be shown. Fig. 4E shows that p-Bnip3 band is quite strong in H9c2 cells, despite total endogenous Bnip3 levels are barely detectable. In addition, phosphorylation of the Bnip3 Thr181 residue in cells and/or in vivo should be confirmed by mass spectrometry.
  
  4.Fig. 4L shows that misoprostol treatment of H9c2 cells leads to an increase in Bnip3 phosphorylation, but this does not seem to be the case in normoxic conditions in vivo (Fig. 4N). Moreover, shouldn't this presumable increase in phosphorylation induced by misoprostol in normoxic conditions lead to Bnip3 accumulation in the cytosol thereby reducing its colocalization with mitochondria (Fig. 6B)? The results obtained with the colocalization method should be corroborated using different methods, such as cell fractionation.
  
  5.In relation to Fig. 4 M, N (page 19), the Authors concluded that the reduction in Bnip3 phosphorylation suggests an increase in Bnip3 activity in the hypoxic neonatal hearts. Nevertheless, this has not been demonstrated.
  
  6.Along that line, the Authors concluded that misoprostol-induced cytoprotection is dependent on PKA Thr181 phosphorylation. Nevertheless, this dependence has not been convincingly demonstrated in hypoxic cells and in vivo.
  
  7.Previous studies showed that Bnip3 induces mitochondrial fragmentation and mitophagy (PMID: 16645637, 20436456). What is the hypothesis for the inhibition of mitochondrial fragmentation induced by misoprostol in the present study? Does it prevent Bnip3 interaction with Opa1 or is this event downstream of ER Ca2+ release and mitochondrial Ca2+ overload? Does misoprostol affect mitophagy?
  
  8.The link between Bnip3 interaction with 14-3-3 and Bnip3 Thr181 phosphorylation, if there is any, is not clear. The Authors mention that Thr181 lies within the 14-3-3 binding domain. Is Thr181 phosphorylation required for 14-3-3 binding or are these events unrelated? What is the significance of these events in hypoxia, does 14-3-3 binding to Bnip3 occur in vivo? Is Bnip3 localization affected by hypoxia, 14-3-3 binding and/or misoprostol treatment in vivo?
  
  9.Fig. 6P shows the presence of myc-tag after IP for HA-tag, even when HA-14-3-3 was not expressed (middle lane). How is this possible?
  
  Minor Comments:
  
  1.Please co-stain with the cardiomyocyte marker in Fig. 2A (such as alpha-actinin).
  
  2.The Methods are not sufficiently detailed. For instance, it is not clear what is the Ca2+ concentration used for Ca2+ pulses in the CRC experiment. The fact that cardiac mitochondria are able to uptake only two Ca2+ pulses raises some concerns regarding the quality of mitochondrial preparation. What is the reason for isolating mitoplasts instead of intact mitochondria?
  
  3.TMRM fluorescence should be measured before and after FCCP administration, to account for the difference in plasma membrane potential (the results should be expressed as F/FFCCP).
  
  4.Measurement of extracellular acidification is mentioned in the methods, but the relative results are not shown.
  
  5.RNAi experiments targeting Bnip3 are also mentioned in the methods, but the results are not described.
  
  Significance
  
  Previous studies have demonstrated that Bnip3 is upregulated by hypoxia and plays a key role in inducing mitochondrial dysfunction and PTP opening that eventually results in cell death (PMID: 12169648, 10922063). Along that line, misoprostol has been shown to prevent damaging effects of hypoxia by repressing Bnip3 and promoting the expression of pro-survival alternative splicing isoforms (PMID: 30275982). Indeed, the same study showed that misoprostol treatment prevents loss of mitochondrial membrane potential, ROS formation and impairment in mitochondrial oxygen consumption caused by hypoxia in primary neonatal cardiomyocytes. The present manuscript recapitulates these previously published findings. The truly novel findings concern the identification of Bnip3 residue Thr181 as target for PKA phosphorylation and the possible interaction of Bnip3 with 14-3-3. However, the role and/or involvement of these events has not been thoroughly investigated in relation to hypoxia and misoprostol treatment in cells or in vivo.
  
  PeerReviewed
Visit annotations in context

Tags

PeerReviewed

Annotators

EMBOpress

URL

biorxiv.org/content/10.1101/2020.10.09.333666v2
www.biorxiv.org www.biorxiv.org

http://biorxiv.org/cgi/content/short/2020.10.27.357558

1
1. sciscore 01 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2020.10.27.357558: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Supernatants were collected and quantified by western blotting using anti-human IgG secondary antibody (ThermoFisher A-21091).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Thermo Fisher Scientific Cat# A-21091, RRID:AB_2535747)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Twenty-four hours before electroporation, BHK-SARS-N cells were treated with 1 μg ml−1 doxycyclin to express SARS-CoV N protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-SARS-N</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry: A stable clone of BHK cells expressing exogenous hACE2 were pelleted and resuspended in reaction buffer (PBS pH7.4 with 0.02% tween-20 and 4% BSA) at a concentration of 5 × 106 cells/ml. 100 μl/well of the cells were aliquoted into a round-bottom 96-well plate and incubated on ice for at least 5 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transcribed capped mRNA was electroporated into baby hamster kidney (BHK-21) cells expressing SARS-CoV N protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21</div><div>suggested: ATCC Cat# CRL-6282, RRID:CVCL_1914)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In brief, Vero E6 cells were infected with P.1 viruses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To determine the ratios of S-614D:S-614G in competition assays in Epithelix and hACE2-KI mice, reverse transcription PCR was performed on extracted RNA using SuperScript™ IV One-step RT-PCR System (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>hACE2-KI</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After incubation, cells were washed in 200 μl PBST washing solution (PBS pH7.4 with 0.02% tween-20) once and then 100 μl of 1:300 diluted secondary antibody (ThermoFisher Cat # A-21091 for Fc-tag and ThermoFisher Cat # MA1-21315-647 for polyhistidine-tag) was added into each well of cells, mixed, and incubated on ice with shaking for 15 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ThermoFisher Cat</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generation of infectious cDNA clones using TAR cloning and rescue of recombinant viruses: To introduce the 614G mutation to the Spike gene, PCR mutagenesis (Supplementary Table 1) was performed on the pUC57 plasmid containing SARS-CoV-2 fragment 1010 using Q5® Site-Directed Mutagenesis Kit (New England BioLab).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>New England BioLab</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DNA concentration was determined using Qubit dsDNA HS (High Sensitivity) Assay (Thermo Fisher), and subsequently diluted to 200 ng in 50 μl of nuclease-free water for sequencing by Nanopore sequencing MinION.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MinION</div><div>suggested: (MinION, RRID:SCR_017985)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For data analysis, TrimGalore v0.6.5 was used to remove low-quality reads and adaptors from the raw sequencing files.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>TrimGalore</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The resulting trimmed paired-end reads were then aligned to the SARS-CoV-2 genome (GenBank accession MT108784) using Bowtie2 v2.3.5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Bowtie2</div><div>suggested: (Bowtie 2, RRID:SCR_016368)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Finally, a consensus sequence was generated for each virus stock using Samtools v1.10 with the -d option set to 10,000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2020.10.27.357558
www.biorxiv.org www.biorxiv.org

http://biorxiv.org/cgi/content/short/2020.11.04.355842

1
1. sciscore 01 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2020.11.04.355842: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">S protein was surface captured via anti-AviTag pAb covalently immobilized on a CM5 chip, RBD protein was surface captured via StrepTactin XT covalently immobilized on a CM5 chip, and ACE2-mFc was surface captured via covalent immobilization of the Cytiva Mouse antibody capture kit on a C1 chip.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-AviTag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For S binding measurements, recombinant ACE2 (residues 19-615 from Uniprot Q9BYF1 with a C-terminal thrombin cleavage site-TwinStrep-10xHis-GGG-tag, and N- terminal signal sequence) was expressed in Expi293 cells at 37°C and 8% CO2 in a humified incubator.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral growth curve: VeroE6-ACE2 cells (VeroE6 cells induced to overexpress Ace2) either with or without TMPRSS2 overexpression (Rhin et al., 2020 under review) were seeded in a 12- well plate and inoculated with an MOI of 0.01 with either the GLA1 (N439/D614G) or GLA2 (N439K/D614G) virus isolates for 1hr before washing the cells three times in PBS and replacing with 2% DMEM.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>VeroE6-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>VeroE6</div><div>suggested: JCRB Cat# JCRB1819, RRID:CVCL_YQ49)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lenti-X™ 293T cells (Takara, 632180) were seeded in 10-cm dishes at a density of 1e5 cells/cm2 and the following day transfected with 5 μg of spike expression plasmid with TransIT-Lenti (Mirus, 6600) according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reads were size filtered, demultiplexed and trimmed with Porechop (https://github.com/rrwick/Porechop), and mapped against reference strain Wuhan-Hu-1 (MN908947).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Wuhan-Hu-1</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RBD residues within 6.0A distance of any ACE2 atoms (determined using MOE) were determined for each of the two copies of the complex in the asymmetric unit, and then were combined to obtain the RBM. 6M0J was obtained from the Coronavirus Structural Task Force server (https://github.com/thorn-lab/coronavirus_structural_task_force) and was further refined (using Refmac5 v5.8.0258), manually fitted (using Coot v0.9) and prepared (using MOE, as described above) in multiple iterative cycles.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Coot</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generated amplicons were used to prepare either Oxford Nanopore or Illumina sequencing libraries.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Oxford Nanopore</div><div>suggested: (Oxford Nanopore Technologies, RRID:SCR_003756)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Oxford Nanopore libraries were prepared as described in the link above and sequenced in a flow cell R9.4.1 (Oxford Nanopore Technologies, Part Number FLO- MIN106D), using MinKNOW version 19.12.6.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MinKNOW</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reads were size filtered, demultiplexed and trimmed with Porechop (https://github.com/rrwick/Porechop), and mapped against reference strain Wuhan-Hu-1 (MN908947).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Porechop</div><div>suggested: (Porechop, RRID:SCR_016967)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Variants were called using Nanopolish 0.11.3 and accepted if they had a log- likelihood score of greater than 200 and minimum read coverage of 20.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Nanopolish</div><div>suggested: (Nanopolish, RRID:SCR_016157)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Reads were trimmed with trim_galore (http://www.bioinformatics.babraham.ac.uk/projects/trim_galore/) and mapped with BWA (Li and Durbin, 2009)) to the Wuhan-Hu-1 (MN908947) reference sequence, followed by primer trimming and consensus calling with iVar (Grubaugh et al., 2019) and a minimum read coverage of 10.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>http://www.bioinformatics.babraham.ac.uk/projects/trim_galore/</div><div>suggested: (Trim Galore, RRID:SCR_011847)</div></div><div style="margin-bottom:8px"><div>BWA</div><div>suggested: (BWA, RRID:SCR_010910)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A maximum-likelihood phylogenetic tree was constructed using IQ-TREE with the the following parameters: -czb -blmin 0.0000000001 -m HKY --runs 5 and all other parameters set to default.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IQ-TREE</div><div>suggested: (IQ-TREE, RRID:SCR_017254)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The tree was visualised with custom python code using the baltic library, https://github.com/evogytis/baltic.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Change in molecules bound to the biosensors caused a shift in the interference pattern that was recorded in real time and plotted using GraphPad Prism 8 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed and visualized with Prism (Version 8.4.3).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">ISRCTN66726260</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NA</td></tr></table>
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2020.11.04.355842
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.01.11.21249265

1
1. sciscore 01 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.01.11.21249265: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Each forward primer additionally includes on the 5’ end, a random 10 nucleotide sequence to serve as molecular barcode.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A total of 155 samples, corresponding to 48 individuals were analyzed by NGS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NGS</div><div>suggested: (PM4NGS, RRID:SCR_019164)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Barcode sequences were clustered based on sequence and amplicon identity, and consensus calling was done for each molecular tag (or barcode) cluster, by first performing global alignment among all associated reads using MAFFT.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Insert length analysis and calculation of viral fragmentation score: For each positive sample with sequencing data, SAMtools was used to capture insert sizes from alignment files with the following specifications: samtools view -f65 -F2048 SampleXYZ_consensus.bam | cut -f 1,4,9 > SampleXYZ_f65F2048.txt where f65 = filter in read paired, first in pair (Reads which are paired and insert sizes for first read in read pair and second in read in read pair will have same same insert size with “negative” length); F2048 = filter out reads with supplementary alignment (removes most subgenomic RNA reads which have part of reads with supplementary alignment and removes chimeric reads.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>samtools</div><div>suggested: (SAMTOOLS, RRID:SCR_002105)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Regression analysis and curve fitting was done using Prism 8.0.1.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  There are important limitations to this study. The use of the exact cut-off of VFS to categorize samples into clinical groups may not universally apply. Nonetheless, the basic premise of the argument that more intact virus would reflect in more longer fragments in a clinical sample would universally apply. As the study’s main conclusions are based on NGS, with some comparison to RT-PCR results, without evidence from virus culture studies it cannot be ruled out that some of the observed infectivity measures are correlated and result from a feature of the specific NGS method. In conclusion, we have applied NGS to comprehensively characterize longitudinal samples collected from different sites. NGS is an enabling tool that provides sequence-related information for which it is primarily designed, and also information from size and length dimensions. Based on this, we identify fragment length differences among clinical samples which are correlated to clinical features of infectiousness of SARS-CoV-2, quantification of which could be incorporated as relevant and straightforward measure to determine infection potential.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.01.11.21249265
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.02.05.21250127

1
1. sciscore 01 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.02.05.21250127: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: This study was exempted from Institutional Review Board review by Yale University as it did not engage in research involving human subjects.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Authentication: 23] Signals Analytics, an advanced analytics consultant that conducted the analysis, accessed these data sources through a third-party data vendor, NetBase.[24,25] These social media posts were geotagged by NetBase both directly, by using geolocation data from posts, and indirectly, by using author profiles and unique domain codes (such as .uk).</td></tr></table>
  Table 2: Resources
  No key resources detected.
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Our study has several limitations. First, although our third-party data provider reported that about 70% of posts were from the US, we do not know the location for most posts according to our direct geotagging methods, which were only able to tag about 80% of posts (eTable 2). As a result, we cannot make international comparisons, but our dataset is more representative of the US than of any other country. Second, the number of posts included in our dataset was much lower than previous studies, likely due to the types of data sources used, which excluded sites such as Twitter in order to exclude noise that might have obscured signals in social media data, and our methodology, which included removing posts not relevant to our more refined taxonomy. We used a stringent exclusion criterion with a list of prespecified keywords that may also have led to a smaller sample size, but our approach aimed to create a sample with high specificity. Finally, there is no demographic information available from the data posts directly due to privacy considerations and data use agreements. Thus, we cannot determine whether our data sample contains biases due to the demographics of the people who post. For instance, Reddit, which was the most common forum source for our data sample, has been found to be used by a younger, male audience.[45,46]
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.02.05.21250127
www.biorxiv.org www.biorxiv.org

https://doi.org/10.1101/2020.06.17.157982

1
1. sciscore 01 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2020.06.17.157982: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following overnight equilibration of ACE2 binding at room temperature, cells were washed in ice-cold PBS-BSA, and resuspended in PBS-BSA containing 1:200 diluted FITC-conjugated anti c-Myc antibody (Immunology Consultants Lab, CMYC-45F) to label for RBD surface expression via a C-terminal c-Myc epitope tag, and 1:200 diluted PE-conjugated streptavidin (Thermo Fisher S866) to detect bound biotinylated ACE2 ligand.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti c-Myc</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>c-Myc epitope tag ,</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For library expression experiments, 45 OD units yeast were washed twice with PBS-BSA and labeled in 3mL 1:100 diluted anti-Myc-FITC antibody for 1hr at 4°C with gentle mixing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Myc-FITC</div><div>suggested: (Sigma-Aldrich Cat# SAB4700448, RRID:AB_10896411)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody epitopes were mapped from crystal structures 6W41 (Yuan et al., 2020b), 6WAQ (Wrapp et al., 2020b), 2DD8 (Prabakaran et al., 2006), 3BGF (Pak et al., 2009), 2GHW (Hwang et al., 2006), 7BZ5 (Wu et al., 2020), and cryo-EM structures 6NB6 and 6NB7 (Walls et al., 2019), and 6WPS (Pinto et al., 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>6NB7</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 2.5e5 293T cells per well were seeded in 12-well plates in 1 mL D10 growth media (DMEM with 10% heat-inactivated FBS, 2 mM l-glutamine, 100 U/mL penicillin, and 100 μg/mL streptomycin).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Media was removed from the 293T-ACE2 cells and replaced with fresh D10 containing 50 μL of pseudovirus supernatant in a final volume of 150 μL.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-ACE2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Plasmids were transfected into 150mL suspension expi293F or HEK293F cells at 37°C in a humidified 8% CO2 incubator rotating at 130 rpm and harvested 3 days later.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293F</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Alignment and phylogeny: We used the curated RBD sequence set from Letko et al. (Letko et al., 2020), adding newly described RBD sequences from sarbecovirus strains RaTG13 (Zhou et al., 2020b), RmYN02 (Zhou et al., 2020a), GD-Pangolin and GX-Pangolin (Lam et al., 2020), and the additional non-Asian bat sarbecovirus isolate BtKY72 (Tong et al., 2009).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RaTG13</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For one bin in which the number of HiSeq reads was less than the number of cells sorted into a bin, we re-amplified PCR product from a newly purified plasmid aliquot, and obtained reads via a single lane of MiSeq 50bp single end sequencing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MiSeq</div><div>suggested: (A5-miseq, RRID:SCR_012148)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data visualization: The interactive heatmap of mutational effects shown at https://jbloomlab.github.io/SARS-CoV-2-RBD_DMS/ was made using the altair (VanderPlas et al., 2018) Python package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Structural images were rendered in PyMol.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMol</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RBD nucleotide sequences were aligned via mafft with a gap opening penalty of 4.5, and the maximum likelihood phylogeny was inferred in RAxML (Stamatakis, 2014) under the GTR model with 4 gamma-distributed discrete categories of among-site rate variation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RAxML</div><div>suggested: (RAxML, RRID:SCR_006086)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  To some degree, these caveats are universal of experimental studies, as even sophisticated animal models are imperfect proxies for true fitness (Louz et al., 2013)—but they are especially true for basic biochemical phenotypes like the ones we measure. However, on a hopeful note, our measurements correlate well with cellular entry by spike-pseudotyped viral particles expressing sarbecovirus RBD homologs (Figures 1D) and single mutants of the SARS-CoV-2 RBD (Figure 4E). Furthermore, fitness ultimately arises from the concerted action of biochemical phenotypes, which are in turn determined by genotype (Dean and Thornton, 2007; Harms and Thornton, 2013; Russell et al., 2014). By making the first link from mutations to biochemical phenotypes, we have taken a step towards enabling better interpretation of viral genetic variation. One important area where our maps do have clear relevance is assessing the potential for SARS-CoV-2 to undergo antigenic drift by fixing mutations at sites targeted by antibodies, as occurs for some other viruses such as influenza (Smith et al., 2004). The RBD is the dominant target of neutralizing antibodies (Cao et al., 2020; Ju et al., 2020; Pinto et al., 2020; Rogers et al., 2020; Seydoux et al., 2020; Shi et al., 2020; Wu et al., 2020; Zost et al., 2020), and so any antigenic drift will be constrained by its mutational tolerance. Our results show that many mutations to the RBD are well-tolerated with respect to both protein folding and ACE2 binding. H...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2020.06.17.157982
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2020.07.30.229377

1
1. sciscore 01 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2020.07.30.229377: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transfected cells were incubated for 3 hours at RT with the following anti-SARS-CoV structural protein monoclonal or polyclonal antibodies at a 1:250 dilution:</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV structural protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, mouse anti-SARS-CoV N monoclonal IgN 42c, rabbit anti-SARS-CoV S polyclonal sera (BEI Resources) and mouse anti-2xStrep-tag antibody (Sigma-Aldrich)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV N</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-2xStrep-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">. Anti-mouse IgG AF555, anti-rabbit IgG AF555, or anti-mouse IgM AF488 conjugated secondary antibodies were added at 1:500 dilution for 1 hour at RT (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-mouse IgG</div><div>suggested: (R and D Systems Cat# AF555, RRID:AB_355438)</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG</div><div>suggested: (SouthernBiotech Cat# 4030-32, RRID:AB_2795940)</div></div><div style="margin-bottom:8px"><div>anti-mouse IgM</div><div>suggested: (SouthernBiotech Cat# 1021-30, RRID:AB_2794251)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">LzGreen SARS-COV-2 S pseudotyped lentivirus were mixed with 2-fold dilutions of the following monoclonal or polyclonal anti-SARS-CoV-2 S antibodies: mouse anti-SARS-CoV S monoclonal IgM 154c</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2 S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following anti SARS-CoV-2 S monoclonal and polyclonal antibodies were serially diluted by 2-fold dilutions in blocking buffer: mouse anti-SARS-CoV S monoclonal IgM 154c</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti SARS-CoV-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-SARS-CoV S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-mouse HRP, and anti-human-HRP secondary antibodies were used at 1:4000 concentration in blocking buffer, and were incubated 1 hour at RT. 50 μL of TMB HRP substrate (ThermoFisher Scientific) was added, and following incubation for 10 minutes at RT, 50μL of 2N H2SO4 was added as a stopping solution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-mouse HRP</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human-HRP secondary antibodies</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Resolved proteins were then transferred to a PVDF membrane, blocked in TBS with 2% BSA 0.1% Tween-20, then incubated with the following antibodies diluted to 1:500 in blocking buffer: mouse anti-SARS-CoV N monoclonal IgM 19c, mouse anti-SARS-CoV M monoclonal IgG1 283c, mouse anti-SARS-CoV E monoclonal IgM 472c, and mouse anti-2xStrep-tag antibody, and anti-His-HRP.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-His-HRP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus transduction capability was then tittered on 293T-Ace2 cells treated with 50μl of 5μg/ml polybrene (Sigma-Aldritch LLC).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-Ace2</div><div>suggested: RRID:CVCL_YZ65)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">His-tagged RBD bearing lentivirus was produced in HEK 293T cells and used to infect HEK 293-F suspension cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK 293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western blot: 293T cells were seeded in 10 cm dishes at a density of 3.5 million cells per dish.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Maximum intensity z-projections were prepared in Fiji.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2020.07.30.229377
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2020.08.24.264333

