PatientID: None

KindredID: 1

Case: M, 75Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: The patient's brother had hypertension at age 77 and was found to carry the mutation. The patient's niece had breast cancer at age 33. Refer to Figure 4 for Pedigree.

CasePresentingHPOs: HP:0006770, HP:0040276, HP:0006748, HP:0001407, HP:0002716, HP:0032618, HP:0100526, HP:0100598 (clear cell renal cell carcinoma, adenocarcinoma of the colon, adrenal pheochromocytoma, hepatic cysts, lymphadenopathy, renal necrosis, neoplasm of the lung, pulmonary edema)

CaseHPOFreeText: Patient admitted at age 64 for intermittent abdominal pain, loss of appetite and constipation. He was found to have a solid tumor with areas of colliquative necrosis in the upper pole of the left kidney. The scans also showed distension of the colon with concomitant wall thickening, indicating possible neoplasia. Colonoscopy revealed a small polyp in the rectum-sigmoid junction, and a subsequent histological exam confirmed a diagnosis of adenocarcinoma. Both tumours were removed via a left hemicolectomy and left radical nephrectomy. A histologic examination of the kidney revealed renal clear cell carcinoma. Five years later, an abdominal CT scan revealed an adrenal pheochromocytoma in the right adrenal gland and multiple hepatic cysts in the right kidney and liver. The patient underwent a right adrenalectomy which found no convincing evidence of malignancy. At age 73 total body positron emission tomography (PET)-CT revealed the presence of several metastatic sites (both lungs, a 12×10 mm right sovraclaveare lymphadenopathy, and a 32×12 mm lesions at the mediastinum). An agobiopsy and cytologic broncholavage showed lymphocytes and epithelial cells with voluminous clear cytoplasm and large nuclei with prominent nucleoli, confirming the presence of metastatic lesions of clear cell renal carcinoma. In the same year, CT imaging revealed progression of pulmonary disease. One year later, a new CT scan revealed hepatic metastases and worsening of the mediastinal adenopathy and pulmonary metastases. At age 75, a new CT scan showed stable disease at various metastatic sites with minimal pleural effusion. Later in the month the patient was hospitalized for severe dyspnea, fatigue, and lower limb edema and died a few days later.

CaseNotHPOs: HP:0009711 (retinal capillary hemangioma)

CaseNotHPOFreeText: Fundoscopy revealed no vascular abnormalities of the retina.

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.P25L (c.74C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 93330 https://www.ncbi.nlm.nih.gov/clinvar/variation/93330/

CAID: N/A

gnomAD: 0.002988 https://gnomad.broadinstitute.org/variant/3-10183605-C-T

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName:P25L (c.74C>T)

MultipleGeneVariants: N/A

PatientID: 30

KindredID: 20

Case: F, 26Y0M, Indian

DiseaseAssertion: VHL

FamilyInfo: Relevant family history but details are not made available.

CohortInfo: This retrospective study was conducted at Department of Endocrinology of a tertiary care health centre in Western India. Patients presented to our institute between 2008 and 2016 were included in the study. During the study period a total of 33 patients were suspected to have VHL syndrome based on clinical features among whom 31 patients were found to have mutation in VHL gene. All patients are of Asian Indian descent.

CasePresentingHPOs: HP:0002666; HP:0001737; HP:0005584, HP:0010797 (Pheochromocytoma, Pancreatic cysts, Retinal capillary hemangioma, Hemangioblastoma)

CaseHPOFreeText: Unilateral pheochromocytoma.

CaseNotHPOs: HP:0002668; HP:0009711; HP:0030405 (Paraganglioma, Renal cell carcinoma, Pancreatic endocrine tumor)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: Exon 1-3 Deletion (c.1-?_642+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 1-3 Deletion

MultipleGeneVariants: N/A

PatientID: II-1

KindredID: Family C

Case: M, 45Y0M, Ethnicity unknown

DiseaseAssertion: VHL

FamilyInfo: Only this one member was studied at have the L198P mutation, however the asymptomatic father of patient C II-1 was also a carrier of the same polymorphism (c.74C>T, p.P25L).

CasePresentingHPOs: HP:0006748; HP:0030405; HP:0009711 (Adrenal pheochromocytoma; pancreatic neuroendocrine tumour; retinal capillary hemangioma)

CaseHPOFreeText: At the age of 15, patient had pancreatic tumor (malignant pancreatic neuroendocrine tumor). At the age of 16, MRI revealed suprarenal tumor masses bilaterally (pheochromocytomas in the adrenal glands), as well as optic nerve hemangioblastomas of the right eye. At the age of 25, he shows no signs of metastases or new VHL-associated tumors, but since the age of 23, he has been suffering from HLAB27-positive ankylosing spondylitis.

CaseNotHPOs: HP:0005584; HP:0010797 (renal cell carcinoma; hemangioblastoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.P25L (c.74C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 93330 https://www.ncbi.nlm.nih.gov/clinvar/variation/93330/

CAID: N/A

gnomAD: 0.002988 https://gnomad.broadinstitute.org/variant/3-10183605-C-T

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: L198P (c.593T>C) AND P25L (c.74C>T)

MultipleGeneVariants: Germline, VHL, c.593T>C (p.Leu198Pro)

PatientID: None

KindredID: 1

Case: Sex Unknown, Age Unknown, Ethnicity Unknown

DiseaseAssertion: Adrenal pheochromocytoma

FamilyInfo: The proband was part of a cohort of apparently sporadic cases of pheochromocytoma/ paraganglioma, implying this individual had no family history of VHL disease or pheochromocytoma.

CasePresentingHPOs: HP:0006748 (Adrenal Pheochromocytoma)

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0002668 (Paraganglioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET, SDHB, SDHC, and SDHD

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.P25L (c.74C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 93330, https://www.ncbi.nlm.nih.gov/clinvar/variation/93330/

CAID: N/A

gnomAD: 0.002988, https://gnomad.broadinstitute.org/variant/3-10183605-C-T?dataset=gnomad_r2_1

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: P25L (c.74C>T)

MultipleGeneVariants: N/A

PatientID: 3

KindredID: 3

Case: 27Y0M, Sex Unknown, Argentinian

DiseaseAssertion: VHL

FamilyInfo: No family history

CasePresentingHPOs: HP:0010797; HP:0006770; HP:0001737; HP:0000107; HP:0030424 (hemangioblastoma; clear cell renal cell carcinoma; pancreatic cysts; renal cyst; epididymal cyst)

CaseHPOFreeText: Aged 20Y at diagnosis (genetic testing); fulfils type 1 VHL clinical diagnosis. CNS angiomas diagnosed at 20, 25, and 26Y, pancreatic, renal, and epididymal cysts diagnosed at 25Y, ccRCC diagnosed at 27Y. (See Table 1 & 2).

