This is a very detailed piece of imagery of air, which is something that is literally all around us. Somehow Mansfield makes such a common thing like air seem beautiful and dainty yet warm.

how to run wsl2 together with virtualbox . .. switching with boot profile

activate my venv 'playground' and do it, it works! Note! when activating 'playground' the current directory is not necessary at 'playground', I guess . . . YES!!

This does not CD to the myenv directory:

照這篇做，很簡單，開個 working directory "playground" and make it the current directory. 用 python -m venv playground 在當前 current directory 處建立 venv. 從此，.\script\activate.bat , .\script\deactivate.bat 就可以切換本 directory to be or not to be the activated environment 了。

SciScore for 10.1101/2020.03.24.20042606: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

Table 2: Resources

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore is not a substitute for expert review. SciScore checks for the presence and correctness of RRIDs (research resource identifiers) in the manuscript, and detects sentences that appear to be missing RRIDs. SciScore also checks to make sure that rigor criteria are addressed by authors. It does this by detecting sentences that discuss criteria such as blinding or power analysis. SciScore does not guarantee that the rigor criteria that it detects are appropriate for the particular study. Instead it assists authors, editors, and reviewers by drawing attention to sections of the manuscript that contain or should contain various rigor criteria and key resources. For details on the results shown here, including references cited, please follow this link.

SciScore for 10.1101/2020.03.10.985499: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

Table 2: Resources

Results from OddPub: We did not detect open data. We also did not detect open code. Researchers are encouraged to share open data when possible (see Nature blog).

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore is not a substitute for expert review. SciScore checks for the presence and correctness of RRIDs (research resource identifiers) in the manuscript, and detects sentences that appear to be missing RRIDs. SciScore also checks to make sure that rigor criteria are addressed by authors. It does this by detecting sentences that discuss criteria such as blinding or power analysis. SciScore does not guarantee that the rigor criteria that it detects are appropriate for the particular study. Instead it assists authors, editors, and reviewers by drawing attention to sections of the manuscript that contain or should contain various rigor criteria and key resources. For details on the results shown here, including references cited, please follow this link.

An analysis of physical conditions would most likely be necessary at any location where an energy storage system is to be installed. This could be an example of a barrier to the transition to green energy, because this type of analysis will take time and money.

This is a pretty good definition (?, or at least example) of what agency is.

Let's just say it's required by the standard, not because of some implementation detail.

Only true for BMP

Unmetered VPS Hosting with Unlimited Bandwidth 1GBPS

Cheap Windows Plesk Hosting plans with plesk control panel - Buy chaep budget windows hosting at $4.95 per month. Create your web hosting plans today.

While reading through Franklin's suggestion on how the Indians had stolen it, I too thought that it was very far fetched. With Betteredge's context about the locked doors and dogs, I agree with him that Franklin's explanation doesn't reallly make any sense. This probably means that the thief is from within the household!

I like the phrase "permeability of that container". It's an interesting way to look at how a leaner would make use of the LMS and what kind of learning they're exposed to.

This seems like an interesting point/claim. How could reconstructions of Greek temples for two centuries be unsubstantiated by any archaeological or historical evidence. How could the presence of windows be overlooked? Why would research of Greek temples be influenced by research on Egyptian temples in the first place? This seems like something that I should mention in the analysis.

MORE BIG MONEY: explicitly on the attacks of public spaces, what public spaces represent and how they are administered over.

Two captured ravens, if released, fly out the windows to join the ravens outside.

The narrator is filled with fear. Does it have to do with how her father died?

in short, gun control is always on the table as a deterrent of crime, it's these "windows" that policy-makers step into for increased policy-passing efficacy.

SciScore for 10.1101/2020.05.04.20090076: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

Table 2: Resources

Results from Barzooka: We also found bar graphs of continuous data. We recommend replacing bar graphs with more informative graphics, as many different datasets can lead to the same bar graph. The actual data may suggest different conclusions from the summary statistics. For more information, please see Weissgerber et al (2015).

Results from OddPub: We did not find a statement about open data. We also did not find a statement about open code. Researchers are encouraged to share open data when possible (see Nature blog).

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore is not a substitute for expert review. SciScore checks for the presence and correctness of RRIDs (research resource identifiers) in the manuscript, and detects sentences that appear to be missing RRIDs. SciScore also checks to make sure that rigor criteria are addressed by authors. It does this by detecting sentences that discuss criteria such as blinding or power analysis. SciScore does not guarantee that the rigor criteria that it detects are appropriate for the particular study. Instead it assists authors, editors, and reviewers by drawing attention to sections of the manuscript that contain or should contain various rigor criteria and key resources. For details on the results shown here, including references cited, please follow this link.

SciScore for 10.1101/2020.04.24.20072611: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

Table 2: Resources

Results from OddPub: We did not find a statement about open data. We also did not find a statement about open code. Researchers are encouraged to share open data when possible (see Nature blog).