1
1. sciscore 01 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2020.08.24.264333: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HRP-conjugated secondary antibodies against T7-tag (Thermo) were diluted 1:7500 and incubated with the well for 1 hr at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>T7-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A validated SARS-CoV-2 antibody-negative human serum control, a validated NIBSC SARS-CoV-2 plasma control, was obtained from the National Institute for Biological Standards and Control, UK) and an uninfected cells control were also performed to ensure that virus neutralization by antibodies was specific.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Control , UK </div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The RBD (residues 319-541) of the SARS-Cov-2 S protein was expressed as a secreted protein in Spodoptera frugiperda Sf9 cells (Expression Systems) using the Bac-to-bac baculovirus method (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sf9</div><div>suggested: CLS Cat# 604328/p700_Sf9, RRID:CVCL_0549)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudotyped SARS-CoV-2 neutralization assay: The 293T-hsACE2 stable cell line (Cat# C-HA101) and the pseudotyped SARS-CoV-2 (Wuhan-Hu-1 strain) particles with GFP (Cat# RVP-701G, Lot#CG-113A) or firefly luciferase (Cat# RVP-701L, Lot# CL109A, and CL-114A) reporters were purchased from the Integral Molecular.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T-hsACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The serum–virus mixes (220 μl total) were incubated at 37 °C for 1 h, after which they were added dropwise onto confluent Vero E6 cell monolayers in the six-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The raw data was processed by Prism 7 (GraphPad) to fit into a 4PL curve and to calculate logIC50.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the MS analysis, the data was searched by pLink for the identification of cross-linked peptides.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pLink</div><div>suggested: (PLINK, RRID:SCR_001757)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Each Nb model was then docked to the RBD structure (PDB 6LZG) by an antibody-antigen docking protocol of PatchDock software that focuses the search to the CDRs and optimizes CXMS-based distance restraints satisfaction (Schneidman-Duhovny, 2012 #52; Schneidman-Duhovny, 2020 #53).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PatchDock</div><div>suggested: (PatchDock, RRID:SCR_017589)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The antigen interface residues (distance <6Å from Nb atoms) among the top 10 scoring models, according to the SOAP score, were used to determine the epitopes.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SOAP</div><div>suggested: (SOAP, RRID:SCR_000689)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The initial model was refined in Phenix (Adams, 2010 #61)and adjusted in COOT (Emsley, 2004 #62).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phenix</div><div>suggested: (Phenix, RRID:SCR_014224)</div></div><div style="margin-bottom:8px"><div>COOT</div><div>suggested: (Coot, RRID:SCR_014222)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The model quality was checked by MolProbity (Williams, 2018 #63).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MolProbity</div><div>suggested: (MolProbity, RRID:SCR_014226)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Nb21 comparative modeling was done using the Nb20 structure as a template in MODELLER.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MODELLER</div><div>suggested: (MODELLER, RRID:SCR_008395)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2020.08.24.264333
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2020.09.14.20194308

1
1. sciscore 01 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2020.09.14.20194308: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: We enrolled 14,057 participants who all signed a written informed consent that also included permission to extract data from the employer’s administrative databases that contain data on sick leave.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">Data analyses: With conventional statistical power and two-sided tests of significance, and assuming a cumulative proportion of sick leave among non-exposed persons of 30% and that 10% of the cohort might be exposed, at least 3800 subjects would need to be enrolled to be able to detect associations of 1.4 or greater, a level which was considered to be medically meaningful.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Most participants were between 30-59 years old and 79% were females (Supplementary Table 1).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum IgG bound to antigen coated beads was detected by F(ab’)2-Goat anti-Human IgG Fc Secondary Antibody, PEfluorescent anti-hIgG (Invitrogen, H10104.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human IgG Fc Secondary Antibody, PEfluorescent anti-hIgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>H10104</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The evaluation of different production hosts was based on degree of concordance in antibody reactivity of the alternative hosts with the virus proteins produced in the HEK cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Consequently, antigen reactivity was measured towards three different virus protein-variants, (i) Spike trimers comprising the prefusion-stabilized spike glycoprotein ectodomain [7] expressed in HEK cells and purified using a C-terminal Strep II tag), (ii) Spike S1 domain, expressed in CHO cells and purified using C- terminal HPC4-tag, and (iii) Nucleocapsid protein, expressed in E.coli and purified using a C-terminal His-tag.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  A limitation is that we were not able to study infections occurring more than six to seven weeks before enrollment, as community transmission of SARS-CoV-2 in the region started only about six to seven weeks before the study. Participants were not questioned about present or prior symptoms, but the hospital rules were clear that employees with symptoms should not be at work and we had, by design, decided to use only sick leave data to avoid possible recall bias. Hospital rules state that also employees working from home that develop COVID-19 symptoms must report this as sick leave. We conclude that antibody testing is a powerful tool for identification of subjects who have had prior virus exposure and are protected against future disease. Although it is commonly assumed that antibodies mark immunity, it is important that it has now been shown in a large cohort study that seropositive subjects have no excess risk for future sick leave. We would like to caution that there is a large number of serology tests currently on the market and the extent of their validation may vary. Also, none of these tests have been specifically validated for the indication proposed here (to separate exposed subjects who are protected from future disease from exposed subjects at risk to develop disease in the future). In summary, the present study has found that validated antibody testing may be helpful in SARS-CoV-2 screening strategies as antibody-positive subjects were found to have no excess risk...
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04411576</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Current and Past SARS-CoV-2 Infection and COVID-19 in Health…</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2020.09.14.20194308
www.biorxiv.org www.biorxiv.org

https://doi.org/10.1101/2020.06.14.151357

1
1. sciscore 01 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2020.06.14.151357: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Cells were regularly passaged and tested for presence of mycoplasma contamination (MycoAlert Plus Mycoplasma Detection Kit, Lonza)</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Primary antibody incubations were performed overnight at 4°C using the following antibodies: rabbit anti-GAPDH 14C10 (0.1 μg/mL, Cell Signaling 2118S), mouse anti-rhodopsin antibody clone 1D4 (1 μg/mL, Novus NBP1-47602) which recognizes the C9-tag added to the Spike proteins.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-GAPDH</div><div>suggested: (Cell Signaling Technology Cat# 2118, RRID:AB_561053)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following the primary antibody, the blots were incubated with IRDye 680RD donkey anti-rabbit (0.2 μg/mL, LI-COR 926-68073) or with IRDye 800CW donkey anti-mouse (0.2 μg/mL, LI-COR 926-32212) for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: (LI-COR Biosciences Cat# 926-68073, RRID:AB_10954442)</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (LI-COR Biosciences Cat# 926-32212, RRID:AB_621847)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike was immunoprecipitated using 2 μg C9 antibodies (Novus NBP1-47602) per sample and incubated on a rotator at 4°C for at least 4 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C9</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western blotting was performed as described above using mouse anti-rhodopsin antibody clone 1D4 (1 μg/mL, Novus NBP1-47602) which recognizes the C9-tag added to the Spike proteins.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rhodopsin</div><div>suggested: (Novus Cat# NBP1-47602, RRID:AB_10010560)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: A549 cells were obtained from ATCC, HEK293FT cells were obtained from Thermo Scientific, and Huh-7.5 and Caco-2 were a kind gift of B. tenOever (Mt. Sinai).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HEK293FT</div><div>suggested: ATCC Cat# PTA-5077, RRID:CVCL_6911)</div></div><div style="margin-bottom:8px"><div>Huh-7.5</div><div>suggested: RRID:CVCL_7927)</div></div><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, for each virus, a T-225 flask of 80% confluent HEK293T cells (Thermo) was transfected in OptiMEM (Thermo) using 25 μg of the transfer plasmid, 20 μg psPAX2, 22 μg spike plasmid, and 175 μl of linear Polyethylenimine (1 mg/ml) (Polysciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ACE2 lentiviral cloning and ACE2 stable cell line overexpression: To generate pLenti-ACE2-Hygro, we amplified human ACE2 (hACE2) from pcDNA3.1-ACE2 (Addgene 1786) and cloned it into a lentiviral transfer pLEX vector carrying the hygromycin resistance gene using Gibson Assembly Master Mix (NEB E2611L).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: RRID:CVCL_DR94)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Huh7.5-ACE2 and A549-ACE2 cell lines were generated by lentiviral transduction of ACE2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh7.5-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A549-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 was propagated in Vero E6 cells in DMEM supplemented with 2% FBS, 4.5 g/L D-glucose, 4 mM L-glutamine, 10 mM</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Band intensity quantification was performed by first converting Odyssey multichannel TIFFs into 16-bit grayscale image (Fiji) and the then selecting lanes and bands in ImageLab 6.1 (BioRad).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For each peptide, we computed the difference in predicted affinity between the D614 and G614 variant using R/RStudio and visualized them using the pheatmap R package.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>pheatmap</div><div>suggested: (pheatmap, RRID:SCR_016418)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Data analysis was performed using R/Rstudio 3.6.1 and GraphPad Prism 8 (GraphPad Software Inc.)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2020.06.14.151357
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.02.03.429555

1
1. sciscore 01 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.02.03.429555: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proteins and antibodies: SARS-CoV-2 (438-516) S-RBD((HiS)6 and biotynilated human ACE2 have been purchased from Fisher Scientific (respective references 16534204 and 16545164).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monoclonal anti-6X His tag antibody has been purchased from ABCAM (reference ab18184, dilution 1/200).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-6X</div><div>suggested: (Abcam Cat# ab18184, RRID:AB_444306)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti α-tubulin antibody has been purchased from SIGMA (reference T6199, dilution 1/500).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti α-tubulin</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary goat anti-mouse antibody coupled to AlexaFluor 488 has been purchase from Fisher Scientific (Reference Allo2g, dilution 1/400).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bound proteins were detected by western blot using anti-His antibody and streptavidin-HRP conjugate (SIGMA, reference GERPN1231).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lentiviral particles were produced by transient transfection of HEK293T(human embryonic kidney cells according to standard protocols.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T(human</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DNA from two different cell clones (human 293T and K562 cells), containing a single integrated copy of the provirus, was used as a normalized cell line.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">DNA from a HEK cell line with one proviral insert (HEK-2C9) was used as a standard for quantification by the ΔCt method.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell imaging: For cell imaging 20 000 HEK293T and HEK293T-ACE2 cells were plated on glass coverslips pretreated with poly-L-Lysine solution 0.01% (SIGMA ref P4832) 5 minutes at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For quantification of the S-RBD/ACE2 interaction in cellular context 45 000 HEK293T and HEK293T-ACE2 cells were incubated 45 minutes at 37°C in 100µl DMEM and increasing concentrations of RBD recombinant protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data were analyzed with GraphPad Prism 5.01 software.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sensorgrams curves were plotted using Prism 5.0 software (Graphpad Software, La Jolla, CA) Cells and lentiviral vectors production: Lentivirus vector production was done by the service platform Vect’UB, (INSERM US 005</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>Graphpad</div><div>suggested: (GraphPad, RRID:SCR_000306)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Epifluorescence microscopy was carried out on a Zeiss Axioimager Z1 driven by Metamorph.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Metamorph</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.02.03.429555
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.02.05.429566

1
1. sciscore 01 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.02.05.429566: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Recovered patients and those with an active infection with SARS-CoV-2 were invited to participate and signed a consent letter at the moment of enrollment to the clinical trial NCT04384588.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Inclusion criteria for convalescent patient considered men and women previously confirmed with COVID-19 by PCR test and 21 or more days after symptoms had finished.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Recombinant proteins and secondary antibodies: Recombinant SARS-CoV-2 Nucleocapsid Protein with C-terminal His-tag (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>His-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the immunodetection, the membranes were separately incubated with either HRP-conjugated secondary antibody anti-human IgG, anti-human IgA or anti-human IgM diluted at 1:20,000 (0.04 μg/ml) in blocking solution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-human IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Later, each well was incubated at 20°C (±1°C) for 1h with 100 μL of a 20 ng/ml solution of the specific peroxidase-conjugated affiniPure anti-Human isotype antibody, anti-IgG (Fcβ fragment specific) (#709-035-098, Jackson Immuno-Research), anti-IgA (Frα fragment specific) (#109-035-011, Jackson Immuno-Research) and anti-IgM (μ chain) (#709-035-073, Jackson Immuno-Research).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Human isotype antibody,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IgA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IgM (μ chain)</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunofluorescence: HeLa cells (ATCC® CCL-2) were transient transfected with a mammalian expression vector expressing a Spike-GFPSpark tag codon optimized fusion SinoBiological VG40589-ACGLN in 10cm plates, 24 h after transfection ~ 8000 cells per well were deposited into 96 well optical plate (Themofisher), after 24 h incubation cells were washed with PBS (phosphate buffered saline solution) 1X 3 times and fixed with 4% paraformaldehyde at room temperature for 30 min.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pixels were quantified using Fiji Software (v.2.0.0, NIH) and exposition time was used as reference.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji</div><div>suggested: (Fiji, RRID:SCR_002285)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">< Statistical analyses: Statistical analysis was performed using GraphPad Prism software, version 8.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  We understood the limitations of our work in the number of cases analyzed and the experimental strategy used; however, it provides information for some laboratories with limited resources to apply, exceptionally, basic research tools for monitoring COVID-19 cases during a pandemic.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04384588</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">COVID19-Convalescent Plasma for Treating Patients With Activ…</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.02.05.429566
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.01.28.21250577

1
1. sciscore 01 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.01.28.21250577: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data (PDB: 6XC2, 6XC4, 7JMP, 7JMO, 6XKQ, and 6XKP) (Supplementary Figure 4) on the three- dimensional structure of six neutralizing antibodies (CC12.1, CC12.3, COVA2-39, COVA2-04, CV07-250, and CV07-270) (Supplementary Figure 4) that bind to the spike glycoprotein of SARS- CoV-2 was used in these studies [6].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CV07-250</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CV07-270</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We investigated the binding of the spike glycoprotein Y453F mutant of SARS-CoV-2 to human angiotensin-converting enzyme 2 (ACE2) and determined the affinity of the spike glycoprotein Y453F mutant of SARS-CoV-2 to six neutralizing monoclonal antibodies using the MOE program (three-dimensional protein structure modeling, protein docking analysis: MOLSIS Inc., Tokyo, Japan) and Cn3D macromolecular structure viewer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The amount of the bound ACE2, which is proportional to ACE2 inhibition intensity, is then recognized by the Neutralizing Detection Complex containing anti-His antibody and measured through an ELISA-like reaction by reading the absorbance in a microplate spectrophotometer at a wavelength of 450 nm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum from 10 normal (negative for COVID-19) patients and 20 COVID-19 patients with varying immunoglobulin M (IgM) and immunoglobulin G (IgG) antibody levels.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>immunoglobulin G (IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">COVID-19 status was confirmed with RT-PCR, antigen, and/or antibody serology tests.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RT-PCR, antigen,</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Adsorption of RBD or RBD Y453F recombinant protein to the solid phase surface of the ELISA plate: HeLa cells were then transfected with pcMV3-2019-nCov-RBD-Flag tag expression vector (2 μg), or the pcMV3-2019-nCov-RBD Y453F-FLag tag expression vector (2 μg) (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HeLa</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.01.28.21250577
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.02.16.431318

1
1. sciscore 01 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.02.16.431318: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Furthermore, each cell type enrichment score is differentiated from a population of enrichment scores (suprema) that is obtained in an iterative process in which cell type labels are randomly permutated, yielding an empirical p-value that indicates the significance of enrichment.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Immunofluorescence detection and protein co-localization: 48 hours post transfection cells were washed with 1x PBS, fixed in 4% paraformaldehyde/1x PBS for 15 min at RT, permeabilized with 0.1 % Triton X-100/1xPBS for 10 min at RT, washed three times with 1x PBS and incubated with 5 % horse serum/1xPBS for 1 h at 20 °C before incubating with the following antibodies (Cell Signaling Laboratories): anti-calnexin (clone C5C9), anti-BiP (clone C50B12), anti-Hsp90a (clone D1A7), anti-ZO1 (clone D7D12), anti-ZO2 (2847), anti-ZO3 (D57G7), anti-claudin 1 (D5H1D), anti-CD2AP (2135), anti-afadin (clone D1Y3Z) or Alexa Fluor 488 anti-DYKDDDDK (flag) tag monoclonal antibody (L5, Life Technologies).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-calnexin</div><div>suggested: (Thermo Fisher Scientific Cat# MA3-027-A488, RRID:AB_2662809)</div></div><div style="margin-bottom:8px"><div>anti-BiP</div><div>suggested: (Cell Signaling Technology Cat# 3177, RRID:AB_2119845)</div></div><div style="margin-bottom:8px"><div>anti-Hsp90a</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-ZO3 (D57G7), anti-claudin 1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-CD2AP</div><div>suggested: (Cell Signaling Technology Cat# 2135, RRID:AB_2228922)</div></div><div style="margin-bottom:8px"><div>anti-afadin</div><div>suggested: (Cell Signaling Technology Cat# 13531, RRID:AB_2798249)</div></div><div style="margin-bottom:8px"><div>anti-DYKDDDDK</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Proteins were separated on NuPAGE 4-12% Bis-Tris gels (Life technologies) before transferring proteins onto Nitrocellulose membranes and incubating with anti-BiP (C50B12, Cell Signaling Laboratories (CSL)), anti-ZO1 (D7D12, CSL), anti-ZO2 (2847, CSL) or Alexa Fluor 488 conjugated anti-DYKDDDDK Tag monoclonal antibody (L5, Sigma) in 5 % BSA, 1x PBS, 0.05 % Tween-20.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-BiP (C50B12</div><div>suggested: (Cell Signaling Technology Cat# 3177, RRID:AB_2119845)</div></div><div style="margin-bottom:8px"><div>anti-ZO1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-ZO2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Signals were detected either using Radiance Q ECL reagent (Azure Biosystems) after washing and incubation with HRP coupled anti-rabbit antibodies (CSL) or imaged directly using an Azure 600 Western blot imaging system.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-rabbit</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture, transfection and transduction: HEK293T cells were grown at 37 °C and 5 % CO2 in DMEM supplemented with 10% tetracycline-free fetal bovine serum and 1% Penicillin-Streptomycin (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Fragment ion spectra were searched with Prolucid 66 with the forward and reversed human UniProt database v.07-01-2020, and filtered with DTASelect 67 to a false discovery rate of < 1 %.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UniProt</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western blot images were quantified in Fiji/ImageJ.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Fiji/ImageJ</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.02.16.431318
www.medrxiv.org www.medrxiv.org

http://medrxiv.org/cgi/content/short/2020.08.01.20166553

1
1. sciscore 01 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2020.08.01.20166553: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Consecutive out-patients diagnosed at the same 4 hospitals prior to March 15th and on a convenience sample of later days were approached for consent to collect serum and saliva at 4–12 weeks PSO.<br>IRB: All samples were collected after Research Ethics Board (REB) review (see Sample section above for the individual REB approval numbers).</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">No randomization was performed, since this is an observational study.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This observational study focused on monitoring the levels of antibodies to SARS-CoV-2 antigens in serum and saliva of patients with confirmed SARS-CoV-2 infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing 4 times, 10 μl of one of the following secondary antibodies (all from Jackson ImmunoResearch) diluted in 1% BLOTTO in PBS-T were added at the indicated concentrations followed by incubation for 2 hr at room temperature: Goat anti-human IgG Fcy – HRP (#109-035-098; 1:40,000 or 0.2 ng per well), Goat anti-human IgM Fc5u – HRP (#109035-129; 1:12,000 or 0.66 ng per well) or Goat anti-human IgA a chain – HRP (#109-035-127; 1:10,000 or 0.8 ng per well).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-035-098, RRID:AB_2337586)</div></div><div style="margin-bottom:8px"><div>anti-human IgM</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-035-129, RRID:AB_2337588)</div></div><div style="margin-bottom:8px"><div>anti-human IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies used for the standard curves were: Human anti-spike S1 IgG (A02038, GenScript), anti-spike S1 IgM (A02046, GenScript) and Ab01680 anti-spike IgA (Ab01680-16, Absolute Antibody), all used at 0.5 to 10ng per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-spike S1 IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A02038</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-spike S1 IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>A02046</div><div>suggested: (GenWay Biotech Inc. Cat# GWB-A02046, RRID:AB_10276779)</div></div><div style="margin-bottom:8px"><div>anti-spike IgA</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-human Ig antibody (Southern Biotech, 2010–01) diluted 1:1000 in PBS was added to 96-well Nunc MaxiSorp™ plates (ThermoFisher, 44-2404-21).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-human Ig antibody</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Anti-human Ig</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HRP-conjugated secondary antibodies against IgA, IgG, and IgM (goat anti-human IgA- and IgG-HRP, Southern Biotech, IgA: 2053–05, IgG: 2044–05, IgM: 2023–05) were added to the appropriate wells at 1:1000 in 2.5% BLOTTO and incubated for 1 hour at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HRP-conjugated secondary antibodies against IgA, IgG, and IgM (goat anti-human IgA- and IgG-HRP, Southern Biotech, IgA: 2053–05, IgG: 2044–05, IgM: 2023–05)</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HRP-conjugated secondary antibodies against IgA, IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>goat anti-human IgA-</div><div>suggested: (InvivoGen Cat# fab-iga, RRID:AB_11125122)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Horseradish peroxidase (HRP)-conjugated Goat anti human-IgG, IgA, and anti-IgM secondary antibodies (Southern Biotech, IgG: 2044–05, IgA: 2053–05, IgM: 2023–05) were added to wells at dilutions of 1:1000, 1:2000 and 1:1000 in 2.5% BLOTTO, respectively, and incubated for 1 hour at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti human-IgG, IgA,</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti human-IgG, IgA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-IgM</div><div>suggested: (SouthernBiotech Cat# 2023-01, RRID:AB_2795619)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For serum samples, seven multivariable linear regression models were constructed (one for each of anti-RBD IgA, anti-S IgA, anti-RBD IgG, anti-S IgG, anti-RBD IgM, anti-spike IgM, neutralizing antibody).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD IgA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S IgA</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-RBD IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-RBD IgM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-spike IgM</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Development and validation of manual colorimetric and automated chemiluminescent assays for monitoring RBD and spike trimers antibodies in serum or plasma. Fig. S2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Effect of heat versus detergent inactivation of saliva samples on the detection of anti-RBD antibodies in a manual, colourimetric ELISA. Fig. S5.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-RBD</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>S5</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To stabilize the spike protein in a trimeric form, the cDNA was cloned in-frame with the human resistin cDNA (aa 23–108) containing a C-terminal FLAG-(His)6 tag (Cricetulus griseus codon bias, GenScript) into a modified cumate-inducible pTT241 expression plasmid and transfected in CHO2353 cells (Stuible et al, manuscript in preparation) followed by methionine sulfoximine selection for 14 days to generate a stable CHO pool.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CHO2353</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Viral stock was expanded using Vero E6 as previously described such that stored aliquots of stock contain 2% FBS.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Initial experiments were done with Triton X-100 (Sigma-Aldrich) serially diluted and applied to Vero-E6 cells in 96-well flat bottom plates to determine the minimum concentration required to prevent toxicity to cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spike trimer was expressed as follows: the SARS-CoV-2 spike sequence (aa 1–1208 from Genebank accession number MN908947 with the S1/S2 furin site (residues 682–685) mutated [RRAR->GGAS] and K986P / V987P stabilizing mutations was codon-optimized (Cricetulus griseus codon bias) and synthesized by Genscript.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Genebank</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">These analyses were performed in Prism (GraphPad), Version 8.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">References and Notes:</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Notes</div><div>suggested: None</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2020.08.01.20166553
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2020.09.09.20191205