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.R161* (c.481C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2217 https://www.ncbi.nlm.nih.gov/clinvar/variation/2217/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: R161* (c.481C>T)

MultipleGeneVariants: N/A

PatientID: 12

KindredID: 2

Case: F, 25Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Patient has 2 siblings (patients 10 and 11) with the same mutation and pheochromocytoma.

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: Unilateral pheochromocytoma (30mm)

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: SDHB (NM_003000.2), SDHC (NM_003001.3), SDHD (NM_003002.2), SDHAF2 (NM_017841.2), RET (exons 10–11 and 13–16, NM_020975.4), TMEM127 (NM_017849.3), MAX (NM_002382.3).

PreviouslyPublished: N/A

SupplementalData: Table 2

Variant: p.R167W (c.499C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2218, https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T

VariantEvidence: Loss of heterozygosity could be detected in tumour DNA.

MutationType: missense_variant;transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

PatientID: IIII-6

KindredID: 1

Case: F, 44Y0M, Hungarian

DiseaseAssertion: Asymptomatic

FamilyInfo: The patient's mother (II-5) carried the Ser80Asn mutation and presented with renal cell carcinoma. The patient's siblings (III-7 and III-8) both carried the Ser80Asn mutation. Patient III-7 presented with hemangioblastoma of the brain and retina hemangioblastoma and her children carried the Ser80Asn mutation with clinical presentation. Patient III-8 presented with brain hemangioblastoma, pheochromocytoma, and retina hemangioma. The patient's maternal aunt (II-1) carried both Ser80Asn and Pro25Leu mutation but was asymptomatic. She passed on the Ser80Asn mutation to her daughter (III-1), the proband and this patient's cousin. Refer to figure 1 for pedigree.

CasePresentingHPOs: N/A

CaseHPOFreeText: N/A

CaseNotHPOs: HP:0005584, HP:0002666, HP:0010797, HP:0009711 (renal cell carcinoma, pheochromocytoma, hemangioblastoma, retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.P25L (c.74C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 93330 https://www.ncbi.nlm.nih.gov/clinvar/variation/93330/

CAID: CA020538 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.74C%3ET

gnomAD: 0.002988 https://gnomad.broadinstitute.org/variant/3-10183605-C-T

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName:P25L (c.74C>T)

MultipleGeneVariants: N/A

PatientID: 231

KindredID: 86

Case: M, 54Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 229) had a sister (patient 230) who was genetically confirmed with the mutation, and presented with a CNS hemangioblastoma at age 40. The proband's brother 1 (patient 231) was also confirmed with the mutation and had a retinal angioma at 25, and renal cell carcinoma at 54. The proband's brother 2 passed away before they could be diagnosed/ confirmed with the mutation, but they had a CNS hemangioblastoma at 35. Finally, the proband's nephew (son of brother 2) was genetically confirmed with the mutation and presented with renal cell carcinoma at age 30.

CasePresentingHPOs: HP:0009711; HP:0005584 (Retinal capillary hemangioma, Renal cell carcinoma)

CaseHPOFreeText: The proband's brother (patient 231) had a retinal angioma at 25 and renal cell carcinoma at 54.

CaseNotHPOs: HP:0010797; HP:0002666; HP:0001737; HP:0001732 (Hemangioblastoma, Pheochromocytoma, Pancreatic cysts, Abnormality of the pancreas)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.L178R (c.533T>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 625261, https://www.ncbi.nlm.nih.gov/clinvar/variation/625261/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: L178R (c.533T>G)

MultipleGeneVariants: N/A

PatientID: 239

KindredID: 91

Case: M, 25Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 239) has a sister (patient 240) who presented with multiple pancreatic cysts/tumors at 28.

CasePresentingHPOs: HP:0010797; HP:0009711 (Hemangioblastoma, Retinal capillary hemangioma)

CaseHPOFreeText: The proband presented with a retinal angioma at 14 and a CNS hemangioblastoma at 25.

CaseNotHPOs: HP:0001737; HP:0001732; HP:0005584; HP:0002666 (Pancreatic cysts, Abnormality of the pancreas, Renal cell carcinoma, Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: Exon 1 Deletion (c.1-?_340+?del)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: exon_loss_variant

CivicName: Exon 1 Deletion

MultipleGeneVariants: N/A

PatientID: 7

KindredID: 7

Case: F, 40Y0M, Ethnicity Unknown

DiseaseAssertion: Cerebellar Hemangioblastoma

FamilyInfo: N/A

CohortInfo: The cohort included a series of 20 capillary haemangioblastomas of the central nervous system for mutations of the VHL gene.

CasePresentingHPOs: HP:0006880 (cerebellar hemangioblastoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.P25L (c.74C>T)

LegacyVariant: p.P25L (c.287C>T)

CaseProblemVariantFreeText: N/A

ClinVarID: 93330 https://www.ncbi.nlm.nih.gov/clinvar/variation/93330/

CAID: N/A

gnomAD: 0.002988 https://gnomad.broadinstitute.org/variant/3-10183605-C-T

VariantEvidence: Refer to Table 1 for abnormal SSCP or heteroduplex patterns.

MutationType: missense_variant;transition

CivicName:P25L(c.74C>T)

MultipleGeneVariants: N/A

PatientID: IV:6

KindredID: 1

Case: F, Age Unknown, Ethnicity Unknown

DiseaseAssertion: Asymptomatic

FamilyInfo: The patient had two siblings both of whom carried the P25L mutation. One was asymptomatic (IV:4) whereas another (IV:2) presented with retinal hemangioma and renal cysts. Her cousin (IV:7) was diagnosed at the age of 47 years with renal cell carcinoma and subsequently died at the age of 48 years. Her great grandmother (I:2) had died of a brain tumor in her late 50s. Her grandfather (II:3) had a brain tumor at the age of 53 years and died aged 78 years. As well, her grandfather's sister (II,1) reportedly died of stomach cancer in her 80s. Of the 13 family members tested, V:2, IV:4, IV:6, III:2, III:3, and III:11 were all found to carry the P25L mutation in the VHL gene. Refer to Figure 1 for pedigree.