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore is not a substitute for expert review. SciScore checks for the presence and correctness of RRIDs (research resource identifiers) in the manuscript, and detects sentences that appear to be missing RRIDs. SciScore also checks to make sure that rigor criteria are addressed by authors. It does this by detecting sentences that discuss criteria such as blinding or power analysis. SciScore does not guarantee that the rigor criteria that it detects are appropriate for the particular study. Instead it assists authors, editors, and reviewers by drawing attention to sections of the manuscript that contain or should contain various rigor criteria and key resources. For details on the results shown here, please follow this link.

SciScore for 10.1101/2020.04.21.20064147: (What is this?)

Please note, not all rigor criteria are appropriate for all manuscripts.

Table 1: Rigor

Table 2: Resources

Results from OddPub: We did not find a statement about open data. We also did not find a statement about open code. Researchers are encouraged to share open data when possible (see Nature blog).

About SciScore

SciScore is an automated tool that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. SciScore is not a substitute for expert review. SciScore checks for the presence and correctness of RRIDs (research resource identifiers) in the manuscript, and detects sentences that appear to be missing RRIDs. SciScore also checks to make sure that rigor criteria are addressed by authors. It does this by detecting sentences that discuss criteria such as blinding or power analysis. SciScore does not guarantee that the rigor criteria that it detects are appropriate for the particular study. Instead it assists authors, editors, and reviewers by drawing attention to sections of the manuscript that contain or should contain various rigor criteria and key resources. For details on the results shown here, please follow this link.

GetProcessHeap函数

GetStdHandle函数

ExitProcess函数

HeapAlloc函数

StringCchPrintf函数

TCHAR笔记

Historical garbage should be removed.

This whole thing would be greatly simplified just by writing out the valid combinations. Macintosh font? These are the values you need. Windows font? Choose from one of these.

Alan Kay did not just predict the future by inventing it but had a blue print for it half a century ago. Had a tablet been built with this designwould have given as a 1000 fold cheaper/more capable device than the iPad by now and would have got to places he could not predict.

Vow to make money and be rich from what he does by playing people and lying to them. He doesn't care where the money will come from. it could be from the poorest people in the church or the poor windows even if the children die of famine.

This really resonated with me as a kind of "skill" I developed as a child as well. I was able to imagine myself as different white characters in stories, suspend my disbelief, and engage with windows as though they were doors in a temporary way. In retrospect, I'm not sure how healthy this practice is in the long term.

I agree, students need to get explanation first. If they do not know what a certain word or phrase typical for a specific language means, it will be harder for them to get the context of the whole text. For example, when I went to school, we read a book in English too. It was hard for me to understand some chapters since there were some phrases which were used in a strange context as I earlier thought. However, that time I did not know that, for instance, French windows are not actually windows. When I read that someone walked through the French window, it sounded very strange for me. I had to look for its meaning by myself. That is why it is better either to teach children the meaning of such words or to provide them with the books that contain the words and phrases they already know. There is not such a big problem if students do not know the meaning of some ordinary words, they can translate them, but if they do not know the words specific for a certain language or culture, they need to hear the explanation.

Here's why it's important to revoke access (rom Upload a VHD to Azure or copy a managed disk to another region - Azure PowerShell):

After the upload is complete, and you no longer need to write any more data to the disk, revoke the SAS. Revoking the SAS will change the state of the managed disk and allow you to attach the disk to a VM.

what he is saying in this paragraph is the feeling of loneliness was worse than not being able to visit his family. furthermore, being alone and hungry felt like seeing ghosts. I felt really sorry for him because its the equivalent of being isolated. I can imagine a lot of people including myself are feeling this way during this pandemic.

racial profiling, policing, surveillance

• Recuento de lagunas de las ideas fuerza de Shirky. Hubiera sido interesante, además de documentar el proceso en Windows, con las capturas de pantalla, colocarlo en diálogo con lo propuesto por Shirky, de modos más interpretativos y también a este autor con los elementos explorados en clase.

remote no matter the platform - work at home, in the park of docking with Soyuz

Each space is always connected, reducing the risk of social loafing and anxiety. Eliminate the need for endlessly re-connecting to video calls, countless meetings and random chat windows.

微软这些人重礼节轻解决， 中间那个人的提问就被忽略了。。。 其实应该提到HKEY_LOCAL_MACHINE\SYSTEM\CurrentControlSet\services\mpssvc的设置的

install uzip

Еще момент, на сайте https://support.microsoft.com/ru-ru/help/4534271/windows-10-update-kb4534271 говорится про номер сборки KB4534271. В статье KB453427.

this is perfect for your son

.vscode/launch.json调试配置。

How can techniques like mindful context switching, asynchronous communication, and mindful breaks help me with my work?