1
1. sciscore 01 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2020.09.09.20191205: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2- specific antibodies were detected using phycoerythrin (PE)-conjugated mouse anti-human pan-IgG, IgG1, IgG2, IgG3, IgA1 or IgA2 (Southern Biotech) at 1.3μg/ml, 25μl per well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human pan-IgG, IgG1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgG2, IgG3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">RBD neutralising human IgG1 antibody (ACROBiosystems, USA) was included as a positive control, in addition to COVID-19 negative plasma and buffer only negative controls.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monoclonal antibodies for surface staining included: CD19-ECD (J3-119) (Beckman Coulter), CD20 Alexa700 (2H7), IgM-BUV395 (G20-127), CD21-BUV737 (B-ly4), IgDCy7PE (IA6-2), IgG-BV786 (G18-145) (BD), CD14-BV510 (M5E2), CD3-BV510 (OKT3), CD8a-BV510 (RPA-T8), CD16-BV510 (3G8), CD10-BV510 (HI10a), CD27-BV605 (O323) (Biolegend), IgA-Vio450 (clone) (Miltenyi).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD20</div><div>suggested: (BD Biosciences Cat# 740204, RRID:AB_2739954)</div></div><div style="margin-bottom:8px"><div>CD21-BUV737</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD14-BV510</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD3-BV510</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>OKT3</div><div>suggested: (BD Biosciences Cat# 566779, RRID:AB_2869862)</div></div><div style="margin-bottom:8px"><div>CD8a-BV510</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD16-BV510</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD10-BV510</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD27-BV605</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>IgA-Vio450</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following stimulation, cells were washed, stained with Live/dead Blue viability dye (ThermoFisher), and a cocktail of monoclonal antibodies: CD27 BUV737 (L128), CD45RA PeCy7 (HI100), CD20 BUV805 (2H7), (BD Biosciences), CD3 BV510 (SK7), CD4 BV605 (RPA-T4), CD8 BV650 (RPA-T8)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CD27</div><div>suggested: (BD Biosciences Cat# 751682, RRID:AB_2875668)</div></div><div style="margin-bottom:8px"><div>CD45RA</div><div>suggested: (BD Biosciences Cat# 742052, RRID:AB_2871341)</div></div><div style="margin-bottom:8px"><div>CD3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD4</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>CD8</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Microneutralisation Assay: SARS-CoV-2 isolate CoV/Australia/VIC01/202042 was passaged in Vero cells and stored at −80C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The ectodomain of SARS-CoV-2 (isolate WHU1;residues 1 – 1208) was synthesised with furin cleavage site removed and P986/987 stabilisation mutations45, a C-terminal T4 trimerisation domain, Avitag and His-tag, expressed in Expi293 cells and purified by Ni-NTA affinity and size-exclusion chromatography using a Superose 6 16/70 column (GE Healthcare).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Comparison of B and T cell frequencies at first and final sampling was performed using Wilcoxon Rank Sum test in GraphPad Prism 8.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 52 and 31. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2020.09.09.20191205
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2021.02.17.21251933

1
1. sciscore 01 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.02.17.21251933: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All work with infectious virus was performed in a Biosafety Level 3 laboratory and approved by the Institutional Biosafety Committee and Environmental Health and Safety. UCLA: Calu3 cells were seeded at 3x104 cells per well in 0.2 ml volumes in 96-well plates.<br>IRB: EHR analysis for UPHS was performed under University of Pennsylvania Institutional Review Board (IRB) protocol #844360 and for MSMC under IRB#20-00338. Outcome: The primary outcome of our case-control EHR study was COVID-19 susceptibility where cases are defined by positive test results from RT-PCR of nasal samples and controls with negative test results.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies to the SARS-CoV-2 N protein were purchased from Invitrogen (#PA1- 41386).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>the SARS-CoV-2 N protein</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SARS-CoV-2 N protein</div><div>suggested: (ABclonal Cat# A20021, RRID:AB_2862924)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies from Cell Signaling included phospho-Glycogen Synthase (#3891), phospho-S6 (#4858), β-catenin (#9562), phospho-β-catenin (#9561), GAPDH (#2118), PKCα (#2056), PKCδ (#2058), PKCε (#2683), and phospho (Ser) substrate (#2261).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>phospho-Glycogen Synthase</div><div>suggested: (Cell Signaling Technology Cat# 3891, RRID:AB_2116390)</div></div><div style="margin-bottom:8px"><div>phospho-S6 (#4858),</div><div>suggested: (Cell Signaling Technology Cat# 4858, RRID:AB_916156)</div></div><div style="margin-bottom:8px"><div>β-catenin</div><div>suggested: (Cell Signaling Technology Cat# 9562, RRID:AB_331149)</div></div><div style="margin-bottom:8px"><div>phospho-β-catenin</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GAPDH</div><div>suggested: (Cell Signaling Technology Cat# 2118, RRID:AB_561053)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Other antibodies included antibodies to GSK-3 (Calbiochem #368662), Tau (T14/46 antibodies provided by Virginia Lee, University of Pennsylvania), and β-actin (Sigma #A5441).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GSK-3</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>T14/46</div><div>suggested: (Abcam Cat# T1446, RRID:AB_10704455)</div></div><div style="margin-bottom:8px"><div>β-actin</div><div>suggested: (Sigma-Aldrich Cat# A5441, RRID:AB_476744)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For immunoprecipitation/protein kinase assays, anti-Myc-tag antibody was incubated with Surebeads Protein G megnetic beads (Bio-Rad, #1614023) for 10 min, lysates were then added for an additional 1 hr at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Myc-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">At 48 hours post infection (hpi), the cells were fixed with 4% paraformaldehyde and viral infection was examined by immunofluorescent analysis (IFA) using SARS-CoV Spike (S) antibody [BEI Resources: NR-616 Monoclonal Anti-24 SARS-CoV S Protein (Similar to 240C)].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-24 SARS-CoV S Protein</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture, transfections, and CRISPR/Cas9 knockout: HEK293T cells (ATCC #CRL-1573) were cultured in Dulbecco’s Modified Eagle Medium (DMEM, GIBCO #11965) supplemented with 10% Fetal Bovine Serum (Hyclone #SH30071.03) and 1% penicillin/streptomycin (GIBCO #15140), and were maintained at 37°C and 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Two days after transduction, about 1,000 tranduced 293T cells were mixed with 1ml of methylcellulose (MethoCult H4034 Optimum, Stem Cell Technologies) into a 6-well plate and cultured at 37°C and 5% CO2 for two weeks.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All work with infectious virus was performed in a Biosafety Level 3 laboratory and approved by the Institutional Biosafety Committee and Environmental Health and Safety. UCLA: Calu3 cells were seeded at 3x104 cells per well in 0.2 ml volumes in 96-well plates.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu3</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The total number of cells and the number of infected cells were measured using MetaXpress 5.3.3 cell scoring module and the percentage of infected cells was calculated.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MetaXpress</div><div>suggested: (MetaXpress, RRID:SCR_016654)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To minimize these differences, we used RxNorm – a resource of standardized nomenclature for drug names from the National Library of Medicine45.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RxNorm</div><div>suggested: (RxNorm, RRID:SCR_006645)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  While the association of lithium therapy and reduced risk of COVID-19 across three health systems is both signficant and intriguing, observational studies have many limitations. A variety of factors with potential biases cannot be measured even after comparing the cases and controls in a manner that accounts for known confounding factors using a rigorous matching algorithm. For instance, details on medicine usage were derived from records of prescription orders, but information on compliance before SARS-CoV-2 PCR testing is not available. In addition, the collection of a non-random sample population can create a collider bias and lead to distorted associations. For example, the COVID-19 test was restricted particularly in the early pandemic to symptomatic patients so that many asymptomatic patients in the EHR were not tested. These findings should therefore be interpreted carefully and deeper investigation is required in a cohort with a larger sample size. Prior work has shown that lithium and the GSK-3 inhibitor Kenpaullone inhibit N phosphorylation and reduce viral titers in SARS-CoV and JHMV infected Vero6 cells8, 9 and GSK3 knockdown also impairs replication of IBV in Vero cells15. We also show that multiple small molecule GSK-3 inhibitors, including CHIR99021, BIM-I, AR-A014418, Enzastaurin, and Sotrastaurin block SARS-CoV-2 phosphorylation. These pharmacological studies are compelling evidence that GSK-3 is a critical host kinase for N protein, but these drugs may have ...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2021.02.17.21251933
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.02.22.432402

1
1. sciscore 01 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.02.22.432402: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Human IgG1 CR3022 antibody (28) (GenBank: ABA54613.1 and ABA54614.1) was expressed from heavy and light chain AbVec expression vectors in Expi293™ cells (Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Human IgG1 CR3022 antibody</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div><div style="margin-bottom:8px"><div>Human IgG1</div><div>suggested: (Imported from the IEDB Cat# CR3022, RRID:AB_2848080)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This construct was expressed as a secreted protein by a stable Drosophila S2 cell line (30) and affinity purified using C-tag affinity resin (Thermo Fisher Scientific) followed by a size-exclusion chromatography polishing step in 20 mM Tris, 150 mM NaCl, pH 7.4.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>S2</div><div>suggested: DGRC Cat# 150, RRID:CVCL_Z831)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04275245</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Clinical Study of Anti-CD147 Humanized Meplazumab for Inject…</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  No conflict of interest statement was detected. If there are no conflicts, we encourage authors to explicit state so.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.02.22.432402
www.biorxiv.org www.biorxiv.org

http://biorxiv.org/cgi/content/short/2020.09.24.311027

1
1. sciscore 01 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2020.09.24.311027: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All mouse experiments were approved by the institutional animal care and use committee (IACUC) and were conducted according to international guidelines for animal studies.<br>IRB: Human COVID-19 convalescent serum samples: 41 human convalescent sera samples from recovered COVID-19 patients (table S1) were obtained from Public Health Clinical Center of Chengdu in Chengdu, China, under approved guidelines by the Institutional Review Board (IRB), and all patients had provided written informed consent before sera sample were collected.<br>Consent: Human COVID-19 convalescent serum samples: 41 human convalescent sera samples from recovered COVID-19 patients (table S1) were obtained from Public Health Clinical Center of Chengdu in Chengdu, China, under approved guidelines by the Institutional Review Board (IRB), and all patients had provided written informed consent before sera sample were collected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Rhesus Macaques (3-6 years old) were randomized into 3 groups of 6 animals, and immunized intramuscularly with either PBS as a negative control, or 30 μg S-Trimer adjuvanted with 0.25 mL AS03, or 30 μg S-Trimer adjuvanted with 1.5 mg CpG 1018 plus 0.75 mg alum.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Animal studies, facilities and ethics statements: Specific pathogen-free (SPF) BALB/c female mice (6-8 weeks old) for immunogenicity studies were purchased from Chengdu Dossy Experimental Animals Co.,</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing 3 times with PBST, the plates were incubated with rabbit anti-Trimer-Tag antibody (Clover Biopharma) at 37°C for 1 h, followed by washing 3 times with PBST and then a 1:20000 dilution of goat anti-rabbit IgG-HRP (Southern Biotech).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Trimer-Tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After washing 3 times with PBST, the plates were incubated with rabbit anti-Trimer-Tag antibody (Clover Biopharma) at 37°C for 1 h, followed by washing 3 times with PBST and then a 1:20000 dilution of goat anti-rabbit IgG-HRP (Southern Biotech).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Trimer-Tag</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-rabbit IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Then, freshly-trypsinized Vero-E6 cells were added to each well at 20000 cells/well.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero-E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Animal studies, facilities and ethics statements: Specific pathogen-free (SPF) BALB/c female mice (6-8 weeks old) for immunogenicity studies were purchased from Chengdu Dossy Experimental Animals Co.,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sprague Dawley (SD) rats immunogenicity studies were performed at JOINN Laboratories Inc. (Suzhou, China), and SD rats (6-9 weeks old) were purchased from Zhejiang Vital River Laboratory Animal Technology Co., Ltd. Studies with SD rats were compliant with the policies of JOINN Laboratories Inc., the Guide for the Care and Use of Laboratory Animals (8th Edition, Institute of Laboratory Animal Resources, Commission on Life Sciences, National Research Council; National Academy Press; Washington, D.C., 2010), and the U.S. Department of Agriculture through the Animal Welfare Act (Public Law 99-198).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Sprague Dawley</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The expression vector was then stably transfected into GH-CHO (dhfr -/-) cell line and high expression clones were selected and adapted to SFM-4-CHO (Hyclone) serum free medium and ACE2-Fc was produced in 15 L bioreactors, as described for Endo180-Fc above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>dhfr -/-</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After stepwise gene amplification with increasing concentrations (0.0–10 nM) of MTX (Sigma), the clones producing the highest S-Trimer titer were then adapted to SFM-4CHO serum-free medium (GE BioSciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GE BioSciences</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis: Statistical analyses were performed using the Prism 8.0 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Prism</div><div>suggested: (PRISM, RRID:SCR_005375)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: We found the following clinical trial numbers in your paper:<br><table><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Identifier</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Status</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Title</td></tr><tr><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">NCT04405908</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Active, not recruiting</td><td style="min-width:95px; border-right:1px solid lightgray; border-bottom:1px solid lightgray">SCB-2019 as COVID-19 Vaccine</td></tr></table>
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2020.09.24.311027
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2020.10.09.20209858

1
1. sciscore 01 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2020.10.09.20209858: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">The sample IDs were composed of six characters generated randomly from the set of alphanumeric characters (a-zA-Z0-9) (random string generator https://www.random.org/strings/), excluding letters O, I, l, Z, Q and numbers 0, 1, 2, 9 to minimize human read errors.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Negative controls taken from patients prior to November 2019 were obtained from Naha Municipal Hospital from intravenous blood, and from a commercial serum pool (Human Serum from human male AB plasma, Sigma Aldrich H4522-100ML</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein purity was verified by SDS-PAGE and confirmed by Western blot with MonoRab™ Anti-His Tag (C-term) Antibody (Nr. 25B6E11, GenScript,</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-His Tag (C-term</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Therefore, another threshold, calculated as 4-times the average blank, which has been demonstrated to be valid for identifying anti-SARS-CoV-2 antibody-positive samples was used instead (6).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Contrast transfer function (CTF) estimation, particle picking and 2D classification were performed with RELION 3.1 (5)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>RELION</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence alignments: The full-length sequences of SARS-CoV, MERS-CoV S protein (UniProt ID: P59594 and K9N5Q8, respectively) were aligned pairwise using ClustalW2 (8), against the SΔcs sequence (3)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ClustalW2</div><div>suggested: (ClustalW2, RRID:SCR_002909)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Figure preparation and digital processing: Images of protein gel and Western blot in Figure 1A were acquired by smartphone camera, cropped and adjusted for intensity level in Adobe Photoshop 2020 (Adobe Inc, USA)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Adobe Photoshop</div><div>suggested: (Adobe Photoshop, RRID:SCR_014199)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Graphs in Figures 2-5 were plotted with GraphPad Prism v8.4.3 (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(GraphPad Software, USA), using the scatter plot function (Figure 2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2020.10.09.20209858
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2020.08.25.256339

1
1. sciscore 01 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2020.08.25.256339: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The extract of each lysed clone was applied as a 1:200 dilution (final concentration) in PBSTB (PBS supplemented with 0.1% Tween 20® and 0.2% (w/v) BSA, pH 7.4) together with 20 nM (final concentration) biotinylated spike protein domain, 1:400 (final concentration) of anti-6His-D2 HTRF antibody – FRET acceptor conjugate (Cisbio) and 1:400 (final concentration) of anti-strep-Tb antibody FRET donor conjugate (Cisbio, France) to a well of a 384-well plate and incubated for 120 min at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>biotinylated spike protein domain</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-6His-D2 HTRF</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-strep-Tb</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Monoclonal antibodies against MERS-S (2), SARS-S or SARS2-S were included as a positive control(47).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MERS-S ( 2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Serum concentrations were determined by sandwich ELISA using RBD as capture reagent and an anti-His-tag antibody as detection reagent and using a standard curve.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-His-tag</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells and viruses: Vero E6 cells (African green monkey kidney cells, ATCC® CRL1586™) purchased from ATCC (Manassas, VA 20110 USA) were passaged in cell culture medium DMEM (FG0445) containing 10% FBS and supplements (2mM L-Glutamine, Non-essential amino acids and 100 U/ml Penicillin 100 μg/ml Streptomycin and HEPES, all from Biochrom, Berlin, Germany) at 37°C with CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK-293T cells were transfected with pCAGGS expression vectors encoding MERS-S, SARS-S or SARS2-S carrying a 16-, 28- or 18-a.a. cytoplasmic tail truncation, respectively.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Twenty-four hours later, supernatants containing SARS2-S pseudotyped VSV particles were harvested and titrated on African green monkey kidney Vero E6 (ATCC#CRL-1586) cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The raw data (relative light unit values) were exported to GraphPad Prism v8.01, and the % neutralization data were normalized to the untreated PsV signal.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Image processing: Movie stacks were manually inspected and then imported in Relion version 3.0.1(48).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Relion</div><div>suggested: (RELION, RRID:SCR_016274)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Drift and gain correction were performed with MotionCor2(49), and GCTF(50) was used to estimate the contrast transfer function for each movie.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MotionCor2</div><div>suggested: (MotionCor2, RRID:SCR_016499)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, PyMOL (The PyMOL Molecular Graphics System, Version 2.0, Schrödinger, LLC) and BioRender (BioRender.com)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div><div style="margin-bottom:8px"><div>BioRender</div><div>suggested: (Biorender, RRID:SCR_018361)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(Certara, Princeton, USA) or GraphPadPrism (GraphPad Software, La Jolla,USA) and non-compartmental analyses.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  A number of alternative molecules are being developed to complement and partially overcome this limitation of antibodies. Here we describe the generation of DARPin molecules - one prominent alternative to antibodies(30) amongst others(31–34) - that bind the SARS-CoV-2 spike protein. We tested a library of one trillion DARPin molecules and identified multiple DARPin molecules with different functionalities and binding specificities. By molecular linkage of individual DARPin molecules, we developed multi-DARPin molecules with low picomolar neutralizing activity and demonstrated their protective efficacy against SARS-CoV-2 infection in a hamster model. In particular, reduced lung tissue damage and reduced virus replication in the lower and upper respiratory tract were observed, the latter also being important for reducing virus shedding and transmission. The most advanced of those multi-DARPin molecules, MP0420 or ensovibep, is currently being studied in Phase 1. The most potent neutralizing mono-DARPin molecules were found to target the RBD, blocking the spike-ACE2 interaction necessary for infection. This finding is congruent with the identified epitopes of potent neutralizing antibodies obtained from COVID-19 patients(20, 35-39). Thus, the in vitro approach using DARPin molecules independently confirms that the ACE2 interaction site on the SARS-CoV-2 spike protein is one of the most vulnerable sites to block virus infection in cell culture. The single-chain binding domain nat...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: Please consider improving the rainbow (“jet”) colormap(s) used on pages 14 and 30. At least one figure is not accessible to readers with colorblindness and/or is not true to the data, i.e. not perceptually uniform.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2020.08.25.256339
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2020.08.26.266825

1
1. sciscore 01 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2020.08.26.266825: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The expression of the proteins was verified by SDS-PAGE and western blotting using a HRP-conjugated anti-Strep-tag antibody (dilution 1/20,000, iba lifesciences).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Strep-tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For chicken samples, an anti-chicken conjugate (Rabbit anti-Chicken IgY (H+L) Secondary Antibody, HRP; ThermoFisher Scientific) diluted 1/10,000 was applied.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Chicken IgY</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expi293 cells were grown in suspension in Expi293 expression medium (ThermoFisher Scientific) at 37 °C, 8 % CO2, and 125 rpm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Biotin was blocked by adding BioLock (iba lifesciences) as recommended, and the supernatant was purified using Strep-Tactin XT Superflow high capacity resin (iba lifesciences) according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioLock</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In addition, three sequential sera from a naturally SARS-CoV-2 infected cat were included (ProMED-mail, 2020).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ProMED-mail</div><div>suggested: (ProMed-Mail, RRID:SCR_010260)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">All analyses and visualizations were performed using GraphPad Prism version 8.0 for Windows (GraphPad Software, USA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2020.08.26.266825
www.biorxiv.org www.biorxiv.org

http://biorxiv.org/cgi/content/short/2020.12.09.417741

1
1. sciscore 01 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2020.12.09.417741: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pET15D Twinstrep 3C SARS-CoV-2 Nsp3 N179-N1329 6His C856A (DU67898) was made by adding the C856A mutation to clone DU67831 using PCR mutagenesis.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C856A</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transfections, lysis and Co-Immunoprecipitations: A549 human alveolar epithelial cells were transfected with empty vector in triplicate or with vectors expressing SARS CoV-2 Nsp3ΔTM or PLpro fused to a 2xStrep tag at the N-terminus (4 replicates each).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">pTXB1 Halo 3C SARS-CoV-2 (2019-nCoV) Nsp1 1-179-Intein CBD (DU67780 was made using NEBuilder (New England Biolabs), amplifying the vector from existing clone DU28033 (pTXB1-HALO-Mxe Intein-CBD) and the Nsp1 1-179 insert from existing clone DU66413 (pGEX6P1 2019-nCoV Nsp1).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Nsp1 1-179-Intein CBD</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">(PepMap C18 100A - 300µm.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PepMap</div><div>suggested: (BioWorks, RRID:SCR_014594)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The MaxQuant output protein group text files were processed using Perseus software suite (Tyanova et al, 2016), version 1.6.10.45 was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MaxQuant</div><div>suggested: (MaxQuant, RRID:SCR_014485)</div></div><div style="margin-bottom:8px"><div>Perseus</div><div>suggested: (Perseus, RRID:SCR_015753)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE (Perez-Riverol et al, 2019) partner repository with the dataset identifier PXD022904.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PRIDE</div><div>suggested: (Pride-asap, RRID:SCR_012052)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mass spectra were acquired with a RapifleX MALDI-TOF/TOF instrument from Bruker Daltonics equipped with Compass software for FlexSeries 2.0.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Compass</div><div>suggested: (COMPASS, RRID:SCR_015874)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data sets were further processed using Excel or GraphPad Prism (v7.03;</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Excel</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">GraphPad Prism was utilized for graphical representation of the data.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2020.12.09.417741
www.medrxiv.org www.medrxiv.org

https://doi.org/10.1101/2020.04.25.20079103

1
1. sciscore 01 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2020.04.25.20079103: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We searched the covid-19 living evidence database [10], which is generated using automated workflow processes [5] to: i) provide daily updates of searches of four electronic databases: Medline Pubmed</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Medline</div><div>suggested: (MEDLINE, RRID:SCR_002185)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ovid Embase, bioRxiv and medRxiv, using medical subject headings and free text keywords for SARS-CoV-2 infection and covid-19; ii) de-duplicate the records; iii) tag records that are preprints; and iv) allow searches of titles and abstracts using Boolean operators.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>bioRxiv</div><div>suggested: (bioRxiv, RRID:SCR_003933)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">One reviewer extracted data using a pre-piloted extraction form in REDCap and a second reviewer verified the extracted data using the query system.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REDCap</div><div>suggested: (REDCap, RRID:SCR_003445)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  Strengths and weaknesses: A strength of this review is that we used clear definitions and separated review questions to distinguish between SARS-CoV-2 infections that remain asymptomatic throughout their course from those that become symptomatic, and to separate proportions of people with infection from their contribution to transmission in a population. This living systematic review uses methods to minimise bias whilst increasing the speed of the review process [5,6], and will be updated regularly. We only included studies that provided information about follow-up through the course of infection, which allowed reliable assessment about the proportion of asymptomatic people in different settings. In the statistical synthesis of proportions, we used a method that accounts for the binary nature of the data and avoids the normality approximation (weighted logistic regression). Limitation of the review are that most included studies were not designed to estimate the proportion of asymptomatic SARS-CoV-2 infection and definitions of asymptomatic status were often incomplete or absent. The risks of bias, particularly those affecting selection of participants, differed between studies and could result in both underestimation and overestimation of the true proportion of asymptomatic infections. Also, we did not consider the possible impact of false negative RT-PCR results, which might be more likely to occur in asymptomatic infections [116] and would underestimate the proportion of a...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a protocol registration statement.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2020.04.25.20079103
www.medrxiv.org www.medrxiv.org