CasePresentingHPOs: N/A

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.P25L (c.74C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 93330 https://www.ncbi.nlm.nih.gov/clinvar/variation/93330/

CAID: N/A

gnomAD: 0.002988 https://gnomad.broadinstitute.org/variant/3-10183605-C-T

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName:P25L (c.74C>T)

MultipleGeneVariants: N/A

PatientID: III:11

KindredID: 1

Case: F, 75, Ethnicity Unknown

DiseaseAssertion: Asymptomatic

FamilyInfo: The patient's father (II:3) had a brain tumour at age 53 and died at age 78. The patient's paternal aunt (II:1) died of stomach cancer at age 80. The patient's paternal grandfather died at age 50 due to a brain tumour. The patient had seven siblings, five of whom underwent genetic testing. Two were found to carry the mutation but both were asymptomatic (patient III:2 and III:3). The patient's sister (III:2) had three children all of whom carried the P25L mutation and were asymptomatic (IV:4 and IV:6) except patient IV:2 who presented with a retinal hemangioma and renal cyst. Her niece, (IV:2) had three children and one was found to carry the mutation. The patient's brother (III:3) had six children one of whom died due to clear cell renal carcinoma at age 48 but did not carry the P25L mutation (IV:7). The patient had three unaffected children who did not carry the mutation. Of the 13 family members tested, V:2, IV:4, IV:6, III:3, and III:11 were all found to carry the P25L mutation in the VHL gene. Refer to Figure 1 for pedigree.

CasePresentingHPOs: N/A

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: Ongoing clinical follow up of the individuals with P25L over a period of 5 years has continued to show no evidence of additional clinical involvement of VHL disease.

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.P25L (c.74C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 93330 https://www.ncbi.nlm.nih.gov/clinvar/variation/93330/

CAID: N/A

gnomAD: 0.002988 https://gnomad.broadinstitute.org/variant/3-10183605-C-T

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName:P25L (c.74C>T)

MultipleGeneVariants: N/A

PatientID: III:2

KindredID: 1

Case: F, 62, Ethnicity Unknown

DiseaseAssertion: Asymptomatic

FamilyInfo: The patient's father (II:3) had a brain tumour at age 53 and died at age 78. The patient's paternal aunt (II:1) died of stomach cancer at age 80. The patient's paternal grandfather died at age 50 due to a brain tumour. The patient had three children all of whom carried the P25L mutation and were asymptomatic (IV:4 and IV:6) except patient IV:2 who presented with a retinal hemangioma and renal cyst. Her daughter (IV:2) had three children and one was found to carry the mutation. The patient had seven siblings, five of whom underwent genetic testing. Two were found to carry the mutation but both were asymptomatic (patient III:3 and III:11). Patient III:3 had six children one of whom died due to clear cell renal carcinoma at age 48 but did not carry the P25L mutation. Of the 13 family members tested, V:2, IV:4, IV:6, III:3, and III:11 were all found to carry the P25L mutation in the VHL gene. Refer to Figure 1 for pedigree.

CasePresentingHPOs: N/A

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.P25L (c.74C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 93330 https://www.ncbi.nlm.nih.gov/clinvar/variation/93330/

CAID: N/A

gnomAD: 0.002988 https://gnomad.broadinstitute.org/variant/3-10183605-C-T

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName:P25L (c.74C>T)

MultipleGeneVariants: N/A

PatientID: 1

KindredID: 1

Case: M, 68Y0M, Ethnicity unknown

DiseaseAssertion: VHL

FamilyInfo: None.

CasePresentingHPOs: HP:0002666; HP:0009711; HP:0000107 (pheochromocytoma, retinal capillary hemangioma, renal cyst)

CaseHPOFreeText: Patient was found observed to have retinal angioma (retinal capillary hemangioma) and a right kidney cortex cyst (30mm). Patient's pheochromocytoma was found incidentally and he remained asymptomatic with steady weight.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET, SDHB, SDHC and SDHD

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.P25L (c.74C>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 93330 https://www.ncbi.nlm.nih.gov/clinvar/variation/93330/

CAID: N/A

gnomAD: 0.002988 https://gnomad.broadinstitute.org/variant/3-10183605-C-T

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: P25L (c.74C>T)

MultipleGeneVariants: N/A

PatientID: 192

KindredID: 73

Case: F, 52Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband, patient 191, has a mother who was also found to have the same germline mutation. The proband's mother (patient 192) had a retinal angioma at 25, a CNS hemangioblastoma at 38, and multiple pancreatic cysts/tumors at 52.

CasePresentingHPOs: HP:0010797; HP:0009711; HP:0001737; HP:0001732 (Hemangioblastoma, Retinal capillary hemangioma, Pancreatic cysts, Abnormality of the pancreas)

CaseHPOFreeText: The patient presented with a CNS hemangioblastoma at 38, retinal angioma at 25, and multiple pancreatic cysts/tumors at 52.

CaseNotHPOs: HP:0005584; HP:0002666 (Renal cell carcinoma, Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in an earlier paper by Wang et al., 2014 (PMID 24581539) as well as a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.R167W (c.499C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2218; https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007954; https://gnomad.broadinstitute.org/variant/3-10191506-C-T?dataset=gnomad_r2_1

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

PatientID: 136

KindredID: 51

Case: M, 25Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 136) has a mother (patient 137) who presented with a CNS hemangioblastoma at 32, and renal cell carcinoma/ pheochromocytoma at 38. However, no DNA sample was available for his mother's genetic testing.

CasePresentingHPOs: HP:0010797, HP:0001737, HP:0001732, HP:0005584 (Hemangioblastoma, Pancreatic cysts, Abnormality of the pancreas, Renal cell carcinoma)

CaseHPOFreeText: The proband (patient 136) presented with multiple pancreatic cysts/tumors at 21, renal cell carcinoma at 23, and a CNS hemangioblastoma at 25.

CaseNotHPOs: HP:0002666; HP:0009711 (Pheochromocytoma, Retinal capillary hemangioma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.P146Gfs*14 (c.435_436ins)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: CA2573131810, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573131810

gnomAD: N/A

VariantEvidence: N/A

MutationType: plus_2_frameshift_variant

CivicName: P146Gfs*14 (c.435_436insGG)

MultipleGeneVariants: N/A

PatientID: 2

KindredID: 4

Case: F, 41Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CohortInfo: Thirteen patients with a supratentorial hemangioblastoma.