1. Mindful Context Switching - It happens very often that I have up to 3 or 4 tasks on my plate at a time. 1 or 2 I've defined for myself and another two that come in from requests in the company. With mindful context switching, I can try to dedicate chunks of time to each task, where I completely focus on that task, get some work done, then move onto another task for another chunk of time. This way, I'm as efficient as possible on each given task for a given window. That way I don't have the other tasks hanging over my head waiting for me to get to them. I've put the tasks in a queue of sorts, which will allow me to manage them more effectively.

2. Asynchronous Communication - Turning Slack notifications off maybe? Setting windows within which I will respond to people on Slack. I'm not sure how well this would work out though. How do I handle situations where I need to have a conversation with someone on Slack? I'll need to think about this more.

3. Breaks - This is straightforward. Set up chunks of time to work, then take short breaks in between those chunks. Refresh your mind, relax a bit, then continue working.

https://www.positronx.io/install-laravel-with-composer-on-macos-ubuntu-and-windows/

As of today, this provides version 4.3.12 for Windows. This version seems to lack EV3 bricks. See here for older versions.

IPFS Desktop

Orion IPFS client

This exposes some terrible design decisions that are worth knowing when using non-MS Office products with MAPI.

VEEBLE HOSTING Avail cheap Linux VPS Hosting Services at affordable prices. Buy affordable various services like registering domain names, SSL certificates, web hosting, windows VPS online

coupled improvements from bias reductions occur on a second, longer time scale (long past atm-land skill horizons)

PC users: make sure you're in anaconda powershell (NOT windows powershell; if the background for powershell is electric blue, you're in the wrong one).

Also: if wget is in the windows directory, but you get a 'file not found error' when you try to run it, you may have to add .exe to wget, eg,

wget.exe http://activehistory.ca/papers

(the reason you have to do that is because I haven't shown you how to add wget.exe to your PATH variable; google 'adding windows environment variable PATH' if you want to go down this route)

If you're familiar with setting PATH variables, you don't have to do this.

https://docs.microsoft.com/en-us/previous-versions/windows/it-pro/windows-2000-server/images%5ccc962011.dsce04(en-us,technet.10).gif

it works.

He is calling out school for their colonized, and a creator of war. "who passed through universities with radiant eyes" tells us that he does not see school as a good thing and questions how absurd the whole institution is.

To her, dwelling in possibility puts her in a place with numerous windows, which means she can constantly focus on opportunity, she has the ability to see all posibilities at all times. This stansa is contrasting imaginative mindsets with ultra realistic ones.

This place sounds heavenly. She yearns to reach that nirvana while writing.

Dickinson's analogy of the windows and doors signify opportunity. When Dickinson says "A fairer House than Prose," it shows her opinion that poetry has more possibilities involved than simple prose.

The story is about writers. The reference to prose (dull writing) is contradicted by a house with more windows (possibilties) and more doors (ways to get to possibilities). The rest is a description of the first stanza.

Dickinson likes all of the options and creative opportunities that her form of poetry brings her. She looks down on prose.

Dickinson mentioned a lot of windows and doors which suggest the sake of freedom. Window usually symbolize freedom and what their heart wants, doors symbolize the the path the author want to go. using window and door as metaphor, Dickinson is telling herself things she want to do but cannot do.

Possibility, is a house. Its doors are as solid as cedars: people can't see through them. Its roof is as high as the sky; The sky, literally, has no ups and downs; But if you think of the sky like a roof, that's the room in this house. Compared with "prose", it is fairer, with more Windows and superior doors. Its visitors are the fairest, because they can do all possible things and fulfill their dreams

He did not have as much as the other people in town. Did he want to be like them? Is he jealous because they all have families in those homes and he is by himself? Is this difference ok and did he choose it?

imagery

Destul de complicat procesul, dar din păcate altă variantă nu există.

Là où les piles «traditionnelles» (Wordpress, Drupal, etc.) délèguent le contenu à un tiers (une base de données, telle que MySQL), les générateurs de site statique proposent d’abstraire cette fonctionnalité à même le système de publication, sans avoir à installer un logiciel supplémentaire.

Le paradigme des fichiers en plein texte comme source de contenu m’apparaît fondamental: là où une base de données virtualise les informations, le fichier texte nativement utilisable dans n’importe quel système d’exploitation (on peut copier/coller un fichier ou un répertoire dans une interface visuelle comme l’explorateur Windows ou le Finder de MacOS, ou encore via une interface en ligne de commande).

Comme tu le soulignes, la structuration des contenus est ainsi plus facile à manipuler. Elle dépend beaucoup moins du logiciel utilisé (bien que chaque système comporte ses petites règles de formatage, comme les clés YAML/TOML/JSON).

C’est ce très bas niveau d’abstraction (que tentent paradoxalement de simuler des logiciels de haut niveau comme Wordpress ou Microsoft Word, paraboles techniques que Ted Nelson qualifie d’extrêmement pernicieuses).

access windows from ubunto terminal in WSL

gImageReader is an excellent open source alternative. It runs both on Windows and Linux, and it provides a simple (yet powerful) frontend GUI to Google's robust open source OCR engine, Tesseract.