https://doi.org/10.1101/2020.05.31.20118554

1
1. sciscore 01 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2020.05.31.20118554: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: Human specimens and data: All experiments and analyses involving samples from human donors were conducted with the approval of the local ethics committee (KEK-ZH-Nr. 2015-0561, BASEC-Nr. 2018-01042, and BASEC-Nr. 2020-01731), in accordance with the provisions of the Declaration of Helsinki and the Good Clinical Practice guidelines of the International Conference on Harmonisation.<br>Consent: EDTA plasma from healthy donors was obtained from the Blutspendedienst (blood donation service) Kanton Zürich and Kanton Luzern from donors who signed the consent that their samples can be used for conducting research.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Additionally, we added 52 and 70 randomly selected prepandemic samples for the BDS and the USZ cohort respectively.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">High-throughput serological screening: In order to test the samples for the presence of IgG antibodies directed against SARS-CoV-2 antigens, high-binding 1536-well plates (Perkin Elmer, SpectraPlate 1536 HB) were coated with 1 μg/mL S or RBD or NC in PBS at 37 °C for 1 h, followed by 3 washes with PBS-T (using Biotek El406) and by blocking with 5% milk in PBS-T (using Biotek MultifloFX peristaltic pumps) for 1.5 h.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After the sample incubation for 2 h at RT, the wells were washed five times with wash buffer and the presence of IgGs directed against above-defined SARS-CoV-2 antigens was detected using an HRP-linked anti-human IgG antibody (Peroxidase AffiniPure Goat Anti-Human IgG, Fcγ Fragment Specific, Jackson, 109-035-098, at 1:4000 dilution in sample buffer).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-Human IgG</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 109-035-098, RRID:AB_2337586)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The day after, membranes were washed four times with PBS-T and incubated for 1 hours with an anti-human secondary antibody, HRP-conjugated, diluted 1:10000 in 1% SureBlock.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human secondary antibody, HRP-conjugated,</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">As a positive control, one membrane was incubated overnight with mouse anti-Histag antibody (ThermoFisher, dilution 1:10000 in 1% SureBlock) and subsequently with anti-mouse secondary antibody, HRP-conjugated (Jackson, dilution 1:10000 in 1% SureBlock).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-Histag</div><div>suggested: (RevMAb Biosciences Cat# 54-1161-00, RRID:AB_2716428)</div></div><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Details of viral proteins used for this study: For high-throughput serology, the following proteins were used: SARS-CoV-2 S (pHL-Sec; aa. 11208, C-terminal 8His-Twin-Strep) and RBD (pOPINTTGNeo; aa. 330-532, C-terminal 6His) pro at the SGC in Oxford and the nucleocapsid protein from AcroBiosystems (AA Met 1 - Ala 419, C-terminal his-tag, NUN-C5227).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 S</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The SARS-CoV-2 chemiluminescent microparticle immunoassay from Abbott (Abbott Park, IL, USA) detects IgG against the nucleocapsid antigen and was performed on an Architect™ analyser.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Abbott</div><div>suggested: (Abbott, RRID:SCR_010477)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For competitive ELISA, we used: The prefusion ectodo of the SARS-CoV-2 S protein (Lausanne, EPFL SV PTECH PTPSP), the RBD from Tren- zyme (C-terminal his-tag, P2020-001) and the nucleocapsid protein from AcroBiosystems (AA Met 1 - Ala 419, C-terminal his-tag, NUN-C5227).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AcroBiosystems</div><div>suggested: (ACRObiosystems, RRID:SCR_012550)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2020.05.31.20118554
www.medrxiv.org www.medrxiv.org

https://doi.org/10.1101/2020.07.07.20148106

1
1. sciscore 01 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2020.07.07.20148106: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Written informed consent was obtained from all participants in this study and was approved by the following IRBs: 1) IRB# SUNY:269846.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The cells were cultured in complete RPMI 1640 medium (RPMI 1640 supplemented with 10% FBS; Atlanta Biologicals, Lawrenceville, GA), 8% GlutaMAX (Life Technologies), 8% sodium pyruvate, 8% MEM vitamins, 8% MEM nonessential amino acid, and 1% penicillin/streptomycin (all from Corning Cellgro) for 72 hours, collected using %0.05 Trypsin-0.53 mM EDTA (Corning Cellgro) and stained with Biotinylated Human ACE2 / ACEH Protein, Fc,Avitag (Acro Biosystems) then stained with APC anti-human IgG Fc Antibody clone HP6017 (Biolegend).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">WT and ACE2 over-expressing HEK-293T were also stained with SARS-CoV-2 S1 protein, Mouse IgG2a Fc Tag (Acro Biosystems) followed with APC Goat anti-mouse IgG2a Fc Antibody (Invitrogen).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Mouse IgG2a</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Anti-S-RBD antibody and ACE2-Fc were both tested at a 5 μ/mL starting concentration and in additional 5-fold serial dilutions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Anti-S-RBD</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">SARS-CoV-2 antibody detection using ELISA: To evaluate antibodies binding to CoV-2 S-RBD protein, SARS-CoV-2 Spike S1-RBD IgG and IgM ELISA Detection Kit from GenScript was used according to the manufacturer’s instructions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>CoV-2 S-RBD protein, SARS-CoV-2 Spike S1-RBD IgG</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Pseudotyped virus neutralization assay: Three-fold serially diluted monoclonal antibodies including anti-SARS-CoV-2 Neutralizing human IgG1 Antibody from Acro Biosystems, NAb#1 (Fig 4c, d), GenScript clone ID 6D11F2, NAb#2 (Fig 4d) and GenScript clone ID 10G6H5, NAb#3 (Fig 4d), Invitrogen clone ID MA5-35939 Nab#4 (Fig 4d), recombinant human ACE2-Fc (Acro Biosystems, sACE2#1 and GenScript, sACE2#2 (Fig 4d) or plasma from COVID-19 convalescent individuals and healthy donors were incubated with RFP-encoding SARS-CoV-2 or GFP-encoding SARS-CoV pseudotyped virus with 0.2 multiplicity of infection (MOI) for 1 hour at 37°C degrees.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: (Thermo Fisher Scientific Cat# MA5-35939, RRID:AB_2866551)</div></div><div style="margin-bottom:8px"><div>human IgG1</div><div>suggested: (Thermo Fisher Scientific Cat# MA5-35939, RRID:AB_2866551)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The half-maximal inhibitory concentration for plasma (NT50), ACE2-Fc or monoclonal antibodies (IC50) was determined using 4-parameter nonlinear regression (GraphPad Prism 8.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2-Fc</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To determine the virus titers, HEK-293T cells were transduced with full length ACE2-IRES-GFP, ACE2-mKO2 fusion construct lentiviruses and analyzed via flow cytometry for their reporter gene expression 72 hours after infection.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">UConn Healthcare workers who tested positive for the virus by PCR were recruited and samples banked for future testing.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UConn Healthcare</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Samples were acquired on a BD FACSymphony A5 analyzer and data were analyzed using FlowJo (Tree Star).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Generating human ACE2 over-expressing cells: Wildtype ACE2 sequence was obtained from Ensembl Gene Browser (Transcript ID: ENST00000252519.8) and codon optimized with SnapGene by removing restriction enzyme recognition sites that are necessary for subsequent molecular cloning steps, preserving the amino acid sequence.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Ensembl Gene Browser</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SnapGene</div><div>suggested: (SnapGene, RRID:SCR_015052)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analyses were performed using GraphPad Prism 8.0 software (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The half-maximal inhibitory concentration for plasma (NT50), ACE2-Fc or monoclonal antibodies (IC50) was determined using 4-parameter nonlinear regression (GraphPad Prism 8.0).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2020.07.07.20148106
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2020.07.17.20155937

1
1. sciscore 01 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2020.07.17.20155937: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: All participants provided written informed consent.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">Anonymized samples from blood donors (n=100/week) and pregnant women (n=100/week) were randomly selected from their respective pools by the department of Clinical Microbiology, Karolinska University Hospital.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">All personal identifiers were pseudo-anonymized, and all clinical feature data were blinded to the researchers carrying out experiments until data generation was complete.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Anonymized samples from blood donors (n=100/week) and pregnant women (n=100/week) were randomly selected from their respective pools by the department of Clinical Microbiology, Karolinska University Hospital.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary HRP-conjugated anti-human antibodies were diluted in blocking buffer and incubated with samples for 1 hour at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Secondary antibodies (all from Southern Biotech) and dilutions used: goat anti-human IgG (2014-05) at 1:10,000; goat anti-human IgM (2020-05) at 1:1000; goat anti-human IgA (2050-05) at 1:6,000.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: (SouthernBiotech Cat# 2014-05, RRID:AB_2795580)</div></div><div style="margin-bottom:8px"><div>anti-human IgM</div><div>suggested: (SouthernBiotech Cat# 2020-05, RRID:AB_2795603)</div></div><div style="margin-bottom:8px"><div>anti-human IgA</div><div>suggested: (SouthernBiotech Cat# 2050-05, RRID:AB_2687526)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We trained the learners on all 733 training samples and used these to predict the probability of anti-SARS-CoV-2 antibodies in blood donors and pregnant volunteers sampled in 2020.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The RBD domain (RVQ – QFG) of SARS-CoV-2 was cloned upstream of a Sortase A recognition site (LPETG) and a 6xHIS tag, and expressed in 293F cells as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293F</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">In vitro virus neutralisation assay: Pseudotyped viruses were generated by the co-transfection of HEK293T cells with plasmids encoding the SARS-CoV-2 spike protein harboring an 18 amino acid truncation of the cytoplasmic tail14; a plasmid encoding firefly luciferase; a lentiviral packaging plasmid (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Approximately 15,000 HEK293T-ACE2 cells were then added to each well and the plates incubated at 37°C for 48 hours.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T-ACE2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This resulted in more similar distributions for 2019 blood donor samples with 2020 blood donors and pregnant volunteers, as well as smaller coefficients of variation amongst PCR+ COVID patients for both SPIKE and RBD.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SPIKE</div><div>suggested: (SPIKE, RRID:SCR_010466)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code and data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2020.07.17.20155937
www.biorxiv.org www.biorxiv.org

https://doi.org/10.1101/2020.07.21.214759

1
1. sciscore 01 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2020.07.21.214759: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IRB: All plasma samples were obtained under protocols approved by Institutional Review Boards at both institutions.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: All cell lines have been tested negative for contamination with mycoplasma.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody binding and ACE2 binding inhibition assay: A conformationally stabilized (6P) version of the SARS-CoV-2 S protein(25), appended at its C-terminus with a trimerization domain, a GGSGGn spacer sequence, NanoLuc luciferase, Strep-tag, HRV 3C protease cleavage site and 8XHis (S-6P-NanoLuc) was expressed and purified from the supernatant of 293T Expi cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Mutants thereof were also expressed and purifies following substitution of sequences encoding the RBD that originated from the unmodified S-expression plasmids For antibody binding assays, 20ng, 40ng, or 80ng S-6P-NanoLuc (or mutants thereof) were mixed with 100ng of antibodies, C121, C135, or C144, \ diluted in LI-COR Intercept blocking buffer, in a total volume of 60μl/well in 96-well plate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C144</div><div>suggested: (Leinco Technologies Cat# C144, RRID:AB_2828501)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For ACE2-binding inhibition assays, 20ng of S-6P-NanoLuc was mixed with 100ng of antibodies, C121, C135 or C144, diluted in 3% goat serum/PBS, in a total volume of 50μl.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>C121</div><div>suggested: (Leinco Technologies Cat# C121, RRID:AB_2828361)</div></div><div style="margin-bottom:8px"><div>C135</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The half maximal inhibitory concentrations for plasma (NT50), and monoclonal antibodies (IC50) was calculated using 4-parameter nonlinear regression curve fit to raw or normalized infectivity data (GraphPad Prism).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NT50</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines: HEK-293T cells and derivatives were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) at 37°C and 5% CO2.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells were transfected with pHIVNLGagPol, pCCNanoLuc2AEGFP and a WT or mutant SARS-CoV-2 expression plasmid (pSARS-CoV-2Δ19) using polyethyleneimine.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">After 30 minutes incubation, the mixture was incubated with 1×105 293T cells, or 293T/ACE2cl.22 cells for 2 hours at 4°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T/ACE2cl.22</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The PCR products were gel-purified and sequenced either using Sanger-sequencing or NGS as previously described (31).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>NGS</div><div>suggested: (PM4NGS, RRID:SCR_019164)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For analysis of NGS data, the raw paired-end reads were pre-processed to remove adapter sequences and trim low-quality reads (Phred quality score <20) using BBDuk.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Phred</div><div>suggested: (Phred, RRID:SCR_001017)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Information regarding RBD-specific variant frequencies, their corresponding P-values, and read depth were compiled using the Python programming language (version 3.7) running pandas (1.0.5), numpy (1.18.5), and matplotlib (3.2.2).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div><div style="margin-bottom:8px"><div>matplotlib</div><div>suggested: (MatPlotLib, RRID:SCR_008624)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The half maximal inhibitory concentrations for plasma (NT50), and monoclonal antibodies (IC50) was calculated using 4-parameter nonlinear regression curve fit to raw or normalized infectivity data (GraphPad Prism).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2020.07.21.214759
www.medrxiv.org www.medrxiv.org

https://medrxiv.org/cgi/content/10.1101/2020.07.30.20163824

1
1. sciscore 01 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2020.07.30.20163824: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Binding was detected using 1:5,000 goat anti-human IgG-HRP conjugated secondary (Jackson Immunoresearch cat# 109-035-098) with TMB substrate (Fisher cat# 34028) for 12 minutes, with the reaction halted via 2 M sulfuric acid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG-HRP</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western Blot Analysis: Serum samples from patients 1F, 8F, 10F, and an uninfected negative control individual were examined for the presence of anti-ACE2 or anti-S antibodies.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-ACE2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-S</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibodies used for these experiments included α-Actin (Abcam # ab-49900).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>α-Actin</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">ELISA plates (Immulon 1B, ThermoFisher cat# 3355) were coated overnight at 4°C with 2 μg/mL SARS-CoV-2 spike RBD-mFc tag (Sino Biological cat# 40592-V05H) produced in HEK293 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero cells were infected using the diluted sera and virus mixture and were incubated for 1h at 37°C.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Whole cell extracts from A549 and Vero E6 were analyzed via BCA assay per the manufacturer’s recommendations (Thermo Fisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: RRID:CVCL_XD71)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Lateral Flow Immunoassay Titer Analysis: Combined anti-SARS-CoV-2 IgG/IgM lateral flow immunoassays were obtained from the following manufacturers: Pinnacle Biolabs SARS</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Pinnacle Biolabs</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">EasyDiagnosis Biomedicine Co., Ltd COVID-19 (SARS-CoV-2) IgM/IgG Antibody Test Kit, reference SA-2-D (EDiagnostics); SafeCare Bio-Tech COVID-19 IgG/IgM Rapid Test Device (WB/S/P) ref NCO-4022 (SafeCare), AcroBiotech 2019-nCoV IgG/IgM Rapid Test Cassette reference INCP-402 (AcroBiotech); LumiQuick Diagnostics Quick Profile 2019 nCoV IgG/IgM Test Card ref 71108B (LumiQuick); Cellex qSARS-COV-2 IgG/IgM Rapid Test (Cellex); CALTH Care Health AllCheck</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>AcroBiotech</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Krippendorff’s alpha statistic, and percent agreement as calculated by STATA 13 (StataCorp. 2013. Stata Statistical Software:</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STATA</div><div>suggested: (Stata, RRID:SCR_012763)</div></div><div style="margin-bottom:8px"><div>StataCorp</div><div>suggested: (Stata, RRID:SCR_012763)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To determine sensitivity and specificity of LFI tests in the healthcare setting for saliva and fingerstick blood, receiver-operator characteristic (ROC) curves were generated with GraphPad Prism version 8.4.3.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Two by two tables used to determine positive predictive value (PPV), negative predictive value (NPV), sensitivity, and specificity were generated using Microsoft Excel.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

medrxiv.org/cgi/content/10.1101/2020.07.30.20163824
www.biorxiv.org www.biorxiv.org

https://doi.org/10.1101/2020.05.21.108506

1
1. sciscore 01 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2020.05.21.108506: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">, GISAID EPI_ISL_402125) using MAFFT [51] implemented in the rapid phylodynamic alignment pipeline provided by Augur (github.com/nextstrain/augur).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MAFFT</div><div>suggested: (MAFFT, RRID:SCR_011811)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Subsequently, for both alignments, a maximum likelihood phylogenetic tree was built using IQ-TREE 2.1.0 Covid release (https://github.com/iqtree/iqtree2/releases/tag/v2.1.0) as the tree-building method [52].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IQ-TREE</div><div>suggested: (IQ-TREE, RRID:SCR_017254)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For the less stringent masking of the alignment, HomoplasyFinder identified a total of 5,793 homoplasies (Figure S5).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HomoplasyFinder</div><div>suggested: (HomoplasyFinder, RRID:SCR_017300)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">This was done by retrieving the amino acid changes corresponding to all SNPs at these positions using a custom Biopython (v.1.76) script (https://github.com/cednotsed/nucleotide_to_AA_parser.git).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Biopython</div><div>suggested: (Biopython, RRID:SCR_007173)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">We simulated a 10,000 nucleotide alignment comprising 1,000 accessions using the rtree() simulator available in Ape v5.3 [59] and genSeq from the R package PhyTools v0.7-2.0 [60] using a single rate transition matrix multiplied by a rate of 6×10−4 to approximately match that estimated in [1].</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PhyTools</div><div>suggested: (phytools, RRID:SCR_015502)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your code.
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  However, we acknowledge this approach has some limitations. We have, for example, relied on admittedly arbitrary choices concerning the number of minimal observations and nodes required to conduct statistical testing. While it seems unlikely this would change our overall conclusions, which are highly consistent for two tested alignments, results for particular mutations should be considered in light of this caveat and may change as more genomes become available. Further, our approach necessarily entails some loss of information and therefore statistical power. This is because our motivation to test independent occurrences means that we do not handle “embedded homoplasies” explicitly: we simply discard them (Figure 2), although inclusion of embedded homoplasies does not change the overall conclusions (Figure S11b). Finally, while our approach is undoubtedly more robust to demographic confounding (such as founder bias), it is impossible to completely remove all the sources of bias that come with the use of available public genomes. In addition, it is of note that the SARS-CoV-2 population has only acquired moderate genetic diversity since its jump into the human population and, consequently, most branches in the phylogenetic tree are only supported by very few mutations. As a result of the low genetic diversity, most nodes in the tree have only low statistical support [41]. This prompted us to apply a series of stringent filters and masking strategies to the alignment (see Meth...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2020.05.21.108506
www.biorxiv.org www.biorxiv.org

https://doi.org/10.1101/2020.06.17.156455

1
1. sciscore 01 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2020.06.17.156455: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For detection of protein abundance by western blotting, HA-HRP (Sigma-Aldrich), ACTB-HRP (Santa Cruz), ATM, MAP1LC3B, MAVS, HSPA1A, TGFβ and SQSTM1, phospho-JNK (T183/Y185), JNK, phospho-p38 (T180/Y182), p38 (Cell Signaling), SARS-CoV-2 (Sino Biological) antibodies were used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ATM</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HSPA1A</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>SQSTM1</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>phospho-JNK (T183/Y185)</div><div>suggested: (R and D Systems Cat# AF1205, RRID:AB_2140857)</div></div><div style="margin-bottom:8px"><div>JNK</div><div>suggested: (Thermo Fisher Scientific Cat# 85-86195-11, RRID:AB_2574775)</div></div><div style="margin-bottom:8px"><div>phospho-p38 (T180/Y182)</div><div>suggested: (R and D Systems Cat# MAB8691, RRID:AB_10890618)</div></div><div style="margin-bottom:8px"><div>p38</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell lines and reagents: HEK293T, A549, Vero E6 and HEK293R1 cells and their respective culturing conditions were described previously22.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293R1</div><div>suggested: RRID:CVCL_9831)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549 cells were transduced twice, and ACE2-expressing A549 (ACE2-A549) cells were selected with puromycin.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ACE2-A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus strains, stock preparation, plaque assay and in vitro infection: SARS-CoV-2-MUC-IMB-1 and SARS-CoV-2-GFP strains20 were produced by infecting Vero E6 cells cultured in DMEM medium (10% FCS, 100 ug/ml Streptomycin, 100 IU/ml Penicillin) for 2 days (MOI 0,01).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549-ACE2 cells were infected with SARS-CoV-2-MUC-IMB-1 strain (MOI 3) for the subsequent experiments.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-ACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Affinity purification mass spectrometric analyses of SARS-COV-2, SARS-COV and HCoV protein expressing A549 cells: For the determination of SARS-COV-2, SARS-COV and partial HCoV interactomes, four replicate affinity purifications were performed for each HA-tagged viral protein.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: NCI-DTP Cat# A549, RRID:CVCL_0023)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Ingenuity knowledge base was used as a reference dataset, only experimentally observed findings were used for confidence filtering, additionally human species and A549-ATCC cell line filters were set.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549-ATCC</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Co-immunoprecipitation and western blot analysis: HEK293T cells were transfected with pWPI plasmid encoding single HA-tagged viral proteins, alone or together with pTO-SII-HA expressing host factor of interest.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Total amounts of IFN-α/β in cell supernatants were measured by using 293T cells stably expressing the firefly luciferase gene under the control of the mouse Mx1 promoter (Mx1-luc reporter cells)47.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, HEK293RI cells were seeded, transfected with pCAGGS-flag-RIG-I plus viral protein constructs and stimulated as described above.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293RI</div><div>suggested: RRID:CVCL_9831)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Virus strains, stock preparation, plaque assay and in vitro infection: SARS-CoV-2-MUC-IMB-1 and SARS-CoV-2-GFP strains20 were produced by infecting Vero E6 cells cultured in DMEM medium (10% FCS, 100 ug/ml Streptomycin, 100 IU/ml Penicillin) for 2 days (MOI 0,01).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2-GFP</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Expression constructs for C-terminal HA tagged viral ORFs were synthesised (Twist Bioscience and BioCat) and cloned into pWPI vector as described previously23 with the following modifications: starting ATG codon was added, internal canonical splicing sites were replaced with synonymous mutations and C-terminal HA-tag, followed by amber stop codon, was added to individual viral open reading frames.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BioCat</div><div>suggested: (BioCAT, RRID:SCR_001440)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To acquire MS data, the data-independent acquisition (DIA) scan mode operated by the XCalibur software (Thermo Fisher) was used.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>XCalibur</div><div>suggested: (Thermo Xcalibur, RRID:SCR_014593)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spectra were searched against forward and reverse sequences of the reviewed human proteome including isoforms (UniprotKB, release 10.2019) and SARS-COV-2, SARS-COV and HCoV proteins by the built-in Andromeda search engine31.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UniprotKB</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Bioinformatic analysis: Unless otherwise specified, the bioinformatic analysis was done in R (version 3.6), Julia (version 1.4) and Python (version 3.8) using a collection of in-house scripts (available upon request).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Python</div><div>suggested: (IPython, RRID:SCR_001658)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Statistical analysis of DDA total proteome, phosphoproteome and ubiquitinome data 6 and 24 hours post SARS-CoV-2 infection of A549-ACE2 cells: The output of MaxQuant was analyzed with Perseus (version 1.6.14.0)36 and visualized with R (version 3.6.0) and RStudio (version 1.2.1335).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>MaxQuant</div><div>suggested: (MaxQuant, RRID:SCR_014485)</div></div><div style="margin-bottom:8px"><div>Perseus</div><div>suggested: (Perseus, RRID:SCR_015753)</div></div><div style="margin-bottom:8px"><div>RStudio</div><div>suggested: (RStudio, RRID:SCR_000432)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Annotation of detected protein groups, phosphosites and ubiquitination sites with GOBP, -MF, -CC, KEGG, Pfam, GSEA, Keywords and Corum as well as PhosphoSitePlus kinase-substrate relations and regulatory sites (version May 1st 2020)37 was performed in Perseus.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>KEGG</div><div>suggested: (KEGG, RRID:SCR_012773)</div></div><div style="margin-bottom:8px"><div>Pfam</div><div>suggested: (Pfam, RRID:SCR_004726)</div></div><div style="margin-bottom:8px"><div>Corum</div><div>suggested: (CORUM, RRID:SCR_002254)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transcripts with low mean normalized count that were flagged by the independent filtering procedure of DESeq2 were removed and those with absolute apeglm shrunk log2 fold change > 0.5 and the p-value < 0.05 were considered differentially expressed in distinct conditions.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>DESeq2</div><div>suggested: (DESeq, RRID:SCR_000154)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Gene Set Enrichment Analysis: We have used Gene Ontology, Reactome and other EnrichmentMap gene sets of human proteins41 as well as protein complexes annotations from IntAct Complex Portal (version 2019.11)42 and CORUM (version 2019)43.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>EnrichmentMap</div><div>suggested: (EnrichmentMap, RRID:SCR_016052)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transcription factor – target gene set libraries from ENCODE were used45.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ENCODE</div><div>suggested: (Encode, RRID:SCR_015482)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Transcriptome, proteome, ubiquitinome and phosphoproteome changes along with unchanged transcripts/proteins/sites were submitted to the core ingenuity pathway analysis (IPA) (www.ingenuity.com).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ingenuity pathway analysis</div><div>suggested: (Ingenuity Pathway Analysis, RRID:SCR_008653)</div></div></td></tr></table>
  Results from OddPub: Thank you for sharing your data.
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  Thank you for including a funding statement. Authors are encouraged to include this statement when submitting to a journal.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2020.06.17.156455
www.biorxiv.org www.biorxiv.org