CasePresentingHPOs: HP:0010797 (hemangioblastoma)

CaseHPOFreeText: The patient had a right temporal hemangioblastoma at age 25. After surgery the patient was disease free. The patient was followed up 16 years later.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: Exon 2-3 Deletion

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType:exon_loss_variant

CivicName: Exon 2-3 Deletion

MultipleGeneVariants: N/A

PatientID: 6

KindredID: 4 (D)

Case: M, 25Y0M, Hungarian

DiseaseAssertion: VHL

FamilyInfo: Patient was the only available member of the family. His father had died several years ago due to a central nervous system tumour, probably a complication of VHL disease

CasePresentingHPOs: HP:0006880; HP:0009713; HP:0006770 (cerebellar hemangioblastoma, spinal hemangioblastoma, clear cell renal cell carcinoma)

CaseHPOFreeText: Cerebellar and spinal cord hemangioma diagnoses.

CaseNotHPOs: HP:0002666; HP:0009711 (pheochromocytoma, retinal capillary hemangioma)

CaseNotHPOFreeText: No other manifestations of VHL disease were detected. See table 1.

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.Y185* (c.555C>A)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVar: N/A

CAID: CA351756378 http://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/allele?hgvsOrDescriptor=NM_000551.3%3Ac.555C%3EA

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: T185* (c.555C>A)

MultipleGeneVariants: N/A

PatientID: None

KindredID: VHL12

Case: M, 25Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: N/A

CohortInfo: A total of 190 patients recruited by the COMETE network over 15 years were included in the study.

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: The patient had two benign pheochromocytomas.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: RET/SDHB/SDHC/SDHD

PreviouslyPublished: N/A

SupplementalData: Table 1 of Supplementary

Variant: p.R161Q (c.482G>A)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 182983, https://www.ncbi.nlm.nih.gov/clinvar/variation/182983/

CAID: N/A

gnomAD: N/A

VariantEvidence: The patient had LOH found in the BAC array CGH data.

MutationType: missense_variant;transition

CivicName: R161Q (c.482G>A)

MultipleGeneVariants: N/A

PatientID: N/A

KindredID: 7

Case: M, 58Y0M, Chinese

DiseaseAssertion: Assumed VHL

FamilyInfo: Patient had family history of VHL disease. Patient’s nephew presented with renal cell carcinoma at 30, patient's sister/brother presented with a hemangioblastoma at age 39 and then retinal capillary hemangioma, renal cell carcinoma, and abnormality of the pancreas at age 57. Patient’s sister presented with a hemangioblastoma at age 40. All three of these family members were genetically tested and possessed the same mutation. Patient’s other brother presented with a hemangioblastoma at age 35 but died before diagnosis and genetic testing.

CohortInfo: 16 Chinese patients clinically diagnosed with VHL disease.

CasePresentingHPOs: HP:0009711, HP:0005584 (retinal capillary hemangioma, renal cell carcinoma)

CaseHPOFreeText: Patient presented with retinal hemangioma at age 25 and renal cell carcinoma at age 54.

CaseNotHPOs: HP:0002666, HP:0030393, HP:0010797, HP:0001732 (pheochromocytoma, endolymphatic sac tumor, hemangioblastoma, abnormality of the pancreas)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.L178R (c.533T>G)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 625261, https://www.ncbi.nlm.nih.gov/clinvar/variation/625261/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant; transversion

CivicName: L178R (c.533T>G)

MultipleGeneVariants: N/A

GroupID: 27

Case: 45Y0M, Sex Unknown, Ethnicity Unknown

DiseaseAssertion: assumed VHL

FamilyInfo: 1 of the 573 patients discussed in this paper were found to have this variant. This mutation was found in 1 VHL family with a single patient.

CasePresentingHPOs: HP:0006880; HP:0005584 (cerebellar hemangioblastoma; renal cell carcinoma)

CaseHPOFreeText: patient had cerebellar hemangioblastoma diagnosed at 25Y, and RCC diagnosed at 45Y

CaseNotHPOs: HP:0009711; HP:0002666 (retinal capillary hemangioma; pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: Supplementary Table S1.

Variant: p.Q145* (c.433C>T) 

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 625249 https://www.ncbi.nlm.nih.gov/clinvar/variation/625249/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: Q145* (c.433C>T) 

MultipleGeneVariants: N/A

PatientID: RCC-23

KindredID: 1

Case: Sex and Age unknown, Italian

DiseaseAssertion: VHL

FamilyInfo: None

CasePresentingHPOs: HP:0006770 (Clear cell renal cell carcinoma)

CaseHPOFreeText: N/A

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.P25L (c.74C>T)

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: 93330 https://www.ncbi.nlm.nih.gov/clinvar/variation/93330/

CAID: N/A

gnomAD: 0.002988 https://gnomad.broadinstitute.org/variant/3-10183605-C-T

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: P25L (c.74C>T)

MultipleGeneVariants: N/A

PatientID: 2

KindredID: 19

Case: F, 33Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Positive. The patient's son was the proband (1) and carried the mutation but was asymptomatic. The proband's uncle (7) carried the mutation and presented with symptoms. The proband's cousin (9) and first cousin once removed (22) were also found to have the mutation but were asymptomatic.

CohortInfo: 20 unrelated VHL families from an ethnically diverse cohort containing both affected and unaffected individuals.

CasePresentingHPOs:HP:0010797, HP:0005584, HP:0001732, HP:0000077 (hemangioblastoma, renal cell carcinoma, abnormality of the pancreas, abnormality of the kidney)

CaseHPOFreeText: The patient presented with a hemangioblastoma at ages 17, 24, 30. At age 25 she presented with renal cell carcinoma and abnormalities of the kidney and pancreas.

CaseNotHPOs: HP:0009711, HP:0002666 (retinal capillary hemangioma, pheochromocytoma )

CaseNotHPOFreeText: The patient did not have epididymal or ovarian cysts.

CasePreviousTesting: N/A

PreviouslyPublished: 31368132

SupplementalData: Supplementary file 1.

Variant: p.W88* (c.263G>A)

LegacyVariant: p.W88* (c.476G>A)

CaseProblemVariantFreeText: N/A

ClinVarID: 182978 https://www.ncbi.nlm.nih.gov/clinvar/variation/182978/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: stop_gained

CivicName: W88* (c.263G>A)

MultipleGeneVariants: N/A

PatientID: 83 (Cousin)

KindredID: 18

Case: F, 50Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: 11 members of this family tested positive for the c.712C>T/c.499C>T germline variant of the VHL gene. 14 members of this family were assumed to carry this variant due to family history/personal medical history. Members of this family range from asymptomatic to multi-organ involvement (pheochromocytoma, pancreatic and renal cysts/tumors and hemangioblastomas). The family was previously reported in PMID 3942913.