I think an open source tool as this is a better fit to the open annotation ecosystem, based on libre software and standards, that Hypothesis promotes, instead of a proprietary (and expensive) tool such as Adobe AcrobatPro.

Mandatory HTTP request line:

• verb (GET, POST, PUT and HEAD most frequently)
• URL (web address)
• protocol version (HTTP/1.1)

Then, there's a bunch of optional request header fields.

Example HTTP request:

GET http://www.davidwhitney.co.uk/ HTTP/1.1
Host: www.davidwhitney.co.uk
Connection: keep-alive
User-Agent: Mozilla/5.0 (Windows NT 10.0; Win64; x64…
Accept: text/html,application/xhtml+xml,application/xml;q=0.9
Accept-Encoding: gzip, deflate
Accept-Language: en-GB,en-US;q=0.9,en;q=0.8

Example response:

HTTP/1.1 200 OK
Cache-Control: public,max-age=1
Content-Type: text/html; charset=utf-8
Vary: Accept-Encoding
Server: Kestrel
X-Powered-By: ASP.NET
Date: Wed, 11 Dec 2019 21:52:23 GMT
Content-Length: 8479


<!DOCTYPE html>
<html lang="en">...

首先，用户不知道有没有，然后是不知道在哪……

本教程中，所谓 Surge3名称 就是 Clash for Windows 的配置。

明显的，这就是coder的自负了：ta自己知道，你不懂是你的事。

当然，作为个人免费软件，ta也有这种自负的资本。

目前，唯一的问题就是——这篇文章里的“神机规则”，是无法跟机场订阅规则很好并存的吧……

How much is relevant for Life Itself starters? Also, Homebrew is Mac only -- what's the preferred Windows alternative? I used chocolatey.

I believe a male would be most likely to continue broadcasting during a hurricane.

Very risky. I believe men are willing to take more physical risks.

I thought this was really interesting, and again something I had never really thought of in the context of domestic abuse. Machado makes a great point here that the house is something that aids in domestic abuse because it allows for it to happen behind closed doors. She also points out that the house is used for the benefit of the abuser, they get to control the house and thus the narrative. I understood this in the sense of a perfect happy home in which everything is picture perfect so we assume that the family living in it is too, but that may not always be the case as Machado points out.

pytest-xdist provides support for parallel testing.

1. To enable it on Windows:

py -3 -m pip install pytest-xdist

1. Create a file pytest.ini in your project directory and specify in it the number of CPUs to be used (e.g. 4):

   [pytest]
   addopts=-n4
   

2. Run your tests

This is a great reminder that texts can be mirrors, windows, or sliding-glass doors for our students. [https://ncte.org/blog/2016/02/windows-mirrors-sliding-doors/]

Books provide windows. Good novels provide empathy n

I really love and admire the imagery implemented by Machado here. Not only does she describe the house as magical, but she goes as far by implementing various physical images to describe it. A "deep pocket of trees" makes me visualize vastness, as well as lush greenery--like a moist, dark forest. The fact that it's all wood and rustic also enables one to think of nature/natural aspects of the world in which we reside in. I also find the set of indoor windows described as "if the house had swallowed a second, tiny" house to be a very distinct description/image of inclusion, of something inside of something larger. It actually reminded me of Matryoshka dolls. The word "dilapidated", meaning run down, makes me envision a house that is old, dirty, tattered. The imagery of the kitchen as covered in shot glasses also gives one the image of a room left littered with half empty red solo cups, one that is dirty and left unclean. And I also love the last bit because that touches upon another sense—smell. There is so much sensory images/imagery provided in this one section and I appreciated reading this one paragraph a lot. It makes the reading more vivid.

Hm, Zoom (and most every other) video conferencing system these days manages to show 200+ participants live. MS again manages to convince buyers with barely implemented features, disredarding the users who eventually have to cope. Sigh!

We learned about this is biosci, epigenetics. I always found this concept super interesting and I am excited to see it resurfacing in my education.

I understand that extrinsic causes for diseases are based on outside factors such as exposure to infectious pathogens, trauma, or toxins and intrinsic causes generally develops within the patients own biome. Just because a disease may have an intrinsic cause does it necessarily mean it had to occur from predetermined genetics or can they be developed through these "windows of vulnerability" as mentioned earlier?

Most "windows" I would guess would be during embryogenesis and early development; I hope they discuss these windows more.

This is a very basic way to look at the entire concept of illness, I like it.

AFAIK Kitematic is totally deprecated. I would recommend Portainer or (on Mac or Windows) the Docker dashboard.