http://biorxiv.org/cgi/content/short/2020.09.27.316174

1
1. sciscore 01 Mar 2021
  
  in SciScore
  
  SciScore for 10.1101/2020.09.27.316174: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">IACUC: All animal studies were reviewed and approved by the Institutional Animal Care and Use Committee at the University of Texas Medical Branch and were conducted according to the National Institutes of Health guidelines.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">Hamster challenge experiments: Male and female Syrian golden hamsters were obtained from Charles River Laboratories at 6 weeks of age.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody binding ELISA: The S1 subunit of the SARS-CoV-2 spike protein (amino acids 16-685) bearing a C-terminal histidine tag (ACRO Biosystems, Newark, NJ) was coated at 2 μg/ml on a Ni-NTA plate (Qiagen, Valencia, CA).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2 spike protein (amino acids 16-685</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody characterization: Kinetic interactions between the antibodies and His-tagged receptor binding domain (RBD, amino acids 319-537) (Acro Biosystems, Newark, NJ) protein was measured at 25°C using BIAcore T200 surface plasmon resonance (SPR) (GE Healthcare).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>His-tagged receptor binding domain (RBD, amino acids 319-537) (Acro Biosystems, Newark, NJ</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">STI-1499 or STI-2020 antibody was covalently immobilized on a CM5 sensor chip to approximately 500 and 100 resonance units (RU), respectively using standard N-hydroxysuccinimide/N-Ethyl-N′-(3-dimethylaminopropyl) carbodiimide hydrochloride (NHS/EDC) coupling methodology.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>STI-2020</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">For antibody binding to the cells expressing the Spike proteins, the cells were dispensed into wells of a 96-well plate (25 μl per well), and an equal volume of 2x final concentration of serially-diluted anti-S1 antibody solution was added.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-S1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Antibody treatments were administered intravenously (i.v.) with monoclonal antibodies (mAbs) against SARS-CoV-2 Spike, or isotype control mAb in up to 350 µl of sterile PBS at 1 hour-post inoculation.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>SARS-CoV-2</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">HEK293 cells were transfected using FuGeneHD transfection reagent according to manufacturer’s protocol (Promega, Cat # E2311).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Vero E6 cells were plated to 96-well plates and incubated at 37° C, 5% CO2</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Vero E6</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell based Spike binding assay: Mammalian expression vectors were constructed either by cloning of the synthesized gene encoding SARS-CoV-2 G614 Spike protein (UniprotKB, SPIKE-SARS2) or, for SARS-CoV-2 D614 Spike protein, via site-directed mutagenesis of the G614 Spike protein gene.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>UniprotKB</div><div>suggested: (UniProtKB, RRID:SCR_004426)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A sigmoidal four-parameter logistic equation was used for fitting the MFI vs. mAb concentration data set to extract EC50 values (GraphPad Prism 8.3.0 software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: An explicit section about the limitations of the techniques employed in this study was not found. We encourage authors to address study limitations.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from rtransparent:
  Thank you for including a conflict of interest statement. Authors are encouraged to include this statement when submitting to a journal.
  No funding statement was detected.
  No protocol registration statement was detected.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2020.09.27.316174
news.umich.edu news.umich.edu

Sleep is vital to associating emotion with memory, according to U-M study

1
1. AnanyaSarkar 01 Mar 2021
  
  in Public
  
  Now, researchers have the tools to genetically tag cells that are activated by an experience during a specific window of time.
  
  Fascinating how human minds are almost like computers themselves.
Visit annotations in context

Annotators

AnanyaSarkar

URL

news.umich.edu/sleep-is-vital-to-associating-emotion-with-memory-according-to-u-m-study/
via4.hypothes.is via4.hypothes.is

PDF.js viewer

1
1. Acarroll_Ksc 01 Mar 2021
  
  in Public
  
  Internet users tend to ascribe the meme tag to observable audiovisual content, such as YouTube videos and humorous images.
  
  This is very popular on social media, comical videos surrounding the internet, youtube creators that rely on the humor to help fuel their views
Visit annotations in context

Annotators

Acarroll_Ksc

URL

via4.hypothes.is/proxy/static/cl7mcnudm7snMVqDIswK9w/1614614400/https://inst-fs-iad-prod.inscloudgate.net/files/c1dd4e60-4fc2-4693-827c-7977869e143d/Meme Culture Part 1.pdf
Feb 2021
sspai.com sspai.com

2018 年主流 RSS 服务选哪家？Feedly、Inoreader 和 NewsBlur 全面横评 - 少数派

1
1. mccc 28 Feb 2021
  
  in Public
  
  NewsBlur 的过滤机制是最特别的，自创了一种称为「Intelligent Trainer」（智能训练）的系统。在任意订阅源上点击右键选择「Intelligent Trainer」，NewsBlur 就会列出该订阅源中文章的所有作者（author）和标签（tag），它们是从原文网页内嵌的元信息（metadata）中提取的。你也可以从任意一篇文章上进入 Intelligent Trainer，从而看到该文章的作者和标签，并可以选择该文章标题中的特定关键词作为「训练」对象。
  
  训练一个源头，只要某种类别的信息
Visit annotations in context

Annotators

mccc

URL

sspai.com/post/44420
www.sciencedirect.com www.sciencedirect.com

Allosteric activation of proto-oncogene kinase Src by GPCR–beta-arrestin complexes

1
1. scibot 27 Feb 2021
  
  in Public
  
  anti-His6 tag
  
  DOI: 10.1074/jbc.RA120.015400
  
  Resource: (Abcam Cat# ab1187, RRID:AB_298652)
  
  Curator: @Naa003
  
  SciCrunch record: RRID:AB_298652
  
  What is this?
  
  RRID:AB_298652 RRIDCUR:Missing
Visit annotations in context

Tags

RRIDCUR:Missing

RRID:AB_298652

Annotators

scibot

URL

sciencedirect.com/science/article/pii/S0021925817504913
store.steampowered.com store.steampowered.com

Star Control®: Origins on Steam

1
1. TylerRick 26 Feb 2021
  
  in Public
  
  I went by the reviews and now i am seeing a pattern on STEAM where even good reviews are bought and paid for and not really player revews and that actuallly watching game play from google will be my best option in the future. AGAIN don;t trust bought and paid for reviews from STEAM....I just learned and realised this now
  
  regret annotation meta: may need new tag
Visit annotations in context

Tags

annotation meta: may need new tag

regret

Annotators

TylerRick

URL

store.steampowered.com/app/271260/Star_Control_Origins/
onezero.medium.com onezero.medium.com

How to Destroy ‘Surveillance Capitalism’

1
1. chrisaldrich 25 Feb 2021
  
  in Public
  
  <small><cite class='h-cite via'>ᔥ <span class='p-author h-card'>Cory Doctorow</span> in Pluralistic: 16 Feb 2021 – Pluralistic: Daily links (<time class='dt-published'>02/25/2021 12:20:24</time>)</cite></small>
  It's interesting to note that there are already two other people who have used Hypothes and their page note functionality to tag this article as to read, one with (to read) and another with (TODO-read).
  
  want to read surveillance capitalism Hypothes.is
Visit annotations in context

Tags

Hypothes.is

want to read

surveillance capitalism

Annotators

chrisaldrich

URL

onezero.medium.com/how-to-destroy-surveillance-capitalism-8135e6744d59
forum.obsidian.md forum.obsidian.md

Research/PhD/Academics - Knowledge management - Obsidian Forum

2
1. chrisaldrich 24 Feb 2021
  
  in Public
  
  I’m an Australian academic in the field of education. I read the How to take smart notes book and a couple of Luhmann’s articles which were translated into English. I also would recommend looking at the writing of Andy Matuschak on how to label your notes, what to include in them, and so on. Here’s the process I’ve come up with (which continues to evolve): Initial highlighting: Read journal article via Zotero. Highlight the parts that are relevant to you using the default PDF viewer on your computer. Use Zotfile to extract the highlights (and any notes) in Zotero, then paste them into Obsidian in a new note. I have a template I copy and paste to start each new highlight note with relevant details like the author names, date of publication and so on before the highlights. Refine highlights: Look through your highlights from the article and use the Obsidian highlighting feature (==like this==) to pinpoint what’s valuable in each highlight. This makes it easier to complete the next step, particularly if it’s a long paper or you have to come back to it. Skip if necessary. Process highlights into literature notes: Summarise the highlights into your own words. Add any personal insights. Each literature note should relate to one idea. I do this directly above the highlight notes using bullet points and a L - for literature notes and a H - for highlight notes. Try to write the literature note as if it was part of a journal article. Add a label to each literature note: Above each literature note, I add a label, which should be the briefest possible summary of the literature note. Have this label inside double square brackets. Avoid labels like “Definition of X”. Instead, write “X is y and z”. Try to be specific. I mainly use the bracket links in this way. An example label might be [[E - X is y and z]]. I use E - because it will soon be an evergreen note. Add each label to an index: The index will be a long list of all your literature note labels. Categorise the labels in a logical manner. Create evergreen notes: Click the label (which is a link to a new note) and copy/paste the literature note text (which will be quite short) into this new evergreen note. Add connections to other notes categorised in the same place in your index plus any other relevant evergreen notes. Add relevant tags. The index may not be overly important in the long run, but it definitely helps at this point with connection making. I also add the reference details at the bottom of each evergreen note. Next it’s time to create your paper. 7a. (Top down approach) Create journal article outline: Create an outline for your article, chapter, application, or whatever you’re working on. You can make a quick template with the relevant stages of the genre (e.g. introduction, literature review, and so on). Then, drag relevant evergreen notes into the sections. You’ll need to massage the gaps between notes to make it cohesive. If you use a note, add a tag to say so. You’ll need to reword the note if you use it again in another paper to avoid self-plagiarism. 7b. (Bottom up approach) Add evergreen notes to papers: Instead of starting with a paper outline, you might look at your notes in the index and consider what kind of interesting questions they might help you answer, then build your paper from there. I hope someone out there finds all this useful. One of the best things I’ve done is create a note called master production line which includes these numbered steps as headings, and then I can add my highlight notes as they’re created and move them down the production line as they’re processed. I also organise them in certain steps (like 2 and 3) as high, medium and low priority. It means you never lose track of notes and there’s always something you could be working on. The bit I’m still figuring out is the last step: how to go from evergreen notes to paper drafts as efficiently as possible. I’m a little old fashioned, so I’ll probably so the final edit in Word once everything else is done in Obsidian. The multiple window support in Obsidian is great, but still a bit janky, and this method requires multiple windows to be open at a time. Hopefully a future update keeps the windows in the one spot.
  
  This is an excellent overview of how to take notes for academic research and creating writing output.
  
  zettelkasten research process Obsidian
2. chrisaldrich 24 Feb 2021
  
  in Public
  
  Others on the page here (specifically Dpthomas87's A, B, C) have done a great job at outlining their methods which I'm generally following. So I'll focus a bit more on the mechanics.
  
  I rely pretty heavily on Hypothes.is for most of my note taking, highlights, and annotations. This works whether a paper is online or as a pdf I read online or store locally and annotate there.
  
  Then I use RSS to pipe my data from Hypothes.is into a text file in OneDrive for my Obsidian vault using IFTTT.com. I know that a few are writing code for the Hypothes.is API to port data directly into Roam Research presently; I hope others might do it for Obsidian as well.)
  
  Often at the end of the day or end of the week, I'll go through my drafts folder everything is in to review things, do some light formatting and add links, tags, or other meta data and links to related ideas.
  
  Using Hypothes.is helps me get material into the system pretty quickly without a lot of transcription (which doesn't help my memory or retention). And the end of the day or end of week review helps reinforce things as well as help to surface other connections.
  
  I'm hoping that as more people use Hypothesis for social annotation, the cross conversations will also be a source of more helpful cross-linking of ideas and thought.
  
  I prefer to keep my notes as atomic as I can.
  
  For some smaller self-contained things like lectures, I may keep a handful of notes together rather than splitting them apart, but they may be linked to larger structures like longer courses or topics of study.
  
  If an article only has one or two annotations I'll keep them together in the same note, but books more often have dozens or hundreds of notes which I keep in separate files.
  
  For those who don't have a clear idea of what or why they're doing this, I highly recommend reading [[Sönke Ahrens]]' book Smart Notes.
  
  I do have a handful of templates for books, articles, and zettels to help in prompting me to fill in appropriate meta data for various notes more quickly. For this I'm using the built-in Templates plug-in and then ctrl-shift-T to choose a specific template as necessary.
  
  Often I'll use Hypothes.is and tag things as #WantToRead to quickly bookmark things into my vault for later thought, reading, or processing.
  
  For online videos and lectures, I'll often dump YouTube URLs into https://docdrop.org/, which then gives a side by side transcript for more easily jumping around as well as annotating directly from the transcript if I choose.
  
  I prefer to use [[links]] over #tags for connecting information. Most of the tags I use tend to be for organizational or more personal purposes like #WantToRead which I later delete when done.
  
  When I run across interesting questions or topics that would make good papers or areas of future research I'll use a tag like #OpenQuestion, so when I'm bored I can look at a list of what I might like to work on next.
  
  Syndicated copies: https://forum.obsidian.md/t/research-phd-academics/1446/64?u=chrisaldrich
  
  Obsidian research process note taking
Visit annotations in context

Tags

note taking

research process

Obsidian

zettelkasten

Annotators

chrisaldrich

URL

forum.obsidian.md/t/research-phd-academics/1446
www.irs.gov www.irs.gov

Instructions for Form 8863 (2020) | Internal Revenue Service

1
1. gherson 24 Feb 2021
  
  in Public
  
  Form 1098-T requirement. To be eligible to claim the American opportunity credit or the lifetime learning credit, the law requires a taxpayer (or a dependent) to have received Form 1098-T, Tuition Statement, from an eligible educational institution, whether domestic or foreign. However, you may claim one of these education benefits if the student doesn't receive a Form 1098-T because the student’s educational institution isn't required to furnish a Form 1098-T to the student under existing rules (for example, if the student is a qualified nonresident alien, has certain qualified education expenses paid entirely with scholarships, has certain qualified education expenses paid under a formal billing arrangement, or is enrolled only in courses for which no academic credit is awarded). If a student’s educational institution isn't required to provide a Form 1098-T to the student, you may claim one of these education benefits without a Form 1098-T if you otherwise qualify, can demonstrate that you (or a dependent) were enrolled at an eligible educational institution, and can substantiate the payment of qualified tuition and related expenses. You may also claim one of these educational benefits if the student attended an eligible educational institution required to furnish Form 1098-T but the student doesn't receive Form 1098-T before you file your tax return (for example, if the institution is otherwise required to furnish the Form 1098-T and doesn't furnish it or refuses to do so) and you take the following required steps: After February 1, 2021, but before you file the return, you or the student must request that the educational institution furnish a Form 1098-T. You must fully cooperate with the educational institution's efforts to gather the information needed to furnish the Form 1098-T. You must also otherwise qualify for the benefit, be able to demonstrate that you (or a dependent) were enrolled at an eligible educational institution, and substantiate the payment of qualified tuition and related expenses. The amount of qualified tuition and related expenses reported on Form 1098-T may not reflect the total amount of the qualified tuition and related expenses paid during the year for which you may claim an education tax credit. You may include qualified tuition and related expenses that are not reported on Form 1098-T when claiming one of the related credits if you can substantiate payment of these expenses.You may not include expenses paid on the Form 1098-T that have been paid by qualified scholarships, including those that were not processed by the universities.
  
  Common sense, so I'll tag as TYCO (Thank you, Captain Obvious).
  
  TYCO
Visit annotations in context

Tags

TYCO

Annotators

gherson

URL

irs.gov/instructions/i8863
blogs.iteso.mx blogs.iteso.mx

Ariadna Cantis – Red Arquitectura

3
1. VivianaDobleG 24 Feb 2021
  
  in Public
  
  Preferimos pensar que quizás hay pocas mujeres que se embarcan en la carrera de concursos y proyectos de edificación de forma solitaria porque:
  
  argumentación
2. VivianaDobleG 24 Feb 2021
  
  in Public
  
  1.
  
  puntos que son un llamado a la acción, vinculado al propósito
3. VivianaDobleG 24 Feb 2021
  
  in Public
  
  Éstas y otras cuestiones se pusieron sobre la mesa la pasada semana en el 1º Congreso de Investigación en Arquitectura y Género “ArquitectAs: redefiniendo la profesión”, celebrado en la Escuela Técnica superior de Arquitectura de Sevilla y dirigido por Nuria Álvarez Lombardero, quien publicó el pasado mes en la ciudad viva un post de “presentación” al congreso. (Visitar aqui: http://www.laciudadviva.org/blogs/?p=20761)
  
  citas, fuentes de consulta
Visit annotations in context

Annotators

VivianaDobleG

URL

blogs.iteso.mx/arquitectura/tag/ariadna-cantis/
www.sciencedirect.com www.sciencedirect.com

Epilepsy and neurobehavioral abnormalities in mice with a dominant-negative KCNB1 pathogenic variant

1
1. scibot 24 Feb 2021
  
  in Public
  
  RRID:AB_2
  
  DOI: 10.1016/j.nbd.2020.105141
  
  Resource: (James Trimmer, University of California at Davis Cat# 12CA5, RRID:AB_2532070)
  
  Curator: @Naa003
  
  SciCrunch record: RRID:AB_2532070
  
  Curator comments: Anti-HA tag mouse monoclonal antibody 12CA5 James Trimmer, University of California at Davis Cat# 12CA5
  
  What is this?
  
  RRIDCUR:Unresolved RRIDCUR:SyntaxError RRID:AB_2532070
Visit annotations in context

Tags

RRID:AB_2532070

RRIDCUR:SyntaxError

RRIDCUR:Unresolved

Annotators

scibot

URL

sciencedirect.com/science/article/pii/S0969996120304162
trailblazer.to trailblazer.to

Trailblazer

1
1. TylerRick 23 Feb 2021
  
  in Public
  
  In both filters, you’re able to rename and coerce variables. This gives you a bit more control than the simpler DSL.
  
  flexibility having enough control over something DSL annotation meta: may need new tag
Visit annotations in context

Tags

annotation meta: may need new tag

having enough control over something

DSL

flexibility

Annotators

TylerRick

URL

trailblazer.to/2.1/docs/activity.html
en.wikipedia.org en.wikipedia.org

Monad (functional programming) - Wikipedia, the free encyclopedia

1
1. TylerRick 23 Feb 2021
  
  in Public
  
  Though rarer in computer science, one can use category theory directly, which defines a monad as a functor with two additional natural transformations. So to begin, a structure requires a higher-order function (or "functional") named map to qualify as a functor:
  
  rare in computer science using category theory directly in computer science What other areas of math can be used / are rare to use directly in computer science?
  
  functor monad category theory annotation meta: may need new tag defining in terms of _ higher-order function
Visit annotations in context

Tags

monad

higher-order function

defining in terms of _

category theory

functor

annotation meta: may need new tag

Annotators

TylerRick

URL

en.wikipedia.org/wiki/Monad_(functional_programming)
jrsinclair.com jrsinclair.com

Elegant error handling with the JavaScript Either Monad

1
1. TylerRick 23 Feb 2021
  
  in Public
  
  This stuff is intoxicating once you get into it.
  
  fun annotation meta: may need new tag functional programming
Visit annotations in context

Tags

annotation meta: may need new tag

functional programming

fun

Annotators

TylerRick

URL

jrsinclair.com/articles/2019/elegant-error-handling-with-the-js-either-monad/
en.wikipedia.org en.wikipedia.org

Value-added service - Wikipedia

1
1. TylerRick 22 Feb 2021
  
  in Public
  
  paid services annotation meta: may need new tag
Visit annotations in context

Tags

paid services

annotation meta: may need new tag

Annotators

TylerRick

URL

en.wikipedia.org/wiki/Value-added_service
2019.trailblazer.to 2019.trailblazer.to

Trailblazer

1
1. TylerRick 22 Feb 2021
  
  in Public
  
  note that TRB source code modifications are not proprietary
  
  In other words, you can build on this software in your proprietary software but can't change the Trailblazer source unless you're willing to contribute it back.
  
  loophole: I wonder if this will actually just push people to move their code -- which at the core is/would be a direction modification to the source code - out to a separate module. That's so easy to do with Ruby, so this restriction hardly seems like it would have any effect on encouraging contributions.
  
  wording designed to be more palatable/pleasing/inoffensive neutral/dispassionate/impartial/objective wording well-written annotation meta: may need new tag good point proprietary software reminder open-source software: not contributing new code back to project software licensing LGPL loophole/escape hatch
Visit annotations in context

Tags

well-written

annotation meta: may need new tag

neutral/dispassionate/impartial/objective wording

reminder

good point

open-source software: not contributing new code back to project

software licensing

LGPL

proprietary software

loophole/escape hatch

wording designed to be more palatable/pleasing/inoffensive

Annotators

TylerRick

URL

2019.trailblazer.to/2.1/docs/pro.html
www.biorxiv.org www.biorxiv.org

Imaging cytoplasmic lipid droplets in vivo with fluorescent perilipin 2 and perilipin 3 knockin zebrafish

1
1. f.bryant 22 Feb 2021
  
  in eLife
  
  Reviewer #2 (Public Review):
  
  In this manuscript, the authors generated transgenic zebrafish reporter lines that allow observation of cytoplasmic lipid droplets in vivo. They knocked in GFP or RFP in the endogenous loci of perilipin 2 and 3, and showed that the reporter genes exhibited similar temporal and spatial expression in the intestine in response to acute high-fat feeding as the endogenous perilipin 2 and 3 transcripts. They also characterized the reporter gene expression in the liver, adipocytes, and around neuromasts. These tools open up new opportunities to study lipid droplets dynamics in live zebrafish that is not feasible in mouse models. Overall the manuscript is well written. The authors have discussed in details the strength and caveats of these reporters. The weakness is the descriptive nature of the study - many interesting observations but no mechanistic study. I have the additional comments:
  
  1) It is curious that in plin2 and plin3 reporter fish, the fluorescent tags were inserted at the 5' and 3' of the open reading frame, respectively. The authors did not provide any explanation. Does the location where the fluorescent tag is inserted affect the expression of the reporter genes?
  