CasePresentingHPOs: HP:0010797; HP:0009711; HP:0001732 (Hemangioblastoma, Retinal capillary hemangioma, Abnormality of the pancreas)

CaseHPOFreeText: This patient presented with CNS hemangioblastoma (25Y), retinal angioma (16Y) and pancreatic tumors or cysts (undefined) (22Y).

CaseNotHPOs: HP:0005584; HP:0000077; HP:0002666 (Renal cell carcinoma, Abnormality of the kidney, Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 3942913 (some members of this family are previously reported (phenotypes only) but unable to match patients across papers with confidence)

SupplementalData: Supplementary Table 1.

Variant: p.R167W (c.499C>T)

LegacyVariant: c.712C>T

CaseProblemVariantFreeText: N/A

ClinVarID: 2218, https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T?dataset=gnomad_r2_1

VariantEvidence: A point mutation (c.712C>T) was found. Being that this variant is out of bound with respect to the NM_000551.3 reference sequence, it was concluded that this variant is noted in the Latif et al. (1993) reference and was translated to c.499C>T (NM_000551.3).

MutationType: missense_variant;transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

PatientID: 127

KindredID: 47

Case: F, 28Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: N/A

CasePresentingHPOs: HP:0010797; HP:0005584; HP:0001737; HP:0001732; HP:0009711 (Hemangioblastoma, Renal cell carcinoma, Pancreatic cysts, Abnormality of the pancreas, Retinal capillary hemangioma)

CaseHPOFreeText: The proband presented at age 25 with a CNS hemangioblastoma, retinal angioma, and renal cell carcinoma, and presented with multiple pancreatic cysts/tumors at age 28.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This kindred was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.E134_V142del (c.402_428del)

LegacyVariant: N/A

CaseProblemVariantFreeText: Variant listed in the paper as c.402-428delATTATTTGTGCCATCTCTCAATGTTGA, p.Glu134Aspfs*72. Listed protein change does not match deletion. Deletion is in-frame and should not lead to a frame shift. Variant updated in this annotation based on protein change listed in ClinGen/ listed on Variant Validator for c.402-428del.

ClinVarID: N/A

CAID: CA2573320387, https://reg.clinicalgenome.org/redmine/projects/registry/genboree_registry/by_caid?caid=CA2573320387

gnomAD: N/A

VariantEvidence: N/A

MutationType: inframe_deletion

CivicName: E134_V142del (c.402_428del)

MultipleGeneVariants: N/A

PatientID: 200

KindredID: 77

Case: F, 25Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 200) has six family members who passed away before diagnosis/ had no DNA sample available. Of the family who passed away before diagnosis: the proband's aunt 1 (patient 202) had a CNS hemangioblastoma at 27; the daughter of aunt 1 (patient 203) had a pheochromocytoma at 31; aunt 2 (patient 205) had a CNS hemangioblastoma at 43, renal cell carcinoma at 36, and multiple pancreatic cysts/tumors at 48. Of the family for whom no DNA sample was available: the proband's mother (patient 201) had a CNS hemangioblastoma at 51, multiple pancreatic cysts/tumors at 46, and a pheochromocytoma at 25; the grandson of aunt 1 (patient 204) had a pheochromocytoma at age 9; and the son of aunt 2 (patient 206) had a pheochromocytoma at 16 and renal cell carcinoma + multiple pancreatic cysts/tumors at 21.

CasePresentingHPOs: HP:0010797 (Hemangioblastoma)

CaseHPOFreeText: The patient presented with a pheochromocytoma and renal cell carcinoma at 36.

CaseNotHPOs: HP:0009711; HP:0001737; HP:0001732; HP:0002666; HP:0005584 (Retinal capillary hemangioma, Pancreatic cysts, Abnormality of the pancreas, Pheochromocytoma, Renal cell carcinoma )

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.R167W (c.499C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2218; https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007954; https://gnomad.broadinstitute.org/variant/3-10191506-C-T?dataset=gnomad_r2_1

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

PatientID: 60

KindredID: 23

Case: M, 30Y0M, Chinese

DiseaseAssertion: VHL

FamilyInfo: The proband (patient 23) had three family members genetically confirmed with the mutation: his son/ patient 61 (asymptomatic at time of assessment), his daughter/ patient 62 (asymptomatic at time of assessment), and his cousin/ the son of his Aunt 3/ patient 68 (CNS hemangioblastoma at 26). The proband also had 5 family members who passed away before they could be confirmed with the mutation: his father/patient 63 (CNS hemangioblastoma at 35, retinal angioma at 35); his sister/ patient 64 (CNS hemangioblastoma at 24 and multiple pancreatic cysts/tumors at 31); his aunt 1/ patient 65 had a CNS hemangioblastoma at 35; his aunt 2/ patient 66 had a CNS hemangioblastoma at 20; and his aunt 3/ patient 67 had a CNS hemangioblastoma at 44.

CasePresentingHPOs: HP:0001732; HP:0001737 HP:0010797; HP:0009711; HP:0005584 (Abnormality of the pancreas, Pancreatic cysts, Hemangioblastoma, Retinal capillary hemangioma, Renal cell carcinoma)

CaseHPOFreeText: The proband presented with CNS hemangioblastoma and retinal angioma at 25, renal cell carcinoma and multiple pancreatic cysts/tumors at 30.

CaseNotHPOs: HP:0002666 (Pheochromocytoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: This patient was also published in a later paper by Wang et al., 2018 (PMID: 29330336).

SupplementalData: Patient and family genotype-phenotype information is listed in Supplementary Table 1.

Variant: p.W88S (c.263G>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2220; https://www.ncbi.nlm.nih.gov/clinvar/variation/2220/?new_evidence=true

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: W88S (c.263G>C)

MultipleGeneVariants: N/A

PatientID: 1 (case)

KindredID: 1

Case: F, 25Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Not significant - the paper states that the parents and siblings were negative for the mutation (indicating de novo).

CasePresentingHPOs: HP:0002666; HP:0009711; HP:0000479; HP:0012045 (pheochromocytoma, retinal capillary hemangioma, abnormal retinal morphology, retinal flecks)

CaseHPOFreeText: patient was referred for eye exam as part of a VHL screening program at 25Y. She has been diagnosed with bilateral pheochromocytoma at the age of 14 after an episode of acute hypertensive encephalopathy. Ophthalmoscopy disclosed in her right eye a small retinal hemangioma (1 disc diameter wide) along with feeder vessels in the mid-periphery and multiple, small, whitish, dome-shaped lesions scattered in the deeper layers of the posterior retina. Fluorescein and indocyanine green angiography confirmed the presence of the retinal hemangioma; multiple window-defects were also seen at the posterior pole and pericentral retina and hypofluorescent dots. (Unusual alterations of the deep retinal layers).