There are performance considerations here as well - bind mounts save space, and are equal performance on Linux. You can unfortunately get very bad performance on Docker for Win / Mac, and you might want to use a volume mount containing your data or similar. WSL2 on Windows also promises improved performance.

this is also not so fair...you can definitely set up individual project todo files, and have side-by-side windows of agenda and project file

Configuration that works in Thunderbird in English in Ubuntu:

• Incoming:
  • Authentication: Normal password
  • Username: bartefil
• Outgoing:
  • Authentication: Normal password
  • Username: bartefil

True that

If you wish to use Java inside VSCode, try downloading the Installer of Visual Studio Code for Java developers

I believe that this verse could suggest two different meanings. Pfufrock is in a life or death situation and is experiencing suicidal thoughts. Overall, he is unsure of what he needs; there is an overwhelming sense of confusion. The other meaning could suggest that he is looking for women, love or sexual relations, since the men are lonely. He therefore is torn between not only life and death, but finding love or not. These themes do also go hand in hand, as love also provides life. Therefore the window is a symbol of his confusion and the options he has.. he is peering to look out at the possibility of finding love or death. Maybe that's the same thing to him? Love could also mean death in this case.

this is a really pretty description i want to go here

A very captivating flashback.

I THOUGHT BROKEN WINDOW POLICING WAS NEGATIVE...WHY SUPPORT IT?

The earth is in the midst of its sixth recorded mass extinction, creating a bottleneck on a global scale. Some of the classes being hit the hardest by anthropogenic activities and global climate change are amphibians and reptiles. Both groups being very heavily affected by habitat loss due to fragmentation. As spring comes, amphibians thaw from wintering-over and travel to breeding hotspots. This great migration occurs on the few first warm rainy nights of spring. Due to rampant sprawl, and thus fragmentation, road mortality spikes for these organisms during these travel windows. Road mortality is actually one of the leading causes of death for these groups.

Relating to my previous annotation, this passage also explores the dry/wet motif, but this time focusing more on the wet. It also ties in a different aspect of zombies, as well as fragments and exile. The opening line discusses a “decayed hole among the mountains”, which reminds me of my previous passage discussing the “withered stumps of time.” A few lines down, “dry bones” can also be a great example of zombies, discussing bones that have been decaying and drying up in ties with the idea of passing time and mortality. Discussing fragments can also relate to these fragments of bones, and even the fragments of this decaying environment that is trying to hold onto its last pieces. The empty chapel seems lonely and exiled from the world, with fragments of architecture barely holding on, and fragments of life scattered and hard to recognize. The single cock that remains seems to be the only source of life left in this environment, and even the cock is exiled as it crows into the storm. The end lines bring back the dry/wet motif, with the heat and dry of lightning, then followed by the wet of the rain. “...a damp gust” can also represent both wet and dry at the same time, since a gust of wind is normally thought of as dry air being blown around, but this time the gust brings rain, thus turning this into a wet and dry type of weather at once.

In this passage I see un/natural time in regards to the decayed hole and the cock on the rooftree. Where there is no organic matter like fauna and flora to decompose, such as the case of the "decayed hole amongst the mountains" the only actual decay is that of the things man has built: the church, the graves, the door swinging on its hinges. To me this brings about images of the desolation this church will face as time continues to wear it down. Once all of man's manipulations of the earth are swept away on the wind the notion of decay will blow away with them. The process of decay is only happening while there is something there to be decaying. Un/natural time is also represented by the rooster's crow. Roosters crow on their own (we had one when I was a kid and it was very annoying), so their relationship to man's conception of time is irrelevant. It seems silly to include the motif of voices in regards to the rooster's call, the rooster is given a single line of dialogue. Maybe this is Eliot showing that all voices deserve a platform.

Couldn't find where the exhaustive list of API versions are listed, but found this on the Azure Instance Metadata Service (aka IMDS) page:

2017-04-02, 2017-08-01, 2017-12-01, 2018-02-01, 2018-04-02, 2018-10-01, 2019-02-01, 2019-03-11, 2019-04-30, 2019-06-01, 2019-06-04, 2019-08-01, 2019-08-15

Also:

The version 2019-11-01 is currently getting deployed and may not be available in all regions.

Where does Shakespeare begin some sort of conflict in this section? Shakespeare show conflict through this section by showing the friction betweeen Marullus

Shows the imposing strength of the castle of Dracula and in turn that of Dracula.

It's like throwing away your own money, and the handouts people give you!

Normally, the cell punches holes specific to glucose in the plasma membrane, but without insulin, it's like trying to feed a tsunami of glucose through the a couple small windows of glut receptors.

He had dangerous lead levels in his blood due to lead being exposed all over the home. How this happened? he ate the lead and was breathing toxic air.

An anxiety and shame that follows the act of sex. Young women are filled with anxiety surrounding their body image and performance. Where as Ms. Lora, being a mature woman, knows she doesn't fit into the conventional definition of beauty because of her strength and muscle tone. Yet isn't hindered by what comes natural in sex.

i can visualize this, when i lived in md and it got really cold in the winters, our windows would freeze over and you couldn't get a clear look outside because there was so much frost

working with Dr. Graham: windows people, install anaconda. Then open Anaconda Navigator. Click on the box that says 'cmd.exe'. Then you can enter code as per the rest of this section.