  2) GFP and TagRFP-T are not fast folding fluorescent proteins and are very stable, which may not be the best options for studying the formation and degradation of lipid droplets. How the fluorescent tags affect the stability and clearance of the protein should be carefully characterized.
  
  3) Was there any indel being introduced by TALENs in these knockin fish? Is there off target effects of the TALENs?
  
  4) The authors also generated transgenic fish overexpressing human PLIN2 and PLIN3 fluorescent fusion proteins. Is the subcellular localization of these fusion proteins similar to the zebrafish knockin under nofed and fed conditions? In other words, do human PLIN2 and PLIN3 proteins behave similarly as the zebrafish orthologs?
  
  scietyType:PeerReview scietyCreator:Reviewer 2
Visit annotations in context

Tags

scietyCreator:Reviewer 2

scietyType:PeerReview

Annotators

f.bryant

URL

biorxiv.org/content/10.1101/2021.01.10.426109v1
help.twitter.com help.twitter.com

COVID-19 misleading information policy

1
1. Leah.Carlson 20 Feb 2021
  
  in Public
  
  replies,
  
  This one I do not understands, likes can result in it becoming viral, retweets cause it to spread, why replies? You can tag specific people in the replies? Concern the person posting will be harassed? Where is the open dialogue to discuss the post more as encourage above?
Visit annotations in context

Annotators

Leah.Carlson

URL

help.twitter.com/en/rules-and-policies/medical-misinformation-policy
www.xiles.net www.xiles.net

Simple, easy and well designed softwares

1
1. conanxin 20 Feb 2021
  
  in Public
  
  NexusFont 是 Windows 下一款轻量好用的字体管理器。
  
  NexusFont 不但能快速预览自定义的文本，还可以给字体打上 tag 进行分类，极大地提高了工作效率。
  
  工具
Visit annotations in context

Tags

工具

Annotators

conanxin

URL

xiles.net/
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.01.31.428824

1
1. sciscore 19 Feb 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.01.31.428824: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  NIH rigor criteria are not applicable to paper type.
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Four rounds of panning were used to isolate scFvs binding both MERS S2 and SARS-2 spike using the following solutions coated on high binding plates: 2 μg/ml anti-c-myc tag antibody (Invitrogen) to eliminate phage expressing no or truncated scFv (Round 1), 2 μg/ml MERS S2 (Round 2), 2 μg/ml SARS-2 spike (Round 3), and 0.4 μg/ml SARS-2 spike (Round 4).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-c-myc tag</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Duplicate serial dilutions of each full-length antibody were allowed to bind each coat, and the secondary antibody solution was a 1:1200 dilution of goat-anti-human IgG Fc-HRP (SouthernBiotech).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>IgG Fc-HRP ( SouthernBiotech) .</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Western blot of antibody binding to coronavirus spike proteins: Purified coronavirus spike proteins (SARS-2 HexaPro, SARS-2, MERS, and HKU1) were reduced and boiled, and 50 ng of each was subjected to SDS-PAGE and transfer to PVDF membranes in quadruplicate.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HKU1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">To determine the affinity of 3A3 Fab by BLI, anti-human IgG Fc sensors were coated with the anti-foldon antibody identified in this work (3E11) at 20nM in kinetic buffer.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-human IgG</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>anti-foldon</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">MERS (18), HKU1 (18), and the SARS-2 variants HexaPro S2 (residues 697-1208 of the SARS-2 spike with an artificial signal peptide, proline substitutions at positions 817, 892, 899, 942, 986 and 987 and a C-terminal T4 fibritin domain, HRV3C cleavage site, 8xHisTag and TwinStrepTag), HexaPro RBD-locked-down (HexaPro with S383C-D985C substitutions), and aglycosylated HexaPro (HexaPro treated with Endo H overnight at 4 °C leaving only one N-acetylglucosamine attached to N-glycosylation site) as well as MERS S2-only (residues 763-1291 of MERS-2P with 8 additional stabilizing substitutions), MERS S2-apex-less (MERS S2-only construct with residues 811-824 replaced with GGSGGS and residues 1042-1073 replaced with a flexible linker) were expressed in Freestyle 293-F cells (ThermoFisher Scientific).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293-F</div><div>suggested: RRID:CVCL_6642)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">On day 2 after transfection, HEK-293T-hACE2 cells (BEI, NR-52511), which stably expresses human ACE2, were stained with 1 μM CellTrace Far Red dye (Invitrogen, Ex/Em: 630/661 nm) in PBS for 20 minutes at room temperature, then quenched with DMEM with 10% heat-inactivated FBS for 5 minutes, and resuspended in fresh media.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK-293T-hACE2</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">expressing human ACE2 under an EF1a promoter was used to transduce HEK293T cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>HEK293T</div><div>suggested: NCBI_Iran Cat# C498, RRID:CVCL_0063)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Flow cytometry: On day 0, Expi-293 cells (ThermoFisher) were mock-transfected or transfected with pWT-SARS-2-spike (BEI NR-52514) or pD614G-SARS-2-spike (generated by site-directed mutagenesis).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Expi-293</div><div>suggested: RRID:CVCL_D615)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Organisms/Strains</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Murine immunization: Three BALB/c mice were immunized subcutaneously with 5μg pre-fusion stabilized MERS S2 and 20 μg of ODN1826 + 100 μl of 2X Sigma Adjuvant System</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BALB/c</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Images were collected with Zeiss LSM 710 confocal microscope (Carl Zeiss, Inc) and processed using ImageJ software (http://rsbweb.nih.gov/ij) (Fig. 2 and fig.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>ImageJ</div><div>suggested: (ImageJ, RRID:SCR_003070)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The statistical significance of either HEK-ACE2 colocalization percentage or average cell size between different conditions was calculated with ANOVA using GraphPad Prism 7 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Spectra were manually assessed, and figures were prepared using HD-eXplosion (40) and PyMOL (41).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>PyMOL</div><div>suggested: (PyMOL, RRID:SCR_000305)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cells were washed again, then scanned for AF647 (640 nm excitation, 670/30 bandpass emission) fluorescence on a BD Fortessa flow cytometer and analyzed with FlowJo (Fig. 6B).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>FlowJo</div><div>suggested: (FlowJo, RRID:SCR_008520)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  There are several limitations to this work as currently described. First, a structure showing the atomic details of 3A3 complexed with spike would provide additional insight into the mechanism of binding and neutralization. However, structures of antibodies bound to S2 are generally challenging to obtain with just one structure available of an antibody binding near the HR2 stem (28). It is possible that 3A3 binding distorts spike structure, disturbing otherwise ordered regions. Accordingly, additional efforts to better understanding the molecular underpinnings of 3A3/ spike interactions are underway. Second, while we have shown that 3A3 binds spike from all three highly pathogenic coronaviruses with similar affinities, we have only demonstrated its ability to neutralize SARS-2 spikes in vitro. Demonstration of broad neutralization in addition to broad recognition would increase the potential relevance of this epitope for future therapeutics. The 3A3 epitope is highly conserved, with pairwise comparisons showing between 56% and 100% identity to the SARS-2 epitope for MERS and SARS-1, respectively (fig. S14). Since 3A3 affinity for the least similar MERS spike is comparable to that for the SARS-2 spike and greater than for HKU1, it seems likely that binding and neutralization depend primarily on RBD position epitope accessibility. The most concerning emerging SARS-2 variants have one conservative substitution in this epitope in B.1.1.7, identified in the United Kingdom, and has...
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We did not find any issues relating to the usage of bar graphs.
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from scite Reference Check: We found one citation with an erratum. We recommend checking the erratum to confirm that it does not impact the accuracy of your citation.
  <table style="border-collapse: collapse;"><tr><th style="min-width:95px; border: 1px solid lightgray; padding:2px">DOI</th><th style="min-width:95px; border: 1px solid lightgray; padding:2px">Status</th><th style="min-width:95px; border: 1px solid lightgray; padding:2px">Title</th></tr><tr><td style="min-width:95px; border: 1px solid lightgray; padding:2px">10.1371/journal.ppat.1000863</td><td style="min-width:95px; border: 1px solid lightgray; padding:2px">Has correction</td><td style="min-width:95px; border: 1px solid lightgray; padding:2px">In Vitro Reconstitution of SARS-Coronavirus mRNA Cap Methyla…</td></tr></table>
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/content/10.1101/2021.01.31.428824v2
www.biorxiv.org www.biorxiv.org

SUSD4 controls GLUA2 degradation, synaptic plasticity and motor learning

1
1. acollings 18 Feb 2021
  
  in eLife
  
  Reviewer #3 (Public Review):
  
  In this study from the Selimi lab, Gónzalez-Calvo and colleagues investigate the role of the uncharacterized complement family protein SUSD4. SUSD4 is expressed at the time of cerebellar synaptogenesis and localizes to dendritic spines of Purkinje cells. Susd4 KO mice show impaired motor learning, a cerebellum-dependent task. Susd4 KO mice display impaired LTD and facilitated LTP at parallel fiber (PF)-Purkinje cell (PC) synapses, indicating altered synaptic plasticity in the absence of Susd4. Climbing fiber (CF)-Purkinje cell synapses show largely normal basal transmission, with the exception of larger quantal EPSCs. Immunohistochemical analysis shows a small decrease in the proportion of CF/PC synapses lacking GluA2. As their data indicates a role for SUSD4 in regulation of postsynaptic GluA2 content at cerebellar synapses, they next explored the molecular mechanism by which SUSD4 might do so. Activity-dependent degradation of GluA2 does not occur in the absence of SUSD4. Affinity purification of proteins associated with recombinant SUSD4 identifies ubiquitin ligases as well as several proteins involved in AMPAR turnover. Finally, the authors show that SUSD4 can bind GluA2 in HEK cells, and that SUSD4 can bind the ubiquitin ligase NEDD4, but that these two interactions are not dependent on each other.
  
  This study provides novel insight in the uncharacterized role of SUSD4 and provides a detailed and well-performed analysis of the Susd4 loss of function phenotype in the cerebellar circuit. The exact mechanism by which SUSD4 affects GluA2 levels remains unclear. However, their findings provide leads for further functional follow-up studies of SUSD4.
  
  Specific comments:
  
  1) Localization of SUSD4. The authors demonstrate localization to spines in distal PC dendrites (Fig. 1C). Does SUSD4 also localize to CF/PC synapses? This is important to establish given the phenotype of increased quantal EPSCs and decreased proportion of synapses without GluA2 at the CF/PC synapse.
  
  2) Figure 4B: There seems to be considerably less surface GluA2 in Susd4 KO cerebellar slices. Is the difference in surface GluA2 between WT and KO significant? Although the mean reduction in surface GluA2 in Susd4 KO following cLTD is similar to WT, the difference with control is not significant. This should be pointed out in the text because it can not be definitively concluded that endocytosis of GluA2 is not altered in Susd4 KO on the basis of this experiment.
  
  3) Figure 4D: The colocalization of SUSD4 with GluA2 is difficult to see in this image. An inset with higher zoom could help. Quantification of colocalization using e.g. Manders coefficient would help.
  
  4) Figure 5B: The negative control used here, PVRL3alpha, lacks an HA tag. This therefore does not control for non-specific interactions of highly overexpressed membrane proteins in co-transfected HEK cells. The authors should use an HA-tagged membrane protein as a control here to demonstrate that the interaction of SUSD4 and GluA2 is specific for SUSD4.
  
  5) Figure 5D: The level of GluA2 recovered in the IP appears normalized to HA-SUSD4. This does not control for the variations in GluA2 input levels shown in Fig. S11. Statements on amounts of GluA2 recovered for various SUSD4 mutants should be adjusted to take this into account.
  
  6) Line 357: binding of SUSD4=is likely meant to be binding of NEDD4.
  
  scietyType:PeerReview scietyCreator:Reviewer 3
Visit annotations in context

Tags

scietyCreator:Reviewer 3

scietyType:PeerReview

Annotators

acollings

URL

biorxiv.org/content/10.1101/859587v2
github.com github.com

Move multi-parameter attributes from ActiveRecord to ActiveModel by georgebrock · Pull Request #8189 · rails/rails

1
1. TylerRick 17 Feb 2021
  
  in Public
  
  Fork rails, add github.com/georgebrock/rails as a remote, merge this branch into rails/4.0.2 (the tag), and then use your fork of Rails: gem 'rails', github: 'yourusername/rails'
  
  using a fork while waiting for upstream to merge
Visit annotations in context

Tags

using a fork while waiting for upstream to merge

Annotators

TylerRick

URL

github.com/rails/rails/pull/8189
www.infoworld.com www.infoworld.com

Why getter and setter methods are evil

1
1. TylerRick 17 Feb 2021
  
  in Public
  
  The JavaBean spec designers threw the getter/setter idiom into the picture because they thought it would be an easy way to quickly make a bean—something you can do while you're learning how to do it right. Unfortunately, nobody did that.Accessors were created solely as a way to tag certain properties so a UI-builder program or equivalent could identify them. You aren't supposed to call these methods yourself. They exist for an automated tool to use.
  
  unintended consequence
Visit annotations in context

Tags

unintended consequence

Annotators

TylerRick

URL

infoworld.com/javaworld/jw-09-2003/jw-0905-toolbox.html
inst-fs-iad-prod.inscloudgate.net inst-fs-iad-prod.inscloudgate.net

That's the Joint!: The Hip-Hop Studies Reader

1
1. aldwin 17 Feb 2021
  
  in Public
  
  As an integral part of hip hop, breakingshares many stylistic features with graffiti, rapping, and scratching. Like wild-style graffiti, itemphasizes flamboyance, and the embellishment of the tag finds its parallel in the freeze. Theact of writing graffiti is, despite its acceptance on canvas at the Fifty-seventh Street galleries,an act of defacement, and breaking, in its days before media hype, was an act of obscenegestures, a threat. In both graffiti and breaking, each piece or freeze is a challenge, a call torivals to try to top this, and at the same time a boast that it is unbeatable. Graffiti, rapping, andbreaking alike celebrate the masculine heroes of the mass media —Superman and other comic-book heroes, the Saint of detective book and TV fame, athletes, kung-fu masters, and greatlovers. The obscure gestural ciphers of breaking find their parallels in the (deliberately) nearlyunreadable alphabets of wild-style graffiti, the (deliberately) nearly unintelligible thicket of raplyrics, and the (deliberately) barely recognizable music that is cut up and recombined inscratching.
  
  Pace Grandmaster Flash.
Visit annotations in context

Annotators

aldwin

URL

inst-fs-iad-prod.inscloudgate.net/files/c38ade4a-2753-4424-a164-a956677328d0/That's the Joint- Hip Hop Studies Reader*.pdf
toraritte.github.io toraritte.github.io

NixOS - Nix 2.3.10 manual

3
1. toraritte 17 Feb 2021
  
  in Public
  
  See annotations with the build-phases tag.
  
  Why are the build phases not enumerated in the Nix manual? If the instructions on how to create a derivation (and thus, a package) then why not go all in instead of spreading out information in different manuals, making the subject harder to grasp?...
  
  (By the way, it is documented in the Nixpkgs manual under 6.5 Phases; not sure why it is not called build phases when every page refers to them like that.)
  
  nix rant https://toraritte.github.io/saves/Nix-Package-Manager-Guide-Version-2.3.10.html build-phases
2. toraritte 17 Feb 2021
  
  in Public
  
  substitute
  
  this is another key topic. Also:
  
  substitute vs. substituter => this (I think)
  
  See annotations with the substitute tag
  
  nix todo question https://toraritte.github.io/saves/Nix-Package-Manager-Guide-Version-2.3.10.html substitute
3. toraritte 17 Feb 2021
  
  in Public
  
  When you ask Nix to install a package, it will first try to get it in pre-compiled form from a binary cache. By default, Nix will use the binary cache https://cache.nixos.org; it contains binaries for most packages in Nixpkgs. Only if no binary is available in the binary cache, Nix will build the package from source. So if nix-env -i subversion results in Nix building stuff from source, then either the package is not built for your platform by the Nixpkgs build servers, or your version of Nixpkgs is too old or too new.
  
  binary caches tie in with substitutes somehow; get to the bottom of it. See annotations with the substitute tag.
  
  Maybe this?
  
  nix https://toraritte.github.io/saves/Nix-Package-Manager-Guide-Version-2.3.10.html substitute question
Visit annotations in context

Tags

substitute

rant

todo

build-phases

question

nix

https://toraritte.github.io/saves/Nix-Package-Manager-Guide-Version-2.3.10.html

Annotators

toraritte

URL

toraritte.github.io/saves/Nix-Package-Manager-Guide-Version-2.3.10.html
www.w3schools.com www.w3schools.com

Tryit Editor v3.6

1
1. hasangokce 17 Feb 2021
  
  in Public
  
  We can use required tag for html, for a simple check.
Visit annotations in context

Annotators

hasangokce

URL

w3schools.com/tags/tryit.asp
github.com github.com

Why another form object? · Issue #3 · GCorbel/activeform-rails

1
1. TylerRick 16 Feb 2021
  
  in Public
  
  The reason Reform does updating attributes and validation in the same step is because I wanna reduce public methods. This is to save users from having to remember state.
  
  I see what he means, but what would you call this (tag)? "have to remember state"? maybe "have to remember" is close enough
  
  Or maybe order is important / do things in the right order is all we need to describe the problem/need.
  
  simplicity by design state management annotation meta: may need new tag have to remember order is important / do things in the right order
Visit annotations in context

Tags

state management

simplicity by design

have to remember

order is important / do things in the right order

annotation meta: may need new tag

Annotators

TylerRick

URL

github.com/GCorbel/activeform-rails/issues/3
oozou.com oozou.com

Introducing ActiveForm for Ruby on Rails | OOZOU

1
1. TylerRick 16 Feb 2021
  
  in Public
  
  I will continue to use form objects and push changes into the repo when I feel they are universally relevant and valuable.
  
  new tag?:
  
  code that is universally relevant/valuable
  
  non - _-specific logic
  
  using your project at work general solution annotation meta: may need new tag _-specific logic
Visit annotations in context

Tags

_-specific logic

general solution

annotation meta: may need new tag

using your project at work

Annotators

TylerRick

URL

oozou.com/blog/introducing-activeform-for-ruby-on-rails-50
drive.google.com drive.google.com

A brief history of the GIF (so far)

1
1. Ashley_Jewell 16 Feb 2021
  
  in Public
  
  Tumblr is also responsible for igniting mainstream interest in the GIF as anaesthetic form, curating search results for the #GIF tag that foreground andcultivate original works created for their own sake.
  
  It seems like GIFs became more popular with social media. It's almost as if social media reinvented the GIF.
Visit annotations in context

Annotators

Ashley_Jewell

URL

drive.google.com/uc
www.washingtonpost.com www.washingtonpost.com

Smaller cakes, shorter dresses, bigger diamonds: The pandemic is shaking up the $73 billion wedding industry

2
1. richardrose1234 16 Feb 2021
  
  in Public
  
  he typical engagement ring, he said, now comes with a 2.5-carat diamond (price tag: $6,000 to $9,000), compared with the 1-carat stones seen pre-pandemic. Signet Jewelers, the parent company of Kay, Zales and Peoples, also reports seeing higher demand for larger and more novel cuts of diamonds, including pear- and heart-shaped stones for both men and women, according to President Jamie Singleton.
  
  What is the purpose of this paragraph?
2. richardrose1234 16 Feb 2021
  
  in Public
  
  In 2019, the average wedding cost nearly $25,000, with most going toward the reception, according to the Wedding Report, a market research firm. But with nuptials increasingly taking place outdoors or online, the average couple now spend significantly less, forcing retailers and vendors to adapt. Hotels are offering elopement packages, bridal gown designers are creating simpler, shorter dresses, and bakers are churning out miniature cakes. And a growing contingent of videographers and wedding planners will produce and host Zoom nuptials, often with a price tag in the thousands.
  
  What is the main idea of this paragraph?
Visit annotations in context

Annotators

richardrose1234

URL

washingtonpost.com/road-to-recovery/2021/02/11/zoom-weddings-covid-diamond-rings/
docdrop.org docdrop.org

Video: Liquid Margins 018 | Social Annotation in Community College: A California Case Study (DocDrop)

1
1. CurtisNB 16 Feb 2021
  
  in Public
  
  i ask the students to tag their strategies that they're using as they're putting them into the margins you know tag when you're asking a question tag when you're synthesizing
  
  I think tagging the type of annotation that is being made is one of the best ways for students to be consciously aware of the moves they are making as readers.
Visit annotations in context

Annotators

CurtisNB

URL

docdrop.org/video/Qm-KvpygL8Q/
gauchospace.ucsb.edu gauchospace.ucsb.edu

Ibn Jubayr Part 3.pdf

1
1. dbsonnenberg 16 Feb 2021
  
  in Public
  
  Jabal al-Judi
  
  Mount Judi, also known as Qardū, is Noah's apobaterion or "Place of Descent", the location where the Ark came to rest after the Great Flood, according to very Early Christian and Islamic tradition. The Quranic tradition is similar to the Judeo-Christian legend.
  
  https://noahsfloodnoahsark.wordpress.com/tag/iran/
Visit annotations in context

Annotators

dbsonnenberg

URL

gauchospace.ucsb.edu/courses/pluginfile.php/14730341/mod_resource/content/1/Ibn Jubayr Part 3.pdf
www.plymouth.edu www.plymouth.edu

9780199554232_000i-00ii_Sodhi_Biology_color_Htitle 1..2

1
1. SheenaDuncan 16 Feb 2021
  
  in Public
  
  . To many, even the thought ofputting a price tag on services like photosynthesis,purification of water, and pollination of food cropsmay seem like hubris, as these are truly pricelessservices without which not only humans, but mostof lifewould perish.A distinguished economistputit best in response to a seminar at the USA FederalTrade Commission, where the speaker down-played the impact of global warming by sayingagriculture and forestry“accounted for only threepercentoftheUSgrossnationalproduct”.Theecon-omist’s response was:“What does this genius thinkwe’re going to eat?
  