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.T157I (c.470C>T)

LegacyVariant: p.T157I (c.683C>T)

CaseProblemVariantFreeText: N/A

ClinVarID: 223223 https://www.ncbi.nlm.nih.gov/clinvar/variation/223223/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: T157I (c.470C>T)

MultipleGeneVariants: N/A

PatientID: II:7

KindredID: 1

Case: M, Age Unknown, Jewish

DiseaseAssertion: VHL

FamilyInfo: This kindred of Jewish-Kurdish origin consisted of 3 generations of 25 members. 7 were clinically affected subjects with pheochromocytoma (5 of which had the confirmed mutation - I:1, II:2, II:4, II:7 and II:9, as the other 2, II:5 and II:10 were said to have passed due to complications of the disease - prior to any genetic testing), and 4 others were carriers, or pre-symptomatic (III:1, III:3, III:7 and III:12). Subject 11:7 developed a cerebellar hemangioblastoma 25 yr after his initial diagnosis of pheochromocytoma, leading to the clinical diagnosis of VHL in the kindred.

CasePresentingHPOs: HP:0002666; HP:0006880; HP:0030074 (pheochromocytoma, cerebellar hemangiolastoma, chemodectoma)

CaseHPOFreeText: patient had cerebellar HB at 25Y, after his initial diagnosis with bilateral pheochromocytoma, and then also extra-adrenal chromafin tumors (carotid body chemodectoma).

CaseNotHPOs: HP:0005584 (renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 33471715

SupplementalData: N/A

Variant: p.V166F (c.496G>T)

LegacyVariant: p.V166F (c.709G>T)

CaseProblemVariantFreeText: N/A

ClinVarID: 2224, https://www.ncbi.nlm.nih.gov/clinvar/variation/2224/

CAID: N/A

VariantEvidence: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: V166F (c.496G>T)

MultipleGeneVariants: N/A

GroupID/ KindredID: 28

PatientID: I

Case: 27Y0M, Sex unknown, Polish

DiseaseAssertion: VHL

FamilyInfo: Family 28 consisted of 4 members; one relative (age 24Y) diagnosed with a single cerebellar HAB, another (40Y) diagnosed at 30Y with multiple cerebellar HABs, and multiple spinal HABs, and a final relative (62Y), diagnosed with a single HAB.

CasePresentingHPOs: HP:0009713; HP:0006880 (spinal hemangioblastoma, cerebellar hemangioblastoma)

CaseHPOFreeText: Patient was found with multiple cerebellar HABs at 25Y, and multiple spinal HABs

GroupNotHPOs: HP:0009711; HP:0005584 (retinal capillary hemangioma; renal cell carcinoma)

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: complete deletion of VHL gene

CaseProblemVariantFreeText: N/A

LegacyVariant: N/A

ClinVarID: N/A

CAID: N/A

gnomAD: N/A

VariantEvidence: Haplotype analysis information in Table 3

MutationType: deletion

CivicName: deletion

MultipleGeneVariants: N/A

GroupID: 6B

DiseaseAssertion: assumed VHL

GroupSize: 9

GroupNumberMales: N/A

GroupNumberFemales: N/A

GroupEthnicity: Chinese

GroupAgeRange: 33.8Y +/- 17.6Y

GroupInfo: Clinical characteristics of 258 patients from 80 unrelated Chinese families were reported in this study. Grouped by the 21 mutations found, 3 families with 13 members total were described. it is unclear how many distinct families are reported in group 6B. 9 individuals were described. Phenotypic information was given for this mutation.

GroupPresentingHPOs: HP:0010797; HP:0009711; HP:0005584; HP:0001737; HP:0009715 (hemangioblastoma, retinal capillary hemangioma, renal cell carcinoma, pancreatic cysts, papillary cystadenoma of the epididymis)

GroupHPOFreeText: 7 of the 9 members presented with CNS hemangioblastoma (mean age of 29.9Y), 2/9 had retinal angiomas at 25Y and 35Y, 1 had renal cell carcinoma (at 30Y), pancreatic cysts in 2 members (with an age of onset of 30 and 31Y), and 1 member with a genital system tumor (epididymis or broad ligament) at 24Y

GroupNotHPOs: HP:0002666 (pheochromocytoma)

GroupNotHPOFreeText: No patients were given with pheochromocytoma

GroupPreviousTesting: N/A

PreviouslyPublished: 29330336; 28388566

SupplementalData: N/A

Variant: p.W88S (c.263G>C)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2220, https://www.ncbi.nlm.nih.gov/clinvar/variation/2220/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: W88S (c.263G>C)

MultipleGeneVariants: N/A

PatientID: 1

KindredID: 1

Case: F, 47Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: No family history.

CasePresentingHPOs: HP:0006880; HP:0002894; HP:0005584 (Cerebellar Hemangioblastoma; neoplasm of the pancreas; renal cell carcinoma)

CaseHPOFreeText: At 35-year old, the female patient was diagnosed with VHL due to clinical presentation of pancreatic serous cystic neoplasm and renal cell carcinoma, and cerebellar hemangioblastomas that were surgically removed at age 21. The patient had underwent total pancreatectomy and right nephrectomy for pancreatic serous cystic neoplasm (SCN) and renal cell carcinoma (RCC), respectively. 4 years later, tumors in the liver were detected by CT scan and radiographically diagnosed as metasta-ses of the pancreatic SCN or RCC. Again, morphology and immunohistochemical findings of the resected tumors again were similar to the primary pancreatic SCN, thus diagnosed as multiple metachronous liver metastases of pancreatic SCN. As of 47Y, the patient has remained disease-free without any recurrence after the third operation.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: 21673464

SupplementalData: N/A

Variant: p.N78I (c.233A>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 223169 https://www.ncbi.nlm.nih.gov/clinvar/variation/223169/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transition

CivicName: N78I (c.233A>T)

MultipleGeneVariants: N/A

PatientID: 10

KindredID: 2

Case: F, 25Y0M, Ethnicity Unknown

DiseaseAssertion: VHL

FamilyInfo: Patient has 2 siblings (patients 11 and 12) with the same mutation and pheochromocytoma.