<html xmlns:v="urn:schemas-microsoft-com:vml" xmlns:o="urn:schemas-microsoft-com:office:office" xmlns:w="urn:schemas-microsoft-com:office:word" xmlns:m="http://schemas.microsoft.com/office/2004/12/omml" xmlns="http://www.w3.org/TR/REC-html40">

<span class=SpellE><span style='font-size:14.0pt;mso-bidi-font-size:11.0pt;line-height:108%'>SciScore</span></span><span style='font-size:14.0pt;mso-bidi-font-size:11.0pt;line-height:108%'>: 6 </span><span style='color:blue'>What's this?</span>

Document Identifier: 3879

Below you will find two tables showing the results of <span class=SpellE>SciScore</span>. Your score is calculated based on adherence to guidelines for scientific rigor (Table 1) and identification of key biological resources (Table 2). Points are given when <span class=SpellE>SciScore</span> detects appropriate information in the text. Details on each criteria and recommendations on how to improve the score are appended to the bottom of this report.

Table 1: Rigor Adherence Table

<u style='text-underline:black'>Institutional Review Board Statement</u>

<span style='font-size:11.0pt;line-height:107%'>IRB: Ethics approval was obtained from the Ethics Committee of Guangzhou Women and Children’s Medical Center and written informed consents were obtained from the parents of the included children.</span>

<span style='font-size:11.0pt;line-height:107%'>Consent: Ethics approval was obtained from the Ethics Committee of Guangzhou Women and Children’s Medical Center and written informed consents were obtained from the parents of the included children.</span>

<u style='text-underline:black'>Randomization</u>

<span style='font-size:11.0pt;line-height:107%'>not detected.</span>

<u style='text-underline:black'>Blinding</u>

<span style='font-size:11.0pt;line-height:107%'>not detected.</span>

<u style='text-underline:black'>Power Analysis</u>

<span style='font-size:11.0pt;line-height:107%'>not detected.</span>

<u style='text-underline:black'>Sex as a biological variable</u>

<span style='font-size:11.0pt;line-height:107%'>not detected.</span>

Table 2: Key Resources Table

Your Sentences

REAGENT or

RESOURCE

SOURCE

IDENTIFIER

<o:p> </o:p>

<u style='text-underline:black'>Software and Algorithms</u>

<o:p> </o:p>

<span style='font-size:11.0pt;line-height:107%'>Microsoft Excel <span class=GramE>( MS</span> Excel 2013 ,</span>

<span class=GramE><span style='font-size:11.0pt;line-height: 107%'>v.15.0 )</span></span><span style='font-size:11.0pt;line-height:107%'> was used for data collection of the epidemiological and clinical information .</span>

<span style='font-size:11.0pt;line-height:107%'>Microsoft Excel</span>

<o:p> </o:p>

<span style='font-size:11.0pt;line-height:107%;color:gray'>Suggestion: (Microsoft Excel,</span>

<span style='font-size:11.0pt;line-height:107%;color:gray'>RRID:SCR_016137)</span><span style='font-size:11.0pt;line-height:107%;color:black;text-decoration:none; text-underline:none'>(</span><span style='font-size:11.0pt;line-height:107%;color:blue'> link</span><span style='font-size:11.0pt;line-height:107%'>)</span>

<o:p> </o:p>

Other Entities Detected

Your Sentences

Recognized Entity

Oligonucleotides

<span style='font-size:11.0pt;line-height:107%'>Forward primer</span>

<span style='font-size:11.0pt;line-height:107%'>CCCTGTGGGTTTTACACTTAA; Reverse primer ACGATTGTGCATCAGCTGA;</span>

<span style='font-size:11.0pt;line-height:107%'>CCCTGTGGGTTTTACACTTAA</span>

<span style='font-size:11.0pt;line-height:107%'>The probe 5#-VIC-</span>

<span style='font-size:11.0pt;line-height:107%'>CCGTCTGCGGTATGTGG</span>

<span style='font-size:11.0pt;line-height:107%'>AAAGGTTATGG-BHQ1-3# Target 2 <span class=GramE>( N</span>):</span>

<span style='font-size:11.0pt;line-height:107%'>5#-VIC-CCGTCTGCGGTATGTGG AAAGGTTATGG-</span>

<span style='font-size:11.0pt;line-height:107%'>BHQ1-3#</span>

<span style='font-size:11.0pt;line-height:107%'>Forward primer</span>

<span class=GramE><span style='font-size:11.0pt;line-height: 107%'>GGGGAACTTCTCCTGCTAGAAT;</span></span>

<span style='font-size:11.0pt;line-height:107%'>Reverse primer</span>

<span style='font-size:11.0pt;line-height:107%'>CAGACATTTTGCTCTCAAGCTG;</span>

<span style='font-size:11.0pt;line-height:107%'>GGGGAACTTCTCCTGCTAGAAT</span>

<span style='font-size:11.0pt;line-height:107%'>The probe 5#-FAM-</span>

<span style='font-size:11.0pt;line-height:107%'>TTGCTGCTGCTTGACAGATT-TAM</span>

<span style='font-size:11.0pt;line-height:107%'>RA-3<span class=GramE># .</span></span>