  I thought this was just awesome. It really highlights the attitude that has developed among some people. Things like food, water, and air are so taken for granted that they have actually been reduced to "inconsequential" status because they are "marginal" in the scope of the over all economy. Like the only thing in the world that is real are dollars.
Visit annotations in context

Annotators

SheenaDuncan

URL

plymouth.edu/courses/pluginfile.php/1878169/mod_resource/content/1/Chapter3.pdf
www.biorxiv.org www.biorxiv.org

https://biorxiv.org/cgi/content/10.1101/2021.02.12.430998

1
1. sciscore 15 Feb 2021
  
  in SciScore
  
  SciScore for 10.1101/2021.02.12.430998: (What is this?)
  Please note, not all rigor criteria are appropriate for all manuscripts.
  Table 1: Rigor
  <table><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Institutional Review Board Statement</td><td style="min-width:100px;border-bottom:1px solid lightgray">Consent: Written consent was obtained from all individuals and the study was approved by the local ethics committee (14/8/20).<br>IRB: Collection of plasma samples from COVID-19 patients treated at the intensive care unit was approved by the Ethic committee of the University Medicine Göttingen (SeptImmun Study 25/4/19 Ü)</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Randomization</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Blinding</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Power Analysis</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Sex as a biological variable</td><td style="min-width:100px;border-bottom:1px solid lightgray">not detected.</td></tr><tr><td style="min-width:100px;margin-right:1em; border-right:1px solid lightgray; border-bottom:1px solid lightgray">Cell Line Authentication</td><td style="min-width:100px;border-bottom:1px solid lightgray">Contamination: Further, cell lines were routinely tested for contamination by mycoplasma.</td></tr></table>
  Table 2: Resources
  <table><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Antibodies</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of recombinant human monoclonal antibodies against SARS-CoV-2 spike: VH and VL sequences of Regeneron antibodies Casirivimab/REGN10933, Imdevimab/REGN10987 and REGN10989 (Hansen et al., 2020) were cloned in pCMC3-untagged-NCV (SINO Biologics, Cat: CV011) and produced in 293T cells by SINO Biological (Beijing, China).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>REGN10989</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The human IgG1 isotype control antibodies IgG1/κ and IgG1/λ were produced by transfecting FreeStyle 293-F or 293T cells (Fisher Scientific, Schwerte, Germany, Cat. no. R790-07) with the respective plasmids using the protocol provided with the FreeStyle 293 Expression System (Thermo Fisher Scientific, Cat. no. K9000-01).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IgG1</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Briefly, 293T cells were stained with the recombinant human IgG1 antibodies in FACS buffer (PBS with 0.5% bovine serum albumin and 1 nmol sodium azide) for 20 minutes in ice, washed, incubated with an Alexa Fluor 647-labeled mouse monoclonal antibody against the human IgG1-Fc (Biolegend, San Diego, USA, cat #409320) and analyzed in a Gallios flow cytometer (Beckman Coulter, Brea, California, USA respectively)</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>human IgG1-Fc</div><div>suggested: (Sino Biological Cat# 10702-MM01T-H, RRID:AB_2860221)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Finally, culture medium was added that was supplemented with anti-VSV-G antibody (culture supernatant from I1-hybridoma cells; ATCC no. CRL-2700; not added to cells expressing VSV-G).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-VSV-G</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The upper portion of the membrane was probed with anti-HA tag antibody (mouse, Sigma-Aldrich, H3663) diluted 1:1,000 in 5% skim milk solution, while the lower portion of the membrane was probed with anti-VSV matrix protein antibody (Kerafast, EB0011; loading control) diluted 1:2,500 in 5% skim milk solution.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-HA</div><div>suggested: (Sigma-Aldrich Cat# H3663, RRID:AB_262051)</div></div><div style="margin-bottom:8px"><div>anti-VSV matrix protein</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Following incubation over night at 4 °C, membranes were washed three times with PBS-T, before being probed with peroxidase-conjugated anti-mouse antibody (Dianova, 115-035-003, 1:5,000) for 1 h at room temperature.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>anti-mouse</div><div>suggested: (Jackson ImmunoResearch Labs Cat# 115-035-003, RRID:AB_10015289)</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Experimental Models: Cell Lines</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Cell culture: All cell lines were incubated at 37 °C in a humidified atmosphere containing 5% CO2. 293T (human, kidney; ACC-635, DSMZ), Huh-7 (human, liver; JCRB0403, JCRB; kindly provided by Thomas Pietschmann, TWINCORE, Centre for Experimental and Clinical Infection Research, Hannover, Germany) and Vero76 cells (African green monkey, kidney; CRL-1586, ATCC; kindly provided by Andrea Maisner, Institute of Virology, Philipps University Marburg, Marburg, Germany) were cultivated in Dulbecco’s modified Eagle medium (DMEM) containing 10% fetal bovine serum (FCS, Biochrom), 100 U/ml of penicillin and 0.1 mg/ml of streptomycin (PAN-Biotech).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Huh-7</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>Vero76</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Caco-2 (human, intestine; HTB-37, ATCC) and Calu-3 cells (human, lung; HTB-55, ATCC; kindly provided by Stephan Ludwig, Institute of Virology, University of Münster, Germany) were cultivated in minimum essential medium supplemented with 10% FCS, 100 U/ml of penicillin and 0.1 mg/ml of streptomycin (PAN-Biotech), 1x non-essential amino acid solution (from 100x stock, PAA) and 1 mM sodium pyruvate (Thermo Fisher</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Caco-2</div><div>suggested: None</div></div><div style="margin-bottom:8px"><div>HTB-37</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">A549 cells (human, lung; CRM-CCL-185, ATCC) were cultivated in DMEM/F-12 medium with Nutrient Mix (Thermo Fisher Scientific) supplemented with 10% FCS, 100 U/ml of penicillin and 0.1 mg/ml of streptomycin (PAN-Biotech).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>A549</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">The following experimental set-ups were used: (i) In case of experiments comparing the efficiency cell entry by WT and mutant SARS-2-S, target cells were inoculated with 100 μl/well of the respective pseudotype particles; (ii) For investigation of inhibition of SARS-2-S-driven cell entry by the serine protease inhibitor Camostat mesylate, Calu-3 cells were preincubated for 1 h with medium (50 μl/well) containing either increasing concentrations of Camostat (0.5, 5 or 50 μM; Tocris) or dimethyl sulfoxide (solvent control) before the respective pseudotype particles were added on top; in order to assess the ability of sol-hACE2-Fc, patient sera and monoclonal antibodies to block SARS-2-S-driven cell entry, pseudotype particles were preincubated for 30 min with medium containing different dilutions of either sol-hACE2-Fc (1:20, 1:200, 1:2,000) or patient serum/plasma (serum: 1:50, 1:100, 1:200, 1:400, 1:800; plasma: 1:25, 1:100, 1:400, 1:1600, 1:6400), or with different concentrations of monoclonal antibody (5, 0.5, 0.05, 0.005, 0.0005 μg/ml), before being inoculated onto Vero76 cells.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Calu-3</div><div>suggested: KCLB Cat# 30055, RRID:CVCL_0609)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Production of sol-hACE2-Fc: 293T cells were grown in a T-75 flask and transfected with 20 μg of sol-hACE2-Fc expression plasmid.</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>293T</div><div>suggested: None</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data normalization was done as follows: (i) In order to assess enhancement of S protein-driven pseudotype entry in BHK-21 cells following directed overexpression of hACE2, transduction was normalized against the assay background (which was determined by using rhabdoviral pseudotypes bearing no viral glycoprotein, set as 1); (ii) To compare efficiency of cell entry driven by the different S protein variants under study, transduction was normalized against SARS-2-S WT (set as 100%); (iii) For experiments investigating inhibitory effects exerted by sol-hACE2-Fc or Camostat Mesylate, patient serum/plasma samples or monoclonal antibodies, transduction was normalized against a reference sample (control-treated cells or pseudotypes, set as 100%).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>BHK-21</div><div>suggested: None</div></div></td></tr><tr><th style="min-width:100px;text-align:center; padding-top:4px;" colspan="2">Software and Algorithms</th></tr><tr><td style="min-width:100px;text=align:center">Sentences</td><td style="min-width:100px;text-align:center">Resources</td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Sequence alignments were performed using the Clustal Omega online tool (</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Clustal Omega</div><div>suggested: (Clustal Omega, RRID:SCR_001591)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Protein models were designed using the YASARA (http://www.yasara.org/index.html) and UCSF Chimera (version 1.14, developed by the Resource for Biocomputing, Visualization, and Informatics at the University of California, San Francisco) software packages, and are either based on PDB: 6XDG (Hansen et al., 2020) or on a template generated by modelling the SARS-2-S sequence on a published crystal structure (PDB: 6XR8, (Cai et al., 2020)) with the help of the SWISS-MODEL online tool (https://swissmodel.expasy.org/).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>YASARA</div><div>suggested: (YASARA, RRID:SCR_017591)</div></div></td></tr><tr><td style="min-width:100px;vertical-align:top;border-bottom:1px solid lightgray">Data normalization and statistical analysis: Data analysis was performed using Microsoft Excel as part of the Microsoft Office software package (version 2019, Microsoft Corporation) and GraphPad Prism 8 version 8.4.3 (GraphPad Software).</td><td style="min-width:100px;border-bottom:1px solid lightgray"><div style="margin-bottom:8px"><div>Microsoft Excel</div><div>suggested: (Microsoft Excel, RRID:SCR_016137)</div></div><div style="margin-bottom:8px"><div>GraphPad Prism</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div><div style="margin-bottom:8px"><div>GraphPad</div><div>suggested: (GraphPad Prism, RRID:SCR_002798)</div></div></td></tr></table>
  Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).
  Results from LimitationRecognizer: We detected the following sentences addressing limitations in the study:
  The following limitations of our study need to be considered. We employed pseudotyped particles instead of authentic SARS-CoV-2 and we did not determine whether Y453F affects viral inhibition by T cell responses raised against SARS-CoV-2. Further, we did not investigate whether presence of Y453F in the SARS-CoV-2 S protein increases binding to mink ACE2. Nevertheless, our results suggest that the introduction of SARS-CoV-2 into mink allows the virus to acquire mutations that compromise viral control by the humoral immune response in humans. As a consequence, infection of mink and other animal species should be prevented and it should be continuously monitored whether SARS-CoV-2 amplification in other wild or domestic animals occurs and changes critical biological properties of the virus.
  Results from TrialIdentifier: No clinical trial numbers were referenced.
  Results from Barzooka: We found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).
  Results from JetFighter: We did not find any issues relating to colormaps.
  Results from scite Reference Check: We found no unreliable references.
  <footer>
  About SciScore
  SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore checks for the presence and correctness of RRIDs (research resource identifiers), and for rigor criteria such as sex and investigator blinding. For details on the theoretical underpinning of rigor criteria and the tools shown here, including references cited, please follow this link.
  </footer>
Visit annotations in context

Annotators

sciscore

URL

biorxiv.org/cgi/content/10.1101/2021.02.12.430998
medium.com medium.com

Are you doing bookmarking the smart way or the hard way? Tips for better bookmarking

1
1. hypolluc 15 Feb 2021
  
  in Public
  
  [Geisel, 2017] Using social bookmarking tools to bookmark, tag, annotate, and take notes on websites; "Better bookmarking"
  
  Diigo
  
  Hypothes.is
  
  notetaking bookmarking hypothesis h_2017
Visit annotations in context

Tags

hypothesis

h_2017

notetaking

bookmarking

Annotators

hypolluc

URL

medium.com/synapse/i-just-found-a-link-from-january-of-2011-in-under-20-seconds-965f1d91f90
www.biorxiv.org www.biorxiv.org

Functional spreading of hyperexcitability induced by human and synthetic intracellular Aβ oligomers

1
1. f.bryant 12 Feb 2021
  
  in eLife
  
  Summary: This study provides new information about how amyloid beta (Ab) oligomers (Abo) may contribute to hyperexcitability which is important because Abo and hyperexcitability have been suggested to occur early in the development of Alzheimer's disease (AD). The authors added Abo intracellularly (iAbo) using dialysis from a patch pipette. Their data suggest iAbo led to increased synaptic excitation mediated presynaptically by retrograde signalling of nitric oxide (NO). Furthermore, they present data suggesting that there is spread of this increase in excitation to neighboring neurons.
  
  Major Comments:
  
  1) The nature of the described effects of intracellular iAbo are quite unexpected, occurring within a minute of obtaining intracellular recording configuration, which contrasts with at least on previous study. While some controls for intracellular application of oligomers are provided, with reverse iAbo failing to reproduce the effect (Fig 2S1) and the effect being blocked by the antibody A11 (Fig 2S2), further controls are necessary to explain this rapid effect, which seems faster than that for the diffusion of the fluorescent tag into the cell (Fig 1S1). Note that Pusch and Neher (Pflug Arch 1988) determined diffusion time for different substances. That paper or others should be cited, and then some estimation of equilibrium time based on diffusibility of ab oligomers should be provided. Equations 17 and 18 in that paper provide some estimates based on molecular weight or diffusion coefficient. One point in Pusch and Neher is there is extreme variability between access times across cells and that it depends on access resistance, of course. Finally, the Pusch and Neher calculations were for small spherical cells - diffusion into spatially extended cells with long dendrites where the synapses are will take even longer. This is especially critical, as one of the major papers of precedent for this work is that of Ripoli, et al. 2014 (cited in the manuscript) in which the authors of that work examined effects of patch applied Ab42 over the course of 20 minutes, with internal controls showing differences between initial responses, right after break in, and 20 minutes later when the oligomer and/or monomers will have had a chance to equilibrate with the intracellular contents. It is not clear how such a rapid effect as indicated in the figures could be achieved by such a large molecule as Ab. The data suggest a time to effect of seconds to minutes, and the peak effect occurs before the fluorescence peaks, which seems hard to explain.
  
  2) The data need reorganization in terms of their results using h-iAbo or iAbo. There needs to be a clear demonstration of why both were used if the results are generalized with both (or not) and if they can actually use both interchangeably.
  
  3) The authors need to clearly indicate whether the experiments were done in culture or in slices. The authors need to provide a rationale on why specific experiments were done in culture and others in slices.
  
  4) There are aspects of the observed phenomenon that have not been taken adequately into account. For example, the authors have not investigated the effects of application of oligomeric beta-amyloid to either the extracellular space or the presynaptic neurons, two other compartments of the synapse.
  
  5) Aspects of the data raise questions: 1) Western blots appear to have multiple bands 2) evidence that the fluorescent probe accurately measures NO. 3) The bursts of activity are not quantified. What was defined as a burst? What was the burst frequency and did it change over the recording period? 4)The external solution for cultures contain 5.4 mM K+ which is quite high, and can induce hyperexcitability. Similarly, the use of 100uM AMPA and GABA seem very high. Justifying these high concentrations is important. They should lead to hyperexcitability and toxicity (AMPA) over time. Another point of concern is that the concentration of K+ for the slice work is 3 mM, much different than cultures. There are also differences in Mg2+ and Ca2+, making data hard to compare in the two preparations. 5) sample sizes are unclear 6) Intracellular Ab produces increases in both EPSCs and IPSCs. However, in Fig 3, the IPSC measures using a charge transfer quantification, did not show a significant change in response to iAbo, in contrast to EPSCs. 7) With regard to the inhibition, In the schematic on Fig. 10, I find this incomplete and slightly inaccurate since it shows one terminal releasing both glutamate and GABA with NO increasing both. While this is obviously an oversimplification, it's slightly inaccurate since NO was not directly shown to increase sIPSCs. Were NOS blockers able to disrupt the increase in sIPSCs? Moreover, there are many papers that have shown that PKC can also phosphorylate GABA receptors and increase their conductance. What could be the reason that this was not involved here? This needs to be discussed.
  
  6) How this work relates to other studies is necessary. For example, how this study is related to others about Ab exposure is lacking. Also, regarding hyperexcitability, many possible causes exist. These should be summarized in the introduction and the authors should comment how their results fit with these studies. Regarding PKC and NO, PKC and NO have several known actions throughout the brain and body. How do the effects the authors have identified relate to all these other effects? For example, if PKC is activated by another mechanism, would it occlude effects of Ab? What are the changes in PKC and NO in AD? Regarding the ability of the data to address AD, a major issue is whether the results are relevant to AD or represent interesting pharmacological data about what Ab can potentially do in some of its forms in normal tissue.
  
  Reviewer #2 opted to reveal their name to the authors in the decision letter after review.
  
  scietyType:ReviewSummary
Visit annotations in context

Tags

scietyType:ReviewSummary

Annotators

f.bryant

URL

biorxiv.org/content/10.1101/2020.10.16.332445v1
www.biorxiv.org www.biorxiv.org

A novel and specific regulator of neuronal V-ATPase in Drosophila

2
1. EMBOpress 11 Feb 2021
  
  in Review Commons
  
  Note: This preprint has been reviewed by subject experts for Review Commons. Content has not been altered except for formatting.
  
  Learn more at Review Commons
  
  Reviewer #4
  
  Evidence, reproducibility and clarity
  
  We have reviewed "A specific regulator of neuronal V-ATPase in Drosophila melanogaster." by Dulac et al. The authors have identified VhaAC45L as a regulator of neuronal V-ATPase in Drosophila melanogaster. The authors have utilized multiple techniques to determine the localization of VhaAC45L in neurons and specifically in the synapse. The use of multiple approaches including determining RNA levels in different regions of the fly, and using CRISPR-Cas9 technique to insert V5 tag, makes a very convincing argument about the synapse-specific expression of VhaAC45L.
  
  The combined use of co-immunoprecipitation technique and LC/MS to show that VhaAC45L co-precipitated with V-ATPase complex subunits is convincing that VhaAC45L is a subunit of V-ATPase. To determine the role of VhaAC45L in acidification of synaptic vesicles the authors have utilized pHluorins in combination with multiple RNAi lines. The authors have used a well-designed experiment to prove that VhaAC45L regulates acidification of the synaptic vesicles. Further, larval locomotion and quantal size determination using VhaAC45LRNAi which is known to be altered due to pH gradient of synaptic vesicles shows the functional role of VhaAC45L in synaptic vesicle acidification.
  
  Minor comments:
  
  For all graphs, please remove gridlines to make data points more visible.
  
  Line 120-123: Authors indicate the VhaAC45LRNAi induced lethal phenotype when expressed in glutamatergic and cholinergic drivers but the figure is missing. Please indicate as "data not shown" if not included in Figure.
  
  A diagram summarizing the role of VhaAC45L in V-ATPase enzymatic complex and specific role is recommended.
  
  Significance
  
  V-ATPase play a crucial role at the synapse by being responsible for acidification of the synaptic vesicles and identification of a synaptic vesicle specific regulator of V-APTase is important to understand the complex regulation of synapse function. The authors have used well-designed experiments to convince the localization and function of VhaAC45L in synaptic vesicle acidification.
  
  Referees cross commenting
  
  The summary of Reviewer#2 looks good!
  
  PeerReviewed
2. EMBOpress 11 Feb 2021
  
  in Review Commons
  
  Note: This rebuttal was posted by the corresponding author to Review Commons. Content has not been altered except for formatting.
  
  Learn more at Review Commons
  
  Reply to the reviewers
  
  We would like to thank the editors and the four reviewers for their careful consideration of our manuscript. We are very grateful for their positive appreciation of our work and we believe that their suggestions, which have been included in the preliminary revised version of the manuscript whenever possible, have greatly improved the quality of the paper and have helped us deepen our understanding of the results.
  
  We were happy to note that all the reviewers found value in our work, as stated in their general comments: “This is certainly a useful contribution to our understanding of neuronal V-ATPase functions in vivo” (…)” (Reviewer 1) – “Dulac et al report the very interesting discovery of a previously uncharacterized neuronal specific regulator of the V-ATPase. (…) The experiments are very well performed, the data presented very convincing and the paper is well written.” (Reviewer 2) – “The discovery of a neuronal specific regulator of the V-ATPase is very interesting (…) The work is therefore of great interest to researchers working on synaptic function in general and on synaptic vesicle biology in particular.” (Reviewer 3) – “The authors have used well-designed experiments to convince the localization and function of VhaAC45L in synaptic vesicle acidification.” (Reviewer 4).
  
  In their remarks, the reviewers suggested additional experiments that could be done to improve our understanding of the role of this new V-ATPase regulator, as well as several minor issues. We have addressed all their comments in our answers below, in which the full text of the reviews is included in blue type, and the responses in black. The line numbers refer to the revised version of the manuscript.
  
  Reviewer #1
  
  Dulac et al. present a first in vivo characterization of the 'accessory' v-ATPase subunit vhaAC45L in Drosophila. The key findings are localization and association of the protein with v-ATPase complexes at synapses and a functional requirement based on lethality and reduced synaptic function. This is certainly a useful contribution to our understanding of neuronal v-ATPase functions in vivo. The main weakness of the study is a lack of depth. The study focuses on localization, co-IP of associated proteins, an analysis of acidification and reduced synaptic function in fly larvae, thus providing a baseline for mechanistic study. However, the mechanism of vhaAC45L is not addressed in this short report. How does is vhaAC45L function different from its homolog vhaAC45? Is it required for v-ATPase assembly? Is it required to localize the full v-ATPase complex (or just V0) to the synapse? Is the defect really due to partial loading of synaptic vesicles or does loss of vhaAC45L also affect endosomal and lysosomal function at synapses? The work as is certainly represents a publishable contribution without answering any of these questions - more as an invite for the community to study the role of vhaAC45L; however, I feel this is a bit of a missed opportunity to put the function of a new potential regulator of specific synaptic v-ATPase functions in the context of the most basic functions obvious in this field.
  
  My main concerns are:
  
  clearly, vhaAC45L is required for SOME function of v-ATPase in neurons - but it remains entirely unclear which one. It is not even clear what compartments are affected. Reduced quantal size of single vesicle exocytosis events can be a direct or indirect consequence of problems in SV biogenesis and recycling.
  
  Is exo- /endocytosis unaffected? (FM1-43 uptake!).
  
  We agree that alterations in the synaptic vesicle release/recycling cycle could indeed contribute to the locomotion defect, in addition to the acidification impairment observed in VhaAC45L knockdown larvae. As suggested by the reviewer, we plan to carry out FM-dye assays to measure endocytosis and exocytosis at the neuromuscular junction of control versus VhaAC45L-KD animals. If successful, a new figure will be added to the final version of the paper.
  
  What compartments are affected? (markers for synaptic vesicles versus lysosomal compartments!).
  
  Finding out whether VhaAC45L is specifically involved in the acidification of synaptic vesicles, or if it also plays a similar role in other synaptic organelles, in particular lysosomes, would be very interesting indeed. However, we found that it was technically difficult to address this issue in the Drosophila nervous system. A good way would be to check whether the lysosomal pH is affected by VhaAC45L knockdown, as it is the case for synaptic vesicles.
  
  Unfortunately, because lysosomes are not abundant in neurons, lysosome-specific pH-sensitive probes such as Lysotracker do not yield detectable signals at Drosophila larval synapses. So, whether VhaAC45L is specific for synaptic vesicles or involved in the regulation of V-ATPase activity in all neuronal compartments reminas an open question for now.
  
  molecular function: is vhaAC45L required for v-ATPase assembly? (IP/Pull-downs of v- ATPase complexes in the presence or absence of vhaAC45L with other subunits!).
  
  In accordance with the reviewer, we are also very much eager to learn more about the precise molecular function of VhaAC45L, and in particular whether it is required or not for assembly of the V-ATPase complex. Pull-downs of V-ATPase proteins in controls versus VhaAC45L-KD could be used to address this question, but this would require a large quantity of antibodies directed against subunits of the V0 and V1 domains, respectively. Unfortunately, there are no such antibodies commercially available against Drosophila V-ATPase proteins. We have tried several antibodies that recognize V-ATPase subunits from other species and were predicted to react against Drosophila homologs, but with no success. The only V-ATPase antibodies currently at our disposal were samples generously sent to us by other laboratories in insufficient quantities for carrying out such experiments. To our regret, therefore, we were not able to answer this question until now because of the lack of appropriate tools.
  
  vha100 was proposed in Drosophila to function on synaptic vesicles and the lysosomal pathway, but, if I remember correctly, here quantal size was normal. I am missing a comparison between the two.
  
  We thank the reviewer for this comment. A comparison with previously published results on subunit Vha100-1 has now been added (lines 458-469) in the discussion related to this topic in the revised manuscript.
  
  The V5 knock-in is used both as a mutant as well as a tool to analyze protein localization. This is likely okay, but a little concern of course has to be that by creating a mutant protein through stop codon deletion its subcellular localization, turnover, etc. are not normal. Similarly, anti-V5 co-IPs will isolate proteins bound to the mutant variant of vhaAC45L. Minimally, IPs or pull- downs using other members of the V0 complex should be done to understand the role of vhaAC45L in direct comparison with vhaAC45 on complex assembly and possibly targeting to the synapse (or ideally targeting to specific compartments).
  