CasePresentingHPOs: HP:0002666 (Pheochromocytoma)

CaseHPOFreeText: Bilateral pheochromocytomas (60mm and 40mm)

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: SDHB (NM_003000.2), SDHC (NM_003001.3), SDHD (NM_003002.2), SDHAF2 (NM_017841.2), RET (exons 10–11 and 13–16, NM_020975.4), TMEM127 (NM_017849.3), MAX (NM_002382.3).

PreviouslyPublished: N/A

SupplementalData: Table 2

Variant: p.R167W (c.499C>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2218, https://www.ncbi.nlm.nih.gov/clinvar/variation/2218/

CAID: N/A

gnomAD: 0.000007954, https://gnomad.broadinstitute.org/variant/3-10191506-C-T

VariantEvidence: SNParray analysis of tumour DNA did not show LOH at any locus.

MutationType: missense_variant;transition

CivicName: R167W (c.499C>T)

MultipleGeneVariants: N/A

PatientID: VHL_2 (tumor ID)

KindredID: 2

Case: M, 25Y0M, Ethnicity Unknown

DiseaseAssertion: Adrenal pheochromocytoma

FamilyInfo: N/A

CasePresentingHPOs: HP:0006748 (Adrenal pheochromocytoma)

CaseHPOFreeText: The patient had a benign adrenal pheochromocytoma at 25Y.

CaseNotHPOs: N/A

CaseNotHPOFreeText: N/A

CasePreviousTesting: N/A

PreviouslyPublished: N/A

SupplementalData: N/A

Variant: p.V84L (c.250G>T)

LegacyVariant: N/A

CaseProblemVariantFreeText: N/A

ClinVarID: 2236, https://www.ncbi.nlm.nih.gov/clinvar/variation/2236/

CAID: N/A

gnomAD: N/A

VariantEvidence: N/A

MutationType: missense_variant;transversion

CivicName: V84L (c.250G>T)

MultipleGeneVariants: N/A

https://youtu.be/0ajIPRy_yc0?si=tBJjJNjg5tnlR9oW&t=1504

For whoever has will be given more, and they will have an abundance. Whoever does not have, even what they have will be taken from them.

【洞察】在关系类对话中，Claude 的迎合率高达 25%——四分之一的回答在「讨好」用户而非提供真实建议。这是 AI 对齐最隐蔽的失效形式：模型没有产生任何有害内容，却系统性地强化了用户可能错误的决策。Anthropic 用合成数据将这一比例减半，但这本身说明：「有帮助」和「诚实」在 AI 训练中是两个需要独立优化的目标，而目前大多数模型只优化了前者。

The Discovery of a Professional Tradition:  Herbert and Lou Hoover’s Translation of De Re Metallica<br /> by Thomas F. Schwartz for [[Herbert Hoover Library and Museum]] blog Hoover Heads<br /> accessed on 2026-03-07T10:03:11

https://shopgoodwill.com/item/256505880

Previously bid up to $196 and abandoned: https://shopgoodwill.com/item/254909011

Looks like Remington Cubic 12 Pitch

Klaus Taschwe im Standard zur Arbeit des Hartland Instituts punkt das Institut hat jetzt in London eine Diplonore aufgemacht. Komma die von einer früheren Vorsitzenden der Antibrexipathal-Yukip geleitet wird. Es versucht in enger Kooperation mit der FPÖ den Europien Drain Deal abzusprechen bzw. zu blockieren. Das Institut gehört zum Aufdraggebern des sogenannten Project 2025-Kommar, dem Drehbuch für das Vorgehen der Tram-Administration gegen bisherige Regierungsinstitutionen vor allem In Bereichen wie Wissenschaft und Diversität https://www.derstandard.at/story/3000000254264/us-lobby-der-klimawandelleugner-dank-fpoe-weiter-auf-dem-vormarsch-in-europa

he uses knowledge to make her feel inferior, rather than treating her as an equal.

I’m surprised that even though she dislikes him, she still respects that he reads poetry, which changes how she sees him.

I find this interesting because it humorously suggests that literature can be used as a tool for seduction.

She has the thoughts that she wants to give up but has the world is holding her.

She the readers perspective to ask why she started writing.

Though this sentence is a little bit related to the book title, why her username is CrazyIndian? Is it indicates the scene, or is it a simple meaning?

He keep asking for respect, but nobody listens to him. People ignore him and act like he doesn’t exist, which shows how lonely and powerless he feels.

Corliss loves her mother, but her mother often tells lies or exaggerates because of her bipolar disorder. Since these stories usually make Corliss look good, she can’t really hate them.

Corliss suddenly feels guilty when she realizes she has never thought about the forgotten books in the library.

This sentence illustrates how Corliss elevates literature to a near-religious status. It reveals her tendency to surrender critical judgment when she admires a writer. It also shows how her passion for reading can blur into blind devotion.

This sentence shows how highly Harlan values his own work. It suggests a desire to prove his cultural legitimacy. It also hints that his idea of authenticity may be shaped more by ego than community tradition.

This passage is interesting because Corliss feels a deep emotional connection to the poet simply because she has shared the same physical landscape. The moment she calls her mother brings the scene back to everyday reality and contrasts her idealistic excitement with her mother’s practical view of identity.

for - stats - US economy - 25% is gig economy

for - definition - city - a geographic area with - at least 50,000 inhabitants - an average population density of 1,500 people/square kilometer - stats - 25% of people live in towns - 48 % of people live in cities - 25% of people live in villages - towns and cities

• according to this new definition, which standardizes the definition of city that has, hitherto been quite varied, 48% of humanity lives in cities (2015)

for - adjacency - hologram metaphor - infinite intelligence - Jesus - Mathew 25 - Donald Hoffman - Interfaith - Ubuntu - I am because you are - I am you and you are me

DOI: 10.1016/j.devcel.2025.07.011

Resource: None

Curator: @areedewitt04

SciCrunch record: RRID:ZFIN_ZDB-ALT-120613-25

What is this?

Portable Typewriters Today - February 2015<br /> by [[Will Davis]] on 2015-02-10<br /> accessed on 2025-08-05T16:35:48

https://www.neighborhoodarchive.com/mrn/episodes/1083/index.html

for - stats - CDC - underaged American children who have been molested - 50 million / year - 5 % boys - 25% girls

use thier old by price/cheaper than/bus slow successful/not expand enough/hope change good planing đắt hơn nhiều so với taxi grow quickly/shame

https://taz.de/CDU-diskutiert-Nord-Stream-Pipeline/!6074813/

Im ersten Quartal 2025 übertraf die installierte Kapazität von Wind- und Solarenergie in China erstmals die von Kohlekraftwerken, mit 1,482 Milliarden Kilowatt gegenüber 1,451 Milliarden Kilowatt. China hat 2024 weltweit 357 Gigawatt neue erneuerbare Energien installiert, zehnmal mehr als die USA. Bis 2030 plant China, 1.200 Gigawatt erneuerbare Energien zu installieren, um bis 2060 klimaneutral zu werden.