<span style='font-size:11.0pt;line-height:107%'>5#-FAM- TTGCTGCTGCTTGACAGATT-TAM RA-3#</span>

<span class=SpellE>SciScore</span> is an <u style='text-underline:black'>automated tool</u> that is designed to assist expert reviewers by finding and presenting formulaic information scattered throughout a paper in a standard, easy to digest format. <span class=SpellE>SciScore</span> is not a substitute for expert review. <span class=SpellE>SciScore</span> checks for the presence and correctness of RRIDs (research resource identifiers) in the <span class=GramE>manuscript, and</span> detects sentences that appear to be missing RRIDs. <span class=SpellE>SciScore</span> also checks to make sure that rigor criteria are addressed by authors. It does this by detecting sentences that discuss criteria such as blinding or power analysis. <span class=SpellE>SciScore</span> does not guarantee that the rigor criteria that it detects are appropriate for the <span class=GramE>particular study</span>. Instead it assists authors, editors, and reviewers by drawing attention to sections of the manuscript that contain or should contain various rigor criteria and key resources.

<u style='text-underline: black'>Rigor Table:</u>

In the rigor table (table 1 of this report), <span class=SpellE>SciScore</span> highlights sentences that include various elements of rigor as described by <span class=SpellE>Hackam</span> and <span class=SpellE>Redelmeier</span> in <span style='color:blue'>2006</span>, and by van der Warp and colleagues in <span style='color:blue'>2010</span>. <span class=SpellE>SciScore</span> was trained using sentences from thousands of published papers that were tagged by expert curators to indicate that the sentence described blinding (either during the experiment or during data analysis), group selection criteria such as how subjects were randomized, power analysis (statistical test), or sex as a biological variable. If a cell line is detected then <span class=SpellE>SciScore</span> ‘expects’ that cell line authentication criteria are described, a cell line is not detected this section of the table will not be visible or scored. When a criterion is expected, but a sentence that addresses the criterion is not detected by <span class=SpellE>SciScore</span>, the statement “Not Detected” is given. It is possible that a criterion is not necessary for a <span class=GramE>particular manuscript</span> or that <span class=SpellE>SciScore</span>, an automated tool, makes a mistake. If <span class=SpellE>SciScore</span> makes substantial mistakes with your manuscript, please <span style='color: blue'>contact us </span><span style='mso-spacerun:yes'> </span>to help us learn from our mistakes. Please see the <span style='color:blue'>FAQ </span><span style='mso-spacerun:yes'> </span>for more details.

<u style='text-underline: black'>Scoring for Rigor Table (total 5 points):</u>

The rigor table makes up 5 points of the total score. Those five points are split evenly among the expected rigor criteria, each criterion being worth five divided by the number of rows in the table points. Scores are rounded to the nearest whole number. For each sentence that describes an expected rigor criterion, such as blinding, <span class=SpellE>SciScore</span> adds the fractional number of points for that criterion, and if it is unable to find a statement on blinding then this section is labeled "Not Detected" and receives a score of 0. To improve detection, please make sure that your language is clear and written in standard English.

<u style='text-underline: black'>Key Resources Table</u>

The key resources table (table 2 of this report), contains two types of things that are detected automatically by <span class=SpellE>SciScore</span>:

<span style='mso-bidi-font-size:12.0pt;line-height:105%'><span style='mso-list:Ignore'>1.<span style='font:7.0pt "Times New Roman"'>  </span></span></span>RRIDs, research resource identifiers

<span style='mso-bidi-font-size:12.0pt;line-height:105%'><span style='mso-list:Ignore'>2.<span style='font:7.0pt "Times New Roman"'>  </span></span></span>Sentences that “should” have RRIDs

RRIDs, are unique identifiers for reagents and other resources that largely overlap those resources that have been labeled as particularly problematic by the National Institutes of Health in recent changes to grant review criteria, please see <span style='color:blue'>"key biological resources"</span>, e.g., antibodies, cell lines and transgenic organisms. The RRID initiative is led by community repositories that provide persistent unique identifiers to their resources, such as transgenic mice, salamanders, antibodies, cell lines, plasmids and software projects such as statistical software. RRIDs are described in a primer by Bandrowski and Martone in<span style='color:blue'>2016</span>.