  It is indeed a legitimate concern to question the physiological relevance of results obtained by studying V5-tagged VhaAC45L. However, the V5 tag is very small (14 amino acids) and we fused it in place of the stop codon to keep intact the whole sequence of the protein. In addition, we found that the V5 knock-in flies are viable and fertile as homozygous. Given that the null mutants, as well as strong RNAi knockdowns, are lethal at early developmental stage, this suggests that the V5 knock-in has limited negative effects, if any, on VhaAC45L function. This led us to believe that at least a good portion of the V5-tagged protein might be targeted to the right subcellular compartment, and associate to its physiological partners.
  
  Significance:
  
  There is significance to the reporting of an accessory v-ATPase subunit required for SOME function of the v-ATPase in neurons. There is some lack of significance in the absence of basic mechanistic insight as to what vhaAC45L does to the v-ATPase in neurons.
  
  We agree that we did not elucidate here the precise molecular mechanisms by which VhaAC45L contributes to synaptic vesicle acidification. It is rather an initial description of a novel neuronal protein that appears to be essential for proper synaptic functioning, and we provide consistent evidence that its function requires specific interaction with the V-ATPase complex, and in particular with three subunits that reproducibly co-immunoprecipitated with VhaAC45L (namely Vha1C39-1, Vha100-1 and ATP6AP2). Please note that it took many years and many papers before the molecular mechanisms of action of comparable accessory subunits, such as ATP6AP1/AC45 or ATP6AP2, was better understood, and it is still nowadays a matter of investigation. It is therefore very demanding to expect that we describe the exact function of the previously uncharacterized VhaAC45L at all levels in a single first paper.
  
  Reviewer #2
  
  In this study and using Drosophila melanogaster as a model system, Dulac et al report the very interesting discovery of a previously uncharacterized neuronal specific regulator of the V-ATPase called VhaAC45L. They combine genetics, IHC, Mass spec and ephys to unravel the expression pattern and function of this protein. They find that it is required to acidify synaptic vesicles in glutamatergic neurons of the Drosophila larval neuromuscular junction, for appropriate synaptic transmission and for larval locomotion. The experiments are very well performed, the data presented very convincing and the paper is well written. Nonetheless, a few additional pieces of evidence and some level of expanded analysis would strengthen the conclusions and increase the depth of the work.
  
  Major comments:
  
  Figure 1F: the while the localization to the presynaptic terminal is convincing, where exactly the protein is localized to is not studied. The imaging in these experiments could use increased resolution and concomitantly colocalization studies with more specific synaptic vesicle markers.
  
  We agree that it would be very good to show this additional result. However, confocal microscopy does not provide sufficient resolution to localize the protein at the membrane of individual synaptic vesicles. Another way would be to see if VhaAC45L immunostaining co- localizes with domains enriched in synaptic vesicle markers, but these organelles are rather ubiquitously distributed in the synaptic boutons at the Drosophila neuromuscular junction. To correctly perform this experiment, we would have to do immuno-electron microscopy, a technique we do not master in our laboratory and that we did not plan to implement for the present work.
  
  Figure 3B-G: these experiments should be complemented by a rescue experiment, ideally of the null mutant using a UAS construct and a pan neuronal driver, or - if such animals are viable to the third larval instar stage - a glutamatergic driver. If possible, it would also be good to study the NMJ phenotype of the null mutant rescued to viability using a neuronal driver that does not express in motor neurons (e.g. Chat-G4).
  
  Although a rescue experiment could potentially add a further evidence that Vha45ACL deficiency is responsible for the synaptic vesicle acidification defect described in Figure 3, we don’t think that it is a requisite here because we obtained similar results by knocking down the gene using two different RNAis. As described in the manuscript, the pan-neuronal expression of Vha45ACL could rescue the embryonic lethality of the null mutant, so it would be theoretically possible to check the acidity level of synaptic vesicles at the neuromuscular junction of the recued larvae. However, this would involve making rather complex genetic constructions to express VMAT-pHluorin in motor neurons in rescued mutant background. In addition, the conclusions we could draw from such experiment would be limited by the lack of comparison. Indeed, in Figure 3 the defect was observed in knockdown context, and the same experiment could not be performed in knockout larvae due to the early lethality. If we could measure the acidity level of rescued null mutants, we would not have any comparison point besides the knockdown experiments. As knockout and knockdown are not likely to produce identical phenotype (especially in terms of magnitude of effect), the ideal would be to compare the rescued phenotype to the null mutant expressing VhaAC45L in all neurons except motoneurons, as suggested by the reviewer. However, such genotype would certainly not be viable, since we observed that expression of VhaAC45L RNAis with a stronger motoneurons driver (D42-Gal4) was sufficient to induce lethality at early developmental stage.
  
  Figure 5: the authors focus on quantal size which measures the postsynaptic response to spontaneous release from the presynaptic terminal. However, it is unclear how this directly relates to the locomotor deficit beyond signaling potential deficits in vesicle loading or fusion. It would be more convincing to also study evoked release, and expand the analysis of presynaptic properties (number of events, amplitude, frequency).
  
  We fully agree with this comment shared by Reviewers 2 and 3 related to the electrophysiology experiments. Note that these experiments have been carried out in collaboration with another laboratory located in another city. The Covid-19 situation during the past year has prevented, and is still complicating, movements between labs, preventing us from going further with the electrophysiology analyses of VhaAC45L KD. If the situation in the near future allows it, we would very much like to add a more extensive electrophysiological analysis, including in particular the study of evoked release. In the revised manuscript, we have nevertheless completed Figure 5 by adding representative distributions of spontaneous mEPSP amplitudes in control and VhaAC45L knockdown larvae, as well as the results of new analyses showing lack of effects the KD on the mean EPSP frequency.
  
  General: showing some level of genetic interaction with V-ATPase subunits in at least some of the assays would be welcome.
  
  We are definitely in accordance with the reviewer on that point, but we think that this would involve a lot of work and be beyond the scope of the present initial description. Here we show by proteomic analyses that at least 12 proteins co-precipitate and so potentially interact with VhaAC45L, three of them being previously identified constitutive or accessory V-ATPase subunits. In our opinion, studying the interactions between VhaAC45L and these proteins through genetic and molecular studies will be the subject of future works. As stated by Reviewer 2 in the Referees cross commenting below: “further biochemical analysis is interesting but probably beyond the scope of this initial description and would take too much time”. We fully agree with this statement.
  
  Minor comments:
  
  Some of the images, especially those in Figure 3, should be larger for ease of visualization.
  
  As requested, the images of Figure 3 have been enlarged.
  
  Significance
  
  The discovery of a neuronal specific regulator of the V-ATPase is very interesting. To my knowledge it is the first description of a neuronal specific V-ATPase related protein since the description of Vha100-1 by Hiesinger and colleagues in 2005. The work is therefore of great interest to researchers working on synaptic function in general and on synaptic vesicle biology in particular.
  
  We are grateful to the reviewer for his very positive assessment of our work.
  
  I note that I do not have in depth expertise in electrophysiology, although I am sufficiently familiar with basic NMJ physiology experiments to render the opinions stated above.
  
  Reviewer #3
  
  In this study, Dulac and colleagues investigated roles of VhaAC45-like gene, which codes one of the V-ATPase accessory proteins in Drosophila, in synaptic transmission. First, they demonstrated that VhaZC45L transcripts are expressed selectively in neurons and that the gene products are addressed to synaptic areas. Second, they showed that VhaAC45L is co- immunoprecipitated with some subunits of V-ATPases, which is consistent with bio-informatics predictions. They further demonstrated that VhaAC45L-knockdown (KD) resulted in defects in synaptic vesicle acidification as well as a reduction in quantal size of glutamate, indicating that VhaAC45L play a key role in regulating neurotransmitter release by modulating the driving force for transmitter uptake. Last, not least, they demonstrated that VhaAC45L-KD in motoneurons attenuated larvae locomotor performance, indicating its physiological relevance. Overall, this study is rigorously executed and nicely presented, and adds one more component of the V- ATPase that is responsible for neurotransmitter uptake into synaptic vesicles. However, since this study simply confirmed an established notion from other species such as yeast and mammals that AC45 is one of the accessory proteins of the V-ATPase complex, a conceptual novelty beyond the previous knowledge is relatively poor in its present form. Thus, this reviewer would suggest several issues as following to improve the comprehensiveness as well as novelty of the current manuscript.
  
  The reason why the authors focused on VhaAC45-'like' is somewhat obscure, and therefore should be explained. How different VhaAC45 and VhaAC45L are in terms of amino acid sequences, tissue distributions, and KO phenotypes. It seems more comprehensive if the authors provide some experimental evidence on VhaAC45; e.g. whether it is also expressed in neurons or not (Fig. 1), and, if VhaAC45 is neuronal, whether it can rescue the phenotypes of VhaAC45L- KD to certain degree (Figs 4 & 5).
  
  Following the reviewer’s request, we have added a sequence alignment of VhaAC45 and VhaAC45L, as well as a graph showing tissue distributions of both genes in Supplementary Figure 1 of the revised manuscript. To our knowledge, there is no published functional study of VhaAC45 in Drosophila, so we can only make assumptions derived from studies on predicted homologs in evolutionarily distant species. For that reason, it is difficult to compare VhaAC45 to VhaAC45L, as it would first require an entire new study of VhaAC45 function in flies. Since our interest is to study neuronal physiology, we focused on VhaAC45L because compelling evidence indicates that this subunit is specific to the nervous system, as described in our manuscript, rather than on VhaAC45 which seems to be expressed in all tissues. In addition, homologs of VhaAC45L have never been functionally characterized to date in any species, making it very interesting to study this new protein in a genetically tractable organism.
  
  What is the mechanism of Ac45 in regulating V-ATPase activity? In mammals, it has been suggested that Ac45 is essential for proper sorting of the V-ATPase to the destined organelles (e.g. Jansen et al., Mol. Biol. Cell., 2010; Jansen et al., BBA, 2008). In this context, it should be examined whether VhaAC45L-KD would affect the synaptic localization of other V-ATPase subunits.
  
  We thank the reviewer for pointing out these very interesting references. We have indeed tried to determine the relative abundance of two other V-ATPase subunits at the larval neuromuscular junction in control and VhaAC45L knockdown contexts. However, because the tested subunits are not specific to neurons, and are expressed at relatively low levels in synapses, it was not possible for us to properly separate the synaptic signal from the background immunostaining in surrounding muscles. This unfortunately prevented us from performing an accurate and reliable quantification.
  
  Given that a rodent brain SV contains a few copies of the V-ATPase on average (Takamori et al., 2006, and some newer papers by others), it is interesting that >80% reduction of Ac45 showed moderate effects on quantal size. If SVs under study also contains 1 or 2 V-ATPase per SV, there must be some SVs lacking VhAC45L upon KD. In this context, it is interesting to see how VhaAC-KD (RNAi1~3) affect the frequencies of minis.
  
  The reviewer’s valuable comment prompted us to undertake new analyses on our electrophysiological recordings. We have now added in Figure 5E graphs showing the mean EPSP frequency for larvae expressing VhAC45L RNAi1 and RNAi2, which are the ones that were used in the quantal analysis. Both of these RNAi apparently decreased the frequency compared to controls, but this difference was not statistically significant. As detailed in the Discussion (line 458-469), this may suggest that VhaAC45L does not influence the abundance of the V-ATPase complex at nerve terminals, but rather its efficiency.
  
  In general, decrease in mini amplitudes is accounted for by changes in postsynaptic sensitivity for neurotransmitters. Although acidification deficits would support that decrease in quantal size is due to the decrease in the driving force for glutamate uptake, it should be examined whether the postsynaptic receptor fields are not affected by VhaAC45L-KD by recording postsynaptic response upon application of non-saturable concentrations of glutamate.
  
  Testing for potential postsynaptic receptor field alteration by glutamate application would be an interesting experiment indeed, but, as we believe, not a critical control for the present manuscript. Because we expressed RNAis presynaptically, any modification in the postsynaptic receptor field would have to be an indirect consequence of VhaAC45L downregulation in motoneurons, and so, likely to be related to the synaptic vesicle acidification defect. It would not change, therefore, our conclusion that VhaAC45L deficiency in motoneurons induces a decrease in quantal size. Because electrophysiology experiments were carried out in collaboration with another laboratory located in another city, the current sanitary context has so far prevented us from performing this test (please refer to our answer to comment 3 of Reviewer 2 for more details).
  
  Related to 4, it is also interesting to see if evoked responses are also attenuated as a result of VhaAC45L-KD, which is more physiologically relevant for locomotor activity phenotype than minis.
  
  We also agree with this comment, shared by Reviewer 2, to which we already responded above in our answer to comment 3 of Reviewer 2.
  
  Minor points:
  
  Quantal size of glutamate is not affected by reduced expression of DVGLUT (Daniels et al., Neuron, 2006), which highly contrasts with VhaAC45L, expression of which defines quantal size. Distinct regulation of quantal size by the transporter and the V-ATPase subunit should be discussed.
  
  As suggested by the reviewer, a discussion of this point has been added (lines 458-469). and Daniels et al. 2006 is now cited in the revised manuscript.
  
  For electrophysiological experiments, respective sample traces should be shown in Figure 5.
  
  Quantal size is not directly visible in sample traces, so we added instead representative distributions of spontaneous mEPSP amplitudes in control and VhaAC45L knockdown larvae in the new Figure 5C.
  
  <![endif]>Only RNAi1 and RNAi2 lines were examined for SV pH estimation and mini analysis. The results from RNAi3 should be presented, or at least mentioned in the text.
  
  These experiments were performed using two different RNAi constructs to ensure that similar effects were observed and to exclude the possibility of potential off-targets. Knocking down VhaAC45L in neurons with RNAi1 and 2 was lethal at pupal stages, suggesting that they give similar levels of inactivation. RNAi3 systematically induced lighter phenotypes, producing viable adults, which led us to believe it had a lower efficiency. Because the results on synaptic vesicle acidification and electrophysiology were very consistent with RNAi1 and RNAi2, we considered that it was not necessary to repeat the experiment with RNAi3.
  
  Significance
  
  As mentioned above, as it stands, the authors merely confirmed the pre-existing bioinformatic knowledge on one of the AC45 homologues in Drosophila. The audience of The EMBO Journal might be interested in how different/similar VhaAC45 and VhaAC45-like are, and their functional relevance. In particular, is VhaAC45 also mandatory for the V-ATPase functioning in neurons? Adding some basic information of VhaAC45, e.g. tissue distribution, KO phenotypes, and ability to rescue the VhaAC45-like-KD phenotypes, will certainly improve the comprehensiveness of this study, and capture audience's attention.
  
  As mentioned in our response to point 1 of the reviewer above, we have added more data comparing the structure and distribution of VhaAC45 and VhaAC45L in the revised manuscript. VhaAC45 appears to be ubiquitously expressed whereas VhaAC45L is neuron-specific.
  
  Comparing VhaAC45 to VhaAC45L would require a completely new study of VhaAC45 function, because it has never been done before in Drosophila to our knowledge. This would require repeating all the experiments with this other gene, probably involving two more years of work, and would make for a much longer and very different manuscript. It is understandable that this cannot be envisaged. Because homologs of VhaAC45L have never been functionally characterized to date in any species, we considered that it was worth studying this new protein on its own.
  
  Reviewer #4
  
  We have reviewed "A specific regulator of neuronal V-ATPase in Drosophila melanogaster." by Dulac et al. The authors have identified VhaAC45L as a regulator of neuronal V-ATPase in Drosophila melanogaster. The authors have utilized multiple techniques to determine the localization of VhaAC45L in neurons and specifically in the synapse. The use of multiple approaches including determining RNA levels in different regions of the fly, and using CRISPR- Cas9 technique to insert V5 tag, makes a very convincing argument about the synapse-specific expression of VhaAC45L.
  
  The combined use of co-immunoprecipitation technique and LC/MS to show that VhaAC45L co- precipitated with V-ATPase complex subunits is convincing that VhaAC45L is a subunit of V- ATPase. To determine the role of VhaAC45L in acidification of synaptic vesicles the authors have utilized pHluorins in combination with multiple RNAi lines. The authors have used a well- designed experiment to prove that VhaAC45L regulates acidification of the synaptic vesicles.
  
  Further, larval locomotion and quantal size determination using VhaAC45LRNAi which is known to be altered due to pH gradient of synaptic vesicles shows the functional role of VhaAC45L in synaptic vesicle acidification.
  
  Minor comments:
  
  For all graphs, please remove gridlines to make data points more visible.
  
  We found that gridlines can be helpful for the readers to assess approximate values on the graphs. So, we have not removed them but rather changed the colour to a light grey so it does not affect any more visibility. We have also placed the points over the error bars in all the graphs, so they become more apparent.
  
  Line 120-123: Authors indicate the VhaAC45LRNAi induced lethal phenotype when expressed in glutamatergic and cholinergic drivers but the figure is missing. Please indicate as "data not shown" if not included in Figure.
  
  This mention has been added in the manuscript (line 125).
  
  A diagram summarizing the role of VhaAC45L in V-ATPase enzymatic complex and specific role is recommended.
  
  We believe that it is too early in this first report to draw an accurate diagram summarizing the role of this new protein in the V-ATPase complex.
  
  Significance
  
  V-ATPase play a crucial role at the synapse by being responsible for acidification of the synaptic vesicles and identification of a synaptic vesicle specific regulator of V-ATPase is important to understand the complex regulation of synapse function. The authors have used well-designed experiments to convince the localization and function of VhaAC45L in synaptic vesicle acidification.
  
  We thank the reviewer for his very positive appreciation of our work.
  
  Referees cross commenting
  
  (Written by Reviewer 2)
  
  There seems to be overall consensus among the reviewers on 3 issues:
  
  A somewhat more precise understanding of the role of vhaAC45L in the synaptic vesicle cycle through better localization studies and some classic assays (like FM dye uptake).
  
  —See our answers to comments 1 of Reviewer 1 and Reviewer 2.
  
  A little more characterization of the transmission defects (e.g. studying evoked responses) would be welcome.
  
  —See our answers comment 3 of Reviewer 2.
  
  Ascertaining the validity of the alleles with rescue experiments, perhaps in the V5 mutant background to allow localization analysis in a rescued background.
  
  —See our answers to comment 2 of Reviewer 2.
  
  I think further biochemical analysis is interesting but probably beyond the scope of this initial description and would take too much time.
  
  We fully agree with this statement.
  
  The minor issues are easy to address
  
  We have addressed all of them in the preliminary revised version of the manuscript.
  
  PeerReviewed
Visit annotations in context

Tags

PeerReviewed

Annotators

EMBOpress

URL

biorxiv.org/content/10.1101/2021.02.08.430253v1
www.metacritic.com www.metacritic.com

We. The Revolution

2
1. TylerRick 10 Feb 2021
  
  in Public
  
  There's no such a thing, more like beautiful interface trying to hide that there's no actual gameplay.
  
  hiding __?
  
  annotation meta: may need new tag
2. TylerRick 10 Feb 2021
  
  in Public
  
  The filthy casuals write positive reviews on steam and it's clear that true gamers won't even try to review such a shallow game.
  
  reviews/ratings because only those already inclined to like it (or who have been swayed by the already positive reviews) will bother buying it and (therefore) bother reviewing it, hence amplifying the positive ratings
  
  reviews annotation meta: may need new tag ratings popularity amplification
Visit annotations in context

Tags

popularity amplification

reviews

annotation meta: may need new tag

ratings

Annotators

TylerRick

URL

metacritic.com/game/pc/we-the-revolution
moz.com moz.com

On-Site Optimization – The Beginner's Guide to SEO

1
1. joshhoustonartist 09 Feb 2021
  
  in Public
  
  There are also sub-headings that go from H2 to H6 tags, although using all of these on a page is not required. The hierarchy of header tags goes from H1 to H6 in descending order of importance.
  
  Will the crawlers lower the relevance of an H6 tag on my page compared to an H1 tag on someone else's page?
Visit annotations in context

Annotators

joshhoustonartist

URL

moz.com/beginners-guide-to-seo/on-page-seo
Local file Local file

Rosenhan On Being Sane In Insane Places.pdf

1
1. sbrown2156 08 Feb 2021
  
  in Public
  
  tag
  
  Author uses it in the context of a label, something that can not be easily removed. Used to identify someone
Annotators

sbrown2156
arstechnica.com arstechnica.com

New report on Apple’s VR headset: 8K in each eye, potential $3,000 price tag

1
1. conanxin 06 Feb 2021
  
  in Public
  
  苹果准备最早明年发布它的高端 VR 设备，这款计划中的产品售价将会高达 3000 美元。代号为 N301 的 VR 设备使用了两个 8K 显示屏，采用 M1 芯片的继任者，能展示丰富的 3D 图形。苹果将会使用眼球跟踪技术以较低的保真度渲染非用户注视的目标。苹果正在测试的一个版本使用了 10 多个摄像头，从跟踪手运动到提供周围空间的即时动态，可用于混合和增强现实体验，不限于浸入式的 VR。
  
  苹果 VR
Visit annotations in context

Tags

苹果

VR

Annotators

conanxin

URL

arstechnica.com/gadgets/2021/02/new-report-on-apples-vr-headset-8k-in-each-eye-potential-3000-price-tag/
linked-data.yalespace.org linked-data.yalespace.org

LUX Linked.Art Mapping

1
1. azaroth42 05 Feb 2021
  
  in Public
  
  "ara"
  
  Example question. Note the "question" tag.
  
  question
Visit annotations in context

Tags

question

Annotators

azaroth42

URL

linked-data.yalespace.org/docs/lux/404593.html
thenewstack.io thenewstack.io

Dynamicland Radically Rethinks the Computer Interface - The New Stack

1
1. conanxin 05 Feb 2021
  
  in Public
  
  each individual piece of paper on the walls and tables, here, is essentially its own snippet of the Lua programming language. Some pieces of paper have their working code printed on them. Dynamicland can actually perform OCR on that code and run it in real-time, but generally, it uses that code symbolically in the real world and has its own digital portion stashed on the server-side. However, when an object is changed, the system can highlight the changed lines on the paper printouts, and it has the ability to tag code sheets that are out of sync with their updated digital counterparts.
  
  在这里，墙上和桌子上的每一张纸本质上都是Lua编程语言的一个片段。有些纸上印着工作代码。Dynamicland 实际上可以对该代码执行 OCR 并实时运行它，但是通常，它在现实世界中象征性地使用这些代码，并在服务器端存储了自己的数字部分。然而，当一个对象发生变化时，该系统可以在打印出来的纸张上突出显示改变的线条，并能够标记与更新后的数字文件不同步的代码表。
  
  Dynamicland
Visit annotations in context

Tags

Dynamicland

Annotators

conanxin

URL

thenewstack.io/dynamicland-rethinks-computer-interfaces/
www.crummy.com www.crummy.com

Beautiful Soup Documentation — Beautiful Soup 4.4.0 documentation

1
1. OverflowCat 04 Feb 2021
  
  in Public
  
  A string corresponds to a bit of text within a tag. Beautiful Soup uses the NavigableString class to contain these bits of text
  
  soup = BeautifulSoup('<b class="boldest">Extremely bold</b>', 'html.parser') tag = soup.b tag.string # 'Extremely bold' type(tag.string) # <class 'bs4.element.NavigableString'>
Visit annotations in context

Annotators

OverflowCat

URL

crummy.com/software/BeautifulSoup/bs4/doc/

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL

Annotators

URL