[Zusammenfassung mit Mistral generiert]

https://www.repubblica.it/economia/2025/04/25/news/cina_rinnovabili_trump_carbone_energia_terre_rare-424148525/

https://www.liberation.fr/politique/le-rn-pousse-pour-un-debat-sur-la-planification-energetique-et-fait-planer-la-censure-20250325_B5QMT5QHYJDL7OZDV3UJEMP4BM/

https://www.liberation.fr/environnement/environnement-en-france-un-organe-democratique-incontournable-sacrifie-sur-lautel-de-la-simplification-20250325_VKSZHAXJENF7HJCNWN4OCRDHGQ/

https://www.repubblica.it/green-and-blue/2025/03/25/news/venezia_a_rischio_inondazioni_estreme_entro_il_2150-424084945/

In Ihrem Global Energy Review 2025 steht die EAA einen re Commissionen zuwachs im Verbrauch und Produktion von Elektrozytet fest. Dieser Zufachs geht allerdings nur in ganz kleinen Teilen auf den Ersatzforsilerenergien zurück und ist im Wesentlichen durch zunehmenden Energieverbrauch bedingt, z.B. durch Datencenter. Durch diesen Zuwachs steigt der Verbrauch, steigt der Bedarf an bestimmten Mitte um Mineralien ebenfalls sprunghaft an. Der Chef der Ehea geht davon aus, dass um 20-30 Gruppen verknab werden wird. Der Kommentar der Tat weiß deshalb darauf hin, dass die Dekabonisierung durch den Umstieg auf erneuerbare Energien ohne Reduzierung des Verbrauchs nicht gelingen wird. https://taz.de/Die-Tuecken-der-Energiewende/!6074719/

Yet thou triumph’st, and say'st that thou <br /> Find’st not thy self, nor me the weaker now;

In line 26, the listener explains how they feel no guilt, and there is no consequence from taking the flea's life as it took both their blood.

Die Redaktion von Nature verurteilt die Angriffe der Trump-Regierung auf die Wissenschaft und fordert die internationale wissenschaftliche Community auf die bedrohte US-Wissenschaft zu unterstützen. Die US-Regierung arbeite an der Zerstörung der bisher führenden Rolle der amerikanischen wissenschaftlichen Institutionen. https://www.nature.com/articles/d41586-025-00562-w

> for - stats - addiction - tobacco - average duration - 25 years

The Tale of Culhwch and Olwen by [[Robin Williamson]]

Magnus Maximus

Mabinogion by [[Will Parker]]

https://www.theguardian.com/business/2025/jan/25/the-oil-crisis-fuelled-by-russias-war-is-evaporating-and-so-are-the-profits

Michael Harvey https://www.youtube.com/@michaelharveystoryteller8003/videos

Has a version of How Culhwch won Owen

Das EU-Parlament hat einer Aufweichung der wichtigsten Bestimmungen zum Schutz der Biodiversität als Voraussetzung für Agrarsubventionen zugestimmt. Greenpeace bezeichnet die Entscheidung als schockierend. 13% der in Deutschland imitierten Treibhausgase stammen laut Umweltbundesamt aus der Landwirtschaft. https://taz.de/Rollback-bei-EU-Agrarsubventionen/!6003674/

Kurze Darstellung der ersten Maßnahmen gegen Dekarbonisierung und zur Förderung der Öl- und Gasindustrie, die von der Trump-Administration zu erwarten sind. https://www.nytimes.com/2024/11/25/briefing/donald-trump- climate-policies.html

Erklär-Artikel im Guardian über Carbon Dioxide Removal (CDR) und Carbon Capture and Storage (CCS). Bei der Verabschiedung der Summary for Policy Makers des letzten Teils des AR6 haben sich vor allem Vertreter Saudi-Arabiens dafür eingesetzt, Hinweise auf CDR und CCS aufzunehmen und Hinweise auf erneuerbare Energien zu streichen. https://www.theguardian.com/environment/2023/apr/25/carbon-dioxide-removal-tech-polarising-climate-science

Find out more! Who was Grigory Shelekhov? Where is Three Saints Bay?

Cite your source(s)!

Drei Klimawissenschaftlerinnen wehren sich in einem Kommentar in Nature gegen den Vorwurf, sie betrieben keine objektive Wissenschaft, weil sie ihren Schmerz angesichts der fortschreitenden Klimakrise offen kommunizieren. Gefühle seien Teil der Realität und dürften von Forschenden nicht unterdrückt werden. Gefühle auszuschließen werde vor allem von Privilegierten zur Norm erklärt, die den Folgen der Klimakrise kaum ausgesetzt seien https://www.theguardian.com/environment/2024/oct/25/we-have-emotions-too-climate-scientists-respond-to-attacks-on-objectivity

Nature-Artikel: https://www.nature.com/articles/s41558-024-02139-3

1:25:22 First comes an AGREEMENT by members of the neighbourhood to co-operate and then they agree to use a mechanism called money to mobilise resources

https://x.com/david_perell/status/1838425252772077636 via David Perell's podcast.

Sam Altman's note taking process. Pocket notebook, spiral bound so he can tear out pages. No real mention of what he does with them after though a suggestion of typing them out somewhere.

https://pages.gseis.ucla.edu/faculty/agre/notes/99-3-14.html

Certainly an early example of blogging here... diary, ideas, even a link blog at the bottom

via u/runrainsky at https://old.reddit.com/r/mechanicalpencils/comments/u7pt8z/kuru_toga_elite_vs_roulette/jhvzka9/

https://metagov.org/projects/koi-pond

Metagov's KOI (Knowledge Organization Infrastructure) is a graph database that supports relationships between knowledge objects, users, and groups within Metagov. via JM

for - stats - digital decay - 25% of webpages that existed from 2013 to 2023 no longer exist as of Oct 2023

stats - digital decay - A quarter of all webpages that existed at one point between 2013 and 2023 are no longer accessible as of October 2023

for - stats - earth system boundary - biodiversity - human modified ecosystems - minimum of 20 to 25% natural / semi-natural habitat per square kilometer