RRIDs are unique numbers that resolve to a particular database record, for example the <span class=GramE>RRID:CVCL</span>_0063 resolves to this record for a cell line:

<span style='color:blue'>https://web.expasy.org/cellosaurus/CVCL_0063</span>

The information in that database is structured and curated by <span class=SpellE>Cellosaurus</span> staff, the authority for cell lines. If authors use this RRID then <span class=SpellE>SciScore</span> will ask the database about the number. Once an RRID is found in the database, <span class=SpellE>SciScore</span> attempts to match text in the sentence with the database record, most often it attempts to find the name of the resource, in this case HEK293T, and information about the company or catalog number to verify that authors have put the right RRID in the sentence. If a typo is made by authors, that renders the RRID not valid, the RRID column will be blank (table 3 will contain the RRID in the unresolved RRID column in red). If an RRID was submitted to the authority by authors, it often takes a week or more to become available in the resolver database, thus exercise caution in the interpretation of the <span class=SpellE>SciScore</span> report in cases of newly minted RRIDs.

Sentences that should have RRIDs are detected by <span class=SpellE>SciScore</span>, by looking for patterns in a sentence that are <span class=GramE>similar to</span> how cell lines or antibodies are described in published papers. A sentence that describes one or more antibodies may be detected by <span class=SpellE>SciScore</span> and this will be placed into the table without a corresponding RRID. <span class=SpellE>SciScore</span> will attempt to find the name(s) and catalog numbers of the resource. In cases where the tool is relatively confident, it will suggest an RRID. The suggested RRID appears in gray with a link to the RRID website where authors must confirm that the RRID found by <span class=SpellE>SciScore</span> is the correct RRID.

<u style='text-underline: black'>Note of caution:</u>

Please verify all RRID suggestions, only the author can know whether suggestions are correct.

<u style='text-underline: black'>Scoring for Resources Table (total 5 points):</u>

Each resource that is detected is scored, and the total is 5 points, with scores rounded to the nearest whole number. For each RRID detected, points are awarded, but for each sentence that is detected that does not contain an RRID, points are not awarded. If <span class=SpellE>SciScore</span> detects catalog numbers or relatively unambiguous resources, partial points are awarded. For each RRID that does not resolve properly only partial points are also awarded. Therefore, the way to maximize the points from this section is to add RRIDs, and proper citations that include vendor names, catalog numbers, lot and version numbers into the methods section of the manuscript.

<u style='text-underline: black'>Incorrect sentences:</u>

<span class=SpellE>SciScore</span> is a text analysis tool, and it is therefore susceptible to making two types of errors, false positives or false negatives.

False <span class=SpellE><span class=GramE>negatives:<span style='font-weight:normal'>The</span></span></span> most common error occurs when the algorithm fails to detect a sentence that contains an antibody or another resource. False negatives generally occur either because the sentence is complex or in a less common syntax pattern. Generally simple sentences in clear standard English are simpler to process and result in few false negatives. If a truly complex sentence structure is required to describe reagents, a table may help not only <span class=SpellE>SciScore</span>, but also human readers. If an RRID is detected in a sentence, <span class=SpellE>SciScore</span> will be triggered to <span class=GramE>take a look</span> at the sentence, which may have been skipped otherwise.

False positives: This type of error includes cases where a sentence does not contain an antibody, but the algorithm asserts that this sentence does have an antibody. If many resources are used and all have RRIDs, a single false positive will not reduce the score substantially. But if only 1-2 resources are used, then a false positive can reduce your <span class=SpellE>SciScore</span> needlessly. False positives are most often seen in the tools portion of table 2, as the algorithm detects company names, where it should not. We try to minimize these false positives using several strategies. If this impacts your score, please contact our team (http:// sciscore.com) and include the sentence where <span class=SpellE>SciScore</span> made the error. While we can't fix the score, we can learn from our mistakes.

</html>

Create juxtaposition of cold and heat to symbolize the mixing of two worlds through the imagery of weather and climate.

MIME stands for Multi-purpose Internet Mail Extensions. MIME types form a standard way of classifying file types on the Internet. Internet programs such as Web servers and browsers all have a list of MIME types, so that they can transfer files of the same type in the same way, no matter what operating system they are working in.

A MIME type has two parts: a type and a subtype. They are separated by a slash (/). For example, the MIME type for Microsoft Word files is application and the subtype is msword. Together, the complete MIME type is application/msword.

Although there is a complete list of MIME types, it does not list the extensions associated with the files, nor a description of the file type. This means that if you want to find the MIME type for a certain kind of file, it can be difficult. Sometimes you have to look through the list and make a guess as to the MIME type of the file you are concerned with.

A MIME type is a label used to identify a type of data. It is used so software can know how to handle the data. It serves the same purpose on the Internet that file extensions do on Microsoft Windows.

So if a server says "This is text/html" the client can go "Ah, this is an HTML document, I can render that internally", while if the server says "This is application/pdf" the client can go "Ah, I need to launch the FoxIt PDF Reader plugin that the user has installed and that has registered itself as the application/pdf handler."

You'll most commonly find them in the headers of HTTP messages (to describe the content that an HTTP server is responding with or the formatting of the data that is being POSTed in a request) and in email headers (to describe the message format and attachments).

Bir örnek sadece

considerations for decision about product or service